PATENT APPLICATION

PRODUCTION OF FATTY ALCOHOLS FROM ENGINEERED MICROORGANISMS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority to previously filed U.S. Provisional Application. No. 61/674,053 filed July 20, 2012; PCT International Application No. PCT/US2012/069444 filed December 13, 2012, PCT International Application No. PCT/US2012/069553 filed December 13, 2012 and PCT International Application No. PCT/US2013/037472 filed April 19, 2013 which are hereby incorporated in their entireties for all purposes.

FIELD OF THE INVENTION

[0002] This invention relates to recombinant microorganisms and particularly recombinant bacterial microorganisms exhibiting selective enhanced production of C12 to C14 fatty alcohols and to the fatty alcohol compositions produced by the engineered microorganisms.

REFERENCE TO A SEQUENCE LISTING, A TABLE OR A COMPUTER PROGRAM LISTING APPENDIX SUBMITTED AS AN ASCII TEXT FILE

[0003] Sequence Listing written in file CX5-118W02 8T25.TXT, created on July 17, 2013, 98,697 bytes, machine format IBM-PC, MS Windows operating system, is hereby incorporated by reference. BACKGROUND OF THE INVENTION

[0004] Crude petroleum has traditionally beers used as a primary source for raw materials for producing numerous specialty chemicals. Particular specialty chemicals that can be produced from the petrochemical raw materials include fatty alcohols. Fatty alcohols have many industrial and commercial uses. For example, fatty alcohols act as surfactants which are useful in personal care and household products, such as detergents. Fatty alcohols are also used in waxes, lubricating oils, cosmetics and solvents. However, obtaining fatty alcohols from crude petroleum requires a significant amount of energy and involves the use of a non-renewable energy source.

[00051 Further, even those fatty alcohols that are obtained from renewable sources, such as from plant or animal derived fatty acids, generally are prepared using a hydrogenation step. Hydrogen ati on is a costly process step but is utilized to eliminate the double bonds of unsaturated fatty acids. A number of prior art references disclose genetically engineered microorganisms that produce products including fatty acid derivatives such as fatty acid esters and fatty alcohols. For example, reference is made to international application publications WO 2007/136762; WO 2008/119082; WO2010/075483; WO2011/008535; and WO 201 1/019858; and USP6143538. However a need still exists in the field for improved fatty alcohol production from bioengineered microorganisms that is efficient and cost effective and further that is tailored for use in particular industrial applications. In certain industrial applications, the presence of one or more double bonds in a fatty alcohol is not a desirable characteristic because the double bond lowers the melting point, reduces the shelf-life and reduces the heat stability of the fatty alcohol. Therefore, compositions and methods that provide products having increased saturation levels in fatty alcohols are also commerciaily beneficial. In addition, it would be beneficial to optimize specific blends of fatty alcohols (e.g., blends of predominan tly C I 2 and C I 4 fatty alcohol carbon chain lengths) to target particular industrial applications that utilize these fatty alcohols or derivatives thereof. SUMMARY OF THE INVENTION

[0006] The invention relates to methods for selective enhanced production of C12 to C14 fatty alcohol compositions and blends and engineered microbial cells which have been modified to comprise a nucleic acid sequence which codes for a protein having the enzymatic activity of a β-ketoaeyl acyl carrier protein ("ACP") synthase III and a nucleic acid sequence which codes for a heterologous protein having fatty alcohol reductase ("FAR") activity. The inventive methods further comprise the expression of genes coding for enzymes having FAR activity and β-ketoacyl ACP synthase III activity. The fatty alcohol composition produced by the modified microbial organisms according to the invention may be used inter alia in detergent compositions, cleaning compositions and personal care compositions,

[0007] In one aspect, the invention provides an engineered prokaryotic cell comprising two recombinant polynucleotides the first polynucleotide encoding a heterologous fatty alcohol forming reductase ("FAR") and the second polynucleotide encoding a β-ketoacyl acyl carrier protein synthase III ("FabH"). In some

embodiments, the engineered cell when cultured in the presence of a carbon source under suitable culture conditions produces a fatty alcohol composition having a chain length profile of at least 50% of C12 to C16 fatty alcohols. In some embodiments, the engineered cell is a bacterial cell such as, E. coll In other embodiments, the engineered cell produces a fatty alcohol composition with a carbon chain length profile of at least 60% (at least 65%, at least 70%, at least 75%, at least 80%, at least 85%), and at least 90%) of C12 to CI 6 fatty alcohols relative to the total fatty alcohol composition produced by engineered host cell. In some embodiments, the engineered cell produces a fatty alcohol composition with a carbon chain length profile of at least 60% (65%, 70%, 75%, 80%, 85% and 90%) of C12 to C14 fatty alcohols relative to the total tatty alcohol composition produced by the cell. In various embodiments, the FAR comprises an amino acid sequence having at least 75% (at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% and even 100%) sequence identity to the amino acid sequence of SEQ ID NO:2. In other embodiments the FAR comprises an amino acid sequence having at least 95% (96%, 97%, 98%, 99% and even 100%) sequence identity to the amino acid sequence of SEQ ID NO:4. SEQ ID NO: 6 or SEQ ID NO: 8. In further embodimenis, the FabH ("FabH") comprises an amino acid sequence having at least 80% (85%, 88%, 90%, 92%, 94%, 96%, 98%, 99% and 100%) sequence identity with SEQ ID NO: 10.

[0008] In a second aspect, the invention provides an engineered prokaryotic ceil comprising three recombinant polynucleotides, the first polynucleotide encoding a heterologous fatty alcohol forming reductase ("FAR"), the second polynucleotide encoding a β-ketoacyl acyl carrier protein synthase III ("FabH") and the third polynucleotide encoding a thioesterase (TE). In some embodiments the TE comprises an amino acid sequence comprising at least 85% (90%, 92%, 95%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 12 or SEQ ID NO: 63. In further embodiments, the engineered prokaryotic cell will optionally comprise a fourth recombinant polynucleotide (e.g., an introduced polynucleotide encoding a FadD such as an E. coli FadD having at least 95% (such as 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 16.

[0009] In a. third aspect, the engineered prokaryotic cell according to the first aspect and the second aspect further comprises one or more introduced polynucleotide sequences encoding an enzyme having FabD activity and/or FabG activity. In some embodiments, the polynucleotide encoding the enzyme having FabD activity comprises an amino acid sequence having at least 90% (91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 26. In some embodiments, the polynucleotide encoding the enzyme having FabG activity comprises an amino acid sequence having at least 90% (91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 18.

[0010] In yet a further embodiment, the engineered prokaryotic cells according to the first aspect, the second aspect and the third aspect further comprise one or more introduced polynucleotide sequences encoding an enzyme having FabI activity and/or FabZ activity. In some embodiments, the polynucleotide encoding the enzyme having FabI activity comprises an amino acid sequence having at least 90% (91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 20. In other embodiments, the polynucleotide sequence encoding the enzyme having FabZ activity comprises an amino acid sequence having at least 90% (91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID [001 11 In yet a further embodiment, the engineered prokaryotic cells according to the first aspect, the second aspect and the third aspect comprise a gene selected from one or more of fadE,fadR,fadD,fabB,fabH and fabF which has been attenuated.

[0012] In a fourth aspect, the invention provides a fatty alcohol composition produced by the engineered cells according to the first, second or third aspect. In some embodiments, the fatty alcohol composition produced by the engineered cells is recovered from the cell culture. In some embodiments the fatty alcohol composition is a component of a detergent composition, a personal care composition, a surfactant composition and/or a cleaning composition.

[0013] In a fifth aspect, the invention provides a method of producing a fatty alcohol composition comprising providing an engineered ceil according to the first, second or third aspects, culturing the engineered host cell under suitable culture conditions in the presence of a carbon source; producing fatty alcohols; and optionally recovering the fatty alcohols from the culture medium. In some embodiments, the carbon source comprises a fermentable sugar. In some embodiments, the fermentable sugars are obtained from a cellulosic feedstock obtained from biomass such as biomass selected from grain (e.g. corn), corn stover, corn cobs, wheat straw, bagasse and beet pulp. In some embodiments the biomass has been pretreated. In some embodiments at least lg/L of fatty alcohols are produced by the engineered cells. In further embodiments, the total fatty alcohol composition produced by the engineered cells comprises at least 60% (70%, 75%, 80%, 85%, 90%, and 95%) of C12 to C14 fatty alcohols.

[0014] In a sixth aspect, the invention provides a vector comprising a first polynucleotide sequence encoding a fatty alcohol forming reductase ("FAR") and a second polynucleotide sequence encoding a β-ketoacyl acyl carrier protein synthase III (KAS-III), wherein the polynucleotide sequences are operably linked to a promoter that is functional in a prokaryotic host cell. In some embodiments, the vector is chromosornaliy integrated into a host cell. In other embodiments, the promoter is the same for the first polynucleotide sequence encoding the FAR and the second polynucleotide sequence encoding the KAS-III. In still other embodiments, the promoter is different for the first polynucleotide sequence encoding FAR and the second polynucleotide sequence encoding KAS-Πί. In further embodiments, the polynucleotide encoding the KAS-III is operably linked to a ribosome binding sequence comprising a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 60 or SEQ ID NO: 61, or at least 95% sequence identity to bases 1-22 of SEQ ID NO: 60 or bases 2-23 of SEQ ID NO: 61. In yet other embodiments, the vector comprises a third polynucleotide sequence encoding a TE comprising an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 12 or SEQ ID NO: 63. In further embodiments, the vector optionally comprises a fourth

recombinant polynucleotide (e.g., an introduced polynucleotide encoding a FadD such as an E. coli FadD having at least 95% (such as at least 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 16. In a further embodiment, the invention relates to a host cell transformed with a vector according to the sixth aspect of the invention. In some embodiments, the host cell is a bacterial cell, for example E.coli.

[0015] In a. seventh aspect, the invention relates to a recombinant bacterial culture that produces a composition of fatty alcohols comprising carbon chain lengths of at least 60% of CI 2, C1 and C16 fatty alcohols, wherein the bacterial culture comprises an engineered bacterial microorganism comprising a. gene encoding a heterologous FAR comprising at least 90% (at least 95%, at least 97% and even 100%) sequence identity to SEQ ID NO: 2, SEQ ID NO:4, SEQ ID NO: 6 or SEQ ID NO:8 and a gene encoding a heterologous FabH comprising at least 90% (at least 95%, at least 97% and even 100%) sequence identity to SEQ ID NO: 10. In some embodiments the engineered bacterial microorganism is an E. coil strain. In some embodiments the fatty alcohol composition produced by the bacterial culture will comprise at least 80% of CI 2, C14 and C16 fatty alcohols. In some embodiments the fatty alcohol composition produced by the bacterial culture will comprise at least 60% of the combination of C12 and C14 fatty alcohols. In further embodiments, the fatty alcohol composition produced by the bacterial culture will be recovered from the culture.

BRIEF DECSRIPTION OF THE FIGURES

[00161 Figure 1 illustrates a pathway for the production of fatty alcohols in an engineered microbial host cell according to an embodiment of the invention, wherein the fatty alcohols are secreted from the engineered cell. [00 ! 7] Figure 2 illustrates plasmid pCDXl 1 -FAR, wherein repA denotes the gene which encodes the protein necessary for plasmid rephcation from the SC I 01 ori; aadAlSpR denotes the gene which encodes a. spectinomycin resistance protein; laclq denotes a transcription factor; and CDX11 promoter denotes a synthetic inducible promoter element.

[0018] Figure 3 describes polynucleotide and amino acid sequences encompassed by the invention:

SEQ ID NQ: 1 illustrates a codon optimized FAR polynucleotide sequence encoding the wild-type FAR amino acid sequence of SEQ ID NO: 2;

SEQ ID NO:3 illustrates a FAR polynucleotide sequence encoding a variant FAR ("FAR-V1" ) amino acid sequence of SEQ ID NO:4;

SEQ ID NO:5 illustrates a FAR polynucleotide sequence encoding a variant FAR ("FAR-V2") amino acid sequence of SEQ ID O:6;

SEQ ID NO:7 illustrates a FAR polynucleotide sequence encoding a variant FAR ("FAR-V3") amino acid sequence of SEQ ID NO:8;

SEQ ID NO: 9 illustrates an E. cottfahH polynucleotide sequence encoding a β ketoacyl acyl carrier protein synthase III amino acid sequence of SEQ ID NO: 10;

SEQ ID NO: l 1 illustrates a polynucleotide sequence encoding the thioesterase ("TE") amino acid sequence of SEQ ID NO: 12;

SEQ ID NO: 13 illustrates a polynucleotide sequence encoding the FadE amino acid sequence of SEQ ID NO: 14;

SEQ ID NO: 15 illustrates a polynucleotide sequence encoding the FadD amino acid sequence of SEQ ID NO: 16;

SEQ ID NO: 17 illustrates a polynucleotide sequence encoding the FabG amino acid sequence of SEQ ID NO: 18;

SEQ ID NO: 19 illustrates a polynucleotide sequence encoding the FabI amino acid sequence of SEQ ID NO:20; SEQ ID NO: 21 illustrates a polynucleotide sequence encoding the FabZ amino acid sequence of SEQ ID NO: 22;

SEQ ID NO: 23 illustrates a polynucleotide sequence encoding the FadR amino acid sequence of SEQ ID NO: 24;

SEQ ID NO: 25 illustrates a polynucleotide sequence encoding the FabD amino acid sequence of SEQ ID NO: 26;

SEQ ID NO: 27 illustrates a polynucleotide sequence encoding the FabB amino acid sequence of SEQ ID NO: 28;

SEQ ID NO: 29 illustrates a polynucleotide sequence encoding the FabF amino acid sequence of SEQ ID NO: 30;

SEQ ID NO: 59 illustrates the DNA sequence of plasmid pL88379 and

SEQ ID NO: 62 illustrates a polynucleotide sequence encoding a TE polypeptide of SEQ ID NO: 63.

ABBREVIATIO S AND TERMS

[0019] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Many technical dictionaries are known to those of skill in the art. Although any suitable methods and materials similar or equivalent to those described herein find use in the practice of the present invention, some methods and materials are described herein. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary, depending upon the context they are used by those of skill in the art.

[0020] Also, as used herein, the singular "a", "an," and "the" include the plural references, unless the context clearly indicates otherwise. Further, the term "or" is used in the present application to mean the disjunctive "or" and the conjunctive "and".

[0021 ] Amino acids are designated using the three-letter symbols or one-letter symbols recommended by the R7PAC-IUB Biochemical Nomenclature Commission. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively, "EC" number refers to the Enzyme Nomenclature of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC- IUBMB). The IUBMB biochemical classification is a numerical classification system for enzymes based on the chemical reactions they catalyze.

[0022] Numeric ranges are inclusive of the numbers defining the range. Thus, every numerical range disclosed herein is intended to encompass every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein. It is also intended that every maximum (or minimum) numerical limitation disclosed herein includes every lower (or higher) numerical limitation, as if such lower (or higher) numerical limitations were expressly written herein.

[0023] Furthermore, the headings provided herein are not limitations of the various aspects or embodiments of the invention which can be had by reference to the application as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the application as a whole. Nonetheless, in order to facilitate understanding of the invention, a number of terms are defined below ,

[0024] As used herein, the term "comprising" and its cognates are used in their inclusive sense (i.e., equivalent to the term "including" and its corresponding cognates).

[0025] The term "fatty alcohol" as used herein refers to an aliphatic alcohol of the formula R-OH, where the R group is at least 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more carbons in length. R can be saturated or unsaturated. Further saturated or unsaturated fatty alcohols can be described as "Ca:b-OH", wherein "a" is an integer that represents the total number of carbon atoms in the fatty alcohol and "b" is an integer that refers to the number of double bonds in the carbon chain. In some embodiments, a fatty alcohol produced according to the methods disclosed herein is a C8-C24 saturated or unsaturated fatty alcohol (i.e., a C8, C9, C IO, CI 1, C12, C 13, CI 4, CI 5, CI 6, CI 7, CI 8, CI 9, C20, C21, C22, or C24 fatty alcohol). In some embodiments, multiple fatty alcohols are produced with varying saturation levels. For example, in some embodiments, C IO, C12, C14, C16 and/or C18 fatty alcohols are produced. In some embodiments, one or more of the following fatty alcohols is produced: 1-deeanol (C10:0), 1-dodecanol (C12:0), 1 -tetradecanoi (C14:0), I- hexadecanol (CI 6:0), 1-octadecanol (CI 8:0).

[0026] The term "carbon chain length" as used herein means the number of carbon atoms in a carbon chain of a fatty alcohol or fatty alcohol substrate. For example the term "CI 2 fatty alcohol" refers to a fatty alcohol molecule having 12 carbons,

[0027] The phrase "preference for cleaving a substrate having a certain carbon chain length" or "predominantly cleaving a substrate having a certain carbon chain length" means that an enzyme cleaves or hydrolyzes mainly substrates having a defined number of carbon atoms. The preference is not necessarily exclusive. For example, an enzyme having a preference for cleaving substrates with chain lengths of 12 carbons, may still cleave substrates having chain lengths of 10 or 14 carbon atoms. A more specific non-limiting example includes but is not limited to a ΤΈ that predominantly hydrolyzes C12 acyl ACP. The enzyme may still cleave a CIO or C14 ACP substrate.

[00281 The term a "fatty alcohol composition" as used herein, means a composition which encompasses at least one fatty alcohol and which is produced from an engineered microbial organism according to the methods of the invention. The fatty alcohol compositions of the invention may include one or more fatty alcohols. For example a fatty alcohol composition may include only CI 2 fatty alcohols or a fatty- alcohol composition may include a combination of CI 2, C14 and CI 6 fatty alcohols and these fatty alcohols may be saturated or unsaturated fatty alcohols.

[00291 The term "fatty acid" as used herein means a compound having the formula RCO ₂ H, wherein R is at feast two carbons in length and generally between 4 and 22 carbons in length. Fatty acids may be saturated or imsaturated and further "R" can be linear or branched. .

[0030] The term "acyl-ACP as used herein means a compound having the formula RCO-S-ACP, wherein "R" is at least three carbons in length and may be a straight chain or branched chain and saturated or unsaturated. The abbreviation "ACP" refers to an acyl carrier protein. [00311 The terms "fatty acyl-CoA reductase", "fatty acyl reductase", and "fatty acyl acyl-ACP reductase" (EC 1,1.1.*) are used interchangeably herein to refer to an enzyme that catalyzes the reduction of a. fatty acyl-CoA, a fatty acyl-ACP, or other fatty acy l thioester complex to a fatty alcohol, in a reaction linked to the oxidation of NAD(P)H to NAD(Py ^r . The abbreviation "FAR" is used herein to refer to these fatty alcohol forming enzymes. In some embodiments, a FAR enzyme includes functional fragments. In some embodiments, the FAR enzyme is a modified or variant FAR, wherein a wild-type FAR has been genetically modified to include at least 1 (at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15 or more) amino acid alterations (e.g., substitutions, deletions and/or insertions) as compared to a reference FAR.

[0032] The term "acyl-CoA" refers to an acyl thioester formed between the carbonyl carbon of an alkyl chain and the sulfydryl group of the 4'- phosphopantetthionyl moiety of co-enzyme A (CoA) which has the formula R-C(O)- S-CoA, wherein R is an alkyl group having at least 4 carbon atoms and preferably between 10 and 14 carbon atoms. R may be straight or branched and saturated or unsaturated.

[0033] The phrase "fatty acid biosynthetic ("Fab") enzymes" as used herein means a complex of enzymes involved in a number of reactions to produce saturated and unsaturated fatty acids. The process is primed by the enzymatic conversion of malonyi-CoA into malonyl-ACP and continues by successive addition of 2 carbons derived from malonyl-ACP residues, providing ACP intermediates (i.e., acyl-ACPs). There are at least 8 enzymes involved fatty acid initiation and elongation biosynthesis including FabA, FabB, FabD, FabF, FabG, FabH, FabT, and FabZ, collectively and individually referred to herein as "fatty acid biosynthetic" enzymes. Furthermore' the ACP protein plays a key role in fatty acid biosynthesis by anchoring the nascent acyl chain and making the acyl chain accessible to other enzymes,

[0034] The term "FabD" refers to a malonyl-CoA-ACP transferase (EC 2.3.1.39).

[0035] The term "FabF" refers to a β-ketoacyl-ACP synthase IT (3-oxoacyl-ACP synthetase (EC 2.3.1.41) which catalyzes the conversion of palmitoieate to cis- vaccenate. [00361 The term "FabG" refers to a 3 ^~ ketoaeyl-ACP-redueat.se (3-oxoacyl ACP reductase) (EC 1.1.1.100) which catalyzes the NADPH dependent reduction of beta- ketoacyl-ACP substrates to beta-hydroxyacyl-ACP products, the first reductive step in the elongation cycle of fatty acid biosynthesis.

