FIELD OF THE INVENTION [0001] The present disclosure provides a process for genetic transformation in Withania somnifera to produce hardened plants with increased secondary metabolite content. More specifically^ the present disclosure relates to genetic transformation in W. somnifera plants by Agrobacterium tumefaciens to overexpress squalene synthase gene (^sSQS) encoding ff¾SQS enzyme that catalyzes synthesis of squalene from farnesyl pyrophosphate (FPP). Increased content of secondary metabolites, particularly withanolides are obtained.

BACKGROUND OF THE INVENTION

[0002] Isoprenoid biosynthesis is an important cellular metabolic pathway and is responsible for synthesis of structurally diverse and biologically active class of compounds called terpenoids, which includes sterols, steroidal sapogenins, alkaloids and lactones in plants. Withanolides is a group of natural ly occurring steroidal lactones commonly present in members of Solana eae, Majority of secondary metabolites (SMs) concentrated in Withania somnifera are responsible for defence, signall ing, flavour, fragrance, hormonal, antibiotic, insecticidal, pharmacological and therapeutic efficiencies. Withania somnifera (L.) Dunal, commonly known as Indian ginseng, is principally recognized for its medicinal value in Ayurveda. Biological activity of withanolides, especial ly withanol ide A and withaferin A have been studied extensively for their anti-cancerous properties (Jayaprakasam et al. 2003 ; lchikawa et al. 2006). Plant extracts from different tissues are found effective in treatment of arthritis, geriatric problems, nervous and venereal disorders. Withanolides have been widely studied for their antioxidant, anti-inflammatory, immunomodulation, antiserotogenic, adaptogenic, rejuvenating effect and for protection against carbon tetrachloride induced hepatotoxicity. Some withanolides have been found associated with dendrite extension (Tohda et al. 2000) and inducing neurite outgrowth in human neuroblastoma SH-SY5Y cel ls (Zhao et al. 2002).

[0003J Withanol ides are organ ic compounds characterized by C ₂ g ergostane type steroid backbone and a side chain of C9 units of which a distinctive feature is the six- membered lactone ring which accounts for the plant biological efficacies. The basic skeleton of a withanolide is defined as a 22-hydroxyergostan-26-oic acid-26, 22- Iactone and are classified on the basis of their structural variations derived by modifications either on the carbocyclic skeleton or side chain. Currently more than 40 withanolides and several sitoindosides (withanolides with glucose molecule at C-27) have been isolated from aerial parts, roots and berries of Withania species.

[0004] Withania somnifera is a slow growing shrub requiring dry conditions and produces minimal quantity of withanolides which are found to be local ized mainly in leaves and roots with concentration ranging from 0.001 - 0.5% dry weight ( irjalili et al. 2009). Such miniscule concentrations of withanolides are incapable of accomplishing the tremendously increasing economic demand for medicinal formulations.

[0005] Alternatively, chemical synthesis of withanolides have been attempted (Koyganko and Kashkan 1997; Gamoh et al. 1984; Jana et al. 201 1 ), but it requires extensive experimentation due to the structural complexities and specific stereochemical requirements of the compounds resulting in low yield, hence the process is not feasible for secondary metabolite production.

[0006] Grover et al {J Biosci Bioeng. 2013 Jim; 115(6):680-5) reports enhanced withanolide production by overexpression of SQS in Withania somnifera using Agrobacterium tumefaciens as the vector system. Callus cell suspension cultures after transformation were assessed for significant 4-fold increase in squalene synthase activity and 2.5-fold increase in vvithanol ide A content. However, efforts to involve tissue culture techniques in plant biotransformation may result in failure to produce metabolites in sufficient quantity as unorganized tissue cultures are unable to produce secondary metabolites at the same levels as an intact plant. Callus is a chimeric tissue, thus reducing the complete effect of the number of cells actually contributing in withanolide production. The fate of developing cells is also unknown, thus providing no idea about the specific tissue contributing for the production of secondary metabolites

[0007J There are few reports on plant cell and hairy root cultures developed for the production of the important metabolites from Withania extracts (Murthy et al. 2008; Roja et al. 1991 ), although withanol ide production by in vitro cultures is stil l far from the levels required for economic exploitation. Moreover, an important constraint in the commercial utilization of hairy root culture is development and up-scaling of appropriate vessels for the delicate and sensitive hairy roots.

[0008] Agrobacterium tumefaciens mediated transformation in Withania somnifera plants is performed by Pandey et al, by employing A. tumefaciens strain LBA4404, containing binary vector plG 12 1 Hm to obtain transgenic plants. However, absence of a functional gene in the expression vector system and minimum transformation efficiency reduces the applicabi lity of this method.

