Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
PROCESS FOR THE PRODUCTION OF PANTHENOL
Document Type and Number:
WIPO Patent Application WO/2007/131750
Kind Code:
A1
Abstract:
A process for the production of panthenol by culturing a microorganism capable of overexpressing at least one enzyme selected from the group consisting of the enzymes in the pantoate biosynthesis and PanC under suitable culturing conditions, with co-feeding of 3-aminopropanol or a suitable derivative thereof and optionally recovering the panthenol from the cell culturing medium.

Inventors:
FERRANDEZ, Abel (Rixheimerstrasse 17, Basel, CH-4055, CH)
FLORES-CANDIA, Juana-Lucia (Hauptstrasse 140, Bettingen, CH-4126, CH)
PERKINS, John, B. (Van Boetzelaerlaan 4, SW Wassenaar, NL-2242, NL)
SCHYNS, Ghislain (Ettingerstrasse 3, Aesch, CH-4147, CH)
Application Number:
EP2007/004249
Publication Date:
November 22, 2007
Filing Date:
May 15, 2007
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
DSM IP ASSETS B.V. (Het Overloon 1, TE Heerlen, NL-6411, NL)
FERRANDEZ, Abel (Rixheimerstrasse 17, Basel, CH-4055, CH)
FLORES-CANDIA, Juana-Lucia (Hauptstrasse 140, Bettingen, CH-4126, CH)
PERKINS, John, B. (Van Boetzelaerlaan 4, SW Wassenaar, NL-2242, NL)
SCHYNS, Ghislain (Ettingerstrasse 3, Aesch, CH-4147, CH)
International Classes:
C12P13/02
Attorney, Agent or Firm:
RABANUS, Birgit et al. (DSM Nutritional Products Ltd, Wurmisweg 576, Kaiseraugst, CH-4303, CH)
Download PDF:
Claims:

Claims

1. A process for the production of panthenol by culturing a microorganism capable of overexpressing at least one enzyme selected from the group consisting of the enzymes in the pantoate biosynthesis and PanC under suitable culturing conditions, with co-feeding of 3-aminopropanol or a suitable derivative thereof and optionally recovering the panthenol from the cell culturing medium.

2. A process as claimed in claim 1 , wherein the microorganism is of the genus Bacillus.

3. A process as claimed in claim 1 or claim 2, wherein the microorganism is Bacillus sυbtilis.

4. A process as claimed in anyone of claims 1-3, wherein at least one of enzymes PanB, PanC, PanE and HvD is overexpressed.

5. A process as claimed in anyone of claims 1-4, wherein PanE is overexpressed.

6. A process as claimed in anyone of claims 1-5, wherein PanB is overexpressed.

7. A process as claimed in anyone of claims 1-6, wherein PanC is overexpressed.

8. A process as claimed in anyone of claims 1-7, wherein PanD is inactivated.

9. The use of PanC or a mutant thereof with increased catalytic activity in a process for the preparation of panthenol from 3-aminopropanol or a derivative thereof and pantoate.

10. Panthenol whenever prepared according to a process as claimed in anyone of claims 1-8.

Description:

Process for the production of panthenol

The present invention relates to a process for the production of panthenol. More precisely, the present invention relates to a process for the fermentative production of panthenol by culturing a microorganism, in a suitable fermentation medium under suitable fermentation conditions, with co-feeding of 3-aminopropanol (AMP) or a derivative thereof and, if desired, recovering the panthenol.

Panthenol is 2,4-dihydroxy-N-(3-hydroxypropyl)-3,3-dimethylbutyramide or N-pantoyl-3- propanolamine, the alcohol corresponding to pantothenic acid. Due to its membrane- protective properties, panthenol is widely utilized in the cosmetic industry. The D(+)- or R- form of panthenol, which in connection with the present invention is the preferred form, has vitamin activity and, therefore, its use as prophylactic agent in the field of medicine as well as food supplement is well founded and new applications are constantly being developed.

The conventional manufacturing process of panthenol is the chemical condensation of synthetic R-pantolactone (α-hydroxy-β,β-dimethyl-γ-butyrolactone) with 3-aminopropanol (see, e.g., Schnider, O.: Synthesis of panthenol and its transformation into pantothenic acid. Jubilee Vol. Emil Barell 1946, 85-91).

No method has been described so far to produce panthenol by a biotechnological process using microorganisms.

CN 1367253 describes the production of D-panthenol by microbial enzymatic hydrolysis of DL-pantoic acid lactone using Fusarium monoliforme which produces D-pantoic acid lactone hydrolase and reacting the resulting D-pantoic acid with 3-aminopropanol.

Complete or partial biosynthesis of panthenol at lower production costs than for the known chemical processes is still an attractive technical goal to be achieved.

Complete or partial biosynthesis of panthenol at lower production costs than for the known chemical processes is still an attractive technical goal to be achieved.

EP 859 848 B1 (BASF AG) claims a process for the production of D-pantothenic acid which process comprises culturing a transformant E. coli in the presence of β-alanine. WO 01/21772 (Omnigene Bioproducts/BASF AG) claims a method of producing pantothenate or pantoate by culturing genetically modified microorganisms of the genus Bacillus, particularly S. subtilis, in which at least one enzyme selected from the group consisting of PanB (ketopantoate hydroxymethyltransferase), PanC (pantothenate synthetase), PanD, (aspartate-α- decarboxylase) and PanE (ketopantoate reductase) is overexpressed.

While PanC is known to catalyze in a microorganism the condensation of β- alanine with pantoate to form pantothenate, it has now surprisingly been found that PanC is also capable of catalyzing the condensation of 3-aminopropanol with pantoate to form panthenol.

Therefore the present invention relates to a process for the production of panthenol characterized by culturing a microorganism capable of overexpressing at least one enzyme selected from the group consisting of the enzymes in the pantoate biosynthesis and PanC under suitable culturing conditions, with co- feeding of 3-aminopropanol or a suitable derivative thereof and optionally recovering the panthenol from the cell culturing medium.

The present invention also relates to panthenol whenever produced according to such a process and to the use of PanC or a mutant thereof with increased catalytic activity in a process for the production of panthenol from 3- aminopropanol or a derivative thereof and pantoate.

The microorganism of the present invention may be eukaryotic or prokaryotic. Preferably, the microorganism is prokaryotic. The prokaryotic microorganism may be Gram positive or Gram negative. Gram positive microorganisms include but are not limited to microorganisms belonging to one of the genera Bacillus, Corynebacterium, Lactobacillus, Lactococus and Streptomyces. Preferably the microorganism belongs to the genus Bacillus. Examples are Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus subtilis, Bacillus puntis, Bacillus halodurans, etc. Most preferably, the microorganism is Bacillus subtilis.

