STENHUUS, Bo (Præstøgade 11 4 tv, København Ø, DK-2100, DK)
DURHUUS, Thomas Thomasen (Tuborgvej 243, København Nv, DK-2400, DK)
MARTINS, Ines (Frederiksborgvej 35D, København Nv, DK-2400, DK)
KATZ, Michael (Ormvråksgatan 9, Malmö, S-215 62, SE)
STENHUUS, Bo (Præstøgade 11 4 tv, København Ø, DK-2100, DK)
DURHUUS, Thomas Thomasen (Tuborgvej 243, København Nv, DK-2400, DK)
MARTINS, Ines (Frederiksborgvej 35D, København Nv, DK-2400, DK)
Claims
1. A method for the production of a consumable product containing pinosylvin and/or containing non- glycosylated resveratrol comprising the use for fermentation in the preparation thereof of a microbial cell comprising a metabolic pathway for the production of pinosylvin and/or for the production of non-glycosylated resveratrol and thereby producing pinosylvin and/or non-glycosylated resveratrol in situ in the consumable product during said fermentation .
2. A method as claimed in claim 1, wherein said micro- organism has an operative metabolic pathway producing pinosylvin from cinnamic acid.
3. A method as claimed in claim 1 or claim 2, wherein said micro-organism has a metabolic pathway for producing resveratrol in glycosylated form in said consumable product.
4. A method as claimed in any one of claims 1 to 3, wherein said micro-organism has a metabolic pathway for producing resveratrol in non-glycosylated form in said consumable product.
5. A method for the production of a leavened bakery product containing resveratrol comprising the use for fermentation in the preparation thereof of a microbial cell comprising a metabolic pathway for the production of resveratrol, and thereby producing resveratrol in situ in said bakery product during said fermentation.
6. A method as claimed in any one of claims 3 to 5, wherein said micro-organism has an operative metabolic pathway producing 4-coumaric acid and producing resveratrol therefrom.
7. A method as claimed in claim 6, wherein substantially no exogenous supply of coumaric acid is provided.
8. A method as claimed in claim 7, wherein starting materials for use in the method are not supplemented by any addition of coumaric acid.
9. A method as claimed in any preceding claim, wherein said consumable product is a food or a beverage.
10. A method as claimed in claim 9, wherein said consumable product is a leavened bakery product and said micro-organism is a yeast and is used for leavening said bakery product.
11. A method as claimed in claim 9, wherein said consumbable product is a fermented meat, vegetable or dairy product and said micro-organism is used in the fermentation thereof.
12. A method as claimed in claim 9, wherein said consumable product is a fermented beverage and said micro-organism is used in the fermentation thereof.
13. A consumbable product containing cells of a microorganism containing pinosylvin or resveratrol. |
Production of Consumable Products
FIELD OF THE INVENTION
This invention relates generally to the use of microorganisms which produce stilbenoids, exemplified by resveratrol and pinosylvin, directly in the production of consumable products (including both foods and drinks) so as to provide therein a content of said stilbenoids.
BACKGROUND OF THE INVENTION
WO2006/089898 disclosed a resveratrol producing yeast strain having constituent enzymes of a resveratrol producing metabolic pathway present in plasmids and having the ability to grow on a galactose containing medium and to produce significant quantities of resveratrol. Other fungal and bacterial strains having resveratrol production capacity were disclosed also. The use of resveratrol produced from such micro-organisms in foods, nutraceutical products and beer was suggested.
ZA2004/8194 disclosed expression on plasmids in yeast of constituents of a resveratrol producing pathway and food or beverage products including red and white wines prepared using such a recombinant yeast. The main intention was to provide yeast strains capable of producing resveratrol during fermentation of wines. Only the production of glycosylated forms of resveratrol (piceid) was achieved and all the piceid produced was said to remain within the yeast cells. The possibility of secreting the relevant enzymes for use in wine where yeast autolysis does not occur during production is suggested as possibly being beneficial to
obtain free piceid. It is further suggested that it might be possible to obtain free resveratrol by including a gene for an appropriate β-glucosidase, but that was merely speculation . WO2008/009728 discloses a pinosylvin producing yeast strain having constituent enzymes of a pinosylvin producing pathway present in plasmids and having the ability to grow on a galactose containing medium and to produce significant quantities of pinosylvin. Other fungal and bacterial strains having pinosylvin production capacity were disclosed also. The use of pinosylvin produced from such microorganisms in foods, neutraceutical products and beer was suggested.
Yeasts are of course used in leavening bakery products and in brewing and in wine making. Filamentous fungi (including Aspergillus) are used in fermenting food products, especially in Japanese and other Far East cultures. Various species of bacteria are used in food production, typically for promoting acidification, as in the production of dairy products such as yoghurt, the production of fermented meat products and the production of pickles.
Pinosylvin (or pinosylvine or 3, 5-dihydroxy- trans- stilbene) is a phytophenol belonging to the group of stilbene phytoalexins, which are low-molecular-mass secondary metabolites that constitute the active defence mechanism in plants in response to infections or other stress-related events. Stilbene phytoalexins contain the stilbene skeleton ( trans-1, 2-diphenylethylene) as their common basic structure: that may be supplemented by addition of other groups as well (Hart and Shrimpton, 1979, Hart, 1981). Stilbenes have been found in certain trees (angio- sperms, gymnosperms) , but also in some herbaceous plants (in species of the Myrtaceae, Vitaceae and Leguminosae
families) . Said compounds are toxic to pests, especially to fungi, bacteria and insects. Only few plants have the ability to synthesize stilbenes, or to produce them in an amount that provides them sufficient resistance to pests. Resveratrol (or 3, 4, 5-trihydroxystilbene) is another phytophenol belonging to the group of stilbene phytoalexins . It is best known for being a constituent of grapes which may be responsible for the possible health benefits of wine consumption . The synthesis of the basic stilbene skeleton is pursued by stilbene synthases, the genes for which over most species examined form a small gene family (Kodan et al. 2002) . Stilbene synthases appear to have evolved from chalcone synthases, and belong to a polyketide synthase (PKS) superfamily that share more than 65% amino acid homology. Unlike the bacterial PKSs, both stilbene- and chalcone synthases function as unimodular PKSs with a single active site, forming relatively small homodimers (Tropf et al., 1995) . Stilbene- and chalcone synthases use common substrates, three malonyl-CoAs and one cinnamoyl-CoA/p- coumaroyl-CoA, forming their products with similar reaction mechanisms (Kindl, 1985). Stilbene synthases can be classified into either a 4-coumaroyl-CoA-specific type that has its highest activity with 4-coumaroyl-CoA as substrate, such as resveratrol synthase (EC 2.3.1.95), or a cinnamoyl- CoA-specific type that has its highest activity with cinnamoyl-CoA as substrate, such as pinosylvin synthase (EC 2.3.1.146). Genes encoding resveratrol synthases have been described earlier for peanut (Arachis hypogaea) (Schδppner and Kindl, 1984; Schroder et al . , 1988) and grapevine (Vitis vinifera) (Melchior and Kindl, 1991; Wiese et al . , 1994) whereas genes encoding pinosylvin synthase have been mostly described for pine (Plnus sylvestrls and - strobus) (Schanz
et al., 1992; Raiber et al . , 1995; Kodan et al . , 2002; Hemingway et al., 1977) .
Much data has been generated demonstrating the health benefits of resveratrol. For instance resveratrol's potent anticancer activity across many cancer cell lines has well been established. Given the similarity in structure with resveratrol, it is anticipated that pinosylvin possesses potent health benefits as well. Indeed pinosylvin' s effect on various cancers, including colorectal- and liver cancers, has been studied, and has indicated it's chemopreventative- and anti-leukemic activity. Moreover, pinosylvin has antioxidant capacity as well, though to a lesser extent than, for instance, resveratrol.
The plant metabolic pathways producing resveratrol and pinosylvin are described in WO2006/089898 and WO2008/009728.
SUMN[ARY OF THE INVENTION
The present invention now provides in a first aspect a method for the production of a consumable product containing pinosylvin comprising the use for fermentation in the preparation thereof of a microbial cell comprising a metabolic pathway for the production of pinosylvin. By using such a micro-organism, pinosylvin is produced in situ in the consumable product during the fermentation.
Preferably, the micro-organism produces resveratrol also, so that this too is produced in situ during the fermentation in the consumable product. Alternatively or additionally, the microbial cell may produce free (non-glycosylated) resveratrol. As shown below, this has been achieved without the introduction of a heterologous β-glycosidase gene. Additionally, the microbial cell may produce glycosylated forms of resveratrol.
The method of the invention includes a method comprising selecting one or more ingredients for making a consumable product, adding thereto a starter culture of a said microbial cell, conducting fermentation of said ingredients, and further processing said ingredients to produce the consumable product, preferably without substantial removal of the microbial cells therefrom.
Consumable products made according to the invention may include a wide reange of foods and beverages. All the normal constituents of such products may be present, supplemented by stilbenoids as described herein, optionally together with other additives. Preferably, the consumable product contains 2.5mg/kg product of stilbenoid, more preferably at least 5mg/kg, more preferably at least 10 mg/kg, more preferably still at least 20mg/kg.