[0009] However, these limitations can be addressed by analysing the biosynthetic pathway of withanolides (described in Fig. 1 ) and employing genetic engineering as a tool to manipulate crucial steps of the metabolic network to increase the yield of withanolide.

[00010] The first committed step which diverts the carbon flux away from the central isoprenoid pathway towards withanolide biosynthesis is squalene formation from farnesyl pyrophosphate (FPP); catalysed by a 47 kDa membrane associated enzyme, squalene synthase (SQS; EC 2.5.1 .2 1 ) (Abe et al. 1993). The substrate for this enzyme originates from isoprenoid biosynthetic pathway and can be channel led by metabolic engineering towards squalene accumulation which is the first precursor of triterpenoids. [00011] SQS catalyses condensation of two FPP molecules to produce presqualene diphosphate (PSPP) and then converts PSPP to squalene in presence of NADPH and Mg ²⁺ . Squalene oxidizes in presence of NADPH-linked oxide to afford squalene 2, 3- epoxide subsequently cyclizing into lanosterol which serves as a backbone structure for various steroidal triterpenoids. ( irja! ili et al. 2009).

[00012] SQS being a regulatory branch point enzyme, has attracted considerable interest as a possible genetic engineering target by blocking a competing branch pathway to promote secondary metabolite biosynthesis in plants. Many approaches have been investigated to understand the regulatory role of SQS in sterol biosynthesis using SQS mutants (Karst and Lacroute, 1977; Tozawa et al., 1999), fungal elicitors (Devarenne et al., 1 998; Threlfall and Whitehead, 1 988; Vo ^' geli and Chappell, 1988) and speci fic inhibitors of SQS (Baxter et al., 1992; Bergstrom et al., 1993; Wentzinger et al., 2002). The effect of S^SOverexpression on accumulation of SMs were studied in Panax ginseng (Lee et al., 2004) and Ele theroeoccus senlicosus (Seo et al., 2005), and similar study was also performed in Glycyrrhiza uralensis via i-mediated transformation (Lu et al., 2008).

[00013] Bearing in mind the minimal concentration of withanolides in plant tissue and the disadvantages posed by chemical synthesis and tissue culture techniques to increase secondary metabol ite production in Wilhania somnifera, the present inventors have developed a transformation process overexpressing f^SQS gene encoding squalene synthase in intact plants of W. somnifera thereby conserving the germplasm of W. somnifera, with considerable increase in vv ithanolide content in all plant tissues.

ABBREVIATIONS

SQS : Squalene synthase (f-sSQS: Wilhania somnifera Squalene synthase

FPP: Farnesyl pyrophosphate PSPP: Presqualene diphosphate SM : Secondary Metabolite

MS: Murashige & Skoog medium

SUMMARY OF THE INVENTION

[00014] The present disclosure provides a process for genetic transformation in Withania somnifera to produce hardened plants with enhanced secondary metabolite content.

[00015] In an aspect, the present disclosure provides a process for transformation in Withania somnifera plants employing an expression vector system carrying WsSQS gene having SEQ I D NO. 1 to cultivate hardened Withania somnifera plants, with increased secondary metabolite content comprising: a) immersing pre-cultured explants in a bacterial suspension for 10-20 mins and co-cultivating with transformant cells for 24- 48 h in dark; b) transferring cells to prol iferation medium containing cefotaxime for ten days; c) confirming expression of the inserted gene in transformed tissues by Gus assay followed by transferring Gus positive explants to hygromycin B selection medium; d) maintaining hygromycin B-resistant Gus-positive shoots on selection medium with reduced cefotaxime concentration; and

e) sub-culturing shoots of transformed explants on rooting medium and subjecting transformed plantlets to greenhouse conditions.

[00016) Accordingly. Agrobacterium tumefaciens mediated transformation in W. somnifera plants results in overexpression of squalene synthase gene ( ff.sSQS) resu lting in enhanced concentration of secondary metabolites. |00017] In another aspect, the present disclosure provides A. lumefaciens harbouring plasmid/binary vector pCA BIA 1 301 containing T-DNA construct for W. somnifera plant transformation.

100018] In yet another aspect, the disclosure provides a process of enhancing the yield of withanolides including withaferin-A, withanolide A and B and Withanone from W, somnifera characterized by the transformation process, wherein the transformation process comprises co-cultivating explants with Agrobacterium t mefaciens carrying ff¾SQS to obtain transformed, hardened W. somnifera plants.

[00019] In an aspect, the present disclosure provides a transgenic plant or parts thereof, including seeds comprising a nuclear genome encoded nucleotide sequence as set forth in SEQ ID NO. I .