The enzymes of the pantoate biosynthetic pathway - as well as the DNA sequences coding for them - are known to the person skilled in the art and comprise, without limitation, PanB, Pan E, HvB, MvC 1 HvD, MvN, GIyA, SerA and SerC as well as the enzymes of the glycine cleavage pathway.

In preferred embodiments of the present invention at least one of enzymes PanB, PanC, PanE and NvD is overexpressed. In a further specific embodiment of the present invention PanD, which catalyses the α-decarboxylation of aspartate to form β-alanine, is inactivated by deleting the corresponding PanD gene partly or completely.

Many specific genetically manipulated and transformed microorganisms are described in the literature which are capable of overexpressing one or more enzymes of the pantoate biosynthetic pathway or increasing the microbial production of pantoate and which, therefore, may be used in the present invention, optionally after introduction of additional advantageous changes. Examples of publications of such microorganisms in the patent literature are:

WO 97/10340, EP 1 001 027, EP 1 006 189, WO 01/21772, WO 01/92556, EP 1 167 520, WO 02/24936, WO 02/29020, WO 02/055711 , WO 02/057474, WO 02/057476, WO 02/061108, WO 02/064806, WO 02/072838, WO 02/072840, WO 02/072854, WO 02/072855, EP 1 247 868, WO 03/004672, WO 03/006664, DE 102 01 540 A1 , WO 03/029476, WO 2004/005525, and WO 2004/005527.

The term "overexpressing" or "overexpression" means expression of a gene product at a level higher than that expressed prior to modification of the microorganism or in a comparable microorganism which has not been modified. In one embodiment, the microorganism of the invention overexpresses one or more genes selected from the group consisting of panB, panC, panE, HvB, HvC, HvD, HvN, glyA, serA, and serC, and the gcv genes involved in the glycine cleavage pathway; as well as mutants thereof that result in the synthesis of encoded enzymes of improved catalytic properties.

The term "deregulated" or "deregulation" means the alteration or modification of a gene in a microorganism such that the level or activity of the gene product in a microorganism is altered or modified. Preferably, at least one gene is altered or modified such that the gene product is enhanced/increased or attenuated/decreased.

Overexpression or deregulation of a gene in a microorganism can be performed according to any methodology known in the art. In one embodiment, the microorganism can be genetically manipulated, e.g., genetically engineered. Genetic manipulation can include, but is not limited to, altering or modifying regulatory sequences or sites associated with the expression of a particular gene, e.g., by adding strong promoters, inducible promoters or multiple promoters or by removing regulatory sequences such that expression is constitutive, modifying the chromosomal location of a particular gene, altering nucleic acid sequences adjacent to a particular gene such as ribosome binding site or transcription terminator, increasing the copy number of a particular gene, modifying proteins, e.g., regulatory proteins, suppressors, enhancers, transcriptional activators and the like, involved in transcription of a particular gene and/or translation of a particular gene product, or any other conventional means of deregulating expression of a particular gene routine in the art (including, but not limited to, the use of antisense nucleic acid molecules, e.g., to block expression of repressor proteins). Examples of suitable promoters are, but are not limited to, P veg , P 15 and P 26 (Lee et al., 1980, MoI. Gen. Genet. 180:57-65 and Moran et al., 1982, MoI. Gen. Genet. 186:339-46.

Alternatively, the microorganism can be physically or environmentally manipulated to overexpress a level of gene product greater than that expressed prior to manipulation of the microorganism or in a comparable microorganism which has not been manipulated. For example, a microorganism can be treated with or cultured in the presence of an agent known or suspected to increase transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased. Furthermore, a microorganism can be cultured at a temperature selected to increase the transcription of a particular gene and/or translation of a particular gene product such that transcription and/or translation are enhanced or increased.

The term "culturing a microorganism under suitable culturing conditions" refers to methods of maintaining and/or growing a living microorganism of the present invention which are well known in the art. The microorganisms can be cultured in liquid, solid or semi-solid media. Preferably, the microorganism of the invention is cultured in liquid media comprising nutrients essential or beneficial to the maintenance and/or growth of the microorganism. Such nutrients include, but are not limited to, carbon sources or carbon substrates, such as alcohols, sugars,

sugar alcohols, complex carbohydrates such as starches, hydrocarbons, fatty acids, other organic acids; oils, fats; nitrogen sources, e.g. vegetable proteins, yeast extract, peptones, peptides and amino acids derived from grains, beans and tubers, or derived from animal sources such as meat or milk, meat extracts and casein hydrolysates; inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium nitrate and ammonium phosphate; phosphorous sources, e.g. phosphoric acid and sodium or potassium salts thereof; trace elements, e.g. magnesium, iron, manganese, calcium, copper, zinc, boron, molybdenum and/or cobalt salts; as well as growth factors such as vitamins, growth promoters and the like.

The microorganisms are preferably cultured under controlled pH. In one embodiment, microorganisms are cultured at a pH of between 6.0 and 8.5, more preferably at a pH of about 7. The desired pH may be maintained by any method known to those skilled in the art.

Preferably, the microorganisms are further cultured under controlled aeration and under controlled temperatures. In one embodiment, the controlled temperatures include temperatures between 15 and 70°C, preferably the temperatures are between 20 and 55°C, more preferably between 30 and 45°C or between 30 and 5O 0 C.

The microorganisms may be cultured in liquid media either continuously, semi- continuously or batchwise by conventional culturing methods such as standing culture, test tube culture, shaking culture, aeration spinner culture or fermentation. Preferably, the microorganisms are cultured in a fermenter. Fermentation processes of the invention include batch, fed-batch and continuous methods of fermentation. Varieties of such processes have been developed and are well known in the art.

The culturing is usually continued for a time sufficient to produce the desired amount of panthenol.

The essential feature of the culturing of the microorganisms in accordance with the present invention is the co-feeding of 3-aminopropanol (AMP) or a suitable derivative thereof. Suitable derivatives of AMP are those which under the culturing conditions are converted into AMP, such as 3-alkoxypropylamines, preferably 3-

methoxy- or 3-ethoxy-propylamines, 3-halopropylamines, e.g., 3-chloropropyl- amine, or 3-aminopropanethiol.

Although bacterial cultures were performed during 72h, for both shake flasks and fermentation experiments, modalities of the AMP co-feeding were carefully adapted to each type of panthenol production experiment. In shake flasks, AMP was added in the growth medium at inoculation time and at a concentration of 40g/L. During fed-batch fermentation, a first 24h-phase of growth performed without AMP co-feeding was followed by feeding AMP during 24h at 14g/L. This AMP feeding was then increased for the last 24h of growth. In both cases, it is essential to maintain pH constant by neutralization with HCI (pH was 7.2 for shake flask experiments and 6.8 for stirred tank fermentation).