[0037] The term "FabF' refers to a trans-2-enoyl-ACP reductase (EC 1.3, 1 .9 and 1.3.1.10) that catalyzes the reaction of a trans-2,3-dehydroacyl-[ACP] + NAD(P)H + H ⁺ to an acyl-ACP + NAD(P) ⁺ .

[0038] The term "FabZ" refers to a beta-hydroxyacyl-ACP dehydratase (EC 4.2.1.59 to 4.2.61) that catalyzes the reaction of a (3R)-3-hydroxyacyl-ACP to a trans

A ² -enoylacylACP + ! i ·().

[0039] The term "FabB" refers to a beta-keioacyl-ACP synthase I (EC 2.3.1.41 ) that catalyzes the chemical reaction of an acyl-A CP to a 3-oxoacyl-ACP.

[0040] The term "FadD" refers to an "acyl-CoA synthetase ("ACS") (EC 6.2.1 (aeid-thiol ligases)). In some embodiments, the ACS is classified as EC 6.2, 1.3. These ACSs are also known as long chain fatty acid-CoA ligases. An ACS catalyzes the reaction of free fatty acids (both saturated and unsaturated fatty acids) into metabolicallv active CoA esters (e.g., aeyi-CoA) during fatty acid degradation. In some embodiments the FadD may be classified as EC 2.3.1.86 (fatty acyl CoA synthase).

[0041] The term "Fad " refers to an acyl-CoA synthetase (ACS) (EC 6.2, 1 ) that catalyzes the reaction of free fatty acids having preferentially C10 or less carbon chain lengths, in some cases the gene (fadK) encoding FadK has also been known as ydiD. Reference is made to Morgan-Kiss RM et al., 2004 J. Biol. Chem., 279:37324- 37333.

[0042] In some bacterial organisms, (e.g. E. coli) both fadD and fadK genes occur and both genes encode enzymes having ACS activity. In some bacterial organisms there may be more than two genes which encode enzymes having ACS activity.

[0043] The term "thioesterase or thioester hydrolase (TE)" enzyme used herein means an enzyme having thioesterase activity. TEs are identified as members of EC 3.1.2.1 to EC 3.1.2.27 and also EC3.1.1.5 and EC 3.1.2.- and these enzyme which hydrolyze the thioester bond between a carbonyl group and a sulfur atom are classified based on enzyme function and substrate identity. In addition, TEs are classified based on the ThYme database (Thioester-aetive enzyme). In this classification system, TEs have been classified based on amino acid sequence similarity. Under the ThYme system, TEs are further divided into 24 different families (TEl - ^■ TE24). Reference is made to D.C. Cantu et al, (2010) Protein Science, 19: 1281-1295 and D.C. Cantu et al, (201 1 ) Nucleic Acid Research

39:doil 0: 1093/nar/gkql072, TEs according to the invention will have the ability to catalyze a thioester cleavage reaction hydrolyzing a. thioester into an acid and a thiol. TEs useful in the invention may be obtained from a number of sources including plant, bacterial, algal, and fungal sources.

[0044] ^' The phrase "altered level of expression" means a polynucleotide or polypeptide in a recombinant microorganism encompassed by the invention is present in an amount or concentration that is different (e.g. greater or less) than the amount or concentration when compared to a corresponding reference microorganism.

[0045] ^' The term "FabH" refers to 3-oxoacyl-(acyl-carrier protein) synthase III activity and is used interchangeably with "KASIU" and "β-ketoacyl-ACP synthase III". FabH participates in the initial condensation reaction in the fatty acid biosynthetic pathway, by catalyzing the condensation of acetyl-CoA with malonyl- ACP to form aceto-acetyl-ACP and is categorized as EC 2.3.1.180. The FabH enzymes have a His-Asn-Cys catalytic triad at their active site.

[0046] The term "FadR" protein as used herein, refers to a multifunctional dual regulator that exerts negative control over the fatty acid degradative regulon and activates expression of fab A and fabV. ^' The FadR regulator is encoded by ufadR gene. A "regulon" comprises a set of genes under control of a single regulatory protein.

[0047] The term "FadE" enzyme as used herein means an acyl-CoA dehydrogenase enzyme (EC 1.3.99.-). A FadE gene is also known as yafl-l.

[0048] Throughout the specification a reference may be made using an abbreviated gene name or an enzyme name. For example "fabH" refers to a gene encoding a β- ketoacyl A CP synthase III or as sometimes referred to herein a FabH enzyme. [00491 The term "analogous sequence" or "homologous sequence" as used herein means a sequence wherein the function of the gene is essentially the same as a reference gene. For example, a. reference gene may be a fab ^' . gene from E. coli. In some embodiments, the analogous sequence will have at least about 60%, for example, at least about 65%, 70%, 75%, 80%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with the reference sequence.

[0050] The term "wild-type" or "native" as used herein in reference to a polypeptide or protein mean a polypeptide or protein expressed by a naturally occurring microorganism found in nature. When used in reference to a microorganism, the term means a naturally occurring (not genetically modified or engineered) microorganism.

[0051] The term "substrate" as used herein refers to a substance or compound that is converted or suitable for conversion into another compound (e.g., a product) by the action of at least one enzyme. The term includes not only a single compound but also combinations comprising more than one compound,

[0052] The term "conversion" as used herein refers to the enzymatic transformation of a substrate to at least one corresponding product. "Percent conversion" refers to the percent of the substrate that is converted to the product(s) within a specified period of time and under specified conditions.

[0053] Nucleic acid sequences may be "introduced" into a cell by protoplast fusion, transfection, transduction, transformation, eleeiroporaiion or any other suitable method known in the art. A nucleic acid sequence introduced into a prokaryotic cell may be integrated into a chromosome or may be maintained as an episome.

[0054] The terms "transformed" and "stably transformed" as used herein refer to a. cell that has a non-native (i.e., heterologous) polynucleotide sequence integrated into its genome or as an episomal plasmid that is maintained for at least two generations.

[00551 The term "gene" as used herein refers to a polynucleotide (e.g., a DNA segment), that encodes a polypeptide and includes regions preceding and following the coding regions as well as intervening sequences (introns) between individual coding segments (exons). [00561 The terms "endogenous" when used in reference to a gene refers to a gene that is found in a parental strain of a cell (e.g., a bacterial cell). As used herein in making comparisons between endogenous nucleic acid sequences, "homologous genes" (or "homologue" genes) refers to genes from different, but usually related species, which correspond to each other and are identical or very similar to each other. The term encompasses genes that are separated by speciation (i.e., the development of ne species) (e.g., orihologous genes), as well as genes that have been separated by genetic duplication (e.g., paralogous genes).

[00571 The term "heterologous" polynucleotide as used herein means any polynucleotide that is introduced into a host cell by laboratory techniques, and includes polynucleotides that are removed from a host cell, subjected to laboratory manipulation, and then reintroduced into a host cell.

[0058] In some embodiments, when "heterologous" is used with reference to a nucleic acid or polypeptide, the term refers to a sequence that is not normally expressed and secreted by an organism (e.g., a "wild-type" organism). In some embodiments, the term encompasses a sequence that comprises two or more subsequences which are not found in the same relationship to each other as normally found in nature, or is recombinantly engineered so that its level of expression, or physical reiationship to other nucleic acids or other molecules in a cell, or structure, is not normally found in nature. For instance, a heterologous nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged in a manner not found in nature (e.g., a nucleic acid open reading frame (ORF) of the invention operatively linked to a promoter sequence inserted into an expression cassette, such as a vector).

[0059] As used herein, a "heterologous enzyme" is used in reference to an enzyme that is encoded by a heterologous gene. However, it is also contemplated herein that a heterologous gene can encode an endogenous or homologous enzyme. As used herein, the term "heterologous gene" refers to a gene that occurs in a form not found in a parental strain of the host ceil. Thus, in some embodiments, a heterologous gene is a gene thai is derived from a species that is different from the species of the host cell expressing the gene. In some embodiments, a heterologous gene is a modified version of a gene that is endogenous to the host cell (e.g., an endogenous gene subjected to manipulation and then introduced or transformed into the host cell). For example, in some embodiments, a heterologous gene has an endogenous coding sequence, but has modifications in the promoter sequence. Similarly, in other embodiments, a heterologous gene encodes the same amino acid sequence as an endogenous gene, but has modifications in codon usage and/or to noncoding regions (e.g., introns), and/or combinations thereof. In some embodiments, the heterologous gene is a gene that has been modified to overexpress a gene product of interest.

[0060] The term "expression" as used herein includes any step involved in the production of a polypeptide including, but not limited to, transcription, post- transeriptional modification, translation, post-translational modification, and secretion.

[0061] The term "overexpression" as used herein refers to any state in which a gene is caused to be expressed at an elevated rate or level as compared to the endogenous expression rate or level for that gene. In some embodiments, "overexpression" includes an elevated translation rate or level of the gene compared to the endogenous translation rate or level for that gene. In some embodiments, overexpression includes an elevated transcription rate or level of the gene compared to the endogenous transcription rate or level for that gene. It is intended that the term encompass overexpression of endogenous, as well as heterologous proteins.

[0062] The term "recombinant" as used herein includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid sequence or that the ceil is derived from a ceil so modified. Thus, for example, recombinant cells express genes that are not found in identical form within the native (i.e., non- recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all as a result of deliberate human intervention. "Recombinant," "engineered," and "non-naturally occurring," when used with reference to a cell, nucleic acid, or polypeptide, refers to a material, or a material corresponding to the natural or native form of the material, that has been modified in a manner that would not otherwise exist in nature, or is identical thereto but produced or derived from synthetic materials and/or by manipulation using recombinant techniques. Non-limiting examples include, among others, recombinant cells expressing genes that are not found within the native (i.e., non -recombinant) form of the cell or express native genes that are otherwise expressed at a different level.

[0063] The term "plasmid" as used herein refers to a circular double-stranded (ds) DNA construct used as a cloning vector, and which forms an extrachromosomal self- replicating genetic element in some eukaryotes or prokaryotes, or integrates into the host chromosome.

[0064] The term "operabiy linked" as used herein refers to a configuration in which a control sequence is appropriately placed (i.e., in a functional relationship) at a position relative to a polynucleotide of interest such that the control sequence directs or regulates the expression of the polynucleotide and/or polypeptide of interest. Thus, a nucleic acid is "operabiy linked" to another nucleic acid sequence when it is placed into a functional relationship with another nucleic acid sequence.

[0065] The term "control sequence" as used herein includes all components, which are necessary and/or advantageous for the expression of a polynucleotide of the present disclosure. Each control sequence may be native or foreign to the polynucleotide of interest. Such control sequences include, but are not limited to, leaders, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators.

[0066] The terms "modified host cell", "engineered host cell" or "recombinant host cell" as used interchangeably herein refer to a cell whose genetic material has been altered using genetic engineering techniques. An engineered cell also refers to a derivative of or the progeny of a cell whose genetic material has been altered using genetic engineering techniques. An example of a genetic modification as a result of genetic engineering techniques includes a modification to the genomic DNA.

Another example of a genetic modification as a result of genetic engineering techniques includes introduction of a stable heterologous nucleic acid into the ceil.

[0067] The phrase "a corresponding engineered cell grown under essentially the same culture conditions" as used herein means a reference host cell (either engineered or native) which is grown under essentially the same culture conditions, including but not limited to pH, temperature, time, and culture media as compared to an engineered cell encompassed by the invention and to which the reference cell is being compared. [00681 The term "carbon source" as used herein refers to a substrate that is suitable for use as a source of carbon for cell growth.

[0069] Nucleic acids "hybridize" when they associate, typically in solution. There are numerous texts and other reference materials that provide details regarding hybridization methods for nucleic acids (See e.g., Tijssen, LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY-HYBRIDIZATION WITH NUCLEIC ACID PROBES," Part 1, Chapter 2, Elsevier, New York, [1993], incorporated herein by reference). For polynucleotides of at least 100 nucleotides in length, lo to very high stringency conditions are defined as follows: prehybridization and hybridization at 42°C in 5xSSPE, 0.3% SDS, 200 ^ιηΐ sheared and denatured salmon sperm DNA, and either 25% formamide for lo stringencies, 35% formamide for medium and medium-high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures. For polynucleotides of at least 200 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 2xSSC, 0.2% SDS at least at 50°C ("low" stringency), at least at 55°C ("medium" or "moderate" stringency), at least at 60°C ("medium-high" stringency), at least at 65°C ("high" stringency), and at least at 70°C ("very high" stringency). In some embodiments, the stringency conditions include those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium

chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ a denaturing agent during hybridization, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%

polyvmylpyrrolidone/SOmM sodium phosphate buffer at pH 6.5 with 750 niM sodium chloride, 75 roM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M Nad, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ^ig/niL), 0.1% SDS, and 10% dextrao sulfate at 42°C, with washes at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55°C. In other embodiments, the stringency conditions include overnight incubation at 37°C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCi, 15 mM trisodium citrate), 50 mM sodium phosphate (plT 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg mL denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-5Q°C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors to accomplish the desired stringency.

[0070] The phrase "naturally-occurring enzyme" as used herein refers to an enzyme having the unmodified amino acid sequence identical to that found in nature {i.e., "wild-type"). Naturally occurring enzymes include native enzymes {i.e., those enzymes naturally expressed or found in the particular microorganism).

[00711 The term "variant" or "mutant" as used interchangeably herein refer to a polypeptide sequence or polynucleotide sequence encoding a polypeptide, said sequence comprising one or more modifications relative to a corresponding wild -type enzyme (or other specified reference sequence) or the wild-type polynucleotide (or other specified reference sequence) such as substitutions, insertions, deletions, and/or truncations of one or more specific amino acid residues or of one or more specific nucleotides or codons in the polypeptide or polynucleotide, in some embodiments, reference to a variant at an amino acid residue refers to a substitution of the amino acid residue for another amino acid residue. Mutagenesis and directed evolution methods are well known in the art for creating variants. See, e.g., USP 7783428; USP 6429175; USP 6376246; USP 65861 82; USP 611 7679; and Ling, et al., 1999, "Approaches to DNA mutagenesis: an overview," Anal. Biochem., 254(2): 157-78; Smith, 1985, "In vitro mutagenesis," Ann. Rev. Genet. , 19:423-462; Carter, 1986, "Site-directed mutagenesis," Biochem. J., 237: 1-7; Minshuil, et al., 1999, "Protein evolution by molecular breeding," Current Opinion in Chemical Biology, 3 :284-290;

[00721 The terms "isolated" or "recovered" as used herein refer to a material that is removed from its original environment {e.g., the natural environment, if it is naturally occurring). For example, the material is said to be "isolated" when it is present in a particular composition in a higher or lower concentration than exists in a naturally- occurring or wild-type organism or in combination with components not normally present upon expression from a naturally-occurring or wild -type organism. For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. In some embodiments, such polynucleotides are part, of a vector, and/or such polynucleotides or polypeptides are part of a composition, and still considered to be isolated, in that such vector or composition is not part of its natural environment. In some

embodiments, the term isolated refers to fatty alcohol compounds of varying chain lengths which are isolated or recovered from an engineered cell according to the invention.

[0073] The terms "numbered with reference to" or "corresponding to," when used in the context of the numbering of a given amino acid or polynucleotide sequence, refers to the numbering of the residues of a specified reference sequence when the given amino acid or polynucleotide sequence is compared to the reference sequence.

[0074] As used herein, the term "biologically active fragment," or "functional fragment" refers to a polypeptide that has an amino-ierminal and/or carboxy-terminal deletion(s) and/or internal deletion(s), but where the remaining amino acid sequence is identical to the corresponding positions in the sequence to which it is being compared (e.g., a full-length FAR of the present invention) and that retains substantially all of the activity of the full-length polypeptide. For example, a biologically active fragment can comprise about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, at about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of a full-length FAR polypeptide.

[0075] The term "attenuated" or "inactivated" used interchangeably herein, as applied to a gene refers to any genetic modification that decreases or eliminates the expression of the gene and/or the functional acti v ity of the corresponding gene product (mRNA and/or protein). The term encompasses complete or partial inactivation, suppression, deletion, interruption, blockage, promoter alterations, antisense RNA, dsRNA, or down-regulation of a gene. This can be accomplished, for example, by gene "knockout," inactivation, mutation (e.g., insertion, deletion, point, or frameshift mutations that disrupt the expression or activity of the gene product), or by use of inhibitory RNAs (e.g., sense, antisense, or RNAi technology). A deletion may encompass all or part of a gene's coding sequence. The term "knockout" refers to the deletion of most (at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%) or all (100%) of the coding sequence of a gene. In some embodiments, any number of nucleotides can be deleted, from a single base to an entire piece of a chromosome.

[0076] With respect to "homologs," reference to particular gene names is for illustration and not limitation. It is understood that gene names vary from organism to organism and reference to a gene name is not intended to be limiting, but is intended to encompass homologs and polymorphic variants with equivalent activity. In certain embodiments, the invention includes a polynucleotide or polypeptide sequence with at least about 50%, about 55%, about 60%, about 65 %, about 70%. about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity with the named gene or gene product.

[0077] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. In various aspects of the invention, the availability of a polypeptide sequence of a specific enzyme provides a description of ail polynucleotides capable of encoding the polypeptide of known sequence because of the known correspondence of particular codons and the amino acids they encode. In certain embodiments, the degeneracy of the genetic code is used to produce a large number of polynucleotides that encode a polypeptide described herein.

[0078] "Identity" or "percent identity" in the context of two or more polypeptide sequences or two or more polynucleotide sequences refers to two or more sequences or sub-sequences that are the same or have a specified percentage of amino acid residues or nucleotide residues that are the same. For example, the sequence can have a percent identity of at least about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% over a specified region to a. reference sequence when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithms or by manual alignment and visual inspection.

[0079] Optimal alignment of sequences for comparison and determination of sequence identity can be determined by a sequence comparison algorithm or by visual inspection (see, generally, Ausubel et al , infra). When optimally aligning sequences and determining sequence identity by visual inspection, percent sequence identity is calculated as the number of residues of the test sequence that are identical to the reference sequence divided by the number of non-gap positions and multiplied by 100. When using a sequence comparison algorithm, test and reference sequences are entered into a. computer, subsequence coordinates and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

[0080] An algorithm that may be used to determine whether a variant FAR has sequence identity to SEQ ID O:2 is the BLAST algorithm, which is described in Altschul et al, 1990, J. Mol Biol 215:403-410, which is incorporated herein by reference. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (on the worldwide web at ncbi.nlm.nih.gov/). The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive -valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., 1997, Nucleic Acids Res., 25:3389-3402). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; alway s <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. For amino acid sequences, the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989, Proc. Natl. Acad. Sci. USA 89: 10915). Other programs that may be used include the Needleman-Wunsch procedure, J. Mo3. Biol. 48: 443- 453 (1970), using blosum62, a Gap start penalty of 7 and gap extend penalty of 1; and gapped BLAST 2.0 (see Altschul, et al. 1997, Nucleic Acids Res., 25:3389-3402) both available to the public at the National Center for Biotechnology Information Website.

[0081] Multiple sequences can be aligned with each other by visual inspection or using a sequence comparison algorithm, such as PSI-BLAST (Altschul, et al, 1997, supra) or "T-Coffee" (Notredame et al, 2000, J. Mol. Bio. 302:205-17). T-Coffee alignments may be carried out using default parameters (T-Coffee Technical Documentation, Version 8.01, July 2009, Worldwide Web .tcoffee.org), or Protein Align. In Protein Align, alignments are computed by optimizing a function based on residue similarity scores (obtained from applying an amino acid substitution matrix to pairs of aligned residues) and gap penalties. Penalties are imposed for introducing any extending gaps in one sequence with respect to another. The final optimized function value is referred to as the alignment score. When aligning multiple sequences, Protein Align optimizes the "sum of pairs" score, i.e., the sum of all the separate pairwise alignment scores.

[0082] As used herein, the term "culturing" refers to growing a population of microbial cells under suitable conditions using any suitable medium (e.g., liquid, solid, or semi-solid media),

[0083] The term " ^• extracellular environment" means the aqueous solution surrounding a ceil membrane, excluding the intracellular space. For example, a secreted enzyme or a compound is found in the extracellular environment. In some embodiments, the extracellular environment comprises the culture medium used to grow the cell.

[0084] The term "contacting" refers to combining an enzyme and a substrate under conditions in which the enzyme can act on the substrate. Those skilled in the art will recognize that mixing a solution containing an enzyme with a substrate will effect "contacting." Similarly, in the context of culturing microorganisms, culturing microorganisms in a media containing a substrate (e.g., a fermentable sugar) will effect "contacting" the microorganism with the substrate.

[0085] The term fermentable sugars" refers to simple sugars (monosaccharides, disaccharides and short oligosaccharides) such as but not limited to glucose, xylose, galactose, arabinose, mannose and sucrose. Fermentable sugar is any sugar that a microorganism can utilize for growth or which can be used in the production of end- products such as but not limited to ethanoi, hydrocarbon, amino acids and other chemical compounds.