[00020] In an aspect, the present disclosure provides a cDNA having nucleotide sequence as set forth in SEQ ID NO. I . BRIEF DESCRIPTION OF ACCOMPANYING FIGURES

[00021 ] Figure I depicts a simplified scheme of withanolide biosynthetic pathway.

[00022] Figure 2 depicts T-DNA construct prepared and cloned into pCAMBIA 1 301 vector for plant transformation. CaMV 35S: Cauliflower mosaic virus 35S rRNA promoter; Nos: Nopaline synthase terminator; Hpt I I : Hygromycin phosphotransferase; WsSQS: W. somnifera squalene synthase; Gits: β-G lucuronidase reporter gene; Cat: Catalase intron; LB : left border; and RB: right border of T-DNA.

[00023] Figure 3 depicts stages of genetic transformation of W. somnifera. (a) Nodal explant in prol iferation media after 2 days of transformation; (b) 1 0 day old explant in selection media; (c) Shoot elongation and proliferation; (d) Plant transferred in rooting media; (e) Rooted plantlet; (f) Plant transferred in pot; (g) successfully hardened transformed plant in green house; and (h) Gus positive transformed tissues. [00024] Figure 4 depicts molecular analysis of different transformed lines, (a) hpl I I specific PCR showing 600 bp amplified products; and (b) WsSQS specific PCR showing ~ 1 .6 bp amplified products.

M: Low range molecular weight ladder (Banglore Genei, India); P: Positive control (plasmid pCAMBIA 1 301 ); : Negative control (untransformed plant); and 1 - 12: randomly selected putative transformed l ines.

[00025] Figure 5 depicts tissue specific W¾SQS transcript analysis in transformed W. somnifera lines by qRT-PCR. Ubiquitin gene was used as an internal control . Tissues from three transformed line (T20, T58 and T79) were used for analysis against the respective untransformed control plant. Values are the means of three replicate measurements and error bars show the standard error of the mean.

[00026] Figure 6 depicts (a) Determining titre of Anti-f vSQS polyclonal antibody by ELISA, (b) Standard curve of ^sSQS for quantification.

[00027] Figure 7 depicts WsSQS protein expression analysis, (a) P sSQS protein quantification in total soluble protein extracted from different tissues of wild-type and ^" transformed lines by ELI SA, determined from the standard curve plotted between purified recombinant WsSQS protein concentration and absorbance at 405 nm; (b) Western blot analysis of W. somnifera transformed with pCAMBIA 1301 harboring H¾SQS gene. RC: recombinant truncated WsSQS protein used as size marker; WL: wi ld-type leaf; TL: Transformed leaf; WS: Wild-type stem; TS: Transformed stem; WR: Wild-type root; and TR: Transformed root.

[00028] Figure 8 depicts improved production of withanol ides in transformed tissues overexpressing 1%'SQS. Vertical bars indicate the mean values ± SE from three independent experiments.

DETAILED DESCRIPTION OF INVENTION

[00029] Withania somnifera is traditionally known as ' ashwagandha and commonly known as I ndian ginseng, poison gooseberry, or winter cherry. Wiihania somnifera is cultivated in many of the drier regions of India, such as Mandsaur district of Madhya Pradesh, Punjab, Sindh, Gujarat, and Rajasthan. It is also found in Nepal.

[00030] In the present disclosure, the seeds of W. somnifera were procured from Vindhya herbals, Bhopal, MP, India. Agrobaclerium tiimefaciens GV2260 is used as the transformation vehicle in the instant disclosure.

[00031] The disclosure wi ll now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more entirely comprehended and appreciated.

[00032] In a preferred embodiment, the present disclosure provides a process for genetic transformation in Wiihania somnifera plants employing an expression vector system carrying WsSQS gene having SEQ ID NO. 1 to cultivate hardened Wiihania somnifera plants, with increased secondary metabolite content comprising: a) immersing pre-cultured explants in a bacterial suspension for 10-20 mins and co-cultivating with transformant cells for 24- 48 h in dark; b) transferring cells to proliferation medium containing cefotaxime for 8- 10 days; c) confirming expression of the inserted gene in transformed tissues by Gus assay followed by transferring Gus positive explants to hygromycin B selection medium; d) maintaining hygromycin B-resistant Gus-positive shoots on selection medium with reduced cefotaxime concentration; and e) sub-culturing shoots of transformed explants on rooting medium and subjecting transformed plantlets to greenhouse conditions.

(00033] Agrobaclerium tiimefaciens mediated transformation in Wiihania somnifera plants results in the overexpression of squalene synthase gene ( WsSQS encoding the WsSQS enzyme, and thereby causing enhanced catalysis of squalene from farnesyl pyrophosphate. [00034] Accordingly, 80-100 pre-cultured explants are immersed with freshly prepared A. tumefaciens suspension for 1 5 mins followed by co-cultivating with A. tumefaciens for 48 h in dark and transferred to proliferation medium containing 220 - 300 mg I ^{" 1} cefotaxime for 8- 10 days to obtain A. tumefaciens mediated transformed cel l lines of W. somnifera.