In a specific embodiment of the invention the yield of the microbially produced panthenol can be increased by simultaneous or intermittent co-feeding of pantoic acid, a suitable pantoic acid derivative or a precursor of pantoate in the biosynthetic pathway. The optimal amount of such co-feeding under the specific culturing conditions can be easily determined by routine experiments.

The panthenol obtained in accordance with the present invention in the fermentation broth can either be used without being recovered or after being recovered. The term "recovering" includes isolating, extracting, harvesting, separating or purifying the compound from the culture medium. Isolating the compound can be performed according to any conventional isolation or purification methodology known in the art including, but not limited to, treatment with a conventional resin, treatment with a conventional adsorbent, alteration of pH, solvent extraction, dialysis, filtration, concentration, crystallization, recrystallization, pH adjustment, and the like. For example, the panthenol compound can be recovered from the culture medium by first removing the microorganisms from the culture. The solution is then passed through or over a cation exchange resin to remove unwanted cations and then through or over an anion exchange resin to remove unwanted inorganic anions and organic acids.

The invention is further illustrated by the following description of general methodology as well as by non-limiting specific Examples.

General Methodology

Strains and plasmids. Bacillus subtilis strains of the present invention are derived from strain 1A747 (Bacillus Genetic Stock Center, The Ohio State University, Columbus, Ohio 43210 USA), which is a prototrophic derivative of β. subtilis 168 {trpC2) (GenBank AL009126). The chloramphenicol-resistance gene (cat) cassette was obtained from plasmid pC194 (GenBank M19465, Cat# 1 E17 Bacillus Genetic Stock Center, The Ohio State University, Columbus, Ohio 43210 USA). The S. aureus erythromycin resistance gene (GenBank V01278) was amplified from plasmid pDG646 (Guerout-Fleury et al., 1995). The S. aureus spectinomycin resistance gene (XO3216) was amplified from plasmid pDG1726 (Guerout-Fleury et al., 1995). The P 75 and P 2 Q promoters of the S. subtilis bacteriophage SPO1 (Lee et al., 1980, MoI. Gen. Genet. 180:57-65) were obtained from derivatives of plasmid pX12 (Humbelin et al., 1999, J. Ind. Microbiol. Biotech. 22:1-7) containing the SPO1-15 and SPO1-26 promoters from RB50::[pRF69]::[pRF93] (Perkins et al., 1999, J. Ind. Microbiol. Biotech. 22:8-18).

Media. Standard minimal medium (MM) for S. subtilis contains 1X Spizizen salts, 0.04% sodium glutamate, and 0.5% glucose. Standard solid complete medium is Tryptone Blood Agar Broth (TBAB, Difco). Standard liquid complete medium is Veal Infusion-Yeast Extract broth (VY). The compositions of these media are described below:

TBAB medium: 33g Difco Tryptone Blood Agar Base (Catalog # 0232), 1 L water. Autoclave.

VY medium: 25g Difco Veal Infusion Broth (Catalog # 0344), 5g Difco Yeast Extract (Catalog #0127), 1 L water. Autoclave.

Minimal Medium (MM): 100ml 10X Spizizen salts; 10 ml 50% glucose; 1 ml 40% sodium glutamate, qsp 1L water.

10X Spizizen salts: 14Og K 2 HPO 4 ; 2Og (NH 4 ) 2 SO 4 ; 6Og KH 2 PO 4 ; 10g Na 3 citrate.2H 2 O; 2g MgSO 4 JH 2 O; qsp 1 L with water.

10X VFB minimal medium (10X VFB MM): 2.5g Na-glutamate; 15.7g KH 2 PO 4 ; 15.7g K 2 HPO 4 ; 27.4 g Na 2 HPO 4 .12H 2 O; 4Og NH 4 CI; 1 g citric acid; 68 g (NH 4 ) 2 SO 4 ; qsp 1 L water.

Trace elements solution: 1.4g MnSO 4 H 2 O; 0.4g CoCI 2 -6H 2 O; 0.15g (NH 4 ) 6 Mo 7 O 24 -4H 2 O; 0.1 g AICI 3 SH 2 O; 0.075g CuCI 2 -2H 2 O; qsp 200 ml water

Fe solution: 0.21 g FeSO 4 JH 2 O; qsp 10 ml water.

CaCI? solution: 15.6g CaCI 2 .2H 2 O; qsp 500 ml water.

Mα/Zn solution: 10Og MgSO 4 JH 2 O; 0.4g ZnSO 4 .7H 2 O; qsp 200 ml water.

VFB MM medium: 100 ml 1OX VFB MM; 10 ml 50% glucose; 2 ml Trace elements solution; 2 ml Fe solution; 2 ml CaCI 2 solution; 2 ml Mg/Zn solution; 882 ml sterile distilled water.

VFB MMGT medium: 100 ml 1OX VFB MM; 100 ml 0.5 M Tris (pH 6.8); 44 ml 50% glucose; 2 ml Trace elements solution; 2 ml Fe solution; 2 ml CaCI 2 solution; 2 ml Mg/Zn solution; 748 ml sterile distilled water.

VF fermentation batch medium: Sterilized in place in solution: 0.75g sodium glutamate; 4.71 g KH 2 PO 4 ; 4.71 g K 2 HPO 4 ; 8.23g Na 2 HPO 4 -12H 2 O; 0.23g NH 4 CI; 1.41g (NH 4 ) 2 SO 4 ; 11.77g Yeast extract (Merck); 0.2 ml Basildon antifoam; qsp 1 L.

Added as autoclaved solution to the fermenter: 27.3g glucose-H 2 O; qsp 1 L.

Added as filter-sterilized solution to the fermenter: 2ml trace elements solution; 2ml CaCI 2 -solution; 2ml Mg/Zn-solution; 2ml Fe-solution; qsp 1 L.

VF fermentation feed medium: 66Og glucose-H 2 O; qsp 1 L. Autoclave. Add 2g MgSO 4 JH 2 O; 14.6mg MnSO 4 H 2 O; 4mg ZnSO 4 H 2 O; qsp 1 L (autoclaved).

VYS medium (g/l): Veal infusion broth, 30; yeast extract, 5; sorbitol 10; K 2 HPO 4 2.5. This medium was used in the first stage of the inoculum.

Co-feeding media: Stock solutions of pantoate and 3-aminopropanol were prepared to final concentrations of 415 g/l and 980 g/l, respectively.