[00861 The terms "cleaning compositions" and "cleaning formulations" refer to compositions that find use in the removal of undesired compounds from items to be cleaning, such as fabric, dishes, contact lenses, other solid substrates, hair

(shampoos), skin (soaps and creams), teeth (mouthwashes, toothpastes, etc.), etc. The terms further refer to any composition that is suited for cleaning, bleaching, disinfecting and/or sterilizing any object and/or surface. It is intended that the terms include, but are not limited to detergent compositions (e.g., laundry and fine fabric detergents), hard surface cleaning formulations (e.g., for glass, wood, ceramics and metal countertops, windows, etc.), oven cleaners, carpet cleaners, fabric fresheners, fabric softeners, hand and machine dish detergents, dish rinse aids, and textile and laundry pre-spotters. In addition, the terms encompass cleaning compositions for use in household and institutional use, including but not limited to liquid cleaning and disinfecting agents, such as anti-bacterial hand soaps and wipes, cleaning bars, mouthwashes, denture cleaners, car shampoos, bathroom cleaners, hair shampoos and conditioners/rinses for humans and other animals, shower gels, foam baths, etc. Indeed, it is not intended that the term be limited to any particular cleaning composition. The terms encompass any materials/compounds selected for the particular type of cleaning compositions desired and the form of the product (e.g., liquid, gel, granule, or spray), as long as the composition is compatible with the fatty alcohol(s) of the present invention. The specific selection of cleaning composition materials are readily made by considering the surface, item or fabric to be cleaned, and the desired form of the composition for the cleaning conditions during use. DETAILED DECSRIPTIO OF THE INVENTION

1. FAR, Enzymes and Polynucleotides :

[0087] The engineered prokaryotic cells encompassed by the invention are modified to express a polynucleotide encoding a heterologous FAR. Polynucleotides encoding FAR enzymes are known in the art (See e.g., WO2011/008535; WO2011/019858; WO2012/006114; US2010/02036; USP 733231 1; USP 6143538 and Metz et al., 2000. Plant Physiol. 122:635-644).

[0088] In some embodiments, FAR substrates, (e.g., acyl-CoA) are reduced to a fatty alcohol in a two-step process. An NAD(P)H dependent acyl-CoA reductase converts an aeyi-CoA to a fatty aldehyde and then the fatty aldehyde is reduced to a fatty alcohol by a NAD(P)H dependent alcohol dehydrogenase. Enzymes involved in this two-step conversion include the enzymes Acrl and YqhD (See, Reiser and Sornerville, J. Bacteriol. (1997) 179:2969; Ishige et al, Appl. Environ. Microbiol. (2000) 66:3481 : Hofrander et al. (2011) FEBS Letters 585:3538-3543 and Kalscheuer et al,, 2006, Appl. Environ. Microbiol. 72: 1373).

[0089] Preferred fatty alcohol forming acyl-CoA reductases (FARs) useful in the present invention catalyze the direct reduction of acyl-CoA and/or acyl-ACP substrates to fatty alcohols wherein free fatty aldehydes are essentially not released as an intermediate. Essentially these FARs reduce acyl chains to fatty alcohols by one enzymatic step. Depending on the substrate chain length it is possible to have trace amounts of aldehydes produced and released. In this direct reduction process, FAR converts at least acyl-ACP substrates to a fatty alcohol end-product without the subsequent action of an alcohol dehydrogenase.

[0090] In some embodiments, the FAR is a prokaryotic enzyme. In some embodiments, the FAR is derived from a species i Marinobacter including, but not limited to M. algicola, M. alkaliphilus, M. aquaeolei, M. arcticm, M. bryozoorum, M. daepoensis, M. excellens, M. flavimaris, M. guadonensis, M. hydmcarbonoclasticus, M, koreenis, M. lipolyticus, M. Htoralis, M. lutaoensis, M. maritimus, M. sediminum, M. squalenivirans, and M. vimfirmus, and equivalent and synonymous species thereof. [00911 In certain embodiments, the FAR is derived from M. algicola strain DG893 and has an amino acid sequence that is at feast about 70% identical, at feast about 75%, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical at least about 95% identical, at least about 97% identical, at least about 98% identical and/or at least about 99%> identical to SEQ ID NO:2 and/or a functional fragment thereof. In another embodiment, the FAR enzyme has an amino acid sequence that is identical to SEQ ID O:2. In certain embodiments, the FAR is a variant of the wild-type FAR of SEQ ID NO:2 for example a FAR having at least 90%, (91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% ,99% and even 100% sequence identity to SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8. In some embodiments, the variant FAR is FAR-V1 comprising an amino acid sequence of SEQ ID NO: 4; in other embodiments the variant FAR is FAR-V2 comprising the amino acids sequence of SEQ ID NO: 6; and in other embodiments the variant FAR is FAR-V3 comprising the amino acid sequence of SEQ ID NO: 8. In some

embodiments, the FAR variant comprises at feast 95%, (at least 96%, 97%, 98%, and 99%) amino acid sequence identity to SEQ ID NO: 8. In some embodiments, the F AR variants will have at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at feast 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 1 8, at least 20 or more amino acid alterations (e.g., substitutions, deletions and/or insertions) relative to SEQ ID NO:4, SEQ ID NO: 6 or SEQ ID NO: 8.

[0092] In certain embodiments, the FAR is derived from Marinobacter aquaeolei and has an amino acid sequence that is at feast about 70% identical, at least about 75%, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical, at least about 95% identical, at least about 97% identical, at least about 98% identical and/or at least about 99% identical to SEQ ID NO: 5 as disclosed in WO 2012/006 ! 14 and/or a functional fragment thereof. In another specific embodiment, the F AR enzyme has an amino acid sequence that is identical to SEQ ID NO: 5. In certain embodiments, the FAR is a. variant of the wild- type FAR of SEQ ID NO:5 that has at least 1, at least 2, at feast 3, at least 4, at least 5, at least 6, at least 7, at least 8, at feast 9, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, or more amino acid alterations (e.g., substitutions, deletions and/or insertions) relative to SEQ ID NO:5. In certain embodiments, the FAR is encoded by a polynucleotide sequence having at least 85% (at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to SEQ ID NO:4 as disclosed in WO 2012/0061 14.

[0093] In certain embodiments, the FAR is obtained from a marine bacterium selected from the group of Meptuniibacter caesariensis strain MED92, Reinekea sp. strain MED297, Marinomonas sp. strain MED121 , unnamed gammaproteobacterium strain HTCC2207, and Marinobacter sp. strain ELB17, as well as equivalents and synonymous species thereof. In certain embodiments, the FAR is obtained from the genus Oceanobacter. In some embodiments, the FAR is obtained from the

Oceanobacter species strain RED65 (e.g. NCBl accession number ZP 01305629) and has an amino acid sequence that is at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical, at least about 95% identical, at least about 97% identical, at least about 98% identical and/or at least about 99% identical to SEQ ID NOs:6 and/or 8 as disclosed in WO 2011/008535.

[00941 In various embodiments, the FAR is encoded by a polynucleotide selected from the group of FAR_Hch (Hahella cheiuensis KCTC 2396 GenBank YP_436183); FAR Mac (from marine Actinobacterium strain PHSC20C1); FAR J VC

(JCVI ORF 1096697648832, GenBank Accession No. EDD40059.1): FAR Fer (JCVI_SCAF__i 101670217388); FAR_Key (JCVI__SCAF J 097205236585; FAR_Gal (JCVIJSCAFJ 101670289386); Vitis vinifera FAR (GenBank Accession No.

CAO22305.1 or CA067776.1 ); Desulfatibacillum alkenivorans FAR (GenBank Accession No. NZ__ABII01000018.1); Stigmatella aurantiaca FAR

(NZ_AAMD01000005.1); Phytophthora ramorum FAR (GenBank Accession No.: AAQX01001 105.1); GenBank Accession no. AAD38039.1;

gi|5020215|gb|AAD38039.1 |AF149917_l acyl CoA reductase [Simmondsia

chinensis]; GenBank Accession no. BAC79425.1 ; g j33146307 |dbj |B AC79425.11 fatty-acyl reductase [Bombyx mori]; GenBank Accession no. DQ446732.1 or NM_1 15529.1 ; gij91806527jgbjDQ446732.1Mra iops« tha!iana clone pENTR221- At3g44560; gi| 18410556jrefiNMJ 15529.11; and (GenBank Accession no.

EU817405.1 ; gi|210063138|gb|EU817405.1 j Ostrinia scapulalis. [00951 As indicated herein, "heterologous FAR" encompasses wild-type FARs, variants and functional fragments thereof. In various embodiments, a functional fragment of a full-length wild-type FAR or a variant FAR comprises at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at feast about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the wild-type or reference amino acid sequence. In certain embodiments, a functional fragment comprises about at least 75%, about at least 80%, about at least 85%, about at least 9Q%>, about at least 91%, about at least 92%, about at least 93%, about at least 94%, about at least 95%, about at least 96%, about at least 97%, about at least 98%, or about at leas t 99% of the amino acid sequence of a full- length FAR polypeptide.

[0096] In another aspect, the present invention provides polynucleotides encoding FAR enzymes as described above. The polynucleotide can be a DNA or RNA, and can be single-stranded or double-stranded. The polynucleotide can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means.

[0097] In certain embodiments, the FAR polypeptide encompassed by the invention is coded for by a polynucleotide sequence that has been codon optimized. In particular embodiments, the polynucleotides that encode the FAR enzymes described herein are codon-optimized for expression in a host bacterial cell. Indeed, it is intended that the polynucleotides of the present invention be produced using any suitable methods and components as known in the art.

[00981 In some embodiments, a FAR enzyme is encoded by a polynucleotide sequence that has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%>, or at least about 99% sequence identity to SEQ ID MO: l, SEQ ID O:3, SEQ ID NO:5 and/or SEQ ID NO:7 and further hybridizes with SEQ ID O: l, SEQ ID NO:3, SEQ ID NO: 5 and/or SEQ ID NO:7 under medium, medium-high, high or very high stringency conditions. [00991 In some embodiments, the preferred substrates for the heterologous FAR are fatty acyl-ACP substrates comprising carbon chain lengths of CIO to CI 8. In certain embodiments, the fatty acyl-ACP substrates comprise carbon chain lengths of C12 to CI 6, and in other embodiments, the fatty acyl-ACP substrates comprise carbon chain lengths of C12 to C14. In certain embodiments, the substrate comprises a majority of saturated hydrocarbons. In certain embodiments, the substrate pool for the heterologous FAR comprises over about 70% (e.g., about 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, and 99%) C I O to CI 8 fatty acyl-ACP substrates; over about 70% (e.g., about 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, and 99%) CIO to CI 6 fatty acyl-ACP substrates; over about 70% (e.g., about 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, and 99%) C12 to C16 fatty acyl-ACP substrates and also over about 70% (e.g., about 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, and 99%) C12 to C14 fatty acyl-ACP substrates. In certain embodiments, the substrate pool for the heterologous FAR comprises over about 70% (e.g., about 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, and 99%) CIO to C18 fatty acyl-CoA substrates; over about 70% (e.g., about 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, and 99%) CIO to CI 6 fatty acyl-CoA substrates; over about 70% (e.g., about 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, and 99%) CI 2 to C16 fatty acyl- CoA substrates and also over about 70% (e.g., about 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, and 99%) C12 to C14 fatty acyl-CoA substrates.

2. FabH Enz m es a d Polyp ucleo ti des :

[OiOOj The engineered prokaryotic ceils encompassed by the invention are additionally modified to express a recombinant polynucleotide encoding a FabH. Polynucleotides encoding FabH enzymes are known in the art (See e.g., Tsay et al, 1992, 1 Biol. Chem.267: 6807 -6814). fOlOIj In some embodiments, the FabH is derived from a bacterial species and in some preferred embodiments the FabH is derived from an E. coli strain. In some embodiments, a FabH enzyme coded for by a recombinant polynucleotide comprises an amino acid sequence that is at least about 70%> identical, at least about 75%> identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical, at least about 95% identical, at least about 97% identical, at least about 98%> identical and/or at least about 99%> identical to SEQ ID NO: 10 and/or a functional fragment thereof. In another embodiment, the FabH enzyme has an amino acid sequence that is identical to SEQ ID NO: 10. in certain embodiments, the FabH is a variant of the wild-type FabH of SEQ ID NO: 10 for example a. FabH having at least 90%, ( 1%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99%) sequence identity to SEQ) ID NO: 10. In some embodiments, the variant FabH will have at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at feast 12, at least 14, at least 16, at least 18, at least 20 or more amino acid alterations (e.g., substitutions, deletions and/or insertions) relative to SEQ ID NO: 10.

[Θ102] Homologous fabH genes and polypeptides are known in the art; for example fabH may be derived from E.coli strains (see, Tsay et al., J. Biol. Chem. (1992) 267:6807-6814; Mycobacterium strains (see, Scarsdale et al, j. Biol. Chem. (2001) 276:20516-20522; and Choi et al, j. Biol. Chem. (2000) 275:28201-28207)), Staphylococcus strain (Qiu et al, (2005) Protein Sci. 14:2087 -2094); Streptococcus strains (Khandekar et al., J. Biol. Chem. (2001) 276:30024 - 30030); and

Haemophilus strains (Ketan et al., FEB Letters 583:2939 - 2946). In some cases, the FabH enzyme uses acetyl-CoA as the primer and synthesizes straight chain fatty- acids, and in other cases the FabH enzyme uses branched chain acyl-CoA as primers. Additional KAS-III polypeptides can be identified by searching the following databases which are available on the world wide web: KEGG database; Entrez databases (NCBI); ExPASy (Swiss Institute of Bioinformatics); and the BRENDA database.

[0103] The ASIII from the bacterium Shigella flexneri (CDC796-83 j has 99% sequence identity to the FabH amino acid sequence of SEQ ID NO: 10. The KASIII from Yersinia aidovae (ATCC 35236; ref gb|EEP95833.1) has 80% amino acid sequence identity to SEQ ID NO: 10. Other non-limiting examples of FabHs are listed in Table 1 below. Table 1 :

[Θ105] FabH activity cars be assayed in a number of well-known ways. FabH expression may be characterized based on its effect on the phenotypic output, wherein cells with and without expressed fab i are compared and the phenotypic output is a fatty alcohol chain length profile. Since FabH expression may be the only variable changed, it can be inferred that changes in the fatty alcohol profile are caused by FabH expression. Additionally, cells expressing exogenous FabH can be assayed directly for changes in KAS III activity by assaying for acetoacetyl-ACP synthase activity (via the in vitro conversion of malonyl-ACP and acetyl-CoA into aceto- acetyl-CoA) as described by Tsay et al. (J Biol. Chem. 1992:267:6807-14.) Further examples of methods that can be used to measure KAS activity include a

complementation growth assay where a native FabH is compromised (See, Morgan- Kiss and Cronan, 2008 Arch. Microbiol, 427-459) and filtered disc assays such as that described in Choi et al., (2000) J. Bacteriol. 182:365 - 370.

[Θ1Θ6] As indicated herein, "heterologous FabH" encompasses wild-type FabHs, variants and functional fragments thereof In various embodiments, a functional fragment of a full-length wild-type FabH or a variant FabH comprises at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the wild-type or reference amino acid sequence. In certain embodiments, a functional fragment comprises at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the amino acid sequence of a full-length FabH polypeptide.

[0107] In some embodiments, the FabH is a variant of a native FabH. In some embodiments, the native FabH has been engineered such that the substrate specificity has been altered (Nomura et al., Appl. Environ. Microbiol., (2004) 70(2):999 -1007).

[Θ108] In another aspect, the present invention provides polynucleotides encoding FabH enzymes as described above. The polynucleotide can be a DNA or RNA, and can be single-stranded or double-stranded. The polynucleotide can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means.

[0109] In certain embodiments, the FabH polypeptide encompassed by the invention is coded for by a polynucleotide sequence that has been codon optimized. In particular embodiments, the polynucleotides that encode the FabH enzymes described herein are codon-optimized for expression in a host E, coli cell. Indeed, it is intended that the polynucleotides of the present invention be produced using any suitable methods and components as known in the art. [0110] In some embodiments, a FabH enzyme is encoded by a polynucleotide sequence that has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 9 and further hybridizes with SEQ ID NO:9 under medium, medium-high, high or very- high stringency conditions. In some embodiments, the nucleic acid coding for the FAR and FabH enzymes as described herein are co-expressed on the same vector and are operably linked to a promoter, and optionally, to other control sequences

3. Other Fab Enzvmes and Polynucleotides:

[01 11] The engineered prokaryotie ceils encompassed by the invention are additionally modified to express one or more introduced polynucleotides encoding a FabD, FabG, Fabl, FabB and/or FabZ enzyme. Polynucleotides encoding these fatty acid biosynthetic (Fab) enzymes are known in the art (See e.g., Magnuson et al, 1993 Moi. Microbiol. 522-542; Wang and Cronan, 2004 JBC 34489 - 34495).

[0112] In some embodiments, the Fab enzyme is derived from a bacterial species and in some preferred embodiments the Fab enzymes are derived from an E.coli strain.

[0113] In some embodiments, a FabD enzyme coded for by a polynucleotide comprises an amino acid sequence that is at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical, at least about 95% identical, a,t least about 97% identical, at least about 98% identical and/or at least about 99% identical to SEQ ID NO:26 and/or a functional fragment thereof In another embodiment, the FabD enzyme has an amino acid sequence that is identical to SEQ ID NO:26. In certain embodiments, the FabD is a variant of the wild-type FabD of SEQ ID NO:26 for example a FabD having at least 90%, (91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity to SEQ ID NO: 26. In some embodiments, the variant FabD will have at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20 or more amino acid alterations (e.g., substitutions, deletions and/or insertions) relative to SEQ ID NO:26. [0114] FabD homologs are known in the art; for example FabD may be derived from E. coli strains (see, Magnuson et al„ 1992 FEBS Letters 16:299 (3): 262-266). FabD is a highly conserved gene and homologs can be found in plants (e.g.,

Arabidopsis thaliana, AT2G30200); mammals (e.g., Canis familiaris

ENSCAFPOOOOOOOl 310); yeast (e.g., Schizosaccharomyces pombe SPACl l G75e); and other bacteria (e.g., Shigella flexneri).

[©115] FabD activity can be assayed in a number of well-known ways. For example, FabD activity can be determined through complementation assays or by a conversion of malonyl CoA to malonyl-ACP as described in Magnuson et a!., 1992 FEBS Letters 16:299(3):262 -6.

[0116] As indicated herein, "heterologous FabD" encompasses wild-type FabDs, variants and functional fragments thereof. In various embodiments, a functional fragment of a full-length wild-type FabD or a variant FabD comprises at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%), or at least about 99% identity to the wild-type or reference amino acid sequence. In certain embodiments, a functional fragment comprises at feast about 80%, at least about 85%, at least about 90%, at least about 1%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the amino acid sequence of a full-length FabD polypeptide.

[0117] In another aspect, the present invention provides polynucleotides encoding FabD enzymes as described above. The polynucleotide can be a DNA or RNA, and can be single-stranded or double-stranded. The polynucleotide can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means.

[0118] In certain embodiments, the FabD polypeptide encompassed by the invention is coded for by a polynucleotide sequence that has been codon optimized. In particular embodiments, the polynucleotides that encode the FabD enzymes described herein are codon- optimized for expression in a host E.coli cell. Indeed, it is intended that the polynucleo tides of the present inven tion be produced using any sui table methods and components as known in the art.

[0119] In some embodiments, a FabD enzyme is encoded by a polynucleotide sequence that has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%», at least about 96%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 25 and further hybridizes with SEQ ID NQ:25 under medium, medium-high, high or very high stringency conditions,

[0120] In some embodiments, a FabG enzyme coded for by a recombinant polynucleotide comprises an amino acid sequence that is at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical, at least about 95% identical, at least about 97% identical, at least about 98% identical and/or at least about 99% identical to SEQ ID NO: 18 and/or a functional fragment thereof. In another embodiment, the FabG enzyme has an amino acid sequence that is identical to SEQ ID NO: 18. In certain embodiments, the FabG is a variant of the wild- type FabG of SEQ ID NO: 18 for example a FabG having at least 90% (91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity to SEQ ID NO: 18. In some embodiments, the variant FabG will have at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 1 8, at least 20 or more amino acid alterations (e.g., substitutions, deletions and/or insertions) relative to SEQ ID NO: 18.

[0121 j FabG homologs are known in the art; for example FabG may be derived from E. coli strains and reference is made, for example to Lai and Cronan, 2004, J. Bacteriol, Mar. p. 1869 - 1878, FabG is a highly conserved gene and homologs can be found in plants (e.g., Arabidopsis thaliana, AT2G30200); mammals (e.g., Cards familiaris ENSCAFP00000001310); yeast (e.g., Schizosaccharomyces pombe SPACl l G75c); and other bacteria (e.g., Shigella flexneri ^' ).