[00035] In orde to establish the expression of the inserted WsSQS gene in the explants, the cel ls are determined for their glucuronidase (Gus) activity and hygromycin resistant property. Cells exhibiting Gus+ and hygromycin resistance are maintained on selection medium with cefotaxime concentration reduced to 1 00 mg ¹ to eliminate growth of Agrobacterium.

[00036] Independent transformed lines obtained by detaching shoots from transformed explant are transferred to a rooting medium. Efficient rooting is obtained in appropriate plant growth medium at favourable growth conditions and is transferred to green house for acclimatization

[00037] In an embodiment, the present disclosure provides a bacterial suspension comprising cel ls of A. tumefaciens harboring piasmid carrying SEQ ID NO. 1 , wherein pre-cultured explants are co-cultivated with the said bacterial suspension.

[00038] In an embodiment, the present disclosure provides a transgenic plant or parts thereof, including seeds comprising a nuclear genome encoded nucleotide sequence as set forth in SEQ I D NO. 1 .

[00039] In an embodiment, the present disclosure provides a cDNA having nucleotide sequence as set forth in SEQ I D NO. I .

[00040] In another preferred embodiment, the present disclosure provides an expression vector system A. tumefaciens harbouring pCAM BIA 1 301 containing the T-DNA construct comprising (described in Figure 2)

a) positioning WsSQS cDNA fragment between cauliflower mosaic virus (CaM V) 35S as the promoter and nopal ine synthase (Nos) terminator in modified pCAMBIA 1301 vector, and b) gus (β-Glucuronidase) reporter gene with catalase intron and a selectable marker hpt I I (hygromycin phosphotransferase) gene imparting resistance against hygromycin B.

[00041] Accordingly, cloned cDNA 0¾SQS fragments of SEQ ID NO: 1 (Accession No: GU732820) with opening reading frame of 1242 bp, were obtained by amplification using primers consisting of restriction enzymes sites Kpn\ and Sac\. The i sSQS open reading frame is adjusted between CaMV 35S promoter and Nos terminator using site specific restriction enzymes to ensure high levels of gene expression.

[00042] Accordingly A. lumejaciens characterized by W¾SQS gene is grown in yeast extract minimal medium containing rifampicin and kanamycin in 1 : 1 ratio. Cells harvested by centrifugation are resuspended in MS medium to obtain suitable bacterial cell density for infection. 90 explants which are two days pre- cultured apical and nodal segments from in vitro grown shoots as explants are initially immersed with freshly prepared A. tumefaciens suspension for 1 5 mins followed by co-cultivating with A. tumefaciens for 48 h in dark and transferred to cefotaxime containing proliferation medium for ten days to obtain A. tumefaciens mediated transformed cell l ines of W. somnifera.

[00043] Further, expression of if.sSQS gene in transformed tissues is confirmed by Gus assay to detect β-Glucuronidase activity according to Jefferson et al., 1987 and by growing Gus+ transformants on hygromycin B selective medium. Hygromycin B- resistant, Gus-positive shoots are continuously maintained on selection medium with cefotaxime concentration reduced to 1 00 mg 1 ^" ' .

[00044] Independent transformed l ines obtained by detaching shoots from transformed explant are transferred to rooting medium. Efficient rooting is obtained in appropriate plant growth medium at favourable growth conditions and is transferred to green house for acclimatization.

[00045) Accordingly expression of introduced gene is determined by β-glucuronidase activity in explants. Gus reporter gene with catalase intron does not express detectable Gus activity in A. titmefaciens; however transformed Gus-positive shoots stained blue indicate stable expression of the introduced gene.

[00046] Gus+ transformants grown in proliferation medium containing 10 mgl ^{" 1} hygromycin B as the selective antibiotic exhibit shoot elongation and multipl ication while untransformed tissues are indicated by necrotic shoots are eliminated. Growth of Gus +, hygromycin B resistant transformed cell lines are sustained in selection medium with decreased concentration of cefotaxime.

[00047] Consequently, of the 90 explants subjected to transformation, a total of 1 8 hygromycin B resistant transformed lines are recovered. Green shoots are subsequently cultured onto rooting medium. Rooted plants are transferred to pots containing autoclaved sand and soil ( 1 :2), kept in humid conditions for two weeks and are then shifted to green house for further acclimatization.

