INCORPORATION BY REFERENCE TO ANY PRIORITY APPLICATIONS

[0001] The present application claims priority under 35 U.S.C. § 1 19(e) to U.S. Provisional Application No. 61/822, 126, filed May 10, 2013, which is herein expressly incorporated by reference in its entirety.

STATEMENT REGARDING FEDERALLY SPONSORED R&D

[0002] This invention was made with government support under DK078938 awarded by the National Institutes of Health. The government has certain rights in the invention.

REFERENCE TO SEQUENCE LISTING

[0003] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled SEQLISTING.TXT, created May 8, 2014, which is 4Kb in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

Field of the Invention

[0004] The present application relates generally to the field of prevention and treatment of colorectal cancer.

Description of the Related Art

[0005] Colorectal cancer is the third most common malignancy in the world and inflammatory bowel diseases (IBD) increase the risk of colorectal cancer in humans. Although the etiology of chronic inflammation and cancer in the intestine is not yet elucidated, it is thought that it may be a result of a disruption of immune balance between proinflammatory and anti- inflammatory responses by inappropriate response to intestinal microbiota. Proinflammatory cytokines and chemokines produced during chronic intestinal inflammation may then initiate and promote colon tumorigenesis.

[0006] Colonization of mice with Bacteroides fragilis or oral treatment of mice with its immunomodulatory molecule polysaccharide A (PSA) has been shown to protect against the development of experimental colitis using the well-established CD4 ⁺ CD45Rb transfer model (Mazmanian et al., Nature 453: 620-625 (2008)).

SUMMARY OF THE INVENTION

[0007] B. fragilis and polysaccharide A (PSA) of B. fragilis can be used to protect a subject from the development of colitis-associated colon cancer, for example by suppressing the expression of proinflammatory cytokines, chemokines and inducible nitric oxide synthase (iNOS). In some embodiments, methods of preventing and treating colorectal tumorigenesis are provided using a probiotic approach.

[0008] In one aspect, methods are provided for preventing, delaying the onset of or reducing the progression of colorectal tumorigenesis in a subject identified as at risk of colorectal tumorigenesis, comprising adjusting the composition of gut microbiota in the subject via administering to the subject a composition comprising Bacteroides bacteria.

[0009] In some embodiments, the Bacteroides is one or more of B. fragilis, B. thetaiotaomicron, B. vulgatiis, or a mixture thereof. In some embodiments, the composition is a probiotic composition, a neutraceutical composition, a pharmaceutical composition, or a mixture thereof. In some embodiments, the composition comprises one or more zwitterionic polysaccharides (ZPS), Vitamin D, or a combination thereof. In some embodiments, the composition is administered via fecal transplantation. In some embodiments, the composition is administered via oral administration.

[0010] In some embodiments, the composition is administered intermittently, periodically, continuously, or chronically.

[0011] In some embodiments, the methods comprise measuring the expression level of a pro-inflammatory cytokine, a chemokine, and/or inducible nitric oxide synthase (iNOS) in the subject before and/or after the composition of gut microbiota is adjusted in the subject. In some embodiments, the pro-inflammatory cytokine is selected from the group consisting of TNF , IL-6, IL-17A, and IL-23. In some embodiments, the chemokine is selected from the group consisting of monocyte chemoattractant protein 1 (MCP- 1), macrophage inflammatory protein 2 (MIP-2), and chemokine ligand (KC).

[0012] In some embodiments, the methods comprise diagnosing a subject with a colorectal condition. In some embodiments, the colorectal condition is an intestinal inflammatory condition. In some embodiments, the intestinal inflammatory condition is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), and ulcerative colitis (UC). In some embodiments, the intestinal inflammatory condition is UC.

[0013] In some embodiments, the methods comprise assessing the risk of colorectal tumorigenesis of a subject. In some embodiments, assessing the risk of colorectal tumorigenesis of the subject comprises looking for a family history of colorectal cancer of the subject, identifying a genetic mutation associated with colorectal cancer in the subject, testing for dysbiosis in the subject, or a combination thereof. In some embodiments, the dysbiosis comprises an over-representation of Proteus mirabilis and/or Klebsiella Pneumonia.

[0014] In some embodiments, the tumor- free time of the subject in which the composition of gut microbiota has been adjusted is increased in comparison to a reference tumor- free time in one or more subjects in which the composition of gut microbiota has not been adjusted. In some embodiments, the total size of one or more tumors in the subject in which the composition of gut microbiota has been adjusted is decreased in comparison to a reference total tumor size in one or more subjects in which the composition of gut microbiota has not been adjusted. In some embodiments, the total number of the tumors in the subject in which the composition of gut microbiota has been adjusted is decreased in comparison to a reference total tumor number in one or more subjects in which the composition of gut microbiota has not been adjusted. In some embodiments, the total size of one or more tumors in the subject in which the composition of gut microbiota has been adjusted is unchanged or changed at a slower pace in comparison to prior to treatment. In some embodiments, the total number of the tumors in the subject in which the composition of gut microbiota has been adjusted is unchanged or decreased in comparison to prior to treatment.

[0015] Further provided herein are methods for preventing, delaying the onset of or reducing the progression of colorectal tumorigenesis in a subject at risk of colorectal tumorigenesis, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising zwitterionic polysaccharide (ZPS).

[0016] In some embodiments, the ZPS is derived from bacteria. In some embodiments, the ZPS is derived from intestinal bacteria. In some embodiments, the ZPS is derived from Bacteroides bacteria. In some embodiments, the Bacteroides bacteria is B. fragilis, B. thetaiotaomicron, or B. vulgatus. In some embodiments, the ZPS is polysaccharide A (PSA). In some embodiments, the pharmaceutical composition comprises Bacteroides bacteria, Vitamin D, or a combination thereof.

[0017] In some embodiments, the methods comprise diagnosing the subject with a colorectal condition. In some embodiments, the colorectal condition is an intestinal inflammatory condition. In some embodiments, the intestinal inflammatory condition is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), and ulcerative colitis (UC). In some embodiments, the intestinal inflammatory condition is UC.

[0018] In some embodiments, the methods comprise assessing the risk of colorectal tumorigenesis of the subject. In some embodiments, assessing the risk of colorectal tumorigenesis of the subject comprises looking for a family history of colorectal cancer of the subject, identifying a genetic mutation associated with colorectal cancer in the subject, testing for dysbiosis in the subject, or a combination thereof. In some embodiments, the dysbiosis comprises an over-representation of Proteus mirabilis and/or Klebsiella Pneumonia.

[0019] In some embodiments, the pharmaceutical composition is administered orally to the subject.

[0020] In some embodiments, the methods comprise measuring the expression level of a pro-inflammatory cytokine, a chemokine, and/or inducible nitric oxide synthase (iNOS) in the subject after the pharmaceutical composition has been administered to the subject. In some embodiments, the pro-inflammatory cytokine is selected from the group consisting of TNF , IL-6, IL-17A, and IL-23. In some embodiments, the chemokine is selected from the group consisting of monocyte chemoattractant protein 1 (MCP- 1), macrophage inflammatory protein 2 (MIP-2), and chemokine ligand (KC). [0021] In some embodiments, the tumor-free time of the subject to which the pharmaceutical composition has been administered is increased in comparison to a reference tumor-free time in subjects to which the pharmaceutical composition has not been administered. In some embodiments, the total size of one or more tumors in the subject to which the pharmaceutical composition has been administered is decreased in comparison to a reference total tumor size in one or more subjects to which the pharmaceutical composition has not been administered. In some embodiments, the total number of one or more tumors in the subject to which the pharmaceutical composition has been administered is decreased in comparison to a reference total tumor number in one or more subjects to which the pharmaceutical composition has not been administered. In some embodiments, the total size of one or more tumors in the subject to which the pharmaceutical composition has been administered is unchanged or changed at a slower pace in comparison to prior to treatment. In some embodiments, the total number of the tumors in the subject to which the pharmaceutical composition has been administered is unchanged or decreased in comparison to prior to treatment.

[0022] In another aspect, methods are provided for treating or ameliorating a colorectal cancer in a subject, comprising adjusting the composition of gut microbiota in the subject having the colorectal cancer.

[0023] In some embodiments, the methods comprise diagnosing the subject with a colorectal cancer. In some embodiments, the colorectal cancer is a colitis-associated colorectal cancer. In some embodiments, the colorectal cancer is a complication of inflammatory bowel disease (IBD).

