Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
PROCESS FOR CLEANING FILTERS
Document Type and Number:
WIPO Patent Application WO/2003/095078
Kind Code:
A1
Abstract:
Filters used in the beverage industry fouled by polyphenol-protein complexes and carbohydrate polymers can be cleaned by treating the filters either with the following methods: -Solubilisation of at least part of the carbohydrate polymers followed by a treatment of the resulting polyphenol protein complex with an oxidative chemical. -Treatment of the fouled filters through a back-wash method using an oxidative chemical. In both cases it is not necessary to rinse the membranes after cleaning with a reductive chemical.

Inventors:
Jetten, Jan Matthijs (Costerlaan 3 B, JL Zeist, NL-3701, NL)
Slaghek, Theodoor Maximiliaan (Schansweg 35, HT Rotterdam, NL-3042, NL)
Application Number:
PCT/NL2003/000461
Publication Date:
November 20, 2003
Filing Date:
June 23, 2003
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
Nederlandse, Organisatie Voor (Toegepast-Natuurwetenschappelijk Onderzoek TNO, Schoemakerstraat 97, VK Delft, NL-2628, NL)
Jetten, Jan Matthijs (Costerlaan 3 B, JL Zeist, NL-3701, NL)
Slaghek, Theodoor Maximiliaan (Schansweg 35, HT Rotterdam, NL-3042, NL)
International Classes:
B01D41/04; B01D65/02; B01D65/06; C12H1/06; C12H1/07; (IPC1-7): B01D65/06; B01D65/02; C12H1/06; B01D41/04
Domestic Patent References:
WO1997045523A11997-12-04
Foreign References:
DE19503060A11996-08-08
US4740308A1988-04-26
EP0733594A11996-09-25
Other References:
PATENT ABSTRACTS OF JAPAN vol. 017, no. 055 (C - 1023) 3 February 1993 (1993-02-03)
TRAGARDH G: "MEMBRANE CLEANING", DESALINATION, ELSEVIER SCIENTIFIC PUBLISHING CO, AMSTERDAM, NL, vol. 71, no. 3, 1 March 1989 (1989-03-01), pages 325 - 335, XP000087751, ISSN: 0011-9164
Attorney, Agent or Firm:
Van Westenbrugge, Andries Et al (Nederlandsch Octrooibureau, Scheveningseweg 82 P.O. Box 29720, LS The Hague, NL-2502, NL)
Download PDF:
Claims:
WHAT IS CLAIMED IS:
1. Isolated or enriched polynucleotide operably encoding eps8 substrate of the epidermal growth factor receptor.
2. The polynucleotide of Claim 1, encoding human eps8.
3. The polynucleotide of Claim 2, which includes a sequence encoding the amino acid sequence of SEQ ID NO:2.
4. The polynucleotide of Claim 1, which includes the DNA sequence SEQ ID NO:l.
5. The polynucleotide of Claim 1, which includes an mRNA transcript of SEQ ID NO:l.
6. The polynucleotide of Claim 1, which includes the proteinencoding domain of SEQ ID NO:3.
7. An antisense mRNA sequence to the polynucleotide of Claim 1, having at least about 15 nucleotides.
8. Isolated eps8.
9. Human eps8 according to Claim 8.
10. The Eps8 of Claim 8, including the amino acid sequence of SEQ ID NO:2.
11. The Eps8 of Claim 8, having the amino acid sequence of SEQ ID NO:4.
12. The Eps8 of Claim 8, in a concentration of at least 1 μg/ml.
13. Isolated antibody to eps8. ~~.
14. Monoclonal antibody to eps8.
15. A method for enhancing mitogenic response of cells to epidermal growth factor, comprising the step of administering to said cells an effective mitogenicresponse enhancing amount of eps8.
16. A method for determining tyrosine kinase activity in a biological sample, comprising the steps of combining eps8 with said sample, and measuring tyrosine phosphorylation of said eps8 by tyrosine kinase in said sample.
17. A method for determining eps8 in a sample, comprising the steps of: contacting the sample with antibody to eps8, such that an immunological complex forms between eps8 and the antibody; and detecting the formation of the immunological complex.
Description:
A SUBSTRATE FOR THE EPIDERMAL GROWTH FACTOR RECEPTOR KINASE

Background of the Invention The present invention relates to substrates for the epidermal growth factor receptor kinase, polynucleotide encoding those substrates, and methods for using the substrates. The cellular machinery involved in mitogenesis is complex, and not fully understood.

In general, receptors present on the cell surface bind growth factors, resulting in an activated receptor. In particular, the receptors of interest are endowed with intrinsic tyrosine kinase activity, and are known as tyrosine kinase receptors or TKRs. The activated receptors, in turn, phosphorylate intracellular substrates. These phosphorylated substrates are responsible for a series of events that leads to cell division. This process is generally referred to as

"mitogenic signal transduction." The molecular machinery involved in this process is considered to be the "mitogenic signaling pathway."

Growth factors and hormones exert pleiotropic effects on cellular functions, including mitogenic stimulation and modulation of differentiation and metabolism (Ullrich, et al. Cell 61:203-212 (1990); Aaronson, S.A. Science 254:1146-1153 (1991)). In many cases, these actions are mediated by the interaction of growth factors with cell surface tyrosine kinase receptors (TKRs), which results in enhanced receptor catalytic activity and tyrosine phosphorylation of intracellular substrates (Ullrich, et al., supra, Aaronson, supra). Knowledge of the nature of these second messenger systems is still scanty, although some molecules which associate and/or are tyrosine phosphorylated by TKRs have been identified. These include the γ isozyme of phospholipase C (PLC-γ) (Margolis, et al. Cell 57:1101-1107 (1989), Meisenhelder, et al. Cell 57:1109-1122 (1989) and Wahl, et al. Mol. Cell. Biol. 9:2934-2943 (1989)); the p21ras GTPase activating protein (GAP) (Molloy, et al. Nature 342:711-714 (1989), Kaplan, et al. Cell 61:125-133 (1990), and Kazlauskas, et al. Science 247:1578-1581 (1990)); the raf serine-threonine kinase (Morrison, et al. Proc. Natl. Acad. Sci. USA 85:8855-8859 (1988), and Morrison, et al. Cell 58:649-657 (1989)); the p85 subunit of the phosphatidylinositol 3-kinase (Ptdlns-3K); (Coughlin, et al. Science 243:1191-1194 (1989), Kazlauskas, et al. Cell 58:1121-1133 (1989)„Varticovski, et al. Nature 342:699-702 (1989), Ruderman, et al. Proc. Natl. Acad. Sci. USA 87:1411-1415 (1990), Escobedo, et al. Cell 65:75-82 (1991), Skolnik, et al. Cell 65:83-90 (1991), Otsu, et al. Cell

65:91-104 (1991)) and some cytoplasmic tyrosine kinases (Gould, et al. Mol. Cell. Biol. 8:3345-3356 (1988); Kypta, et al. Cell 62:481-492 (1990)). These signaling molecules are thought to mediate at least in part the mitogenic effects of TKRs (Ullrich, et al. supra; Aaronson, supra).

However. the Epidermal growth factor (EGF) receptor (EGFR) does not appear efficiently interact with known second messenger systems (Fazioli, et al. Mol. Cell. Bi

11:2040-2048 (1991); Segatto, et al. Mol. Cell. Biol. 11:3191-3202 (1991)). Thus, there is need to ascertain the mechanism by which the EGFR functions in mitogenesis, and particular need to identify and characterize the substrate (if any) of the EGFR.

Errors which occur in the mitogenic signaling pathway, such as alterations in one more elements of that pathway, are implicated in malignant transformation and cancer. is believed that in at least some malignancies, interference with such abnormal mitogen signal transduction could cause the cells to revert to normal phenotype. In addition, reagents useful in identifying molecular components of the mitogen signaling pathway find utility as tumor markers for therapeutic, diagnostic, and prognost purposes. Furthermore, identification of how such components differ from norm components in malignant tissue would be of significant value in understanding and treati such malignancies. Alterations of the EGFR mitogenic signal transduction have be described in several human tumors. Accordingly, substrates of EGFR are of particul interest.

Finally, there is a need for reagents for determining the tyrosine kinase activity particular samples of biological origin. —

It is therefore an object of the present invention to provide reagents and metho useful in identifying components of the mitogenic signal transduction pathway, f determining tyrosine kinase activity of samples, and for determining how particul components of the pathway in abnormal tissue differ from normal components. particular, it is an object of the invention to provide such reagents and methods that rela to the substrate of the EGFR. Summary of the Invention

A method is disclosed which allows direct cloning of intracellular substrates f tyrosine kinase receptors (TKRs). By applying this technique to the study of the epiderm growth factor receptor (EGFR) signaling pathway, a cDNA which predicts an approximate 92 kDa protein designated eps8, bearing the characteristic signatures of TKR substrat including SH2 and SH3 domains, has been isolated. EpsS also contains a putative nucle targeting sequence. Antibodies specific to the eps8 gene product recognize two proteins 97 kDa and 68 kDa which are closely related as demonstrated by V8 proteolytic mappin The product of the eps8 gene associates with and is phosphorylated on tyrosine by t EGFR. Several other TKRs are also able to phosphorylate p97eps8 on tyrosine residu

Thus, the eps8 gene product represents a novel substrate for TKRs. Adoptive expression of the eps8 cDNA in fibroblastic or hematopoietic target cells expressing the EGFR resulted in increased mitogenic response to EGF implicating the eps8 gene product in the transduction of mitogenic signals. Thus, one aspect of the present invention is isolated or enriched polynucleotide operably encoding an eps8 substrate of the epidermal growth factor receptor, preferably mammalian eps8, and more preferably human eps8. This human sequence can include polynucleotide encoding the amino acid sequence of SEQ ID NO:2, and can include the DNA sequence SEQ ID NO:l. Alternatively, the polynucleotide sequence can be an mRNA transcript of SEQ ID NO:l. Also included within the scope of the invention is a polynucleotide sequence which includes the protein-encoding domain of SEQ ID NO:3. Moreover, the invention includes an antisense mRNA sequence to the eps8 gene, preferably including at least 15 nucleotides.