The method of the invention is applicable to the production of for instance a leavened bakery product in which said micro-organism is a yeast and is used for leavening said bakery product. Alternatively, the invention may be used to make a fermented meat, vegetable or dairy product and said micro-organism is used in the fermentation thereof. Alternatively, said consumable product may be a fermented beverage and said micro-organism is used in the fermentation thereof. As described in WO2006/089898 and WO2008/009728, the metabolic pathway for the production of pinosylvin and/or resveratrol may be genetically engineered into a wide range of fungi (including yeast and filamentous fungi) and bacteria . Suitable bacteria to be metabolically engineered for use according to the invention in making fermented food or beverage products include the lactic acid bacteria.
Suitable bacteria may be used for fermentative acidification in producing cured meat products. Preferred bacteria for use in making preserved meat products are acid producing bacteria, especially lactic acid producing bacteria such as sausages include Lactobacillus plantarum, Lactobacillus curvatus, Pediococcus cerevisiae, Pediococcus acidilacti and Staphylococcus camosus . Others are Lactobacillus lactis, Lactobacillus sakei, Lactobacillus camosus, Lactobacillus farciminis, and Staphylococcus xylosus . Suitable preserved meat products include sausages, including moist, semi-dry and dried sausages. Starter cultures containing one or more of these metabolically engineered organisms for use inthe invention may be added to sausage making meat as known in the art. Suitable bacteria to be metabolically engineered and used according to the invention to produce milk based products include Lactobacillus bulgaricus, Lactobacillus lactis and Streptococcus thermophilus .
Suitable bacteria to be metabolically engineered and used according to the invention in making fermented vegetable products such as sauerkraut and fermented pickles include Leuconostoc mesenteroides .
The most preferred yeast for use in brewing, wine making or the production of leavened bakery products according to the invention will of course be Saccharomyces cerevisiae .
Aspergillus species (particularly A. Oryzae) are traditionally used in fermentation of soya or mixtures of soya and cereals in Far Eastern cultures to produce a variety of food products and sauces including soy sauce, koji, miso, and tempeh and are also used in fermenting cereals, including wheat in the production of minchin, rice in the production of sake and sorghum or maize in producing
' kaffir beer'. Aspergillus is also used in fermenting fish to make katsoubushi. Suitably genetically engineered versions of the various species used in such production may be used according to the invention. Preferably, the micro-organism used has an operative metabolic pathway producing pinosylvin from cinnamic acid. Preferably, it has a metabolic pathway for producing resveratrol also, although the invention includes in an alternative aspect a method for the production of a leavened bakery product containing resveratrol comprising the use for leavening in the preparation thereof of a microbial cell comprising a metabolic pathway for the production of resveratrol. In this alternative aspect, the resveratrol may preferably be in the free (non-glycosylated) form but may additionally or alternatively be glycosylated.
Preferably, said micro-organism has an operative metabolic pathway producing 4-coumaric acid and producing resveratrol therefrom. Thus, preferably substantially no exogenous supply of coumaric acid is provided. Thus, the starting materials for use in the method are preferably not supplemented by any addition of coumaric acid.
The invention extends to all consumbable products containing therein cells of a micro-organism containing resveratrol or pinosylvin, including especially non-liquid products or unfiltered liquid products in which substantially all of cells produced in the product during fermentation are still present.
Food products described herein include feed products for animals as well as food products for humans.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
Preferably, said pinosylvin is produced in a reaction catalysed by an enzyme in which endogenous malonyl-CoA is a substrate, and preferably said pinosylvin is produced from cinnamoyl-CoA. Said pinosylvin is preferably produced from cinnamoyl- CoA, preferably by a stilbene synthase synthase which preferably is expressed in said micro-organism from nucleic acid coding for said enzyme which is not native to the micro-organism. Because of the substrate promiscuity of such stilbene synthase enzymes, resveratrol will generally also be produced if coumaroyl-CoA is available.
Generally herein, unless the context implies otherwise, references to pinosylvin or to resveratrol include reference to oligomeric or glycosidically bound derivatives thereof. However, the production of free stilbenoids is preferred.
Thus, in certain preferred embodiments, said stilbene synthase is a resveratrol synthase (EC 2.3.1.95) from a plant belonging to the genus of Arachis, e.g. A. glabatra , A. hypogaea, a plant belonging to the genus of Rheum, e.g. R. tataricum, a plant belonging to the genus of Vitus, e.g. V. labrusca , V. riparaia , V. vinifera, or any one of the genera Pinus, Piceea, Lilium, Eucalyptus, Parthenocissus, Cissus, Calochortus, Polygonum, Gnetum, Artocarpus, Nothofagus, Phoenix, Festuca, Carex, Veratrum, Bauhinia or Pterolobium.
Where pinosylvin production is preferred, the stilbene synthase may be one which exhibits a higher turnover rate with cinnamoyl-CoA as a substrate than it does with 4- coumaroyl-CoA as a substrate, e.g. by a factor of at least 1.5 or at least 2. Thus, in further preferred embodiments, said stilbene synthase is a pinosylvin synthase, suitably from a tree species such as a species of Pinus, Eucalyptus, Picea or Madura. In particular, the stilbene synthase may
be a pinosylvin synthase (EC 2.3.1.146) from a plant belonging to the genus of Pinus, e.g. P. sylvestris, P. strobes, P. densiflora, P. taeda, a plant belonging to the genus of Picea, or any one of the genus Eucalyptus. Where resveratrol production is preferred, said substrate preferences may be reversed. Enzymes and genes for producing them which are suitable for constituting a metabolic pathway for producing resveratrol and microorganisms containing such pathways are described in detail in WO2006/089898.
Preferably, for pinosylvin production said cinnamic acid may be produced from L-phenylalanine in a reaction catalysed by an enzyme in which ammonia is produced and suitably said cinnamic acid is formed from L-phenylalanine by a phenylalanine ammonia lyase.
In certain preferred embodiments, said L-phenylalanine ammonia lyase is a L-phenylalanine ammonia lyase (EC 4.3.1.5) from a plant or a micro-organism. The plant may belong to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Brassica , e.g. B. napus, B. rapa, a plant belonging to the genus of Citrus, e.g. C. reticulata, C. clementinus, C. limon, a plant belonging to the genus of Phaseolus, e.g. P. coccineus, P. vulgaris, a plant belonging to the genus of Pinus, e.g. P. banksiana, P. monticola, P. pinaster, P. sylvestris, P. taeda, a plant belonging to the genus of Populus, e.g. P. balsamifera, P. deltoides, P. Canadensis, P. kitakamiensis, P. tremuloides, a plant belonging to the genus of Solanum, e.g. 5. tuberosum, a plant belonging to the genus of Prunus, e.g. P. avium, P. persica, a plant belonging to the genus of Vitus, e.g. Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays or other plant genera e.g. Agastache, Ananas, Asparagus, Bromheadia, Bambusa, Beta, Betula, Cucumis,
Camellia, Capsicum, Cassia, Catharanthus, Cicer, Citrullus, Coffea, Cucurbita, Cynodon, Daucus, Dendrobium, Dianthus, Digitalis, Dioscorea, Eucalyptus, Gallus, Ginkgo, Glycine, Hordeum, Helianthus, Ipomoea, Lactuca, Lithospermum, Lotus, Lycopersicon, Medicago, Malus, Manihot, Medicago,
Mesembryanthemum, Nicotiana , Olea, Oryza, Pisum, Persea, Petroselinum, Phalaenopsis, Phyllostachys, Physcomitrella, Picea, Pyrus, Quercus, Raphanus, Rehmannia , Rubus, Sorghum, Sphenostylis, Stellaria, Stylosanthes, Triticum, Trifolium, Triticum, Vaccinium, Vigna, Zinnia. The micro-organism might be a fungus belonging to the genus Agaricus, e.g. A. bisporus, a fungus belonging to the genus Aspergillus, e.g. A. oryzae, A. nidulans, A. fumigatus, a fungus belonging to the genus Ustilago, e.g. U. maydis, a bacterium belonging to the genus Rhodobacter, e.g. R. capsulatus, a bacterium belonging to the genus Streptomyces, e.g. 5. maritimus, a bacterium belonging to the genus Photorhabdus, e.g. P. luminescens, a yeast belonging to the genus Rhodotorula, e.g. R. rubra. Because, as described above, for the production of pinosylvin we require production of cinnamic acid by a PAL enzyme and also its conversion on to pinosylvin rather than either the production of coumaric acid from tyrosine by a substrate promiscuous PAL or by conversion of cinnamic acid by a C4H enzyme, micro-organisms for use in the invention preferably have a PAL which favours phenylalanine as a substrate (thus producing cinnamic acid) over tyrosine (from which it would produce coumaric acid) . Preferably, therefore, the ratio K m (phenylalanine) /K m (tyrosine) for the PAL is less than 1:1, preferably less 1:5, e.g. less than 1:10. As usual, K m is the molar concentration of the substrate (phenylalanine or tyrosine respectively) that produces half the maximal rate of product formation (V max ) .
