The invention relates to retinoic acid and immune regulation. Background

It is now well accepted that the host microbiota condition and prime immunological function with a previously unexpected level of interdependence between bacteria and the immune system ^1"3 . However, the mucosal immune system must correctly discriminate between harmful microbes and commensal microbes in order to ensure protective immunity and tolerance respectively. A characteristic feature of mucosal tolerance is the induction and expansion of Foxp3+ T regulatory cells which limit excessive pro-inflammatory responses ^4"5 . Specific microbes present within the gastrointestinal tract which selectively promote Foxp3+ polarization within the mucosa of mice have been identified ^6"10 . Recent studies in patients suffering from inflammatory diseases (ulcerative colitis and allergy) suggest that feeding with specific therapeutic microbes can increase the proportion of CD25 ^hlgh T cells' ¹ ' ¹² . However, the in vivo mechanisms underpinning this response (microbiota-associated influence on T regulatory cells) are not well understood and it is not clear if results obtained in the murine system are also applicable to humans. Within the gastrointestinal mucosa, a number of cell types including epithelial cells, intraepithelial lymphocytes, lamina propria macrophages and dendritic cells are required to maintain intestinal homeostasis and tolerance ¹³ . In particular, both myeloid dendritic cells (mDCs) and plasmacytoid dendritic cells (pDCs) are in close contact with microbes and are responsible for presenting microbial and dietary antigens to the adaptive immune system thereby influencing polarization of the adaptive response via cytokine and metabolite production ^{14"1 8} . Thus, the decision to induce Foxp3+ T cells is significantly influenced by activation of dendritic cell pattern recognition receptors (PRRs) which program dendritic cell gene expression and subsequent T cell polarization ¹⁹ . Co-ordination between PRR signaling pathways is important for the induction of the appropriate dendritic cell and T cell response. For example, TLR-2 recognition of zymosan results in the secretion of retinoic acid and IL-10 leading to Foxp3+ induction while dectin-1 activation by zymosan leads to IL-23 secretion and Thl 7 induction ²⁰ . In addition, TLR-2 activation was demonstrated to inhibit TLR-3 associated inflammatory responses within the skin in a TRAF-1 -dependent mechanism ²¹ . Furthermore, DC subsets may utilize different molecular mechanisms to cooperate in the induction of T regulatory cells ²² ' ²³ . Statements of Invention

The invention provides a formulation comprising Bifidobacteria infantis 35624 in an amount to induce the expression of retinaldehyde dehydrogenase (RALDH) and a substrate that provides a source of retinal which is metabolised to all-trans retinoic acid by RALDH.

In one embodiment, the substrate may be retinal. In a different embodiment, the substrate may be retinol. Alternatively, the substrate may be retinyl acetate, retinyl palmitate, retinol acetate or retinol palmitate.

The formulation may comprise from about l xl O ⁴ to about lxl O ¹² colony forming units (cfu) Bifidobacteria infantis 35624 per gram of formulation. The formulation may comprise at least l lO ⁹ colony forming units (cfu) Bifidobacteria infantis 35624 per gram of formulation.

Bifidobacteria infantis 35624 may be in the form of viable cells in the formulation. Alternatively, Bifidobacteria infantis 35624 may be in the form of non-viable cells.

Bifidobacteria infantis 35624 may induce the expression of RALDH2.

The formulation may comprise one or more additional components selected from: lipids, fats, fatty acids, proteins, carbohydrate sources, vitamins, minerals, emulsifiers, stabilisers and prebiotics. The formulation may be in a form suitable for enteral administration.

The formulation described herein may be used to maintain a normal structure and function of the skin and mucous membranes. The formulation described herein may be used in the prophylaxis and/or treatment of a mucosal inflammatory condition. The mucosal inflammatory condition may be associated with gastrointestinal health such as diarrhoea, inflammatory bowel disease or irritable bowel syndrome; respiratory inflammatory disorders such as asthma and broncho-pulmonary dysplasia; disorders of the eyes such as uveitis; disorders of the nose such as rhinitis or allergy; or cancer associated with mucosal surfaces such as lung or the gastrointestinal tract.

The formulation described herein may be used in the prophylaxis and/or treatment of one or more inflammatory disorder selected from the group comprising: asthma, gastrointestinal inflammatory activity such as inflammatory bowel disease eg. Crohns disease or ulcerative colitis, irritable bowel syndrome, pouchitis, or post infection colitis, gastrointestinal cancer(s), systemic disease such as rheumatoid arthritis, autoimmune disorders, cancer due to undesirable inflammatory activity, diarrhoeal disease due to undesirable inflammatory activity, such as Clostridium difficile associated diarrhoea, Rotavirus associated diarrhoea or post infective diarrhoea, diarrhoeal disease due to an infectious agent, such as E.coli.

The formulation described herein may be used in the prophylaxis and/or treatment of vitamin A deficiency.

The invention also provides a method of maintaining normal structure and function of the skin and mucous membranes comprising the step of administering an effective amount of formulation described herein to a subject. The invention also provides a method of prophylaxis and/or treatment of a mucosal inflammatory condition comprising the step of administering an effective amount of formulation described herein to a subject. The mucosal inflammatory condition may be associated with gastrointestinal health such as diarrhoea, inflammatory bowel disease or irritable bowel syndrome; respiratory inflammatory disorders such as asthma and broncho-pulmonary dysplasia; disorders of the eyes such as uveitis; disorders of the nose such as rhinitis or allergy; or cancer associated with mucosal surfaces such as lung or the gastrointestinal tract.

The invention also provides a method of prophylaxis and/or treatment of one or more inflammatory disorder selected from the group comprising: asthma, gastrointestinal inflammatory activity such as inflammatory bowel disease eg. Crohns disease or ulcerative colitis, irritable bowel syndrome, pouchitis, or post infection colitis, gastrointestinal cancer(s), systemic disease such as rheumatoid arthritis, autoimmune disorders, cancer due to undesirable inflammatory activity, diarrhoeal disease due to undesirable inflammatory activity, such as Clostridium difficile associated diarrhoea, Rotavirus associated diarrhoea or post infective diarrhoea, diarrhoeal disease due to an infectious agent, such as E.coli comprising the step of administering an effective amount of formulation described herein to a subject.

The invention also provides a method of prophylaxis and/or treatment of vitamin A deficiency comprising the step of administering an effective amount of formulation described herein to a subject.

We have made the surprising discovery that B. infantis 35624 induces the immune-regulatory enzyme RALDH2 in dendritic cells and the product of this enzyme, retinoic acid, was essential for the induction of regulatory T cells. Thus, a formulation which combines the substrate, i.e vitamin A or its derivatives, with a bacterial strain that induces expression of the enzyme responsible for substrate conversion will ensure the optimal conversion of the substrate to its immunologically active product. This formulation will provide a profound therapeutic benefit in patients suffering from inflammatory disorders.

In addition, vitamin A deficiency is estimated to affect approximately one third of children under the age of five around the world. It is estimated to claim the lives of 670,000 children under five annually. Deficiency of vitamin A severely affects vision and also reduces immunological defense and tolerance mechanisms.

According to the invention there is provided a formulation comprising:-

Vitamin A, a source of Vitamin A, a derivative of Vitamin A, and/or a source of a derivative of Vitamin A; and

& Bifidobacterium strain capable of inducing RALDH and retinoic acid production.

In one embodiment the Bifidobacterium comprises Bifidobacterium infantis 35624 In one case the formulation comprises Bifidobacterium infantis 35624 with vitamin A. The formulation induces optimal retinoic acid production in vivo, thereby promoting immune regulatory functions and inhibiting inflammatory diseases.

The strain may be in the form of a biologically pure culture. In one embodiment of the invention Bifidobacterium strains are in the form of viable cells. Alternatively Bifidobacterium strains are in the form of non-viable cells.

The formulation may be in the form of a food or a supplement.

In one embodiment of the invention the formulation includes another probiotic material.

In one embodiment of the invention the formulation includes a prebiotic material. Preferably the formulation includes an ingestable carrier. The ingestable carrier may be a pharmaceutically acceptable carrier such as a capsule, tablet or powder. Preferably the ingestable carrier is a food product such as acidified milk, yoghurt, frozen yoghurt, milk powder, milk concentrate, cheese spreads, dressings or beverages. In one embodiment of the invention the formulation of the invention further comprises a protein and/or peptide, in particular proteins and/or peptides that are rich in glutamine/glutamate, a lipid, a carbohydrate, a vitamin, mineral and/or trace element.

In one embodiment of the invention the Bifidobacterium strain is present in the formulation at more than 10 ⁶ cfu per gram of delivery system. The formulation may include any one or more of an adjuvant, a bacterial component, a drug entity or a biological compound.

In another aspect the invention provides a screening method for identifying immunoregulatory Bifidobacteria comprising the co-incubation of a test bacterium with mammalian cells and assaying retinoic acid production.

Brief Description of the Drawings

The invention will be more clearly understood from the following description of an embodiment thereof, given by way of example only, with reference to the accompanying drawings, in which:

Fig 1. illustrates that human dendritic cells bind and internalise B. infantis 35624. Myeloid and plasmacytoid dendritic cells (mDCs, pDCs) efficiently bind B. infantis as visualized by muitispectral flow cytometry imaging (A). (B) is a conventional microscope image showing that myeloid dendritic cells bind and internalize B. infantis. B. infantis is carboxy fluorescein diacetate succinimidyl ester (CFSE) labeled (white arrow) while CD1 lc+ cells are Pc5 labelled (striped arrow) for the multispectral and flow cytometry analysis. (C) is a flow cytometry plot confirming the binding of B. infantis to MDDCs (shift to the right). Approximately 25% to 35% of monocyte derived dendritic cells (MDDCs), mDCs or pDCs bind B. infantis after 2 hours incubation at 37°C regardless of the DC subset. (D) is a fluorescent image showing that internalization of B. infantis into lysosomes was identified using isotracker staining (arrows) after 16 hours co-incubation, internalized B. infantis cells were co-localised within MDDC activated lysozymes. Approximately 30% of the MDDC population internalize B. infantis. (E) are plots showing that CD80 and CD86 are significantly upregulated on MDDCs when exposed to LPS (positive control) while B. infantis stimulates co-stimulatory molecule expression in a dose-dependent manner (representative data of 5 independent experiments);

Fig. 2. (A) is a graph showing gene expression of the enzymes required for retinoic acid metabolism, RALDH1 , 2 & 3, quantified every 4 hours, until 24 hours, following B. infantis stimulation. RALDH2 rapidly increased in expression, peaking at 12 hours following stimulation. Retinoic acid production by dendritic cells is an important feature of mucosal immune health. (B) are plots showing how the functional activity of RALDH was confirmed by conversion of a non-fluorescent substrate into a fluorescent product in MDDCs and mDCs exposed to B. infantis for 24 hours. The RALDH inhibitor DEAB blocked the conversion of the substrate. (All experiments were repeated independently at least 4 times);

Fig. 3. are plots showing that direct contact between MDDCs and B. infantis is associated with retinoic acid production. B. infantis was labeled with PKH26, incubated with MDDCs for 24 hours at which time retinoic acid induction was assessed. RALDH induction is enriched in the MDDC population which have bound high numbers of B. infantis. (This data is representative of 3 independent experiments);