The invention further comprises isolated eps8, preferably mammalian eps8, and more preferably human eps8. The human eps8 advantageously includes the amino acid sequence of SEQ ID NO:2. The invention further includes mouse eps8, having the amino acid sequence of SEQ ID NO:4. The concentration of the isolated or purified eps8 is preferably at least lμg/ml.

Another aspect of the invention is isolated antibody to eps8, including both monoclonal and polyclonal antibody.

Further, the invention includes a method for enhancing mitogenic response of cells to epidermal growth factor, comprising the step of administering to the cells an effective mitogenic-response enhancing amount of eps8.

Another aspect of the present invention is a method for determining tyrosine kinase activity in a biological sample, comprising the steps of combining eps8 with the sample, and measuring tyrosine phosphorylation of the eps8 by tyrosine kinase in the sample.

Finally, the invention includes a method for determining eps8 in a sample, comprising the steps of contacting the sample with antibody to eps8, such that an immunological complex forms between eps8 and the antibody, and detecting the formation of the immunological complex.

Detailed Description of the Invention A. Overview

In the case of the Epidermal growth factor (EGF) receptor (EGFR) expressed in murine fibroblasts, two lines of evidence indicate that this receptor is not very efficient at

coupling with known second messenger systems. There is a low stoichiometry of tyrosi phosphorylation (- 1% of the total pools), of PLC-γ, and GAP weak induction of PI breakdown, and no phosphorylation/activation of raf or activation of Ptdlns-3K by EGF even when overexpressed at levels of approximately 2 x 10 6 receptors/cell (Fazioli, et Mol. Cell Biol. 11:2040-2048 (1991)). In addition, a mitogenesis-incompetent mutant of t

EGFR (EGFR Δ660-667 Segatto, et al,Mol. Cell Biol. 11:3191-3202(1991)) did not show a decreased ability to phosphorylate PLC-γ or GAP, or to induce PIP2 breakdown compared to the wild type EGFR (Segatto, et al., supra). This strongly indicates t existence of alternative effector pathways for mitogenic signal transduction by EGFR. Characterization of EGFR-activated pathways requires the identification of nov proteins that are tyrosine phosphorylated following stimulation of this receptor kinase. Th present invention utilized a novel approach to the cloning of cDNAs coding for EGF substrates, as disclosed in Fazioli, et al. /. Biol. Chem. 267:5155-5157 (1992). The approac relies on batch purification of the entire set of proteins that are phosphorylated on tyrosi following EGFR activation and generation of antisera directed against the entire pool purified proteins. These sera can be used to immunologically characterize various substrat or for expression screening of cDNA libraries.

The present invention includes the discovery of a novel EGFR substrate isolated this approach, which is called eps8, together with complete cDNA and predicted protei sequences for the murine eps8 (SEQ ID NOS:3 and 4; respectively) and partial cDNA an predicted protein sequences for the human eps8 (SEQ ID NOS:l and 2, respectively). T protein sequences are referred to as "predicted" sequences simply because they we determined from the nucleotide sequence, rather than from analysis of purified natur protein. In addition, the present invention provides methodology for isolating the comple human cDNA and protein sequences, as well as those of other species; antibodies whi recognize the protein encoded by the cDNA; expression vectors for producing eps8 prokaryotic or eucaryotic cells; cell lines overexpressing eps8; and assays using t antibodies, cDNA sequences, and proteins. The eps8 proteins, polynucleotide sequences, constructs, vectors, clones, and oth materials comprising the present invention can advantageously be in enriched or isolat form. As used herein, "enriched" means that the concentration of the material is at lea about 2, 5, 10, 100, or 1000 times its natural concentration (for example), advantageous

0.01%, by weight, preferably at least about 0.1% by weight. Enriched preparations of about 0.5%, 1%, 5%, 10%, and 20% by weight are also contemplated.

The term "isolated" requires that the material be removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide present in a living animal is not isolated, but the same polynucleotide, separated from some or all of the coexisting materials in the natural system, is isolated.

It is also advantageous that the protein or the sequences be in purified form. The term "purified" does not require absolute purity; rather, it is intended as a relative definition, with reference to the purity of the material in its natural state. Purification of natural material to at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is expressly contemplated.

B. Identification of Murine cDNA Encoding eps8

Antibodies to phosphotyrosine were used to isolate proteins that are tyrosine-phosphorylated upon EGF stimulation of NIH-3T3 murine fibroblasts overexpressing the EGFR (NIH-EGFR cells), as discussed in Example 1. A strategy was developed that allowed direct cloning of the cDNAs encoding several of these proteins. Briefly, two polyclonal sera were generated using the entire purified pool of phosphotyrosine (pTyr)-containing proteins as an immunogen (Fazioli, et al. /. Biol. Chem., supra). These antibodies were used to screen cDNA clones, as reported in greater detail in Examples 1 and 2.

A novel cDNA isolated by this method was sequenced as described in Example 3, and the encoded protein was designated eps8. The amino acid sequence (SEQ ID NO:4) predicts a protein bearing the characteristic hallmarks of TKR substrates. Antibodies generated to the cDNA protein product in accordance with Example 4 recognized a 97 kDa protein and a less abundant 68 kDa protein which were phosphorylated on tyrosine residues following treatment of intact cells with EGF.

C. Features and Properties of eps8 Protein

The amino acid sequence deduced from the single eps8 ORF (SEQ ID NO:4) predicted an 821 amino acid protein with a calculated molecular weight of 91738 daltons.

One relevant feature of the predicted sequence of the eps8 gene product is the presence of unique SH2 and SH3 signatures. The SH2 domain was first identified as a non- catalytic motif of sequence homology between cytoplasmic tyrosine kinases, and was subsequently recognized in other proteins, including molecules involved in mitogenic

signaling such as PLC-γ and GAP (Koch, et al. Science 252:668-674 (1991)). The SH2 domain is thought to mediate the binding of substrates to receptors by recognizing tyrosine- phosphorylated motifs (Anderson, et al. Science 250:979-981 (1990), Matsuda, et al. Science 248:1537-1539 (1990), Mayer, et al. Proc. Natl. Acad. Sci. USA 87:2638-2642 (1990), Moran, et al. Proc. Natl. Acad Sci. USA 87:8622-8626 (1990), Margolis, et al. EMBOJ. 9:4375-4380

(1991)). Variations in the number position and primary sequence of the SH2 domains also suggest that they may serve different recognition functions. Indeed, there is evidence that known kinase substrates such as GAP, p85, and PLC-γ interact with different regions of the platelet-derived growth factor receptor and do not compete for their respective binding sites (Morrison, et al. Mol. Cell. Biol. 10:2359-2366 (1990), Escobedo, et al. Mol. Cell. Biol.

11:1125-1132 (1991)). In this regard, it is of note that the SH2 domain of the eps8 gene product, although readily recognizable, displayed significant variations in the primary sequence when compared to other analogous domains. The eps8 SH2 domain is also unique in its relative position within the molecule, being located at the very amino-terminus. The SH2 domain of the eps8 gene product extended between position 2 and 120 of the predicted protein sequence and displayed the highest level of identity with the analogous domains of c-src and v-crk. In the conserved regions of the SH2 consensus (defined according to Koch, et al. supra), eps8 displayed 40% and 32% identity with c-src and v-crk respectively, whereas the latter two proteins showed 45% identity between themselves. Notably, eps8 lacked the initial WY/F motif (which is well conserved among SH2 domains), but retained the 3 conserved basic residues that are thought to be involved in SH2/phosphotyrosine interactions (Koch, et al. supra).

The product of the eps8 gene also contained an SH3 domain. Understanding of the function of SH3 regions is preliminary. The sequence is contained in several of the proteins bearing an SH2 domain (Koch, et al. supra) but is also observed in a number of other species. These include cytoskeletal proteins (Jung, et al. Proc. Natl. Acad Sci. USA 84:6720-6724 (1987), Wasenius, et al./. Cell Biol. 108:79-93 (1989), and Drubin, et al. Nature 343:288-290 (1990)); putative transcription factors like HS-1 (Kitamura, et al. Nucl. Acids Res. 17:9367-9379 (1989)); yeast proteins involved in control of proliferation (Broek, et al. Cell 48:789-799

(1987), and Hughes, et al. Nature 344:355-357 (1990)) and cell fusion (Trueheart. et al. Mol. Cell. Biol. 7:2316-2328 (1987)); and the neutrophil oxidase factor 67-kD (Leto, et al. Science 248:727-730 (1990)). In addition, mutations in the SH3 domain of v-src attenuated its

ability to depolymerize actin filaments (reviewed in Koch, et al. supra). Thus, this domain may direct protein-protein interactions in the cytoskeleton.