The presence of C4H is not helpful to the production of pinosylvin, but need not be forbidden provided that the diversion of cinnamic acid away from pinosylvin production toward formation of resveratrol via coumaric acid is not excessive. Therefore, where pinosylvin production is desired, preferably C4H production is either absent or such that K cat (PAL) /K cat (C4H) is greater than 2, preferably greater than 4. As usual, in each case, K cat is V max / [Enzyme] , where [Enzyme] is the concentration of the relevant enzyme. By way of illustration, typical Km values for A. thaliana phenylalanine ammonia lyase PAL2 and its homologue PALI are around 60 μM with phenylalanine as substrate (Cochrane et al, 2004) and more than 1000 μM when using tyrosine as substrate (Watts et al, 2006). The catalytic turnover rate K cat for A. thaliana PAL2 is 192 mol cinnamic acid/mole enzyme PAL2 when converting phenylalanine to cinnamic acid (Cochrane et al, 2004) but K cat is minute for the conversion of tyrosine to coumaric acid. A PAL with the above kinetic properties is specific for phenylalanine as substrate and gives exclusively cinnamic acid formation from phenylalanine and undetectable levels of coumaric acid from tyrosine .
The typical turnover rate for the hydroxylase reaction catalyzed by C4H is 25 moles coumaric acid product/mole enzyme/minute when native yeast CPR activity supports the reaction (Urban et al, 1994) . The activity of C4H may be limited by NADPH availability and this may be increased if the enzyme cytochrome P450 hydroxylase (CPR) is overexpressed. If CPR is overexpressed as exemplified in the literature by 5 to 20 times (Mizutani et al, 1998, Urban et al, 1994) the catalytic turnover rates for the C4H reaction converting cinnamic acid to coumaric acid increases
to 125 mole coumaric acid product/mole enzyme/minute and 530 mole coumaric acid product/mole enzyme/minute, respectively.
The outcome of the combined reaction PAL-C4H-CPR will depend on the catalytic numbers and the amount of each enzyme present, especially the amount of CPR supporting the electron donation, NADPH, for the C4H. An effiecient PAL will give ca 192 moles cinnamic acid/mole PAL/minute and the C4H enzyme following in the sequence will convert ca 25 moles of this cinnamic acid/mole C4H/minute into coumaric acid with native CPR activity. Thus the dominant product from the combined reaction PAL-C4H-CPR will be cinnamic acid (167 moles cinnamic acid/mole PAL enzyme/minute and 25 moles coumaric acid/mole enzyme C4H/minute with native CPR activity. Higher CPR activity will lead to more C4H activity per mole C4H enzyme and ultimately to pure coumaric acid if overexpressed at high levels. A CPR overexpressed only five times as in the Mizutani paper (Mizutani et al, 1998) would result in 125 moles coumaric acid/mole C4H/minute and only 67 moles cinnamic acid would be the result from the PAL per minute. Thus the CPR must at least be overexpressed ca 8 times for pure coumaric acid production .
In the case of a recombinant or natural organism with several PALs/TALs and C4H one can prepare a cell extract and measure the apparent catalytic turnover rates and Km values as a sum total (or aggregated enzyme) apparent enzyme PAL, TAL or C4H. From these estimated sum properties it will be possible to determine if the organism will produce mainly coumaric acid or cinnamic acid and thus which product resveratrol or pinosylvin would be the outcome when 4CL and VST are expressed in this organism. The turnover rate will now be expressed as moles product / (mole total protein/ time) instead of when using pure enzymes moles product/ (mol
pure enzyme/time) . Therefore, the preferred ratio K m (phenylalanine) /K m (tyrosine) for the PAL less than 1:1 can be applied to the aggregate PAL activity where more than one PAL is present and the preferred ratio K cat (PAL) /K cat (C4H) greater than 2 can be applied to the aggregate of the PAL and/or C4H activity (as modulated by CPR) where more than one PAL and/or C4H activity is present.
Optionally, the micro-organism has no exogenous C4H, i.e. has not been genetically modified to provide expression of a C4H enzyme. Any C4H production there may then be will be native to the organism. Optionally, the micro-organism without exogenous C4H may also lack endogeous C4H. Lack of endogenous C4H may be due to a native C4H capability having been deleted by genetic engineering or gene silencing methods or simply because the organism naturally lacks the C4H genes, since the enzyme is not part of its metabolism. However, for resveratrol production C4H is preferably provided by genetic engineering.
Similarly, as seen above, the presence of CPR is not helpful to the production of pinosylvin and its overexpression . Accordingly, the micro-organism may have no endogenous CPR, no exogenous CPR or no overexpression of native CPR, or may have reduced expression of native CPR. Suitably, said L-phenylalanine ammonia lyase is expressed in said micro-organism from nucleic acid coding for said enzyme which is not native to the micro-organism.
Preferably, cinnamoyl-CoA is formed in a reaction catalysed by an enzyme in which ATP and CoA are substrates and ADP is a product and suitably cinnamoyl-CoA is formed in a reaction catalysed by a 4-coumarate-CoA ligase (also referred to as 4-coumaroyl-CoA ligase) . Known 4-coumarate- CoA ligase enzymes accept either 4-coumaric acid or cinnamic acid as substrates and produce the corresponding CoA
derivatives. Generally, such enzymes are known as M- coumarate-CoA ligase' whether they show higher activity with 4-coumaric acid as substrate or with cinnamic acid as substrate. However, we refer here to enzymes having that substrate preference as λ cinnamate-CoA ligase' enzymes (or cinnamoyl-CoA-ligase) .
Said 4-coumarate-CoA ligase or cinnamate-CoA ligase may be a 4-coumarate-CoA ligase / cinnamate-CoA ligase (EC 6.2.1.12) from a plant, a micro-organism or a nematode. The plant may belong to the genus of Abies, e.g. A. beshanzuensis, B. firma, B. holophylla, a plant belonging to the genus of Arabidopsis, e.g. A. thaliana, a plant belonging to the genus of Brassica, e.g. B. napus, B. rapa, B . oleracea, a plant belonging to the genus of Citrus, e.g. C. sinensis, a plant belonging to the genus of Larix, e.g. L. decidua, L. gmelinii , L. griffithiana , L. himalaica , L. kaempferi , L. laricina , L. mastersiana , L. occidentalis, L. potaninii , L. sibirica , L. speciosa, a plant belonging to the genus of Phaseolus, e.g. P. acutifolius, P. coccineus, a plant belonging to the genus of Pinus, e.g. P. armandii P. banksiana, P. pinaster, a plant belonging to the genus of Populus, e.g. P. balsamifera , P. tomentosa , P. tremuloides, a plant belonging to the genus of Solanum, e.g. 5. tuberosum, a plant belonging to the genus of Vitus, e.g. Vitus vinifera, a plant belonging to the genus of Zea, e.g. Z. mays, or other plant genera e.g. Agastache, Amorpha, Cathaya, Cedrus, Crocus, Festuca, Glycine, Juglans, Keteleeria, Lithospermum, Lolium, Lotus, Lycopersicon, Malus, Medicago, Mesembryanthemum, Nicotiana, Nothotsuga, Oryza, Pelargonium, Petroselinum, Physcomitrella, Picea, Prunus, Pseudolarix, Pseudotsuga, Rosa, Rubus, Ryza, Saccharum, Suaeda, Thellungiella, Triticum, Tsuga. The micro-organism might be a filamentous fungi belonging to the
genus Aspergillus, e.g. A. flavus, A. nidulans, A. oryzae, A. fumigatus, a filamentous fungus belonging to the genus Neurospora, e.g. N. crassa, a fungus belonging to the genus Yarrowia, e.g. Y. lipolytics, a fungus belonging to the genus of Mycosphaerella, e.g. M. graminicola, a bacterium belonging to the genus of Mycobacterium, e.g. M. bovis, M. leprae, M. tuberculosis, a bacterium belonging to the genus of Neisseria, e.g. N. meningitidis, a bacterium belonging to the genus of Streptomyces, e.g. 5. coelicolor, a bacterium belonging to the genus of Rhodobacter, e.g. R. capsulatus, a nematode belonging to the genus Ancylostoma, e.g. A. ceylanicum, a nematode belonging to the genus Caenorhabditis, e.g. C. elegans, a nematode belonging to the genus Haemonchus, e.g. H. contortus, a nematode belonging to the genus Lumbricus, e.g. L. rubellus, a nematode belonging to the genus Meilodogyne, e.g. M. hapla, a nematode belonging to the genus Strongyloidus, e.g. 5. rattii, S. stercoralis, a nematode belonging to the genus Pristionchus, e.g. P. pacificus. Whilst the micro-organism may be naturally occurring, preferably at least one copy of at least one genetic sequence encoding a respective enzyme in said metabolic pathway has been recombinantly introduced into said microorganism. Additionally or alternatively to introducing coding sequences coding for a said enzyme, one may provide one or more expression signals, such as promoter sequences, not natively associated with said coding sequence in said organism. Thus, optionally, at least one copy of a genetic sequence encoding a L-phenylalanine ammonia lyase is operatively linked to an expression signal not natively associated with said genetic sequence in said organism.
