PROCESSFORCELLSURFACEEXPRESSIONOFHUMANALPHAID

ADRENERGICRECEPTOR

Field of the Invention

The present invention relates to a process for the stable expression and cellular localization of human alpha ID adrenergic receptor using charcoal/dextran treated fetal bovine serum (FBS), which greatly increases the receptor binding sites for interaction with the ligand.

Background of the Invention

The ^-Adrenergic receptors ((X ₁ -ARs) are members of the seven transmembrane G protein coupled receptors (GPCRs) super family, mediating various sympathetic nervous system responses, such as smooth muscle contractions, arterial blood pressure and cell growth. Pharmacol. Rev. 45 (1993) 147-175; Eur. J. Pharmacol. 375, (1999) 261-276. The OC ₁ -ARs couple predominantly via G _q to stimulate phospholipase C-β resulting in formation of inositol 1, 4, 5-triphosphate that leads to the mobilization of calcium from intracellular stores and ultimately to muscle contraction. MoI. Pharmacol. 44 (1993) 76- 86; Proc. West. Pharmacol. Soc. 37 (1994) 163-167. Alterations in normal Ct ₁ -AR functions may contribute to the pathophysiology of diseases, such as hypertension, congestive heart failure and benign prostatic hyperplasia.

Several non-subtype selective Cc ₁ -AR antagonists, such as prazosin, tetrazosin, doxazosin and alfuzosin were originally introduced as antihypertensive agents but have been increasingly important for the treatment of lower urinary tract symptoms (LUTS)/BPH. J.Urol.154 (1995) 923-934; Pharmacol. Res.33 (1996) 145-160; J.Med.Chem. 40(1997) 1293-1315. These compounds reduce smooth muscle tone in the prostate and lower urinary tract, thereby relaxing the bladder outlet and increasing urinary flow. The major disadvantages of non selective OC ₁ -AR antagonists are their adverse side effects, such as postural hypotension, dizziness, asthenia and syncope. J. Androl. 12 (1991) 389-394. Besides relaxing smooth muscles in the prostate, nonselective Cc ₁ -AR antagonists also cause relaxation of blood vessels, which can lead to orthostatic hypotension.

Selective Ct ₁ -ARs, on the other hand, affect only the tissues around the prostate and have minimal effect on lowering blood pressure. Studies have indicated that Cc ₁ -ARs are present in the human prostate and are functionally active. Whereas Cc _1A -AR subtype is involved in contraction of smooth muscles resulting in dynamic obstruction and related voiding symptoms, Ci _1D -AR subtype is present in human detrusor region and plays a role in storage and irritative symptoms. Eur Urol. 40 Supp 4 (2001) 5-11. Since there may be an increase in vascular Ot _1B -AR subtype expression with aging, the blockade of this receptor should be avoided to minimize interference with blood pressure regulation. Treatment of LUTS/BPH with super-selective ai/Jctw -AR antagonists such as tamsulosin is being used to reduce obstruction and both voiding and storage symptoms with minimal risk of cardiovascular side effects. Prostate Cancer Prostatic Dis. 2 (1999) 110-119; Eur. Urol. 29 (1996) 145-154. Clearly, there is a great need to develop αi _A /oti _D -AR selective antagonists. To screen such compounds, recombinant cell lines over-expressing Ot _1A , Ct _1B and Ot _{1 D} -ARs are required. These cell lines should be stable for various passages for high throughput screening of large number of compounds. With this approach we may be able to synthesize a candidate with minimum adverse effects.

Three Ot ₁ -AR subtypes have been cloned and pharmacologically characterized, the Ot _1A -AR (J. Biol. Chem. 265, (1990) 8183-8189, MoI. Pharmacol. 46, (1994) 823-831), the Ct _1B -AR (Proc. Natl. Acad. Sci. U S A. 85 (1988) 7159-7163), and the α _1D -AR (J. Biol. Chem. 266 (1991) 6365-6369; MoI. Pharmacol. 40 (1991) 876-883.). These subtypes couple to a variety of second messengers and G proteins to modulate multiple signaling mechanisms in different cells. Pharmacol. Rev. 40 (1988) 87-119;Mol. Pharmacol. 44 (1993) 784-795; J. Pharmacol. Exp. Ther. 284 (1998) 576-585; J. Neurochem. 72 (1999) 2388-2396. However, the coupling efficiencies of these three subtypes vary in transfected cells. The expression level and coupling efficiency of Ci _1D -AR is quite low compared to Ct _1A -AR and α _1B -AR subtypes. MoI. Pharmacol. 50 (1996) 1376-1387. hi addition, attempts to detect Ot _1D -AR protein in vivo in different tissues have proven difficult. Arch. Pharmacol. 355 (1997) 438-446.