Molecular and genetic techniques. Standard genetic and molecular biology techniques are generally known in the art and have been previously described. DNA transformation, PBS1 generalized transduction, and other standard B. subtilis genetic techniques are also generally known in the art and have been described previously (Harwood and Cutting, 1992).

Fermentations. Strains were grown in stirred tank fermenters, for example, New Brunswick 20 liters vessels initially containing 6 liters of VF fermentation batch medium with glucose/salt solution. Computer control was done by NBS Biocommand 32 commercial software (New Brunswick Scientific Co., Inc., Edison, NJ, USA); Lucullus software (Biospecktra AG, Schlieren, Switzerland) was used for data collection and controlling the glucose feeding.

To prepare the inoculum for the fermentation, a two-seed culture protocol was used. In the first stage 2 ml stock culture, previously prepared and preserved at - 25°C, was inoculated into 25 ml VYS broth in a 100 ml Erlenmeyer flask, which was then incubated for 3 h at 39°C on a rotary shaker at 200 rpm. In the second stage, 0.1 ml of this culture was transferred to 300 ml of the production media. This second pre-culture was carried out in a 2 L Erlenmeyer flask and was incubated again at 39°C for 21 h, time at which an OD > 12 was achieved. For the final stage, the content of such a flask was transferred aseptically to the stirred tank reactor (fermenter) to give approximately 5% w/w inoculum concentration. Frozen bacterial stocks were prepared by growing bacteria in VY medium to late exponential stage (ODβoo = 0.8-1.0), adding sterile glycerol to a final concentration of 20%, and then freezing 1 ml samples on dry ice and storing the frozen bacteria at -8O 0 C.

During fermentation, a pH of 6.8 was kept constant in the reactor by the automatic addition of ammonium hydroxide solution 27% and 3M HCI. The fermentation temperature was 39°C. A minimum concentration of 15% dissolved oxygen (PO 2 ) was achieved by automatic cascading of the stirrer (ranging from 400 rpm to 1000 rpm) and the airflow at levels higher that 1 wm. Antifoam (Basildon) was added manually as needed.

Fermentations can be batch processes, but are preferably carbohydrate-limited, fed-batch processes. Therefore a defined VF fermentation feed solution (see above) was provided to the reactor after consumption of the initial glucose which was usually the case after 6-8 hours process time. At that time, a constant addition of the feed solution was initiated at a rate of 84 g/h.

Determination of Panthenol, Pantothenate, Pantoate, Aminopropanol, and THMP (2,3,4 Trihydroxy, 3 Methyl Pentane)

The amount of panthenol, pantothenate, pantoate, aminopropanol, and THMP was determined by 1 H NMR spectroscopy as follows: to 500 μl of supernatant was added 500 μl of a standard solution containing an exactly known amount of maleic acid (5.607 g/l). After lyophilization and re-dissolution into 650 μl D 2 O, the 1 H NMR spectrum was measured at 600 MHz at 300 K on a Bruker Avance 600 spectrometer. The relaxation delay was adjusted to 30 seconds, to ensure complete relaxation between scans. A total amount of 16 scans was measured. From the ratio between the integrals from the methyl resonances of the compound in question, the exact amount of those components present was calculated.

EXAMPLE 1

This example describes the construction of the pantothenate-overproducing strain PA12.

Polymerase Chain Reaction (PCR) was used to generate a deletion mutation in the promoter region of the panBCD operon of a B. subtilis prototroph strain 1A747, in which a 215 bp-long nucleotide region between birA and panB was replaced with the chloramphenicol resistance (cat) cassette from Staphylococcus aureus (GeneBank M58515). To do this, the cat cassette was first introduced between the Nhe\ and C/al sites of the pBR322 plasmid (GeneBank J01749) in an orientation opposite to the transcriptional direction of panB. Two PCR fragment ,,arms" were then generated: 0.2 μl of a 100 mM solution of primer panB/up2/for/R1 and panB/up2/rev/Clal or primers panB/down2/for/Nhel and panB/down2/rev/Bam (Table 1) were added to 0.1 μg 1A747 chromosomal DNA in a 50 μl reaction volume containing 1 μl of 40 mM dNTP's, 5 μl of 10X buffer and 0.75 μl PCR enzyme (Taq and Tgo), as described by the manufacturer (Expand High fidelity PCR System-Roche Applied Science). The PCR reaction was performed for 30 cycles, using an annealing temperature of 58 °C and an elongation time of 60 seconds. The resulting fragments called F1 and F2, respectively, were purified, and inserted sequentially, respectively between the EcoRI and C/al sites (for F1 ) and the Nhe\ and BamHI sites (for F2) of pBR322. Ligated DNA was transformed into E. coli TOP10 cells (Invitrogen), selecting for ampicillin-resistance at 100 μg/ml concentration. This resulted in the E. coli

plasmid pPA5. The ApanB p ::cat deletion cassette was then introduced into the chromosome of B. subtilis 1 A747 by DNA transformation, selecting for chloramphenicol-resistance (Cm r ) on TBAB agar plates containing 5 μg/ml chloramphenicol (Cm) using standard conditions. A single Cm r colony containing a deletion in the panB promoter region was isolated and named PA1

(ApanBp.:cat). As expected PA1 was also a pantothenate auxotroph (Pan " ), which requires pantothenate for growth on minimal medium. The deletion mutation was confirmed by diagnostic PCR using panB/up2/for/R1 and panB/down2/rev/Bam primers (Table 1), again using standard reaction conditions. Table 1. Primers used to generate a B. subtilis strain containing a ApanB p ::cat deletion mutation.

