Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
PRODUCTION OF MICROBIAL OILS WITH AN ELEVATED OLEIC ACID CONTENT
Document Type and Number:
WIPO Patent Application WO/2016/185073
Kind Code:
A1
Abstract:
The present invention refers to the production of oleic acid through the cultivation of a micro-organism of the species Rhodosporidium toruloides, by inserting a gene that encodes an enzyme with delta-9 desaturase activity and/or a gene that encodes an enzyme with C16 3-ketoacyl-CoA synthase activity to produce oleic acid in the presence of different carbon sources.

Inventors:
FILLET, Sandy Christiane (NEOL BIOSOLUTIONS, S.A.PTS Granada,Avda. de la Innovación nº, Edificio BIC Granada, E-18016, ES)
SUÁREZ GONZÁLEZ, Beatriz (NEOL BIOSOLUTIONS, S.A.PTS Granada,Avda. de la Innovación nº, Edificio BIC Granada, E-18016, ES)
RONCHEL BARRENO, Mª del Carmen (NEOL BIOSOLUTIONS, S.A.PTS Granada,Avda. de la Innovación nº, Edificio BIC Granada, E-18016, ES)
VELASCO ÁLVAREZ, Javier (NEOL BIOSOLUTIONS, S.A.PTS Granada,Avda. de la Innovación nº, Edificio BIC Granada, E-18016, ES)
ADRIO FONDEVILA, José Luis (NEOL BIOSOLUTIONS, S.A.PTS Granada,Avda. de la Innovación nº, Edificio BIC Granada, E-18016, ES)
Application Number:
ES2016/070373
Publication Date:
November 24, 2016
Filing Date:
May 18, 2016
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
NEOL BIOSOLUTIONS, S.A. (Parque Tecnológico Ciencias de la Salud, Avenida de la Innovación, Edif. BIC Granada, E-18100, ES)
International Classes:
C12N9/02; C12N1/19; C12N9/10; C12P7/64
Domestic Patent References:
WO2014198988A12014-12-18
WO2012040175A12012-03-29
WO2013002910A12013-01-03
WO2013184255A12013-12-12
WO2013163071A12013-10-31
WO2014164597A12014-10-09
Foreign References:
US20080153141A12008-06-26
US20120052537A12012-03-01
US20110059204A12011-03-10
US6316649B12001-11-13
US8372301B22013-02-12
US8357634B22013-01-22
US8575081B22013-11-05
US8410033B22013-04-02
EP2406357A22012-01-18
US5063154A1991-11-05
ES2526617A12015-01-13
US8357643B22013-01-22
Other References:
YANBIN LIU ET AL: "Characterization of glyceraldehyde-3-phosphate dehydrogenase gene RtGPD1 and development of genetic transformation method by dominant selection in oleaginous yeast Rhodosporidium toruloides", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 97, no. 2, 22 June 2012 (2012-06-22), pages 719 - 729, XP055120693, ISSN: 0175-7598, DOI: 10.1007/s00253-012-4223-9
N. MORIN ET AL: "Draft Genome Sequence of Rhodosporidium toruloides CECT1137, an Oleaginous Yeast of Biotechnological Interest", GENOME ANNOUNCEMENTS, vol. 2, no. 4, 10 July 2014 (2014-07-10), pages e00641 - 14, XP055179727, DOI: 10.1128/genomeA.00641-14
CHONG MEI JOHN KOH ET AL: "Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides", BMC MICROBIOLOGY, BIOMED CENTRAL LTD, GB, vol. 14, no. 1, 27 February 2014 (2014-02-27), pages 50, XP021179888, ISSN: 1471-2180, DOI: 10.1186/1471-2180-14-50
HORNER, D., J SYNTH LUBR, vol. 18, 2002, pages 327 - 347
ERHAM, INDUST CROPS PRODUCTS, vol. 24, 2006, pages 292 - 299
SCHNEIDER, M, J SCI FOOD AGRI, vol. 86, 2006, pages 1769 - 1780
SCHNEIDER, M., J SCI FOOD AGRI, vol. 86, 2006, pages 1769 - 1780
VIJAYENDRAN, B., INDUST BIOTECHNOL, vol. 10, 2014, pages 64 - 68
CASTRO, JAOCS, vol. 83, 2006, pages 47 - 52
CARLSSON, EUR J LIPID SCI TECHNOL, vol. 113, 2011, pages 812 - 831
RATLEDGE; WYNN, AVD APPL MICROBIOL, vol. 51, 2002, pages 1 - 51
RATLEDGE, BIOCHEMIE, vol. 86, 2004, pages 807 - 815
SAMBROOK: "Molecular cloning: a Laboratory Manual, 3rd ed.", vol. 1-3, 2001, COLD SPRING HARBOR LABORATORY PRESS
ALTSCHUL S.F. ET AL.: "Basic Local Alignment Search Tool", J MOL BIOL., vol. 215, no. 3, 5 October 1990 (1990-10-05), pages 403 - 10, XP002949123, DOI: doi:10.1006/jmbi.1990.9999
Attorney, Agent or Firm:
ARIAS SANZ, Juan (ABG Patentes, S.L.Avenida de Burgos, 16, Edificio Euromor Madrid, E-28036, ES)
Download PDF:
Claims:
REIVINDICACIONES

1. Un microorganismo de la especie Rhodosporidium toruloides modificado genéticamente con al menos un gen seleccionado de un grupo que consiste en: un gen que codifica una enzima con actividad delta-9-desaturasa y un gen que codifica una enzima con actividad Ci6 3-cetoacil-CoA sintasa.

2. Un microorganismo según la reivindicación 1 en donde dicho gen se expresa bajo control de un promotor constitutivo. 3. Un microorganismo según las reivindicaciones 1 o 2, en donde dicha enzima con actividad delta-9-desaturasa comprende la secuencia SEQ ID NO: 1 o una variante funcionalmente equivalente de la misma y/o en donde dicha enzima con actividad Ci6 3-cetoacil-CoA sintasa comprende la secuencia en SEQ ID NO: 2, o una variante funcionalmente equivalente de las misma.