It is now generally accepted that G protein-coupled receptors (GPCRs) can exist as homo- or hetero-dimers or as a part of larger oligomeric complexes. Subtype specific

homo- and hetero-dimerization between Oc ₁ -AR subtypes has also been reported. Cc _1B -AR has been reported to interact with α _1A or α _1D -ARs. MoL Pharmacol. 64 (2003) 1379-1390. Further, heterodimerization of CC _1B -AR with α m-AR is associated with increased surface expression and coupling efficiency of Oc _1D -AR. [MoI. Pharmacol. 64 (2003) 1379-1390; J. Biol. Chem. 279 (2004) 15541-15549.

The OC ₁ -ARs have been thought to be expressed predominantly on the cell surface, where they are accessible to water soluble ligands. However, heterologous expression of recombinant Oc ₁ -ARs in various cell lines has shown that cellular localization of OC ₁ -ARs is more complicated. Results obtained over the last several years have shown that Oc ₁ A- and OC _1B -ARs are predominantly localized on the cell surface, whereas Ct _1D -AR is mainly intracellular. MoI. Pharmacol. 52 (1997) 52764-52770; J. Pharmacol. Exp. Ther. 290 (1999) 452-463; MoI Pharmacol. 57 (2000) 659-666; J. Pharmacol. Exp. Ther. 298 (2001) 403-410. Thus, it is less available on the cell surface for ligand interaction. The process described herein provides an approach for cell surface expression of Ct _1D receptor thereby facilitating the high throughput Ct ₁ D dual antagonists.

Summary of the Invention

In one general aspect there is provided a process for stable cell surface expression of human alpha ID adrenergic receptors. The process includes: a) PCR amplificating and cloning of one or more adrenergic receptor cDNAs; b) sub cloning the one or more cDNAs into one or more mammalian expression vectors; c) transfecting the one or more expression vectors comprising the one or more cDNAs into one or more human cell lines to create clones; d) selecting one or more stable clones with puromycin; e) culturing the one or more clones overexpressing the one or more human alpha ID adrenergic receptors by growing the cells in media comprising charcoal and dextran treated fetal bovine serum; and, f) analyzing the one or more clones for cell surface expression of the one or more human alpha ID adrenergic receptors.

Embodiments of the present invention may include one or more of the following features. For example, the one or more adrenergic receptor cDNAs may include subtypes OC _1D -ARs and N-terminal 19 amino acids deletion mutant of am- AR (δ ^1'79 Oc _1D -AR). and the one or more cDNAs subcloned may be OC _1D -AR and δ ^1'79 OC _1D -AR. The one or more mammalian expression vectors may be recombinant pIRESpuro plasmid vectors. The one or more human cell lines may include HEK 293 cells, HeLa cells, CHO cells or NIH3T3 cells.

The media may include 10% charcoal and dextran treated fetal bovine serum.

The clones may be analysed by immunofluorescence, flow cytometry, western blotting and radio ligand bind assays to detect the cell surface expression of the one or more adrenergic receptors

Detailed Description of the Figures

Figure 1 is a Western Blot analysis of ocl-AR subtypes expressed in HEK 293 cells. Membranes from the cells expressing each subtypes were solubilized with 2% DBS. The samples were run on SDS-PAGE, transferred to nitrocellulose membranes and Western blotted with anti goat polyclonal Gc _1A IgG (A) or Oc _1B IgG (B) or anti rabbit polyclonal OC _1D IgG (C, D). Signals were detected using chemiluminescence kit. Arrows indicate apparent monomers and dimers of each subtype.

Figure 2 shows the cellular localization of GC ₁ -ARs in HEK293 cells in the presence of 10% FBS. HEK293 cells were stably transfected with either pIRESpuro vector (A) or α _1A -AR (B) or CC _1B -AR (C) or Oc ₁ D-AR (D) cDNAs, and were analyzed by immunoflourescence. Staining of the cells was performed as described under "Materials and Methods."