[0024] In some embodiments, adjusting the composition of gut microbiota of the subject comprises administering to the subject a composition comprising Bacteroides bacteria. In some embodiments, the Bacteroides bacteria is B. fragilis, B. thetaiotaomicron, B. vulgatiis, or a mixture thereof. In some embodiments, the composition is a probiotic composition, a neutraceutical composition, a pharmaceutical composition, or a mixture thereof. In some embodiments, the composition comprises ZPS, Vitamin D, or a combination thereof. [0025] In some embodiments, the composition is administered via fecal transplantation. In some embodiments, the composition is administered via oral administration.

[0026] In a further aspect, methods are provided for relieving gastrointestinal (GI) distress of a subject having a colorectal condition, comprising: determining the colorectal condition of the subject; and relieving GI distress in the subject by adjusting the composition of gut microbiota in the subject.

[0027] In some embodiments, the colorectal condition is a colorectal cancer. In some embodiments, the colorectal cancer is a colitis-associated colorectal cancer. In some embodiments, the colorectal cancer is a complication of inflammatory bowel disease (IBD).

[0028] In some embodiments, the colorectal condition is an intestinal inflammatory condition. In some embodiments, the intestinal inflammatory condition is selected from the group consisting of IBD, Crohn's disease (CD), and ulcerative colitis (UC). In some embodiments, the intestinal inflammatory condition is IBD.

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 shows colonization of azoxymethane (AOM)/dextran sulfate sodium (DSS) treated mice with B. fragiUs protects from the development of colon cancer, compared to mice colonized with B. fragiUs APSA (a mutant in B. fragiUs only of the genes required to produce PSA) or control group. (A) B. fragiUs or B. fragiUs APS A was orally administered to mice and monitored for weight loss during DSS water treatment. Mice with PBS or B. fragiUs APSA colonization showed significantly increased weight loss during the third DSS treatment period compared to mice with B. fragiUs colonization. (B, C) The number of tumors and the sum of tumor size in B. fragiUs colonized mice were also significantly decreased compared to control and B. fragiUs APSA colonized groups.

[0030] Figure 2 shows the effect of B. fragiUs colonization on the expression of pro- inflammatory cytokines and signature genes during colon cancer development. (A) Comparison of TNF- level among control, mice colonized with B. fragiUs and mice colonized with B. fragiUs APSA. (B) Comparison of IL-6 level among control, mice colonized with B. fragiUs and mice colonized with B. fragiUs APSA. (C) Comparison of IL- 17A level among control, mice colonized with B. fragiUs and mice colonized with B. fragiUs APS A. (D) Comparison of MCP-1 level among control, mice colonized with B. fragiUs and mice colonized with B. fragiUs APSA. (E) Comparison of MIP-2 level among control, mice colonized with B. fragi s and mice colonized with B. fragiUs APSA. (F) Comparison of KC level among control, mice colonized with B. fragiUs and mice colonized with B. fragiUs APSA. (G) Comparison of iNOS level among control, mice colonized with B. fragiUs and mice colonized with B. fragiUs APSA.

[0031] Figure 3 shows TLR2 signaling is responsible for the protection by B. fragiUs from the development of colon cancer in mice. (A) WT mice colonized with B. fragiUs showed significantly decreased weight loss compared to WT mice treated PBS, whereas TLR2 ^7" mice showed similar degree of weight loss regardless of B. fragiUs colonization. (B) The number of tumors in distal colon was significantly decreased in WT mice colonized with B. fragiUs compared to WT mice treated with PBS, whereas TLR2 ^_/" mice developed similar number of tumors in distal colon regardless of B. fragiUs colonization. (C) More tumors were found in proximal colon of TLR2 ^7" mice with or without B. fragiUs colonization in comparison to WT.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

[0032] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the present disclosure, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein.

General Techniques

[0033] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, immunology, and pharmacology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, 2 ⁿ ed. (Sambrook et al., 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Animal Cell Culture (R. I. Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987, and periodic updates); PCR: The Polymerase Chain Reaction (Mullis et al., eds., 1994); and Remington, The Science and Practice of Pharmacy, 20 ^th ed., (Lippincott, Williams & Wilkins 2003).

Definitions

[0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this invention belongs. See, e.g. , Dictionary of Microbiology and Molecular Biology 2 ^nd ed. (Singleton et al., J. Wiley & Sons 1994). All patents, applications, published applications and other publications referred to herein are incorporated by reference in their entireties. If a definition set forth in this section is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth in this section prevails over the definition that is incorporated herein by reference.

[0035] For the purposes of the present disclosure, the following terms are defined below.

[0036] In this application, the use of the singular can include the plural unless specifically stated otherwise or unless, as will be understood by one of skill in the art in light of the present disclosure, the singular is the only functional embodiment. Thus, for example, "a" can mean more than one, and "one embodiment" can mean that the description applies to multiple embodiments. Additionally, in this application, "and/or" denotes that both the inclusive meaning of "and" and, alternatively, the exclusive meaning of "or" applies to the list. Thus, the listing should be read to include all possible combinations of the items of the list and to also include each item, exclusively, from the other items. The addition of this term is not meant to denote any particular meaning to the use of the terms "and" or "or" alone. The meaning of such terms will be evident to one of skill in the art upon reading the particular disclosure. [0037] As used herein, the term "subject" is a vertebrate, such as a mammal. The term "mammal" is defined as an individual belonging to the class Mammalia and includes, without limitation, humans, domestic and farm animals, and zoo, sports, or pet animals, such as sheep, dogs, horses, cats or cows. In preferred embodiments, the subject is human.

[0038] As used herein, the term "treatment" refers to a clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient. The aim of treatment may include, but is not limited to, one or more of the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and the remission of the disease, disorder or condition. In some embodiments, treatment may refer to a clinical intervention made to a cancer patient, particularly a patient suffering from colorectal cancer. In some embodiments, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already affected by a disease or disorder or undesired physiological condition as well as those in which the disease or disorder or undesired physiological condition is to be prevented. For example, in some embodiments treatment may prevent, delay the onset of or reduce the progression of colorectal tumorigenesis of the subject, including subjects having an intestinal inflammatory condition such as IBD. As used herein, the term "prevention" refers to any activity that avoids, delays the onset of or reduces the progression of colorectal cancer. This takes place at primary, secondary and tertiary prevention levels, wherein: a) primary prevention avoids the development of colorectal cancer; b) secondary prevention activities are aimed at early stages of the colorectal cancer treatment, thereby increasing opportunities for interventions to prevent progression of the colorectal cancer and emergence of symptoms; and c) tertiary prevention reduces the negative impact of an already established colorectal cancer by, for example, restoring function and/or reducing any colorectal cancer or related complications.

[0039] As used herein, the term "neutraceutical" refers to a food stuff (as a fortified food or a dietary supplement) that provides health benefits.

[0040] As used herein, the term "probiotic" refers to live microorganisms, which, when administered in adequate amounts, may confer a health benefit on the host. The probiotics may be available in foods and dietary supplements (for example, but not limited to capsules, tablets, and powders). Non-limiting examples of foods containing probiotics include dairy products such as yogurt, fermented and unfermented milk, smoothies, butter, cream, hummus, kombucha, salad dressing, miso, tempeh, nutrition bars, and some juices and soy beverages. In some embodiments, the probiotics may be present naturally.

[0041] The term "zwitterionic polysaccharide (ZPS)" as used herein indicates synthetic or natural polymers comprising one or more monosaccharides joined together by glicosidic bonds, and including at least one positively charged moiety and at least one negatively charged moiety. Zwitterionic polysaccharides include but are not limited to polymers of any length, from a mono- or di-saccharide polymer to polymers including hundreds or thousands of monosaccharides. In some embodiments, a zwitterionic polysaccharide can include repeating units wherein each repeating unit includes from two to ten monosaccharides, a positively charged moiety (e.g., an free positively charged amino moiety) and a negatively charged moiety (such as sulfonate, sulfate, phosphate and phosphonate). In some embodiments, the ZPS can have a molecular weight from about 500 Da to about 2,000,000 Da. In some embodiments, the ZPS can have a molecular weight from about 200 to about 2500. ZPSs can be isolated from natural sources, and in particular from bacterial sources, e.g., by purification. Exemplary ZPSs include but are not limited to PSA and PSB from ?. fragilis, CP5/CD8 from Staphylococcus aureus, and Spl/CPl from Streptococcus pneumonia. ZPSs can also be produced by chemical or biochemical methods, as well as by recombinant microorganism technologies all identifiable by a skilled person. Thus, those methods and technologies will not be further described herein in detail.