Fig. 4. (A) are flow cytometry plots showing that B. infantis stimulated MDDCs or mDCs induce CD25+Foxp3+ T cells which was associated with increased secretion of IL-10, but not IL-12p70. (B) is a graph showing mean +/- SE (n=4). The selective induction of regulatory cells by B. infantis 35624 was confirmed by staining for the Thl transcription factor T-bet. (C) is a graph showing that T-bet was induced in response to other Bifidobacteria but not B. infantis 35624. (D) are plots showing that inhibition of retinoic acid production or retinoic acid signaling blocked the induction of Foxp3+ cells by B. infantis stimulated MDDCs. (E) are flow cytometry plots showing that supplementation of the MDDC-T cell co-cultures with retinal resulted in enhanced conversion of Foxp3+ T cells. (The flow cytometry plots are representative data from at least 3 independent experiments); Fig. 5. (A) is a graph showing that in vitro stimulated PBMCs displayed increased secretion of IL-10 following B. infantis consumption (n=10) for 8 weeks which was not observed in the placebo group (n=12). Results are expressed as the change from baseline (Week 8 minus Week 0) for each individual. (B) is a graph showing the increased secretion of IL-10 following B. infantis consumption in a second study (n=17). (C) are graphs showing that while in vitro anti- CD3/CD28 stimulated PBMCs from B.infantis-fed volunteers displayed increased secretion of IL-10, there was no change in IL-2 (p=0.89), IL- 12p70 (p=0.13), TNF- (p=0.41 ) or IFN-γ (p=0.56) secretion. (D) are plots showing that Foxp3 expression was significantly increased in CD25 ^high and CD25 ^intermediate CD4 T cells following B. infantis treatment. (*p<0.05 versus placebo group; *i p<0.01 versus pre-treatment (Week 0));

Fig. 6. are graphs showing that following consumption of B. infantis for 8 weeks, Foxp3+ T cells from the peripheral blood displayed significantly increased expression of 1COS with a trend towards increased expression of CTLA-4 (p=0.06). (*p<0.05 versus pre-treatment (Week 0)); Fig. 7. (A) is a graph showing that IL- 10 secretion by MDDCs in response to B. infantis increased in a dose-dependent manner, while IL- I 2p70 levels remained low (mean +/- SE, n=5 donors). (B) and (C) are graphs showing that directly isolated mDCs (B; n=3 donors) and pDCs (C; n=3 donors) secreted IL-10, but not IL- 12p70 in response to B. infantis. (D) is a graph showing the quantification of ALDH1A2 gene expression (encoding the RALDH2 enzyme) every 6 hours, until 18 hours, following B. infantis stimulation of MDDCs, mDCs and pDCs. (E) are plots showing the functional activity of RALDH as determined by detection of BODIPY- aminoacetate (BAA) positive MDDCs and mDCs, but not pDCs, exposed to B. infantis for 24 hours. The RALDH inhibitor DEAB blocked the conversion of the substrate. (F) is a graph showing that gene expression of the metabolic enzyme IDO was observed in MDDCs, mDCs and pDC. (For D-F, all experiments were repeated independently for at least 4 donors);

Fig. 8. are graphs showing the quantification of IL-10 and IL-12 secretion in MDDC co-cultures with Bifidobacterium (B.J infantis, B. globosum, B. animalis, Streptococcus (S.) pyogenes, Staphylococcus (S.) aureus or Pseudomonas (P.) aeruginosa. All bacterial strains induced the secretion of IL-10 in a dose-dependent manner. Only B. infantis did not induce the secretion of IL-12p70 at the bacterial doses tested. (Results are shown as the mean +/- SE, n=4 donors);

Fig. 9. (A) are plots showing B. infantis labeled with P H26, incubated with MDDCs for 24 hours at which time retinoic acid metabolism was assessed by detection of BODIPY- aminoacetate (BAA) positive MDDCs. PKH26 positive MDDCs, which have bound B. infantis and are labeled as B. infantis +ve, while PKH26 negative MDDCs, which have not bound B. infantis are labeled B. infantis -ve. (B) is a plot showing that following gating of the B. infantis +ve and B. infantis -ve cells, RALDH enzyme activity is increased in the MDDCs, which have bound B. infantis. Unstimulated cells were not incubated with B. infantis. (C) is a graph showing the induction of RALDH activity by B. infantis is dose dependent, with an optimal bacterial :MDDC cell ratio of 10: 1. (Results from two independent donors are illustrated);

Fig. 10. (A) and (B) are graphs showing the quantification of ALDH 1 A2 (A) and IDO (B) gene expression in B. infantis, B. animalis, B. globosum (5x10 ⁵ or 5x10 ⁶ cells) or LPS incubated with MDDCs (5xl 0 ⁵ cells) for 16 hours. Only B. infantis induced ALDH1 A2 gene expression, while all three Bifidobacterial strains and LPS induced IDO expression. (Results are shown as the mean +/- SE, n=3 donors); Fig. 1 1. 5. infantis stimulated MDDCs were pre-incubated with blocking antibodies to TLR-2 (n=9) or DC-SIGN (n=8) and cytokine secretion was quantified following 24 hours stimulation. Blocking of TLR-2 significantly reduced IL-10 secretion, which was accompanied by a significant increase in IL-12p70 and TNF-a secretion. (A) are graphs showing that blocking of DC-SIGN had no impact on IL-10 or IL-12p70 secretion but did result in increased TNF-a secretion. 5. infantis stimulated mDCs were pre-incubated with blocking antibodies to TLR-2 (n=3) or DC-SIGN (n=3) and cytokine secretion was quantified following 24 hours stimulation. (B) are graphs showing that blocking of TLR-2 or DC-SIGN significantly reduced IL-10 secretion, which was accompanied by a significant increase in TNF-a secretion. (C) is a graph showing that IL-10 secretion by pDCs in response to 5. infantis was unchanged between isotype control antibody (IC) and anti-TLR-2 blocking antibody treated cells (n=4). (D) is a graph showing that pre-incubation of pDC with blocking TLR-9-specific ODNs significantly reduced pDC secretion of IL-10 in response to 5. infantis stimulation. IL-10, IDO and IFN-a gene expression were quantified in pDCs following stimulation with CpG or 5. infantis for 0, 6, 12 or 18 hours (E). (*p<0.01 versus isotype control antibody or control ODN treated DCs); Fig. 12. are graphs showing that HEK-293 cells, which do not express TLR-2 (TLR-2Neg), remained unstimulated by B. infantis. HEK-293 cells, which expressed TLR-2 (TLR-2Pos), were able to respond to B. infantis as demonstrated by NF-κΒ activation and IL-8 secretion. Anti- TLR-2 blocking antibody significantly reduced both NF-κΒ activation and IL-8 secretion (results are shown as the mean of 3 independent experiments). Cells were stimulated with Pam3CSK4 as the positive control TLR-2 ligand. (* p<0.01 versus TLR-2 negative cells; * 1 p<0.01 versus TLR-2Pos cells); Fig. 13. are graphs showing that TLR-2 and TLR-6, but not TLR-1 , are required for optimal NF- KB and IL10 induction. HEK-293 cells and MDDCs were stimulated with B. infantis plus isotype control antibody (IC), anti-TLR-1 , anti-TLR-2, anti-TLR-6 antibodies or combinations thereof (Results are expressed as the mean +/- SE, n=4 independent experiments); Fig. 14. (A) are plots showing that blocking of either TLR-2 or DC-SIGN significantly attenuated RALDH induction by B. infantis-stimulated MDDCs. (B) is a graph showing that the mean inhibition of RALDH activity by anti-TLR-2 or anti-DC-SIGN antibodies was equivalent for both MDDCs and mDCs (n=4 donors). Isotype control antibodies (IC) were included in all experiments. (C) is a graph showing that stimulation of MDDCs with TLR-2 (Pam3CSK4) or DC-SIGN (ManLam) specific ligands induced retinoic acid metabolism, while TLR-4 (LPS) or TLR-5 (flagellin) stimulation did not. (*p<0.05 versus isotype control antibody);

Fig. 15. (A) is a graph showing B. infantis stimulated MDDCs co-cultured with autologous CD4+ T cells for five, seven or nine days. T cells were co-cultured with B. infantis stimulated MDDCs alone or were re-stimulated with anti-CD2/CD3/CD28 antibodies for two days prior to analysis. Induction of Foxp3 by unstimulated MDDCs was also assessed under both culture conditions and at each timepoint. The data was normalized by subtracting the unstimulated MDDC-T cell Foxp3+ levels from B. infantis stimulated MDDC-T cell at each timepoint with or without re-stimulation. Peak induction of Foxp3+ lymphocytes occurred at seven days co-culture with B. infantis stimulated MDDCs. (B) MDDCs were stimulated with three different Bifidobacteria strains followed by co-incubation with autologous CD4+ T cells. B. globosum and B. animalis induced T-bet expression while B. infantis did not. (Results are shown as the mean +/- SE, n=3 donors. *p<0.05 versus non-stimulated MDDCs); Fig. 16. B. infantis stimulated MDDCs, mDCs or pDCs induce CD25+Foxp3+ T cells (A) associated with increased secretion of IL-10 (B, n=6 donors) compared to unstimulated MDDC-, mDC- or pDC-T cell co-cultures. The flow cytometry density plots illustrated are from anti- CD2/CD3/CD28 restimulated T cell cultures. (C) is a graph showing that blocking TLR-2 significantly reduced IL-10 secretion from MDDC and mDC-T cell cocultures, with no effect on pDC-T cell IL-10 secretion (n=3 donors). (D) is a graph showing that blocking TLR-9 significantly reduced pDC-T cell secretion of IL- 10 (n=4). (*p<0.05 versus unstimulated cells);

Fig. 17. (A) is a graph showing that induction of Foxp3+ T cells by B. infantis was blocked when MDDCs were pre-incubated with anti-TLR-2 or anti-DC-SIGN blocking antibodies. In contrast, there was no effect on T-bet or GATA-3 expression by T cells (mean +/- SE, n=4 donors). (B) are graphs showing that inhibition of retinoic acid production (citral) or retinoic acid signaling (LEI 35) blocked the induction of Foxp3+ cells by B. infantis stimulated MDDCs and mDCs (n=3 donors). (C) are plots showing that inhibition of pDC IDO activity by 1 -methyl tryptophan significantly attenuated the pDC induction of Foxp3+ T cells. (D) is a graph showing that IDO inhibition partially reduced B. infantis-stimuiated MDDC-T cell Foxp3 induction (n=3 donors) but not as significantly as IDO inhibition for pDC-T cell Foxp3 induction (n=5 donors). (*p<0.05 versus unstimulated cells); Fig. 18. is a graph showing the increased % cells, from mesenteric lymph nodes, actively metabolising retinoic acid (CD1 l b+CDl l c+CD103+RALDH+ but CD3 and CD 19 negative) following administration of B. infantis 35624 (relative to placebo), which is reversed by coadministration of the RALDH inhibitor Citral; Fig. 19. is a graph showing the increased % Tregs cells (CD3+CD4+CD25+Foxp3+), from mesenteric lymph nodes, following administration of B. infantis 35624 (relative to placebo; p<0.05, 1 way ANOVA), which is reversed by co-administration of the RALDH inhibitor Citral;

Fig. 20. are graphs showing the decreased % lamina propria cells producing pro-inflammatory cytokines (CD3+CD4+IL-17+ or IFN-g+) following administration of B. infantis 35624 (relative to placebo; p<0.05, 1 way ANOVA), which is reversed by co-administration of the RALDH inhibitor Citral; Fig. 21 are graphs showing the influx of alpha4/beta7+ lymphocytes into from mesenteric lymph nodes and lamina propria following DSS induction of colitis, which is blocked by B. infantis administration. This effect is reversed by administration of the RALDH inhibitor Citral; and Fig. 22 are graphs showing the increased % lamina propria cells producing pro-inflammatory cytokines (CD3+CD4+IL-17+ or IFN-g+) following DSS induction of colitis, which is blocked by B. infantis administration. This effect is reversed by administration of the RALDH inhibitor Citral. Detailed Description

A deposit of Bifidobacterium longum biotype infantis strain UCC 35624 was made at the National Collections of Industrial and Marine Bacteria Limited (NCIMB) Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA, Scotland, UK on January 13, 1999 and accorded the accession number NCIMB 41003.