Figure 3 shows the cellular localization of am- ARs in HEK 293 cells in the presence of 10% FBS (A, D) or 10% charcoal/dextran treated FBS (B, C, E, F). HEK-293 cells, stably transfected with either full-length α _1D -AR (A-C) or δ ^1"79 α _1D -AR (D-F) cDNAs, were analyzed by immunofluorescence. HEK-αm and HEK-δ ^1"79 am were treated with lOOμM phenylepherine for 30 min. (C, F). Staining of the cells was performed as described under "Materials and Methods."

Figure 4a is a Flow Cytometry Analysis of αl-AR subtypes expressed in HEK293 cells. Cells were stained with lμM BODIPY Prazosin in presence (+PZN) and absence (PZN-FL) of lμM cold Prazosin in blocking buffer (1% BSA, 0.1% Pluoronic F127, lμM Cold prazosin in PBS) and incubated for 30 minutes at room temperature. Cells were resuspended in 500 μl of PBS and analyzed by FACScan flow cytometer.

Figure 4b shows the effect of charcoal/dextran treated FBS on expression of full-length (panel A) and δ ^1"79 (panel B) Cc _1D -ARs. HEK-Ct _1D and HEK-δ ^1"79 cells were grown in the presence of FBS or charcoal/dextran treated FBS. Cells were treated with lμM BODIPY prazosin in 100 μl of blocking buffer and incubated for 30 minute at room temperature. Cells were resuspended in 500 μl of PBS and analyzed by FACScan flow cytometer.

Detailed Description of the Invention hi one embodiment, the present invention is directed to a process for the isolation of adrenergic receptor cDNA encoding the three subtypes Ot _1A -, Ot _1B - and Oc _1D -ARs and N- terminal 79 amino acids deletion mutant of Ot _1D -AR (δ ^1"79 Ot _1D -AR) by the polymerase chain reaction (PCR) cloning. hi another embodiment, the invention is directed to a process for generating stable cell lines for expression of Ot ₁ -AR wherein HEK 293 cells are transfected with the pIRESpuro plasmid harboring Ct ₁ -AR cDNAs (Ot _1A , Ot ₁ B and Ot _1D )- Puromycin resistant clones for each receptor cDNA were isolated and recombinant cell lines, thus generated, were termed as HEK-α _1A , HEK-α _1B , HEK-α _1D and HEK-δ ^1"79 ot _1D -AR. These cell lines were analyzed at various passages by Western blotting. Specific protein bands of Ot _1A -, Ot ₁ B-, Ct _1D - and δ ^1"79 Ct _1D -ARs were detected in the immunoblot as shown in Figure 1 of the accompanying drawing. The stability of these recombinant clones and expression of Ot ₁ - AR subtypes in recombinant cell lines was monitored by Western blotting, flow cytometry and radioligand binding assays for up to 35 passages. hi yet another embodiment, the invention provides the effect of charcoal/dextran treated FBS on the cellular localization of am -AR.

Materials and Methods

DU 145, SK-N-MC and HEK-293 cells were obtained from American Type

Culture Collection, Manassas, VA;

Dulbecco's modified Eagle's medium (DMEM), Dulbecco's phosphate buffer saline (DPBS), fetal bovine serum (FBS), and charcoal/dextran treated FBS were obtained from Hyclone, Logan, UT;

Penicillin, Streptomycin, Lipofectamine 2000 were obtained from Invitrogen

Corporation, Carlsbad, CA;

Goat polyclonal αu IgG, goat polyclonal α _1B IgG , rabbit polyclonal α _1D IgG, rabbit anti-goat polyclonal IgG, donkey anti-rabbit polyclonal IgG were obtained from Santa Cruz Biotechnology, Lie, Santacruz, CA;

Alexa-conjugated secondary antibody, BODIPY-FL labeled prazosin were obtained from Molecular Probes, Eugene, Oregon;

[ ³ H] Prazosin was obtained from Perkin Elmer LAS, Boston, MA; Chemiluminiscence assay kit was obtained from Amersham Biosciences, Lie,

Chicago, IL;

Puromycin was obtained from Calbiochem EMD Biosciences Lic.,SanDiego,CA;

Nitrocellulose membrane, electrophoresis reagents were obtained from Bio-Rad

Laboratories, Hercules, CA; pIRESpuro expression vector was obtained from BD Biosciences Clontech, Palo

Alto, CA; and pBluescript II KS vector was obtained from Stratagene, La Jolla, CA.