4. Un microorganismo según las reivindicaciones 1 a 3 en donde el microorganismo de la especie Rhodosporidium toruloides en el que se ha introducido el gen que codifica una enzima con actividad delta-9-desaturasa y/o un gen que codifica una enzima con actividad Ci6 3-cetoacil-CoA sintasa pertenece a la cepa R. toruloides CECT 13085.

5. Un microorganismo según las reivindicaciones 1 a 4, en donde, el gen FAD2 no es funcional. 6. Un microorganismo según la reivindicación 5, en donde el gen KU70 y/o el gen KU80 no es funcional.

7. Un procedimiento para obtener una biomasa microbiana enriquecida en aceite rico en ácido oleico que comprende: i) cultivar un microorganismo según cualquiera de las reivindicaciones 1 a 6 en un medio de cultivo que comprende al menos una fuente de carbono y al menos una fuente de nitrógeno en condiciones adecuadas para el crecimiento de dicho microorganismo; y

ii) separar la biomasa microbiana del caldo de cultivo.

8. Procedimiento según la reivindicación 7, en donde la fuente de carbono se selecciona del grupo que consiste en glucosa, sacarosa, glicerol, melazas, xilosa, arabinosa, mañosa, fructosa, acetato y combinaciones de las mismas. 9. Procedimiento según la reivindicación 7, en donde la fuente de carbono es un hidrolizado de biomasa lignocelulósica.

10. Procedimiento, según la reivindicación 9, en donde el hidrolizado se obtiene de paja de trigo, bagazo de caña de azúcar, bagazo de maíz, racimos vacíos de palma aceitera, poda de palma aceitera, fibra de palma aceitera, poda de vid, poda de olivo y combinaciones de las mismas.

1 1. Procedimiento según la reivindicación 8, en donde la fuente de carbono es glucosa.

12. Procedimiento según la reivindicación 8, en donde la fuente de carbono es xilosa.

13. Procedimiento según cualquiera de las reivindicaciones 7 a 12, en donde la fuente de nitrógeno se selecciona del grupo que consiste en extracto de levadura, peptona, líquido macerado de maíz, urea, glutamato sódico, fuentes de nitrógeno inorgánico y combinaciones de las mismas.

14. Procedimiento según la reivindicación 13, en donde la fuente de nitrógeno es una sal de amonio, preferiblemente cloruro de amonio.

15. Procedimiento según cualquiera de las reivindicaciones 7 a 14, en donde el medio de cultivo contiene inhibidores sólidos seleccionados de: ácido acético, ácido fórmico, ácido levulínico, ácido cumárico, ácido ferúlico, ácido succínico, 4-hidroxibenzaldehído, vanillina, ácido vaníllico, siringaldehido, ácido 4- hidroxibenzoico, catecol, guaiacol, ácido siríngico, furfural, 5-hidroximetilfurfural y combinaciones de los mismos.

16. Procedimiento según cualquiera de las reivindicaciones 7 a 15, en donde las condiciones adecuadas para el crecimiento de dicho microorganismo de la etapa (i) comprenden

temperatura en un rango entre 18 °C y 37 °C,

- concentración de oxígeno disuelto de al menos el 20%, y/o

agitación constante.

17. Procedimiento según cualquiera de las reivindicaciones 7 a 16 en donde la etapa (ii) se realiza mediante un método seleccionado del grupo que consiste en filtración, microfiltración, centrifugación y combinaciones de los mismos.

18. Procedimiento según cualquiera de las reivindicaciones 7 a 17, que comprende además secar la biomasa microbiana de la etapa (ii). 19. Procedimiento según la reivindicación 7 en donde dicho ácido oleico representa, al menos, un 70% (p/p) con respecto al total de ácidos grasos de dicho microorganismo.

20. Biomasa microbiana enriquecida en aceite rico en ácido oleico obtenible según el procedimiento de cualquiera de las reivindicaciones 7 a 19.

21. Procedimiento para obtener una preparación enriquecida en aceite rico en ácido oleico que comprende: i) cultivar un microorganismo según cualquiera de las reivindicaciones 1 a

6 en un medio de cultivo que comprende al menos una fuente de carbono y al menos una fuente de nitrógeno en condiciones adecuadas para el crecimiento de dicho microorganismo;

ii) separar la biomasa microbiana del caldo de cultivo; y

iii) extraer el aceite rico en ácido oleico de la biomasa microbiana obtenida en la etapa (ii).

22. Procedimiento según la reivindicación 21 , en donde la extracción de la etapa (iii) se lleva cabo mediante métodos mecánicos, mediante un método de extracción sólido-líquido, o combinaciones de los mismos.

23. Procedimiento según la reivindicación 22, en donde el método de extracción mecánica se realiza usando prensa de tornillo, prensa francesa o molino de bolas.

24. Procedimiento según la reivindicación 22, en donde el método de extracción sólido-líquido se realiza usando un disolvente orgánico inmiscible en agua.

25. Procedimiento según la reivindicación 24, en donde dicho disolvente orgánico inmiscible en agua se selecciona del grupo que consiste en n-hexano, acetato de etilo, éter de petróleo, éter-etílico y combinaciones de los mismos.

26. Procedimiento según cualquiera de las reivindicaciones 21 a 25, que comprende además secar la biomasa microbiana de la etapa (ii).

27. Procedimiento para obtener biolubricantes que comprende: i) obtener una preparación enriquecida en aceite rico en ácido oleico, en donde dicha obtención se lleva a cabo mediante el procedimiento según la reivindicación 21 ;

ii) retinar el aceite rico en ácido oleico obtenido en la etapa i)

iii) convertir el aceite rico en ácido oleico obtenido en la etapa (ii) en biolubricantes.

28. Uso del microorganismo según las reivindicaciones 1 a 6 para obtener una biomasa enriquecida en aceite rico en ácido oleico, para obtener una preparación enriquecida en aceite rico en ácido oleico, o para obtener biolubricantes.

Description:
PRODUCCIÓN DE ACEITES MICROBIANOS CON ALTO CONTENIDO EN ACIDO

OLEICO

DESCRIPCIÓN

CAMPO DE LA INVENCIÓN

La presente invención se refiere a la producción de aceites microbianos con un alto contenido en ácido oleico mediante el cultivo de un microorganismo en presencia de diferentes fuentes de carbono.