Expression signals include nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Such sequences may include promoters, translation leader sequences, introns, and polyadenylation recognition sequences .
Optionally, at least one copy of a genetic sequence encoding a 4-coumarate-CoA ligase or cinnamate-CoA ligase, whether native or not, is operatively linked to an expression signal not natively associated with said genetic sequence in said organism.
Optionally, at least one copy of a genetic sequence encoding a stilbene synthase, which may be a resveratrol synthase, whether native or not, is operatively linked to an expression signal not natively associated with said genetic sequence in said organism.
Optionally, at least one copy of a genetic sequence encoding a pinosylvin synthase, whether native or not, is operatively linked to an expression signal not natively associated with said genetic sequence in said organism.
In certain aspects the invention uses a metabolically engineered micro-organism of the kind described, having an operative metabolic pathway in which a first metabolite is transformed into a second metabolite in a reaction catalysed by a first enzyme, said reaction step producing ammonia, and in which said second metabolite is transformed into a third metabolite in a reaction catalysed by a second enzyme in which ATP and CoA is a substrate, and ADP is a product, and in which said third metabolite is transformed into a fourth metabolite in a reaction catalysed by a third enzyme in which endogenous malonyl-CoA is a substrate.
The micro-organisms described above include ones containing one or more copies of a heterologous DNA sequence encoding phenylalanine ammonia lyase operatively associated with an expression signal, and containing one or more copies of a heterologous DNA sequence encoding 4-coumarate-CoA- ligase or cinnamate-CoA ligase operatively associated with an expression signal, and containing one or more copies of a heterologous DNA sequence encoding a stilbene synthase, which may be resveratrol synthase, operatively associated with an expression signal.
Alternatively, the micro-organisms described above include ones containing one or more copies of a heterologous DNA sequence encoding phenylalanine ammonia lyase operatively associated with an expression signal, and containing one or more copies of a heterologous DNA sequence encoding 4-coumarate-CoA-ligase or cinnamate-CoA ligase operatively associated with an expression signal, and containing one or more copies of a heterologous DNA sequence encoding pinosylvin synthase operatively associated with an expression signal.
In the present context the term "micro-organism" relates to microscopic organisms, including bacteria, microscopic fungi, including yeast.
More specifically, the micro-organism may be a fungus, and more specifically a filamentous fungus belonging to the genus of Aspergillus, e.g. A. niger, A. awamori, A. oryzae, A. nidulans, a yeast belonging to the genus of Saccharomyces, e.g. 5. cerevisiae, S. kluyveri , S. bayanus, S. exiguus, S. sevazzi, S. uvarum, a yeast belonging to the genus Kluyveromyces, e.g. K. lactis K. marxianus var. marxianus, K. thermotolerans, a yeast belonging to the genus Candida, e.g. C. utilis C. tropicalis, C. albicans, C. lipolytics, C. versatilis, a yeast belonging to the genus
Pichia, e.g. P. stipidis, P. pastoris, P. sorbitophila , or other yeast genera, e.g. Cryptococcus, Debaromyces, Hansenula, Pichia, Yarrowia , Zygosaccharomyces or Schizosaccharomyces . Concerning other micro-organisms a non- exhaustive list of suitable filamentous fungi is supplied: a species belonging to the genus Penicillium, Rhizopus, Fusarium, Fusidium, Gibberella , Mucor, Mortierella , Trichoderma .
Concerning bacteria a non-exhaustive list of suitable bacteria is given as follows: a species belonging to the genus Bacillus, a species belonging to the genus Escherichia, a species belonging to the genus Lactobacillus, a species belonging to the genus Lactococcus, a species belonging to the genus Corynebacterium, a species belonging to the genus Acetobacter, a species belonging to the genus Acinetobacter, a species belonging to the genus Pseudomonas, etc .
The preferred micro-organisms of the invention may be 5. cerevisiae, A. niger, A. oryzae, E. coli, L. lactis or B. subtilis.
Any wild type enzyme referred to herein may be substituted by a mutant form thereof, suitably having an amino acid homology relative to the named wild type enzyme of at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably still at least 90% or at least 95%, whilst of course maintaining the required enzyme activity of the wild type. This may include maintaining any substrate preference of the wild type, e.g. for phenylalanine over tyrosine or for cinnamic acid over coumaric acid or for cinnamoyl-CoA over coumaroyl-CoA. Any wild type coding sequence coding for an enzyme referred to herein may be substituted with a sequence coding for the same enzyme but in which the codon
usage is adjusted. This applies both to wild type enzymes mentioned herein and mutant forms as discussed above. Nucleotide sequences coding for mutant forms of wild type enzymes are preferably homologous with the wild type nucleotide sequence of the corresponding wild type enzyme to the extent of at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably still at least 90% or at least 95%.
Mutant forms of enzymes may have a level of enzyme acitivity largely unchanged from that of the wild type enzyme or may be selected to have a higher level of activity. Conservative substitutions of amino acids of the wild type enzyme may be made in accordance with known practice. Enzymes having improved activity may be developed by directed evolution techniques as known in the art, random changes in the enzyme being produced by methods such as introducing random genetic changes in the coding for the enzyme in a suitable test organism such as E.coli or 5. cerevisiae followed by expression and selection of improved mutants by screening for the desired property, or by imposing self selection conditions under which organisms expressing an improved activity will have a survival advantage .
References herein to the absence or substantial absence or lack of supply of a substance, e.g. of cinnamic acid, include the substantial absence of derivatives thereof such as cinnamic acid esters (including thioesters) , e.g. cinnamoyl-CoA, which may be metabolised to the substance or which are immediate products of further metabolism of the substance. In particular, lack of cinnamic acid implies lack of cinnamoyl-CoA.
Pinosylvin and/or resveratrol produced in consumable products according to the invention may be cis- or trans-.
BRIEF DESCRIPTION OF THE DRAWINGS
To assist in the ready understanding of the above decription of the invention reference has been made to the accompanying drawings in which:
Figure 1 shows the structure of plasmid pESC-URA-PAL2 -C4H::AR2 produced in Example 2.
Figure 2 shows the structure of plasmid pESC-HIS-4CL-VSTl produced in Example 3.
Figure 3 shows the structure of a fused divergent constitutive promoter produced in Example 6.
Figure 4 shows the structure of plasmid pESC-URA-TEF-PAL2- TDH3-C4H:AR2 produced in Example 7.
Figure 5 shows the structure of plasmid pESC-HIS-TEF-4CL- TDH3-VST1, produced in Example 8.
Figure 6 shows an HPLC chromatogram of bread prepared as a control obtained in Example 13.
Figure 7 shows an HPLC chromatogram of bread according to the invention obtained in Example 13.
Figure 8 shows the structure of plasmid Rho29-URA3 produced in Example 14.
Figure 9 shows the structure of plasmid RHO30-HIS3 produced in Example 14.
Figure 10 shows the structure of plasmid 0834325 from Example 20.
The invention will be further described and illustrated by the following non-limiting examples.
EXAMPLES
Examples 1-20 of WO2008/009728 provide description of materials and micro-organisms used in these examples.
Examples of the invention
Example 1
Isolation of genes encoding PAL2, C4H, AR2, 4CL and VSTl
Phenylalanine ammonia lyase (PAL2) (Cochrane et al . , 2004) (SEQ ID NO 1), cinnamate 4-hydroxylase (C4H) (Mizutani et al, 1997) (SEQ ID NO 2), cytochrome P450 reductase (AR2) (Mizutani and Ohta, 1998) (SEQ ID NO 3), 4- coumarate : coenzymeA ligase (4CL) (Hamberger and Hahlbrock 2004; Ehlting et al . , 1999) (SEQ ID NO 4) were isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using the primers in Table 1.
The codon optimized VSTl gene encoding Vitis vinifera (grapevine) resveratrol synthase (Hain et al . , 1993) (SEQ ID NO 5) for expression in 5. cerevisiae was synthesized by
GenScript Corporation (Piscataway, NJ) . The synthetic VSTl
gene was delivered inserted in E. coli pUC57 vector flanked by BamHl and Xhol restriction sites. The synthetic gene was purified from the pUC57 vector by BamHl/Xhol restriction and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen) .