Bifidobacterium infantis 35624 (B. infantis) is a commensal microbe that was originally isolated from the human gastrointestinal mucosa. Bifidobacterium infantis 35624 is sold by Procter & Gamble Co. under the trademark Bifantis. Bifidobacterium infantis 35624 is described in EP 1 141 235 B l, US 7, 195,906, WO 2010/003803 and Brenner et al ⁴⁴ .

As B. infantis 35624 has been identified as a probiotic which can limit inflammatory disease, both in mice and humans, we examined the mechanisms underpinning the immune regulatory nature of this organism ⁶ ' ^24"30 . We discovered that human dendritic cells exposed to B. infantis 35624 induced the conversion of na ^' ive T cells into regulatory T cells in a retinoic acid-dependent manner. Thus, the induction of vitamin A metabolizing enzymes by B. infantis 35624 is an essential molecular step in its ability to suppress proinflammatory disorders. In addition, we demonstrate that humans that consume B. infantis have significantly elevated IL-10 responses and Foxp3 expression following in vivo exposure, supporting our in vitro observations. We have demonstrated that both human mDCs and pDCs specifically induce Foxp3+ CD4 cells following in vitro incubation with B. infantis and that there is a different mechanism of Foxp3 induction in mDCs and pDCs. Induction of Foxp3+ T cells by mDCs is TLR-2-, DC-SIGN- and retinoic acid dependent whereas induction of Foxp3+ cells by pDCs requires indoelamine 2,3 dioxygenase (IDO). Intestinal homeostasis is dependent on immunological tolerance to the resident microbiota. Dendritic cells (DCs) continually sample microbes and provide polarization signals to lymphocytes following pattern recognition receptor activation. We have found that DCs expressed functionally active RALDH2 resulting in retinoic acid secretion following stimulation with B. infantis 35624. DCs exposed to B. infantis induced polarization and activation of autologous CD4 T cells to express CD25 and Foxp3. Retinoic acid was required for DC induction of Foxp3+ T cells. Consumption of B. infantis by healthy human volunteers resulted in increased secretion of IL-10 and enhanced expression of Foxp3 by CD25+ T cells.

Induction of Foxp3+ T regulatory cells is a pivotal feature of mucosal immune tolerance. We describe that oral feeding of healthy human volunteers with B. infantis results in increased numbers of Foxp3+ CD4+ T cells within peripheral blood, which is associated with enhanced secretion of IL-10 following stimulation. In addition, our in vitro data supports the hypothesis that DCs are responsible for the induction of Foxp3+ cells. Both myeloid and plasmacytoid DC subsets play a role, but recognize B. infantis via different PRRs. Induction of Foxp3+ T cells by DDCs and mDCs involves TLR-2, DC-SIGN and retinoic acid metabolism. However, induction of Foxp3+ T cells by pDC is independent of TLR-2 and retinoic acid but requires I DO. To our knowledge this is the first report which demonstrates that human DC subsets utilize different pathways when exposed to a commensal microbe that enhances Foxp3 expression in autologous CD4+ T lymphocytes.

Human Foxp3+ T cells are heterogeneous in phenotype and function, composing distinct, although related, subpopulations. Interestingly, enhanced expression of ICOS and CTLA-4 within the Foxp3+ population suggests that B. infantis induces an effector Treg phenotype ³¹ . B. infantis feeding was associated with increased numbers of CD25+ cells that expressed Foxp3 but there was no effect on Foxp3 expression within the CD25- population. One possible explanation is that Foxp3 can promote CD25 expression and therefore B. infantis associated induction of Foxp3 in CD25- cells leads to the expression of CD25 and their inclusion in the CD25+ gate ³² . Alternatively, B. infantis might not induce new CD25+Foxp3+ cells in vivo, rather B. infantis might stabilize and promote expansion of the pre-existing CD25+Foxp3+ population.

The default status of the gastrointestinal micro-environment is thought to favour induction of regulatory lymphocytes. For example, retinoic acid generation from vitamin A occurs in intestinal epithelial cells and specialized dendritic cell subsets resulting in the conversion of naive T cells into Foxp3+ T regulatory cells ³³ . However, the gut-specific factors which promote vitamin A metabolism have been poorly described. We describe upregulation of the retinoic acid metabolizing enzyme RALDH2 in mDCs, which are exposed to a single commensal strain. The retinoic acid response is functional and contributes to the induction of Foxp3+ T cells. Thus, the presence of certain bacterial strains within the gastrointestinal tract may provide the necessary signals to gut-associated lymphoid tissue for the induction of enzymes, such as RALDH2, which are required for maintaining intestinal homeostasis in a milieu of exogenous antigenic challenge. Surprisingly, tryptophan metabolism, but not retinoic acid metabolism, is required for the. induction of Foxp3+ CD4 T cells by pDCs upon B. infantis exposure. These molecular mechanisms highlight an important link between diet, composition of the gastrointestinal microbiota and regulation of intestinal immune responses. Interestingly, recent findings by ^ther investigators on microbiota-derived short-chain fatty acids (SCFA) suggest that we may have previously under estimated the importance of the relationship between diet and the microbiota ³⁴ . In addition, acetate production (following carbohydrate fermentation) by certain Bifidobacteria strains mediates protection from lethal E. coli infection in mice ³⁵ .

Recent findings on the role of PRR signaling in mucosal homeostasis have emphasized the delicate balance between different PRR functions, and revealed that defective PRR signaling can result in inflammation ³⁶ . TLR-2 KO animals are more sensitive to dextran sodium sulphate- induced colitis, while TLR-2 gene variants are associated with disease phenotype in IBD patients. Indeed, TLR-2 has been demonstrated to promote Foxp3 expression in response to intestinal microbes in murine models ³⁷ ' ³⁸ . Our results show that inhibition of human mDC TLR- 2/6 activation resulted in suppression of IL- 10 secretion and Foxp3 induction, while enhancing secretion of IL-12p70 and TNF-cc following B. infantis exposure. DC-SIGN activation by B. infantis is required for full RALDH activity and blocking DC-SIGN results in significantly fewer Foxp3+ CD4+ T cells. Similarly, TLR-9 is required for pDC secretion of IL-10 in response to B. infantis. However, CpG stimulation of pDCs resulted in enhanced IFN-cc gene expression, which was not observed with B. infantis stimulation, suggesting that other molecular pathways distinct from those induced solely by TLR-9 are involved in the pDC response to this bacterium. These findings suggest that cross-talk between TLR-2/6, DC-SIGN, TLR-9 and other PRRs determine the innate and subsequent adaptive immune response to this commensal microbe. Appropriate PRR activation in vivo may promote immune homeostatic mechanisms, which limit the activation of pro-inflammatory responses and protect mucosal tissue from injury. In addition, the involvement of multiple P Rs suggests that multiple bacterial components including lipoteichoic acids (TLR-2), polysaccharides (DC-SIGN) and DNA (TLR-9) are all important for optimal induction of the immune regulatory program in vivo. Furthermore, a commensal microbe that expresses all of these regulatory factors may be more efficient in the local induction of Foxp3+ cells compared to a commensal bacterium that only expresses one or two regulatory factors.

Both mDCs and pDCs are present within the gastrointestinal tract at relatively high numbers compared to the peripheral blood. .In the mouse, pDCs are numerically dominant within the lamina propria and Peyer's patches, while mDCs dominate mesenteric lymph nodes ³⁹ . In murine models, pDCs have been shown to be essential for the induction and maintenance of oral tolerance as systemic depletion of pDCs prevents tolerance induction to fed antigen, while adoptive transfer of oral antigen-loaded liver pDCs induced antigen-specific suppression of CD4 and CD8 T cell responses ⁴⁰ . It is likely that mDCs and pDCs will also cooperate in the induction of tolerance to commensal microbes other than B. infantis, but our data suggests that not all Bifidobacteria induce the same pDC and mDC response.

B. infantis 35624 has been shown to protect against inflammatory disease in a number of murine models (including colitis, arthritis, respiratory allergy and infectious models). In humans, we now demonstrate in vivo that oral administration of this bacterium results in elevated IL-10 responses and Foxp3 expression in CD4+ T cells and we describe the potential cellular mechanisms underpinning this regulatory response. Manipulation of T regulatory cell numbers or functions is an exciting therapeutic target in a wide range of inflammatory diseases ⁴ ' ' ⁴² . A clearer understanding of the mechanisms employed in vivo for the induction of oral tolerance by the microbiota will likely result in rational strategies to manipulate both regulatory and effector T cells, thereby influencing gastrointestinal disorders such as food allergy, eosinophilic esophagitis, irritable bowel syndrome and inflammatory bowel diseases.

The invention will be more clearly understood from the following Examples.

Materials and Methods

Human studies

Two healthy human volunteer studies were performed and both were approved by the Clinical Research Ethics Committee of the Cork Teaching Hospitals, Ireland. Each potentially eligible healthy adult volunteer was evaluated by a full clinical history review, physical examination, hematological and serum chemistry analysis. Clinically significant findings in any of the evaluation parameters led to the exclusion of that volunteer. In the first study (feeding trial study 1), healthy adults were randomized to receive B. infantis (n=10; lxl 0 ⁹ live bacteria per day) or placebo (n=12; maltodextrin and magnesium stearate with no bacteria) for 8 weeks. All investigators, as well as the volunteers, remained blinded to the randomization process until completion of the study. The second study (feeding trial study 2) was conducted with healthy adults fulfilling the same selection criteria as outlined above but in this study all subjects were fed B. infantis (n=17; lxlO ⁹ live bacteria per day) for 8 weeks.