The eps8 gene product did not display sequence features that would readily identify an enzymatic activity. In this regard it may be classified with proteins like v-crk or nek which are also apparently devoid of intrinsic activity (Koch, et al. supra). These proteins have been proposed to serve as molecular adapters, juxtaposing by virtue of their SH2 domains a TKR to other effector molecules (reviewed in Koch, et al. supra). A similar function could be reasonably postulated for the eps8 gene product. However, at variance with v-crk and nek, the eps8 gene product presents two long stretches of sequence of about 400 and 250 amino acids with no detectable homology to other proteins. Thus, it may also contain determinants responsible for some intrinsic, yet-to-be-discovered function. A physiological role of eps8 is suggested by the observation that it contains a putative nuclear targeting sequence.

In addition, coimmunoprecipitation experiments demonstrated physical association between the eps8 gene products(s) and the EGFR. Thus, the eps8 protein represents an authentic substrate for the EGFR kinase.

No other region of extensive sequence homology with proteins present in databanks was demonstrable. Notably, a stretch rich in basic amino acids extending from position 299 to 309 contained a putative nuclear targeting sequence RKKSK (Gomez-Marquez, et al. FEBS Lett. 226:217-219 (1988)). Structural analysis of the predicted eps8 product revealed a high turn propensity due to the elevated proline content of the protein (7.9%). An hydropathy plot revealed a rather hydrophilic profile consistent with the relatively high content in charged amino acids (25.5%) and no long hydrophobic stretches that could encode a transmembrane domain or a signal peptide. D. Obtaining Partial and Complete Human cDNA for eps8

The present invention includes partial and complete human cDNA sequences and human genomic DNA sequences for eps8. A partial cDNA sequence for human eps8 is set forth as SEQ ID NO:l, and the corresponding predicted peptide sequence is set forth as SEQ ID NO:2. The partial sequence of SEQ ID NO:l was obtained by PCR amplification from a human cDNA library using short sequences of the mouse eps8 cDNA (SEQ ID

NO:3) as primers. This procedure is explained in more detail in Example 5.

The partial human cDNA sequence of SEQ ID NO: l can be used as a probe to identify a cDNA clone corresponding to a full-length transcript. The full length sequence can then be routinely determined by sequencing of that clone. The partial or full-length

cDNA clone can also be used as a probe to identify a genomic clone or clones that conta the complete gene including regulatory and promoter regions, exons, and introns. Finall an expression product of the partial sequence can be used for expression screening of cDNA library, using the techniques set forth in Example 4 to generate polyclonal antibo against human eps8, and then screening clones to identify candidates as set forth in Examp

2, followed by sequencing as set forth in Example 3.

One general procedure for obtaining a complete DNA sequence corresponding the partial human sequence disclosed herein is as follows:

1. Label a partial sequence and use it as a probe to screen a lambda pha human cDNA library or a plasmid cDNA library.

4. Identify colonies containing clones related to the probe cDNA and puri them by known purification methods.

5. Nucleotide sequence the ends of the newly purified clones to identify f length sequences. 6. Perform complete sequencing of full length clones by Exonuclease I digestion or primer walking. Northern blots of the mRNA from various tissues using least part of the clone as a probe can optionally be performed to check the size of t mRNA against that of the purported full length cDNA.

More particularly, all or part of the DNA sequence of SEQ ID NO:l may be us as a probe to identify a cDNA clone containing the full length cDNA sequence. The parti sequence of SEQ ID NO:l, or portions thereof, can be nick-translated or end-labelled wi 32 P using polynucleotide kinase and labelling methods known to those with skill in the a (Basic Methods in Molecular Biology, L.G. Davis, M.D. Dibner, and J.F. Battey, e Elsevier Press, NY 1986). A lambda library can be directly screened with the labelled cDN probe, or the library can be converted en masse to pBluescript (Stratagene, La Joll

California) to facilitate bacterial colony screening. Both methods are well know in the a

Briefly, filters with bacterial colonies containing the library in pBluescript or bacteri lawns containing lambda plaques are denatured and the DNA is fixed to the filters. T filters are hybridized with the labelled probe using hybridization conditions described Davis, et al. The partial sequence, cloned into lambda or pBluescript, can be used as positive control to assess background binding and to adjust the hybridization and washi stringencies necessary for accurate clone identification. The resulting autoradiograms a compared to duplicate plates of colonies or plaques: each exposed spot corresponds to

positive colony or plaque. The colonies or plaques are selected, expanded, and the DNA is isolated from the colonies for further analysis and sequencing.

Positive cDNA clones in phage lambda may be analyzed to determine the amount of additional sequence they contain using PCR with one primer from the partial sequence (SEQ ID NO:l) and the other primer from the vector. Clones with a larger vector-insert

PCR product than the original clone are analyzed by restriction digestion and DNA sequencing to determine whether they contain an insert of the same size or similar as the mRNA size on a Northern blot.

Once one or more overlapping cDNA clones are identified, the complete sequence of the clones can be determined. The preferred method is to use exonuclease III digestion

(McCombie, W.R., Kirkness, E., Fleming, J.T., Kerlavage, A.R. Iovannisci, D.M., and Martin-Gallardom R., Methods: 3:33-40, (1991)). A series of deletion clones is generated, each of which is sequenced. The resulting overlapping sequences are assembled into a single contiguous sequence of high redundancy (usually three to five overlapping sequences at each nucleotide position), resulting in a highly accurate final sequence.

A similar screening and clone selection approach can be applied to obtaining cosmid or lambda clones from a genomic DNA library that contains the complete gene from which the partial sequence was derived (Kirkness, E.F., Kusiak, J. W., Menninger, J., Gocayne, J.D., Ward, D.C., and Venter, J.C. Genomics 10:985-995 (1991)). Although the process is much more laborious, these genomic clones can also be sequenced in their entirety. A shotgun approach is preferred to sequencing clones with inserts longer than 10 kb (genomic cosmid and lambda clones). In shotgun sequencing, the clone is randomly broken into many small pieces, each of which is partially sequenced. The sequence fragments are then aligned to produce the final contiguous sequence with high redundancy. An intermediate approach is to sequence just the promoter region and the intron-exon boundaries and to estimate the size of the introns by restriction endonuclease digestion. E. Expression of eps8 Gene

With the sequence of the eps8 gene in hand, it is routine to express that gene in a recombinant organism to obtain significant amounts of eps8. One example of a suitable expression vector and host is set forth in Example 4. Alternatively, the DNA encoding eps8 can be inserted into other conventional host organisms and expressed. The organism can be a bacterium, yeast, cell line, or multicellular plant or animal. The literature is replete with examples of suitable host organisms and expression techniques. For example, naked polynucleotide (DNA or mRNA) can be injected directly into muscle tissue of mammals,

where it is expressed. This methodology can be used to deliver the polynucleotide and, therefore, the resulting polypeptide translation product to the animal, or to generate an immune response against a foreign polypeptide (Wolff, et al. Science 247:1465 ( 1990); Feigner, et al. Nature 349:351(1991)). Alternatively, the coding sequence, together with appropriate regulatory regions (i.e., a construct), can be inserted into a vector, which is then used to transfect a cell. The cell (which may or may not be part of a larger organism) then expresses the polypeptide.

F. In vivo Transcription of eps8

In order to assess the expression of mRNA encoded by the eps8 gene, we performed Northern blot analysis of poly(A)+ RNA extracted from NIH-3T3 cells using the pi 8 insert as a probe. Two major bands of ~ 3.8 and ~ 4.7 kb were detected. The size of the smaller band is in agreement with that of the longest eps8 cDNA clone. The nature of the 4.7 kb band is not resolved. It is unlikely that the band represents a related species since hybridization was performed under conditions of high stringency. Thus, it most likely represents a partially processed precursor or an alternatively spliced form.

G. Assays for Detecting eps8

Antibodies generated against the polypeptide corresponding to a sequence of the present invention can be obtained by direct injection of the naked polynucleotide into an animal (Wolff, supra) or by administering the polypeptide to an animal, as explained in Example 4. The antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of eps8 can be used to generate antibodies binding the whole native polypeptide.

Antibodies generated in accordance with Example 4 can be used in standard immunoassay formats to detect the presence and/or amount of eps8 in a sample. Such assays can comprise competitive or noncompetitive assays. Radioimmunoassays, ELISAs,

Western Blot assays, immunohistochemical assays, immunochromatographic assays, and other conventional assays are expressly contemplated. Furthermore, polyclonal antibodies against human or other eps8 can be readily generated using the techniques of Example 4, and monoclonal antibodies to any form of eps8 can be generated using well-known methods. All of these antibodies can be used in assays of the present invention, and the assays and the antibodies form a part of this invention. H. Detection of TKR Activity

In many instances, it is important to know the tyrosine kinase activity of a sample. The present invention provides a ready method by which such activity can be determined.