[00048] In yet another embodiment transformed, hardened W. somnifera plants with increased withanolide content are obtained. Transgenic plants thus obtained are normal in growth with no phenotypic aberrations.

[00049] Randomly selected transformed lines T20, T58 and T79 exhibit increased mRNA transcript levels up to 2-5 fold as compared to the respective wild-type tissue. Favourably, the transcriptionally activated H¾SQS gene catalysing the regulatory step leading to withanolide biosynthesis was up regulated in all the transformed tissues.

[00050] Advantageously ffsSQS activity in transformed leaf and stem tissues was found to be 2.7 and 2. 1 fold higher, respectively, while it was 3.3 fold higher in case of root tissue compared to wild type tissues. The increase in W¾SQS activity is transformed cel l l ines compared to wild type tissue is described in Table 1 .

[00051 ] In accordance with Western blot analysis the increased intensity of the immune-precipitated protein bands of transformed tissues confirms that ffsSQS protein detected in the transformed l ines is the product of the overexpressed WsSQS coding region.

Table 1 : Summary of i ^' .vSQS activity and squalene detected in the reactions

1 I Plant Tissue Sample WsSQS activity QS Squalene

(p at/mg protein) activity (μιτιοΙ/mg

(p at/g FW) protein)

Leaf Wild type Leaf 36 0.72 54

Transformed Leaf 54.7 1 .98 82

Stem Wild type Stem 1 0 0.39 15

Transformed Stem 14.4 0.83 23

Root Wild Type Root 41 0.82 57

Transformed Root 139.4 2.78 1 80

Further, the H^SQS activity in the transformed plant tissues is in the range of 50 - 1 50 pKat/mgprotein. (Refer Table 1 )

[00052] In yet another preferred embodiment enhanced concentrations of withanolide secondary metabolites including withaferin A, withanol ide A and B and withanone are obtained.

[00053] LC-ESI-MS provides identification of Withaferin A, Withanolide A,

Withanol ide B and Withanone characterised by retention time (Rt) and mass spectrum facil itates their quantification.

Table 2: Quantitative determination of different withanolide content by LC-MS in leaf, stem and root of transformed W. somnifera overexpressing H¾SQS

Wilhanolides Rt Lea Stem Root.

(inin) Wild-type Transformed Wild-type Transformed Wild -type Transformed

Withaferin A 1 1.3 1 0. 15 ± 0.012 0.65 ± 0.09 0.32 ± 0.04 0.63 ± 0.07 0.31 ± 0.05 0.66 ± 0.08 Wiihanolide A 12.35 ^' 0.35 ± 0.03 1.43 ± 0.12 0.91 ± 0.09 0.82 ± 0.08 0.71 ± 0.09 1.78 ± 0.16 Withanolide B 15.00 0.92 ± 0.10 0.98 ± 0.09 0.86 ± 0.07 1.36 : 0.18 0.92 ± 0.12 1 .12 ± 0.14 Withanone 18.35 0.42 ± 0.06 0.49 ± 0.08 .0.1 5 ± 0.01 0.56 ± 0.05 0. 1 ± 0.04 0.42 ± 0.07

Values represent the mean of three independent experiments with their SD and expressed as mg/g DW of the respective tissue.

[00054] The disclosure will now be illustrated with help of examples. The aforementioned embodiments and below mentioned examples are for i l lustrative purpose and are not meant to limit the scope of thedisclosure. Various modi fications of aforementioned embodiments and below mentioned examples are readi ly apparent to a person ski lled in the art. Al l such modifications may be construed to fall within the scope and limit of this disclosure as defined by the appended claims.

EXAMPLES

Example 1 Plant material and propagation

[00055] Seeds of W. somnifera were procured from Vindhya herbals, Bhopal, M P, India. Seeds were surface sterilized with sterile distilled water and then rinsed with 1 % (v/v) teepol for 1 min followed by sterile distilled water washings in laminar air flow cabinet. Seeds were then treated with 0. 1 % (w/v) mercuric chloride (HgC^) for 5 min, washed thoroughly with sterile distilled water to remove traces of HgCl ₂ . Seeds were inoculated on germination medium (half strength MS medium containing 3% (w/v) sucrose and solidified with 0.3% Phytagel) and incubated in dark for 1 5 days to germinate. Germinated seeds were transferred to liquid half strength MS medium for further seedling development. Seedlings were cut into apical and nodal segments of about 1 cm length containing a single node along with a small portion of petiole and micropropagated by inoculating into the prol iferation medium (MS medium supplemented with 0. 1 mg f ' kinetin, 0.2 mg Γ ¹ 6-BAP) for shooting and subsequently transferred to rooting medium (half-strength MS l iquid medium containing 2 mg I ^" ' IBA) to develop into complete plants. Cultures were incubated under 60 μιτιοΙ m"V light intensity at 26 ± 2 °C for 1 6 h photoperiod. Apical and nodal segments from in vitro grown shoots were used as explants for transformation.