[0042] The term "polysaccharide A" (or PSA, or PSA ligand) as used herein indicates a molecule produced by the PSA locus of B. fragilis and derivatives thereof which include but are not limited to polymers of the repeating unit {→3) -d-AAT Galp(l→4)-[P- d-Galf(l→3)] -d-GalpNAc(l→3)-[4,6-pyruvate]- -d-Galp(l→} , where AATGal is acetamido-amino-2,4,6-trideoxygalactose, and the galactopyranosyl residue is modified by a pyruvate substituent spanning 0-4 and 0-6. The term "derivative" as used herein with reference to a first polysaccharide (e.g., PSA), indicates a second polysaccharide that is structurally related to the first polysaccharide and is derivable from the first polysaccharide by a modification that introduces a feature that is not present in the first polysaccharide while retaining chemical properties, biological properties, or both, of the first polysaccharide. Accordingly, a derivative polysaccharide of PSA, usually differs from the original polysaccharide by modification of the repeating units or of the saccharidic component of one or more of the repeating units that might or might not be associated with an additional function not present in the original polysaccharide. A derivative polysaccharide of PSA retains however one or more functional activities that are herein described in connection with the anti- inflammatory activity of PSA.

[0043] The term "Vitamin D" as used herein includes any one or a combination of a group of fat-soluble prohormones (D1-D5: 25 D, 1 ,25 D see below), which encourages the absorption and metabolism of calcium and phosphorous. Five forms of vitamin D have been discovered, vitamin Di, D ₂ , D ₃ , D , D5. The two forms that seem to matter to humans the most are vitamins D ₂ (ergocalciferol) and D ₃ (cholecalciferol). Vitamin D for humans is obtained from sun exposure, food and supplements. It is biologically inert and has to undergo two hydroxylation reactions to become active in the body. The term may also include 1 ,25-dihydroxycholecalciferol or 1 ,25-dihydroxyvitamin ("1 ,25-D"), which is considered the active form of vitamin D. 1 ,25 D is derived from its precursor 25- hydroxyvitamin-D(D-25) by the enzyme 1 -hydroxylase ("CYP27B 1") encoded by the CYP27B1 gene, (NG_007076.1 Homo Sapiens) CYP27B 1.

[0044] As used herein, the term "cytokine" refers to a secreted protein or active fragment or mutant thereof that modulates the activity of cells of the immune system. Examples of cytokines include, without limitation, interleukins, interferons, chemokines, tumor necrosis factors, colony-stimulating factors for immune cell precursors, and the like.

[0045] Throughout this disclosure, various aspects of this invention are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1 , 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. [0046] Other objects, advantages and features of the present invention will become apparent from the following specification taken in conjunction with the accompanying drawings.

Prevention of Colorectal Tumorigenesis

[0047] We observed that mice colonized with B. fragilis developed significantly less colorectal tumors than mice with B. fragilis APSA or control mice using an azoxymethane (AOM)/dextran sulfate sodium (DSS)-induced colon cancer model. The finding is especially remarkable because B. fragilis did not protect against DSS-induced colitis in a mouse model (data not shown). Proinflammatory cytokines and signature genes of colon homogenates were down-regulated by B. fragilis colonization during the development of colon cancer. Without being held to any particular theory, it is believed that toll-like receptor (TLR) 2 signaling is responsible to protect B. fragilis colonized mice from tumor development.

[0048] Therefore, in one aspect, the present invention provides methods for preventing, delaying the onset of or reducing the progression of colorectal tumorigenesis in a subject. In some embodiments, the methods comprise adjusting the composition of gut microbiota in the subject. In some embodiments, the subject is a human.

[0049] In some embodiments, the colorectal tumorigenesis may be associated with an intestinal inflammatory condition. In some embodiments, the colorectal tumorigenesis may be associated with colitis or IBD. Chronic inflammation is a known risk factor for tumorigenesis, and epidemiological data suggest that up to 15% of human cancer incidence is associated with inflammation (Mantovani et al., Nature 454: 436-444 (2008)); Kuper et al., J. Intern. Med. 248: 171-183 (2000)). Inflammation-induced colorectal cancer develops in patients with chronic IBD (Jawad et al, Recent Results Cancer Rec. 185: 99-1 15 (201 1)), which has been shown to be regulated by caspase-1 and NLRC4 (Hu et al., Proc. Natl. Acad. Sci. 107: 21635-21640 (2010)). Chronic formation of reactive oxygen species and chronic epithelial exposure or inflammatory stimuli, such as IL-6 and TNF-a have been implicated in the tumorigenesis (Coussens & Werb, Nature 420: 860-867 (2002); Popivanova et al., J. Clin. Invest. 1 18: 560-570 (2008); Becker et al., Immunity 21 : 491-501 (2004); Bollrath et al, Cancer Cell 15: 91-102 (2009); Grivennikov et al, Cancer Cell 15: 103-1 13 (2009)). A number of intestinal inflammatory conditions are known to one of ordinary skill in the art, including but not limited to, colitis, IBD, Chron's disease, ulcerative colitis and pancolitis. Severity of the inflammation and the longer time of the inflammation have been linked to an increased risk of colorectal cancer tumorigenesis (Xie & Itzkowitz, World J. Gastroenterol. 14: 378-89 (2008); Triantafillidis et al, Anticancer Res. 29: 2727-37 (2009)).

[0050] For the presently disclosed preventative methods, it may be desirable to select subjects that are at an increased risk of colorectal tumorigenesis. In some embodiments, known risk factors that increase the likelihood of colorectal tumorigenesis may be used to evaluate the suitability of a subject for the preventative methods disclosed herein. These risk factors include, but are not limited to, duration of colitis, extent of colitis, a family history of colorectal cancer, and, according to some studies, early disease onset and more severely active inflammation, greater extent of colonic involvement, primary sclerosing cholangitis, young age of IBD onset, backwash ileitis, history of dysplasia, etc. Raised dysplastic lesions, also known as dysplasia associated lesion or mass (DALM), or flat dysplastic lesions may significantly increase the likelihood of a subject to develop colitis- associated colorectal cancer. Additionally, a number of genetic syndromes have been known to be associated with higher rates of colorectal cancer, such as hereditary nonpolyposis colorectal cancer (HNPCC or Lynch syndrome), Gardner syndrome and familial adenomatous polyposis (FAP).

[0051] Severity of inflammation or diagnosis/staging of dysplasia or cancer in subjects may be assessed using a number of techniques, including but not limited to, histology, endoscopy, colonoscopy, chromoendoscopy, biopsy, etc. For the assessment of inflammation or diagnosis/staging of dysplasia or cancer, multiple biopsy specimens may be required. In some embodiments, at least 1 , 2, 3, 4, 5, 10, 15, 20, 25, 30 or more biopsy specimens are taken from the subject.

[0052] Another risk factor that may increase a subject's susceptibility to colorectal tumorigenesis is the composition of gut microbiota. Shifts in the intestinal microenvironment may lead to changes in the microbiota known as dysbiosis, which in turn may increase susceptibility to intestinal inflammation and colorectal tumorigenesis (Mazmanian et al, Nature 453: 620-625 (2008); Garrett et al, Cancer Cell 16: 208- 19 (2009)). Proteus mirabilis and/or Klebsiella Pneumonia were found to be over-represented in mice that spontaneously develop dysbiosis and colitis (Garrett et al., Cell Host Microbe 8: 292-300 (2010)). Other dysbiosis conditions that may contribute to colorectal cancer tumorigenesis include, but are not limited to, increased colonization of segmented filamentous bacteria (SFB), Helicobacter hepaticus, Helicobacter pylori, Actinobacteria or Ptoteobacteria, and/or decreased colonization of Firmicutes or Bacteroides bacteria. Dysbiosis conditions that may contribute to colorectal tumorigenesis may also include a genetic mutation in commensal bacteria. For example, deletion of the commensal colonization factor (ccf) gene in B. fragilis has been shown to result in colonization defects in mice (Lee et al, Nature 501 : 426-29 (2013)).