Cloning of Human cti-AR Subtypes

RNA isolation and PCR Total RNA was extracted from DUl 45 (for isolation of human Cc _1A - and Cc _1B -ARs) or SK-N-MC (for isolation of human Oc _1D -AR) cells using Trizol (Invitrogen). First strand cDNA was made using Superscript II reverse transcriptase (Invitrogen) with oligo dT/random primer. The full length coding region of each gene was amplified by PCR using gene specific primers.

Two overlapping PCR fragments spanning 1-714 base pairs (bp) and 712- 1401 bp were amplified by two gene specific primer pairs. The primers corresponding to bases 1- 714 were forward AGAATTCGCACCATGGTGTTTCTCTCGGGA and reverse CCGATGG ATGCGGAGCGTCACTTGC. The primers corresponding to bases 712- 1401 were forward AGCAAGTGACGCTCCGCATCCATC and reverse AAGAATTCCTAGA CTTCCTCCCCGTTCTCACT. The full length coding region was amplified by fusion PCR using these two fragments and 5' and 3' end primer pairs. The full length product was cloned in to the EcoRI site of pBluescript II KS vector (Stratagene).

Amplification of human am- AR cDNA

Two overlapping PCR fragments spanning 1-771 bp (EcoRI-BamHI) and 745- 1560 bp (BamHI-EcoRI) were amplified by two primer pairs. The primers corresponding to bases 1-771 were forward ATGGAGGGAATTCGCCACCATGAATCCCGACCTG GACAC and reverse GGAATGGATCCTCAGGGTCAGCTCCTTGGAGTTG. The primers corresponding to bases 745-1560 were forward AAGGAGCTGA CCCTGAGGATCCATTCCAAGAAC and reverse TGCGCACGGAATTCCTAAAACT GCCCGGGCG. The full length clone was constructed by three way ligation of EcoRI and Bam HI digested PCR products and EcoRI digested pBluescript II KS vector. Amplification of human am- AR cDNA

Two overlapping PCR fragments spanning 376-870 bp (Pstl-Xho I) and 850-1719 bp (XhoI-EcoRI) were amplified by two primer pairs. The primers corresponding to bases 376-870 were forward CACCTGCAGACCGTCACCAACTATTTCATC and reverse TGCCTCGAGGCTGCGCGTGGT. The primers corresponding to bases 850-1719 were forward ACCACGCGCAGCCTCGAGGCAG and reverse CTAGCTCTGGAATTCTTA AATATCGGTCTCCCGTAG. The partial cDNA clone spanning 376-1719 bp was amplified by fusion PCR using these two fragments and primers binding at positions 376 and 1719. We were not able to amplify 1-375 bp of α _1D -AR as this region is highly GC rich. The coding region from 1-384 bp (EcoRI-Pstl) was synthesized by Microsynth GmbH (Switzerland). The full length coding region was amplified by fusion PCR of 1- 384 bp and 376-1719 bp overlapping fragments using specific primers (forward

CCGACGGGAATTCGCCGCCATGACTTTCCGCGA TCTCCT and reverse CTAGCTCTGGAATTCTTAAATATCGGTCTCCCGTAG). The full length product was cloned in to the EcoRI site of pBluescript II KS vector.

δ ^1"79 Ci _1D mutant was generated by PCR using gene specific primers (forward GTGAGATATCGCCACCATGGACGTGAATGGCACGGCG and reverse

CCGGAATTCTTAAATATCGGTCTCCCGTAGGTTGC). After sequence confirmation, the full length coding regions of Ot _1A , OC _1B and Ci _1D and N-truncated coding region of Gi _1D - ARs were subcloned into pIRESpuro (BD Biosciences Clontech) expression vector.