Example 2

Vector construction

[00056] Previously cloned full length Ws Q (GenBank GU732820) with an open reading frame of 1 242 bp (SEQ ID NO. 1 ) was amplified using primers having sites for restriction enzymes Kpn\ and Sac\ . The resulting fragment was positioned between cauliflower mosaic virus (CaMV) 35S and a nopaline synthase (Nos) terminator in modified pCAMB!A 1 301 vector (Omer et al., 20 13) which had been already digested with the same enzymes. The correct orientation within the vector was confirmed by DNA sequencing and the construct was transformed into A. tumefaciens GV2260. The T-DNA region of the vector was constituted by gus (β-Glucuronidase) reporter gene and a selectable marker hpt I I (hygromycin phosphotransferase) gene imparting resistance to hygromycin B under the control of the constitutive CaMV 35S promoter (Fig 2).

Example 3

Genetic transformation of W. somnifera

[00057] Genetic transformation in W. somnifera was achieved by A. tumefaciens GV2260 carrying W^SQS. A. tumefaciens was grown in yeast extract minimal medium containing 50 mg f' rifampicin and 50 mg I ^{" 1} kanamycin, harvested by centrifugation and the bacterial pel let was resuspended in MS medium to obtain appropriate bacterial cell density for infection. Two days pre-cultured explants were immersed in freshly prepared bacterial suspension for 15 min and co-cultivated with A. tumefaciens for 48 ft in dark and then transferred to a proliferation medium containing 250 mg Γ ¹ cefotaxime for ten days. Expression of the inserted gene in transformed tissues was confirmed by Gus assay to detect the β-Glucuronidase activity (Jefferson et al., 1 987) and visual izing it under a stereoscope (Leica MZ 125, Switzerland). Explants exhibiting shoot development were then transferred to selection medium (prol i feration medium containing 10 mg T ¹ hygromycin B). Hygromycin B-resistant Gus-positive shoots were continuously maintained on selection pressure while cefotaxime concentration was decreased to 1 00 mg Γ ¹ . To produce independent transformed l ines, shoots were detached from the transformed explant, cultured on proliferation medium and rooted onto rooting medium. Rooted plants were shifted to plastic pots containing autoclaved sand and soil ( 1 :2), kept covered with plastic sheets to maintain humidity for two weeks and then transferred to green house for further acclimatization. Example 4

Molecular identification of transformants by PCR analysis

[00058] Presence of integrated DNA into genome of transformed tissues was confirmed by PCR (C I 000 BIO-RAD thermal cycler, USA) using primers specific to hpt i i and t

ffsSQS. Total genomic DNA was extracted from tissues of wild-type and hygromycin B-resistant transformed shoots by using plant DNA extraction kit (H ipura Plant Genomic Purification kit, Himedia, India). The hpt I I gene specific forward and reverse primer sequences used were (SEQ ID NO. 2) 5 -TCCTGCAAGCTCCGGATGCCTC- 3 ^' and 5 -CGTGCACAGGGTGTCACGTTGC-3 ^' (SEQ ID NO. 3) respectively.

[00059] For W¾SQS gene specific PCR, the forward primer was designed from the sequence of CaMV 35S promoter (GeneBank GQ336528. 1 ; 5 ^' - ACAGTCTCAGAAGACCAAAGGGCA -3 ^' ) (SEQ I D NO. 4) and reverse primer was designed from the 3 ' terminal sequence of ^s-SQS (GeneBank GU732820; 5 ^' - GAGCTCCTAAGATCGGTTGCCAG-3 ^' ) (SEQ ID NO. 5). Components of PCR reaction mixture were: 1 5 ng template DNA, 1 50 μ dNTPs, hpt UISQS gene specific forward and reverse primers (0.66 pmol each), 0.5 U of Tag DNA polymerase in a total volume of 15 μΙ with I X reaction buffer. The PCR reaction was carried out as follows: an initial denaturation at 94 °C for 5 min followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for I min (for hpt I I) and 1 .6 min (for ffsSQS) and a final 5 min extension at 72 °C. The amplified products were subjected to 1 % (w/v) agarose gel electrophoresis and visual ized by ethidium bromide staining under UV. (Observed in Fig 4.)