[0053] In some embodiments, a combination of risk factors, such as genetic risk factors, intestinal inflammatory conditions, and/or gut microbiota, may be combined to evaluate a subject's susceptibility to colorectal tumorigenesis. A subject identified as at an increased risk of colorectal tumorigenesis may be treated with the preventative methods disclosed herein. In some embodiments, a subject with an intestinal inflammatory condition, such as IBD, may be treated with the preventative methods disclosed herein. In some embodiments, a subject with ulcerative colitis may be treated with the preventative methods disclosed herein. In some embodiments, a subject with chronic IBD, i.e., which has had IBD for 7, 8, 9, 10, 20, 30, 40 or more years, may be treated with the preventative methods disclosed herein.

[0054] In some embodiments, known molecular biomarkers of colorectal tumorigenesis may be used to identify a subject that is at an increased risk of colorectal tumorigenesis to be treated with the preventative methods disclosed herein. A number of biomarkers are well known in the art that may contribute to colorectal tumorigenesis, including but not limited to, APC, β-catenin, TP53, TGF-β, DCC (Deleted in Colorectal Cancer), SMAD, ΑΧΓΝΙ , ΑΧΓΝ2, TCF7L2, or NKD1 , KRAS, RAF, and PI3K, PTEN, CT B1 , FAM123B, SOX9, ATM, and ARID 1 A, ACVR2A, TGFBR2, MSH3, MSH6, SLC9A9, TCF7L2, and BRAF, MYC, etc. TP53 mutation, Cox-2, aneuploidy, methylation of the hMLHl , pl6INK4a, and E-cadherin promoter, microsatellite instability (MSI), sialyl- Tn, TP53 loss of heterogeneity (LOH), DCC, c9src, k-ras, and APC have been showed to occur in colitis-associated colorectal cancer (Itzkowitz & Harpaz, Gastroenterology 126: 1634-1648 (2004)). In some embodiments, the molecular biomarkers may be used to monitor the progression (or lack thereof) of colorectal cancer in a subject under treatment.

[0055] As used herein, "preventing, delaying or reducing colorectal tumorigenesis" may include, but not limited to, delaying the onset of dysplasia or colorectal cancer, slowing the progression of colorectal cancer from an early stage to a more advanced stage, delaying or preventing the transformation of a benign tumor to a malignant tumor, delay or preventing the metastasis of the tumor, etc. Colorectal tumorigenesis may also refer to recurrence of colorectal cancer after remission induced by surgery, chemotherapy, radiation therapy, etc. In some embodiments, the presently disclosed methods may be used to prevent or delay the development of precancers, such as tubular adenoma, colorectal villous adenoma, or colonic polyp. In some embodiments, the subject treated with the methods disclosed herein is tested for the development of tubular adenoma, colorectal villous adenoma, or colonic polyp. Onset of colorectal cancer may refer to tumor budding. In some embodiments, the subject treated with the methods disclosed herein is tested for tumor budding. Staging of colorectal cancer may be made according to the TNM staging system from the WHO organization, the UICC and the AJCC. Biopsy specimens are graded pathologically as negative, indefinite for dysplasia, low-grade dysplasia, high-grade dysplasia, or invasive cancer. In some embodiments, the subject treated with the methods disclosed herein is graded pathologically for stage of colorectal cancer.

[0056] One of ordinary skill in the art should be able to appreciate that a variety of parameters may be used to characterize the preventative effect of the methods disclosed herein. For example, the preventative effect may be characterized as the tumor-free period for the treated subject, the total number of tumors in the treated subject, the total weight of tumors in the treated subject, or a combination thereof. In some embodiments, the subject treated with the methods disclosed herein is assessed for the tumor-free period, the total number of tumors, the total weight of tumors in the treated subject, or a combination thereof. In some embodiments, the tumors may be tumors of distal colon, proximal colon, or both. To characterize the preventative effect, a reference value may be established based on one or more control subjects that are not treated with the methods disclosed herein. In some embodiments, the treated subject may show an increase of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 200%, about 300%, about 400%, about 500% or more in the tumor-free period in comparison to the reference value. In some embodiments, the treated subject may show a decrease of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% or about 100%, or a range between any two of these values in the total number of tumors in comparison to the reference value. In some embodiments, the treated subject may show a decrease of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% or about 100%, or a range between any two of these values in the total weight of tumors in comparison to prior to treatment. In some embodiments, the treated subject may show a decrease of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% or about 100%, or a range between any two of these values in the total number of tumors in comparison to prior to the treatment. In some embodiments, the treated subject may show a decrease of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% or about 100%, or a range between any two of these values in the total weight of tumors in comparison to prior to the treatment.

[0057] Other than colorectal cancer, other types of cancer or cancer-like diseases such as small intestinal adenocarcinoma, Squamous cell carcinoma of the anus, cholangiocarcinoma, hepatobiliary cancers, and hematologic malignancies such as leukemia, hematopoietic cancer, lymphoma, myeloid leukemia may also be prevented, delayed, reduced or treated by the methods disclosed herein.

Adjustment of Gut Microbiota

[0058] Humans are colonized with a great abundance and diversity of microbes, which play a critical role in regulating health and disease. Dysbiosis of the commensal microbiota is implicated in the pathogenesis of several human ailments, including IBD, obesity and cardiovascular disease (Blumberg and Powrie, Sci. Transl. Med. 4: 137rv7 (2012); Clemente et al, Scand. J. Gastroenterol. 47: 943-50 (2012)). [0059] In some embodiments, colorectal tumorigenesis may be prevented, delayed, or reduced through the adjustment of the composition of gut microbiota in a subject susceptible to developing colorectal cancer. Adjustment of composition of gut microbiota refers to changing the composition of the bacteria in the gut. Adjustment of the composition of gut microbiota in the subject can be achieved by, for example, fecal transplantation (also known as fecal microbiota transplantation (FMT), fecal bacteriotherapy or stool transplant). Fecal transplantation can include a process of transplantation of fecal bacteria from a healthy donor, for example a subject without IBD, to a recipient (e.g., a subject suffering from IBD). The procedure of fecal transplantation can include single or multiple infusions (e.g., by enema) of bacterial fecal flora from the donor to the recipient. In some embodiments, methods disclosed herein consist essentially of adjusting the composition of gut microbiota in a subject susceptible to colorectal cancer. In some embodiments, methods disclosed herein consist of adjusting the composition of gut microbiota in a subject susceptible to colorectal cancer. In some embodiments, methods disclosed herein are not combined with other pharmaceutical(s), e.g., antibiotics, anti-inflammatory drug(s) or chemotherapeutics, e.g., 5-Fluorouracil, Capecitabine, oxaliplatin, Irinotecan, etc.

[0060] In some embodiments, adjusting the composition of gut microbiota in the subject includes administering the subject a composition comprising bacteria, for example, a composition comprising Bacteroides bacteria. In some embodiments, the Bacteroides bacteria comprise B. fragilis, B. thetaiotaomicron, B. vulgatus, or a mixture thereof. In some embodiments, the composition may comprise B. fragilis and B. thetaiotaomicron. In some embodiments, the composition may comprise B. fragilis and B. vulgatus. In some embodiments, the composition may comprise B. thetaiotaomicron and B. vulgatus. In some embodiments, the Bacteroides bacteria can be B. fragilis. The composition comprising bacteria, for example a composition comprising Bacteroides bacteria, can be administered to the subject via various routes. For example, the composition can be administered to the subject via oral administration, rectal administration, transdermal administration, intranasal administration or inhalation. In some embodiments, the composition is administered to the subject orally. The composition comprising bacteria, such as Bacteroides bacteria, can also be in various forms. For example, the composition can be a probiotic composition, a neutraceutical, a pharmaceutical composition, or a mixture thereof. [0061] In some embodiments, the composition is a probiotic composition. Each dosage for human and animal subjects preferably contains a predetermined quantity of the bacteria calculated in an amount sufficient to produce the desired effect. The actual dosage forms will depend on the particular bacteria employed and the effect to be achieved. The composition comprising bacteria, for example, a composition comprising Bacteroides bacteria, can be administered alone or in combination with one or more additional probiotic, neutraceutical, or therapeutic agents. Administration "in combination with" one or more further additional probiotic, neutraceutical, or therapeutic agents includes both simultaneous (at the same time) and consecutive administration in any order. Administration can be chronic or intermittent, as deemed appropriate by the supervising practitioner, particularly in view of any change in the disease state or any undesirable side effects. "Chronic" administration refers to administration of the composition in a continuous manner while "intermittent" administration refers to treatment that is done with interruption.