ANTECEDENTES DE LA INVENCIÓN

Durante las últimas dos décadas ha surgido un interés renovado por el uso de lubricantes basados en aceites vegetales debido al incremento de las preocupaciones medioambientales y de las normas regulatorias. Un estudio estima que el 50% de todos los lubricantes vendidos a nivel global acaban en el medio ambiente debido a pérdidas durante su uso, vertidos y volatilidad (Horner, D. 2002. J Synth Lubr, 18: 327- 347).

Sólo los aceites de motores, unos 16 millones de litros de aceite usado en todo el mundo, suponen uno de los retos más importantes. Algunos estudios han determinado que un 40% de estos aceites se pierden por uso, bien por pérdidas sobre las carreteras o porque se quema en la cámara de combustión. Estos aceites son, por definición, imposibles de recolectar.

El consumo global de lubricantes en el año 201 1 fue de 31 millones de toneladas con la proyección de alcanzar los 42 millones de toneladas en 2018, debido a una tasa de crecimiento anual compuesta del 2,5%. Aunque el consumo actual de biolubricantes es pequeño, aproximadamente un 1 % del mercado, su consumo está previsto que crezca a una tasa del 6,7% durante el periodo 2013-2018. Específicamente, se espera un gran crecimiento de los aceites base tipo éster para lubricantes verdes para el mercado de motores de automóviles, particularmente en Asia, donde existe mayor necesidad de mejorar las prestaciones, menos cambios frecuentes de aceite y preocupaciones medioambientales y regulaciones. Está ampliamente reconocido que los aceites vegetales tienen varias ventajas inherentes con respecto a los aceites derivados del petróleo como materias primas para la formulación de lubricantes. Los aceites vegetales tienen una excelente lubricidad debido a su funcionalidad polar, un alto índice de viscosidad y altos puntos de ignición (flash point). Además, estos aceites son biodegradables por lo que no tienen impacto negativo sobre el medio ambiente. Sin embargo, los aceites vegetales tienen limitaciones importantes para su uso como lubricantes en un amplio rango de aplicaciones debido a su baja estabilidad térmica y oxidativa (Erham y col. 2006. Indust Crops Products, 24: 292-299). Con el objetivo de solventar estas deficiencias se realizan varias estrategias, que incluyen el uso de diferentes aditivos, aunque éstas no logran en muchos casos alcanzar las propiedades requeridas. Por ello, gran parte del trabajo se ha centrado en realizar modificaciones químicas de la estructura y composición de los ácidos grasos (Schneider, M. 2006. J Sci Food Agri, 86: 1769- 1780).

Muchos de estos procesos químicos se basan en la eliminación de los sitios de insaturación a través de su funcionalización. Modificaciones químicas de derivados del ácido oleico incluyen alquilación, adición de radicales, acilación, aminoalquilación, co- oligomerización, hidroformilación y aciloxilación (Schneider, M. 2006. J Sci Food Agri, 86: 1769-1780; Vijayendran, B. 2014. Indust Biotechnol, 10: 64-68).

Los documentos US6316649, US8372301 , WO2012040175 y WO2013002910 describen la formación de estólidos mediante la unión química de diferentes tipos de ácidos grasos insaturados. Estos estólidos pueden ser posteriormente esterificados con alcoholes de cadena larga para producir ésteres ramificados tal y como, por ejemplo, se detalla en el documento WO2013184255. Estos ésteres tienen excelentes propiedades que rivalizan con los aceites de base mineral que se utilizan como base en la formulación de aceites de motor. Otra estrategia es el uso de aceites vegetales epoxidados como materia prima para para la producción de mono/di-ésteres con excelente lubricidad, flujo en frío y alto índice de viscosidad (US 8357634, US 8575081 y US8410033).

El ataque a los sitios de insaturación es otra de las estrategias para modificar los aceites vegetales y producir aceites base para lubricantes. La reacción de metátesis olefínica desarrollada por Elevance (WO2013163071 , W02014164597) ha sido aplicada con éxito para la obtención de moléculas base, a partir de aceites vegetales, con una determinada estructura, peso y ramificaciones. La reciente disponibilidad de aceites de soja, girasol, cártamo y colza con un alto contenido en ácido oleico han supuesto un nuevo campo de trabajo para estos desarrollos. Estos aceites han sido reconocidos como materias primas muy atractivas para el desarrollo de biolubricantes, fluidos hidráulicos y aceites para transformadores eléctricos debido a su excelente estabilidad térmica y oxidativa (Castro y col. 2006. JAOCS, 83: 47-52; Ing, A. 2009. Proceedings of the 53rd Annual Meeting of the ISSS; EP2406357). Por este motivo, durante los últimos años el desarrollo de líneas de cultivos de soja con un aceite con un alto contenido en ácido oleico (>75% de los ácidos grasos totales) ha sido el objetivo de compañías como Monsanto (Vistive Gold™) o Dupont/Pioneer (Plenish™). Otro reciente avance es el logrado por la Agencia Nacional de la Ciencia de Australia (CSIRO) la cual ha recibido la aprobación para realizar sus primeros ensayos de campo con cárcamo capaz de producir aceite con un muy alto contenido en ácido oleico (>90% del total de los ácidos grasos). Esta alta concentración de oleico se logró mediante la puesta a punto de una tecnología de silenciamiento de genes mediante ARN de interferencia que impide la formación de ácido linolénico. Sin embargo, en todos estos casos, se trata todavía de ensayos con producciones muy bajas.

La producción mundial de aceites vegetales en el año 2011 alcanzó los 146 millones de toneladas. La mayor parte de esta cantidad se reparte entre los aceites de palma (32%), soja (29%), colza (16%) y girasol (8%). Alrededor del 79% de estos aceites (115 MT/año) se utilizan para alimentación y el 21 % (31 MT/año) para aplicaciones industriales. Según estimaciones (Carlsson y col. 201 1. Eur J Lipid Sci Technol, 113: 812-831) en el año 2030 las necesidades globales de aceites se triplicarán (390 MT/año) debido al incremento de la población y al mayor consumo calórico (150 MT/año para alimentación humana) y, sobre todo, por el incremento en el uso de aceites para aplicaciones industriales (240 MT/año). Este incremento en producción no será posible con los cultivos oleaginosos actuales. Por ello, la producción de aceites y sus derivados (ácidos grasos, alcoholes grasos, metil ésteres, etc.) mediante microorganismos puede suponer una buena fuente alternativa para la futura obtención de estos productos a partir de materias primas sostenibles y renovables. La enzima delta-9 desaturasa (delta-9 FAD) en levaduras está localizada en la membrana reticular endoplásmica y usa ácidos grasos esterificados a Co-A como sustratos para producir ácidos grasos monoinsaturados. Los productos de esta proteína son los ácidos palmitoleico (C16:1) y oleico (C18:1) que se forman a partir del palmitil-CoA (C16:0) y estearil-CoA, respectivamente.