Table 1
Primer for amplification of gene Gene
(Restriction sites are underlined)
5-CG GAATTC CGTACG TA ATG GAT CAA ATC GAA GCA ATG TT SEQ ID NO: 6 PAL2
5-CG ACTAGT TTA GCA AAT CGG AAT CGG AGC SEQ ID NO: 7 PAL2
5-CG CTCGAG GCGGCCGC TAAAAT ATG GAC CTC CTC TTG CTG GAG SEQ ID NO: C4H
5-AGTAGATGGAGTAGATGGAGTAGATGGAGTAGATGG ACA GTT CCT TGG TTT CAT AAC C4H G SEQ ID NO: 9
5-CCATCTACTCCATCTACTCCATCTACTCCATCTACT AGG AGA TCC GGT TCT GGG A AR2 SEQ ID NO: 10
5-CG GGTACCAT TTA CCA TAC ATC TCT AAG ATA TCT TCC SEQ ID NO: 11 AR2
5'GCGAATTCTTATGACGACACAAGATGTGATAGTCAATGAT SEQ ID NO: 12 4CL
5'GCACTAGTATCCTAGTTCATTAATCCATTTGCTAGTCTTGC SEQ ID NO: 13 4CL
Example 2
Construction of a yeast vector for galactose induced expression of PAL2 and C4H:AR2 fusion gene
The gene encoding PAL2 was amplified from cDNA from A. thaliana as template using forward primer 5-CG GAATTC CGTACG
TA ATG GAT CAA ATC GAA GCA ATG TT-3 SEQ ID NO: 14 and reverse primer 5-CG ACTAGT TTA GCA AAT CGG AAT CGG AGC-3 SEQ ID NO: 15. The amplified PAL2 PCR-product was digested with EcoRl/Spel and ligated into EcoRl/Spel digested pESC-URA vector (Stratagene) , resulting in vector pESC-URA-PAL2. Two
different clones of pESC-URA-Pal2 were sequenced to verify the sequence of the cloned gene.
C4H was amplified using cDNA from A. thaliana as template using forward primer 5-CG CTCGAG GCGGCCGC TAAAAT ATG GAC CTC CTC TTG CTG GAG -3 SEQ ID NO: 16 and reverse primer 5- AGTAGATGGAGTAGATGGAGTAGATGGAGTAGATGG ACA GTT CCT TGG TTT CAT AAC G-3 SEQ ID NO: 17. AR2 was amplified using cDNA from A. thaliana as template using forward primer 5- CCATCTACTCCATCTACTCCATCTACTCCATCTACT AGG AGA TCC GGT TCT GGG A-3 SEQ ID NO: 18 and reverse primer 5'- CG GGTACCAT TTA CCA TAC ATC TCT AAG ATA TCT TCC -3 SEQ ID NO: 19.
The amplified PCR products C4H and AR2 were used as templates for the creation of the fusion gene C4H:AR2 using the forward primer 5-CG CTCGAG GCGGCCGC TAAAAT ATG GAC CTC CTC TTG CTG GAG-3 SEQ ID NO: 20 and the reverse primer 5-CG GGTACC AT TTA CCA TAC ATC TCT AAG ATA TCT TCC-3 SEQ ID NO: 21. The fusion gene C4H:AR2 gene was digested with Xhol/Kpnl and ligated into Xhol/Kpnl digested pESC-URA-PAL2. The resulting plasmid, pESC-URA-PAL2-C4H: AR2, contained the genes encoding PAL2 and C4H:AR2 under the control of the divergent galactose induced <=GAL1/GAL1O=> promoters (Figure 1) . The sequence of the gene encoding C4H:AR2 was verified by sequencing of two different clones of pESC-URA-PAL2- C4H:AR2.
Example 3
Construction of a yeast vector for galactose induced expression of 4CL and VSTl
The gene encoding 4CL was isolated as described in example 1. The amplified 4CL PCR-product was digested with EcoRl/Spel and ligated into EcoRl/Spel digested pESC-HIS vector (Stratagene) , resulting in vector pESC-HIS-4CL . Two different clones of pESC-HIS-4CL were sequenced to verify the sequence of the cloned gene.
The gene encoding VSTl was isolated as described in example 1. The amplified synthetic VSTl gene was digested with BamHl/Xhol and ligated into BamHl/Xhol digested pESC-HIS-
4CL. The resulting plasmid, pESC-HIS-4CL-VSTl, contained the genes encoding 4CL and VSTl under the control of the divergent galactose induced <=GAL1/GAL1O=> promoters (Figure 2) . The sequence of the gene encoding VSTl was verified by sequencing of two different clones of pESC-HIS-4CL-VSTl .
Example 4
Construction of strong constitutive promoter fragment TDH3
The 600 base pair TDH3 (GPD) promoter was amplified from 5. cerevisiae genomic DNA using the forward primer 5' GC GAGCTC AGT TTA TCA TTA TCA ATA CTC GCC ATT TCA AAG SEQ ID NO: 22 containing a Sacl restriction site and the reverse primer 5'- CG TCTAGA ATC CGT CGA AAC TAA GTT CTG GTG TTT TAA AAC TAA AA SEQ ID NO: 23 containing a Xbal restriction site. The amplified TDH3 fragment was digested with Sacl/Xbal and ligated into Sacl/Xbal digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TDH3.
Example 5
Construction of constitutive strong promoter fragment TEF2
The 400 base pair TEF2 promoter was amplified from 5. cerevisiae genomic DNA using the forward primer 5'- GC GAGCTC ATA GCT TCA AAA TGT TTC TAC TCC TTT TTT ACT CTT 24 containing a Sacl restriction site and the reverse primer 5'- CG TCTAGA AAA CTT AGA TTA GAT TGC TAT GCT TTC TTT CTA ATG A 25 containing a Xbal restriction site. The amplified TEF2 fragment was digested with Sacl/Xbal and ligated into Sacl/Xbal digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TEF2.
Example 6
Construction of fused divergent constitutive TEF and TDH3 promoter fragment
A divergent fusion fragment (Figure 3) between TEF2 promoter and TDH3 promoter was constructed starting from PRS416-TEF and PRS416-TDH3.
The 600 base pair TDH3 fragment was reamplified from PRS416- TDH3 using the forward primer 5' TTGCGTATTGGGCGCTCTTCC GAG CTC AGT TTA TCA TTA TCA ATA CTC GC SEQ ID NO: 26 containing the underlined overhang for fusion PCR to TEF2 fragment and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 27 containing the underlined BamHl restriction site. This resulted in a fragment ready for fusion to the below TEF2 fragment.
The 400 base pair TEF2 fragment including a 277 base pair spacer upstream of the Sacl restriction site was reamplified from PRS416-TEF2 using the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO: 28 containing the underlined EcoRl restriction site and the reverse primer 5' TGA TAA TGA TAA ACT GAG CTC GGA AGA GCG CCC AAT ACG CAA AC SEQ ID NO: 29 containing the underlined overhang for fusion to the TDH3 fragment. This resulted in a 680 base pair fragment ready for fusion to the TDH3 fragment.
The 680 base pair TEF2 fragment and the 600 base pair TDH3 fragments were joined together (fused) using fusion PCR with the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO: 30 and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 31, resulting in the divergent fragment <=TEF2/TDH3=> (Figure 3) (Sequence ID NO:34) .
Example 7
Construction of a yeast vector for constitutive expression of PAL2 and C4H:AR2 fusion gene
The vector pESC-URA-PAL2-C4H: AR2 (Figure 1) with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with Notl and BsiWI to remove the GAL1/GAL10 promoters .
The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 6) was re-amplified with forward primer 5-GC CGTACG TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC-3 32 and reverse primer 5-ATT GCGGCCGC TCT AGA ATC CGT CGA AAC TAA GTT CTG -3 33. The resulting PCR product was sequentially digested with
Notl and BsiWI and ligated into the above vector without the GALl/GallO fragment. This resulted in a vector pESC-URA- TEF-PAL2-TDH3-C4H:AR2 with replaced promoters, from GALl/GallO to TEF2/TDH3 (Figure 4) (Sequence ID NO:35).
Example 8
Construction of a yeast vector for constitutive expression induced of 4CL and VSTl
The vector pESC-HIS-4CL-VSTl (Figure 2) with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with EcoRl and BamHl to remove the GAL1/GAL10 promoters.
The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 6) was sequentially digested with EcoRl and BamHl and ligated into the above linearized vector without the GAL1/GAL10 fragment. This resulted in a vector pesc-HIS-
TEF2-4CL-TDH3-VST1 with replaced promoters, from GALl/GallO to TEF2/TDH3 (Figure 5) (SEQ ID NO : 8 ) .
Example 9 Generation of strain with constitutive expression of the pathway to resveratrol in the yeast S. cerevisiae .
The transformation of the yeast cell was conducted in accordance with methods known in the art, for instance by using lithium acetate transformation method (Gietz and
Schiestl, 1991). 5. cerevisiae strain FS01528 (CEN. PK MATa ura3 His3) was co-transformed with pESC-URA-TEF-PAL2-TDH3- C4H:AR2 (example 7) and pesc-HIS-TEF2-4CL-TDH3-VSTl (example
8), and the transformed strain was named FS09215.
Transformants were selected on medium lacking uracil and histidine and streak purified on the same medium.
Example 10
Generation of biomass
Yeast strains FS01201 (CEN. PK 113-7D wild type non modified control strain) was kept on YPD agar plates with 20 g/1 glucose. FS09215 (genetically modified resveratrol producer from example 9) was kept on SC-HIS-URA agar plates with 20 g/1 glucose.
The two yeast strains were grown in 10-16 500 ml shake flasks with 200 ml DELFT medium (Verduyn et al, 1992) containing 45 g/1 glucose, 30 g/1 ammonium sulphate, 14 g/1 KH 2 PO 4 , and 1.5 g/1 MgSO 4 for 4 days at 30 0 C and 150 rpm. A paste of wet weight cells was collected (harvested) by centrifugation at 300Og for 5 minutes in 50 ml Sartorious tubes and discarding the supernatant after each round. After repetitive rounds of centrifugation 26 g wet weight was collected of strain FS01201 and 24 g wet weight of FS09215.