[0062] The composition of gut microbiota of the treated subject may be monitored before, during, or after the treatment period. A variety of monitoring techniques are known to one of ordinary skill in the art. For example, sequencing, PCR or microarray analysis may be used to identify the species and amount of bacteria present in the gut microbiota. ELISA assays using antibodies that specifically bind to bacterial antigens may also be used to identify and quantify the bacteria species in the gut microbiota. In some embodiments, administrating the composition comprising bacteria, for example, a composition comprising Bacteroides bacteria, may also be adjusted according to the results from monitoring the composition of gut microbiota. For example, if the administered bacteria composition fully restores the normal colonization state of the bacteria, further administration of the composition may be suspended in view of further monitoring results.

[0063] In some embodiments, administrating the composition comprising bacteria, for example, a composition comprising Bacteroides bacteria, may also be adjusted according to the subject's intestinal inflammatory condition. Administration of the bacteria composition may be suspended if the intestinal inflammatory condition, such as IBD, Crohn's disease, ulcerative colitis, etc., has been cured permanently or has gone into remission. The subject's intestinal inflammatory condition may be assessed using a number of techniques, including but not limited to, histology, endoscopy, colonoscopy, chromoendoscopy, biopsy, etc. In some embodiments, multiple biopsy specimens may be required. In some embodiments, at least 1 , 2, 3, 4, 5, 10, 15, 20, 25, 30 or more biopsy specimens are taken from the subject.

[0064] In the methods disclosed herein, the amount of bacteria, for example Bacteroides bacteria (e.g., B. fragilis), administered to the subject in need of treatment can be determined according to various parameters such as the age, body weight, response of the subject, condition of the subject to be treated; the type and severity of intestinal inflammatory condition, IBD, or the pathological conditions with one or more symptoms of IBD; the form of the composition in which the bacteria is included; the route of administration; and the required regimen. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. For example, the amount of bacteria can be titrated to determine the effective amount for administering to the subject in need of treatment. One of ordinary skill in the art would appreciate that the attending physician would know how to and when to terminate, interrupt or adjust administration of bacteria due to toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity).

[0065] For example, the bacteria may be administered at a dose of at least 10 ³ CFU, optionally at least 10 ⁴ CFU, optionally at least 10 ⁵ CFU, optionally at least 10 ⁶ CFU,

7 8 9 optionally at least 10 CFU, optionally at least 10 CFU, or optionally at least 10 CFU. In

3 12 some embodiments, the bacteria may be administered at a dose of 10 to 10 CFU, optionally at a dose of 10 ⁴ to 10 ^{1 1} CFU, optionally at a dose of 10 ⁵ to 10 ¹⁰ CFU, optionally at a dose of 10° to 10 ^1U CFU, or optionally at a dose of 10' to 10 ^1U CFU. In some embodiments, the bacteria may be administered at optionally at a dose of 10 ⁷ to 10 ¹⁰ CFU. In some embodiments, the bacteria may be administered at optionally at a dose of 5x l0 ⁹ to 7x l0 ¹⁰ CFU.

[0066] In some embodiments, the subject being treated may be a human. In some embodiments, the subject being treated may be a non-human mammal. A program comparable to that discussed above may be used in veterinary medicine.

[0067] Methods for assessing the susceptibility of a subject to probiotic treatment are provided herein. The methods can include: determining the level of a B. fragilis- responsive metabolite in the subject; and comparing the level of the B. fragilis -responsive metabolite in the subject to a reference level of the metabolite in subjects suffering from an intestinal inflammatory condition, wherein substantial identity between the blood level of the metabolites in the subject and the reference level indicates that the subject is susceptible to the probiotic treatment, for example B. fragilis probiotic treatment. In some embodiments, the methods include determining the level of two or more B. yragz ^' /w-responsive metabolites in the subject; and comparing the level of each of the two or more B. fragilis -responsive metabolites in the subject to the reference level of each of the two or more B. fragilis- responsive metabolites, wherein substantial identity between the blood levels of the metabolites in the subject and the reference levels indicates an increased susceptibility of the subject to the probiotic treatment.

[0068] The level of the metabolite can be the level of the metabolite in circulation of the subject. For example, the level of the metabolite is the level of the metabolite in blood or other body fluids (e.g., cerebrospinal fluid, pleural fluid, amniotic fluid, semen, or saliva) of the subject. In some embodiments, the level of the metabolite is the blood level of the metabolite in the subject. The blood level of the metabolite can be, for example, serum level or plasma level of the metabolite. In some embodiments, the level of the metabolite is the urine level of the metabolite in the subject.

B. fragilis-responsive metabolites

[0069] As used herein, the term "B. Tragz ^' /w-responsive metabolite" refers to a metabolite whose level has been determined to be altered by B. fragilis treatment. For example, the level of the metabolite may be altered in circulation of the subject after B. fragilis treatment. In some embodiments, the level of the metabolite is altered in blood, serum, plasma, body fluids (e.g., cerebrospinal fluid, pleural fluid, amniotic fluid, semen, or saliva), urine, and/or feces of the subject after B. fragilis treatment. The B. fragilis- responsive metabolite can be increased or decreased in level after B. fragilis treatment.

[0070] As disclosed herein, B. fragilis -responsive metabolite can be determined by comparing the pre -treatment level of a metabolite in a subject, for example a subject suffering from an intestinal inflammatory condition, with the level of a metabolite in the subject after B. fragilis treatment. One of ordinary skill in the art will appreciate that variability in the level of metabolites may exist between individuals, and a reference level for a B. Tragz ^' /w-responsive metabolite can be established as a value representative of the level of the metabolites in a population of subjects suffering from an intestinal inflammatory condition for the comparison.

[0071] Non-limiting examples of B. Tragz ^' /w-responsive metabolites are provided in Table 1.

Table 1. Exemplary B. Tragz ^' /w-responsive metabolites

pyruvate choline

ribitol chiro-inositol

ribose pinitol

ribulose 3-hydroxybutyrate (BHBA)

xylitol 1 ,2-propanediol

citrate 1 -linoleoylglycerophosphoethanolamine fumarate 1 -arachidonoylglycerophosphoethanolamine malate 2-arachidonoylglycerophosphoethanolamine linoleate (18:2n6) 1 -stearoylglycerophosphoinositol linolenate [alpha or gamma; (18:3n3 or 6)] 1 -linoleoylglycerophosphoinositol dihomo-linolenate (20:3n3 or n6) 1 -arachidonoylglycerophosphoinositol docosapentaenoate (n3 DP A; 22:5n3) 1-palmitoylplasmenylethanolamine docosapentaenoate (n6 DP A; 22:5n6) hypoxanthine

docosahexaenoate (DHA; 22:6n3) eicosenoate (20: ln9 or 1 1)

heptanoate (7:0) dihomo-linoleate (20:2n6)

pelargonate (9:0) mead acid (20:3n9)

laurate (12:0) adrenate (22:4n6)

myristate (14:0) 8-hydroxyoctanoate

palmitate (16:0) 3 -hydroxydecanoate

palmitoleate (16: ln7) 16-hydroxypalmitate

margarate (17:0) 13-HODE + 9-HODE

stearate (18:0) 12,13 -hydroxyoctadec-9(Z)-enoate oleate (18: ln9) 9,10-hydroxyoctadec- 12(Z)-enoic acid stearidonate (18:4n3) adipate

suberate (octanedioate) 2-hydroxyglutarate

sebacate (decanedioate) pimelate (heptanedioate)

azelate (nonanedioate)

[0072] The methods of adjusting the composition of gut microbiota disclosed herein may be combined with other medications and/or dietary supplements that have antiinflammatory effects, such as aspirin or other NSAID, 5-aminosalicylates (5-ASA), systemic steroids, topical steroids, 6-mercaptopurine or azathioprine. Folate supplement, ursodiol and other anti-oxidants, statins may also be used in combination with the methods of adjusting the composition of gut microbiota disclosed herein. In some embodiments, the methods of adjusting the composition of gut microbiota disclosed herein may be combined with Vitamin D. Vitamin D has been known to enhance the protective effect of B. fragilis and PSA against IBD (U.S. Patent Publication No. 2013/0064859, the content of which is herein expressly incorporated by reference in its entirety).