Los microorganismos oleaginosos que incluyen bacterias, levaduras, cianobacterias, microalgas y hongos filamentosos, se definen por su capacidad para acumular, al menos, un 20% de su peso seco en forma de lípidos (Ratledge y Wynn. 2002. Avd Appl Microbiol, 51 : 1-51 ; Ratledge. 2004. Biochemie, 86: 807-815). Esta característica hace que estos microorganismos se consideren como unos candidatos muy atractivos para ser utilizados como cepas hospedadoras para la producción de aceites o compuestos derivados de los mismos como ácidos o alcoholes grasos. Las bacterias oleaginosas han sido las menos estudiadas hasta la fecha debido a que su contenido en lípidos es relativamente más bajo que en levaduras, cianobacterias, microalgas y hongos filamentosos; y también están limitadas por sus bajas tasas de crecimiento. Las cianobacterias y microalgas oleaginosas son hospedadores atractivos para la producción de aceites y derivados de ácidos grasos principalmente por su capacidad fotosintética que les permite convertir la energía solar y reciclar el C0 2 . Sin embargo, ambos tipos son técnicamente difíciles de manipular y sus procesos de cultivo y de crecimiento son más complicados que los de bacterias, levaduras y hongos. Estas dificultades son las que han impedido su uso en la producción de compuestos derivados de ácidos grasos a través de ingeniería metabólica. De forma similar, la explotación de hongos filamentosos oleaginosos como organismos de producción también ha sido impedida por la falta de técnicas de transformación eficientes.

Existe por tanto una necesidad en el estado de la técnica de lograr un alto rendimiento, producción y productividad de aceites de origen microbiano con una composición específica, y lograr que estos procesos puedan llegar a ser competitivos con los utilizados hoy en día.

SUMARIO DE LA INVENCIÓN Los autores de la presente invención han modificado genéticamente un microorganismo de la cepa Rhodosporidium toruloides, mediante la inserción de genes propios o heterólogos que codifican una enzima con actividad delta-9 desaturasa, o una enzima con actividad Ci 6 3-cetoacil-CoA sintasa que permite producir aceites con un alto contenido en ácido oleico. La producción de aceite mediante el empleo de dicho microrganismo se sitúa por encima de 50 g/L y el contenido en ácido oleico es superior al 70% del total de los ácidos grasos presentes.

Por lo tanto, en un primer aspecto, la presente invención se relaciona con un microorganismo de la especie Rhodosporidium toruloides modificado genéticamente con al menos un gen seleccionado de un grupo que consiste en: un gen que codifica una enzima con actividad delta-9 desaturasa y un gen que codifica una enzima con actividad d 6 3-cetoacetil-CoA sintasa.

En otro aspecto, la presente invención se relaciona con un procedimiento para obtener una biomasa microbiana enriquecida en aceite rico en ácido oleico que comprende: i) cultivar el microorganismo de la invención en un medio de cultivo que comprende al menos una fuente de carbono y al menos una fuente de nitrógeno en condiciones adecuadas para el crecimiento de dicho microorganismo; y

ii) separar la biomasa microbiana del caldo de cultivo.

En otro aspecto, la invención se relaciona con una biomasa microbiana enriquecida en aceite rico en ácido oleico obtenida mediante el procedimiento para obtener una biomasa microbiana enriquecida en aceite rico en ácido oleico de la invención.

En otro aspecto, la presente invención se relaciona con un procedimiento para obtener una preparación enriquecida en aceite rico en ácido oleico que comprende: i) cultivar el microorganismo de la en un medio de cultivo que comprende al menos una fuente de carbono y al menos una fuente de nitrógeno en condiciones adecuadas para el crecimiento de dicho microorganismo; ii) separar la biomasa microbiana del caldo de cultivo; y

iii) extraer el aceite rico en ácido oleico de la biomasa microbiana obtenida en la etapa (ii). En otro aspecto, la presente invención se relaciona con un procedimiento para obtener biolubricantes que comprende: i) obtener una biomasa microbiana enriquecida en aceite rico en ácido oleico, en donde dicha obtención se lleva a cabo mediante el procedimiento según la presente invención

ii) retinar el aceite rico en ácido oleico obtenido en la etapa i)

iii) convertir el aceite rico en ácido oleico obtenido en la etapa (ii) en biolubricantes.

Finalmente, la invención se relaciona con el uso del microorganismo de la invención para obtener una biomasa microbiana enriquecida en aceite rico en ácido oleico. La presente invención también se relaciona con el uso del microorganismo de la invención para obtener una preparación enriquecida en aceite rico en ácido oleico. La presente invención también se relaciona con el uso del microorganismo de la invención para obtener biolubricantes.

BREVE DESCRIPCIÓN DE LAS FIGURAS

Figura 1 : casetes integrativos en Rhodosporidium toruloides

Figura 2: Incremento de ácido oleico en clones de Rhodosporidium toruloides conteniendo la elongasa 1 (EloI Rt).

Figura 3: Incremento de ácido oleico en clones de Rhodosporidium toruloides conteniendo la delta-9 desaturasa (A9Rt).

Figura 4: Incremento de ácido oleico en R. toruloides T124-347 conteniendo la elongasa 1 (EloI Rt) y la conteniendo la delta-9 desaturasa (A9Rt).

Figura 5: Incremento de ácido oleico en R. toruloides T194-1 16-1 conteniendo la elongasa 1 (EloI Rt) y una deleción de la delta-12 desaturasa (AFad2).