Example 11
Baking of bread
A commercial flour mixture was used for bread baking; Danish brand "Amo - Durumstykker - med hele durumkerner" . One package of commercial flour mixture was used to bake two breads: a control bread with strain FS01201 and resveratrol containing bread with strain FS09215.
For each bread 163 ml water preheated to 30 0 C was mixed with cells (26 g wet weight for FS1201 and 24 g wet weight for FS09215) and 25Og of commercial flour mixture to generate dough. The dough was raised over night at ambient temperature (24 0 C) for 8 hours in a plastic beaker covered with a wet towel. The following morning the dough was put into two baking forms and let to regain shape by raising the dough another 2 hours at 30 0 C. The raised dough was heated in an oven at 200 0 C for 90 minutes covered with aluminium paper to generate bread.
Example 12
Extraction of bread and HPLC
From the two breads 20g was torn into crumbs and the crumbs were extracted over night with 60 ml ethyl acetate (divided in two 50 ml Sartorious tubes) using a rotary unit at ambient temperature (24 0 C) . The extraction tubes were covered with aluminium foil to avoid any light induced degradation of stilbenoids. The following day the crumbs were removed by a "classical" filtration using a Munktell filter paper and a glas funnel. From the initial 60 ml ethyl acetate 28ml extract was collected for the reference bread and 38ml for the resveratrol bread. These extracts were evaporated for 2 hours using a freeze dryer until a dry residue was the result.
The dry residue was dissolved in 600 microliter 50% ethanol which resulted in an emulsion. The emulsion was vortexed and further diluted 15-fold with 96% ethanol. This resulted in a clear solution that could be used for HPLC analysis.
Example 13
HPLC determination of stilbenoids and phenylpropanoids
For quantitative analysis of cinnamic acid, trans- resveratrol and trans-pinosylvin, samples were subjected to separation by high-performance liquid chromatography (HPLC) Agilent Series 1100 system (Hewlett Packard) prior to uv- diode-array detection at λ = 306 nm. A Phenomenex (Torrance, CA, USA) Luna 2.5 micrometer C18 (100 X 2.00 mm) column was used at 60 °C . As mobile phase a non linear S-shaped gradient of acetonitrile and milliq water (both containing 50 ppm trifluoroacetic acid) was used at a flow of 0.8 ml/min. The S-shaped gradient profile was from 10% to 100% acetonitrile in 5 minutes. The elution time was approximately 3.0 minutes for trans-resveratrol and 4.4 minutes trans- pinosylvin. Pure pinosylvin standard (> 95% pure) was purchased from ArboNova (Turku, Finland) and pure trans- resveratrol standard was purchased from Sigma.
After analysis of the chromatograms (Figure 6 and 7) and UV spectra of the compounds, we concluded that no stilbenoids or phenylpropanoids were detected in the bread prepared with the reference strain (FS01201) (Figure 6) . The bread prepared with the resveratrol producing strain (FS09215) had 11.5 microgram trans-resveratrol / g bread, 6.5 microgram trans-cinnamic acid / g bread and 18.7 microgram trans-pinosylvin/ gram bread (Figure 7) . This converts to 11.5 milligram resveratrol / kg bread, 6.5 milligram cinnamic acid / kg bread and 18.7 milligram pinosylvin/ kg bread.
Example 14
Construction of yeast vectors with the full propanoic! pathway
In a manner similar to that described in Examples 1-4, but using genes codon optimised for 5. cerevisiae, two vectors were constructed, Rho29-URA3 (Figure 8) and RHO30-HIS3 (Figure 9, which were based on Stratagene PESC -vectors, PESC-URA and PESC-HIS (www.stratagene.com), and contained the plant resveratrol pathway genes, with the full set of resveratrol pathway genes included in each plasmid. The heterologous plant genes prior to codon opimisation came from the non-pathogenic Arabidopis thaliana and Vitis vinifera (grape) (resveratrol, synthase) . The inserted heterologous genes encode enzymes involved in the phenylpropanoid pathway. This pathway involves the degradation of L-phenylalanine via cinnamic acid, coumaric acid to coumaroyl-CoA. Finally, the formation of resveratrol is made possible via resveratrol synthase from grape. The formed product resveratrol is a nutraceutical with anticarcinogenic and antioxidant properties. The genes were as follows:
a) Codon optimized phenylalanine ammonia lyase (PAL2) from Arabidopsis thaliana for expression in 5. cerevisiae catalysing the deamination of phenylalanine into cinnamic acid (Sequence ID NO: 36) :
b) A fused DNA fragment consisting of parts of three genes (Sequence ID NO: 37) :
Part i) a cinnamate 4-hydroxylase gene (C4H) from Arabidopsis thaliana codon optimized for expression in 5. cerevisiae, (Sequence ID NO: 38):
Part ii) Electron carrier Cytochrome b5 CYB5 encoded by S. cerevisiae native ORF YNLlllc
Part iii) a cytohrome p450 reductase gene (AR2) from Arabidopsis thaliana. Codon optimized for expression in 5. cerevisiae (Sequence ID NO: 39) : The three parts were fused in such a way that they were expressed as one single enzyme and the orientation of the fused DNA fragment was >Start codon C4H: : CYB5 : : AR2 stop codon< (where "::" means fused genes in frame) . This fusion constructs enables higher catalytic activities of the hydroxylation step (conversion of cinnamic acid into coumaric acid), than when C4H was expressed alone.
c) A non codon optimized 4-coumaroyl CoA-ligase (4CL2) from Arabidopsis thaliana catalyzing the activation of coumaric acid into coumaroyl-CoA while consuming ATP and acetyl-CoA, (Sequence ID NO: 4) .
d) Codon optimized resveratrol synthase from grape (Vitis vinifera) catalyzing the ring-folding reaction of one coumaroyl-CoA and 3 malonyl-CoA into resveratrol, (Sequence ID NO: 5) .
Example 15
Generation of a strain with constitutive expression of the pathway to resveratrol in the yeast S. cerevisiae .
Strain FS09236 was transformed with the two 2-micron based multi copy plasmids containing the full resveratrol pathway
and an empty leu-vector; that is plasmids rho29-URA3 (Figure 8) rho30-HIS3 (Figure 9) and pesc-leu (www.stratagene.com). Transformants were selected on SC-ura-his-leu plates. The resulting strain obtained was FS09250. The transformation of the yeast cell was conducted in accordance with methods known in the art, for instance by using lithium acetate transformation method (Gietz and Schiestl, 1991). Strain FS09236 was a CEN. PK strain with the following genotype; [MatA, ura3,52, his3, Ieu2, TPI-ACCl] Ura3,52, his3 and Leu2 means that the strain is auxotrophic for uracil, histidine and leucine. TPI-ACCl means that the natural promoter on the chromosome in front of the gene encoded by ACCl (YNROlβc) was exchanged to the constitutive TPI promoter by homlogous recombination. ACCl (systematic gene name YNROlβc) encodes the enzyme acetyl-CoA carboxylase from 5. cerevisiae, which is a biotin containing enzyme that catalyzes the carboxylation of acetyl-CoA to form malonyl- CoA; normally required for de novo biosynthesis of long- chain fatty acids in yeast and also needed in the resveratrol pathway. The method used for the promoter switch is described in (Erdeniz et al, 1997) .
Example 16
Generation of biomass
Strain FS09250 was grown in a 2L fermentor following a batch and a subsequent fed-batch control. The fed-batch cultivation was performed in a bioreactor, Biostat B plus from Sartorius BBI systems, with a working volume of 2 1. The initial volume of liquid used was 500 ml. The total volume of feed prepared was 1 1, such that the volume of liquid in the fermentor vessel did not exceed 1.5 1. The bioreactor was equipped with two Rushton four-blade disc
turbines and baffles. Air was used for sparging the bioreactors. The concentrations of oxygen, carbon dioxide, and ethanol in the exhaust gas were monitored by a gas analyzer Innova 1313 with multiplexing. Temperature, pH, agitation, and aeration rate were controlled throughout the cultivation. The temperature was maintained at 30 0 C. The pH was kept at 5.5 by automatic addition of KOH (2N) or NH4OH (25%), in the course of the initial batch, and NH4OH (25%) and HCl (2 N), during the feeding phase. The stirrer speed was initially set to 1200 rpm and the aeration rate to 1.5 vvm (i.e., 0.75 1/h, for a volume of liquid of 500 ml) . The aeration rate was set to 2.25 1/h, during the feeding process. When the levels of dissolved oxygen decreased below 60%, the stirrer speed was increased to values up to 1800 rpm. The formation of foam was controlled using a foam sensor and through the addition of an antifoam agent (Sigma A-8436) (diluted or pure) . Samples were withdrawn at selected time points and analyzed for cell mass, extracellular metabolites, and stilbenoids. An exponential feeding profile was implemented during the fed-batch phase such that a constant specific growth rate of 0.1 1/h was reached and residual glucose concentrations were close to 0 g/1) . The feed rate was manually adjusted in the course of the cultivation, in order to avoid respirofermentative metabolism and subsequent formation of ethanol.