Zwitterionic Polysaccharide

[0073] PSA was shown to contribute to the anti-colitis activity of B. fragilis colonization in an experimental mouse model, as well as to the prevention of colorectal cancer tumorignensis by B. fragilis colonization in a mouse model of colitis-induced colorectal cancer. Purified PSA was also shown to suppress pro-inflammatory IL- 17 production, and prevent intestinal inflammation through induction of IL- 10 expression.

[0074] Therefore, further provided herein are methods of preventing, delaying or reducing colorectal tumorigenesis in a subject, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a zwitterionic polysaccharide (ZPS) to prevent colorectal tumorigenesis, delay the onset of colorectal tumorigenesis, or reduce the progression of colorectal tumorigenesis. In some embodiments, the pharmaceutical composition may comprise more than one ZPSs.

[0075] Bacterial ZPSs isolated from strains of B. fragilis, S. aureus, and S. pneumoniae type 1 represent an unusual group of bacterial carbohydrates. ZPSs which include both positively and negatively charged groups have unique immunological properties: molecules as small as 17 kDa elicit a potent CD4 ⁺ T cell response in vitro, and ZPS-activated T cells confer protection against experimental intraabdominal abscess formation (Kalka-Moll et al, J. Immunol. 164: 719-24 (2000); U.S. Patent Publication No. 2013/0039949, the content of which is herein expressly incorporated by reference in its entirety). B. fragilis polysaccharide A (PSA) as used herein refers to B. fragilis capsular polysaccharide A as disclosed, for example, in U.S. Patent No. 5,679,654, the content of which is herein expressly incorporated by reference in its entirety. This polysaccharide has a tetrasaccharide repeating unit containing one cationic free amine and one anionic carboxylate in each repeating unit. (Tzianabos et al., J. Biol. Chem. 267: 18230-5 (1992); U.S. Patent Nos. 5,679,654 and 5,700,787). PSA is also known as PSA1. [0076] ZPS as used herein in some embodiments refers to a naturally occurring polysaccharide having certain structural features including the presence of repeating units, each with at least one positively charged moiety and at least one negatively charged moiety. A ZPS as used herein in one embodiment refers to polysaccharides that have been modified to include the structural features including the presence of repeating units, each with at least one positively charged moiety and at least one negatively charged moiety.

[0077] In some embodiments ZPSs have a plurality of repeating units, wherein each repeating unit comprises two to ten monosaccharides and a positively charged free amino moiety and a negatively charged moiety selected from the group consisting of carboxylate, phosphate, phosphonate, sulfate, and sulfonate. Molecular weights of the ZPSs useful in the invention typically have molecular weights between 500 Da and 2,000,000 Da, although smaller and larger polysaccharides can also be used. For example, the polysaccharide can be as small as one or two saccharide units. In some embodiments a disaccharide including only one non-acetylated amino sugar and one uronic acid is sufficient to stimulate T-cell proliferation.

[0078] Polysaccharides that can be used in some embodiments include those naturally occurring polysaccharides that include the requisite charged groups. See, e.g. , U.S. Patent No. 8,206,726, the content of which is herein expressly incorporated by reference in its entirety. In addition to the naturally occurring polysaccharides, polysaccharide repeating units that consist of at least one N-acetyl sugar and at least one uronic acid (sugar with a negatively charged carboxyl group) can be modified to produce the immune response of the present invention. Molecules which may be de-N-acetylated include Salmonella typhi capsular polysaccharide (VI antigen), E. coli K5 capsular polysaccharide, S. aureus type 5 capsular polysaccharide, Group B Streptococcus type III capsular polysaccharide, and Rhizobium meliloti exopolysaccharide II. These polysaccharides and their modification have been described in U.S. Pat. No. 5,679,654, the content of which is incorporated herein in its entirety.

[0079] In some embodiments, the pharmaceutical composition comprising ZPS disclosed herein may be combined with Vitamin D.

[0080] The ZPS may be administered subcutaneously, transdermally, orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or stent), subcutaneous ly, intraadiposally, intraarticularly, or intrathecally. The ZPS may also be administered in slow release dosage forms.

[0081] In the methods disclosed herein, the amount of ZPS, for example PSA, administered to the subject as risk for colorectal tumorigenesis can be determined according to various parameters such as the age, body weight, response of the subject, condition of the subject to be treated; the type and severity of intestinal inflammatory condition, IBD, or the pathological conditions with one or more symptoms of IBD; the form of the composition in which ZPS is included; the route of administration; and the required regimen. The severity of the condition may, for example, be evaluated, in part, by standard prognostic evaluation methods. For example, the amount of ZPS can be titrated to determine the effective amount for administering to the subject in need of treatment. One of ordinary skill in the art would appreciate that the attending physician would know how to and when to terminate, interrupt or adjust administration of bacteria due to toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity).

[0082] For example, the ZPS may be administered at a dose of at least 0.01 μg, optionally at least 0.1 μg, optionally at least 1 μg, optionally at least 0.5 μg, optionally at least 1 μg, optionally at least 5 μg, optionally at least 10 μg, optionally at least 50 μg, optionally at least 100 μg, optionally at least 500 μg, or optionally at least 1 mg. In some embodiments, the ZPS may be administered at a dose of 1 μg to 1000 mg, optionally at a dose of 0.005-500 mg, optionally at a dose of 0.01 -200 mg, optionally at a dose of 0.05-100 mg, optionally at a dose of 0.1-50 mg, optionally at a dose of 1-20 mg, optionally at a dose of 0.1-5 mg, or optionally at a dose of about 1-5 mg. In some embodiments, the ZPS is administered at a dose of 1 μg to 10 mg. In some embodiments, the ZPS is administered at a dose of 25 μg to 1 mg.

[0083] In some embodiments, the subject being treated may be a human. In some embodiments, the subject being treated may be a non-human mammal. A program comparable to that discussed above may be used in veterinary medicine. [0084] Various pharmaceutical compositions and techniques for their preparation and use will be known to those of skill in the art in light of the present disclosure. For a detailed listing of suitable pharmacological compositions and associated administrative techniques one may refer to the detailed teachings herein, which may be further supplemented by texts such as Remington, The Science and Practice of Pharmacy, 20 ^th ed., (Lippincott, Williams & Wilkins 2003). Except insofar as any conventional media or agent is incompatible with the active compound, such use in the compositions is contemplated.

[0085] As used herein the language "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. A "pharmaceutically acceptable salt" is intended to mean a salt of a free acid or base of a compound represented herein that is non-toxic, biologically tolerable, or otherwise biologically suitable for administration to the subject. See, generally, Berge, et al., J. Pharm. Sci. , 1977, 66, 1-19. Preferred pharmaceutically acceptable salts are those that are pharmacologically effective and suitable for contact with the tissues of subjects without undue toxicity, irritation, or allergic response. A compound described herein may possess a sufficiently acidic group, a sufficiently basic group, both types of functional groups, or more than one of each type, and accordingly react with a number of inorganic or organic bases, and inorganic and organic acids, to form a pharmaceutically acceptable salt.

[0086] Examples of pharmaceutically acceptable salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, monohydrogen-phosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caproates, heptanoates, propiolates, oxalates, malonates, succinates, suberates, sebacates, fumarates, maleates, butyne- l ,4-dioates, hexyne- l ,6-dioates, benzoates, chlorobenzoates, methylbenzoates, dinitrobenzoates, hydroxybenzoates, methoxybenzoates, phthalates, sulfonates, methylsulfonates, propylsulfonates, besylates, xylenesulfonates, naphthalene- 1- sulfonates, naphthalene-2-sulfonates, phenylacetates, phenylpropionates, phenylbutyrates, citrates, lactates, γ-hydroxybutyrates, glycolates, tartrates, and mandelates.

[0087] As used herein, the term "therapeutically effective amount" or "effective amount" refers to an amount of a therapeutic agent that when administered alone or in combination with an additional therapeutic agent to a cell, tissue, or subject is effective to prevent, delay the onset of, or reduce the progression of colorectal tumorigenesis. A therapeutically effective dose further refers to that amount of the therapeutic agent sufficient to result in amelioration of symptoms, e.g., treatment, healing, prevention or amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions. When applied to an individual active ingredient administered alone, a therapeutically effective dose refers to that ingredient alone. When applied to a combination, a therapeutically effective dose refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously. In particular, an effective amount is an amount that inhibits or reduces colorectal tumorigenesis.