DESCRIPCIÓN DETALLADA DE LA INVENCIÓN En un primer aspecto, la presente invención se relaciona con un microorganismo, en adelante "microorganismo de la invención", de la especie Rhodosporidium toruloides modificado genéticamente con al menos un gen seleccionado de un grupo que consiste en: un gen que codifica una enzima con actividad delta-9 desaturasa y un gen que codifica una enzima con actividad Ci 6 3-cetoacil-CoA sintasa. El término "gen", tal y como se usa en el presente documento, se refiere a una cadena de desoxirribonucleótidos que codifica una proteína. En una realización particular de la invención, dicho término se refiere a una cadena de desoxirribonucleótidos que codifica una enzima con actividad delta-9 desaturasa. En otra realización particular de la invención, dicho término se refiere a una cadena de desoxirribonucleótidos que codifica una enzima con actividad d 6 3-cetoacil-CoA sintasa.

El término "enzima", en el contexto de la presente invención, se refiere a una proteína que funciona como un catalizador altamente selectivo, acelerando tanto la velocidad como la especificidad de la reacción metabólica para la cuál es específica.

En concreto, el microorganismo de la invención es un microorganismo modificado genéticamente. El término "microorganismo modificado genéticamente" como se usa en el presente documento, se refiere a un microorganismo cuyo material genético se ha alterado usando técnicas de ingeniería genética. Según esto, dicho microorganismo genéticamente modificado expresa una enzima que tiene una actividad actividad delta- 9 desaturasa y/o una actividad Ci 6 3-cetoacil-CoA sintasa, comparado con un microorganismo control no modificado correspondiente de la misma cepa. En el contexto de la presente invención, la enzima que tiene actividad delta-9 desaturasa puede estar codificada por un gen que codifica dicha enzima en R. toruloides o en otro organismo. Así mismo, en el contexto de la presente invención, la enzima que tiene actividad Ci 6 3-cetoacil CoA sintasa puede estar codificada por un gen que codifica dicha enzima en R. toruloides o en otro organismo.

Generalmente, el gen que codifica una enzima que tiene actividad delta-9 desaturasa o el gen que codifica una enzima que tiene actividad Ci 6 3-cetoacil-CoA sintasa se puede introducir en el microorganismo en cualquier forma adecuada, por ejemplo, comprendido en un vector, un plásmido o como ácido nucleico desnudo. Después de ser introducido en el microorganismo, el gen se puede expresar de modo exógeno si se expresa en un vector/plásmido en el microorganismo [es decir, fuera de del/de los cromosoma(s) microbiano(s)], o se puede incorporar en el/los cromosoma(s) microbiano(s) por recombinación aleatoria (ectópica) u homologa o cualquier otro método adecuado conocido en el estado de la técnica. Técnicas apropiadas que permiten la transformación genética en levaduras incluyen pero no están limitadas a: - Transformación de esferoplastos que supone eliminar la pared celular de la levadura y poner en contacto los esferoplastos con el plásmido en presencia de PEG.

- Transformación con Li + , que supone el tratamiento de las células de levadura con cationes alcalinos monovalentes (Na + , K + , Rb + , Cs + y Li + ) en combinación con PEG para estimular la captación de ADN por las células intactas.

Bombardeo génico que supone bombardear las células con microproyectiles recubiertos con el ADN exógeno.

Electroporación, que supone administrar pulsos eléctricos a las levaduras que produce la apertura de poros en la membrana de los esferoplastos y células de levadura intactas.

- Tranformación mediada por Agrobacterium tumefaciens (ATMT) se basa en el empleo de la capacidad de transferencia génica que A. tumefaciens posee de forma natural.

Los transformantes se hacen crecer en un medio nutriente adecuado y bajo condiciones de selección para asegurar la retención del ADN endógeno. La inserción del gen que codifica una acil-CoA reductasa en dichos transformantes puede determinarse mediante cualquier técnica de biología molecular apropiada para ello, por ejemplo, mediante Southern blot o PCR. Métodos convencionales de detección y cuantificación de la expresión de un gen pueden encontrarse, por ejemplo, en Sambrook y cois., 2001. "Molecular cloning: a Laboratory Manual", 3 rd ed., Cold Spring Harbor Laboratory Press, N.Y., Vol. 1-3.

El término "delta-9 desaturasa", "estearoil-CoA desaturasa", "estearoil-CoA 9 desaturasa", "acil-CoA desaturasa", o "desaturasa de ácidos grasos", tal y como se utiliza en el presente documento, se refiere a un polipéptidos que pertenece a la familia de enzimas E.C. 1.14.19.1 y que cataliza la introducción de un doble enlace en la posición delta-9 de la cadena de un ácido graso. En una realización particular, dicha enzima cataliza la introducción de un doble enlace en el ácido palmítico o esteárico dando lugar al ácido palmitoleico o al ácido oleico, respectivamente. En una realización preferida de la invención la enzima con actividad delta-9 desaturasa de la invención cataliza la introducción de un doble enlace en el ácido esteárico dando como producto final de la reacción ácido oleico. El término "C I B 3-cetoacil-coA sintasa", "acil-Coa elongasa", "beta-cetoacil CoA sintasa", "3-oxoacil CoA sintasa de cadena muy larga", o "elongasa de ácidos grasos" tal y como se utiliza en el presente documento, se refiere a un polipéptido que pertenece a la familia de enzimas E.C. 2.3.1.199 y que cataliza la adición de dos carbonos a un ácido graso de 16 carbonos en su extremo carboxilo. De esta forma, la enzima con actividad Ci 6 3-cetoacil-CoA sintasa de la invención es capaz de elongar en dos átomos de carbono un ácido graso de 16 carbonos, para dar lugar a un ácido graso de 18 carbonos.