[Θ122] FabG activity can be assayed in a number of well-known ways. One example is to generate a temperature sensitive strain and reference is made to Lai and Cronan 2004, J. Bacteriol. Mar, p. 1869. Another method to measure FabG activity is to purify the enzyme and test for in vitro activity by measuring the product of the reaction acetoacetyl-ACP NADPH + ^■ H to (R )-3-hydroxybutanoyi-ACP

\A\W .

[0123] As indicated herein, "heterologous FabG" encompasses wild-type FabGs, variants and functional fragments thereof. In various embodiments, a functional fragment of a full-length wild-type FabG or a variant FabG comprises at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the wild-type or reference amino acid sequence. In certain embodiments, a functional fragment comprises at least about 80%, at least about 85%, at least about 90%, at least about 1%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the amino acid sequence of a full-length FabG polypeptide.

[0124] In another aspect, the present invention provides polynucleotides encoding FabG enzymes as described above. The polynucleotide can be a DNA or RNA, and can be single-stranded or double-stranded. The polynucleotide can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means.

[0125] In certain embodiments, the FabG polypeptide encompassed by the invention is coded for by a polynucleotide sequence that has been codon optimized. In particular embodiments, the polynucleotides that encode the FabG enzymes described herein are codon- optimized for expression in a host E.coli cell. Indeed, it is intended that the polynucleotides of the present invention be produced using any suitable methods and components as .known in the art.

[0126] In some embodiments, a FabG enzyme is encoded by a polynucleotide sequence that has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%), or at least about 99% sequence identity to SEQ ID NO: 17 and further hybridizes with SEQ ID NO: 17 under medium, medium-high, high or very high stringency conditions. [0127] In some embodiments, a Fabl enzyme coded for by a recombinant polynucleotide comprises an amino acid sequence that is at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical, at least about 95% identical, at least about 97% identical, at least about 98% identical and/or at least about 99% identical to SEQ ID NO: 20 and/or a functional fragment thereof. In another embodiment, the Fabl enzyme has an amino acid sequence that is identical to SEQ ID NO:20. In certain embodiments, the Fabl is a variant of the wild- type Fabl of SEQ ID NO:20; for example a Fabl having at least 90%, (91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity to SEQ ID NO: 20. In some embodiments, the variant Fabl will have at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20 or more amino acid alterations (e.g., substitutions, deletions and/or insertions) relative to SEQ ID NO:2().

[0128] Fabl homoiogs are known in the art; for example Fabl may be derived from E.coli strains or from Rhodobacter strains such as R. capsulatus (see, Heath and Rock, 1996, JBC 271 :44(1 1) 27795-27801. In some embodiments, Fabl homologues will have a sequence identity that is less than 90% but greater than 40% to SEQ ID NO: 20; thai is less than 85% but greater than 40% to SEQ ID NO: 20; that is less than 75% but greater than 40% to SEQ ID NO: 20; that is less than 65% but greater than 40% to SEQ ID NO: 20; and that is less than 55% but greater than 40% to SEQ ID NO: 20.

[0129] Fabl activity can be assayed in a number of well-known ways. For example complementation assays as previously mentioned above for other Fab enzyme activity and reference is made to Heath and Rock (1995) JBC 270:44 (3) 26538 - 26542. Further assays include in- itro measurements of the Fabl reaction such as

measurement of product from crotonyl-ACP + NADH + H to butyryl-ACP + NAD ^" . Dehydration assays as described in Heath and Rock (1996) JBC 271 :44(1 1) 27795 - 27801 may also be used to measure Fabl activity.

[0130] As indicated herein, "heterologous Fabl" encompasses wild-type Fabls, variants and functional fragments thereof. In various embodiments, a functional fragment of a full-length wild-type Fabl or a variant Fabl comprises at least about 80%, at least about 90%>, at least about 91%, at least about 92%, at feast about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the wild-type or reference amino acid sequence. In certain embodiments, a functional fragment comprises at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at feast about 96%, at least about 97%, at least about 98%, or at least about 99% of the amino acid sequence of a foil-length FabI polypeptide, such as an E.coli FabI or a Rhodobacter capsulaius FabI (such as SEQ ID NO: 20).

[0131] In another aspect, the present invention provides polynucleotides encoding FabI enzymes as described above. The polynucleotide can be a. D A or RNA, and can be single-stranded or double-stranded. The polynucleotide can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means.

[0132] In certain embodiments, the FabI polypeptide encompassed by the invention is coded for by a polynucleotide sequence that has been codon optimized, in particular embodiments, the polynucleotides that encode the FabI enzymes described herein are codon-optimized for expression in a host E.coli cell. Indeed, it is intended that the polynucleotides of the present invention be produced using any suitable methods and components as known in the art.

[Θ133] In some embodiments, a FabI enzyme is encoded by a polynucleotide sequence that has at least about 75%, at least about 8Q%>, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, or at least about 99% sequence identity to SEQ ID NO: 19 and further hybridizes with SEQ ID NO: 1 9 under medium, medium-high, high or very high stringency conditions.

[0134] In some embodiments, a FabZ enzyme coded for by a recombinant polynucleotide comprises an amino acid sequence that is at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical, at least about 95% identical, at least about 97% identical, at feast about 98% identical and/or at least about 99% identical to SEQ ID O:22 and/or a functional fragment thereof. In another embodiment, the FabZ enzyme has an amino acid sequence that is identical to SEQ ID 1 0:22. In certain embodiments, the FabZ is a variant of the wild- type FabZ of SEQ ID NO:22; for example a FabZ having at least 90%, (91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99%) sequence identity to SEQ ID NO: 22. In some embodiments, the variant FabZ will have at least 1, at least 2, at least 3, at least 4, at feast 5, at least 6, at least 7, at least 8, at least 9, at least 10, at feast 12, at least 14, at least 16, at least 18, at least 20 or more amino acid alterations (e.g.,

substitutions, deletions and/or insertions) relative to SEQ ID NO:22.

10135] FabZ homologs are known in the art; for example FabZ may be derived from E.coli strains (see, Heath and Rock 1996, JBC 271 :44(i f) 27795-27801).

[0136] FabZ activity can be assayed in a number of well-known ways. One example includes dehydration assays using an in-vitro system as described in Heath and Rock, 1996 JBC 271 :44(1 1) 27795 -27801.

[0137] As indicated herein, "heterologous FabZ" encompasses wild-type FabZs, variants and functional fragments thereof. In various embodiments, a functional fragment of a full-length wild-type FabZ or a variant FabZ comprises at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the wild-type or reference amino acid sequence, in certain embodiments, a functional fragment comprises at least about 80%, at least about 85%, at least about 90%, at feast about 91%, at least about 92%, at feast about 93%, at least about 94%, at least about at feast 95%, at least about 96%, at feast about 97%, at least about 98%, or at least about 99% of the amino acid sequence of a full-length FabZ polypeptide.

[0138] In another aspect, the present invention provides polynucleotides encoding FabZ enzymes as described above. The polynucleotide can be a DNA or RNA, and can be single- stranded or double- stranded. The polynucleotide can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means,

[ΘΪ 39] In certain embodiments, the FabZ polypeptide encompassed by the invention is coded for by a polynucleotide sequence that has been codon optimized. In particular embodiments, the polynucleotides thai encode the FabZ enzymes described herein are codon-optimized for expression in a host E.coli cell. Indeed, it is intended that the polynucleotides of the present invention be produced using any suitable methods and components as known in the art.

[0140] In some embodiments, a FabZ enzyme is encoded by a polynucleotide sequence that has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at feast about 97%, or at least about 99% sequence identity to SEQ ID NO: 21 and further hybridizes with SEQ ID NO:21 under medium, medium-high, high or very high stringency conditions,

[0141] In some embodiments, a FabB enzyme coded for by a recombinant polynucleotide comprises an amino acid sequence that is at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical, at least about 95% identical, at least about 97% identical, at least about 98% identical and/or at least about 99% identical to SEQ ID >JO:28 and/or a functional fragment thereof. In another embodiment, the FabB enzyme has an amino acid sequence that is identical to SEQ ID O:28. In certain embodiments, the FabB is a variant of the wild- type FabB of SEQ ID NO:28 for example a FabB having at least 90%, (91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%) sequence identity to SEQ ID NO: 28. In some embodiments, the variant FabB will have at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20 or more amino acid alterations (e.g.,

substitutions, deletions and/or insertions) relative to SEQ ID NO:28.

[0142] FabB homologs are known in the art; for example FabB may be derived from E.coli strains (see, Kitagawa M. et al., (2005) DNA Res., 12:291 -299). Other non-limiting examples of FabB homologous are Drosophila pseudoobscura (GA 17498-PA) &nd enop s tropica/ is (ENSXETP00000009583).

[0143] FabB activity can be assayed in a number of well-known ways. For example, enzymatic activity can be measured in-vitro by purifying a FabB enzyme. In general the reaction of dodecanoyl-ACP + a malonyl- ACP to 3-oxo-myristoyl-ACP + C0 ₂ + a holo-ACP is measured. In addition complementation assays can be conducted with temperature sensitive FabB and reference is made to Mendoza et al., ( 1983) JBC 258:4925) 2098 -2101 ,

[0144] As indicated herein, "heterologous FabB" encompasses wild-type FabBs, variants and functional fragments thereof. In various embodiments, a functional fragment of a full-length wild-type FabB or a variant FabB comprises at least about 80%, at least about 90%, at feast about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to the wild-type or reference amino acid sequence. In certain embodiments, a functional fragment comprises at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the amino acid sequence of a full-length FabB polypeptide,

[0145] In another aspect, the present invention provides polynucleotides encoding FabB enzymes as described above. The polynucleotide can be a DNA or RNA, and can be single-stranded or double-stranded. The polynucleoiide can be isolated from a naturally occurring microorganism, or prepared wholly or partially via synthetic means.

[0146] In certain embodiments, the FabB polypeptide encompassed by the invention is coded for by a polynucleoiide sequence that has been codon optimized. In particular embodiments, the polynucleotides that encode the FabB enzymes described herein are codon- optimized for expression in a host E.coli cell. Indeed, it is intended that the polynucleotides of the present invention be produced using any suitable methods and components as .known in the art.

[0147] In some embodiments, a FabB enzyme is encoded by a polynucleotide sequence that has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 96%, at least about 97%), or at least about 99% sequence identity to SEQ ID NO: 27 and further hybridizes with SEQ ID NO:27 under medium, medium-high, high or very high stringency conditions. [0148] In some embodiments, a recombinant or engineered microbial host cell encompassed by the invention will comprise: a first introduced polynucleotide encoding a FAR enzyme (for example a polynucleotide encoding a. FAR enzyme Slaving at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NOs: 2, 4, 6, or 8; a second introduced polynucleotide encoding a FabH having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 10; and optionally one or more additional introduced polynucleotides comprises a) a polynucleotide encoding a FabD having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 26; b) a polynucleotide encoding a FabF having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 29; c) a polynucleotide encoding a FabG having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100% ) sequence identity to SEQ ID NO: 17; d) a polynucleotide encoding a Fabl having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 19; e) a polynucleotide encoding a F bZ having at least 90% (at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 21, f) a polynucleotide encoding a FabB having at least 90% (at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 27 and g) a combination of anyone of a) to f).

10149] In some embodiments, a recombinant or engineered microbial host cell encompassed by the invention will comprise: a first introduced polynucleotide encoding a FAR. enzyme (for example a polynucleotide encoding a FAR. enzyme having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NOs: 2, 4, 6, or 8; a second introduced polynucleotide encoding a FabH having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 10; a third introduced

polynucleotide encoding a FabD having at least 95% (also at least 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 26 and a fourth introduced polynucleotide encoding a FabG having at least 95% (also at least 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 17. 4. DNA Constructs, Vectors and Transformation:

[0150] In some embodiments, the nucleic acid coding for the FAR and FabH enzymes as described herein are co-expressed on the same vector and are operably linked to a promoter, and optionally, to other control sequences.

[0151 ] In some embodiments, the invention encompasses a vector comprising a first nucleic acid sequence encoding a FAR having an amino acid sequence that is at least about 70% identical, at least about 75%, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical at least about 95% identical, at least about 97% identical, at least about 98% identical and/or at least about 99% identical to SEQ ID NOs:2, 4, 6 or 8 and/or a functional fragment thereof and comprising a second nucleic acid sequence encoding a FabH having an amino acid sequence that is at least about 70% identical, at least about 75%, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical at least about 95% identical, at least about 97% identical, at least about 98% identical and/or at least about 99% identical to SEQ ID NO: 10 and/or a functional fragment thereof. In other embodiments, the vector will comprise a first nucleic acid sequence encoding a FAR having an amino acid sequence that is at least 95% identical to SEQ ID NO: 8 and a second nucleic acid sequence encoding a FabH having at least 95% sequence identity to SEQ ID NO: 10,

[0152] In some embodiments, a vector will compromise a first DNA construct encoding a FAR enzyme and a second DNA construct encoding a FabH enzyme and each DNA construct will have the same promoter. In other embodiments, the promoter will be different for the nucleic acid sequence encoding the FAR enzyme and the nucleic acid sequence encoding the FabH enzyme. In some embodiments, the FAR encoding genes will be transcribed first on the vector and in other embodiments the FabH encoding gene will be transcribed first on the vector. Suitable promoters include, but are not limited to constitutive promoters, regulated promoters, and inducible promoters. Appropriate promoter sequences can be obtained from genes encoding extracellular or intracellular polypeptides which are either endogenous or heterologous to the host cell. Methods for the isolation, identification and manipulation of promoters of varying strengths are available in or readily adapted from the art. See e.g., Nevoigt et al (2006) Appl. Environ. Microbiol 72:5266-5273, the disclosure of which is herein incorporated by reference in its entirety,

[0153] Polynucleotides coding for the introduced Fab enzymes as described herein above and the vectors comprising said polynucleotides or DMA constructs include polynucleotides comprising a sequence having at least 90% (at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 25 encoding a. FabD; polynucleotides comprising a. sequence having at least 90% (at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 17 encoding a FabG; polynucleotides comprising a sequence having at least 90% (at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 19 encoding a Fabl; polynucleotides comprising a sequence having at least 90% (at least 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 21 encoding a FabZ; and polynucleotides comprising a sequence having at least 90% (at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 27 encoding a Fa B.

[0154] For bacterial host cells, suitable promoters for directing transcription of the nucleic acid constmcts of the present disclosure, include, but are not limited to the promoters obtained or derived the E. coli lac operon, Sireptomyces coelicolor agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha- amylase gene (amyL), Bacillus stear other mophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, Bacillus megaierium promoters, and prokaryotic beta- lactamase gene (Villa-Kamaroff et al, Proc. Natl Acad. Set USA 75: 3727-3731( 1978)), as well as the tac promoter (DeBoer et al, Proc. Natl Acad. Sci. USA 80: 21-25(1993)). Additional promoters include trp promoter, phage lambda PL, T7 promoter, promoters found at PromEC. See e.g., the website margalit.huji.ac.il/promec/index.html. Particularly useful promoters include the Trc promoter (Brosius J. et al., (1985) J. Biol. Chem. 260: 3539-3541).

Additional promoters suitable for use in the present disclosure are described in Terpe H., 2006, Appl. Microbiol. Biotechnol. 72:211-222 and in Snmbrook et a,L, (2001) Molecular Cloning: A Laboratory Manual, 3 ⁿ e i. Cold Spring Harbor Laboratory- Press, New York.

[0155] In various embodiments, an expression vector optionally contains a ribosome binding site (RBS) for translation initiation, and a transcription terminator, such as the transcriptional terminators Ti and T2 derived from the rniB operon from E. coir (See e.g., Orosz et a!., (1991) Eur. J. Biochem. 201 : 653-659). RBS are effective control elements for protein production and the type of RBS can result in different expression levels of the same protein or enzyme. In some embodiments, the expression Of a Fab enzyme may be too high for the microbial system resulting in toxicity if other enzymes in the metabolic pathway are not capable or evolved to utilize the expressed protein. Studies have been conducted to design RBS to provide optimized protein expression. In general the mRNA region containing the RBS may range from about 18 to 50 nucleic acid residues in length. The RBS in bacteria are usually located about 8 base pairs upstream of the start codon. To accelerate the development of optimized enzyme pathway engineering both library based approaches and biophysical models using algorithms to predict a RBS with target translation initiation rates have been explored and reference is specifically made to H. Salis et al.. Nature Biotechnology 2009, 27(10) 946 -951. One skilled in the art is aware of a number of well-characterized RBS and reference is made to Vellanoweth & Rabinowitz, 1992 [Mol. Microbiol. 6: 1 105-11 14. The influence of ribosome- binding-site elements on translational efficiency in 5. subtilis and is, coli in vivo].

[0156] In addition one of skill in the art could use the algorithm described in Slais et al, supra, to calculate other RBS sequences with similar translational efficiencies and then empirically test these sequences, in some embodiments according to the instant invention, a 23 base pair RBS region was taken from the native E.coli FabA gene SEQ ID NO: 60 (5' ATAAAATAAGGCTTACAGAGAAC) and also from the native E.coli FabH gene, SEQ ID NO: 61 (5 ' AACCGAAAAGTG ACTG AGCGT AC) and used as a RBS for FabH expression.

10157] Some embodiments of the instant invention include a D A construct comprising a promoter, a RBS comprising at least 95%, (96%, 97%, 98%, 99% and 100% sequence identity to SEQ ID NO: 60 or SEQ ID NO: 61 and a nucleic acid coding for a FabH enzyme having at least 80% ( at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 10, wherein the promoter and the RBS are operable linked to the nucleic acid encoding the FabH enzyme. In some embodiments, the DNA construct comprises a first polynucleotide sequence encoding a FAR comprising at least 80%, (for example 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, and even 100% ) sequence identity to SEQ ID NO: 2, 4, 6 or 8 and a second polynucleotide sequence comprising a RBS comprising at least 95%, (96%, 97%, 98%, 99% and 100% sequence identity to SEQ ID NO: 60 or 61 and a nucleic acid coding for a FabH enzyme having at least 80% ( at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 10, wherein the RBS is located between the FAR and the FabH and is operably linked to the nucleic acid encoding the FabH enzyme. In some embodiments, the vector also optionally includes appropriate sequences for amplifying expression, e.g., trans lational enhancers.

[0158] In various embodiments, the polynucleotides useful for expressing the recombinant enzymes in the bacterial host cells are operably linked to other control sequences, including but not limited to, a transcription terminator sequence, a signal sequence that when translated directs the expressed polypeptide into the secretory pathway of the recombinant host cell, and/or a polyadenylation sequence

(eukaryotes). The choice of appropriate control sequences for use in the

polynucleotide constructs of the present disclosure is within the skill in the art and in various embodiments is dependent on the recombinant host cell used and the desired method of recovering the fatty alcohol compositions produced. Indeed, it is not intended that the present invention be limited to any particular control sequence(s).

[0159] A recombinant expression vector according to the invention can be any- suitable vector, e.g., a plasmid or a vims, which can be manipulated by recombinant DNA techniques to facilitate expression of at least one heterologous enzyme in the recombinant host cell. In certain embodiments, the expression vector is integrated into the chromosome of the recombinant host cell and comprises one or more heterologous genes operably linked to one or more control sequences useful for production of at least one heterologous enzyme as described above. In other embodiments, the expression vector is an extra chromosomal replicative DNA molecule, e.g., a linear or closed circular plasmid, that is found either in low copy number (e.g., from about 1 to about 10 copies per genome equivalent (such as at least about 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10)) or in high copy number (e.g., more than about 10 copies per genome equivalent (such as at least 10, at least 15, at least 20, at least 30, at least 40, at least 50 and in some embodiments at least 100. in various embodiments, the expression vector includes a selectable marker, such as a gene that confers antibiotic resistance (e.g., ampicillin, kanamycin, chloramphenicol or tetracycline resistance) to the recombinant host organism that comprises the vector.

[Θ160] Expression vectors which, in certain embodiments, are useful for expressing enzymes as disclosed herein (for example FAR and FabIT either singly or co- expressed on the same vector are commercially available e.g., from Sigma-Aidrich Chemicals, St. Louis MO and Stratagene, LaJolia CA. In some embodiments, examples of suitable expression vectors are plasmids which are derived from pBR322 (Gibco BRL), pUC (Gibco BRL), pREP4, pCEP4 (Invitrogen) or pPoly (Lathe et al., 1987' Gene 57: 193-201 ). In certain embodiments, the present disclosure provides a plasmid for expression of heterologous genes in E. coli.