Name Nucleotide sequence (5'>3') SEQ ID NO: cat/for/Nhel ATGCGCTAGCCGAAAATTGGATAAAGTGGG 1 cat/rev/Clal ATGCATCGATAAGTACAGTCGGCATTATCTCATA 2 panB/up2/for/R1 ATGCGAATTCGGGTATGGCATTCTCAAGAAGG 3 panB/down2/rev/Bam ATGCGGATCCGCCGTCAAGCACTGTCTGG 4 panB/up2/rev/Clal ATGCATCGATGGAAGTATACCAAAATCAACGG 5 panB/down2/for/Nhel ATGCGCTAGCATGAAAACAAAACTGGATTTTC 6

The next step was to introduce a strong constitutive promoter upstream of the panB gene. Such promoters have been described in the literature, including those derived from the SP01 bacteriophage of S. subtilis, P 15 and P 2 Q (Lee et al., 1980). Long Flanking Homology Polymerase Chain Reaction (LFH-PCR) (Wach, 1996) was used to generate DNA fragments containing P 15 upstream of the ribosome binding site (RBS) of panB. To do this, two PCR fragment ,,arms" were first created: 0.2 μl of a 100 mM solution of primer Pi panBCD and P2panBCD or primers P3panBCD and P4panBCD (Table 2) were added to 0.1 μg 1A747 chromosomal DNA in a 50 μl reaction volume containing 1 μl of 40 mM dNTP's, 5 μl of 10X buffer and 0.75 μl PCR enzyme (Taq and Tgo), as described by the manufacturer (Expand High fidelity PCR System-Roche Applied Science). The

PCR reaction was performed for 30 cycles using an annealing temperature of 55.7 °C and an elongation time of 45 seconds. The resulting fragments called F3 and F4 respectively, were purified and used as primers in a second round of PCR. F3 and F4 fragments were diluted 50-fold and 1 μl of each was added to 0.1 μg of linearized plasmid pXI23roDTD-SPO1-15 (containing the P 15 promoter) in a 50 μl reaction volume. In the first 10 cycles, an annealing temperature of 63 °C and an elongation time of 6 minutes was used. In the next 20 cycles, the elongation time was extended by 20 seconds after each cycle. The resulting products were then used in a third round of PCR as a template. The PCR products were diluted 50- fold and 1 μl was combined with 0.2 μl of a 100 mM solution of primer Pi panBCD and P4panBCD in a 50 μl reaction volume containing dNTP's, buffer, and enzyme as described above. The PCR reaction parameters were identical to those used in the second round PCR. The finished PCR fragments were next transformed into the panB promoter-deleted strain PA1 by DNA transformation, selecting for pantothenate prototrophy (Pan + ) on minimal medium agar plates using standard conditions. These Pan + colonies were also chloramphenicol sensitive (Cm s ), confirming the insertion of the promoter cassette. A single Pan + Cm s colony containing a panBCD operon expressed from the P 15 promoter was isolated and named PA12 [P 15 panBCD). The presence of the P 15 promoter upstream of panB gene was confirmed by diagnostic PCR using P15seq and P4panBCD primers (Table 2), again using standard reaction conditions.

Table 2. Primers used to generate a B. subtilis strain containing a P 15 panBCD expression cassette.

Name Nucleotide sequence (5'>3') SEQ ID

NO:

P1panBCD CCTTATTGAATTATTTTCTCAGGCCG 7

P2panBCD GGACTGATCTCCAAGCGATGGATGGAAGTATACCAAAATCAACGGC 8

P3panBCD TCGAGAATTAAAGGAGGGTTTCATATGAAAACAAAACTGGATTTTCT 9

P4panBCD CGGATATGCTTCAAAATCTTCATTAGG 10

P15seq CTACTATTTCAACACAGCTATCTGC 11

EXAMPLE 2

This example describes the construction of the pantothenate-overproducing strain PA49.

To construct a strain that also contained a strong constitutive promoter upstream of the panE gene (ylbQ), a deletion mutation was first constructed. Inspection of the panE gene reveals two potential start sites: Start Site 1 (5' - AAATTGGGTG - 3' (RBS)- 7 nt - ATG) that overlaps a BspH\ site and is 33 bp upstream from Start Site 2 (5 1 - GGAGG - 3' (RBS) - 5 nt - TTG) that overlaps a SsaXI site. Consequently, a 219 bp deletion of the panE/ylbQ promoter region was constructed by LFH-PCR using a S. aureus erythromycin resistance (Em r ) gene (GenBank V01278). To do this, two PCR fragment ,,arms" were first created: 0.2 μl of a 100 mM solution of primer Pi panE and P2panE/Er or primers P3panE/Er/2 and P4panE (Table 3) were added to 0.1 μg 1A747 chromosomal DNA in a 50 μl reaction volume containing 1 μl of 40 mM dNTP's, 5 μl of 10X buffer and 0.75 μl PCR enzyme (Taq and Tgo), as described by the manufacture (Expand High fidelity PCR System-Roche Applied Science). The PCR reaction was performed for 30 cycles using an annealing temperature of 55.7°C and an elongation time of 45 seconds. The resulting fragments, called F1 and F2 respectively, were purified and used as primers in a second round of PCR. F1 and F2 fragments were diluted 50-fold and 1 μl of each was added to 0.1 μg of linearized plasmid pDG646 (containing the erm cassette; Guerout-Fleury et al., 1995) in a 50 μl reaction volume. In the first 10 cycles, an annealing temperature of 63 0 C and an elongation time of 6 minutes was used. In the next 20 cycles, the elongation time was extended by 20 seconds after each cycle. The resulting products were then used in a third round of PCR as a template. The PCR products were diluted 50- fold and 1 μl was combined with 0.2 μl of a 100 mM solution of primer Pi panE and P4panE in a 50 μl reaction volume containing dNTP's, buffer, and enzyme as described above. The PCR reaction parameters were identical to those used in the second round PCR. The finished PCR fragments were next transformed into PA4 (Trp + colonies obtained from B. subtilis CU550 trpC2 HvC4 leu-124 by transformation with 1 A747 chromosomal DNA) resulted in Em r colonies that were pantothenate auxotrophs. This strain was called PA5 (Apart E p ::erm HvC leuC). Diagnostic PCR was used to confirm the structure of the deletion. Subsequently, the panB promoter deletion was introduced into PA5 by transformation of PA1

chromosomal DNA at non-congressional concentration to generate PA6 (HvC leυC ApanBp.-.cat δpanE p ::erm).

Table 3. Primers used to generate a S. subtilis strain containing a ApanE p ::ermt deletion mutation.

Name Nucleotide sequence (5'>3') SEQ ID

NO:

PipanE GGCAGCCTGTGGTTTCAGGTGG 12

P2panE/Er ATTATGTCTTTTGCGCAGTCGGCCGTCTGCTTATCAACTATAAAA 13

CGC

P3panE/Er CATTCAATTTTGAGGGTTGCCAGGCCTATTATTTGTCACTTTATC 14

/2 ACG

P4panE CCAGTCTTTCGCGCCACATGTCC 15

The next step was to introduce simultaneously strong constitutive P 15 promoters upstream of both panB and panE. LFH-PCR was used again to generate DNA fragments containing Pj 5 upstream of the open reading frame of panB and containing P 15 upstream of the open reading frame of panE. To do this, two PCR fragment ,,arms" were created for panB and for panE using primers P1 panB and P2panB/P15 (F1 ) and primers P3panB/P15 and P4panB (F2) (Tables 1 and 2, P 15 panB construction), and Pi panE and P2panE/P15 (F1 ) and P3panE/P15 and P4panE (F2) (Tables 3 and 4, P 15 panE construction), using the same PCR protocol used to construct PA12 (see above).