Treatment of Colorectal Cancer

[0088] In another aspect, the present invention herein provides methods for treating or ameliorating a colorectal cancer in a subject, comprising adjusting the composition of gut microbiota in the subject having the colorectal cancer. In some embodiments, methods disclosed herein consist essentially of adjusting the composition of gut microbiota in a subject having colorectal cancer. In some embodiments, methods disclosed herein consist of adjusting the composition of gut microbiota in a subject having colorectal cancer. In some embodiments, methods disclosed herein are not combined with other pharmaceutical(s), e.g., antibiotics, anti-inflammatory drug(s) or chemotherapeutics, e.g., 5-Fluorouracil, Capecitabine, oxaliplatin, Irinotecan, etc.

[0089] In some embodiments, the subject has been diagnosed with colitis- associated colorectal cancer. For example, the subject may have a history of IBD before the diagnosis of colorectal cancer. However, other types of colorectal cancer are also contemplated including, but not limited to, HNPCC, colorectal cancer associated with Gardner syndrome, colorectal cancer associated with FAP, colorectal adenocarcinoma, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, primary colorectal lymphoma, leiomyosarcoma, melanoma, squamous cell carcinoma, etc.

[0090] Subjects at various stages of colorectal cancer may be treated with the presently disclosed methods. For example, a subject may be treated with the presently disclosed methods at the precancer or tumor budding stage, at the dysplasia stage, before or after the tumor invades submucosa, before or after the tumor invades muscularis propria, before or after the tumor invades subserosa or beyond, before or after the tumor invades adjacent organs, before or after the tumor perforates the visceral peritoneum, before or after metastasis, before or after surgery, radiation therapy or chemotherapy, before or after remission, etc.

[0091] In some embodiments, adjusting the composition of gut microbiota in the subject includes administering the subject a composition comprising bacteria, for example, a composition comprising Bacteroides bacteria. In some embodiments, the Bacteroides bacteria comprise B. fragilis, B. thetaiotaomicron, B. vulgatus, or a mixture thereof. In some embodiments, the composition may comprise B. fragilis and B. thetaiotaomicron. In some embodiments, the composition may comprise B. fragilis and B. vulgatus. In some embodiments, the composition may comprise B. thetaiotaomicron and B. vulgatus. In some embodiments, the Bacteroides bacteria can be B. fragilis. The composition comprising bacteria, for example a composition comprising Bacteroides bacteria, can be administered to the subject via various routes. For example, the composition can be administered to the subject via oral administration, rectal administration, transdermal administration, intranasal administration or inhalation. In some embodiments, the composition is administered to the subject orally. The composition comprising bacteria, such as Bacteroides bacteria, can also be in various forms. For example, the composition can be a probiotic composition, a neutraceutical, a pharmaceutical composition, or a mixture thereof.

[0092] A variety of parameters may be used to characterize the therapeutic effect of the methods disclosed herein. For example, the therapeutic effect may be characterized as the slowing or stopping of tumor growth in the treated subject, the reduction in tumor number or mass in the treated subject, loss of invasiveness of tumors in the treated subject, or a combination thereof. In some embodiments, the tumors may be tumors of distal colon, proximal colon, or both. To characterize the therapeutic effect, a reference value may be established based on a control subject that is not treated with the methods disclosed herein or the treated subject prior to treatment. In some embodiments, the treated subject may show a decrease of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% or about 100%, or a range between any two of these values in the tumor growth in comparison to the reference value. In some embodiments, the treated subject may show a decrease of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% or about 100%, or a range between any two of these values in the tumor number or tumor mass in comparison to the reference value. In some embodiments, the treated subject may show a decrease of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99% or about 100%, or a range between any two of these values in the tumor invasiveness in comparison to the reference value.

[0093] Other than colorectal cancer, other types of cancer or cancer-like diseases such as small intestinal adenocarcinoma, Squamous cell carcinoma of the anus, cholangiocarcinoma, hepatobiliary cancers, and hematologic malignancies such as leukemia, hematopoietic cancer, lymphoma, myeloid leukemia may also be treated by the methods disclosed herein.

[0094] In some embodiments, the methods comprises identifying the subject in need of treatment based on the type of colorectal cancer, development history of the colorectal cancer, presence of dysbiosis, or a combination thereof. In some embodiments, the composition comprises Vitamin D, ZPS, or a combination thereof. In some embodiments, the composition is administered orally, via fecal transplantation, etc. In some embodiments, the composition may be administered one time, intermittently, chronically, or continuously.

[0095] In the methods disclosed herein, the amount of bacteria, for example Bacteroides bacteria (e.g., B. fragilis), administered to the subject in need of treatment can be determined according to various parameters such as the age, body weight, response of the subject, condition of the subject to be treated; the type and severity of the colorectal cancer; the form of the composition in which the bacteria is included; the route of administration; and the required regimen. The severity of the colorectal cancer may, for example, be evaluated, in part, by standard prognostic evaluation methods. For example, the amount of bacteria can be titrated to determine the effective amount for administering to the subject in need of treatment. One of ordinary skill in the art would appreciate that the attending physician would know how to and when to terminate, interrupt or adjust administration of bacteria due to toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity).

Relieving Gastrointestinal (GI) Distress

[0096] In a further aspect, the present invention herein provides methods for relieving gastrointestinal (GI) distress of a subject having a colorectal condition, comprising: determining the colorectal condition of the subject; and relieving GI distress in the subject by adjusting the composition of gut microbiota in the subject. In some embodiments, methods disclosed herein consist essentially of adjusting the composition of gut microbiota in a subject having a colorectal condition. In some embodiments, methods disclosed herein consist of adjusting the composition of gut microbiota in a subject having a colorectal condition. In some embodiments, methods disclosed herein are not combined with other pharmaceutical(s), e.g., antibiotics, anti-inflammatory drug(s) or chemotherapeutics, e.g., 5- Fluorouracil, Capecitabine, oxaliplatin, Irinotecan, etc.

[0097] In some embodiments, the GI distress comprises abdominal cramps, chronic diarrhea, constipation, intestinal permeability, or a combination thereof. In some embodiments, the methods can include reducing intestinal permeability in the subject.

[0098] In some embodiments, adjusting the composition of gut microbiota in the subject includes administering the subject a composition comprising bacteria, for example, a composition comprising Bacteroides bacteria. In some embodiments, the Bacteroides bacteria comprise B. fragilis, B. thetaiotaomicron, B. vulgatus, or a mixture thereof. In some embodiments, the composition may comprise B. fragilis and B. thetaiotaomicron. In some embodiments, the composition may comprise B. fragilis and B. vulgatus. In some embodiments, the composition may comprise B. thetaiotaomicron and B. vulgatus. In some embodiments, the Bacteroides bacteria can be B. fragilis. The composition comprising bacteria, for example a composition comprising Bacteroides bacteria, can be administered to the subject via various routes. For example, the composition can be administered to the subject via oral administration, rectal administration, transdermal administration, intranasal administration or inhalation. In some embodiments, the composition is administered to the subject orally. The composition comprising bacteria, such as Bacteroides bacteria, can also be in various forms. For example, the composition can be a probiotic composition, a neutraceutical, a pharmaceutical composition, or a mixture thereof.

[0099] In some embodiments, the methods comprises identifying the subject in need of treatment based on abdominal cramps, chronic diarrhea, constipation, intestinal permeability, or a combination thereof. In some embodiments, the composition comprises Vitamin D, ZPS, or a combination thereof. In some embodiments, the composition is administered orally, via fecal transplantation, etc. In some embodiments, the composition may be administered one time, intermittently, chronically, or continuously.

[0100] In the methods disclosed herein, the amount of bacteria, for example Bacteroides bacteria (e.g., B. fragilis), administered to the subject in need of treatment can be determined according to various parameters such as the age, body weight, response of the subject, condition of the subject to be treated; the type and severity of the colorectal cancer; the form of the composition in which the bacteria is included; the route of administration; and the required regimen. The severity of the colorectal cancer may, for example, be evaluated, in part, by standard prognostic evaluation methods. For example, the amount of bacteria can be titrated to determine the effective amount for administering to the subject in need of treatment. One of ordinary skill in the art would appreciate that the attending physician would know how to and when to terminate, interrupt or adjust administration of bacteria due to toxicity or organ dysfunctions. Conversely, the attending physician would also know to adjust treatment to higher levels if the clinical response were not adequate (precluding toxicity).