Peripheral blood mononuclear cells (PBMCs) were isolated on day - 1 (pre-feeding) and day 56 (post-feeding). Freshly isolated PBMCs were stained with monoclonal antibodies to CD4- PerCP, CD25-APC, ICOS-PE, CTLA-4-PE and Foxp3-Alexa Fluor 488 (eBioscience, San Diego, CA, USA). Duplicate samples were evaluated using a FACSCalibur (Becton Dickinson) and analysis was carried out using the BD CellQuest software. In addition, 1 x 10 ⁶ cells/mL PBMCs were stimulated with anti-CD3 {5\igl \) and anti-CD28 {5 aglm\) antibodies for 48 hours. PBMC supernatants were analysed for cytokine levels simultaneously using the MesoScale Discovery (MSD) multiplex platform. Administration of B. infantis in Feeding trial study 1

The dried powder active was manufactured to a cGMP standard at Chr Hansen A/S, Denmark. The active was blended with maltodextrin and magnesium stearate and packaged in 5g sachets and stored at 4 degrees Celius. Active ingredient: Bifidobacterium Infantis 35624 at approx. 4xl0 ⁹ cfu/sachet (the target dosage of Bifidobacterium Infantis 35624 was l x 10 ⁹ cfu per day, each sachet contained approx. 4x10 ⁹ cfu Bifidobacterium Infantis 35624 to allow for loss of numbers on storage). Prior to consumption, a sachet was opened and the contents added to a glass of milk (50-100mls) as part of a meal at breakfast time and consumed within 15 minutes on a daily basis each morning for 8 weeks. Subjects consumed lxl 0 ⁹ to 4x10 ⁹ cfu Bifidobacterium Infantis 35624 per day.

Administration of B. infantis in Feeding trial study 2

The dried powder active was manufactured to a cGMP standard at Chr Hansen A/S, Denmark. The active was blended by Bifodan AS, Denmark and packaged in lg sachets and stored at 4 degrees Celius. Active ingredient: Bifidobacterium Infantis 35624 at approx. 4x10 ⁹ cfu/sachet (the target dosage of Bifidobacterium Infantis 35624 was l x 10 ⁹ cfu per day, each sachet contained approx. 4x10 ⁹ cfu Bifidobacterium Infantis 35624 to allow for loss of numbers on storage). Prior to consumption, a sachet was opened and the contents added to a glass of milk (50-100mls) as part of a meal at breakfast time and consumed within 15 minutes on a daily basis each morning for 8 weeks. Subjects consumed lxl O ⁹ to 4xl0 ⁹ cfu Bifidobacterium Infantis 35624 per day.

Dendritic cell isolation and culture conditions

Dendritic cell experiments were performed using cells isolated from naive (i.e. non-B. infantis fed) healthy volunteers. Human peripheral blood monocytes were obtained using CD 14+ positive isolation with the MACS system (Miltenyi Biotec, Bergisch Gladbach, Germany). Cells were cultured in cRPMI media (Invitrogen, Carlsbad, USA) with 1,000 U/ml IL-4 (Novartis, Basel, Switzerland) and 1 ,000 U/ml GM-CSF (PeproTech, London, UK) for 5 days in order to generate MDDCs. Peripheral blood mDCs were isolated following CD3, CD 14 and CD 19 depletion and CDlc positive selection with the MACS system. Peripheral blood pDCs were positively enriched using CD304 isolation with the MACS system. In addition, flow cytometric sorting with anti-CD123 FITC (Miltenyi Biotec) yielded a highly purified pDC population. Peripheral blood CD4+ T cells were isolated by negative selection with the MACS system. MDDCs, mDCs and pDCs were routinely cultured in cRPMI medium and stimulated with bacterial strains or remained unstimulated. For blocking experiments, dendritic cells were pre- incubated for 30 minutes with control oligonucleotide GCTAGATGTTAGCGT (SEQ ID NO. 1 ), TLR9 antagonist oligonucleotide TTTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID No. 2) (Microsynth, Balgach, Switzerland) or the blocking monoclonal antibodies: anti-TLR2 (gift from C. Kirschning, Munich, Germany), anti-DC-SIGN (AZDN1 , Beckman Coulter, Brea, USA) and IgG2B control antibody (R&D Systems Europe, Abingdon, England). Cytokine secretion was quantified by Bio-Plex multiplex suspension array (Bio-Rad Laboratories, Hercules, USA).

Bacterial labeling and visualization of cell binding

B. infantis was stained with CFSE (Invitrogen, Carlsbad, USA) while MDDCs were co-stained with anti-CDl lc PE-Cy5 (BD Pharmingen, Franklin Lakes, USA). MDDCs were visualized at multiple time-points using multispectral imaging flow cytometry Image Stream X (Amnis Corporation, Seattle, USA) and images were analyzed using IDEAS software (Amnis Corporation, Seattle, USA). CD80 FITC and CD86 PE (BD Pharmingen) expression was evaluated by flow cytometry (Gallios system, Beckman Coulter). MDDCs were incubated with CFSE-stained B. infantis for 16 hours and B. infantis localization within activated lysosomes was determined by staining MDDCs with Lysotracker red DND-99 (Invitrogen) and DAPI in ProLong Gold antifade reagent (Invitrogen). Slides were analyzed by confocal microscopy. RALPH assessment

MDDCs, mDCs and pDCs were stimulated with bacteria (with or without inhibitors) for 16-24 hours in cRPMI. RALDH activity was determined using the ALDEFLOUR kit (Aldagen, Durham, USA) and positive cells were visualized by flow cytometry. In representative experiments, MDDCs were incubated with PKH26 stained B. infantis in order to co-localise bacterial binding and RALDH induction.

HEK-293 TLR-2 Cells

HEK-Blue hTLR-2 cells and HEK-Blue Null l cells (Invivogen, San Diego, USA) were stimulated with B. infantis for 24 hours. Both cell lines express the NF-KB-inducible secreted embryonic alkaline phosphatase (SEAP) reporter. The TLR-2 ligand Pam3CSK4 (2^g/ml, Calbiochem, Merck GaA, Darmstadt, Germany) was used as a positive control.

Dendritic cell T cell co-cultures

Dendritic cells were stimulated for 4 hours with test bacterial strains and co-cultured with autologous CD4+ T cells at a 1 :40 ratio (mDCs) or a 1 :20 ratio (MDDCs and pDCs) in AIM-V media (Invitrogen, Carlsbad, USA). After 5 days, cells were re-stimulated with anti-CD28 (generated in house), anti-CD3 (Orthoclone OKT3, Janssen-Cilag) and anti-CD2 (Sanquin, Amsterdam, Netherlands). Two days later lymphocytes were permeabilised and stained for CD4, CD25 and Foxp3 (eBioscience San Diego, CA, USA). Citral (Sigma- Aldrich, St. Louis, USA), LEI 35 (Tocris Bioscience, Bristol, United Kingdom) and 1 -methyl-L-tryptophan (Sigma- Aldrich, St. Louis, USA) were added as RALDH2 and IDO inhibitors, respectively. Retinal (Sigma- Aldrich, St. Louis, USA) was added as substrate of RALDH2.

Statistical analysis

Wilcoxin-matched pairs test or student's t-tests were used to evaluate the effect of inhibitors on in vitro activated dendritic cells and dendritic cell-T cell co-cultures. In addition, D'Agostino & Pearson normality tests were performed on the cytokine and flow cytometric data from the human volunteer studies. Pre-feeding and post-feeding measurements were assessed using student's t-tests for paired data while comparisons between placebo and treatment groups were performed using Student t-tests (two-tailed) and Mann- Whitney tests. All data analysis was carried out using GraphPad Prism software.

Example 1 - B. infantis induces dendritic cell maturation and regulatory activity

In order to understand how B. infantis induced IL-10 polarization and expression of Foxp3+ cells in humans, we focused on dendritic cells as the potential cellular mediators, which could aquire B. infantis in vivo within the mucosa and secrete immunoregulatory factors that induce T cell polarization. Human monocyte derived dendritic cells (MDDCs), directly isolated human mDCs and directly isolated human pDCs were demonstrated, in vitro, to bind B. infantis and rapidly internalize this microbe (Figure 1 A-D). A dose dependent maturation of the MDDCs is evident from the increased expression of CD80 and CD86 (Figure I E). A similar increase in myeloid dendritic cell (mDC) co-stimulatory molecule expression was observed.

B infantis stimulated MDDCs, mDCs and pDCs secreted IL-10, but not IL-12p70, in response to this bacterium (Figure 7A-C). This was not observed with all Bifidobacteria as MDDCs secreted IL-12p70, when co-incubated with other unrelated Bifidobacterial strains and pathogenic bacteria such as Streptococcus pyrogenes, Staphylococcus aureus and Pseudomonas aeruginosa (Figure 8). Example 2 - B. infantis induced expression of retinaldehyde dehydrogenases in dendritic cells Vitamin A, in the retinoic acid form, plays an important role in gene transcription. Once retinol has been taken up by a cell, it can be oxidized to retinal (retinaldehyde) by retinol dehydrogenases and then retinaldehyde can be oxidized to retinoic acid by retinaldehyde dehydrogenases (RALDH enzymes). The conversion of retinaldehyde to retinoic acid is an irreversible step, meaning that the production of retinoic acid is tightly regulated, due to its activity as a ligand for nuclear receptors. The physiological form of retinoic acid (all-trans- retinoic acid) regulates gene transcription by binding to nuclear receptors known as retinoic acid receptors (RARs) which are bound to DNA as heterodimers with retinoid "X" receptors (RXRs). The RAR-RXR heterodimer recognizes retinoic acid response elements (RAREs) on the DNA whereas the RXR-RXR homodimer recognizes retinoid "X" response elements (RXREs) on the DNA. Upon binding of retinoic acid to the RAR component of the RAR-RXR heterodimer, the receptors undergo a conformational change that causes co-repressors to dissociate from the receptors. Coactivators can then bind to the receptor complex, which may help to loosen the chromatin structure from the histones or may interact with the transcriptional machinery. This response can upregulate (or downregulate) the expression of target genes.

B. infantis induced the expression of RALDH2 in MDDCs as assessed by RT-PCR (Figure 2A). The functional activity of RALDH2 was confirmed in MDDCs and mDCs by flow cytometry (Figure 2B). Inhibition of RALDH activity with DEAB completely blocked the conversion of the substrate. MDDCs which had bound B. infantis, expressed greater RALDH2 activity compared to MDDCs that had not captured B. infantis (Figure 3). B. infantis induced expression of the ALDH1A2 gene, which encodes for the enzyme retinaldehyde dehydrogenase 2 (RALDH2), in MDDCs and mDCs but not pDCs (Figure 7D). ALDH1A2 was induced quickly in MDDCs, while ALDH1A2 was induced at later time points in mDCs. B. infantis did not alter ALDHJA1 or ALDH1A3 gene expression in any DC subset. The functional activity of RALDH2 was confirmed in MDDCs and mDCs by flow cytometry (Figure 7E). Inhibition of RALDH activity with diethylaminobenzaldehyde (DEAB) completely blocked the detection of BODIPY-aminoacetate (BAA)-positive cells. However, pDCs did not upregulate RALDH activity with B. infantis incubation (Figure 7E). MDDCs which had bound B. infantis, expressed a higher level of RALDH metabolic activity compared to MDDCs that had not captured B. infantis (Figures 9A and B). In addition, the induction of RALDH was dose dependent and the optimal dose of approximately 5x10 ⁶ bacterial cells (10: 1 bacteria:MDDC cell number) was used in subsequent experiments (Figure 9C). Another metabolic enzyme with regulatory activity is indoleamine 2,3 dioxygenase (IDO). B. infantis induced IDO gene expression in MDDCs, mDCs and pDCs, with relatively higher levels of expression by pDCs (Figure 7F). The kinetics of IDO induction was different for each DC subset. MDDCs expression slowly increased over time, while mDCs reached maximal expression levels at 6 hours and expression was maintained over time. Similarly, pDCs IDO expression peaked at 6 hours but decreased rapidly thereafter.