Table 4. Primers used to generate a B. subtilis strain containing a Pi 5 panE expression cassette.

Name Nucleotide sequence (5'>3') SEQ ID

NO:

P2panE/P1 GGACTGATCTCCAAGCGATGGGAATTTTTTAAATAAAGCG 16

5 TTTACAATAT

P3panE/P1 TCGAGAATTAAAGGAGGGTTTCATATGAAAATTGGAATTA 17

5 TCGGCGGAG

The finished Pi δ panB and Pi 5 panE PCR fragments were then transformed together into the panB and panE promoter-deleted strain PA6 (HvC leuC ApanB p ::cat ApanE p ::erm) by DNA transformation, selecting for pantothenate prototrophy (Pan + ) on minimal medium agar plates using standard conditions. Recovered Pan + colonies were also Cm s and erythromycin sensitive (Em s ), confirming the insertion of the promoter cassettes. A single Pan + Cm s Em s colony containing both panBCD operon and panE gene expressed from the P 15 promoter was isolated and named PA32. The presence of the P 15 promoter upstream of panB gene was confirmed by diagnostic PCR using P15seq and P4panB primers (Tables 1 and 2), again using standard reaction conditions. An identical control was performed on the panE gene using P15seq and P4panE primers (Tables 3 and 4). Subsequent sequencing of the P 15 promoter in front of panE, however, revealed a partial deletion of the P 15 promoter.

To replace the partially deleted Pi 5 panE gene with the correct construction, the ApanE p ::erm mutation was re-introduced into PA32 by DNA transformation using chromosomal DNA from PA5 (ApanE p ::erm HvC leuC) and selecting for erythromycin-resistance. This resulted in strain PA41 (P 15 panBCD ApanE p ::erm HvC leuC). P 15 panE DNA fragments, generated by LFH-PCR as described before, were then transformed into PA41 , selecting for Pan + prototrophs. This resulted in strain PA43 (HvC leuC P 15 panBCD P 15 panE). This Hv " Leu " auxotrophic strain was then transduced to Nv + Leu + prototrophy using a PBS1 phage lysate prepared on wild-type B. subtilis 1A747, using standard procedures. This resulted in strain PA49 (P 15 panBCD P 15 panE).

EXAMPLE 3

This example describes the construction of strain PA112, a derivative of PA49 that contains a deletion of panC.

Long Flanking Homology Polymerase Chain Reaction (LFH-PCR) was used to generate a deletion mutation in the coding region of the panC open reading frame of the panBCD operon, in which a 487 bp-long nucleotide region of panC was replaced with the chloramphenicol (cat) resistance cassette from Staphylococcus aureus (GenBank M58515). To do this, two PCR fragment ,,arms" were first created: 0.2 μl of a 100 μM solution of primers Pi panC and P2panC-cat or primers P3panC and P4panC-cat (Table 5) were added to 0.1 μg MKl Al chromosomal DNA in a 50 μl reaction volume containing 1 μl of 40 mM dNTP's, 5 μl of 10X buffer and 0.75 μl PCR enzyme (Taq and Tgo), as described by the manufacturer (Expand High fidelity PCR System-Roche Applied Science). The PCR reaction was performed for 30 cycles using an annealing temperature of 55.7 °C and an elongation time of 45 seconds. The resulting fragments, called F1 and F2 respectively, were purified and used as primers in a second round of PCR. F1 and F2 fragments were diluted 50-fold and 1 μl of each was added to 0.1 μg of linearized plasmid pPA4 (containing the cat cassette) in a 50 μl reaction volume. In the first 10 cycles, an annealing temperature of 63 °C and an elongation time of 3 minutes was used. In the next 20 cycles, the elongation time was extended by 20 seconds after each cycle. The resulting products were then used in a third round of PCR as a template. The PCR products were diluted 50-fold and 1 μl was combined with 0.2 μl of a 100 μM solution of primer Pi panC and P4panC in a 50 μl reaction volume containing dNTP's, buffer, and enzyme as described above. The PCR reaction parameters were identical to those used in the second round PCR. The finished PCR fragments were next transformed into the pantothenate overexpressing strain PA49, selecting for chloramphenicol resistance on TBAB medium (Cm r ). A single Cm r colony deleted for panC was isolated and named PA112 (P wt panBAC::catD). The presence of the cat cassette was confirmed by diagnostic PCR using Pi panC and P4panC, again using standard reaction conditions. Phenotypically, PA112 was unable to grow on minimal medium (MM) supplemented with either 1 mM pantoate or 1 mM pantoate plus 1 mM β-alanine, but grew normally on MM with 1 mM pantothenate. In shake flask cultures, PA112 grew poorly with either 1 μM or 10 μM pantothenate, but normally when the pantothenate supplement was increased to 100 μM or 1 mM.

Table 5. Primers used to generate a ApanC/.cat deletion mutation

Name Nucleotide sequence (5'>3') SEQ ID

NO:

PipanC GAGACAGATTACTGATATTTCACAGC 18

P2panC-cat CCCACTTTATCCAATTTTCGAACACGTCTGTGCGTCTTTC 19

P3panC-cat TAACCTGCCCCGTTAGTTGAACGAGAAATGGAGAGAATAT 20

AATATG

P4panC TCAGAACAGCCACTTTCGGC 21

Underlined sequences were homologous with panC region

EXAMPLE 4

This example describes the construction of strain PA121 , a derivative of PA49 that contains a deletion of panCD.

Long Flanking Homology Polymerase Chain Reaction (LFH-PCR) was used to generate a deletion mutation encompassing the coding regions of the panC and panD open reading frames of the panBCD operon, in which an 874 bp-long nucleotide region of panC and panD was replaced with the chloramphenicol (cat) resistance cassette from Staphylococcus aureus (GenBank M58515). To do this, two PCR fragment ..arms" were first created: 0.2 μl of a 100 μM solution of primers P1 panC and P2panC-cat or primers P3panD-cat and P4panD (Table 6) were added to 0.1 μg 1A747 chromosomal DNA in a 50 μl reaction volume containing 1 μl of 40 mM dNTP's, 5 μl of 10X buffer and 0.75 μl PCR enzyme (Taq and Tgo), as described by the manufacturer (Expand High fidelity PCR System-Roche Applied Science). The PCR reaction was performed for 30 cycles using an annealing temperature of 55.7 °C and an elongation time of 45 seconds. The resulting fragments, called F1 ' and F2' respectively, were purified and next used as primers in a second round of PCR. F1' and F2' fragments were diluted 50-fold and 1 μl of each was added to 0.1 μg of linearized plasmid pPA4 (containing the cat cassette) in a 50 μl reaction volume. In the first 10 cycles, an annealing