[0161] E xpression vector pCK l 10900, which comprises a PISA origin of replication "on " (P15A ori), lac a CAP binding site, a lac promoter, a T7 ribosomal binding site (T7gI0 RBS) and a chloramphenicol resistance gene (camR) is an exemplary vector that finds use in the present invention. This expression vector is depicted in Figure 3 of U.S. Patent Publication No. 2006/0195947, which is incorporated herein by reference in its entirety. Other suitable plasmid vectors include, but are not limited to derivatives of pCL1920 and pCL1921 (Lerner and Inouye, 1990; NAR 1 8:4631). These vectors contain the pSClOi ori and confer resistance to spectinomycin (GenBank: AB236930). In some embodiments, the vector is an expression vector derived from pCLI920 including the Trc promoter and the laclq gene from E. coli. pL88379 (SEQ ID NO: 59). In other embodiments, the vector is the plasmid pCDXl 1 -FAR (Figure 2).

[Θ162] Methods, reagents and tools for transforming host cells described herein, such as bacteria, are known in the art. General methods, reagents and tools for transforming, e.g., bacteria can be found, for example, in Sambrook et al (2001 ) Molecular Cloning: A Laboratory Manual, 3 ^fd ed., Cold Spring Harbor Laboratory Press, New York. In some embodiments, introduction of the DNA construct or vector of the present invention into a host cell is accomplished by calcium phosphate transtection, DEAE-dextran mediated transfection, electroporation' or other common techniques (See Davis et al,, 1986, Basic Methods in Molecular Biology, which is incorporated herein by reference). In one embodiment, a preferred method used to transform E. coli strains is electroporat on and reference is made to Dower et al, (1988) MAR 16: 6127-6145. Indeed, any suitable method for transforming host cells finds use in the present invention. It is not intended that the present invention be limited to any particular method for introducing nucleic acids such as constructs into host cells.

5. Thioesterase:

[0163] According to one embodiment of the invention, a microbial host cell is engineered to express a heterologous FAR; a FablT, and a recombinant thioesterase ('TE"). The thioesterase may be one that preferentially uses C12, C14 or C16 ACPs. Depending on the TE used essentially a homogenous population of fatty alcohols may ^¬ be produced. For example, if the TE is one that predominantly uses C!2 ACPs then the fatty alcohol composition produced by a recombinant microbial cell according to the invention will predominantly comprise fatty alcohols ha,ving a carbon chain length of CI 2.

[0164] In some embodiments the expressed TE is one that is classified as TE from the Family TE14 in the ThYme database. These sequences may be downloaded from GenBank and UniProt databases (Nucleic Acid Res 201G38:D142-D148).

|0165] Some nonlimiting examples of TEs that may be used include the "class I" and "class II" acyi-ACP TE fat genes (e.g. fatA orfalB genes and reference is made to A. Jones et al., 1995, Plant Cell 7:359-371). In particular, FatB are preferred TEs (e.g. plant acyi-ACP TEs) useful in the invention. In some embodiments, the TE may be a bacterial acyi-ACP TE. FatB may be obtained for example from UmheUuIaria California having UniProtKB Accession number Q41635; and NCBI Accession number AAA34215; (Jlmus Americana having NCBI Accession number AAB71731, Cuphea hooker iana NCBI Accession number Q39513; UniProtKB Accession numbers AAC49269; AAC49269; and AAC72881 ; Cinnamonum camphorum having NCBI Accession number Q39473 and UniProtKB AAC49151; and acyl-ACP thioesterases from Cuphea palustris (AAC49179; and USP 5,955,329). Other TEs include without limitation CnFatB (Cocos nucifera, e.g. JF338903; JF338904 and JF338905); ccFAT iCmnamomum camphora); pdFat (Parabacteroides distasonis, ATCC 8503); gsFat (Geobacillus sp. Y412MC10); pvFAT ⁽ Paenibacillus vortex V453): pm FAT (Parabacteroides merdae ATCC 43184); cvFatB (Cuphea viscosissima, JF338906; JF338907; and JF338908); eoFat (Elaeis oleifera)

AAD42220 (Elaeis guineensis) and mlFat ⁽ Madhiica longofolia var. latifolia).

[0166] In some embodiments, homologous or analogous TE genes will be used for the heterologous expression of a TE enzyme.

[0167] It is known that different acyl-ACP TE have different degrees of chain length specificity. In some embodiments, the TE useful in the invention is a TE having a preference for cleaving chain lengths of any one of C12, C14 and/or C16 fatty acids from ACP. In some embodiments, having a preference for cleaving chain lengths of any one of C12 , C14 and/or C16 fatty acids from ACP means thai the thioester hydrolysis will produce fatty acids having at least 85%, (such as at least 88%, 90%, 93%, 95%, 96%, 97%, 98% or more) of any one of C 12, C14 and/or CI6 carbon chain lengths.

[0168] In one embodiment, the TE is encoded by a gene comprising the polynucleotide sequence having at least 70%, (at least 75%, 80%, 85%, 90%, 93%, 95%, 97%, 99%, and even 100%) sequence identity to the polynucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 62. In some embodiments, the TE enzyme will comprise at least 70%, (at least 75%, 80%, 85%, 90%, 93%, 95%, 97%, 99%, and even 100%) sequence identity to the polypeptide sequence of SEQ ID NO: 12 or SEQ ID NO: 63. In some embodiments, the TE gene will comprise at least 85% (at least 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to the polynucleotide sequence of SEQ ID NO: 1 1 or SEQ ID NO: 62. In some embodiments, the TE enzyme will comprise at least 85% (at least 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to the polypeptide sequence of SEQ ID NO: 12 or SEQ ID NO: 63. In some embodiments the gene encoding the TE enzyme is derived from UmheUuria ealifornica (California Bay), and in other embodiments the gene encoding the TE enzyme is derived from

Cinnamomum camphorum.

[0169] In some embodiments, the TE enzyme will be a functional fragment of a native TE, such as a TE having deletions at the N-terminal amino acid positions. In certain embodiments, the functional fragment will comprise at least 95% of the reference enzyme. In certain embodiments, the functional fragment will include a deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid residues. In some embodiments, the TE is a variant enzyme having at least 1, at least 5, at least 10, at least 15 or more amino acid modifications, such as substitutions. Non-limiting examples include the TE FatB genes from California Bay, Cinnamomun camphora and from various Cuphea species such as those disclosed in WO 201 1/008565 and reference is made to SEQ ID NOs. 21, 48, 52, 56, 60, 64, 66, 70, 72, 76, 80, 82, 86, 90, 92, 94, 96 and 100 described therein.

10170] Further acyl-ACP TEs that are useful according to the invention are described in the following references: USP 5,344,771; USP 5,512,482; USP

6,150,512; USP 5,723,761; USP 5,910,631 and WO2010/075483.

[0171] In some embodiments, a bacterial host cell encompassed by the invention will be transformed with a vector comprising a first nucleic acid coding for a FAR; a second nucleic acid coding for a FabH enzyme and a third nucleic acid coding for a TE enzyme. In some embodiments, ah three nucleic acid sequences are found on the same vector and in other embodiments each nucleic acid encoding any one of FAR, FabH or TE are found on different vectors. In some embodiments each nucleic acid sequence may include the same or different promoters which are operably linked to the nucleic acid coding for the FAR, FabH or TE. In various embodiments the nucleic acid sequence encoding the FAR, FabH and TE are optionally linked to other control sequences.

[0172] In some embodiments, the engineered prokaryotic cell (such as E.coli) will comprise three recombinant polynucleotides, the first polynucleotide encoding a FAR variant comprising at least 95% sequence identity to SEQ ID NO:2, SEQ ID NO: 4; SEQ ID NO: 6, and/or SEQ ID NO: 8; the second polynucleotide encoding a FabH comprising at least 90% (at least 95%) sequence identity to SEQ ID NO: 10; and a third polynucleotide encoding a TE comprising at least 90% or 95% sequence identity to SEQ ID NO: 12 or SEQ ID NO: 63 and optionally the engineered prokaryotic cell will comprise a fourth introduced polynucleotide encoding a FadD comprising at least 95% sequence identity to SEQ ID NO: 16, wherein the engineered cells produce a fatty alcohol composition comprising C I 2, and C14 fatty alcohols.

[Θ173] Various assays are known which can be used to test for TE activity in a recombinant microorganism transformed with a vector comprising a polynucleotide encoding a TE according to the invention (See, Voelker and Davies, 1994, J.

Bacteriol. 76:7320).

[0174] As described above, the term "acyl-CoA synthetase" is used synonymously with "ACS" or "acyl-CoA synthetase" or "FadD". These enzymes mediate the formation of acyl-CoA esters (See, Fig. 1 ). According to an embodiment of the invention, a microbial host cell is engineered to express a recombinant ACS. ACS that can be expressed to produce acyl-CoA includes the E.coii fadD gene comprising the polynucleotide sequence of SEQ ID NO: 15 which codes for the ACS comprising the polypeptide sequence of SEQ ID NO: 16. In some embodiments, the fadD gene will comprise at least 70%, (at least 75%, 80%, 85%, 90%, 93%, 95%, 97%, 99%, and even 100%) sequence identity to the polynucleotide sequence of SEQ ID NO: 15, In some embodiments, the ACS enzyme encoded by a ACS polynucleotide will comprise at least 70%, (at least 75%, 80%, 85%, 90%, 93%, 95%, 97%, 99%, and even 100%) sequence identity to the polypeptide sequence of SEQ ID NO: 16. In some embodiments, fadD encodes an ACS variant enzyme having at least 1 , at least 5, at least 10, at least 15 or more amino acid modifications, such as substitutions. Non- limiting examples include modifications to the gene encoding the ACS of SEQ ID NO: 16.

[0175] In some embodiments, homologous fadD genes will be used for the heterologous expression of an ACS enzyme to produce acyi-CoAs. These fadD genes include without limitation, fadD from Acinetohacter sp. NCBI ID YP__045024;/aiiD from Haemophilus influenza NCBI ID NP _... 438551; fadD from Pseudomonas aeruginosa NCBI ID 251989 and 251990; BH3101 from Bacillus halodurans NP__243969; yhfL from Bacillus suhtilis NP_388908; and fadD from Rhizobium eili CFN NCBI ID_ 53, 919; fadD from Marinobacter algicola ZP_01892995;/a<*D from Marinobacter aquaeolei YP__958864; fadO from Mycobacterium tuberculosis NP_215722; fadDlS from Mycobacterium tuberculosis P_216703; fad \ 9 from Mycobacterium tuberculosis YP 177983; at/D from Rhodopseudomonas palustris YP 00993712; y&i D from seHifowo«o$ fluorscens PfO-1 YP_ 350081 ; /arfD from Pseudomonas putida ACC11300;fadK. from £co / strain W ZP_07590374; putative j¾iiK from Salmonella iyphimuri LT2 NP 460316; and putative at/K from

Thermomonospora fusca YP 290214.

[0176] In some embodiments, an engineered host cell according to the invention (e.g. a bacterial host cell) will comprise a first introduced nucleic acid sequence encoding a FAR having an amino acid sequence that is at least about 70% identical, (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, at least about 98% and/or at least about 99%) identical to SEQ ID NOs:2, 4, 6 or 8 and/or a functional fragment thereof; a second introduced nucleic acid sequence encoding a FabH having an amino acid sequence that is at least about 70% identical, (e.g., at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, at least about 98%, at least about 99% and even 100%) identical to SEQ ID NO: 10 and/or a functional fragment thereof; a third introduced nucleic acid sequence encoding a TE having at least about 85% (e.g., at least about 88%, at least about 90%, at feast about 93%, at least about 95%, at least about 96%>, at least about 97%, at least about 98%, at least about 99% and even 100%) sequence identity to the polypeptide sequence of SEQ ID NO: 12 or SEQ ID NO: 63 and optionally a fourth introduced nucleic acid sequence encoding a FadD having an amino acid sequence that is at least about 80%, (e.g., at least about 85%, at least about 88%, at least about 90%, at least about 93%, at least about 95%, at least about 96%. at least about 97%, at least about 98%, at least about 99% and even 100%) identical to SEQ ID NO: 16 or a functional fragment thereof. In some embodiments, the engineered microorganism comprising the at least three nucleic acid sequences encoding a FAR, a FabH and a TE will produce a fatty alcohol composition comprising at least 50% (at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, and at least 85%) C12 and/or C14 saturated and/or unsaturated fatty alcohols. In some embodiments, the engineered microorganism comprising the at least four nucleic acid sequences encoding a FAR, a FabH, a TE and a FadD will produce a fatty alcohol composition comprising at least 50% (at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, and at least 85%) C12 and/or CI 4 saturated and/or unsaturated fatty alcohols.

6. Endogeno Gene Inacti vation :

[0177] In some embodiments, endogenous genes of the engineered microorganism of the present invention have been inactivated. For example, the genes have been genetically modified to at least partially delete a gene encoding the endogenous enzyme (e.g., FadE, FabF or FadR). Typically, these modifications of the gene reduce or eliminate the total amount of endogenous enzyme produced by the host cell. In some embodiments, complete or near-complete deletion of the gene sequence is contemplated. However, a deletion mutation need not completely remove the entire gene sequence encoding the enzyme, in order to reduce the amount of endogenous enzyme produced by the engineered cell. For example, in some embodiments, there is a partial deletion that removes one or more nucleotides encoding a portion of an enzyme (e.g., FadE) that plays a role in endogenous enzyme activity by the host cell (See, USP 8110670).

[0178] A deletion in a gene encoding an enzyme (e.g., FadE, FabF and/or FadR) in accordance with the embodiments provided herein includes a deletion of one or more nucleotides in the gene encoding the target enzyme (e.g., FadE, FabF and/or FadR). In some embodiments, there is a. deletion of at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%, of the gene (e.g. a gene encoding for example FadE, FabF and/or FadR), wherein the amount of enzyme produced by the cell is reduced.

[0179] Thus, in some embodiments, the deletion results in at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about a 99% reduction in the enzyme activity produced by the cell, relative to the enzyme activity of a corresponding enzyme produced by an unmodified organism grown or cultured under essentially the same culture conditions and including the gene coding for the corresponding enzyme which had not be inactivated or deleted. In some embodiments, deletion is of a /· · /!· ^' gene, afadE gene, &fadD gene or afadR gene.

[Θ180] Deletion of a gene of interest can be detected and confirmed by any of a variety of methods known in the art for detection of gene deletions, including the methods provided herein. For example, gene deletion can be confirmed using PCR amplification of the modified genomic region, it will be appreciated that additional suitable techniques for confirming deletion can be used and are well known, including but not limited to Southern blot techniques, DNA sequencing of the modified genomic region, and screening for positive or negative markers incorporated during recombination events,

[0181] Some additional methods for complete and/or partial deletion of a gene are well-known. The genetically modified cells described herein can be generated using any of a variety of deletion methods known in the art that result in the complete inaciivation or at least a reduction in the amount of at least one endogenous gene expressed by the cells.

[0182] There are numerous approaches to create genetic modifications in bacteria (See e.g., Court et al., (2002) Annual Rev, Genet 36:361-388; and Datsenko and Wanner (2000) P AS 97:6640-6645).

[0183] In some embodiments, the engineered microorganism will comprise an inactivated gene which codes for a FabF enzyme wherein the FabF comprises an amino acid sequence that is at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 93% identical, at least about 95% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical and even 100% identical to SEQ ID NO:30. In some embodiments, the FabF is encoded by a nucleic acid sequence comprising at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% and even 100% sequence identity to the polynucleotide sequence of SEQ ID NO: 29. In some embodiments, the FabF is encoded by a nucleic acid sequence that can selectively hybridize to SEQ ID NO:29 under moderately stringent or highly stringent conditions, as described hereinabove. To determine if FabF activity has been inactivated one of skill in the art may use a number of different assays. These assays include but are not limited to the measurement of thermal sensitivity, the measurement of reduction of cis-vaccenate (oleic acid) portion of cells as described for example in Mendoza et al, (1983 ) JBC 258:4(25) 2098 - 2101 ; and verification of gene deletion by PGR or sequencing.

[0184] In certain embodiments the inactivation is of a fadR gene sequence encoding a FadR enzyme. For example, in one embodiment, the polynucleotide sequence encoding a FadR enzyme is set forth herein as SEQ ID NO:23, and the encoded amino acid sequence is set forth as SEQ ID NO:24. In some embodiments, the FadR is encoded by a nucleic acid sequence that is at feast about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to SEQ ID NO:23. In some embodiments, the FadR is encoded by a nucleic acid sequence that can selectively hybridize to SEQ ID NO:23 under moderately stringent or highly stringent conditions, as described hereinabove. In some embodiments, the FadR enzyme has an amino acid sequence that is at least about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to SEQ ID NO:24.

[0185] In certain embodiments the inactivation is of a fadE gene sequence encoding a FadE enzyme. For example, in one embodiment, the polynucleotide sequence encoding a FadE enzyme is set forth herein as SEQ ID NO: 13, and the encoded amino acid sequence is set forth as SEQ ID NO: 14. In some embodiments, the FadE is encoded by a nucleic acid sequence that is at least about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to SEQ ID NO: 13. In some embodiments, the FadE is encoded by a nucleic acid sequence that can selectively hybridize to SEQ ID NO: 13 under moderately stringent or highly stringent conditions, as described hereinabove.

[Θ186] In some embodiments, the FadE has an amino acid sequence that is at least about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or even 100% identical to SEQ ID NO: 14. FadE sequences can be identified by any of a variety of methods known in the art. For example, a sequence alignment can be conducted against a database, for example against the NCBI database, and sequences with the lowest HMM E-value can be selected (Clio et al, 1995 J. Biol. Chem. 270:4216 - 4219).

[0187] In certain embodiments, in addition to a polynucleotide encoding a FabH being introduced into a microbial cell according to the invention, the engineered microbial cell may further comprise an inactivated endogenous FabH. For example, in one embodiment, the polynucleotide sequence encoding a FabH enzyme is set forth herein as SEQ ID NO:9, and the encoded amino acid sequence is set forth as SEQ ID NO: 10, In some embodiments, the FabH is encoded by a nucleic acid sequence that is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or even 100% identical to SEQ ID NO: 10. In some embodiments, the FabH is encoded by a nucleic acid sequence that can selectively hybridize to SEQ ID NO:9 under moderately stringent or highly stringent conditions, as described hereinabove.

[0188] In some embodiments, the FabH has an amino acid sequence that is at least about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to SEQ ID NO: 10.

[0189] In certain embodiments the inactivation is of &fadD polynucleotide sequence encoding a FadD enzyme. For example, in one embodiment, the polynucleotide sequence encoding a FadD enzyme is set forth herein as SEQ ID NO: 15, and the encoded amino acid sequence is set forth as SEQ ID NO: 16. In some embodiments, the FadD is encoded by a nucleic acid sequence that is at least about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81 %, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or even 100% identical to SEQ ID NO: 16. In some embodiments, the FadD is encoded by a nucleic acid sequence that can selectively hybridize to SEQ ID NO: 15 under moderately stringent or highly stringent conditions, as described hereinabove.

[0190] In some embodiments, the FadD has an amino acid sequence that Is at least about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or even 1QQ%> identical to SEQ ID NO: 16. FadD sequences can be identified by any of a variety of methods known in the art. For example, a sequence alignment can be conducted against a database, for example against the NCBI database, and sequences with the lowest HMM E-value can be selected (Black, P.N. et al, 1992, J. Biol. Chem., 267:25513 - 25520).

[0191] In some embodiments, a recombinant or engineered microbial host cell encompassed by the invention will comprise; a first introduced polynucleotide encoding a FAR enzyme (for example a polynucleotide encoding a FAR enzyme having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NOs: 2, 4, 6, or 8; a second introduced polynucleotide encoding a FabH having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100% ) sequence identity to SEQ ID NO: 10; and optionally one or more introduced polynucleotides encoding a FabD having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 26; a FabG having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 17; a Fabl having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 19; a FabZ having at least 90% (at least 93%, 95%, 96%, 97%, 98%, 99% and even 100%) sequence identity to SEQ ID NO: 21 and a FabB having at least 90% (at least 93%, 95%, 96%, 97%, 98% 99% and even 100%) sequence identity to SEQ ID NO: 27 and optionally one or more attenuated endogenous fad ox fab genes selected from a gene encoding a FadE comprising at least 90% (at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 99% and even 100%) sequence identity to SEQ ID NO: 14; a gene encoding a FadD comprising at least 90% (at least 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% 99% and even 100%) sequence identity to SEQ ID NO: 16; a gene encoding a FabF having at least 90% (also at least 93%, 95%, 96%, 97%, 98%, 99%) sequence identity to SEQ ID NO: 29; and/or a gene encoding a FadR comprising at least 90% (at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 99% and even 100%) sequence identity to SEQ ID NO: 24. In some embodiments the polynucleotide encoding the FadE comprises a polynucleotide sequence comprising at least 95% sequence identity to SEQ ID NO: 13; the polynucleotide encoding the FadD comprises a polynucleotide sequence comprising at least 95% sequence identity to SEQ ID NO: 15; the polynucleotide encoding FabF comprises a polynucleotide sequence comprising at least 95% sequence identity to SEQ ID NO: 29 and the polynucleotide encoding the FadR comprises a polynucleotide sequence comprising at least 95% sequence identity to SEQ ID NO: 23.