Preferiblemente, el enzima con actividad Ci 6 3-cetoacil-CoA sintasa cataliza la reacción de elongación mencionada anteriormente empleando como único sustrato ácidos grasos de 16 carbono. En una realización particular y preferida de la invención, dicha enzima emplea como único sustrato el ácido ácido esteárico, es decir, tiene especificidad absoluta por dicho sustrato, obteniéndose ácido oleico como producto de la reacción de elongación. No obstante, enzimas con actividad Ci 6 3-cetoacil-CoA sintasa adecuadas para su uso en la presente invención incluyen también aquellas enzimas que poseen especificidad por más de un sustrato, en cuyo caso presentan una especificidad sustancialmente superior sobre ácidos grasos de 16 átomos de carbono que sobre átomos de carbono de mayor (por ejemplo, ácidos grasos de 18 átomos de carbono) o de menor longitud (por ejemplo, ácidos grasos de 14 átomos de carbono Así, enzimas con actividad Ci 6 3-cetoacil-CoA sintasa adecuadas para su uso en la presente invención incluyen aquellas que muestran una especificidad frente a ácidos grasos de 16 átomos de carbono que es de al menos 1 ,5 veces, al menos 3 veces, al menos 3 veces, al menos 4 veces, al menos 5 veces, al menos 6 veces, al menos 7 veces, al menos 8 veces, al menos 8 veces, al menos 9 veces, al menos 10 veces, al menos 20 veces, al menos 30 veces, al menos 40 veces, al menos 50 veces, al menos 60 veces, al menos 70 veces, al menos 80 veces, al menos 90 veces, al menos 100 veces o más con respecto a la especificidad frente a ácidos grasos de 18 átomos de carbono. Dicha definición también incluye enzimas que catalizan la adición de dos carbonos a un ácido graso de 16 carbonos en su extremo carboxilo con una especificidad mayor que la especificidad que presentan por un ácido graso de 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 17, 18, 19, 20 carbonos o más. El término "especificidad", tal y como se utiliza en el presente documento, hace referencia a la eficiencia con la que el enzima transforma un sustrato determinado en el producto de reacción. El término "especificidad mayor", tal y como se usa en el presente documento, se refiere a que la eficiencia con la que el enzima de la invención transforma un ácido graso de 16 carbonos, en particular el ácido esteárico, en el producto de reacción, es decir en un ácido graso de 18 carbonos, en particular en ácido oleico, es de al menos, de al menos 1 ,5 veces, al menos 3 veces, al menos 3 veces, al menos 4 veces, al menos 5 veces, al menos 6 veces, al menos 7 veces, al menos 8 veces, al menos 8 veces, al menos 9 veces, al menos 10 veces, al menos 20 veces, al menos 30 veces, al menos 40 veces, al menos 50 veces, al menos 60 veces, al menos 70 veces, al menos 80 veces, al menos 90 veces, al menos 100 veces o más, mayor que la especificidad de dicha enzima por un ácido graso cuya longitud no sea de 16 carbonos, en particular por un ácido graso de 18 carbonos, como por ejemplo, un ácido graso de 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 17, 18, 19, 20 carbonos o más. En una forma preferida de realización, se entiende que un enzima con actividad Ci 6 3-cetoacil-CoA sintasa es específica frente a un sustrato de 16 átomos de carbono su especificidad de sustrato es superior a la observada frente a un sustrato con número distinto de átomos de carbono y que presente al mismo número de insaturaciones que el sustrato de 16 átomos de carbono.

La especificidad de un enzima se puede determinar midiendo la constante de especificidad (Kcat/Km) El experto en la materia conoce que los sustratos preferidos para las enzimas son aquellos para los que los valores de Km son bajos y los valores de Kcat altos en comparación con sustratos por los que no muestra especificidad o por los que muestra una menor especificidad. La determinación de la especificidad del enzima con actividad Ci 6 3-cetoacil-CoA sintasa de la invención puede determinarse, por ejemplo cuantificando el número de moléculas de sustrato transformadas en producto por unidad de tiempo (Kcat) en presencia de distintos sustratos y dividiendo dicho valor por la concentración de cada uno de dichos sustratos a la cual la velocidad de reacción es la mitad de la velocidad máxima (Km). A modo ilustrativo, la especificidad del enzima con actividad Ci 6 3-cetoacil-CoA sintasa de la invención por un ácido graso de 16 carbonos frente a la especificidad de dicha enzima por un ácido graso de 18 carbonos puede determinarse comparando el ratio de la concentración del ácido graso de 18 carbonos/ la concentración del ácido graso de 16 carbonos a la cual a la cual la velocidad de reacción es la mitad de la velocidad máxima frente a el ratio de la concentración del ácido graso de 20 carbonos/ la concentración del ácido graso de 18 carbonos a la cual a la cual la velocidad de reacción es la mitad de la velocidad máxima. La concentración de un ácido graso puede determinarse mediante cualquier técnica conocida en el estado de la técnica apropiada para ello como técnicas espectrofotométicas o cromatográficas. El término "ácidos grasos", tal y como se utiliza en el presente documento, se refiere a biomoléculas de naturaleza lipídica formadas por una larga cadena hidrocarbonada lineal, de diferente longitud o número de átomos de carbono que presentan un grupo alquilo en un extremo y un grupo ácido en el otro extremo. Dicho término incluye ácidos grasos saturados y ácidos grasos insaturados. Los primeros no poseen dobles enlaces en la cadena hidrocarbonada que los conforma y son flexibles y sólidos a temperatura ambiente mientras que, los segundos poseen dobles o triples enlaces, son rígidos a nivel de estos enlaces y presentan una temperatura líquida o viscosa a temperatura ambiente. En este último grupo, además podemos diferenciar entre ácidos grasos monoinsaturados o MUFA (del inglés " monounsaturated fatty acid') y ácidos grasos polinsaturados o PUFA (del inglés "polyunsaturated fatty acid').

El término "ácido oleico" o "ácido cis-9-actadienoico", tal y como se utiliza en el presente documento, se refiere a un ácido graso monoinsaturado de la serie omega 9 típico de los aceites vegetales como aceite de oliva, de aguacate etc. y cuya fórmula empírica es Ci 8 H 34 02.

En una realización particular y preferida de la invención, el gen que codifica la enzima que tiene actividad delta-9 desaturasa y/o el gen que tiene actividad Ci 6 3-cetoacil- CoA sintasa es un gen de la especie R. toruloides. En otra realización particular de la invención, el gen que codifica la enzima que tiene actividad delta-9 desaturasa y/o el gen que tiene actividad Ci 6 3-cetoacil-CoA sintasa tiene codones optimizados para la expresión en el microorganismo recombinante, es decir en R. toruloides.