The induction of ALDH1A2 in MDDCs by B. infantis 35624 was not observed with the other Bifidobacterial strains that were examined (Figure 10A), while IDO gene expression was enhanced by LPS and all three Bifidobacterial strains (Figure 10B). Example 3 - B. infantis activation of DCs is PRR-dependent

In order to better understand the molecular basis for B. infantis-m ^' duced DC immunoregulatory responses, we examined the role played by a range of PRRs. MDDCs express high levels of Dectin-1 , however no significant differences in cytokine production were observed for IL-10 (1 ,626 +/- 453 pg/ml compared to 1,522 +/- 418 pg/ml) or IL-12p70 (12.5 +/- 4.8 pg/ml compared to 1 1.9 +/- 4.1 pg/ml) secretion with Dectin-1 inhibition. Blockade of MDDC TLR-2 resulted in significantly decreased secretion of IL-10 and significantly increased secretion of IL- 12p70 and TNF-a (Figure 1 1 A). Inhibition of MDDC DC-SIGN did not significantly alter IL- 10 or IL-12 secretion although TNF-a secretion was significantly increased (Figure 1 1 A). Blockade of mDC TLR-2 or DC-SIGN resulted in significantly reduced IL-10 secretion associated with increased secretion of TNF-a (Figure 1 I B). In order to confirm that TLR-2 induced an intracellular signaling cascade in response to B. infantis, we examined HE -293 cells, which were engineered to express TLR-2. HE -293 ^{TL "2+} cells responded to B. infantis as demonstrated by an increase in NF-κΒ activation and IL-8 secretion (Figure 12). In contrast, NF-KB activation and IL-8 secretion did not increase over baseline levels in HEK ^{TLR 2"} cells. In addition, pre-incubation of HEK-293 ^TLR"2+ cells with anti-TLR-2 blocking antibody significantly reduced NF-KB activation and IL-8 secretion in response to B. infantis. TLR-2 can form heterodimers with either TLR-1 or TLR-6. Blocking TLR-1 had no effect on B. infantis- ^' mduced NF-KB activation or IL-10 secretion, while TLR-6 had a partial effect but not as significant as TLR-2 blockade (Figure 13). The combination of anti-TLR-2 and anti-TLR-6 antibodies was the most effective in the inhibition of HEK-293 NF-κΒ activation and MDDC IL- 10 secretion. TLR-2 was expressed by pDCs at a very low level and blocking experiments did not alter the pDC IL-10 response to B. infantis (Figure 1 1 C), while IL-12p70 was not detected. However, blockade of TLR-9 with an inhibitory oligonucleotide abolished the secretion of IL- 10 by pDCs in response to B. infantis (Figure 1 I D). In order to evaluate if pDCs respond in a similar manner to specific TLR-9 agonists, pDCs were stimulated with CpG or B. infantis. Both B. infantis and CpG stimulation resulted in enhanced IL-10 and IDO gene expression, while IFN-a gene expression was only increased following CpG stimulation (Figure H E). MDDCs and mDCs express very low levels of TLR-9 and TLR-9 inhibitory oligonucleotides did not alter the MDDC response to B. infantis.

In addition to cytokine production, the blocking of MDDC TLR-2 or DC-SIGN resulted in significant inhibition of retinoic acid metabolism in B. infantis stimulated MDDCs and mDCs (Figure 14A and B). Furthermore, specific activation of MDDC TLR-2 by Pam3CSK4 induced > retinoic acid metabolism, while stimulation of DC-SIGN by mannosylated lipoarabinomannan (ManLam) marginally increased retinoic acid metabolism (Figure 14C). In contrast, specific activation of TLR-4 or TLR-5 by LPS or flagellin respectively did not induce retinoic acid metabolism in MDDCs (Figure 14C).

Example 4A - B. infantis stimulated dendritic cells induce Foxp3+ T cells

Induction of Foxp3+ T regulatory cells is an essential feature of mucosal tolerance. We examined the induction of Foxp3+ T cells after co-incubation with B. infantis stimulated myeloid dendritic cells. MDDCs and mDCs were incubated with B. infantis for four hours, washed extensively and re-incubated with autologous CD4+ cells for seven days. Following incubation with B. infantis, all dendritic cell sub-types induced Foxp3 expression when co-incubated with CD4 T cells (Figure 4A). In addition, enhanced IL-10 secretion was observed in the B. infantis stimulated dendritic cell-T cell co-cultures (Figure 4B). No induction of T-bet positive T cells over baseline was observed. However, co-incubation of MDDCs with other Bifidobacteria, which induced high levels of IL-12p70 secretion from dendritic cells, did result in the induction of T-bet+ T cells (Figure 4C) which confirms the selective nature of the B. infantis effect on dendritic cells and T cells. RALDH2 induction has been associated with the enhanced capacity of mucosal associated CD 103+ dendritic cells to induce Foxp3+ T cells. Following inhibition of retinoic acid synthesis with citral or inhibition of retinoic acid receptor signaling with LEI 35, the induction of Foxp3+ T cells by B. «/o«to-stimulated MDDCs was suppressed (Figure 4D). Supplementation of B. infantis stimulated MDDCs with the RALDH2 substrate retinal resulted in enhanced conversion of Foxp3+ T cells (Figure 4E). Example 4B - B. infantis stimulated dendritic cells induce Foxp3+ T cells

As human DCs clearly secrete immunoregulatory mediators in response to B. infantis, we assessed whether these DCs could also induce Foxp3+ expression by autologous T cells in vitro. MDDCs were incubated with B. infantis for four hours, washed and re-incubated with autologous CD4+ cells for five, seven or nine days. Peak induction of Foxp3, compared to unstimulated MDDCs was observed at seven days with or without co-stimulation (Figure 15A). In all subsequent experiments, DCs were co-cultured for seven days with autologous CD4+ T cells for assessment of Foxp3 induction. Following incubation with B. infantis, MDDCs, mDCs and pDCs induced Foxp3 expression in cultures with CD4 T cells (Figure 16A). In addition, enhanced IL-10 secretion was observed in the B. DC-T cell co-cultures, compared to T cells incubated with unstimulated DCs (Figure 16B). Blocking TLR-2 significantly reduced IL-10 secretion from MDDC and mDC-T cell cocultures, with no effect on pDC-T cell IL-10 secretion (Figure 16C), while blocking TLR-9 significantly reduced pDC-T cell secretion of IL- 10 (Figure 16D). In order to determine which PRRs were responsible for the preferential induction of Foxp3+ T cells, MDDCs were pre-incubated with anti-TLR-2 or anti- DC-SIGN blocking antibodies prior to B. infantis activation. A significant reduction in the CD4+CD25+Foxp3+ population was observed when dendritic cell TLR-2 responses were blocked. To a lesser extent, blockade of DC-SIGN also significantly reduced CD4+CD25+Foxp3+ induction (Figure 17A). No induction of T-bet or GATA-3 positive T cells over baseline was observed. However, incubation of MDDCs with other Bifidobacteria, which induced IL-12p70 secretion from dendritic cells, resulted in the induction of T-bet+ T cells (Figure 15B). RALDH2 induction has been associated with the enhanced capacity of mucosal associated CD103+ dendritic cells to induce Foxp3+ T cells. Following inhibition of MDDC or mDC retinoic acid synthesis (using citral) or inhibition of T cell retinoic acid receptor signaling (using LEI 35), the induction of Foxp3+ T cells by B. «/ «iw-stimulated MDDCs and mDCs was suppressed (Figure 17B). Using the IDO inhibitor 1 -methyl trypthophan, induction of Foxp3+ T cells by B. « antw-stimulated pDCs was inhibited (Figure 17C). B. infantis- stimulated MDDC induction of Foxp3+ T cells was also partially reduced in the presence of 1 - methyl tryptophan, however the reduction was not statistically significant and not as substantial as that observed for pDC-T cells (Figure 17D).

Example 5 - Feeding of healthy human volunteers with B. infantis is associated with induction of IL-10 and Foxp3 in vivo

The gastrointestinal micro-environment has been previously described to favour the induction of regulatory lymphocytes. For example, retinoic acid generation from vitamin A occurs in intestinal epithelial cells and specialized dendritic cell subsets resulting in the polarization of B cell immunoglobulin synthesis, induction of gut homing receptors on lymphocytes and conversion of na ^' ive T cells into Foxp3+ T regulatory cells. However, the gut-specific factors which promote vitamin A metabolism are poorly described. We have discovered that B. infantis 35624 upregulates the retinoic acid metabolizing enzyme RALDH2 in myeloid dendritic cells. The retinoic acid response is functional as inhibition of retinoic acid production or retinoic acid signaling blocks the induction of Foxp3+ T cells. Thus, the presence of certain bacterial strains within the gastrointestinal tract may provide the necessary signals to gut associated lymphoid tissue for the induction of enzymes, such as RALDH2, which are required for maintaining intestinal homeostasis in the context of multiple foreign, non-self, antigens. In addition, this molecular mechanism links nutrition, the gastrointestinal microbiota and regulation of intestinal immune responses as the consumption of adequate vitamin A levels in the diet and the presence of RALDH2-inducing microbiota could result in the optimal local induction of Foxp3+ regulatory T cells.

Healthy human volunteers consumed B. infantis or placebo for eight weeks. Peripheral blood mononuclear cells (PBMCs) were isolated before and after the feeding period. Surprisingly, B. infantis consumption was associated with significantly enhanced IL-10 levels in anti-CD3/CD28 stimulated PBMCs (p=0.01), while IL-10 levels in the placebo group did not change over the same period (p=0.01 ) (Figure 5 A). On the basis of these results, we performed another study with greater numbers of healthy human volunteers whereby we re-assessed PBMC IL- 10 levels as before and in addition we quantified Foxp3+ expression following eight weeks of B.infantis consumption. We were able to replicate the effect on anti-CD3/CD28 stimulated PBMC secretion of IL-10 (pO.001) (Figure 5B) while we observed no difference in anti-CD3/CD28 stimulated IL-2, IL-12p70, TNF-a or IFN-γ secretion (Figure 5C). In addition, the percentage of peripheral blood CD4+ T cells that express Foxp3 was significantly increased following B. infantis feeding (Week 0 CD4+Foxp3+ cells = 8.14+/-0.25% versus week 8 CD4+Foxp3+ cells = 9.19+/-0.34%; p=0.003). The increased expression of Foxp3 was observed in CD25 ^{hl h} and CD25 ^{intermedia e} CD4 T cells, but not CD25 ^negative T cells, was significantly increased following B. infantis consumption (Figure 5D). The CD4+CD25+Foxp3+ cells displayed a more pronounced regulatory phenotype following B. infantis administration as ICOS was expressed by significantly more of these cells at week 8 (Figure 6). CTLA-4 expression also increased but this difference did not reach statistical significance (p=0.06). Thus, in vivo, consumption of B. infantis results in more Foxp3+ T cells within peripheral blood of healthy humans suggesting that the dendritic cell responses described in vitro are also operational in vivo.