Cell Culture and Transfections HEK-293 cells were propagated in Dulbecco's modified Eagle's Medium supplemented with 10% of either heat inactivated or charcoal/dextran treated FBS, 100 μg/ml streptomycin and 100 U/ml penicillin in a humidified atmosphere with 5% CO ₂ . Stable cell lines were obtained by transfection of expression vector pIRESpuro containing the cDNA constructs of each of the human Ci ₁ -ARs into HEK-293 cells using Lipofectamine 2000 reagent. Stable clones were selected for resistance to puromycin (3 μg/ml). Cells were harvested and membrane preparations were analyzed by western blotting and radioligand binding assays.

Western Blotting

The cell pellets were lysed with lysis buffer (5OmM Tris pH 7.8,15OmM NaCl, 1% NP-40) and membrane fractions were solubilized with 2% n-Dodecyl-β-D-maltoside (DβM). The protein samples were separated on 7.5 % SDS PAGE. The separated proteins were transferred to nitrocellulose membranes. Ci ₁ -AR specific proteins were detected using a chemiluminescence kit after incubating the membranes with goat polyclonal Ci ₁ A IgG or am IgG at 1 :500 dilution or rabbit polyclonal Ci _1D IgG at 1 : 1000 dilution followed by incubation with secondary rabbit anti goat polyclonal IgG at 1 :5000 dilution or donkey anti rabbit polyclonal IgG at 1 : 2000 dilution.

Radioligand Binding Assays

Transfected cells from culture flasks were detached into 5 ml of DPBS pH 7.4 containing 5mM EDTA. Cells were pelleted down by centrifugation at 2000 rpm for 5

minutes and re-suspended in 4 ml of homogenizing buffer (5mM Tris-HCl, 5mm EDTA pH 7.4) supplemented with protease inhibitors and homogenized for 30 sec with a polytron homogenizer PT 1300D (Kinematica AG, Switzerland) at 14000 to 20000 rpm. The homogenate was centrifuged at 30000 rpm for 30 min at 4°C. The membrane pellet was re-suspended in 500 μl assay buffer (50 mM Tris-HCl, ImM MgCl ₂ pH 7.4). The membranes were rehomogenized for 30 sec with polytron homogenizer at 14000 to 20000 rpm. The protein estimation of homogenized membrane was done using a protein assay kit from Bio-Rad. Radioligand binding assays were conducted in 250 μl of assay buffer using 96 well plates. The assay wells contained 5-10 μg of membrane protein and varying concentration (0.5nM to 5nM) of [ ³ H] Prazosin ligand and were incubated for 2 h at 22-25°C.

Incubations were terminated by harvesting the plate with ice-cold Tris -HCl buffer pH 7.4 using 96 well Skatron harvester on a filter mat (the filter mat was presoaked in 0.1% polyethylene amine for 2 h and dried before using). The filter mat was dried and the bound radioactivity was determined by scintillation counting using Wallac Liquid

Scintillation Counter. All the assays were conducted in triplicate. The data was analyzed by nonlinear one site binding hyperbola curve using GraphPad Prism software.

Immunocytochemistry

Stable HEK-293 cell lines expressing Ot ₁ -AR were grown in four well Lab-Tek chamber slides for 24 h at 37°C. The cells were fixed with 2% paraformaldehyde/0.1% Triton X-100 for 20 min at room temperature. The cells were blocked in 10% FBS for 20 min at room temperature. The cells were incubated with 1 : 100 dilution of appropriate primary antibody followed by incubation with 1 :500 diluted Alexa- conjugated secondary antibody. To study the effect of phenylephrine on the cellular localization of Ci _1D -AR, cells were incubated with 100 μM phenylephrine for 30 min. at 37°C. Cells were analyzed under a fluorescent microscope TE 2000-E (Nikon Instech CO. LTD., Japan).

Flow Cytometry

Stable HEK-293 cells expressing Oc ₁ -AR were detached in o 5 ml of DPBS pH 7.4 containing 5mM EDTA. Cells were pelleted down by centrifugation at 2000 rpm for 5 minutes and washed twice in DPBS pH 7.4. Cells were incubated for 30 min at room

temperature in 100 μl of blocking buffer containing BODIPY-FL labeled prazosin ( 1% BSA, 0.1% Pluoronic F127, lμM BODIPY prazosin in DPBS). Cells were washed and resuspended in 500 μl of DPBS. Cells were acquired and analyzed by cell quest program of FACS CALIBUR Flow cytometer (BD Biosciences, San Jose, CA). Results