El término "codones optimizados", como se usa en el presente documento, se refiere a la alteración de codones en moléculas de ácidos nucleicos para reflejar el uso de codones típico del organismo huésped sin alterar el polipéptido codificado por el ADN, para mejorar la expresión. Los métodos y herramientas de software para la optimización de codones son bien conocidos en el estado de la técnica.

En la técnica se conocen codones que pueden ser empleados para la expresión de genes en R. toruloides. Ejemplos ilustrativos no limitativos de codones optimizados que pueden ser empleados para la expresión de genes en incluyen: UUU, UUC, UUA, UUG, CUU, CUC, CUA, AUU, AUC, AUG, GUU, GUC, GUA o GUG (Codon usage datábase, data source: NCBI-GenBank). En este contexto de la invención, el microorganismo genéticamente modificado se cultiva en las condiciones adecuadas que permitan la expresión del gen que tiene actividad y actividad delta-9 desaturasa y/o del gen que tiene actividad Ci 6 3-cetoacil-CoA sintasa de esta manera, producir ácido oleico. Los medios de cultivo adecuados para el crecimiento apropiado de diferentes microorganismos se conocen bien en la técnica. Normalmente dichos medios de cultivo comprenden fuentes de carbono, como, por ejemplo, glucosa, xilosa, sacarosa, glicerina, y fuentes de nitrógeno apropiadas como, por ejemplo, extracto de levadura, peptona, sales de amonio, líquido macerado de maíz, urea o glutamato sódico. Preferiblemente, dicho gen se introduce en un vector de expresión o construcción de ADN replicativa que permite la expresión del gen que codifica una enzima con actividad delta-9 desaturasa y/o la expresión del gen que codifica una enzima con actividad Ci 6 3-cetoacil-CoA sintasa según la presente invención y que incluye una unidad transcripcional que comprende el ensamblaje de (1) elemento(s) genético(s) que desempeña(n) un papel regulador en expresión génica, por ejemplo, promotores, operadores o potenciadores, operativamente unidos a (2) la secuencia del gen que codifica una enzima con actividad con actividad delta-9 desaturasa y/o a la secuencia del gen que codifica una enzima con actividad Ci 6 3-cetoacil-CoA sintasa según la invención y que se transcribe a ARN mensajero y se traduce a proteína y (3) secuencias adecuadas para iniciar y terminar la transcripción y la traducción. Los vectores que se pueden usar en el contexto de la presente invención normalmente incluyen un marcador genético, un origen de replicación en bacterias o levaduras, sitios múltiples de clonación y un marcador genético. El marcador genético es habitualmente un gen que confiere resistencia a un antibiótico, por ejemplo ampicilina o geneticina, o alternativamente, un marcador auxotrófico en el caso de levaduras. Tales elementos reguladores pueden incluir una secuencia operadora para controlar la transcripción. La capacidad de replicarse en un huésped, habitualmente conferida por un origen de replicación, y un gen de selección para facilitar el reconocimiento de transformantes se pueden incorporar adicionalmente. Las regiones de ADN están operativamente unidas cuando están funcionalmente relacionadas entre sí. Por ejemplo, el ADN para un péptido señal está operativamente unido al ADN para un polipéptido si se expresa como un precursor que participa en la secreción del polipéptido; un promotor está operativamente unido a una secuencia codificante si controla la transcripción de la secuencia; o un sitio de unión a ribosomas está operativamente unido a una secuencia codificante si está colocado de modo que permita la traducción. Las secuencias reguladoras útiles para la presente invención pueden ser secuencias promotoras nucleares o, de forma alternativa, secuencias potenciadoras y/o secuencias reguladoras que aumentan la expresión de la secuencia de nucleótidos, secuencias supresoras, sitios de inicio transcripcional, sitios de parada transcripcional, sitios de poliadenilación y similares. En la técnica se conocen un gran número de secuencias de control de la expresión y se pueden utilizar según la presente invención.

En el caso de células eucariotas, estas comprenden normalmente promotores que aseguran el inicio de la transcripción y opcionalmente señales de poli-A que aseguran la terminación de la transcripción y estabilización del transcrito. Promotores comúnmente usados son el promotor del virus del mosaico de la escrofularia, el promotor de poliubiquitina y el promotor de la actina para la expresión ubicua. El promotor puede ser constitutivo o inducible. Si se desea, la expresión constante del gen, entonces se usa un promotor constitutivo. Se usa un promotor "inducible" cuando se desea una expresión regulada del gen dependiendo de las condiciones fisiológicas o de desarrollo. Los promotores típicos para la expresión en células de levadura incluyen, pero no están limitados a:

Promotores constitutivos tales como, por ejemplo, el promotor de la alcohol deshidrogenasa (ADH1), el promotor del factor de elongación 1-a (TEF) y el promotor del gen que codifica la triosa fosfato isomerasa (TPI), el promotor de la gliceraldehído 3-fosfato deshidrogenasa (GPD) y el promotor de la 3- fosfoglicerato quinasa (GPK), el promotor de MRP7 y el promotor de la alcohol, oxidasa (AOX1).

Promotores inducibles tales como, por ejemplo, el promotor de la metalotioneína (CUP1), cuya expresión está regulada por medio de la adición de cobre al medio de cultivo, el promotor del gen que codifica el gen FUS1 o el gen FUS2, cuya expresión se activa en presencia de feromonas (al factor a) como se describe en el documento US5063154, el promotor TET, cuya expresión se regula en presencia de tetraciclinas, los promotores GAL1-10, GALL, GALS que se activan en presencia de galactosa, el promotor VP16-ER, inducible por estrógenos, y el promotor de fosfatasa (PH05) cuya expresión se activa en presencia de fosfato y el promotor de la proteína de choque térmico HSP150, cuya expresión se activa a alta temperatura. Promotores represibles tales como, por ejemplo, el promotor del gen de la enolasa (ENO-1) de S. cerevisiae, cuya expresión se puede reprimir cuando el microorganismo se cultiva en una fuente de carbono no fermentable, así como promotores cuya expresión está sometida a represión de glucosa de modo que la expresión se reprimirá cuando parte de la lactosa se haya hidrolizado y la concentración de glucosa en el medio empiece a aumentar, el promotor de la gliceraldehído-3-fosfato deshidrogenasa (ADH2/GAP) de R.toruloides, y el promotor de galactoquinasa (GAL1).