temperature of 63 °C and an elongation time of 5 minutes was used. In the next 20 cycles, the elongation time was extended by 20 seconds after each cycle. The resulting products were then used in a third round of PCR as a template. The PCR products were diluted 50-fold and 1 μl was combined with 0.2 μl of a 100 μM solution of primer Pi panC and P4panD in a 50 μl reaction volume containing dNTP's, buffer, and enzyme as described above. The PCR reaction parameters were identical to those used in the second round PCR. The finished PCR fragments were transformed into the pantothenate overexpressing strain PA49, selecting for chloramphenicol resistance on TBAB medium (Cm r ). A single Cm r colony deleted for panCD was isolated and named PA121 (P^ panBδCD::cat). The presence of the cat cassette was confirmed by diagnostic PCR using P1 panC and P4panD, again using standard reaction conditions. As for strain PA112, strain PA121 was phenotypically unable to grow on minimal medium (MM) supplemented with either 1 mM pantoate or 1 mM pantoate plus 1 mM β-alanine, but grew normally on MM with 1 mM pantothenate. In shake flask cultures, PA121 grew poorly with either 1 μM or 10 μM pantothenate, but normally when the pantothenate supplement was increased to 100 μM or 1 mM.

Table 6. Primers used to generate a ApanCD::cat deletion mutation

Name Nucleotide sequence (5'>3') SEQ ID

NO:

PipanC GAGACAGATTACTGATATTTCACAGC 18

P2panC- CCCACTTTATCCAATTTTCGAACACGTCTGTGCGTCTTTC 19 cat

P3panD- TAACCTGCCCCGTTAGTTGAACGAACCAGCCCGTACAATTTTG 22 cat

P4panD GATTAGAGATTCCAGTAAGCTGCTC 23

Underlined sequences were homologouswith panCD region

EXAMPLE 5

This example describes the construction of the pantothenate-overproducing strain PA73.

LFH-PCR was used to generate DNA fragments containing a P 26 promoter upstream of HvD. Two PCR fragment ,,arms" were first amplified using primers P1/ilvD/for and P2/ilvD/f/26 for F1 arm and primers P3/ilvD/r/26 and P4/ilvD/rev (F2 arm) (Table 7). The template was chromosomal DNA of 1A747. The resulting F1 and F2 arms were used as primers in a second round of PCR with linearized plasmid pUC18SP01-26 (containing the P 26 promoter). The resulting F1-P 26 -F2 LFH-PCR product was amplified with primers P1/ilvD/for and P4/ilvD/rev (Table 7) in a third round of PCR. F1-P 26 -F2 LFH-PCR fragment containing P 26 HvD was transformed into the HvD promoter deleted strain PA24 (δilvDv.spec) resulting in PA27 (P 26 HvD). P 26 HvD was introduced into the HvD promoter deleted strain PA60 (P 15 panBCD P 15 panE AilvD/.spec) by transduction with PBS1 lysate from PA27. HvD prototrophic and spectinomycin sensitive (Spec s ) colonies were selected on minimal agar plates. The resulting strain PA62 (Pi 5 panBCD Pi 5 panE P 26 ilvD G320D ) carried a single point mutation within the HvD coding region, which caused a GIy- to-Asp amino acid change in residue 320. The HvD coding sequence was then restored to wild-type by first removing an internal segment of the HvD gene encompassing this mutation using LFH-PCR. Two PCR fragment ,,arms" were amplified with primers P1c/ilvD/for and P2c/ilvD/cat for F1 arm and primers P3c/ilvD/cat and P4c/ilvD/rev for F2 arm (Table 7). The template DNA was chromosomal DNA of 1A747. The resulting F1 and F2 arms were used as primers in a second round of PCR with linearized plasmid pTH5 (containing the cat cassette; GenBank M58515). F1-cat-F2 LFH-PCR fragment was transformed into PA62, and the Cm' and NvD " auxotroph strain PA64 (P 15 panBCD P 15 panE P 26 AilvD::cat) was selected. Diagnostic PCR was used to confirm the structure of the deletion. Strain PA64 was then converted to prototrophy using chromosomal DNA of wild-type strain 1A747. In the resulting strain PA73 (P 15 panBCD P-, 5 panE P 26 HvD), the presence of the P 26 promoter upstream of HvD and the absence of the cat gene was confirmed by diagnostic PCR using P26seq and P4/ilvD/rev primers (Table 7).

Table 7. Primers used to generate AilvDv.spec deletion mutation and P26-driven overexpression of HvD

Name Nucleotide sequence (5'>3') SEQ ID

NO:

P1/ilvD/for AAACCTGAGCAAGCAGAAGGCGCA

P2/ilvD/r/sp ACATGTATTCACGAACGAAAATCGACATGATCTGCACCTTTT 25

TTATCTTTATTCG

P3/ilvD/f/SD ATTTTAGAAAACAATAAACCCTTGCAATGGCAGAATTACGCA 26 GTAATATGAT 27

P4/ilvD/rev AAATGAAGCGCTCCTTCTTTCTTCG

OQ

P1c/ilvD/for ATGGCAGAATTACGCAGTAATATGAT

P2c/ilvD/cat CCCACTTTATCCAATTTTCGCGTCGGAATGTTGATGCGCATT 29

G

P3c/ilvD/cat TAACCTGCCCCGTTAGTTGAACGGCGTACAGAATGGGATTAC 30

AAG

P4c/ilvD/rev GCACTTGTCACAAGTTTAGAATAACG 31

P2/ilvD/f/26 GGACTGATCTCCAAGCGATGGCATGATCTGCACCTTTTTTAT 32 CTTTATTCG

P3/ilvD/r/26 TCGAGAATTAAAGGAGGGTTTCATATGGCAGAATTACGCAGT 33

AATATGAT

P26seq CTACTATTTCAACACAGCTATCTGC 34

Underlined sequences were homologue with HvD region

EXAMPLE 6

This example describes the construction of PA207, a derivative of PA12 that contains a deletion of the panD gene.

A strain with a P 15 panBCδpanDv.spec operon was constructed in two steps.