As discussed in more detail herein, eps8 is tyrosine phosphorylated by the EGFR as well as by other tyrosine kinase receptors. This ability of TKRs to phosphorylate eps8 is exploited to measure the presence of TKRs in a sample.

Briefly, one method for such measurement is to contact a sample with eps8, add radiolabeled γ-ATP to the sample and then measure the extent to which the radiolabel is incorporated into the eps8. An -eps8 antibodies may be used in the final step of the assay to capture eps8 for measurement of phosphorylation. Such assays are disclosed in more detail in Examples 9 and 10.

Alternatively, the ability of TKRs to bind eps8 can be utilized to measure the presence of TKRs in a sample. Labeled eps8 (e.g., radiolabeled, enzyme labeled, colorimetrically labeled) can be added to a sample where it binds EGFR or other TKR in the sample. The biological sample to be analyzed should be obtained, for this purpose, in the presence of low concentration of non-ionic detergents, such as 1% NP-40 or 1% Triton- X-100, to allow formation of the eps8-TKR complex and prevent its dissociation. These conditions are advantageous for two reasons: first, most, if not all, of the TKRs (and other tyrosine kinases of non-receptorial type) can be completely solubilized from biological materials under these conditions. Second, the eps8/EGFR complex is stable under these conditions. The resulting complex is then isolated and measured, using conventional chromatographic or immunological techniques. For example, the ep^8/TKR complex can be recovered with an anύ-eps8 antibody, and the presence of TKRs (or other tyrosine kinases) can be detected with specific antibodies against individual TKRs or with an anti- phosphotyrosine antibody. Several kind of assays can be used for this purpose, including, but not exclusively, immunoblot, ELISA, and radioimmunoassays. I. Detection of Altered Mitogenic Signal Transduction The eps8 of the present invention is also valuable in detection of altered mitogenic signal transduction. Such altered signal transduction can be ascertained by measurement of eps8 levels in vivo or in vitro using the immunoassays discussed above. Alternatively, altered forms of eps8 can be detected by using at least a portion of the DNA encoding eps8 as a probe to isolate the DNA encoding a possibly altered form oϊ eps8. Techniques of the type disclosed in Examples 2 and 3, or other conventional techniques, can then be used to sequence the isolated DNA. By comparing this sequence to the known sequence, alterations can be detected.

If an altered eps8 sequence or abnormal labels of eps8 are detected in malignan tissue, antisense therapy can be utilized in accordance with Example 11 to halt translatio of the protein and, thus, to interfere with mitogenesis. J. Increasing the Mitogenic Response of Cells The mitogenic response of cells can be enhanced by delivering eps8 to the cell i amounts greater than the natural amounts. Although the optimum dosage for any particula cell type can be empirically determined in a relatively straightforward manner, it is apparen that any increased dosage will have a mitogenesis-enhancing effect.

Particular aspects of the invention may be more readily understood by reference t the following examples, which are intended to exemplify the invention, without limiting it scope to the particular exemplified embodiments.

EXAMPLE 1 Generation of Polyclonal Antibody Against EGFR Substrates Immunoaffinity chromatography techniques were used to isolate proteins which wer tyrosine phosphorylated by EGFR, as described by Fazioli, et al. /. Biol. Chem. 267:5155

5161 (1992). Briefly, genetically engineered NIH-3T3 cells which overexpress EGFR (NIH EGFR) (Fazioli, et al. Mol. Cell Biol. 11:2040-2048 (1991)) were maintained in DME (Gibco, Gaithersburg, MD) supplemented with 10% calf serum (Gibco, supra). Subconfluen cell monolayers were treated with EGF (Upstate Biotechnology, Inc. (UBI), Lake Placi NY), and lysed. EGFR was removed from the lysate using an anti-EGFR column prepare by linking anti-EGFR monoclonal antibody (Abl, Oncogene Science, Uniondale, NY) t agarose beads. The lysate was then contacted with an anti-phosphotyrosine (anti-pTy Oncogene Science, supra) column; the column was washed; and the bound protein was the eluted. Fractions were collected and were used to immunize two New Zealand whit rabbits, yielding two polyclonal immune sera, designated 450 and 451.

EXAMPLE 2

Identification of eps8 cDNA Clone

A pool of sera 450 and 451 from Example 1 was used to screen a commerci

(Clontech, Palo Alto, CA) λgtll library from NIH-3T3 cells. Recombinant plaques (10 6 were initially screened with a 1:200 dilution of each antibody in TTBS (0.05% Tween 20 m

Tris-HCl [pH 7.5] 150 mM NaCl) containing 1% BSA. Detection was carried out with goat anti-rabbit Ab conjugated to alkaline phosphates by utilizing a commercial k

(Picoblue, Stratagene, La Jolla, CA) according to the manufacturer's specification. Analysi yielded several positive plaques; one of these clones (pi 8) contained an insert of - 1.6 kb

which was completely sequenced and showed no corresponding to sequences present in the Genbank or EMBL data banks. The pi 8 insert was subcloned in the EcoRI site of pBluescript (Stratagene, supra).

The sequence of pi 8 predicted an ORF which started in the expected frame with the β-galactosidase portion of λgtll and terminated at position 1081-1083 with a stop codon.

The pi 8 cDNA, however, displayed no initiation codon. It was concluded that pi 8 represented a partial cDNA encoding a novel protein, now designated eps8 (for EGFR- pathway substrate # 8).

EXAMPLE 3 Isolation and Sequencing of eps8 cDNA

Full length cDNA for eps8 was obtained by screening a mouse keratinocyte cDNA library (Miki, et al. Science 251:72-75 (1991)) using the pi 8 insert from Example 2 as a probe according to standard procedures (Sambrook, et al. Molecular Biology: A Laboratory Manual (Cold Spring Harbor Laboratory press 1989)). Several recombinant phages were isolated, the longest containing an insert of - 3.6 kbp. DNA sequence was performed on this sequence by the dideoxy-termination method on both strands of the cDNA, using a commercial kit (Sequenase, United States Biochemical, Cleveland, OH). The resulting DNA sequence is identified herein as SEQ ID NO:3. The sequence contains a stop codon at position 2708-2710 followed by a 3' untranslated sequence containing a canonical polyadenylation site (AATAAA) starting at position 3035. Three putative ATG initiation codons were identified at positions 246-248, 258-260, and 336-338, respectively. Only the first ATG conformed to Kozak's rules for translational initiation (Kozak, M. /. Cell Biol. 108:229-241 (1989)) and was preceded by an in-frame stop codon at position 222-224; thus it is believed to represent the translation initiation codon. EXAMPLE 4

Preparation of Anti-eps8 Antibody and Expression of eps8 gene Product Polyclonal antibodies specific for the eps8 gene product were generated against a recombinant glutathione S-transferase fusion protein. To this end the open reading frame (ORF) of pi 8 (between positions 246 and 2708 of SEQ ID NO:3) was modified by adding an inframe Bam HI restriction site to its 5' end using recombinant PCR (Higuchi, R. PCR

Protocols: A Guide to Methods and Applications, eds. Innis M. A. Gelfand D.H., Sninsky J.J. & White T.J. (Academic press San Diego, CA) pp 177-183 (1990)). The BaHI I- EcoR I fragment containing the entire ORF (pi 8) was cloned between the homologous sites of the pGEX expression plasmid (Pharmacia, Piscataway, NJ). The recombinant fusion protein

was expressed following the manufacturer's specifications and used to immunize Ne Zealand rabbits. In addition, an aτιti-eps8 specific peptide serum was generated against th synthetic peptide Y(EDSNGSSELQEIMRRRQEK) corresponding to amino acid position 784-803 of SEQ ID NO:4, the predicted eps8 protein. The peptide was conjugated to macromolecular carrier (key limpet hemocyanin) and used to immunize New Zealan rabbits. A commercially available anti-phosphotyrosine (anti-pTyr) monoclonal antibod (Upstate Biotechnology, Lake Placid, NY) was also used. Specificity of detection for anti pTyr was controlled as described previously (Fazioli, et al. Mol. Cell Biol, supra and Faziol et al. /. Biol. Chem., supra.) This antibody specifically recognized a major species of Mr 97 kDa (p97eps8) an a minor component of 68 kDa (p68eps8) in NIH-EGFR cells. The size of the majo component was consistent with the predicted molecular weights of the eps8 gene produc Both p97eps8 and p68eps8 underwent a mobility shift upon in vivo EGF treatmen suggesting EGF-induced post-translation modification, possibly tyrosine phosphorylation. Indeed, sequential immunoprecipitation and immunoblotting with anti-pTyr and anύ-eps antibodies indicated that p91eps8 is phosphorylated in vivo on tyrosine following EGF activation.