A 270 ml aliquot of cell-broth was collected at 14.7 hrs after the start of the glucose-feed. The density of the cell mass corresponded to an OD600 of 41.2, which translated to a dry weight content of 0.8 * 41.2 = 32.96 g/1. Hence the 270 ml of cell broth contained 0.27 1 * 32.96 g/1 = 8.9 g/1 dry-weight. The resveratrol concentration of the cell broth was 249.1 mg/1; hence a 270 ml-aliquot of cell broth
contained 0.27 1 * 249.1 mg/1 = 67.26 mg resveratrol. However, solubility of resveratrol in an aquous solution is 30 mg/1 only, and hence it can be assumed that 0.27 1 * (249.1-30.0) mg/1 = 59.16 mg ended up as precipitate in the cell-pellet. Next, the 270 ml of cell broth was divided over 50 mi-Falcon tubes and cells were harvested by subsequent rounds of centrifugation at 3000g for 5 minutes and discarding the supernatant after each round. As a result, the wet cell paste of strain FS09250 was collected into one Falcon tube, and was used to beak a bread.
As a control a bread was baked using a commercial yeast that did not contain a phenylpropanoid pathway; "Malteserkors gaer" from "De danske spritfabrikker A/S", Copenhagen, Denmark.
Example 17
Baking of bread
A commercial flour mixture was used for bread baking; Danish brand "Ciabatta" from Amo, Lantmannen Schulstad A/S, Hammerholmen 21-35, 2650 Hvidovre, Denmark". Two packages of commercial flour mixture was used to bake two breads: a control bread with the commercial yeast "Malteserkors gaer" from "De danske spritfabrikker A/S", Copenhagen, Denmark, and a resveratrol containing bread with strain FS09250.
For each bread 325 ml water preheated to 30 0 C and 500 g of commercial flour mixture was mixed with either cells 8.9 g dry weight of FS09250, or 14 g dry weight of the commercial yeast, to generate dough. Small sample aliquots were taken
for analysis of resveratrol content before prooving. The dough was then allowed to proove at room temperature (24
0 C) for ca. 15 hours in a plastic beaker covered with a wet towel. Small sample aliquots were taken for analysis of resveratrol content after prooving. The raised dough was heated in an oven at 220 0 C for 30 minutes covered with aluminium paper to generate bread.
Example 18
Extraction of unprooved doug, prooved dough and bread and HPLC analysis
Aliquots of unprooved- and prooved dough, made from the commercial yeast strain and the FS09250 strain were subjected to an ethylacetae extraction over night with 30 ml ethyl acetate (each aliquot divided in two 50 ml Sartorious tubes) using a rotary unit at ambient temperature (24°C) . The aliquots taken were; i) 12.7 gram "commercial dough" before prooving; ii) 4.7 gram "commercial dough" after prooving; iii) 13.8 gram "FS09250 dough" before prooving; iv) 10.35 gram "FS09250 dough" after prooving. The extraction tubes were covered with aluminium foil to avoid any light induced degradation of stilbenoids. The following day the dough was condensed by centrifugation at 3000g for 5 minutes and the supernatant was collected. From the initial 30 ml ethyl acetate, 20 ml extract was collected for the commercial dough" before prooving; 25 ml for the "commercial dough" after prooving; 25 ml "FS09250 dough" before prooving and 30 ml for the "FS09250 dough" after prooving. Said extracts were evaporated for 2 hours using a freeze dryer until a dry residue was obtained. The dry residue was dissolved in 500 microliter 50% ethanol and further diluted
100-fold with 50% ethanol. This resulted in a clear solution that could be used for HPLC analysis.
From the two breads 2Og was torn into crumbs and the crumbs were extracted over night with 60 ml ethyl acetate (divided in two 50 ml Sartorious tubes) using a rotary unit at ambient temperature (24°C). The extraction tubes were covered with aluminium foil to avoid any light induced degradation of stilbenoids. The following day the crumbs were condensed by centrifugation at 300Og for 5 minutes and the supernatant was collected. From the initial 60 ml ethyl acetate, 45.0 ml extract was collected for the control bread and 42.5 ml for the resveratrol bread. These extracts were evaporated for 2 hours using a freeze dryer until a dry residue was obtained.
The dry residue was dissolved in 500 microliter 50% ethanol and further diluted 100-fold with 50% ethanol. This resulted in a clear solution that could be used for HPLC analysis.
Example 19
HPLC determination of stilbenoids and phenylpropanoids For quantitative analysis of coumaric acid, cinnamic acid, trans-resveratrol and trans-pinosylvin, samples were subjected to separation by high-performance liquid chromatography (HPLC) , using a HPLC-system from Dionex, prior to uv-diode-array detection at 1 = 306 nm. A Phenomenex (Torrance, CA, USA) Luna 2.5 micrometer C18 (100 X 2.00 mm) column was used at 60 0 C. The method used a non linear S-shaped gradient of acetonitrile and millipore water (both containing 50 ppm trifluoroacetic acid) , at a flow of
31
0.8 ml/min. The S-shaped gradient profile was from 10% to 100% acetonitrile over 5 minutes. The elution time was approximately 2.0 minutes for coumaric acid, 3.0 minutes for trans-resveratrol, 3.5 minutes for cinnamic acid and 4.4 minutes for trans-pinosylvin .
Pure pinosylvin standard (> 95% pure) was purchased from ArboNova (Turku, Finland) and pure trans-resveratrol standard was purchased from Sigma.
After analysis of the chromatograms no stilbenoids or phenylpropanoids were detected in the bread prepared with the commercial strain. The bread prepared with the resveratrol producing strain FS09250, however contained 66.04 mg trans-resveratrol / kg bread, 6.67 mg cinnamic acid / kg bread and 7.84 mg coumaric acid/ kg bread.
The analysis showed no detectable levels of pinosylvin, neither in the bread baked with commercial yeast nor the bread baked with FS09250. This was as expected since the strain has been optimized for exclusive resveratrol production. The results for the other components are given in the table below
From the table it is clearly seen that both resveratrol and the precursor coumaric acid is produced during the baking process in the bread baked with FS09250 and nothing is produced in the control bread. Further it can be seen that cinnamic acid, the precursor for pinosylvin, is also produced in the bread baked with FS09250. This means that pinosylvin could be produced if desired by choosing a different strain for the production.
Example 20
Codon optimization of TAL, 4CLl and VSTl genes for expression in Lactococcus lactis subsp. cremoris
A synthetic gene operon encoding TAL, 4CLl and VSTl was synthesized by Geneart using a gene optimization algorithm adapted to the codon bias of L. lactis subsp. cremoris . The synthetic gene was designed in the following way: The 5' end contained a unique restriction site (BamRI) followed by an untranslated leader sequence, which is identical to the sequence present in the L. lactis expression vectors used for expression of the TAL-4CL1-VST1 operon. This leader contained a ribosome binding site for translation of TAL. The ribosome binding site (RBS) present upstream of lacA (Ace no. M65190) was placed inbetween the TAL gene and the 4CLl gene. The sequence of this intergenic region was: 5' ATTTAGGAGGTAGTCCAA 3' SEQ ID NO: 40. Furthermore, the ribosome binding site present upstream of lacB (Ace no. M65190) was placed inbetween the 4CLl gene and the VSTl gene. The sequence of said intergenic region was: 5'
GAAAAGGAGTTAAAAA3' SEQ ID NO: 41. In addition, an unique Sail restriction site was placed downstream of the VSTl gene. The operon with indicated ribosomal binding sites and restriction sites is presented in Figure 10. The total length of the synthezised gene sequence was 4564 bp . The entire plasmid was obtained from Geneart and named 0834325 by Geneart.
Example 21 Construction of vectors for expression of TAL, 4CLl and VSTl in L. lactis
The synthesized gene operon was inserted into an expression vector. The vector was an E. coli-L. lactis shuttle vector, and erythromycin selection was used for plasmid selection in both E. coli (200 mg/L) and L. lactis (1 mg/L) .
In said vector gene expression was controlled by a constitutive promoter, which was derived from the P170 promoter (refs; Madsen et al 1999, EP 0 677 110 Bl; EP 0 925 364 Bl) . The vector backbone having a medium copy number was combined with the promoters, resulting in the expression vector pAMJ2006 (Inducible promoter, Medium copy, Bioneer plasmid collection) .
Said vector, with the constitutive promoter, was created by insertion of an appr. 100 bp XhoI-BamRI fragment originating from pAMJ326 (Bioneer plasmid collection) . Aforementioned plasmid contained the constitutive promoter derived from P170) into a similarly digested pAMJ2006. The resulting vector was named pAMJ2496 (medium copy number plasmid) .