First the panD deletion cassette was transformed into strain PA1 that contained a deletion of the panB leader region. Long Flanking Homology Polymerase Chain Reaction (LFH-PCR) was used to generate a deletion mutation in the coding region of the panD open reading frame of the panBCD operon, in which the nucleotide region of panD was replaced by the adenyltransferase cassette from Staphylococcus aureus (Accession number XO3216) conferring resistance to spectinomycin. To do this, two PCR fragment ,,arms" were first created: 0.2 μl of a 100 μM solution of primers Pi panD and P2panD-spec or primers P3panD-spec and P4panDb (Table 8) were added to 0.1 μg 1A747 chromosomal DNA in a 50 μl reaction volume containing 1 μl of 40 mM dNTP's, 5 μl of 10X buffer and 0.75 μl PCR enzyme (Taq and Tgo), as described by the manufacturer (Expand High fidelity PCR System-Roche Applied Science). The PCR reaction was performed for 30 cycles using an annealing temperature of 55.7 °C and an elongation time of 45 seconds. The resulting fragments, called F1 and F2 respectively, were purified and used as primers in a second round of PCR. F1 and F2 fragments were diluted 50-fold and 1 μl of each was added to 0.1 μg of linearized plasmid pDG1726 (containing the spec cassette) in a 50 μl reaction volume. In the first 10 cycles, an annealing temperature of 63 °C and an elongation time of 3 minutes was used. In the next 20 cycles, the elongation time was extended by 20 seconds after each cycle. The resulting products were then used in a third round of PCR as a template. The PCR products were diluted 50-fold and 1 μl was combined with 0.2 μl of a 100 μM solution of primers Pi panD and P4panD in a 50 μl reaction volume containing dNTP's, buffer, and enzyme as described above. The PCR reaction parameters were identical to those used in the second round PCR. The finished PCR fragments were then transformed into the strain PA1 , selecting for spectinomycin resistance on TBAB medium (Sp r ). A single Sp r colony deleted for panD was isolated and named PA203. A DNA fragment containing the P1 5 promoter (see construction of PA12) was then transformed into strain PA203 to re-construct the engineered Pi 5 panBCδD operon. Cells containing this operon were selected by recovering for Pan + prototrophy and loss of chloramphenicol resistance. This resulted in strain PA207. Phenotypic analysis indicated that PA207 was a β-alanine bradyotroph. The presence of the spec cassette was confirmed by diagnostic PCR using Pi panD and P4panDb, again using standard reaction conditions.

Table 8. Primers used to generate a δpanD::spec deletion mutation

Name Nucleotide sequence (5'>3') SEQID NO:

PipanD CCGATGCCTGGAGGAGCTTC 35

P2panD- ACATGTATTCACGAACGAAAATCGAAAGAAAAGCC 36

Spec CCCTTTATCGGGG

P3panD- ATTTTAGAAAACAATAAACCCTTGCAATTATATTC 37 spec TCTCCATTTCTCGAATATC

P4panDb CGCGCATTGATGAAACCATCGAAAC 38

EXAMPLE 7

This example demonstrates the production of panthenol, by feeding 3- aminopropanol to strains PA49, PA73, PA112, PA121 , and PA207.

Overnight cultures of PA112, PA121 , and PA207 were grown at 37° C and diluted 1 :100 into 200 ml of freshly prepared SMG medium. Three 40 ml aliquots of each culture were then transferred to 250 ml flasks containing styroform stoppers. A HCI-neutralized solution of 3-aminopropanol (pH 7.2) was added to each flask to a final concentration of 40 g/l. Growth was resumed at 37° C for 72 hours at which time cells were removed by centrifugation and supematants sterile filtered. As controls, pantoate and 3-aminopropanol were added to culture medium without cells and incubated for 72 hours at 37° C. Panthenol, pantoate, and pantothenate levels were measured by NMR and the results are summarized in Table 9. Production of panthenol is clearly detected strains PA49, PA73, and PA207. Strains PA112 and PA121 containing a deletion of panC did not produce panthenol. No spontaneous formation of panthenol was detected when pantoate and 3-aminopropanol were incubated in culture medium (no cells) for 72 hours. These results indicate that the PanC enzyme, which normally couples pantoate and β-alanine to form pantothenate, can also couple pantoate and 3- aminopropanol to form panthenol. Obviously, the enzymatic properties of PanC to catalyze the conversion of pantoate and 3-aminopropanol to panthenol can be

greatly improved using methods (e.g. PCR mutagenesis, protein evolution) well known to those skilled in the art.

Table 9. Production of panthenol in various pantothenate production strains grown in the presence of 40 g/liter aminopropanol.

Strain Genotype 3-Amino- Pantothenate Pantoate Panthenol propanol (g/liter) a (g/liter) a (g/liter) a

(g/liter) a

PA49 P 15 panBCD 25.1 4.9 0.2 0.04 P 15 panE

PA73 P 15 panBCD 25.0 5.4 0.2 0.06 P 15 panE P 2β HvD

PA112 b P 15 panB[AC]D 24.5 0.6 0.3 0.00 P 15 panE

PA121 b P 15 panB[δCD] 23.0 0.6 0.4 0.00 P 15 panE

PA207 Pis 23.5 0.1 0.3 0.05 panBCApanD: : spec P 15 panE average of three samples. b 11 mmMM ppaannttothenate added to cultures since PA112 and PA121 are pantothenate auxotrophs.

EXAMPLE 8

This example demonstrates the production of panthenol, by feeding 3- aminopropanol and pantoate to strain PA207 in a stirred tank reactor using a fed- batch operation mode.

Strain PA 207 was grown in standard glucose limited fed-batch fermentation for 71 hours. After the initial ~6h of batch phase, fed batch phase was started using

80% glucose fed in the range of 84 and 95 g/h. After 25h of fermentation time, a 98% solution of 3-aminopropanol was supplied with an average rate of 14 g/h over 22h. Ten hours after 3-aminopropanol feeding started, a 41.5% pantoate solution was added at average rate of 26g/h for approximately 16h.

As shown in Table 10, panthenol was clearly detected by NMR when both pantoate and 3-aminopropanol were co-fed to the fermentation.

Table 10. Production of panthenol in pantoate and 3-aminopropanol co-fed fermentation of strain PA207 (PA49 ApanD/.spec)

Time 3 3--AAmmiinnoo-- Pantothenate Pantoate Panthenol propanol

(g/liter) a (g/liter) a (g/liter) a

(g/literf

6.6 0.0 0.01 0.1 0.00

24.4 0.0 0.03 0.9 0.00

30.6 10.2 0.02 1.65 0.00

47.0 25.5 0.00 14.2 0.05

54.7 24.1 0.33 13.6 0.21

71.0 20.6 0.44 11.6 0.14

average of three samples.




 
Previous Patent: CHAMBER FILTER PLATE

Next Patent: VACUUM DRY BOX