Anti-pTyr recovery of the eps8 product might be due-to direct recognition o phosphotyrosil residues or to association with other pTyr-containing proteins. To distinguis between these possibilities immunoprecipitation experiments with anti-eps8 were performe followed by immunoblot with anti-pTyr. It was found that p91eps8 was readily detectabl under these conditions in cell lysates obtained from NIH-EGFR cells triggered with EG Under these conditions, p68eps8 exhibited detectable pTyr content as well. In additio EGF-induced tyrosine phosphorylation of both eps8 proteins was detected by phosphoamin acid analysis of 32 P-labeled p91eps8 and p68ep.s8.

Anti-pTyr immunoblotting also revealed a 170 kDa protein which was specificall immunoprecipitated by the a ~ ιti-eps8 antibody following EGF treatment of intact cells. It size was consistent with the possibility that it represented the EGFR co-immunoprecipitate with one of the eps8 products. To test this possibility, cell lysates obtained under mil condition to preserve protein-protein interactions were immunoprecipitated with the anti eps8 serum and immunoblotted with a specific anti-EGFR serum. Under these condition the EGFR was readily detectable following EGF treatment of intact cells, indicating physic association between the receptor and the eps8 gene product(s).

To further investigate the nature of p97eps8 and p68eps8. we performed limited V8- protease digestions by the Cleveland method (Cleveland, et al. /. Biol. Chem. 252:1102-1106 (1977)). A number of common proteolytic fragments were detectable in p97eps8 and p68ep_ϊ8, indicating that the two proteins are highly related. EXAMPLE 5

Derivation of Partial Human eps8 Sequences The partial human eps8 sequence of SEQ ID NO:l was obtained by the polymerase chain reaction (PCR) method using two oligonucleotides from the mouse eps8 cDNA sequence as primers to amplify the human cDNA fragment from a human cDNA library. The library used was from A101D cells (human melanoma cells, Giard, et al. / Natl. Cancer

Institute 51:1417-1423 (1973)), although other readily-available libraries could be used. The library was prepared using the method of Miki, et al, Science 251:72-75 (1991). The two oligonucleotide PCR primers were: 1) 5' CGAGCTCGAGAGATCAGCTGACACTCCTTCT 2) 5' CGATATCGATTCTCTTGTAACTCGGAGCTTC corresponding to positions 2088-2107 and 2608-2628 of the mouse eps8 cDNA sequence (SEQ ID NO:3), respectively. A typical PCR contained 100 ng of cDNA library DNA, 5 units of Taq DNA polymerase (Boehringer Mannheim, Indianapolis, IN), 1 μM of each oligonucleotide primer, 200 μM dNTPs, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl 2 , 50 mM KC1, 0.1 mg/ml gelatin. Reactions were carried out for 35 cycles of 1.5 min at 94° C, 5 min at 50° C, and 2 min at 72° C. Reactions were then terminated with an additional 10 min at 72° C. The PCR products were purified by chroma spin + TE -400 column (Clontech, Palo Alto, CA), subcloned into pBluescript II KS vector (Stratagene, La Jolla, CA), and sequenced by the dideoxy-termination methods on both strands using the Sequenase DNA sequencing kit (USB, Cleveland, OH).

EXAMPLE 6 Derivation of Complete Human eps8 Sequences Using the partial sequence of SEQ ID NO:l as a probe, a cDNA library generated from A101D cells (or other human library) is screened using the techniques described in Example 3. Several recombinant phages are isolated, and are compared to the known mouse sequence, SEQ ID NO:3. DNA sequencing is performed on the most promising cDNA by the dideoxy-termination method, as explained in Example 3.

EXAMPLE 7 Isolation of eps8 Sequences from other Organisms

Two potentially complementary strategies are used to isolate and clone the eps8 gene in other species. The first one is essentially the same as the one used to obtain the human partial cDNA for eps8. Briefly, two oligonucleotides from the mouse or the human eps8 sequence can be used to amplify, by the PCR method, fragments of eps8 cDNA from other species. The oligonucleotides can be designed from regions of high nucleotide identity between the human and mouse sequence, in a way to increase the probability of obtaining an efficient matching of the primers with the eps8 sequences of other species. The template for the PCR reaction can be a cDNA library from cells of another species or a cDNA obtained by reverse transcriptase (in the so called reverse transcriptase/PCR) directly from the mRNA of another species. A second approach relies on classical low stringency hybridization of nucleic acids. In this case a probe representing the eps8 cDNA from human or mouse is hybridized, under relaxed conditions of stringency, against libraries (cDNA or genomic) prepared from cells of other species. Relaxed stringency is obtained by modifying the temperature and the ionic strength of the hybridization buffer, in a manner designed to allow stable formation of hybrids which are not 100% matching (as expected in inter-species hybridization). The positives are then analyzed as described above (see Example 6). A complete review on low stringency hybridization is to be found in Kraus, et al. Methods in Enzymolog 200:546-556 (1991).

EXAMPLE 8 Quantitative Immunoassay for eps8

It is often desirable to determine the quantity of eps8 in a sample. This can be particularly useful in clinical research, as well as in detecting abnormalities in mitogenic signal transduction in malignant tissue. In addition, in many human tumors, tumor markers are released in the blood stream at levels which correlate with the size of the tumor and its clinical stage. Determination of the levels of a marker (such as eps8) in biological fluids can be advantageous in aiding the diagnostic procedures and in monitoring the effectiveness of therapy.

In one exemplary technique, an -eps8 antibody from Example 4 is immobilized to an agarose column, as explained in Example 1. Sample is then directed through the column where eps8 in the sample is bound by the immobilized antibody. Next, a known quantity of radiolabeled anti-ep^8 antibody is directed through the column. The quantity of labeled antibody which is not retained on the column is measured, and bears an relationship to the quantity of eps8 in the sample.

Another exemplar)' technique is liquid phase radioimmunoassay. First, a standard measurement is made. Specifically, a small, known amount of purified eps8, radiolabeled in a conventional manner, is challenged against a known amount of anύ-eps8 antibody. The resulting immunocomplex is recovered by centrifugation, and the radioactivity of the centrifugate is determined. This value is used as a standard against which later measurements are compared.

Next, a sample, containing unknown amounts of eps8, is challenged against the same known amount (used in making the standard measurement) of anti-eps8 antibody. Then, the same amount of labeled eps8 used in making the standard measurement is added to the reaction mixture, followed by centrifugation and measurement of radioactivity as explained above. The decrease in the immunoprecipitated radioactivity (in comparison to the standard) is proportional to the amount of eps8 in the sample.

Of course, in addition to the foregoing exemplary methods, any of the well known conventional immunoassay methods may similarly be used. EXAMPLE 9

Assay for Phosphorylation of eps8 by TKRs A biological sample is assayed for TKR activity by combining the sample with known quantities of eps8 and 32 P-labeled γ-ATP. The sample is then contacted with an -eps8 from Example 4 immobilized on a column; the column is washed; and the bound eps8 is eluted with 0.1M glycine, pH 2.5. The eluant is then subjected to fractionation to separate the resulting radiolabeled eps8 from the free radioactivity in the sample using any conventional technique, such as precipitation in 5-10% trichloroacetic acid. Following fractionation, the amount of radioactivity incorporated into the eps8 is counted to measure TKR activity of the sample. EXAMPLE 10

Alternative Assay for TKR Activity lOOng of eps8 is added to 1 ml buffered cell lysate suspected of having tyrosine kinase activity, together with 30μC 32 P-γATP. Following incubation, the mixture is heated to 100° C in a solution containing sodium lauryl sulfate (SDS) and β-mercaptoethanol. Aliquots are electrophoresed on 10-15% gradient SDS polyacrylamide gels and exposed to

X-Omat X-ray film to identify radioactive eps8. Cell lysate from e wδ-transfected cells incubated in the presence of radiolabeled amino acids is used to confirm the location on the gel of the phosphorylated eps8.

EXAMPLE 11

Preparation and Use of Antisense Oligonucleotides

Antisense RNA molecules are known to be useful for regulating translation within the cell. Antisense RNA molecules can be produced from the sequences of the present invention. These antisense molecules can be used as diagnostic probes to determine whether or not a particular gene is expressed in a cell. Similarly, the antisense molecules can be used as a therapeutic agent to regulate gene expression.

The antisense molecules are obtained from a nucleotide sequence by reversing the orientation of the coding region with regard to the promoter. Thus, the antisense RNA is complementary to the corresponding mRNA. For a review of antisense design see Green et al., Ann. Rev Biochem. 55:569-597 (1986). The antisense sequences can contain modified sugar phosphate backbones to increase stability and make them less sensitive to RNase activity. Examples of the modifications are described by Rossi et al., Phannocol. Ther. 50(2):245-254, (1991).

Antisense molecules are introduced into cells that express the eps8 gene. In a preferred application of this invention, the effectiveness of antisense inhibition on translation can be monitored using techniques that include but are not limited to antibody- mediated tests such as RIAs and ELISA, functional assays, or radiolabeling. The antisense molecule is introduced into the cells by diffusion or by transfectioirprocedures known in the art. The molecules are introduced onto cell samples at a number of different concentrations, preferably between lxlO "10 M to lxlO^M. Once the minimum concentration that can adequately control translation is identified, the optimized dose is translated into a dosage suitable for use in vivo. For example, an inhibiting concentration in culture of lxlO "7 M translates into a dose of approximately 0.6 mg/kg bodyweight. Levels of oligonucleotide approaching 100 mg/kg bodyweight or higher may be possible after testing the toxicity of the oligonucleotide in laboratory animals.