Example 6 - In-vivo studies demonstrate the upregulation of retinoic acid metabolism, by B. infantis 35624, within the gut mucosa

B. infantis 35624 has been shown to induce retinoic metabolism in human myeloid dendritic cells in in vitro models. However, the in vivo relevance of these findings is currently unknown. These murine studies were designed to demonstrate the upregulation of retinoic acid metabolism within the mucosa and show the importance of this. Mice were administered B. infantis 35624 (or placebo) daily in drinking water for 9 days (n=8 mice fed probiotic and n=8 fed placebo or n=8 fed probiotic and injected i.p. with 2mg citral). B. infantis 35624 dried powder active was manufactured by Chr Hansen A/S, Denmark and resuspended in the drinking water before use; approximately l-2xl0 ⁹ cfu per day. After 9 days lamina propria and mesenteric lymph node cells were isolated as single cell suspensions. These cells were then stained for dendritic cell markers, and flow cytometry performed to quantify retinoic acid metabolising cells (CD1 l b+CDl l c+CD103+RALDH+ but CD3 and CD19 negative), Tregs (CD3+CD4+CD25+Foxp3+), intracellular cytokines (CD3+CD4+IL- 1 7+ or IFN-g+ or IL-4+).

Figures 18 and 19 show the results for RALDH+ cells and T Regs in mesenteric lymph nodes, while Figure 20 shows the results of intracellular cytokines for lamina propria cells.

These data confirm the observations from in-vitro studies. Administration of B. infantis 35624 increased the percentage of cells from mesenteric lymph nodes that actively metabolise retinoic acid (shown by staining for CD 1 lb+CDl lc+CD103+RALDH+ but CD3 and CD19 negative) (Figure 18). This increase in retinoic metabolism is directly correlated with an increase in T Reg cells (shown by staining for CD3+CD4+CD25+Foxp3+) (Figure 19) and decreased production of pro-inflammatory cytokines from lamina propria cells (IL-17 and IFN-g) (Figure 20). In each case, the effect of B. infantis 35624 could be reversed using a selective inhibitor of RALDH (Citral) demonstrating the causal link between B. infantis 35624, RALDH induction and beneficial immune-modulation.

Example 7 - In-vivo studies demonstrate the influx of alpha4/beta7+ lymphocytes producing pro- inflammatory cytokines, is blocked by B. infantis 35624 and is dependent on retinoic acid metabolism.

B. infantis 35624 has been shown to induce retinoic metabolism in human myeloid dendritic cells in in vitro models. However, the in vivo relevance of these findings is currently unknown. These murine studies of colitis were designed to demonstrate that the effect of B. infantis 35624 is dependent on retinoic acid metabolism.

Mice were administered B. infantis 35624 (n=32), (or placebo; n=16) daily in drinking water for 9 days. B. infantis 35624 dried powder active was manufactured by Chr Hansen A/S, Denmark and resuspended in the drinking water before use; approximately l -2xl 0 ⁹ cfu per day. Half of the animals in each group were also administered Citral daily (2mg per mouse i.p. injection). Groups 1 (B. infantis 35624) and 2 (B. infantis 35624 + Citral) were euthanized after the feeding period and immunological measurements performed. Colitis was induced in groups 3 (B. infantis 35624 + colitis), 4 (B. infantis 35624 + Citral + colitis), 5 (placebo + colitis) and 6 (placebo + Citral + colitis) by administration of DSS in the drinking water for an additional 7 days. The severity of colitis was assessed using macroscopic and histology scores. In addition, MPO levels and cytokine gene expression were determined in mucosal tissues. (See Murphy CT et al ⁴³ for details of the Colitis Model). For immunological measurements lamina propria and mesenteric lymph node cells were isolated as single cell suspensions. These cells were then stained for CD4+ alpha4/beta7+ lymphocyte cell markers, and intracellular cytokines (CD4+IL-17+ or IFN-g+) performed by flow cytometry.

Figure 21 shows the results for CD4+ alpha4/beta7+ cells in mesenteric lymph nodes and for lamina propria cells, while Figure 22 shows the results for intracellular cytokines for lamina propria cells.

The data from this well recognised animal model of inflammation (DSS-induced colitis) confirms observations from in-vitro studies. DSS-induced colitis is associated with an influx of inflammatory cells (CD4+ alpha4/beta7+ lymphocytes) and an increased production of intracellular pro-inflammatory cytokines (CD4+IL- 17+ or IFN-g+). Administration of B. infantis. 35624 reversed these characteristic of inflammation (Figures 21 and 22). In each case, the effect of B. infantis 35624 could be reversed using a selective inhibitor of RALDH (Citral) demonstrating the causal link between B. infantis 35624, RALDH induction and beneficial immune-modulation.

Example 8 - Formulations/compositions

A composition or formulation of B. infantis and a substrate that provides a source of retinal can be administered by means known to those skilled in the art. The form of administration of the composition or formulation is not critical as long as an effective amount of the composition or formulation is administered. The composition or formulation may for example be administered enterally through or within the gastrointestinal or digestive tract. Enteral administration includes oral feeding, intragastric feeding, transpyloric administration or any other introduction into the digestive tract. The composition or formulation may be administered via tablet, pills, encapsulations, caplets, gelcaps, capsules, oil drops, sachets, liquids, liquid concentrates, powders, elixirs, solutions, suspensions, emulsions, lozenges, beads, and combinations thereof. Alternatively, the composition or formulation may be provided in a dissolvable form (such as a powder or tablet) to be added to a food or drink by the end user prior to consumption. The composition or formulation may be added to a food or drink product such as dairy products (for example yogurt, cheese, milk, milk based drinks and the like) fruit juice, fruit-based drinks, milk powder (including infant and toddler formulations), beverages and the like.

The composition or formulation may be supplemented into a formulation for children or infants. The term "infant" means a postnatal human that is less than about 1 year old. The term "child" means a human in the age range of about 1 and 12 years old. In certain embodiments, a child is in the age range of about 1 and 6 years old. In other embodiments, a child is in the age range of about 7 and 12 years old. The composition or formulation may be supplemented into a product for example an infant's nutritional product, such as an infant formula or a human milk fortifier. As used herein, the term "infant formula" means a composition that satisfies the nutrient requirements of an infant by being a substitute for human milk. The term "human milk fortifier" means a composition which can be added to human milk to enhance the nutritional value of the human milk. In some embodiments, the composition is an acidified product (as required by certain medical food regulations). The nutritional product may be a product for a full-term infant, a preterm infant, a low-birth-weight infant, or a very-low-birth-weight infant. As used herein, the terms "preterm" or "preterm infant" may include low-birth-weight infants or very-low-birth weight infants. Low- birth-weight infants are those born from about 32 to about 37 weeks of gestation or weighing from about 3.25 to about 5.5 pounds at birth. Very-low-birth-weight infants are those born before about 32 weeks of gestation or weighing less than about 3.25 pounds at birth. Thus, preterm infants may include infants born before about 37 weeks gestation and/or those weighing less than about 5.5 pounds at birth. The composition or formulation may provide minimal, partial, or total nutritional support. The composition or formulation may be nutritional supplements or meal replacements. The composition or formulation may be administered in conjunction with a food or nutritional composition for example, the composition or formulation can either be intermixed with the food or nutritional composition prior to ingestion by the subject or can be administered to the subject either before or after ingestion of a food or nutritional composition. The composition or formulation may be administered to preterm infants receiving infant formula, breast milk, a human milk fortifier, or combinations thereof. The composition or formulation may, but need not, be nutritionally complete. By the term "nutritionally complete," it is meant that the composition contains adequate nutrients to sustain healthy human life for extended periods. If the composition or formulation is administered via an infant formula or children's nutritional product, the formulation may be nutritionally complete and contain suitable types and amounts of lipid, carbohydrate, protein, vitamins and minerals. Commercially available infant formulas and other formulations for example, Enfamil®, Enfamil® Premature Formula, Enfamil® with Iron, Lactofree®, Nutramigen®, Pregestimil®, and ProSobee® (available from Mead Johnson & Company, Evansville, Ind., U.S.A.) may be supplemented with suitable levels of a composition or formulation describe herein.

The composition or formulation comprises a substrate that provides a source of retinal. The quantity of the substrate in the composition or formulation should be sufficient to provide the recommended daily allowance (RDA) of vitamin A in the all-trans retinoic acid form to the end user. Suitable substrates include retinal, retinol, retinyl acetate, retinyl palmitate, retinol acetate, retinol palmitate, beta carotene, alpha carotene, gamma carotene or beta cryptoxanthin. B. infantis 35624 is incorporated into the composition or formulation in an amount suitable to induce the expression of RALDH at a level that will metabolise a source of retinal to all-trans retinoic acid. The amount of B. infantis 35624 incorporated into the composition or formulation may correspond to the range of from about l xlO ⁴ to about lxlO ¹² colony forming units (cfu). For example the amount of B. infantis 35624 incorporated into the composition or formulation may correspond to the range of from about l xl O ⁶ to about l xl O ⁹ colony forming units (cfu). The amount of B. infantis 35624 incorporated into the composition or formulation may be at least lxl O ⁹ colony forming units (cfu). The amount of B. infantis 35624 incorporated into the composition or formulation may be colony forming units (cfu) per gram composition or formulation or a total daily amount of colony forming units (cfu).

The composition or formulation may comprise additional components such as lipids, fats, fatty acids, proteins, carbohydrate sources, minerals, emulsifiers, stabilisers, and combinations thereof. The amount of lipid or fat typically may vary from about 3 to about 7 g/100 kcal. Lipid sources may be any known or used in the art, e.g., milk fat, egg yolk lipid, fish oil, vegetable oils such as palm oil, soybean oil, palmolein, palm oil, palm kernel oil, coconut oil, medium chain triglyceride oil, high oleic sunflower oil, olive oil, high oleic safflower oil, and esters of fatty acids.