7. Host cells:

[Θ192] In some embodiments, the recombinant bacterial microorganism according to the invention is a Gram-positive, Gram negative and Gram-variable bacterial cell. In certain embodiments, host cells include, but are not limited to, species of a genus selected from the group consisting of Agrobacierium, Arthrohacter, Bacillus, Clostridium, Corynebacterium, Escherichia, Erwinia, Geobacillus, Klebsiella, Lactobacillus, Mycobacterium, Pantoea, Rhodococcus, Rhotobacter, Streptomyces and Zymomonas. In certain embodiments, the recombinant host ceil is an industrial bacterial strain. Numerous bacterial industrial strains are known and suitable for use in the methods disclosed herein. In some embodiments, the bacterial host cell is a species of the genus Bacillus, e.g., B. thuringiensis, B. anthracis, B. megateri m, B. subtilis, B. lentus, B. circulans, B. pumilus, B. lautus, B.coagulans, B. brevis, B.

firmus, B. alkaophius, B. licheniformis, B. clausii, B. stearothermophilus, B.

halodurans, B. subtilis, B. pumilus, and B. amyloliquefaciens. In some embodiments, the bacterial host cell is a species of the genus Erwinia, e.g., E. uredovora, E, carotovora, E, ananas, E. herbicola, E. punctata and E. terreus. In other

embodiments the bacterial host ceil is a species of the genus Pantoea, e.g., P. citrea or P. agglomerans. In still other embodiments, the bacterial host cell is a species of the genus Streptomyces, e.g., S. ambofaciens, S. achromogenes, S. avermitilis, S.

coelicolor, S. aureofaciens, S. aureus, S. fungicidicus, S. griseus or S. lividans. In further embodiments, the bacterial host cell is a species of the genus Zymomonas, e.g., Z. mohilis or Z, lipoiytica. In further embodiments, the bacterial host cell is a species of the genus Rhodococcus, e.g. R. opacus.

[0193] In some embodiments, the bacterial host cell is a species of the genus Escherichia, e.g., E. coll. In various embodiments, the engineered E. co i bacterial strains useful in the processes described herein are derived from strain W31 10, strain MG1655, strain B766 (E. coli W) and strain BW251 13. In some further

embodiments, the W31 10 strain finds use in the present invention; the genome of this strain has been fully sequenced and annotated See e.g., Hayashi et al., (2005) Mol. Syst. Biol. 2:2006.0007). For industrial applications, phage-resistant strains are particularly useful. In this sense, deletion of the ftiuA gene (also known as tonA) confers resistance to phages Tl, T5 and phiSO (Link et al., 1997, J. Bac/. 179: 6228- 8237). Another useful strain is E. coli W (Archer et al., 201 1, BMC Genomics, 12:9.doi: 10.1 1 U/1471-2164-12-9). Also reference is made to Elben et al. (2005) J. of Food Protection 68(2):282 - 291.

[0194] Other examples of useful E. coli strains include, but are not limited to, E. coli strains found in the E. coli Stock Center from Yale University (see the website cgsc. biology.yak. edu/index.php); the Keio Collection, available from the National BioResource Project at NBRP E. coli, Microbial Genetics Laboratory, National Institute of Genetics 1 1 1 1 Yata, Mishima, Shizuoka, 41 1 -8540 Japan (see the website, www at shigen. nig. ac.jp/ecoli/strain/top/top.jsp); or strains deposited at the American Type Culture Collection (ATCC).

[0195] In some embodiments, the host cell is an E. coli cell that has been transformed with a polynucleotide sequence encoding a FAR, a FabI! and optionally a FabD, FabF, FabG, FabI, FabZ and/or FabB as described herein. The polynucleotides encoding each of these enzymes may be located on the same vector or they may be located on different vectors. In some embodiments, the introduced genes are chromosomally integrated into the host genome. In some embodiments, the recombinant E, coli comprises a heterologous TE as described above. In some of the embodiments, the recombinant E.coli produces a fatty alcohol composition having at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% and at least 95%) of any one of CI 2, CI4, C 16 fatty alcohols or combinations thereof.

8. Fermentation/Culturing:

[0196] Any suitable means for culturing the recombinant host cells finds use in the present invention. Indeed, any suitable fermentation protocol finds use in the production of the tatty alcohols provided herein. In some embodiments, fermentation of the recombinant host cells as described hereinabove for example comprises fermenting bacterial host cells such as E. coli comprising: a heterologous

polynucleotide encoding a FAR enzyme, a heterologous polynucleotide encoding an FabIT enzyme; optionally a heterologous (introduced) polynucleotide encoding a Fab enzyme selected from a FabD, FabG, FabI, FabZ and/or FabB and variants and functional fragments thereof as described above; and optionally further comprising an inactivated fadE, an inactivated fadD, an inactivated fabF, and/or an inactivated fadR gene, under suitable conditions and for a time sufficient for production of fatty alcohols, as desired.

[ 0197] Conditions for the culture and production of ceils, including bacterial, fungal and yeast cells, are readily available and well-known in the art. The engineered host cells can be cultured in conventional nutrient media modified as appropriate. Culture conditions, such as temperature, pH and the like, are those previously used with, the host cell selected for expression, and will be apparent to those skilled in the art,

[0198] Ceil culture media in general are set forth in Atlas and Parks (eds.) The Handbook of Microbiological Media ( 1993) CRC Press, Boca Raton, FL, which is incorporated herein by reference. Additional information for cell culture is found in available commercial literature such as the Life Science Research Cell Culture Catalogue (1998) from Sigma-AIdrick, Inc (St Louis, MO) ("Sigma-LSRCCC") and, for example, The Plant Culture Catalogue and supplement ( 1997) also from Sigma- Aldrich, Inc (St Louis, MO) ("Sigma-PCCS"), all of which are incorporated herein by reference. Reference is also made to the Manual of Industrial Microbiology and Biotechnology. A. Demain and J. Davies Eds. ASM Press. 1999.

[0199] In some embodiments, the recombinant cells encompassed by the invention are grown under batch or continuous fermentations conditions. Classical batch fermentation is a closed system, wherein the compositions of the medium is set at the beginning of the fermentation and is not subject to artificial alterations during the fermentation. A variation of the batch system is a fed-batch fermentation which also finds use in the present invention. In this variation, the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression is likely to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Batch and fed-batch fermentations are common and well known in the art. Continuous fermentation is a system where a defined fermentation medium is added continuously to a bioreacior and an equal amount of conditioned medium (e.g., containing the desired end- products) is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in the growth phase where production of end products is enhanced. Continuous fermentation systems strive to maintain steady state growth conditions. Methods for modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well laiown in the art of industrial microbiology.

[0200] In some embodiments, fermentations are carried out at a temperature within the range of from about 10°C to about 60°C, from about 15°C to about 50°C, from about 20°C to about 45°C, from about 25°C to about 45°C, from about 30°C to about 45°C and from about 25°C to about 40°C. Indeed, it is intended that any suitable fermentation temperature will be used in the present invention.

[0201] In some other embodiments, the fermentation is carried out for a period of time within the range of from about 8 hours to 240 hours, from about 8 hours to about 168 hours, from about 16 hours to about 144 hours, from about 16 hours to about 120 hours, or from about 24 hours to about 72 hours. Indeed, it is intended that any suitable fermentation time will find use in the present invention,

[0202] In some other embodiments, the fermentation will be carried out at a pH in the range of about 4 to about 8, in the range of about 4.5 to about 7,5, in the range of about 5 to about 7, or in the range of about 5.5 to about 6.5, Indeed, it is intended that any suitable pH range will find use in the present invention.

[0203] Carbon sources useful in the fermentation medium (e.g., broth) in which the recombinant microorganisms are grown are those that can be assimilated by the recombinant host strain. Such carbon sources are available in many forms and include renewable carbon sources, including but not limited to celhtlosic and starch feedstock substrates obtained there from. Such examples include for example fermentable sugars such as monosaccharides, disaccharides, and short chain oligosaccharides (e.g., glucose, fructose, xylose, galactose, arabinose, maltose, mannose, and sucrose, fructo-oligosaceharide, galaeto-oligosaecharide as well as numerous other sugars; it is not intended that the present invention be limited to any particular fermentable sugar). Other carbon sources include, but are not limited to saturated and unsaturated fatty acids, alcohols, glycerol, lactose, succinate, ketones, amino acids, acetate, gases (e.g., C0 ₂ ), and mixtures thereof.

[0204] In some embodiments, the assimilable carbon source is derived from biomass. The term "biomass" is broadly used herein to encompasses any living or dead biological material that contains a polysaccharide substrate, including but not limited to cellulose, starch, other forms of long-chain carbohydrate polymers, and mixtures of such sources. Examples of biomass include, but are not limited to, wood, wood pulp, paper pulp, corn fiber, grain, corn grain, corn cobs, sugar cane, sugar beet, crop residues such as com husks, com stover, grasses, wheat, wheat straw, barley, barley straw, hay, rice, rice straw, switchgrass, waste paper, paper and pulp processing waste, woody or herbaceous plants, fruit or vegetable pulp, distillers grain, grasses, rice hulls, cotton, hemp, flax, sisal, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood chips, sawdust, shrubs and bushes, vegetables, fruits, and flowers and any suitable mixtures thereof. In some embodiments, the biomass comprises, but is not limited to cultivated crops (e.g., grasses, including C4 grasses, such as switch grass, cord grass, rye grass, miscanthus, reed canary grass, or any combination thereof), sugar processing residues, for example, but not limited to, bagasse (e.g., sugar cane bagasse, beet pulp [e.g., sugar beet], or a combination thereof), agricultural residues (e.g., soybean stover, corn stover, corn fiber, rice straw, sugar cane straw, rice, rice hulls, barley straw, corn cobs, wheat straw, canola straw, oat straw, oat hulls, com fiber, hemp, flax, sisal, cotton, or any combination thereof), fruit pulp, vegetable pulp, distillers' grains, forestry biomass (e.g., wood, wood pulp, paper pulp, recycled wood pulp fiber, sawdust, hardwood, such as aspen wood, softwood, or a combination thereof).

Furthermore, in some embodiments, the biomass comprises cellulosic waste material and/or forestry waste materials, including but not limited to, paper and pulp processing waste, municipal paper waste, newsprint, cardboard and the like. In some embodiments, biomass comprises one species of fiber, while in alternative embodiments, the biomass comprises a. mixture of fibers that originate from different biomasses. In some embodiments, the biomass may also comprise transgenic plants that express ligninase and/or cellulase enzymes (See e.g., US 2008/0104724 A I).

[0205] In some embodiments, the cellulosic feedstock useful as an assimilable carbon source has been derived from a. biomass substrate that has been pretreated. Various pretreatment methods are known in the art, such as chemical pretreatment (e.g., ammonia pretreatment, dilute acid pretreatment, dilute alkali pretreatment, or solvent exposure), physical pretreatment (e.g., steam explosion or irradiation), mechanical pretreatment (e.g., grinding or milling) and biological pretreatment (e.g., application of lignin-solubilizing microorganisms) and combinations thereof. The pretreatment increases the susceptibility of cellulose to hydrolysis. In some embodiments, the substrate is slurried prior to pretreatment. The following references described various means of pretreatment. Steam explosion performing acid pretreatment of biomass substrates is described in U.S. Patent No. 4,461 ,648. Also reference is made to WO2010/1 12129; W02Q 12/042545 and WO2012/0425544. Continuous pretreatment using a slurry is described U.S. Patent No. 7,754,457.

Methods of alkali pretreatment is such as Ammonia Freeze Explosion, Ammonia Fiber Explosion or Ammonia Fiber Expansion (" AFEX") are described in U.S. Patent Nos. 5, 171,592; 5,037,663; 4,600,590; 6,106,888; 4,356, 196; 5,939,544; 6, 176, 176; 5,037,663 and 5, 171,592. Alternative methods to AFEX utilizing a dilute ammonia pretreatments are described in WO2009/0456 1 and US 2007/0031953. Chemical pretreatments with organic solvents are disclosed in U.S. Patent No. 4,556,430. Other pretreatments methods are disclosed in U.S. Patent No. 7,465,791; PCT publication WO2011 028554, and Weil et al ( 1997) Appl. Biochem. BiotechnoL, 68(1-2): 21 -40 [1997].

9. Production of Fatty Alcohols i

10206] In some embodiments, the in vention is directed to a method of producing fatty alcohols from the engineered cells, wherein the engineered cells comprise a recombinant FAR polynucleotide, an introduced polynucleotide encoding a. FabH, and optionally a polynucleotide encoding one or more of i) a heterologous TE, ii) an introduced FadD, iii) an introduced Fabl, iv) an introduced FabA, and v) an introduced FabZ as described more specifically herein.

[0207] In various embodiments, fatty alcohols produced by the methods of the invention are further recovered or isolated (for example from the cell culture).

Recovery or isolation of the produced fatty alcohols refers to substantially separating the fatty alcohols from other components of the culture medium or fermentation process. Recovery or isolation may be accomplished by solvent extraction of the aqueous nutrient medium with a suitable water immiscible solvent. Extraction may occur simultaneously with fatty alcohol production and in some embodiments, extraction is continuous. Phase separation followed by solvent removal provides the fatty alcohol which may then be further purified and fractionated using methods and equipment known in the art. In some other aspects of the invention, the secreted fatty alcohols coalesce to form a water immiscible phase that can be directly separated from the aqueous nutrient medium either during the fermentation process or after its completion,

[0208] In certain embodiments of the invention, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%. at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95%, of the fatty alcohols produced by the methods described herein are secreted into the culture medium by the recombinant host cells.

[0209] In certain embodiments, fatty alcohols are isolated by separating the host cells from the aqueous nutrient medium, for example by centrifugation, resuspension and extraction of the fatty alcohols from the recombinant host cells using an organic solvent or solvent mixture. Suitable protocols for recovering fatty alcohols from recombinant host cells and/or culture medium are known to the skilled artisan. In some embodiments, fatty alcohols may be recovered by first lysing the cells to release the fatty alcohols and then extracting the fatty alcohol from the lysate using conventional means. Reference is also made to Yeast Protocols Handbook, (2009) Clontech Laboratories, Inc. A Takara Bio Company, Mi View CA 94043; P AS 2003 Vol 100, 16:9156- 9161 ; and Doan et al., (2009) J. Plant Physiol. 166: 787-796 which discloses methods to isolate and measure fatty alcohols produced in E. coli using FARs from Arabidopsis. Indeed, it is intended that any suitable method will find use in the present invention and it is not intended that the present invention be limited to any particular method(s) for separating host cells from the nutrient medium.

[0210] In various embodiments, the compositions produced by the methods and microorganisms described herein comprise both saturated and unsaturated fatty alcohols. In certain embodiments, the unsaturated fatty alcohols are mono- unsaturated fatty alcohols. In some embodiments, the fatty alcohol compositions comprise both saturated and unsaturated fatty alcohols, and the amount of unsaturated fatty alcohols compared to saturated fatty alcohols in the total fatty alcohol composition is less than about 40%, less than about 35%, less than about 30%, less than about 20%, less than about 15%, less than about 10%», less than about 5%, or less than about 1% of the fatty alcohols present in the composition. [0211] In some embodiments, the fatty alcohol compositions comprise both saturated and unsaturated fatty alcohols. In some embodiments, the percentage of saturated fatty alcohols in the fatty alcohol compositions produced by the engineered bacterial cells encompassed by the invention is greater than about 50%, greater than about 55%, greater than about 60%, greater than about 65%, greater than about 70%, greater than about 75%, greater than about 80%, greater than about 85%, greater than about 90%, greater than about 95%, or greater than about 97%.

[0212] In some embodiments, the fatty alcohol compositions produced by the methods and engineered microorganisms described herein comprise one or more aicohols selected from 1-decanol (C10:0), l-dodecanoi (C12:0), 1-tetradecanol (C14:0), 1-hexadecanol (C16:0), and 1-octadecanol (CI 8:0).

[0213] In some typical embodiments, C IO to C18 fatty aicohols comprise at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% by weight of the total fatty alcohols produced by the recombinant host cells. In some embodiments, CI 2 to C16 fatty aicohols comprise at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92% _, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%>, or at least about 98% by weight of the total fatty alcohols produced by the recombinant host cells. It is understood that a reference to a "Cx fatty alcohol" (e.g., C12) includes both saturated and unsaturated fatty alcohols having "x" carbon atoms unless indicated otherwise.

[0214] In certain embodiments, C14 to C16 fatty alcohols comprise at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at leas _t about 90%, at least about 92%, at feast about 95%, at least about 97%, or at least about 99% by weight of the total produced fatty alcohols.

[0215] In certain embodiments, C12 to C14 fatty alcohols comprise at least about 50%, at least 55%, at least 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or at least about 99% by weight of the total produced fatty aicohols. [0216] In some typical embodiments, C10:0 to C18:0 fatty alcohols comprise at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% by weight of the total produced fatty alcohols, in some embodiments, C 12:0 to C16:0 fatty alcohols comprise at least about 75%, at least about80% at least about 85%, at least about 90%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, or at least about 98% by weight of the total produced fatty alcohols, in certain embodiments, C14:0 to CI6:0 fatty alcohols comprise at least about 70%, at least about 75%, at least about 8Q%>, at least about 85%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or at least about 99% by weight of the total produced fatty alcohols.

[0217] In certain embodiments, CI 2:0 to C14:0 fatty alcohols comprise at least about 60%, at least about 65%, at least about 70%, at least about75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, or at least about 99% by weight of the total produced fatty alcohols.

[0218] The proportions of saturated and unsaturated fatty alcohols produced by the strains may be calculated after quantifying all the fatty alcohol species using any suitable method known in the art (e.g., GC-FID as described in US

201 1/0000125SA1 ). The saturated fraction represents the sum of all C12:0-GH; 04:0-011; C16:0-OH and 08:0-01 . While the unsaturated fraction is composed of the sum of C12: l-OH: C14: l-OH: C16: l-OH and C ! 8: 1 ·()! !.

[0219] In some embodiments, the fatty alcohol compositions produced by the recombinant cells comprise a % of saturated fatty alcohols that is greater than about 55%; greater than about 60%; greater than about 65%; greater than about 70%;

greater than about 75%; greater than about 80%; greater than about 85%; greater than about 90%; greater than about 95%; or greater than about 97%. In some additional embodiments, the fatty alcohol compositions further comprise at least about 85%, at least about 88%, at least about 90%, at least about 91%, at feast about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, or at least about 98% C12 to C16 fatty alcohols. In some additional

embodiments, the fatty alcohol compositions further comprise at least about 85%, at least about 88%>, at least about 90%, at least about 91 %, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, or at least about 98% C12 to CI 4 fatty alcohols.

[0220] In some embodiments, the methods encompassed by the invention produce fatty alcohol compositions having a carbon chain length profile that has shifted from the carbon chairs length profile of a corresponding host cell. In some embodiments, the composition of C I 2 fatty alcohols has been increased by greater than 2,5%, greater than 30%, greater than 35%, greater than 40%, greater than 50%, greater than 60% and even greater than 70%, and at the same time the composition of CI 6 fatty alcohols produced from the same engineered cells has been decreased by at least 10%, by at least 15%, by at least 20%, by at least 25% and by at least 30%. In some embodiments, the composition of CI 6 fatty alcohols produced from the same engineered cells has been decreased by at least 10%, by at least 15%, by at least 20%, by at least 2.5% and by at least 30% as compared to a corresponding host cell. In some embodiments, the engineered ceils producing fatty alcohol compositions comprising a shift in the percent of C12 and CI 6 fatty alcohols comprise an engineered cell comprising a polynucleotide encoding a FAR comprising at least 90% (at least 95%, 96%, 97%, 98% or 99%) sequence identity to SEQ ID NO:2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8 and comprise an introduced polynucleotide encoding a FabH comprising at least 80% (at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, at least 99% and even 100% sequence identity to SEQ ID NO: 10 as compared to a corresponding engineered cell transformed to include only the polynucleotide encoding the FAR comprising at least 90% (at least 95%, 96%, 97%, 98% or 99%) sequence identity to SEQ ID NO:2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8.