The antisense can be introduced into the body as a bare or naked oligonucleotide, oligonucleotide encapsulated in lipid, oligonucleotide sequence encapsidated by viral protein, or as oligonucleotide contained in an expression vector such as those described in Example 3. The antisense oligonucleotide is preferably introduced into the vertebrate by injection. Alternatively, cells from the vertebrate are removed, treated with the antisense oligonucleotide, and reintroduced into the vertebrate. It is further contemplated that the antisense oligonucleotide sequence is incorporated into a ribozyme sequence to enable the antisense to bind and cleave its target. For technical applications of ribozyme and antisense oligonucleotides, see Rossi, et al. supra.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: The Government of the United States, as represented by the Secretary of Health and Human Services

(ii) TITLE OF INVENTION: Substrate of the Epidermal Growth Factor Kinase

(iii) NUMBER OF SEQUENCES: 4

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Knobbe, Martens, Olson & Bear

(B) STREET: 620 Newport Center Drive, 16th Floor

(C) CITY: Newport Beach

(D) STATE: CA

(E) COUNTRY: USA

(F) ZIP: 92660

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.25

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (619) 235-8550

(B) TELEFAX: (619) 235-0176

(2) INFORMATION FOR SEQ ID Nθ:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 499 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..498

(xi) SEQUENCE DESCRIPTION: SEQ ID Nθ:l:

GCT CCA TCA CCT CCT CCA ACA CCA GCT CCT GTT CCT GTT CCC CTT CCC 48

Ala Pro Ser Pro Pro Pro Thr Pro Ala Pro Val Pro Val Pro Leu Pro 1 5 10 15

CCT TCC ACT CCA GCA CCT GTT CCT GTG TCA AAG GTC CCA GCA AAT ATA 96 Pro Ser Thr Pro Ala Pro Val Pro Val Ser Lys Val Pro Ala Asn lie 20 25 30

ACA CGT CAA AAC AGC AGC TCC AGT GAC AGT GGT GGC AGT ATC GTG CGA 144 Thr Arg Gin Asn Ser Ser Ser Ser Asp Ser Gly Gly Ser lie Val Arg 35 40 45

GAC AGC CAG AGA CAC AAA CAA CTT CCG GTG GAC CGA AGG AAA TCT CAG 192 Asp Ser Gin Arg His Lys Gin Leu Pro Val Asp Arg Arg Lys Ser Gin 50 55 60

ATG GAG GAA GTG CAA GAT GAA CTC ATC CAC AGA CTG ACC ATT GGT CGG 240 Met Glu Glu Val Gin Asp Glu Leu lie His Arg Leu Thr lie Gly Arg 65 70 75 80

AGT GCC GCT CAG AAG AAA TTC CAT GTG CCA CGG CAG AAC GTG CCA GTT 288 Ser Ala Ala Gin Lys Lys Phe His Val Pro Arg Gin Asn Val Pro Val 85 90 95

ATC AAT ATC ACT TAC GAC TCC ACA CCA GAG GAT GTG AAG ACG TGG TTA 336 lie Asn lie Thr Tyr Asp Ser Thr Pro Glu Asp Val Lys Thr Trp Leu 100 105 110

CAG TCA AAG GGA TTC AAC CCT GTG ACT GTC AAT AGT CTT GGA GTA TTA 384 Gin Ser Lys Gly Phe Asn Pro Val Thr Val Asn Ser Leu Gly Val Leu 115 120 125

AAT GGT GCA CAA CTT TTC TCT CTC AAT AAG GAT GAA CTG AGG ACA GTC 432 Asn Gly Ala Gin Leu Phe Ser Leu Asn Lys Asp Glu Leu Arg Thr Val 130 135 140

TGC CCT GAA GGG GCG AGA GTC TAT AGC CAA ATC ACT GTA CAA AAA GCT 480 Cys Pro Glu Gly Ala Arg Val Tyr Ser Gin lie Thr Val Gin Lys Ala 145 150 155 160

GCA TTA GAG GAG AGC AGT G 499

Ala Leu Glu Glu Ser Ser 165

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 166 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

Ala Pro Ser Pro Pro Pro Thr Pro Ala Pro Val Pro Val Pro Leu Pro 1 5 10 15

Pro Ser Thr Pro Ala Pro Val Pro Val Ser Lys Val Pro Ala Asn lie 20 25 30

Thr Arg Gin Asn Ser Ser Ser Ser Asp Ser Gly Gly Ser lie Val Arg 35 40 45

Asp Ser Gin Arg His Lys Gin Leu Pro Val Asp Arg Arg Lys Ser Gin 50 55 60

Met Glu Glu Val Gin Asp Glu Leu lie His Arg Leu Thr lie Gly Arg 65 70 75 80

Ser Ala Ala Gin Lys Lys Phe His Val Pro Arg Gin Asn Val Pro Val 85 90 95 lie Asn lie Thr Tyr Asp Ser Thr Pro Glu Asp Val Lys Thr Trp Leu 100 105 110

Gin Ser Lys Gly Phe Asn Pro Val Thr Val Asn Ser Leu Gly Val Leu 115 120 125

Asn Gly Ala Gin Leu Phe Ser Leu Asn Lys Asp Glu Leu Arg Thr Val 130 135 140

Cys Pro Glu Gly Ala Arg Val Tyr Ser Gin lie Thr Val Gin Lys Ala 145 150 155 160

Ala Leu Glu Glu Ser Ser 165

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3245 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 246..2708

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3 :

GGCCATTACC AATCGCGACC CGCGCACACA CGGCCCGGGC GGCGGGCGAA GCGGGCTCCC 60

GGGGCGCTGG GCGCAGGGCG CGGGGCAAGC CCCAGCAGCG TGTCTGCAAC GGGGCGCGGC 120

GGGCGCTCCA GCTCCGGGAT CTTTCTCCCT CGGTCACCTC CCTCGCGTCT AGGGAGGTCG 180

TGGCACTCCC TGAGGAGCGC GGCTGCTCGG AGGGCGGATC CTAGAACAGA GGCGTGAGAG 240

CCGGC ATG AAT GGT CAT ATG TCT AAC CGC TCC AGT GGG TAT GGA GTC 287

Met Asn Gly His Met Ser Asn Arg Ser Ser Gly Tyr Gly Val 1 5 10

TAC CCT TCT CAA CTG AAT GGT TAC GGA TCT TCA CCA CCC TAT TCC CAG 335 Tyr Pro Ser Gin Leu Asn Gly Tyr Gly Ser Ser Pro Pro Tyr Ser Gin 15 20 25 30

ATG GAC AGA GAA CAC AGC TCA AGA ACA AGT GCA AAG GCC CTT TAT GAA 383 Met Asp Arg Glu His Ser Ser Arg Thr Ser Ala Lys Ala Leu Tyr Glu 35 40 45

CAA AGG AAG AAC TAT GCC CGA GAC AGT GTC AGC AGT GTG TCG GAC GTG 431 Gin Arg Lys Asn Tyr Ala Arg Asp Ser Val Ser Ser Val Ser Asp Val 50 55 60

TCC CAG TAC CGC GTG GAA CAC TTG ACC ACC TTC GTG CTG GAT CGG AAA 479 Ser Gin Tyr Arg Val Glu His Leu Thr Thr Phe Val Leu Asp Arg Lys 65 70 75

GAT GCA ATG ATC ACT GTC GAG GAC GGA ATA AGA AAG CTG AAG TTG CTG 527 Asp Ala Met He Thr Val Glu Asp Gly He Arg Lys Leu Lys Leu Leu 80 85 90

GAT GCC AAG GGC AAA GTG TGG ACT CAA GAT ATG ATT CTC CAA GTG GAT 575 Asp Ala Lys Gly Lys Val Trp Thr Gin Asp Met He Leu Gln_Val Asp 95 100 105 110

GAC CGA GCT GTG AGC CTG ATT GAC TTA GAG TCA AAG AAT GAA TTG GAG 623 Asp Arg Ala Val Ser Leu He Asp Leu Glu Ser Lys Asn Glu Leu Glu 115 120 125

AAT TTT CCT CTA AAC ACA ATC TCG CAT TGT CAA GCA GTG GTG CAT GCA 671 Asn Phe Pro Leu Asn Thr He Ser His Cys Gin Ala Val Val His Ala 130 135 140

TGC AGC TAT GAC TCC ATT CTC GCC TTG GTA TGC AAA GAG CCA ACG CAG 719 Cys Ser Tyr Asp Ser He Leu Ala Leu Val Cys Lys Glu Pro Thr Gin 145 150 155