EXAMPLES

[0101] Some aspects of the embodiments discussed above are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the present disclosure.

Experimental Material and Methods [0102] The following experimental methods were used for Examples 1-5 described below.

Animals and AOM-Induced Colon Cancer

[0103] Azoxymethane (AOM)/dextran sulfate sodium (DSS)-induced colon cancer mouse model was used to study whether PSA can protect mice from colitis-induced colorectal tumorigenesis. A single AOM injection with three cycles of DSS administration was used to induce colon cancer that mimics colitis-driven tumor development. Mice were treated orally with B. fragi s or B. fragiUs APSA three times a week starting a week prior to AOM injection until the end of experiment. After initial AOM intraperitoneal injection, 2.5% DSS was given in the drinking water for 6 days followed by regular drinking water. Mice were subjected to a second DSS cycle with 2.5% DSS water at day 25 for 6 days and a third cycle with 1.5% DSS water at day 55 for 4-6 days. Mice were sacrificed on days 81 post AOM injection.

B. fragiUs Colonization Assay

[0104] Fecal samples are sterilely collected from mice at 1 , 2 and 3 weeks after the start of treatment with B. fragiUs or vehicle. DNA is isolated fecal samples using the QIAamp DNA Stool Mini Kit (Qiagen). 50 ng DNA is used for qPCR with B. fragilis- specific primers 5' TGATTCCGCATGGTTTCATT 3 ' (SEQ ID NO: 1) and 5' CGACCCATAGAGCCTTCATC 3 ' (SEQ ID NO: 2), and universal 16S primers 5' ACTCCTACGGGAGGCAGCAGT 3 ' (SEQ ID NO: 3) and 5' ATTACCGCGGCTGCTGGC 3 ' (SEQ ID NO: 4) according to Odamaki et al, Appl. Environ. Microbiol. 74: 6814- 17 (2008).

Example 1

Colonization with B. fragiUs protects mice from the development of colon cancer.

[0105] To examine the role of B. fragiUs colonization and PSA during the development of colorectal cancer, 8 week old mice were given B. fragiUs or B. fragiUs APSA orally and monitored for weight loss during DSS water treatment. Mice treated with PBS or B. fragiUs APSA showed significantly increased weight loss during the third cycle of DSS treatment compared to mice with B. fragilis (Figure 1 A). It indicates the protective effect of B. fragilis colonization and PSA during the development of colitis-induced colon cancer. The number of tumors and the sum of tumor size in B. fragilis colonized mice were also significantly decreased compared to control and B. fragilis APSA groups (Figures IB & 1 C). These results indicate that colonization of B. fragilis protects mice against colitis-induced colorectal tumorigenesis in a PSA dependent manner. The finding is especially remarkable because B. fragilis did not protect against DSS-induced colitis in a mouse model (data not shown).

Example 2

B. frasilis colonization inhibits the expression of pro-inflammatory cytokines and signature genes during colon cancer development.

[0106] Monocyte chemoattractant protein 1 (MCP-1), macrophage inflammatory protein 2 (MIP-2) and KC (also called chemokine ligand 1 ; CXCL1) are key chemokines that are often observed during inflammation. Expression of inducible nitric oxide synthase (iNOS) has also been observed during colon carcinogenesis. The expression level of proinflammatory cytokines, chemokines and iNOS from colon homogenates of B. fragilis or B. fragilis APSA colonized mice were examined. Colonic tissues from B. fragilis colonized mice expressed significantly lower level of TNFa, IL-6, IL-17A, MCP-1 , MIP-2, KC and iNOS compared to untreated controls and B. fragilis APSA colonized mice (Figure 2). It indicates that B. fragilis colonization and PSA regulate the expression level of proinflammatory cytokines, chemokines and iNOS during the development of colon cancer.

Example 3

TLR2 signalling is required for the protection from development of colon cancer by B.

fragilis colonization.

[0107] PSA of B. fragilis has been shown to utilize TLR2 signalling to regulate inflammatory responses (Wang et al., J. Exp. Med. 203: 2853-63 (2006)). TLR2 signalling was tested to see whether it is required for the protection of the development of colon cancer in mice colonized by B. fragilis. WT mice colonization with B. fragilis showed significantly decreased weight loss compared to mice treated PBS, whereas TLR2 ^" mice showed similar degree of weight loss regardless of B. fragilis colonization (Figure 3A). The number of tumors in distal colon was significantly decreased in WT mice colonized with B. fragilis compared to WT mice treated with PBS, whereas TLR2 ^_/~ mice developed similar number of tumors in distal colon regardless of B. fragilis colonization (Figure 3B). More tumors were found in proximal colon of TLR2 ^_/~ mice with or without B. fragilis colonization in comparison to WT (Figure 3C). These results indicate the protection from colitis-induced colon cancer by B. fragilis colonization is through the TLR2 signalling pathway.

Example 4

Prevention of colitis-induced colorectal tumorigenensis in mice by PSA.

[0108] To examine the protective effect of PSA during the development of colitis-induced colorectal cancer, 8 week old mice are given PSA or PBS orally and monitored for weight loss during DSS water treatment. Mice treated with PBS show significantly increased weight loss during the third cycle of DSS treatment compared to mice treated with PSA. The number of tumors and the sum of tumor size in PSA treated mice are also significantly decreased compared to control mice.

Example 5

Treatment of colitis-associated colorectal cancer in mice by B. fragilis colonization.

[0109] To examine the effect of B. fragilis colonization on colitis-associated colorectal cancer, AOM/DSS-induced colon cancer or genetically engineered IBD mouse models are used (see, e.g. , Tong et al., Chin. J. Cancer 30: 450-62 (201 1), the content of which is herein expressly incorporated by reference in its entirety). Mice having colorectal cancer are colonized with B. fragilis by fecal transplantation or oral administration. B. fragilis colonization of mouse is monitored during treatment period. The status of colorectal cancer, including the size of tumor, number of tumors, tumor growth, tumor remission, and progression to metastasis, etc., is recorded and compared between the treatment and control groups. Example 6

Prevention of colorectal tumorigenensis in chronic ulcerative colitis patients by colonization of B. fragiUs.

[0110] Patients diagnosed with chronic ulcerative colitis are treated with B. fragiUs to determine the preventative effect of adjusting the composition of gut microbiota on colorectal tumorigenesis. B. fragiUs is administered orally to the patients. A control group of patients is treated with a placebo. The composition of the patients' gut microbiota is monitored throughout the treatment period. Administration of B. fragi s is suspended after successful colonization of patient's colon by B. fragi s. The status of colorectal tumorigenesis, including the onset of tumor, type of tumor, size of tumor, number of tumors, and response or lack thereof to treatment regimens is recorded and compared between the treatment and control groups.

Example 7

Prevention of colorectal tumorigenesis in chronic ulcerative colitis patients by PSA.

[0111] Patients diagnosed with chronic ulcerative colitis are treated with a pharmaceutical composition of PSA to determine the preventative effect of PSA on colorectal tumorigenesis. Oral administration is used to introduce the pharmaceutical composition of PSA into the patients. A control group of patients is treated with placebo. The status of colorectal tumorigenesis, including the onset of tumor, type of tumor, size of tumor, number of tumors, and response or lack thereof to treatment regimens is recorded and compared between the treatment and control groups.

[0112] The foregoing description and examples detail certain preferred embodiments of the invention and describes the best mode contemplated by the inventors. It will be appreciated, however, that no matter how detailed the foregoing may appear in text, the invention may be practiced in many ways and the invention should be construed in accordance with the appended claims and any equivalents thereof. Although the present application has been described in detail above, it will be understood by one of ordinary skill in the art that various modifications can be made without departing from the spirit of the invention.

[0113] All references cited herein including, but not limited to, published and unpublished patent applications, patents, text books, literature references, and the like, to the extent that they are not already, are hereby incorporated by reference in their entirety. To the extent that one or more of the incorporated literature and similar materials differ from or contradict the disclosure contained in the specification, including but not limited to defined terms, term usage, described techniques, or the like, the specification is intended to supersede and/or take precedence over any such contradictory material.