The cDNA encoding three subtypes of Oc _1A -, OC _1B - and Oc _1D -ARs and N-terminal 79 amino acids deletion mutant of am- AR (δ ^1"79 CC _1D -AR) were isolated by PCR cloning. High GC-content at the 5 'end of the Oc ₁ D-AR gene causes the amplification of this gene to be quite cumbersome. Thus, the first 375 base pairs of Cc _1D -AR cDNA were chemically synthesized, wherein 24 G or C nucleotides were changed to A or T nucleotide to reduce the G + C contents. This change in the nucleotide sequence did not alter the amino acid sequence or the frequency score of these codon triplets in mammalian cells. These three cloned receptor cDNAs were confirmed by restriction mapping and DNA sequencing, and were sub cloned into pIRESpuro mammalian expression vector. The Puromycin resistant clones for each receptor cDNA were isolated and recombinant cell lines thus generated were termed as HEK-Cc ₁ A, HEK-OC ₁ B, HEK-CC ₁ D and HEK-δ ^1'79 αm-AR and the expression of each receptor was analyzed at various passages by Western blot analysis. Specific protein bands of Ci ₁ A-, OC ₁ B-, OC ₁ D and δ ^1"79 CC ₁ D-ARs were detected in the immunoblot as shown in Fig. 1. The three Ci _1- AR subtypes were observed as monomeric and /or dimeric forms. HEK-Oc _1A exhibited specific bands of monomer at 55 kDa and dimer at 110 kDa (Fig. IA). For HEK- OC _1B , a band of 65 kDa, corresponding to monomeric form was detected (Fig. IB). HEK-Oc _1D showed protein bands of 70 kDa and 140 kDa corresponding to monomeric and dimeric forms (Fig. 1C). HEK-δ ^1"79 am showed a protein band of 65 kDa corresponding to the monomeric form only (Fig. ID). All the three subtypes showed expected band sizes with the subtype specific antibodies without any cross reactivity. In control HEK293 cells, no signal was detected.

The pharmacological properties of the three subtypes were studied by radioligand- binding assay using [ H] Prazosin as non-selective ligand for αi-AR. Non-specific binding was estimated using lOμM terazosin. The binding site densities (B _max ) for αi _A - AR in the recombinant cell line was 2030 fmol/mg of protein with a K _& value of 0.28nM,

for Ot _1B was 2007 fmol/mg of protein with a K _& value of 0.14nM and for am was 1003 fmol/mg of protein with a K _& value of OJnM at passage 5 as revealed by radioligand binding assay using [ ³ H] Prazosin as ligand as shown in Table 1.

Table 1

Maximum binding site density (B _mcVζ ) and equilibrium density constant (Ka) values of specific [ ³ HJ Prazosin binding to HEK-293 cell membranes expressing cci-ARs.

Saturation analysis of specific binding was used to determine Bmax and Kd values for [ ³ H] Prazosin. Each value represents mean ± S.E.M. of at least three experiments performed in triplicate. * These values were obtained after growing recombinant cell lines in presence of charcoal/ dextr an treated FBS.

The heterologous expression of GPCRs in mammalian cell lines is generally unstable, as with the subsequent cell division and passaging, expression of these proteins tends to go down. In order to check the stability of our recombinant clones, expression of αi-AR subtypes in recombinant cell lines was monitored by Western blotting and radioligand binding assay for up to 35 passages. Western blot analysis revealed that there was no change in the expression level of αu and OC _1B -ARs even at passage 35. The binding site density for Oc _1A and CC _1B -ARs in recombinant cell line at passage 35 was 3933 and 3400 miol/mg of protein, respectively, as revealed by radioligand binding assay suggesting that recombinant cell lines expressing Cc _1A and Oc _1B -AR are highly stable. Unlike the other two subtypes, expression of am- AR was found to be very unstable. Radioligand binding assay revealed that there was a decrease in the binding site density in

the recombinant cell line expressing full-length am- AR with B _max of 110 fmol/mg of protein at passage 15.

The stable cell line for N-terminal deletion mutant of Cc _1D -AR was generated. The expression level of this deletion derivative of Ot _1D -AR was found to be slightly lower at passage 5 (900 fmol/mg of protein) as compared to the full-length receptor (1003 fmol/mg of protein) [Table 1], it was found to be relatively more stable with subsequent passages {B _max of 500 fmol/mg for δ ^1"79 am as compared to 110 fmol/mg for full length a^-AR at passage 15).