AGC AAG CCA GAC CTT CAC CTT TTC CAG TGT GAT GAG GTT AAG GCA AAC 767

Ser Lys Pro Asp Leu His Leu Phe Gin Cys Asp Glu Val Lys Ala Asn

160 165 170

CTA ATT AGT GAA GAT ATC GAA AGT GCA ATC AGT GAC AGT AAA GGT GGG 815

Leu He Ser Glu Asp He Glu Ser Ala He Ser Asp Ser Lys Gly Gly

175 180 185 190

AAA CAG AAG AGG CGG CCG GAG GCC CTG AGG ATG ATT GCC AAA GCA GAT 863

Lys Gin Lys Arg Arg Pro Glu Ala Leu Arg Met He Ala Lys Ala Asp

195 200 205

CCT GGC ATC CCT CCT CCT CCC AGA GCT CCT GCC CCT GTG CCA CCG GGG 911

Pro Gly He Pro Pro Pro Pro Arg Ala Pro Ala Pro Val Pro Pro Gly

210 215 220

ACT GTC ACA CAG GTG GAC GTT AGG AGT CGC GTA GCA GCC TGG TCT GCC 959

Thr Val Thr Gin Val Asp Val Arg Ser Arg Val Ala Ala Trp Ser Ala 225 230 235

TGG GCA GCT GAC CAG GGT GAC TTC GAG AAG CCC CGG CAG TAC CAC GAG 1007

Trp Ala Ala Asp Gin Gly Asp Phe Glu Lys Pro Arg Gin Tyr His Glu

240 245 250

CAA GAA GAG ACG CCC GAG ATG ATG GCA GCC CGG ATC GAC AGG GAT GTG 1055

Gin Glu Glu Thr Pro Glu Met Met Ala Ala Arg He Asp Arg Asp Val

255 260 265 270

CAA ATC TTA AAC CAT ATT TTG GAT GAC ATT GAA TTT TTT ATC ACC AAA 1103

Gin He Leu Asn His He Leu Asp Asp He Glu Phe Phe He Thr Lys

275 280 285

CTC CAA AAA GCC GCC GAA GCG TTT TCT GAG CTT TCT AAA AGG AAG AAA 1151

Leu Gin Lys Ala Ala Glu Ala Phe Ser Glu Leu Ser Lys Arg Lys Lys

290 295 300

AGT AAG AAA AGT AAA AGG AAA GGA CCT GGA GAG GGC GTT TTA ACA CTG 1199

Ser Lys Lys Ser Lys Arg Lys Gly Pro Gly Glu Gly Val Leu Thr Leu 305 310 315

AGG GCA AAA CCG CCA CCT CCT GAC GAG TTT GTT GAC TGT TTC CAG AAG 1247

Arg Ala Lys Pro Pro Pro Pro Asp Glu Phe Val Asp Cys Phe Gin Lys

320 325 330

TTT AAA CAT GGA TTC AAC CTT CTG GCC AAG TTG AAG TCC CAT ATC CAG 1295

Phe Lys His Gly Phe Asn Leu Leu Ala Lys Leu Lys Ser His He Gin

335 340 345 350

AAC CCG AGT GCT TCA GAT CTG GTT CAT TTT TTG TTT ACT CCA CTA AAT 1343

Asn Pro Ser Ala Ser Asp Leu Val His Phe Leu Phe Thr Pro Leu Asn

355 360 365

ATG GTG GTC CAG GCA ACA GGT GGC CCT GAA CTG GCC AGT TCG GTA CTC 1391

Met Val Val Gin Ala Thr Gly Gly Pro Glu Leu Ala Ser Ser Val Leu 370 375 380

AGC CCA CTG TTG ACA AAA GAC ACA GTT GAT TTC TTA AAC TAC ACA GCC 1439

Ser Pro Leu Leu Thr Lys Asp Thr Val Asp Phe Leu Asn Tyr Thr Ala 385 390 395

ACT GCG GAG GAA CGG AAG CTG TGG ATG TCA CTG GGA GAT AGT TGG GTG 1487

Thr Ala Glu Glu Arg Lys Leu Trp Met Ser Leu Gly Asp Ser Trp Val

400 405 410

AAA GTG AGA GCA GAG TGG CCG AAA GAA CAG TTC ATC CCA CCT TAC GTC 1535

Lys Val Arg Ala Glu Trp Pro Lys Glu Gin Phe He Pro Pro Tyr Val 415 420 425 430

CCG AGG TTC CGC AAC GGC TGG GAG CCC CCG ATG CTG AAC TTC ATG GGC 1583

Pro Arg Phe Arg Asn Gly Trp Glu Pro Pro Met Leu Asn Phe Met Gly 435 440 445

GCG CCC ACA GAG CAA GAC ATG TAT CAA CTG GCC GAG TCC GTG GCC AAC 1631

Ala Pro Thr Glu Gin Asp Met Tyr Gin Leu Ala Glu Ser Val Ala Asn 450 455 460

GCA GAA CAC CAG CGC AAA CAG GAC AGC AAG AGG CTG TCC ACA GAG CAT 1679

Ala Glu His Gin Arg Lys Gin Asp Ser Lys Arg Leu Ser Thr Glu His 465 470 475

TCC AAT GTG TCC GAC TAT CCT CCA GCC GAC GGA TAT GCG TAC AGT AGC 1727

Ser Asn Val Ser Asp Tyr Pro Pro Ala Asp Gly Tyr Ala Tyr Ser Ser

480 485 490

AGC ATG TAC CAC AGA GGA CCA CAT GCA GAC CAC GGG GAG GCT GCC ATG 1775

Ser Met Tyr His Arg Gly Pro His Ala Asp His Gly Glu Ala Ala Met 495 500 505 510

CCT TTC AAG TCA ACT CCT AAT CAC CAA GTA GAT AGG AAT TAT GAC GCA 1823

Pro Phe Lys Ser Thr Pro Asn His Gin Val Asp Arg Asn Tyr Asp Ala 515 520 525

GTC AAA ACA CAA CCC AAG AAA TAC GCC AAA TCC AAG TAC GAC TTT GTG 1871

Val Lys Thr Gin Pro Lys Lys Tyr Ala Lys Ser Lys Tyr Asp Phe Val 530 535 540

GCG AGG AAC AGC AGC GAG CTC TCG GTT ATG AAA GAT GAT GTC TTA GAG 1919

Ala Arg Asn Ser Ser Glu Leu Ser Val Met Lys Asp Asp Val Leu Glύ 545 550 555

ATA CTC GAC GAT CGA AGG CAG TGG TGG AAA GTC CGG AAT GCC AGT GGA 1967

He Leu Asp Asp Arg Arg Gin Trp Trp Lys Val Arg Asn Ala Ser Gly

560 565 570

GAC TCT GGG TTT GTG CCA AAT AAC ATT CTG GAT ATC ATG AGA ACT CCA 2015 Asp Ser Gly Phe Val Pro Asn Asn He Leu Asp He Met Arg Thr Pro 575 580 585 590

GAA TCT GGA GTG GGG CGC GCT GAC CCC CCA TAC ACA CAT ACC ATA CAG 2063 Glu Ser Gly Val Gly Arg Ala Asp Pro Pro Tyr Thr His Thr He Gin 595 600 605

AAA CAA AGG ACG GAA TAC GGC CTG AGA TCA GCT GAC ACT CCT TCT GCC 2111 Lys Gin Arg Thr Glu Tyr Gly Leu Arg Ser Ala Asp Thr Pro Ser Ala 610 615 620

CCA TCA CCC CCT CCA ACG CCA GCA CCC GTT CCG GTC CCC CTT CCA CCT 2159 Pro Ser Pro Pro Pro Thr Pro Ala Pro Val Pro Val Pro Leu Pro Pro 625 630 635

TCT GTA CCA GCA CCC GTT TCT GTG CCC AAG GTT CCA GCA GAT GTC ACC 2207 Ser Val Pro Ala Pro Val Ser Val Pro Lys Val Pro Ala Asp Val Thr 640 645 650

CGC CAG AAC AGC AGC TCC AGT GAC AGT GGG GGC AGC ATT GTG CGG GAC 2255 Arg Gin Asn Ser Ser Ser Ser Asp Ser Gly Gly Ser He Val Arg Asp 655 660 665 670

AGC CAG AGA TAC AAA CAA CTC CCA GTG GAC CGA AGG AAG TCC CAG ATG 2303 Ser Gin Arg Tyr Lys Gin Leu Pro Val Asp Arg Arg Lys Ser Gin Met 675 680 685

GAA GAG GTT CAG GAT GAG CTC TTC CAG AGG CTG ACC ATC GGG CGC AGT 2351 Glu Glu Val Gin Asp Glu Leu Phe Gin Arg Leu Thr He Gly Arg Ser 690 695 700

GCT GCG CAG AGG AAG TTC CAC GTG CCA CGG CAG AAC GTT CCA GTG ATC 2399 Ala Ala Gin Arg Lys Phe His Val Pro Arg Gin Asn Val Pro Val He 705 710 715

AAT ATC ACT TAT GAC TCC TCA CCG GAA GAA GTA AAG ACT TGG CTG CAG 2447 Asn He Thr Tyr Asp Ser Ser Pro Glu Glu Val Lys Thr Trp Leu Gin 720 725 730

TCA AAG GGA TTC AAT CCC GTG ACT GTC AAT AGC CTC GGG GTG TTG AAC 2495 Ser Lys Gly Phe Asn Pro Val Thr Val Asn Ser Leu Gly Val Leu Asn 735 740 745 750