[0221] In certain preferred embodiments, the methods encompassed by the invention produce fatty alcohol compositions having a carbon chain length profile that has shifted from the carbon chain length profile of a corresponding host cell wherein the composition of C I 2 fatty alcohols has increased by greater than 30%, by greater than 40%, greater than 50%, greater than 60% and even greater than 70%, and at the same time the composition of CI 6 fatty alcohols produced from the same engineered cells has been decreased by at least 2.0% and the engineered cells producing the fatty alcohol compositions comprising a shift in the percent of C12 and C16 comprise a polynucleotide encoding a FAR comprising at least 95% sequence identity to SEQ ID NO:2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8 and comprise an introduced polynucleotide encoding a FabH comprising at least 90%, sequence identity to SEQ ID NO: 10 and optionally include a) a polynucleotide encoding an introduced TE (e.g., a TE having at least 90% sequence identity to SEQ ID NO: 12 or SEQ ID NO: 63 and a. polynucleotide encoding an introduce FadD (e.g., a FadD having at least 90% sequence identity to SEQ ID NO: 16 or b) a polynucleotide encoding an introduced Fabl (e.g., a Fabl having at least 90% sequence identity to SEQ ID NO: 20; c) a polynucleotide encoding an introduced FabZ (e.g., having at least 90% (at least 95%, at least 98% and even 100%) sequence identity to SEQ ID NO: 22), d) a polynucleotide encoding an introduced FabD (e.g., having at least 90% (at least 95%, at least 98% and even 100%) sequence identity to SEQ ID NO: 26); and/or a e) polynucleotide encoding an introduced FabG (e.g. having at least 90%, at least 95%, at least 98% and even 100%) sequence identity to SEQ ID NO: 18) as compared to a corresponding engineered cell transformed to include only the polynucleotide encoding the FAR comprising at least 95% sequence identity to SEQ ID NO:2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8.

[0222] In certain embodiments, the amount of fatty alcohols produced by the recombinant bacterial cells according to the methods described herein comprise saturated and/or unsaturated C8 to C18 alcohols in a range of about 10 rag/L to about 150 g/L of aqueous nutrient medium, such as in a range of about 10 mg/L to about 125 g/L, about 10 mg/L to about 100 g/L, about 10 mg/L to about 75 g/L, about 10 mg L to about 50 g/L, about 10 mg/L to about 25 g L, about 10 mg L to about 5 g L or in a range of about 10 mg/L to about 2 g/L of medium, using routine modification of culturing conditions. In some embodiments, the amount of fatty alcohols produced by the methods described herein is at least about 0.5 g/L, at least about 1 g/L, at least about 1.5 g/L, at least about 2.0 g/L, at least about 2.5 g/L, at least about 3 g/L, at least about 3.5 g/L, at least about 4 g/L, at least about 4.5 g L, at least about 5 g/L, or at least about 10 g/L of medium. In various embodiments, the amount of fatty alcohols produced by the methods described herein is at least about 20 g/L, at least about 30 g/L, at least about 40 g/L, or at feast about 50 g L of medium. In some embodiments, a recombinant bacteria (e.g., E. coif) encompassed by the invention produces C12 to C16 fatty alcohols in an amount of at least about 1.0 g/L, at least about 5.0 g' L, at feast about 10 g<'L, at feast about 15 g/L, at feast about 20 g L, at least about 25 g/L, or at least about 30 g L of medium. One method to extract and quantify fatty alcohols is provided in US Patent Application 201 1/0000125.

However, it is not intended that the present invention be limited to any particular method(s) for extracting and/or quantifying the fatty alcohols produced using the present invention, as any suitable methods find use.

10223] In some embodiments, the amount of fatty alcohols produced by the methods described herein are in at least about lOOmg/g, at least 500 mg/g, at least Ig/g, at feast 2 g/g, at least 5 g/g/ at least 6g/g, at least 7 g/g, at feast 8 g/g'' ^' at feast 9g/g/ at least l Og/g/ at least 12g/g at least 15g/g of dry ceil weight, in some embodiments the amount of fatty alcohols produced by the methods described herein are in the range of about 100 mg g to about 15 g/g of dry cell weight and also in the range of about 100 mg/g to about 10 g/g of dry ceil weight. In other embodiments, the amount of tatty alcohols produced by the methods described herein is in the range of about f g/g to about f2g/g; about lg/g to about 10 g/g; about f g/g/ to about 5 g/g of dry ceil weight, and about 5 g/g to about 10 g/g of dry cell weight.

[0224] In certain embodiments, the amount of fatty alcohols produced by the methods described herein is in the range of about 10% to about 20% of dr ceil weight, about 20% to about 30% of dry cell weight, about 30% to about 40% of dry cell weight, about 40% to about 50% of dry cell weight, about 50% to about 60% of dry ceil weight, about 60% to about 70% of dry cell weight, or about 70% to about 80% of dry cefl weight.

[0225] In some embodiments, the fatty alcohol compositions produced by the engineered cells and methods described herein may also comprise fatty acid-derived components. Fatty acid derivative compounds include compounds such as but not limited to esters (e.g. acetyl, methyl or ethyl esters and waxes) and fatty acids.

10. Compositions:

10226] In yet another aspect, the present invention relates to the use of the engineered microorganisms as described herein for the production of various compositions, including but not limited to, fuel compositions (e.g., biodiesels and petrodiesels), cleaning compositions including detergent compositions (e.g., laundry detergents in liquid gel, spray, and powder form, hard surface cleaners, dishwashing detergents, and the like); industrial compositions (e.g., lubricants, solvents, and industrial cleaners); and personal care compositions (e.g., soaps, cosmetics, shampoos, gels, etc.).

Detergent Compositions

10227] In some embodiments, the fatty alcohol compositions described herein, and compounds derived there from, can be used as components of detergent compositions. Detergent compositions comprising fatty alcohols and fatty alcohol derivatives produced by the methods of the present invention include compositions used in cleaning applications, including, but not limited to, laundr detergents, hand-washing agents, dishwashing detergents, rinse-aid detergents, household detergents, and household cleaners, in liquid, gel, granular, powder, or tablet form. In some embodiments, the fatty alcohols produced by the methods described above are used directly in detergent compositions. In some embodiments, the fatty alcohols and fatty alcohol derivatives are reacted with, a sulfonic acid group to produce sulfate derivatives that can be used as components of detergent compositions. In some embodiments, the fatty alcohols and fatty alcohol derivatives are reacted with an ethylene oxide to produce ethoxylated derivatives that can be used as components of detergent alcohols. Detergent compositions that can be generated using the fatty alcohols and fatty alcohol derivatives produced by the methods of the present invention include, but are not limited to, hair shampoos, rinses, and conditioners for humans and other animals, carpet shampoos, hard surface cleaners, light-duty household cleaners, light-duty household detergents, heavy-duty household cleaners, and heavy-duty household detergents. Detergent compositions generally include, in addition to fatty alcohols and derivative thereof, one or more builders (e.g., sodium carbonate, eomplexation agents, soap, and zeolites), enzymes (e.g., proteases, lipases, cellulases, and/or amylases); carboxymethyl cellulose, optical brighteners, fabric softeners, colourants and perfumes (e.g., cyclohexyl salicylate). Indeed, it is not intended that the present invention be limited to any particular detergent, detergent formulation, nor detergent use. [0228] In some embodiments, sulfate derivatives and/or ethoxylated derivatives (e.g., C12-15) derived from fatty alcohols are used in products such as hair shampoos, carpet shampoos, light-duty household cleaners, and light-duty household detergents. In some embodiments, sulfate derivatives and/or ethoxylated derivatives (e.g., C16- C18) derived from fatty alcohols are used in products such as hair shampoos and conditioners. In some embodiments, sulfate derivatives and/or ethoxylated derivatives (e.g., C 16-18) derived from fatty alcohols are used in products such as heavy-duty household cleaners and heavy-duty household detergents. Indeed, it is not intended that the present invention be limited to any particular detergent, detergent formulation, nor detergent use.

Personal Care Compositions

[Θ229] In some embodiments, fatty alcohol compositions as described herein, and compounds derived there from, are used as components in personal care

compositions. In some embodiments, the fatty alcohols produced by the methods described above are used directly in personal care compositions. Personal care compositions containing fatty alcohols or fatty alcohol derivatives produced by the methods of the present invention include compositions used for application to the body (e.g., for application to the skin, hair, nails, or oral cavity) for the purposes of grooming, cleaning, beautifying, or caring for the body, including but not limited to lotions, balms, creams, gels, serums, cleansers, toners, masks, sunscreens, soaps, shampoos, conditioners, body washes, styling aids, and cosmetic compositions (e.g., makeup in liquid, cream, solid, anhydrous, or pencil form),

[0230] In some embodiments, the tatty alcohols or fatty alcohol derivatives can be reacted with a sulfonic acid group to produce sulfate derivatives that can be used as components of said compositions. In some embodiments, the fatty alcohols and fatty alcohol derivatives are reacted with an ethylene oxide to produce ethoxylated derivatives that can be used as components of said compositions. In some embodiments, sulfate derivatives (e.g., CI 2 to 14) derived from the fatty alcohol compositions produced by the methods described herein are used in products such as toothpastes. Indeed, it is not intended that the present invention be limited to any particular formulation, nor use. [0231] In some embodiments, fatty alcohol compositions (e.g., CI 2) produced by the methods described herein are used in products such as lubricating oils, pharmaceuticals, and as an emollient in cosmetics. In some embodiments, fatty alcohol compositions (e.g., C 14) produced by the methods described herein are used in products such as cosmetics (e.g., cold creams) for its emollient properties. In some embodiments, fatty alcohol compositions (e.g., C16) produced by the methods described herein are used in products such as cosmetics (e.g., skin creams and lotions) as an emollient, emulsifier, or thickening agent. In some embodiments, fatty alcohol compositions (e.g., CI 8) produced by the methods described herein are used in products such as lubricants, resins, perfumes, and cosmetics, e.g., as an emollient, emulsifier, or thickening agent. Indeed, it is not intended that the present invention be limited to any particular formulation, nor use.

Other Compositions:

[0232] In some embodiments, fatty alcohol compositions (e.g., C12) produced by the methods described herein are used in products such as lubricating oils, pharmaceuticals, and as an emollient in cosmetics. In some embodiments, fatty alcohol compositions (e.g., C 14) produced by the methods described herein are used in products such as cosmetics (e.g., cold creams) for its emollient properties. In some embodiments, fatty alcohol compositions (e.g., CI 6) produced by the methods described herein are used in products such as cosmetics (e.g., skin creams and lotions) as an emollient, emulsifier, or thickening agent. In some embodiments, fatty alcohol compositions (e.g., CI 8) produced by the methods described herein are used in products such as lubricants, resins, perfumes, and cosmetics, e.g., as an emollient, emulsifier, or thickening agent. In some embodiments, sulfate derivatives (e.g., CI 2 to C 14) derived from the fatty alcohol compositions produced by the methods described herein are used in products such as toothpastes,

[Θ233] In some instances, fatty alcohols (especially cetyl alcohol, stearyl alcohol and myristyl alcohol) may be used as food additives (e.g., adjuvants and production aids).

Alkane αηά/or Athene Compositions

[0234] In some embodiments, fatty alcohols produced according to the methods described herein can be reduced to yield alkanes and/or alkenes having the same carbon chain length as the fatty alcohol starting materials. Without being bound by any particular theory, the hydroxy! group of an alcohol is a poor leaving group, and therefore, in principle a chemical moiety that binds to the oxygen atom of the hydroxy! group to make it a better leaving group can be used to reduce the fatty alcohols described herein.

[Θ235] Any suitable method known in the art can be used to reduce the fatty alcohols. In some embodiments, reduction of fatty alcohols is carried out chemically, for example, by a Barton deoxygenation (or Barton-McCombie deoxygenation), a two-step reaction in which the alcohol is first converted to a methyl xanthate or thioimidazoyl carbamate, and the xa.ntha.te or thioimidazoyl carba.ma.te is reduced with a tin hydride or trialkylsilane reagent under radical conditions to produce the alkane and/or aikene. See Li et al, 2007, Modern Organic Synthesis in the Laboratory, p. 81- 83. In another embodiment, alkanes are produced by hydrogenation of fatty alcohols.

10236] The alkanes can be isolated from the reaction mixture (which may contain unreduced fatty alcohols) to yield a composition comprising substantially all alkanes Alternatively, the alkanes and un-reduced fatty alcohols can be isolated from the reaction mixture to yield a composition comprising alkanes and fatty alcohols. In some embodiments, the fatty alcohol compositions comprise at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%», at least about 85%, at least about 90%, at least about 92%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% alkanes by weight of the composition after reduction. In some embodiments, the alkane is octane, decane, dodecane, tetradecane, hexadecane, octadecane, icosane, docosane, tetracosane, or mixtures thereof.

Ester Compositions:

[0237] In other embodiments, fatty alcohols are reacted with a carboxylic acid to form acid esters. Esterification reactions of fatty alcohols are well-known in the art. In certain embodiments, the transesterification reaction is carried out in the presence of a. strong catalyst, e.g., a strong alkaline such as sodium hydroxide. In other embodiments, the esterification reaction is carried out enzymatically, using an enzyme that catalyzes the conversion of tatty alcohols to acid esters, such as lipoprotein lipase. See, e.g., Tsujita et al, 1999, "Fatty Acid Alcohol Ester-Synthesizing Activity of Lipoprotein Lipase" J. Biochem. 126: 1074-1079.

[0238] The following examples are offered to illustrate, but not to limit, the claimed invention.

EXAMPLES

[0239] The present invention is described in further detail in the following

Examples, which are not in any way intended to limit the scope of the invention as claimed. In the experimental disclosure below, the following abbreviations apply: ppm (parts per million); M (molar); mM (millimolar), uM and μΜ (micromolar); uM (nanomolar); rnoi (moles); gm and g (gram); mg (milligrams); ug and μg

(micrograms); L and 1 (liter); ml and mL (milliliter); cm (centimeters); mm

(millimeters); um and μπι (micrometers); sec. (seconds); min(s) (minute(s)); h(s) (hour(s)); U (units); LB ( Luria-Bertani); MW (molecular weight); rpm (rotations per minute); °C (degrees Centigrade); wt % (weight percent); w.r.t. (with regard to); Δ (deletion); DNA (deoxyribonucleic acid); PCR (polymerase chain reaction); _F (forward primer); R (reverse primer); (RNA (ribonucleic acid); gDNA (genomic DMA); cDNA (com lementary DNA); PCR (polymerase chain reaction); rbs (ribosome binding sequence); Sigma (Sigma Aldrich, St. Louis, MO); Qiagen (Qiagen, Inc., Valencia, CA); Invitrogen (Invitrogen, Corp., Carlsbad, CA); and Promega (Promega, Corp., Madison, WD.

Example 1

Construction of plasmid pLS8379

[0240] To overproduce the FAR enzyme having SEQ ID NO: 6 or 8 in E. coli, a low copy vector carrying the Trc promoter was constructed. A DNA fragment containing the laclq gene, the Trc promoter, and the multiple cloning sites present in pTrcHis2-B (Invitrogen, Carlsbad, CA) was PCR amplified using the primers:

1920TrcM_F 5 ' ^■■ GACCTI^AAACCCTAAAGGCTTAAGGGCATCCGC TTACAGACA (SEQ ID NO: 31) and 1920TrcM_R 5 '- GGAGAAAATACCGCATCAGGCGCCTCAGGAGAG

CGTTCACCGAC (SEQ ID NO: 32).

[0241] The PGR reaction was carried out using the enzyme Phusion (New England BioLabs, Ipswich, MA) with an initial denaturation step at 98°C for 30 sec, followed by 25 cycles of the steps: 98°C for 10 sec; 65°C for 15 sec and 72°C for 15 sec. This was followed by a. final elongation step at 72°C for 5 min. The primers used for this PGR reaction carry regions of homology to plasmid pCL1920, and therefore the PGR product described above can be used as a megaprimer to amplify a defined region of pCL1920 (Lerner and Inouye (1990) NAR 18: 4631) which contains the pSClOl origin of replication and confers resistance to Spectinomycin (GenBank: AB236930). This PGR reaction was carried out using the Pfu Ultra enzyme (Agilent Technologies, Santa Clara, CA) with an initial denaturation step at 95°C for 2 min, followed by 16 cycles of the steps: 95°C for 30 sec; 55°C for 30 sec and 68°C for 7 min. This was followed by a final elongation step at 68°C for 7 min. The o utcome of the second PGR reaction was sequence-verified and the resulting plasmid was named pLS8379 (SEQ ID NO: 59).

Example 2

Construction of pCDXl 1

[Θ242] The PTRC promoter present in pLS8379 was replaced with a synthetic DNA fragment containing a PTRC variant where a symmetrical Lac operator (Sadler et al., 1983, PNAS. 80:6785-6789) was introduced upstream of the -35 region of PTRC- This promoter was synthesized as an EcoRV- Ncol DN A fragment (GeneScript,

Piscataway, NJ) having the sequence

GATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCG TTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTG CTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTG GTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTG GCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTAA TAATTTAAATTGGTTTGACAGCTTATCATCGACTGCACGGTGCACCAATGCTTCTGG CGTCAGGCAGCCATCGGAAGCTGTGGTATGGCTGTGCAGGTCGTAAATCACTGCATA ATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGGATAATGTTTTTTGCGCCGACATAA TTGTGAGCGCTCACAATTTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTA TAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCGCCGCTGAGA

ACCGGAATTATCGATTAACTTTATTATTAAAAATTAAAGGAGGAATAAACCATGG

( SEQ ID NO: 64) and used to replace the EcoRV-Ncol region from pLS8379 previously cut with the same restriction enzymes, A ligation reaction containing the two DNA fragments was incubated overnight at 16°C and then transformed into E. coll Top 10 electrocompetent cells (Invitrogen, Carlsbad, CA) following the manufacturer's protocols. Cells were plated on LB agar plates containing 100 micrograms/ml of Spectinomycin. Plates were incubated overnight at 37°C. Obtained clones were sequence verified.

Example 3

Construction of pCDXl 1-7076 plasmid

[0243] The plasmid pCDXl 1 -FAR comprising the FAR-V2 polynucleotide of SEQ ID NO:5 encoding the FAR-V2 enzyme having the amino acid sequence of SEQ ID NO: 6 is designated pCDXl 1-7076 and was constructed as described below. A DNA fragment containing the FAR-V2 gene was PGR amplified using the primers:

7076_NcoI_F 5' TAAACCATGGCGACTCAACAACAGAACA (SEQ ID NO: 33) and

7076 _... Sail R 5 ' CTATGTCGACTTAGGCGGTTTTATCGTCAGTATCA (SEQ ID NO: 34).

[0244] The restriction enzyme sites Ncol and Sail were incorporated into

7076 Ncol F and 7076 Sail R respectively, allowing ligation into pCDXl 1 digested with Ncol and Sail. Ligation reactions were incubated overnight at 16 C and then transformed into E. coll ΤΌΡ10 chemically competent cells (Invitrogen, Carlsbad, CA) using standard techniques. Cells were plated on LB agar plates containing 100 ug/ml of Spectinomycin and incubated overnight at 37 C. Obtained clones were sequence verified. The cycling conditions and reactions were applied according to the manufacturers' instructions.

Example 4

Construction of pCDXl 1 -7076-FabH plasmid [0245] Two different plasmids were assembled comprising the polynucleotides encoding FAR-V2 and FabH; pCDXl 1-7076-rbsH-FabH and pCDX l 1-7076-rbsA - FabH. The plasmid pCDXl 1-7076 was digested with enzymes Sail and Pmel (New England BioLabs, Ipswich, MA) following manufacturer recommendations and a synthetic linker containing a multicloning site ("MCS") was ligated into this vector to facilitate further cloning. pCLlinker_F 5' TCGACATAGATCTAGAACTTACTCGGAAGCTTCTTA ATTAAGAGGATCCATTGACGTCTATGAATTCGTTT-3' (SEQ ID NO: 35) and

pCLlinkerJR 5 ' AAACGAATTCATAGACGTCAATGGATCCTCTT

AATTAAGAAGCTTCCGAGTAAGTTCTAGATCTATG-3 '(SEQ ID NO: 36). After ligation the obtained plasmid pCDXl 1-7076 was sequence verified.

[Θ246] The E, coli fabH. gene was PGR. amplified from genomic DNA isolated from E. coli strain W31 10 using primers Sail-rbsH-fabH F and BamHI-fabH R.

Sall-rbsH-fabH F 5 ' -AAAAGTCG AC AACCGA AAAGTGACTGAG

CGTAC ATGTATA CGA AGATTATTGGT ACTGGC-3 ' (SEQ ID NO: 37) and BamHI-fabH__R 5 ^, -AAAAGGATCCTTAGAAACGAACCAGCGCGG-3 ^' ' (SEQ ID NO: 38).

[0247] Primer Sall-rbsH-fabH F was designed to add the 23 base pair RBS region from the fabH gene ("rbsH") and primer BamHI-fabH_R was designed to replace the normal TAG stop codon of fabH with the TAA stop codon. Additionally, th.e E. coli fabH gene was PGR amplified from genomic DNA isolated from E. coli strain W3110 using primers Sall-rbsA-fabHJF and BamHI-fabH_R.