Plasmid 0834325 from Geneart was digested with BamRI and Sail, and the 4564 bp fragment was purified and ligated into a similarly digested expression vector pAMJ2496. The resulting plasmid was established in E. coli DHlOB and named, pAMJ2518. The correct insertion of the fragment encoding the TAL, 4CLl and VSTl genes was verified by restriction enzyme mapping and by DNA sequencing of the cloning junctions.
Example 22
Construction of L. lactls strains for expression of TAL, 4CLl and VSTl
The plasmid pAMJ2518 constructed in Example 21 was transformed into the L. lactls subsp cremorls strain MG1363 (lac + , prtP + ) (ref; Gasson 1983) . The strains were named as described in Table 2 with the features as indicated. L. lactls subsp cremorls MG1363 (lac + , prtP + ) contained the plasmid pLP712, which was necessary for metabolism of the lactose and the casein present in the milk.
Table 2
Example 23
Expression of the pathway to resveratrol in L. lactis cultivated in rich medium. The strain AMJ1699, was precultivated in M17 medium (ref; Terzaghi and Sandine 1975; manufactured by Oxoid Ltd, Cambridge, UK) with 5 g/L glucose and 1 mg/L erythromycin. For the host strain MG1363 (lac + , prtP + ) , which was grown in parallel for comparison, erythromycin was omitted from the medium. The initial preculture volume was 2 mL in a 15 mL screw-capped centrifuge tube. An aliquot of 10 mL fresh medium was added after 12 hours at 30 0 C, and incubation was continued for 10 hours.
Example 24
Production of buttermilk
The strain AMJ1699, (see table 2), which contained the plasmid pLP712, was able to utilize lactose as energy source and the casein as amino acid source, and was thus capable to grow in milk. The strains were precultivated as described in Example 23. Cells from 5 mL of preculture were harvested, washed by resuspension in 20 mL sterile 150 mM sodium chloride solution, and resuspended in 30 mL semi- skimmed milk (Milsani, heat treated at 141°C 4 seconds,
Hansa-Milch AG, 23935 Upahl) and 10 ml autoclaved 1 g/L L- tyrosine solution in water, supplemented with 1 mg/L erythromycin. The fermentation was conducted in a 50 mL screw-capped centrifugation tube. The fermentations were allowed to proceed for 24 hours, after which the milk had coagulated, acidified to pH 3.7-3.8 and developed a characteristic buttermilk aroma. The cultures were frozen
for later analysis. The cultures are listed in Table 3 according to the numbering under which they were stored for resveratrol analysis as described in Example 25.
Table 3
Sample no . Strain Growth medium erm D) L-tyr a)
AVR967 MG1363, lac + , PrtP + Milk - -
AVR976 AMJl 699 Milk, diluted 3: 1 + + a) 250 mg/L L-tyrosine added. b ) 1 mg/L erythromycin added
The control strain MG1363 (lac + , prtP + ) was cultivated similarly as described above; however without the addition of tyrosine and erythromycin in 40 ml semi skimmed milk (Milsani, Heat treated at 141°C 4 seconds, Hansa-Milch AG, 23935 Upahl) .
Example 25
Extraction of milk media and buttermilk broth and subsequent HPLC analysis
Volume aliquots of 10 ml milk and buttermilk broth were subjected to an ethylacetate extraction for 5 minutes with 10 ml ethyl acetate using a whirly mixer at ambient temperature (24 0 C). The extraction tubes were covered with aluminium foil to avoid any light induced degradation of stilbenoids. Next, the extracts were divided over 2-ml eppendorf tubes and centrifuged for 5 minutes at 1300Og to obtain suitable separation between the various fat/protein/water/ethylacetate layers with the ethylacetate as the upper layer. From the initial 10 ml ethyl acetate, an aliquot of 8 ml of extract was collected, which was evaporated for 8 hours using a freeze dryer, until an oily residue of less then 50 μl was obtained. Then, 100 μl 50% ethanol was added to the oily residue and whirly mix for 1 min to form an ethanolic extract. Non-dissolvable solids were spun down for 5 minutes at 13000g, and the resulting sample was transferred to HPLC analysis tubes and subjected to HPLC analysis.
Example 26
HPLC determination of stilbenoids and phenylpropanoids
For quantitative analysis of coumaric acid, cinnamic acid, trans-resveratrol and trans-pinosylvin, samples from cultivation of strain AMJ1699 and strain MG1363 L+P+ were subjected to separation by high-performance liquid chromatography (HPLC) , using a HPLC-system from Dionex, prior to uv-diode-array detection at 1 = 306 nm. A Phenomenex (Torrance, CA, USA) Luna 2.5 micrometer C18 (100 X 2.00 mm) column was used at 60 0 C. The method used a non linear S-shaped gradient of acetonitrile and millipore water (both containing 50 ppm trifluoroacetic acid) , at a flow of 0.8 ml/min. The S-shaped gradient profile was from 10% to 100% acetonitrile over 5 minutes. The elution time was approximately 1.9 minutes for coumaric acid, 2.8 minutes for trans-resveratrol, 3.3 minutes for cinnamic acid and 4.1 minutes for trans-pinosylvin . Pure pinosylvin standard (> 95% pure) was purchased from ArboNova (Turku, Finland) and pure trans-resveratrol standard was purchased from Sigma.
After analysis of the chromatograms indeed peaks were observed at retention times similar to resveratrol (2.5 -2.8 minutes) in extracts of unfermented milk, of buttermilk produced with the control strain MG1363 L+P+, and buttermilk produced with the engineered strain AMJ1699. However, the UV spectra revealed that the peaks in the chromatograms of the unfermented milk and of the milk fermented with the control strain, were not resveratrol. The UV spectrum of the peak in the production strain AMJ1699, however, indeed had absorptions similar to the UV spectrum of resveratrol. Said results demonstrated that the AMG1699 extract did contain resveratrol.
Based upon the HPLC analysis, the ethanolic extract contained 1.03 mg/1 resveratrol, which translates to 12.9 μg/1 in the buttermilk.
Hence, this example shows that by using an engineered strain of L. Lactis containing the phenylpropanoid pathway, in the fermentation of milk, the resulting buttermilk was indeed enriched with resveratrol. Similar enrichment with pinosylvin could easily be produced by changing the vector to only produce cinnamic acid instead of coumaric acid.
REFERENCES
The following publications are all hereby incorporated by reference:
Each publication referenced in WO2008/009728.
ZA200408194
EP0309862
EP0464461
US5391724
US5973230
WO2006125000
WO2006055322
Cochrane FC, Davin LB, Lewis NG.
The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms . Phytochemistry . 2004:65:1557- 64.
Ehlting J, Buttner D, Wang Q, Douglas CJ, Somssich IE, Kombrink E. Three 4-coumarate : coenzyme A ligases in Arabidopsis thaliana represent two evolutionarily divergent classes in angiosperms . Plant J. 1999:19:9-20.
Erdeniz, N., Mortensen, U. H., Rothstein, R. (1997) Cloning-free PCR-based allele replacement methods. Genome Res. 7: 1174-1183.
Gasson, M.J. (1983) Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast curing. J Bacteriol 154, 1-9.
Gietz RD, Schiestl RH .Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier .Yeast . 1991:7:253-63.
Hain R, Reif HJ, Krause E, Langebartels R, Kindl H, Vornam B, Wiese W, Schmelzer E, Schreier PH, Stocker RH, et al . Disease resistance results from foreign phytoalexin expression in a novel plant. Nature. 1993:361:153-6.
Hamberger B, Hahlbrock K. The 4-coumarate : CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes . Proc Natl Acad Sci U S A. 2004:101:2209-14.
Madsen, S. M., Arnau, J., Vrang, A., Givskov, M., Israelsen, H. (1999) Molecular characterization of the pH-inducible and growth phase-dependent promoter P170 of Lactococcus lactis. MoI Microbiol 32, 75-87.
Mizutani M, Ohta D, Sato R.
Isolation of a cDNA and a genomic clone encoding cinnamate 4-hydroxylase from Arabidopsis and its expression manner in planta. Plant Physiol. 1997:113:755-63.
Mizutani M, Ohta D.
Two isoforms of NADPH : cytochrome P450 reductase in Arabidopsis thaliana.
Gene structure, heterologous expression in insect cells, and differential regulation . Plant Physiol.
1998:116:357-67.
Mumberg D, Muller R, Funk M. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds .Gene .
1995:156:119-22.
Sikorski RS, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae .Genetics . 1989:122:19-27.
Terzaghi, B. E., and Sandine, W. E. (1975) Improved medium for lactic streptococci and their bacteriophages. Appl . Microbiol. 29, 807-813.
Urban P, Werck-Reichhart D, Teutsch HG, Durst F, Regnier S, Kazmaier M, Pompon D (1994) .Characterization of recombinant plant cinnamate 4- hydroxylase produced in yeast. Kinetic and spectral properties of the
major plant P450 of the phenylpropanoid pathway. Eur J Biochem. 222:843- 50
Verduyn C, Postma E, Scheffers WA, Van Dij ken JP.
Effect of benzoic acid on metabolic fluxes in yeasts : a continuous- culture study on the regulation of respiration and alcoholic fermentation. Yeast. 1992:8:501-17.