The amount of protein typically may vary from about 1 to about 5 g/100 kcal. Protein sources may be any known or used in the art, e.g., milk protein, non-fat milk solids, nonfat milk, whey protein, casein, soy protein, animal protein, cereal protein, vegetable protein, or combinations thereof. The composition or formulation may contain proteins and/or peptides rich in glutamine/glutamate. The protein source may be intact, partially hydrolyzed, or extensively hydrolyzed. The protein source may be a combination of intact protein and hydrolyzed protein. The protein source may be an isolate or a concentrate. The composition or formulation may contain a nitrogen source, such as amino acids and/or protein, such that the total amount of amino acids or protein may be from about 1 g/100 kilocalories (kcal) to about 10 g/100 kcal of total composition, or from about 2 g/100 kcal to about 6 g/100 kcal. The amount of lipid source per 100 kcal of total composition may be greater than 0 g up to about 6 g, for example about 0.5 g to about 5.5 g, or about 2 g to about 5.5 g; and the amount of non-fiber carbohydrate source per 100 kcal of total composition may be from about 5 g to about 20 g, such as from about 7.5 g to about 15 g. The amount of vitamins and minerals in the nutritionally complete composition may be sufficient to meet 100% of the recommended daily allowance (RDA). The composition or formulation may be protein-free. A protein-free composition or formulation may contain a protein equivalent source that comprises 100% free amino acids.

The amount of carbohydrate typically may vary from about 8 to about 12 g/100 kcal. Carbohydrate sources may be any known or used in the art, e.g., lactose, fructose, glucose, corn syrup, corn syrup solids, maltodextrins, sucrose, starch, rice syrup solids, rice starch, modified corn starch, modified tapioca starch, rice flour, soy flour, and combinations thereof.

The composition or formulation may optionally include one or more of the following vitamins or derivatives thereof, including, but not limited to, biotin, vitamin B l , thiamin, thiamin pyrophosphate, vitamin B2, riboflavin, flavin mononucleoride, flavin adenine dinucleotide, pyridoxine hydrochloride, thiamin mononitrate, folic acid, vitamin B3, niacin, nicotinic acid, nicotinamide, niacinamide, nicotinamide adenine dinucleotide, tryptophan, biotin, pantothenic acid, vitamin B6, vitamin B 12, cobalamin, methylcobalamin, deoxyadenosylcobalamin, cyanocobalamin, calcium pantothenate, pantothenic acid, vitamin C, ascorbic acid, vitamin D, vitamin D3, calciferol, cholecalciferol, dihydroxy vitamin D, 1 ,25-dihydroxycholecalciferol, 7- dehyrdocholesterol, choline, vitamin E, vitamin E acetate, vitamin K, menadione, menaquinone, phylloquinone, naphthoquinone, and mixtures thereof.

The composition or formulation may optionally include one or more of the following minerals or derivatives thereof, including, but not limited to, phosphorus, potassium, sulfur, sodium, docusate sodium, chloride, manganese, magnesium, magnesium stearate, magnesium carbonate, magnesium oxide, magnesium hydroxide, magnesium sulfate, copper, cupric sulfate, iodide, boron, zinc, zinc oxide, chromium, molybdenum, iron, carbonyl iron, ferric iron, ferrous fumarate, polysaccharide iron, fluoride, selenium, molybdenum, calcium phosphate or acetate, potassium phosphate, magnesium sulfate or oxide, sodium chloride, potassium chloride or acetate, ferric orthophosphate, alpha-tocopheryl acetate, zinc sulfate or oxide, copper gluconate, chromium chloride or picolonate, potassium iodide, sodium selenate, sodium molybdate, phylloquinone, cyanocobalamin, sodium selenite, copper sulfate, inositol, potassium iodide, cobalt, and mixtures thereof. Non-limiting exemplary derivatives of mineral compounds include salts, alkaline salts, esters and chelates of any mineral compound.

The composition or formulation also may contain emulsifiers and stabilizers such as soy lecithin, carrageenan, and combinations thereof. The composition or formulation may optionally contain other substances that may have a beneficial effect such as lactoferrin, nucleotides, nucleosides, immunoglobulins, and combinations thereof.

The composition or formulation may contain one or more prebiotics. The term "prebiotic" means a non-digestible food ingredient that stimulates the growth and/or activity of probiotics. Any prebiotic known in the art will be acceptable provided it achieves the desired result. Suitable prebiotics include oligosaccharides, polysaccharides, and other prebiotics that contain fructose, xylose, soya, galactose, glucose and mannose. Suitable prebiotics may also include lactulose, gluco-oligosaccharide, inulin, polydextrose, galacto-oligosaccharide, fructo-oligosaccharide, isomalto-oligosaccharide, soybean oligosaccharides, lactosucrose, xylo-oligosacchairde, and gentio-oligosaccharides. The composition or formulation may contain other active agents such as long chain polyunsaturated fatty acids (LCPUFAs). Suitable LCPUFAs include, but are not limited to, [alpha]-linoIeic acid, [gammaj-linoleic acid, linoleic acid, linolenic acid, eicosapentanoic acid (EPA), arachidonic acid (ARA) and/or docosahexaenoic acid (DHA). Commercially available infant formula that contains DHA, ARA, or a combination thereof, for example, Enfamil® or LIPIL® may be supplemented with a composition or formulation described herein. The weight ratio of ARA:DHA may be from about 1 :3 to about 9: 1 such as from about 1 :2 to about 4: 1 or about 2:3 to about 2: 1. Other suitable weight ratios of ARA:DHA include about 2: 1 , about 1 : 1 .5, about 1 : 1.3, about 1 : 1.9, about 1.5:, and about 1.47: 1. The level of DHA may be in the range of about 0.0% and 1.00% of fatty acids, by weight. The level of DHA may be about 0.32% by weight. The level of DHA may be about 0.33% by weight. The level of DHA may be about 0.64% by weight. The level of DHA may be about 0.67% by weight. The level of DHA may be about 0.96% by weight. The level of DHA may be about 1.00% by weight. The level of ARA is in the range of 0.0% and 0.67% of fatty acids, by weight. The level of ARA may be about 0.67% by weight. The level of ARA may be about 0.5% by weight. The level of DHA may be in the range of about 0.47% and 0.48% by weight. If included, the effective amount of DHA may typically be from about 3 mg per kg of body weight per day to about 150 mg per kg of body weight per day. Other suitable effective amounts of DHA include from about 6 mg per kg of body weight per day to about 100 mg per kg of body weight per day, from about 10 mg per kg of body weight per day to about 60 mg per kg of body weight per day, and from about 15 mg per kg of body weight per day to about 30 mg per kg of body weight per day. If included, the effective amount of ARA may typically be from about 5 mg per kg of body weight per day to about 150 mg per kg of body weight per day. Other suitable amounts of ARA vary from about 10 mg per kg of body weight per day to about 120 mg per kg of body weight per day. Such as from about 15 mg per kg of body weight per day to about 90 mg per kg of body weight per day or from about 20 mg per kg of body weight per day to about 60 mg per kg of body weight per day. If an infant formula is utilized, the amount of DHA in the infant formula may vary from about 5 mg/100 kcal to about 80 mg/100 kcal such as from about 10 mg/100 kcal to about 50 mg/100 kcal or from about 15 mg/100 kcal to about 20 mg/100 kcal. The amount of DHA may be about 17 mg/100 kcal. If an infant formula is utilized, the amount of ARA in the infant formula may vary from about 10 mg/100 kcal to about 100 mg/100 kcal such as from about 15 mg/100 kcal to about 70 mg/100 kcal or from about 20 mg/100 kcal to about 40 mg/100 kcal. The amount of ARA may be about 34 mg/100 kcal. If an infant formula is used, the infant formula may be supplemented with oils containing DHA and ARA using standard techniques known in the art. For example, DHA and ARA may be added to the formula by replacing an equivalent amount of an oil, such as high oleic sunflower oil, normally present in the formula. As another example, the oils containing DHA and ARA may be added to the formula by replacing an equivalent amount of the rest of the overall fat blend normally present in the formula without DHA and ARA. If utilized, the source of DHA and ARA may be any source known in the art such as marine oil, fish oil, single cell oil, egg yolk lipid, and brain lipid. In some embodiments, the DHA and ARA are sourced from the single cell Martek oil, DHASCO(R), or variations thereof. The DHA and ARA can be in natural form, provided that the remainder of the LCPUFA source does not result in any substantial deleterious effect on the infant. Alternatively, the DHA and ARA can be used in refined form.

The composition or formulation may include a LCPUFA source which contains EPA. Altermatively, the composition or formulation may include a LCPUFA source which is substantially free of EPA.

The composition or formulation may be shelf stable. By "shelf stable," it is meant that the composition or formulation, in a form that is ready to consume, remains in a single homogenous phase (i.e., does not separate into more than one phase upon visual inspection), and/or that settling does not occur upon visual inspection after storage overnight in the refrigerator.

The following exemplary examples describe capsules, sachets and dry powder (from fermented dairy) as the product form, which may be subsequently blended with a food stuff or beverage prior to consumption as required

A) Dried Powder in form of Sachet

The following is suitable to make a single dose 2g sachet:

B. infantis 5-10mg (> I x 10 ⁹ cfu) in cryoprotectant (inc. sucrose, trehalose, sodium citrate) Vitamin A* (retinol) 2500-5000 IU

Maltodextrin l ,890mg

Magnesium stearate lOmg (for even dispersal) * Vitamin A may be as Acetate or Palmitate, or in its pro-form Beta Carotene. Dose according to Recommended Dietary Allowances. For administration add contents to water, diluted fruit drink, milk, or malted milk drink, stirring rapidly until fully dispersed.

B) Dried Powder in form of Sachet

The following is suitable to make a single dose 2g sachet:

B. infantis 5-1 Omg (> 1 x 10 ⁹ cfu) in cryoprotectant (inc. sucrose, trehalose, sodium citrate)

Vitamin A* (retinol) 2500-5000 IU

Milk Powder or Malted Milk Powder 1 ,890mg

Magnesium stearate 1 Omg

* Vitamin A may be as Acetate or Palmitate, or in its pro-form Beta Carotene. Dose according to Recommended Dietary Allowances.

For administration add contents to water, diluted fruit drink, milk, or malted milk drink, stirring rapidly until fully dispersed.

C) Capsule

B. infantis (> 1 x 10 ⁹ cfu) in cryoprotectant (inc. sucrose, trehalose, sodium citrate) Vitamin A* (retinol) 2500-5000 IU

Microcrystalline cellulose (for even dispersal)

Sugar

Magnesium stearate (for even dispersal)

Milk protein

Titanium dioxide

Propyl gallate (anti-oxidant stabiliser)

* Vitamin A may be as Acetate or Palmitate, or in its pro-form Beta Carotene. Dose according to Recommended Dietary Allowances. For administration take one capsule daily.

D) Powder derived from fermented dairy products

Dairy products (for example milks and yogurts) are a natural source of vitamin A (retinol). In this formulation we envisage a fermentate or partial fermentate of B. infantis in a Malted Milk. The Malted Milk may be fortified with additional vitamin A, other vitamins and fibre for example psyllium fibre. Additional fermantative bacteria such as Lactobacillus delbrueckii subsp. bulgaricus and/or Streptococcus salivarius subsp. Thermophilus may be included in the formulation.

The fermentate or partial fermentate, enriched with B. infantis (> 1 x 10 ⁶ cfu/ml) may then be dried to generate a powder (for example by spray drying or by other means known in the art). The resulting powder is suitable for blending with a range of food products for example beverages, snack bars etc.