Sall-rbsA-fabHJF 5' A AAA GTCG ACATAA A AT A A GGC

TTACAGAGAACATGTATACGAA GATTATTGGT ACTGGC-3 ' (SEQ ID NO:39) and BamHI-fabH R

5'AAAAGGATCCTTAGAAACGAACCAGCGCGG-3 ' (SEQ ID NO: 40). [Θ248] Primer SalI-rbsA-fabH_F was designed to add the 23 base pair RBS region from the fab A gene ("rbsA") and primer BamHI-fabH R was designed to replace the normal TAG stop codon of fabH with the TAA stop codon. [0249] The PGR reactions were carried out using the enzyme Phusion (New England BioLabs, Ipswich, MA) with an initial denaturation step at 98°C for 30 sec, followed by 30 cycles of the steps: 98°C for 5 sec; 63°C for 20 sec and 72°C for 30 sec. This was followed by a final elongation step at 72°C for 5 min. After the PGR reaction, the PGR products were purified through a purification column and eluted with water,

[0250] Both PGR products (Sail-rbsH-fabH-BamHI and Sall-rbsA-fabH-BamHI) and the plasmid (pCDXl I -7076) were digested with the restriction enzymes Sail and BamHI (New England BioLabs, Ipswich, MA) following manufacturer

recommendations. The plasmid and inserts were ligated using Quick Ligase (New England BioLabs, Ipswich, MA) following manufacturer recommendations and the resulting products were transformed into E. coli TOP 10 electrocompetent cells (Invitrogen, Carlsbad, CA) using standard techniques. Cells were plated on LB agar plates containing 100 ug/ml of Speetmomyein and incubated overnight at 37 C, Obtained clones were sequence verified.

Example 5

Construction of pCK900-FadD-TE plasmid

[0251] The plasmid pCK900-FadD-TE comprising a polynucleotide (SEQ ID NO: 1 1) encoding an acyl-ACP thioesterase from Umbellularia californica having the amino acid sequence of SEQ ID NO: 12 and a polynucleotide (SEQ ID NO: 15) encoding a FadD enzyme having the amino acid sequence of SEQ ID NO: 16 was constructed by cloning fadD and TE into pCKl 10900-i-bla plasmid (denoted pCK900-I. The native E. coli fadD gene (SEQ ID NO: 15) was PCR amplified using the primers:

0 C221 ladD Sil l Y TAGAGGCCAGCCTGGCCATAAGGAGATATACA TATGA A GA AG GTTTGGCTT AA CCGTTAT (SEQ ID NO: 41) and oKC222 fadD_BTEl_R

CGGTTTTGGTTTCCACTCTAACATGGTTTATTCCTCCTTTCATTAGGCTT

TATTGTCCACTTTG (SEQ ID NO: 42). [0252] The polynucleotide sequence of TE (SEQ ID NO: 1 1) was synthesized by GenScriptfPiscataway, NJ) and the synthesized gene was PGR amplified using the primers:

OKC223 fadD TE 1 F CAAAGTGGACA ATAAAGCCTAATGAAA

GGAGG AATAAACCATGTTAGAGTGGAAACCAAAACCG (SEQ ID NO: 43) and oKC224

TE_SfiI_R TGGTGGCCAGTTTGGCCTTATACCCGCGGCTCGGCCGG AAT (SEQ ID NO:44).

[0253] Sill restriction sites were incorporated into the design of oKC221 and OKC224. Primers oKC222 and oKC223 provided a region of overlap between the two PGR products that allowed for their combination into a single larger product housing both genes in a subsequent PGR reaction. The final PGR product and pCK900-I were digested with Sfil restriction enzyme (New England Biolabs, Ipswich, MA) and ligated together using T4 DNA Ligase (New England Biolabs) followed by transformation into E. coli TOPIC) chemically competent cells (Life Technologies, Carlsbad, CA) following the manufacturer's instructions. Tranformants were selected on LB agar plates supplemented with l OOug/ml spectinomycin and incubated overnight at 37°C. Clones were sequence verified.

Example 6

Construction of pCDXl 1-8087 plasmid

[Θ254] The plasmid pCDXl 1-FAR comprising the FAR-V3 polynucleotide of SEQ ID NO:7 encoding the FAR-V3 enzyme having the amino acid sequence of SEQ ID NO:8 is designated pCDXl 1 -8087 and was constmcted as described below. A DNA fragment containing the FAR-V3 gene was PGR amplified using the primers:

8087_NcoI_F 5' - TAAACCATGGCGACTCAACAACAGAACA (SEQ ID NO: 45) and

8087 Sail R 5 ' - CTATGTCG ACTTAGGCGGTTTTATCGTC AGTATCA

(SEQ ID NO:46). [0255] The restriction enzyme sites Ncol and Sail were incorporated into

8087_NcoI_F and 8087_SalI_R respectively, allowing ligation into nC ^' DX i 1 (See, example 3) digested with Ncol and Sail, Ligation reactions were incubated overnight atl6 C and then transformed into E. coli TOP10 chemically competent cells

(Invitrogen, Carlsbad, CA) using standard techniques. Cells were plated on LB agar plates containing 100 ug ml of Spectinomycin and incubated overnight at 37 C.

Obtained clones were sequence verified. The cycling conditions and reactions were applied according to the manufacturers' instructions, unless otherwise specified.

Example 7

Construction of pCDXl 1-8087-rbsA-FabH plasmid

[0256] The plasmid pCDXl 1-8087-rbsA-FabH was constructed as described below. The FAR-V3 gene was amplified from pCDX 11-8087 using the primers 8379 Fwd and 8379_Rev:

8379_F 5 '- TGTGGA ATTGTGAGCGGATA-3 ' (SEQ ID NO: 47) and

8379_R 5'- CGCTTCTGCGTTCTGATTT-3 ' (SEQ ID NO: 48).

[0257] The PGR reactions were carried out using the enzyme Phusion (New

England BioLabs, Ipswich, MA) with an initial denaturaiion step at 98°C for 30 sec, followed by 30 cycles of the steps: 98°C for 5 sec; 63 °C for 20 sec and 72°C for 30 sec. This was followed by a final elongation step at 72°C for 5 min. After the PGR reaction, the PGR product was purified through a PGR purification column and eluted with water.

[0258] The F AR-8087 PCR product from above and the plasmid pCDX 1 1 -7076- rbsA-fabH were digested with the restriction enzymes Clal and Sail (New England BioLabs, Ipswich, MA) following manufacturer recommendations. The plasmid and inserts were ligated using Quick Ligase (Ne England BioLabs, Ipswich, MA) following manufacturer recommendations and the resulting products were

transformed into E. coli TOP 10 electrocompetent cells (Invitrogen, Carlsbad, CA) using standard techniques. Cells were plated on LB agar plates containing 100 ug/ml of Speciinomycin and incubated overnight at 37 C. Obtained clones were sequence verified.

Example 8

Construction of pCDX 1-8087-rbsA-FabH-D-G plasmid

[0259] The plasmid pCDXl 1-8087-rbsA-FabH-FabD-FabG was constructed as described below. The E. cottfabH-fabD-fabG operon was PGR amplified from genomic D A isolated from E. coli strain W31 10 with primers fabH-mid_F and BamHI-fabG_R: fabH-mid F: 5 ' -GTCGTCGGTTCCGATGTACT- 3 ' (SEQ ID NO: 49) and

BamHI-fabG_R: 5 ' -AAAAGGATCCTTAGACC ATGTACATCCCGCC -3 ' (SEQ ID NO: 50).

[0260] Primer BamHI-fabG_R. was designed to replace the normal TGA stop codon of fabG with the TAA stop codon.

[0261] The PGR reactions were carried out using the using the enzyme Phusion (New England BioLabs, Ipswich, MA) with an initial denaturation step at 98°C for 30 sec, followed by 30 cycles of the steps: 98°C for 5 sec; 63°C for 20 sec and 72°C for 30 sec. This was followed by a final elongation step at 72°C for 5 min. After the PGR reaction, the PGR product was purified through a PGR purification column and eluted with water.

[ 0262] The PGR product and the pCDX 11 -8087-rbs A-fabH plasmid were digested with the restriction enzymes Sapl and BamlTI (Ne England BioLabs, Ipswich, MA) following manufacturer recommendations. The plasmid and inserts were ligated using Quick Ligase (New England BioLabs, Ipswich, MA) following manufacturer recommendations and the resulting products were transformed into E. coli TOP10 electrocompetent cells (mvitrogen, Carlsbad, CA) using standard techniques. Cells were plated on LB agar plates containing 100 ug/ml of Speciinomycin and incubated overnight at 37 C. Obtained clones were sequence verified. Example 9

Construction of pCK-900-FabI-l-FabZ plasmid

[0263] Plasmid pC 900-FabI-l-FabZ was constructed as follows:

[0264] (a) To clone Fabl, the protein sequence of Fabl-l from Rhodobacter sphaeroides SB 103 (SEQ ID NO: 20) (GenBank: ADE86080) was utilized to design an E. coll codon-optimized gene (SEQ ID NO: 19). The gene was synthesized and cloned in pUC57 by GenScript (Piscataway, NJ). The gene was PGR amplified from plasmid pUC57-FabI-l, using Phusion polymerase, with primers containing a Sail site and RBS/spacing in front of a -1 : and a HindTTT site on the 3 ' end primer. Primers sequences:

Fabl- I F ACTAAGTCGACATAAGGAGATATACATATGACC (SEQ ID NO: 53) and

Fabl- 1 _R AGGTCAAGCTTATTAGTCTTTACG (SEQ ID NO: 54).

[0265] The PGR reaction was carried out using the enzyme Phusion (New England BioLabs, Ipswich, MA) with an initial denaturation step at 98°C for 10 sec, followed by 25 cycles of the steps: 98°C for 20 sec; 56°C for 20 sec and 72°C for 30 sec. This was followed by a final elongation step at 72°C for 5 min. After the PGR reaction, the product was purified through a PGR purification column and eiuted with water. The DNA was digested with the restriction enzymes Sail and HindTTT (New ^r England BioLabs, Ipswich, MA) following manufacturer recommendations.

[0266] (b) The E. coHfabZ gene (SEQ ID NO: 21) including its natural

RBS/spacing sequence was PGR amplified from genomic DNA isolated from is. coli strain W31 10, using primers:

FabZ-Fwd 5 ' -ACAGGAAGAGTATC ATGACTACTAAC-3 ' (SEQ ID NO: 51 )

FabZ-Rev 5'-TTAGGCCTCCCGGCTACGAGCAC-3 ' (SEQ ID NO: 52).

10267] The PGR reaction was carried out as described above in the previous section, except that 30 cycles were used for the amplification step. These primers were also used to replace the original TTG start and TGA stop codons present fabZ, with ATG and TAA codons respectively. [0268] The PGR product obtained was cloned using the TOPO kit from Invitrogen (Carlsbad, CA) following manufacturer instructions. Topo cloning reaction was transformed into commercial electrocompetent TOP 10 E. coli ceils and cells were plated on LB agar plates containing 100 micrograms/ml of Carbenicillin . Plates were incubated overnight at 37°C. The sequence otfabZ gene was verified.

[0269] (c) Construction of pCL5019: A gene (SEQ ID NO:3) encoding the FAR- VI polypeptide was ligated as Ncol-Sall fragments to pLS8379 digested with the same restriction enzymes. Ligation reactions were incubated overnight at 16°C and then transformed into E. coli DH10B-T1 electrocompetent cells (Invitrogen, Carlsbad, CA) following the manufacturer's protocols. Cells were plated on LB agar plates containing 100 μ§ ηι1 of Speciinomycin. Plates were incubated overnight at 370C. Obtained clones were sequence verified and the resulting plasmid was named pCL5019.

[0270] (d) Construction of pCL50191inker: pCL5019 plasmid was digested with restriction enzymes Sall-Pmel (New England BioLabs, Ipswich, MA) following manufacturer recommendations and a synthetic linker containing a multicloning site ί VIC ^' S ) was ligated into this vector to facilitate further cloning. pCLlinker_F TCGACATAGATCTAGAACTTACTCGGAAGCTTCTTAATTA

AGAGGATCCATTGACGTCTATGAATTCGTTT (SEQ ID NO: 35) and pCLlinker R AAACGAATTCATAGACGTCAATGGATCCTCTTAATTAA GAAGCTTCCGAGTAAGTTCTAGATCTATG (SEQ ID NO: 36).

[Θ271 ] After ligation, the obtained plasmid pCL5019Iinker was sequence verified.

[Θ272] (e) Construction of pCL5019-FabI-l-FabZ: The pCL50191inker was linearized by digestion with the Sail and Aatll restriction enzymes. (New England BioLabs, Ipswich, MA) following manufacturer recommendations. The fabl-l gene was amplified from plasmid pUC57-Fabl-l, using Phusion polymerase, with primers containing a Sail site and a Hindlll site on the 3 ' end primer. Primers sequences:

Fabl-1__ F ACTAAGTCGACATAAGGAGATATACATATGACC (SEQ ID NO: 53) and

5019-FabI-l_R AGGTCAAGCTTATTAGTCTTTACG (SEQ ID NO: 54). [0273] The PGR reaction was carried out using the enzyme Phusion ( ew England BioLabs, Ipswich, MA) with an initial denaruration step at 98°C for 10 sec, followed by 25 cycles of the steps: 98°C for 20 sec: 56°C for 20 sec and 72°C for 30 sec. This was followed by a final elongation step at 72°C for 5 min. After the PGR reaction, the PGR. product was purified through a PGR purification column and eluted with water. This DNA was digested with the restriction enzymes Sail and Hindlll (New England BioLabs, Ipswich, MA) following manufacturer recommendations. ThefabZ gene was PGR amplified from ΎΟΐΌ-fahZ piasmid described above section (b), with primers containing Hindlll site on 5 'end primer and Aatll site on 3 'end primer.

FabZ F AGTAAGCTTGAGTTTAGGAAGAGTATCATG (SEQ ID NO: 55) and

FabZ_R AAGCTGACGTCTTAGGCCTCCCGGCTACG (SEQ ID NO: 56).

[Θ274] The resulting PGR product was purified through a PGR purification column; eluted with water. The DN was digested with the restriction enzymes Hindlll and Aatll (New England BioLabs, Ipswich, MA) following manufacturer

recommendations.

[0275] The final piasmid pCL50I9-FabI-l -fabZ was obtained by a three way ligation between FabI-1/SalI-HindIII, FabZ/Hindlll- Aatll fragments and

pCL50191inker vector digested with Sall-AatIL Ligation reaction was performed overnight at 16°C.

[Θ276] (f) Construction of pCK900-FabI-l-FabZ: FabI-l_fabZ genes were PGR. amplified from pCL-5019-fabI-l -fabZ piasmid described above (e) with the following primers:

488 5'- GATACGACCCGTAAACTTGCAACCATTTTTGGC -3' (SEQ ID NO: 57) and

8379_R 5'- CGCTTCTGCGTTCTG ATTT-3 ' (SEQ ID NO: 58).

[0277] The PGR reaction was carried out using the enzyme Phusion (New England BioLabs, Ipswich, MA) with an initial denaruration step at 98°C for 30 sec, followed by 25 cycles of the steps: 98°C for 10 sec; 56°C for 20 sec and 72°C for 40 sec. This was followed by a final elongation step at 72°C for 5 min. Obtained PGR product was purified using PGR clean-up Gel extraction Kit (Macherey-Nagel Inc.), digested with Ndel and EcoRI enzymes, gel purified and ligated with pCK900-BlaI vector digested with the same restriction endonucleases. The ligation reaction was incubated ON at 16°C and then transformed into E.coii DH10B-T1 strain, l ml of SOC (Super Optimal Media with Catabolite Repression) media was added to transformed cells and cells were left to recover for Ih at 37°C with shaking at 250 rpm. Cells were plated on LB agar/with 30 microgram ml ^"1 of chloramphenicol Petri dish plates incubated overnight at 37°C. The presence of the insert was verified by colony PGR with GoTag GreenMix (Promega) and the obtained clone was sequence verified.

Example 10

Generating W3110 fhuA strain harboring plasmids

[0278] Eiectrocompetent cells otE. coii W31 10 AfhuA were prepared as follows. The culture was grown in LB media to an ODeoo of -0.6 and concentrated 100-fold by centrifugation. The cells were washed three times with ice-cold sterile water, and then washed once with ice-cold 10% glycerol. The various plasmids as described above were introduced into the eiectrocompetent E. coii W31 10 AfhuA using standard methods (Dower et al, 1988 NAR 16:6127 -6145).

Example 11

Fatty Alcohol Production

[0279] Recombinant E. coii host strains comprising a plasmid including heterologous genes as specified above were grown in M9 (Sambrook et al., (2,001) Molecular Cloning: A Laboratory Manual 3 ^rd Ed Cold Spring Harbor, NY) medium supplemented with 1 % glucose, 2g/l yeast extract and the specified antibiotic selection, for approximately 16-18 hours (overnight) at 30°C., 200 rpm. A 5% inoculum was used to initiate fresh M9 media, 5% glucose and 2g/l yeast extract containing spectinimycin at 100 micgrograms ml ^"1 when the pCDXl 1 vector was used and chloramphoenicol at 30 micrograms mi ^"1 when pCK900-I-bla was used. The culture was incubated in a shaker for 2.5 hours at 30°C and at 250 rpm to an ODeoo of about 0.6 to about 0.8. The expression of the heterologous FAR was then induced with isopropyl-p-D-thiogalactoside (IPTG) (1 mM final concentration). Incubation was continued for about 48 hours under the same conditions. Fatty acid species including fatty alcohols were extracted using I ml_ of methyl isobutyl ketone (MIBK) into 500μ3 of cell culture, sealed tightly and shaken for >2.5h. The extract was centrifuged and analyzed directly by GC-FID, A 1 μΐ, sample was analyzed by GC- FTD with the split ratio 1 : 10 using the following conditions: GC-6890N from Agilent Technologies equipped with FID detector and HP-5 column (length 30 m, I.D. 0.32 mm, film 0.25 μηι). GC method: start at 100°C, with an increase in temperature at a rate of 25°C/mm to 246°C which was held for 1.96 min. Total mn time was 7.8 min. Under the above GC conditions, the approximate retention times (min) of produced fatty alcohols and acids were as follows: 1.81 , C 10:0-OH; 2.47, C12:0-OH; 5.08, C14:0-OH; 5.40, C14:0-OOH; 5.74, CI 6: 1 -OH; 5.93, C16:0-OH; 6.11, C16:0-OOMe (internal standard); 6.16, C16: l-OOH; 6.29, C16:0-OOH; 6.80, C18: l-OH; 6.90, C18:0-OH; and 7.3, C18:0- and C 18: l-OOH. Results of fatty alcohol production under these conditions are depicted in Tables 2 - 5. Identification of individual fatty alcohols was determined by comparison to commercial standards (Sigma Chemical Company, 6050 Spruce St. Louis, Mo. 63103). ("Sat." = "saturation".)

Table 2: Fatty Alcohol (FOH) Production in a W31 10 AfhuA Strain

pCDXl 1-7076 -rbsH- 69 40 32 23 ++ FabH

pCK900-FadD-TE

pCDXl l -7076-rbsA- 81 59 32 10 {) +

FabH

pCK900-FadD-TE

% as measured by calculating the individual fatty alcohols as part of the sum of all fatty alcohol measured.

All values are rounded to the closest unit.

CX (wherein X = 12, 14, 16 or 18) denotes both saturated and unsaturated species. Total FOH g/L wherein + is < 1.0; ++ is 1.0 to < 3.0 and +-H- is 3.0 or greater.

Table 3 : Fatty Alcohol (FOH) Production in a W3110K /¾wA::FRT Strain

% as measured by calculating the individual fatty alcohols a s part of the sum of ail fatty alcohol measured.

CX (wherein X= 12, 14, 16, or 18) denotes both saturated and unsaturated species. All values are rounded to the closest unit.

Total FOH g/L wherein + is < 1.0; ++ is 1.0 to < 3.0 and -H-+ is 3.0 or greater. Table 4: Fatty Alcohol (FOH) Production in a W31 10 AfhuA strain

% as measured by calculating the individual fatty alcohols as part of the sum of all fatty alcohol measured.

% C 18-OH measured approximately 0 in all cases.

CX (wherein X^ 12, 14 or 16) denotes saturated and unsaturated species.

All values are rounded to the closest unit.

Total FOH g L wherein + is < 1.0; ++ is 1.0 to < 3.0 and +++ is 3.0 or greater.

Table 5: Fatty Alcohol (FOH) Production in a W31 10K Strain

of all fatty alcohol measured.

CX (wherein X= 12, 14, 16 or 18 denotes saturated and unsaturated species. All values are rounded to the closest unit.

Total FOH g/L wherein + is < 1.0; +÷ is 1.0 to < 3.0 and +÷+ is 3.0 or greater.

[0280] All publications, patents, patent applications and other documents cited in this application are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent, patent application or other document were individually indicated to be incorporated by reference for all purposes.

[0281] While various specific embodiments have been illustrated and described, it will be appreciated that various changes can be made without departing from the spirit and scope of the invention(s).