Example 5 qRT-PCR analysis

[00060] Total RNA was isolated from different tissues (leaf, stem and root) of transformed lines and wi ld-type W. somnifera using Plant RNA Isolation Kit (I nvitrogen) as per manual instructions and treated with DNase using DNase I Digest kit (Sigma. USA) to el iminate DNA contamination. Total RNA (2 μg) was reverse transcribed into cDNA using AMV reverse transcription system (Promega, USA) with oligo dT primers in a 20 μί reaction volume. The reaction mixture was incubated for I h at 42 °C. For normal ization of the relative expression data, ubiquitin gene was employed as an internal standard using primer mix from Eurogentec (Belgium). To quantify W¾SQS transcripts, first-strand DMA was PCR amplified using gene-specific primers: SQS-F (5 '-TTTATGATCGTGAATGGCACTTTTC-3 ') (SEQ ID NO. 6) and SQS-R (5 '-AGCGGTTGAAACATGATGGAAC-3 ^! ) (SEQ ID NO. 7) synthesized from W¾SQS. All qRT-PCR reactions were performed with SYBR Green Brilliant® II QPCR Master Mix (2X with low ROX, Stratagene, USA) on Mx 3000P instrument (Stratagene, USA) according to the manufacturer's instructions. PCR cycling conditions included a DNA denaturing stage of 95 °C for 10 min, followed by 40 cycles of 95 °C for 30 s, 55 °C for 45 s and 72 °C for 30 s. The amplified products were analyzed with MxPro software provided with the machine. Data was analyzed by comparative Ct method (Pfafl l, 2001 ). Example 6

Indirect ELISA and western blot of JfsSQS protein

[00061] Fresh tissues (500 mg each) of transformed and wild-type plants were ground in liquid nitrogen and resuspended in 1 ml phosphate buffered saline (PBS; 1 36 mM NaCI, 2 mM CI, 8 mM Na ₂ FI P0 ₄ , 1 mM H ₂ P0 ₄ , pH 7.5) containing CHAPS (5mM) to solubi lize membrane proteins. The supernatant was collected after centrifugation and the total protein quantity was estimated by Bradford assay, using bovine serum albumin as standard. Antibodies against /%SQS raised in rabbits (New Zealand White) and the antibody titre of the anti-SQS serum were determined by plotting a graph o f different antisei a dilution ( 1 :500, 1 : 1000, 1 :5000, 1 : 10000 and 1 :20000) against recombinant truncated W SQS. For detection of ffsSQS in total plant protein, the equal concentration of extracted protein ( 1 00 was coated on 96 wel l polystyrene microtitre plate (Costar, USA) for overnight at 4°C followed by washings with PBST (PBS + 0.05% Tween 20). Non-specific sites were blocked with blocking buffer (PBS + 1 % BSA) and incubated for 2 h at 37°C. After washing thrice with PBST, primary antibody ( 1 :5000 dilution) was added and incubated for 2 h at 37°C. Unbound primary antibody was washed thrice with PBST and the plate was exposed to secondar antibody (goat anti-rabbit IgG-alkaline phosphatase conjugate, 1 :20000) and fol lowed by incubation for 1 -2 h at 37 °C. The presence of antigen was determined by the addition of enzyme specific substrate pNPP (p- N itro phenyl phosphate; 1 mg/mL) fol lowed by incubation of 45 min in dark for color development. The reaction was terminated by adding 10 mM EDTA and absorbance was measured at 405 nm using an xMark EL1SA plate reader (BIO-RAD, USA). Detection limit of ELISA was determined by plotting a standard curve using the purified recombinant truncated f ¾SQS protein. Concentration of W¾SQS present in total soluble protein extracted from wild-type and transformed plants were analyzed in each case of three replications from the standard curve.

[00062] Total crude protein (50μg) from transformed and wild-type tissues was electrophoresed on 10% SDS-PAGE and electro-transferred on to PVDF membrane using iBlot gel transfer system (Invitrogen) as per manufacturer's instructions, with recombinant truncated W^SQS used as a size marker. Western Breeze kit (Invitrogen) was used for further processing of the blot. Blot was placed in blocking solution and incubated at room temperature for 30. min on rotatary shaker. The membrane was rinsed and incubated with primary antibody solution ( 1 :5000 di lution, rabbit polyclonal I gG against ^sSQS) for 1 h. The membrane was washed thrice and incubated in secondary antibody for 30 min. Signals were detected with ready to use 5-bromo-4- chloro-3-indolyl phosphate and nitroblue tetrazolium (BC I P/NBT) solution (Calbiochem, Germany) (Harlow and Lane, 1988). Example 7

ffsSQS enzyme activity determination

|00063] M icrosomal protein fractions were prepared for WvSQS activity measurements from different tissues of the transformed and wild-type plants. (Vogeli and Chappell, 1 988). Essentially, 1 g frozen tissue was homogenized in 1 0 mL protein extraction buffer (PBS, pH 7.5, 1 % PVP, 5 mM DTT and 0.5 M sucrose). Homogenates were filtered through 40 μ ^η ι mesh and cent fuged at 10,000g for 25 min at 4 °C. The supernatant was again centrifuged at 100,000 g for 60 min to obtain the microsomal pellet which was resuspended in 200 μΐ of 100 mM Tris-CI (pH 7.5), 1 .5 mM DTT and 20 % glycerol and protein concentration was determined by Bradford method.