Summary

B. infantis 35624 has been previously shown to protect against inflammatory disease in a number of murine models (including colitis, arthritis, respiratory allergy and infection models). Adoptive transfer of CD25+ T cells from B. infantis-fed animals to naive recipients transferred the anti-inflammatory protective effect. In humans, we now describe that consumption of this bacterium results in elevated IL-10 responses and Foxp3 expression. Manipulation of T regulatory cell numbers or functions is an exciting therapeutic target in a wide range of inflammatory disorders. This data confirms our in vitro and murine models. However, we made the surprising discovery that B. infantis 35624 induces the immune-regulatory enzyme RALDH2 in dendritic cells and the product of this enzyme, retinoic acid, was essential for the induction of regulatory T cells. Thus, a formulation which combines the substrate, i.e. vitamin A or its derivatives, with a bacterial strain that induces expression of the enzyme responsible for substrate conversion will ensure the optimal conversion of the substrate to its immunologically active product. This formulation will provide a profound therapeutic benefit in patients suffering from inflammatory disorders. The formulation may be useful in maintaining a normal structure and function of the skin and mucous membranes (such as in the lung, intestines, nose, eyes and female reproductive tract). The inflammatory disorder may be a mucosal inflammatory condition. The inflammatory disorder may be associated with Mucosal/GI health such as diarrhoea, inflammatory bowel disease (IBD), irritable bowel syndrome (IBS), skin disorders such as acne, aging, beauty, respiratory inflammatory disorders (such as asthma and bronchopulmonary dysplasia), disorders of the eyes such as uveitis, disorders of the nose such as rhinitis or allergy or cancer associated with mucosal surfaces such as lung and GI. The inflammatory disorder may be selected from one or more of: asthma, gastrointestinal inflammatory activity such as inflammatory bowel disease e.g. Crohns disease or ulcerative colitis, irritable bowel syndrome, pouchitis, or post infection colitis, gastrointestinal cancer(s), systemic disease such as rheumatoid arthritis, autoimmune disorders, cancer due to undesirable inflammatory activity, diarrhoeal disease due to undesirable inflammatory activity, such as Clostridium difficile associated diarrhoea, Rotavirus associated diarrhoea or post infective diarrhoea, diarrhoeal disease due to an infectious agent, such as E.coli.

In addition, vitamin A deficiency is estimated to affect approximately one third of children under the age of five around the world. It is estimated to claim the lives of 670,000 children under five annually. Deficiency of vitamin A severely affects vision and also reduces immunological defense and tolerance mechanisms.

As used herein, the term "treating" means ameliorating, improving or remedying a disease, disorder, or symptom of a disease or condition. The term "reducing" means to diminish in extent, amount, or degree. The term "preventing" means to stop or hinder a disease, disorder, or symptom of a disease or condition through some action.

The invention is not limited to the embodiment hereinbefore described, with reference to the accompanying drawings, which may be varied in construction and detail.

O'Hara AM, Shanahan F. The gut flora as a forgotten organ. EMBO Rep 2006;7:688-93.

Shanahan F. Gut microbes: from bugs to drugs. Am J Gastroenterol 2010;105:275-9.

Lee YK, Mazmanian SK. Has the microbiota played a critical role in the evolution of the adaptive immune system? Science 2010;330: 1768-73.

Sakaguchi S, Miyara M, Costantino CM, et al. FOXP3+ regulatory T cells in the human immune system. Nat Rev Immunol 2010;10:490-500.

Akdis M, Verhagen J, Taylor A, et al. Immune responses in healthy and allergic individuals are characterized by a fine balance between allergen-specific T regulatory 1 and T helper 2 cells. J Exp Med 2004;199: 1567-75.

O'Mahony C, Scully P, O'Mahony D, et al. Commensal-induced regulatory T cells mediate protection against pathogen-stimulated NF-kappaB activation. PLoS Pathog 2008;4:el 0001 12.

Atarashi , Tanoue T, Shima T, et al. Induction of colonic regulatory T cells by indigenous Clostridium species. Science 201 1 ;331:337-41.

Karimi K, Inman MD, Bienenstock J, et al. Lactobacillus reuteri-induced regulatory T cells protect against an allergic airway response in mice. Am J Respir Crit Care Med 2009;179: 186-93.

Di Giacinto C, Marinaro M, Sanchez M, et al. Probiotics ameliorate recurrent Th l - mediated murine colitis by inducing IL-10 and IL-10-dependent TGF-beta-bearing regulatory cells. J Immunol 2005;174:3237-46.

Lyons A, O'Mahony D, O'Brien F, et al. Bacterial strain-specific induction of Foxp3+ T regulatory cells is protective in murine allergy models. Clin Exp Allergy 2010;40:81 1 -9. 1 1. Martinez-Canavate A, Sierra S, Lara-Villoslada F, et al. A probiotic dairy product containing L. gasseri CECT5714 and L. coryniformis CECT571 1 induces immunological changes in children suffering from allergy. Pediatr Allergy Immunol 2009;20:592-600. 12. Pronio A, Montesani C, Butteroni C, et al. Probiotic administration in patients with ileal pouch-anal anastomosis for ulcerative colitis is associated with expansion of mucosal regulatory cells. Inflamm Bowel Dis 2008;14:662-8.

13. Atarashi K, Umesaki Y, Honda . Microbiotal influence on T cell subset development.

Semin Immunol. 201 1 ;23: 146-53.

14. Coombes JL, Siddiqui KR, Arancibia-Carcamo CV, et al. A functionally specialized population of mucosal CD 103+ DCs induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid-dependent mechanism. J Exp Med 2007;204: 1757-64.

15. Sun CM, Hall JA, Blank RB, et al. Small intestine lamina propria dendritic cells promote de novo generation of Foxp3 T reg cells via retinoic acid. J Exp Med 2007;204: 1775-85.

16. Mazmanian SK, Liu CH, Tzianabos AO, et al. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 2005J22: 107-18.

17. Yamazaki S, Steinman RM. Dendritic cells as controllers of antigen-specific Foxp3+ regulatory T cells. J Dermatol Sci 2009;54:69-75. 18. Akdis M, Burgler S, Crameri R, et al. Interleukins, from 1 to 37, and interferon-gamma:

Receptors, functions, and roles in diseases. J Allergy Clin Immunol 201 1 ;127:701 -21 e70.

19. Pulendran B, Tang H, Manicassamy S. Programming dendritic cells to induce T(H)2 and tolerogenic responses. Nat Immunol 2010;11:647-55. 0. Manicassamy S, Ravindran R, Deng J, et al. Toll-like receptor 2-dependent induction of vitamin A-metabolizing enzymes in dendritic cells promotes T regulatory responses and inhibits autoimmunity. Nat Med 2009;15:401 -9. Lai Y, Di Nardo A, Nakatsuji T, et al. Commensal bacteria regulate Toll-like receptor 3- dependent inflammation after skin injury. Nat Med 2009;15: 1377-82. van der Aar AM, Sibiryak DS, Bakdash G, et al. Vitamin D3 targets epidermal and dermal dendritic cells for induction of distinct regulatory T cells. J Allergy Clin Immunol 201 1 ;127: 1532-40. Palomares O, O'Mahony L, Akdis CA. The many routes of dendritic cells to ensure immune regulation. J Allergy Clin Immunol 201 1 ;127: 1541 -2. O'Mahony L, McCarthy J, Kelly P, et al. Lactobacillus and bifidobacterium in irritable bowel syndrome: symptom responses and relationship to cytokine profiles. Gastroenterology 2005;128:541 -51. O'Mahony L, O'Callaghan L, McCarthy J, et al. Differential cytokine response from dendritic cells to commensal and pathogenic bacteria in different lymphoid compartments in humans. Am J Physiol Gastrointest Liver Physiol 2006;290:839-45. Sibartie S, O'Hara AM, Ryan J, et al. Modulation of pathogen-induced CCL20 secretion from HT-29 human intestinal epithelial cells by commensal bacteria. BMC Immunol 2009;10:54. Whorwell PJ, Altringer L, Morel J, et al. Efficacy of an encapsulated probiotic Bifidobacterium infantis 35624 in women with irritable bowel syndrome. Am J Gastroenterol 2006;101 : 1581 -90. O'Hara AM, O'Regan P, Fanning A, et al. Functional modulation of human intestinal epithelial cell responses by Bifidobacterium infantis and Lactobacillus salivarius. Immunology 2006;118:202-15. van der Kleij H, O'Mahony C, Shanahan F, et al. Protective effects of Lactobacillus reuteri and Bifidobacterium infantis in murine models for colitis do not involve the vagus nerve. Am J Physiol Regul Integr Comp Physiol 2008;295: 1 131-7. 30. McCarthy J, O'Mahony L, O'Callaghan L, et al. Double blind, placebo controlled trial of two probiotic strains in interleukin 10 knockout mice and mechanistic link with cytokine balance. Gut 2003;52:975-80. 31. Miyara M, Sakaguchi S. Human FoxP3(+)CD4(+) regulatory T cells: their knowns and unknowns. Immunol Cell Biol 201 1 ;89:346-51.

32. Hori S, Nomura T, Sakaguchi S. Control of regulatory T cell development by the

transcription factor Foxp3. Science 2003; 299: 1057-61 .

33. Duriancik DM, Lackey DE, Hoag KA. Vitamin A as a regulator of antigen presenting cells. JNutr 2010;140: 1395-9.

34. Maslowski KM, Mackay CR. Diet, gut microbiota and immune responses. Nat Immunol

201 1 ;12:5-9.

35. Fukuda S, Toh H, Hase K, et al. Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature 201 1 ;469:543-7. 36. Fukata M, Abreu MT. Pathogen recognition receptors, cancer and inflammation in the gut. Curr Opin Pharmacol 2009;9:680-7.

37. Round JL, Lee SM, Li J, et al. The Toll-like receptor 2 pathway establishes colonization by a commensal of the human microbiota. Science 201 1 ;332:974-7.

38. Round JL, Mazmanian SK. Inducible Foxp3+ regulatory T-cell development by a commensal bacterium of the intestinal microbiota. Proc Natl Acad Sci U S A 2010;107: 12204-9. 39. Wang X, O'Gorman MR, Bu HF, et al. Probiotic preparation VSL#3 alters the distribution and phenotypes of dendritic cells within the intestinal mucosa in C57BL/10J mice. JNutr 2009;139: 1595-602. 40. Goubier A, Dubois B, Gheit H, et al. Plasmacytoid dendritic cells mediate oral tolerance. Immunity 2008;29:464-75.

41. Akdis M, Akdis CA. Therapeutic manipulation of immune tolerance in allergic disease.

Nat Rev Drug Discov 2009;8:645-60.

42. O'Mahony L, Akdis M, Crameri R, et al. Novel immunotherapeutic approaches for allergy and asthma. Autoimmunity 2010;43:493-503. 43. Murphy CT et al. Journal of Leukocyte Biology Volume 88, December 2010.

44. Brenner DM, Moeller MJ, Chey WD and Schoenfeld PS. The utility of probiotics in the treatment of irritable bowel syndrome: a systematic review. Am. J. Gastroenterol. 2009 104(4): 1033-49.