GGA GCA CAA CTC TTT TCT CTC AAC AAA GAC GAA CTG AGG TCT GTC TGC 2543 Gly Ala Gin Leu Phe Ser Leu Asn Lys Asp Glu Leu Arg Ser Val Cys 755 760 765

CCG GAA GGT GCC AGA GTC TTT AAC CAA ATC ACT GTT CAG AAA GCT GCT 2591 Pro Glu Gly Ala Arg Val Phe Asn Gin He Thr Val Gin Lys Ala Ala 770 775 780

TTG GAG GAC AGT AAT GGA AGC TCC GAG TTA CAA GAG ATC ATG CGG AGA 2639 Leu Glu Asp Ser Asn Gly Ser Ser Glu Leu Gin Glu He Met Arg Arg 785 790 795

CGG CAG GAG AAG ATC AGC GCC GCT GCG AGC GAC TCG GGA GTG GAG TCT 2687 Arg Gin Glu Lys He Ser Ala Ala Ala Ser Asp Ser Gly Val Glu Ser 800 805 810

TTT GAT GAA GGG AGC AGC CAC TGAGTCCATG AACTTCCTTA TTCTTGGTGT 2738

Phe Asp Glu Gly Ser Ser His 815 820

GGTCGTTGAA CAGTGATGGA CATGCTTTGT TTTAAGAAGC CTTGAAGGGA ATGTCAAAGC 2798

TGTCGTCTTG GTATATGTAA TTTATCGCCA TATAAGGAAA CAGTATATGC CTGAGTAAGC 2858

AGAGGACCCG CTGCTTCTGT GCACATTAGT TTGATTAAAA CTGAGAAGCG GGTAGGTGAG 2918

ATGGCTCAGC AAGTAAAGGT GCTTGCTGCC AAGCCCAATG ACCCAAGTTC GAGTCCCTGG 2978

GTCTACATGG TAGGAGAGAG CTGGCTTCTG CAAGTTGTCC TCTGACCACC ACACATAAAT 3038

AAATAACAAA TGTAATTTAC AAACTTTTAA AAGAAAATGT AATTTAAAAA ACCAGACGTT 3098

CTAGACTGTT CTGGGCTTGG GAAATATTTT TTTCACTTTC CTAAGGTGTA CTTTCCTTTG 3158

CTACATTAAT TATTGCAGCC TTGTTCGATG ATCTAAGTGG GGATATTTGA CAATGGCAGA 3218

TTTATTCATT GCAACAAGGA AAGACAC 3245

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 821 amino acids

(B) TYPE: amino acid

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Met Asn Gly His Met Ser Asn Arg Ser Ser Gly Tyr Gly Val Tyr Pro 1 5 10 15

Ser Gin Leu Asn Gly Tyr Gly Ser Ser Pro Pro Tyr Ser Gin Met Asp 20 25 30

Arg Glu His Ser Ser Arg Thr Ser Ala Lys Ala Leu Tyr Glu Gin Arg 35 40 45

Lys Asn Tyr Ala Arg Asp Ser Val Ser Ser Val Ser Asp Val Ser Gin 50 55 60

Tyr Arg Val Glu His Leu Thr Thr Phe Val Leu Asp Arg Lys Asp Ala 65 70 75 80

Met He Thr Val Glu Asp Gly He Arg Lys Leu Lys Leu Leu Asp Ala 85 90 95

Lys Gly Lys Val Trp Thr Gin Asp Met He Leu Gin Val Asp Asp Arg 100 105 110

Ala Val Ser Leu He Asp Leu Glu Ser Lys Asn Glu Leu Glu Asn Phe 115 120 125

Pro Leu Asn Thr He Ser His Cys Gin Ala Val Val His Ala Cys Ser 130 135 140

Tyr Asp Ser He Leu Ala Leu Val Cys Lys Glu Pro Thr Gin Ser Lys 145 150 155 160

Pro Asp Leu His Leu Phe Gin Cys Asp Glu Val Lys Ala Asn Leu He 165 170 175

Ser Glu Asp He Glu Ser Ala He Ser Asp Ser Lys Gly Gly Lys Gin 180 185 190

Lys Arg Arg Pro Glu Ala Leu Arg Met He Ala Lys Ala Asp Pro Gly 195 200 205

He Pro Pro Pro Pro Arg Ala Pro Ala Pro Val Pro Pro Gly Thr Val 210 215 220

Thr Gin Val Asp Val Arg Ser Arg Val Ala Ala Trp Ser Ala Trp Ala 225 230 235 240

Ala Asp Gin Gly Asp Phe Glu Lys Pro Arg Gin Tyr His Glu Gin Glu 245 250 255

Glu Thr Pro Glu Met Met Ala Ala Arg He Asp Arg Asp Val Gin He 260 265 270

Leu Asn His He Leu Asp Asp He Glu Phe Phe He Thr Lys Leu Gin 275 280 285

Lys Ala Ala Glu Ala Phe Ser Glu Leu Ser Lys Arg Lys Lys Ser Lys

290 295 300 ___

Lys Ser Lys Arg Lys Gly Pro Gly Glu Gly Val Leu Thr Leu Arg Ala 305 310 315 320

Lys Pro Pro Pro Pro Asp Glu Phe Val Asp Cys Phe Gin Lys Phe Lys 325 330 335

His Gly Phe Asn Leu Leu Ala Lys Leu Lys Ser His He Gin Asn Pro 340 345 350

Ser Ala Ser Asp Leu Val His Phe Leu Phe Thr Pro Leu Asn Met Val 355 360 365

Val Gin Ala Thr Gly Gly Pro Glu Leu Ala Ser Ser Val Leu Ser Pro 370 375 380

Leu Leu Thr Lys Asp Thr Val Asp Phe Leu Asn Tyr Thr Ala Thr Ala 385 390 395 400

Glu Glu Arg Lys Leu Trp Met Ser Leu Gly Asp Ser Trp Val Lys Val 405 410 415

Arg Ala Glu Trp Pro Lys Glu Gin Phe He Pro Pro Tyr Val Pro Arg 420 425 430

Phe Arg Asn Gly Trp Glu Pro Pro Met Leu Asn Phe Met Gly Ala Pro 435 440 445

Thr Glu Gin Asp Met Tyr Gin Leu Ala Glu Ser Val Ala Asn Ala Glu 450 455 460

His Gin Arg Lys Gin Asp Ser Lys Arg Leu Ser Thr Glu His Ser Asn

465 470 475 480

Val Ser Asp Tyr Pro Pro Ala Asp Gly Tyr Ala Tyr Ser Ser Ser Met 485 490 495

Tyr His Arg Gly Pro His Ala Asp His Gly Glu Ala Ala Met Pro Phe 500 505 510

Lys Ser Thr Pro Asn His Gin Val Asp Arg Asn Tyr Asp Ala Val Lys 515 520 525

Thr Gin Pro Lys Lys Tyr Ala Lys Ser Lys Tyr Asp Phe Val Ala Arg 530 535 540

Asn Ser Ser Glu Leu Ser Val Met Lys Asp Asp Val Leu Glu He Leu 545 550 555 560

Asp Asp Arg Arg Gin Trp Trp Lys Val Arg Asn Ala Ser Gly Asp Ser 565 570 575

Gly Phe Val Pro Asn Asn He Leu Asp He Met Arg Thr Pro Glu Ser 580 585 590

Gly Val Gly Arg Ala Asp Pro Pro Tyr Thr His Thr He Gin Lys Gin 595 600 605

Arg Thr Glu Tyr Gly Leu Arg Ser Ala Asp Thr Pro Ser Ala Pro Ser 610 615 620

Pro Pro Pro Thr Pro Ala Pro Val Pro Val Pro Leu Pro Pro Ser Val 625 630 635 640

Pro Ala Pro Val Ser Val Pro Lys Val Pro Ala Asp Val Thr Arg Gin 645 650 655

Asn Ser Ser Ser Ser Asp Ser Gly Gly Ser He Val Arg Asp Ser Gin 660 665 670

Arg Tyr Lys Gin Leu Pro Val Asp Arg Arg Lys Ser Gin Met Glu Glu 675 680 685

Val Gin Asp Glu Leu Phe Gin Arg Leu Thr He Gly Arg Ser Ala Ala 690 695 700

Gin Arg Lys Phe His Val Pro Arg Gin Asn Val Pro Val He Asn He 705 710 715 720

Thr Tyr Asp Ser Ser Pro Glu Glu Val Lys Thr Trp Leu Gin Ser Lys 725 730 735

Gly Phe Asn Pro Val Thr Val Asn Ser Leu Gly Val Leu Asn Gly Ala 740 745 750

Gin Leu Phe Ser Leu Asn Lys Asp Glu Leu Arg Ser Val Cys Pro Glu 755 760 765

Gly Ala Arg Val Phe Asn Gin He Thr Val Gin Lys Ala Ala Leu Glu 770 775 780

Asp Ser Asn Gly Ser Ser Glu Leu Gin Glu He Met Arg Arg Arg Gin 785 790 795 800

Glu Lys He Ser Ala Ala Ala Ser Asp Ser Gly Val Glu Ser Phe Asp 805 810 815

Glu Gly Ser Ser His 820