Assay for P s-SQS enzyme was carried out with 1 0 μg microsomal protein according to the method described previously (Gupta et al., 2012).

Enzyme activity determination by fluorimetry [00064] Enzyme activity was determined flourimetrical ly by measuring NADPH depletion during the reaction on an LS 55 spectrofluorimeter (Perkin Elmer). Assay mixture was excited at 340 nm and emission was recorded in the range 400-500 nm with characteristic maxima around 460 nm corresponding to NADPH fluorescence. Excitation and emission slits were kept at 7.5 and 2.5 nm, respectively, with a scan speed of 100 nm min ^{" 1} . The reaction was carried out at 30 °C for 1 h and averaged fluorescence of 5 accumulated scans were recorded at regular time intervals. A standard curve was prepared by plotting fluorescence of commercially avai lable NADPH (dissolved in 50 mM Tris-CI; pH 8.0) at 460 nm against its different concentrations. Enzyme activity was defined as the pKat/mg protein.

Enzyme activity determination by GC-MS

[00065] In order to validate the enzyme reactions, squalene formed in each reaction was checked on GC-MS. Replicates of the above mentioned reactions, after 2 h of incubation, were extracted using tert-butyl methyl ether and concentrated to 1 00 μL· by bubbling dry nitrogen. The concentrate ( 1 μί) was injected on GC-MS (Agilent 5975C mass selective detector interfaced with an Agi lent 7890A gas chromatograph) fitted with a capi llary column HP-5 (25 m X 0.25 mm, film thickness 0.33 μιη 5% methyl polysiloxane cross-l inked capil lary column, Hewlett-Packard, USA) with a spl it ratio of 1 0: 1 . The injector temperature was set at 290 °C with helium as the carrier gas ( 1 0 m L min ^" '). The oven temperature was programmed from 1 50 °C to 250 °C at 10°C min ^{" 1} and from 250 °C to 3 10 °C at the rate of 5 °C min ^{" 1} , and maintained at final temperature for 5min. The chromatogram obtained was compared with standard/commercially available squalene (Sigma, USA) for its retention time and mass fragmentation pattern. The squalene content was calculated from the standard curve plotted from the peak area versus concentrations of standard squalene, and expressed in nmol/mg protein.

Example 8

Withanoiides extraction and LC-ESI-MS analysis

[00066] Dried tissues ( l OOmg each) were separately crushed to fine powder and percolated thrice with 5 ml methanol for l h under shaking conditions at room temperature. Extracts were pooled, filtered, concentrated under reduced pressure at 45 °C and thoroughly washed with equal volume of n-hexane. The methanol fraction was dried completely and further partitioned twice with waterxhloroform ( 1 : 1 ). The chloroform fractions were pooled, concentrated and finally dissolved in 1 50 μΐ methanol. The samples were filtered and subjected to liquid chromatography. All the solvents used in the study were H PLC grade purchased from Fischer Scientific, USA.

[00067] LC-MS was performed on Waters Acquity UPLC system (Milford, MA, USA) with an Acquity UPLC*' BEH C I S column (2. 1 x 100 mm, 1 .7 μιη) attached to a positive ion elecrospray ionization-mass spectrometer (Waters) for identification and quantification of withanoi ides in W. sommfera extracts. Separations were achieved following a binary gradient elution using water (solvent A) and acetonitrile (solvent B) with the fol lowing program carried out at 25 °C: 10% B for 2 min; 45% B for 8 min; 75% B for 1 0 min; and 95% B for 5 min, at a flow-rate of 0.4 mL/min, with a total run time of 25 min. External standards of different withanoi ides (Chromadex, USA) were used to construct calibrated graph from peak area versus withanol ide concentration, being linear over 1 0 measurements at different concentrations. Sequence Listing

sequence SEQ ID NO. 5 23bp DNA sequence gagctcctaa gatcggttgc cag

WsSQS gene

reverse

primer

sequence

SEQ ID NO. 6 25bp DNA sequence tttatgatcg tgaatggcac ttttc

WsSQS RT-PCR

forward

primer

sequence

(SQS-F)

SEQ ID NO. 7 22bp ^{■ '} DNA agcggttgaa acatgatgga ac

Sequence

WsSQS RT-PCR

reverse

primer

sequence

(SQS-R)