The <x _\A - and α^-AR were found to be predominantly localized at the cell membrane in recombinant HEK 293 cells, as shown in the accompanying drawing (Fig. 2B and 2C), by immunocytochemical analysis at passage 15 using commercially available antibodies. On the other hand, expression of am- AR was predominantly intracellular as shown in the accompanying drawing (Fig. 2D) by punctate staining, suggesting that this receptor protein does not get properly folded and has problems in translocation to the cell

1 VQ membrane. Analysis of HEK-δ ^" am by immunocytochemical analysis revealed that N- terminus deleted am- AR was primarily localized on the cell membrane, though some intracellular expression was also observed, as shown in the accompanying drawing (Fig. 3D).

The expression of the three subtypes was detected by Fluorescence-activated flow cytometry (FACS) at passage 15. BODIPY-FL prazosin was used as a specific fluorescent ligand for αl-AR, although the Kd value of BODIPY-FL prazosin is approximately 100 times higher than that of the original unlabelled prazosin. FEBS Lett. 386,(1996) 141- 148; Life Sciences 70,(2002), 2113-2124. All the recombinant cell lines expressing αl- AR subtype were positively stained by BODIPY-FL prazosin as shown in the accompanying drawing (Fig. 4a). The fluorescent intensity of 60% cell population showed a significant shift in HEK-α^ as compared to wild type HEK 293 cells as shown in the accompanying drawing (Fig. 4a, panel A). In case of recombinant cell lines HEK- αm and HEK-αm, 60% and 40% cell population showed a significant shift in fluorescence intensity respectively as shown in the accompanying drawing (Fig. 4a, panel B and C), whereas in HEK-δ ^1"79 am, 60% cell population exhibited significant shift in fluorescence

intensity as compared to wild type HEK 293 cells as shown in the accompanying drawing (Fig. 4a, panel D). The fluorescent intensity of the cells expressing N-terminal deleted OC _1D -AR was found to be slightly higher than that of the cells expressing full-length CC _1D - AR. This may be due to the better stability of N-terminal deleted ccm-AR at higher passages as compared to the full-length receptor. These data also suggest that the truncated Oc _1D -AR is more exposed to the cell surface compared to full-length Oc _1D -AR. hi order to improve the localization and expression of CC _1D -AR, HEK-OC _1D -AR recombinant cell line was cultured under different conditions. The HEK 293 cells expressing OC _1D -AR were grown in the presence of 10% charcoal/dextran treated FBS instead of 10% FBS and immunocytochemical analysis was performed. After culturing cells in the presence of 10% charcoal/dextran treated FBS, there was dramatic change in the localization of CC _1D -AR in HEK 293 cells. As shown in the accompanying drawing (Fig. 3B), most of the OC _1D -AR protein was localized on the cell membrane in case of full- length OC _1D -AR. Binding site density of am- AR at passage 35 was found to be 355 miol/mg of protein as shown in Table 1. HEK-Oc _{1 D} cells cultured in the presence of charcoal/dextran treated FBS when analyzed by FACS showed an increase in the fluorescent intensity (around 60% shift) as compared to the cells cultured in the presence of FBS (40% shift) as shown in the accompanying drawing [Fig. 4b, panel A].

Similarly, in the case of HEK-δ ^1"79 CC _1D there was marked improvement in the cellular localization of N-terminal deleted Cc _1D -AR after culturing cells in the presence of 10% charcoal/dextran treated FBS as compared to FBS. Most of the N-terminal deleted CC _1D -AR was localized on the cell membrane, which is shown in the accompanying drawing (Fig. 3E). hi order to see the reversal of the effect of charcoal/dextran treated FBS, HEK-OC _1D and HEK-δ ^1"79 am cells grown in the presence of charcoal/dextran treated FBS were incubated with αi-AR selective agonist phenylepherine. Agonist activation promoted a significant degree of αio and δ ^1"79 αio -AR internalization, as most of the fluorescence was detected in cytosol as shown in the accompanying drawing (Fig 3 C and F).

While the present invention has been described in terms of its specific embodiments, certain modifications and equivalents will be apparent to those skilled in the art and are included within the scope of the present invention.