Preferiblemente, en esos casos en los que se sospecha que la proteína heteróloga es tóxica para la célula huésped, el promotor usado para regular su expresión es aconsejablemente un promotor inducible de modo que la expresión de la proteína de interés se pueda retrasar hasta que se hayan alcanzado suficientes niveles de biomasa. En una forma de realización preferida, el gen que codifica para las enzima con actividad delta-9 desaturasa y/o el gen que codifica para una enzima con actividad Cíe 3-cetoacil-CoA sintasa con capacidad para incrementar la concentración de ácido oleico de acuerdo a la presente invención, se expresa bajo el control de un promotor constitutivo. Al construir plásmidos de expresión adecuados, las secuencias de terminación asociadas con estos genes también se ligan en el vector de expresión 3' de la secuencia deseada que se va a expresar para proporcionar poliadenilación del ARNm y terminación. Otros promotores, que tienen la ventaja adicional de transcripción controlada por condiciones de crecimiento son la región promotora para alcohol deshidrogenasa-2, isocitocromo C, fosfatasa ácida, enzimas degradantes asociadas con el metabolismo del nitrógeno, y la anteriormente mencionada gliceraldehído-3-fosfato deshidrogenasa, y enzimas responsables de la utilización de maltosa y galactosa. Cualquier vector plasmídico que contenga un promotor, origen de replicación y terminación compatibles con levadura, es adecuado.

Los vectores de levaduras adecuados para la presente invención se pueden basar en los siguientes tipos de plásmidos: - Plásmidos autónomos multicopia: estos plásmidos contienen secuencias que permiten generar múltiples copias de dichos vectores. Estas secuencias pueden ser la denominada 2μ tal como la que aparece en plásmidos episomales (YEp o plásmidos episomales de levadura) o secuencias de tipo ARS tales como las que aparecen en plásmidos de replicación (YRps o plásmidos de replicación de levadura), Los ejemplos de vectores basados en plásmidos de este tipo son p426GPD, p416GPD, p426TEF, p423GPD, P425GPD, p424GPD o p426GAL, YEp24 y YEplac.

Plásmidos autónomos de copia única: plásmidos que contienen la secuencia de replicación autónoma ARS1 y una secuencia centromérica (CEN4). Los plásmidos de este tipo incluyen los plásmido centroméricos (YCps o plásmidos centroméricos de levadura).

Plásmidos de integración: plásmidos que pueden ser integrados en el genoma de la célula huésped. Los plásmidos de este tipo incluyen plásmidos de integración (YIPs o plásmidos de integración de levadura). Los ejemplos de vectores basados en plásmidos de este tipo son pRS303, pRS304, pRS305 o pRS306 y similares.

En una realización aún más particular y preferida de la invención, dichos genes que codifican enzimas con actividad delta-9 desaturasa y/o Ci 6 3-cetoacil-CoA sintasa se expresan bajo control del promotor glicerol-3-fosfato deshidrogenasa de R. toruloides.

Realizaciones preferidas de la invención contemplan el empleo de secuencias terminadoras. El término "secuencia terminadora", tal y como se utiliza en la presente invención, hace referencia a una secuencia de ADN localizada en el extremo de una unidad transcripcional que señala la terminación de la transcripción. Los terminadores son secuencias de ADN sin traducir que contienen una señal de poliadenilación, que facilita la adición de secuencias de poliadenilato al extremo 3 ' de un transcrito primario. Las secuencias terminadoras son conocidas por el experto en la materia. Ejemplos ilustrativos y no limitativos de secuencias terminadoras que pueden emplearse de acuerdo a la presente invención incluyen el terminador del gen de la nopalina sintasa de Agrobacterium tumefaciens (t-nos) o el terminador del gen 35S del virus del mosaico de la coliflor (CaMV). En una realización todavía más preferida de la invención el terminador es el terminador del gen nos de A. tumefaciens.

Como se ha mencionado anteriormente, la invención contempla formas de realización en donde los vectores empleados para la expresión del gen que codifica enzima con actividad delta-9 desaturasa y/o del gen que codifica la enzima con actividad Ci 6 3- cetoacil-CoA sintasa en R. toruloides comprende un marcador genético, como por ejemplo, un gen que confiere resistencia a un antibiótico. Si se desea, la expresión de dicho gen puede optimizarse para la expresión en R. toruloides mediante el empleo de secuencias promotoras, terminadoras y codones optimizados para la expresión el levaduras. Ejemplos de dichas secuencias han sido mencionados anteriormente en el presente documento. En una realización preferida, dichas secuencias promotoras y terminadoras son distintas a los promotores y terminadores empleados para la correcta expresión de los genes que codifican las enzimas delta-9 desaturasa y/o 3- cetoacil-CoA sintasa en el microorganismo de la invención.

En una realización particular y preferida de la invención, el gen que codifica una enzima con actividad delta-9 desaturasa es el gen delta-9 desaturasa aislado de R. toruloides cuya enzima comprende la secuencia mostrada en SEQ ID NO: 1 o una variante funcionalmente equivalente de la misma.

En otra realización particular, el gen que codifica una enzima con actividad Ci 6 3- cetoacil-CoA sintasa es el gen Elo1 de R. toruloides cuya enzima comprende la secuencia mostrada en SEQ ID NO: 2 o una variante funcionalmente equivalentes de la misma. El término "es de" o "aislado de" significa que el gen o la enzima codificada por dicho gen está sustancialmente separado o purificado de un gen o la enzima codificada en la célula del organismo en el que el dicho gen o polipéptido codificado se produce de forma natural. Por tanto, el término aislado abarca genes purificados por métodos de purificación estándar para ácidos nucleicos o proteínas codificadas. El término también comprende genes o enzimas codificadas por dichos genes preparados por expresión recombinante en una célula huésped así como ácidos nucleicos químicamente sintetizados o el polipéptido codificado de los mismos.

El término "variante funcionalmente equivalente" tal y como se utiliza en el presente documento, se refiere a todos aquellos polipéptidos derivados de la secuencia de la enzima con actividad delta-9 desaturasa mostrada en la SEQ ID NO: 1 , o de las secuencia de la enzima con actividad Ci 6 3-cetoacil-CoA sintasa mostrada en la SEQ ID NO: 2 mediante modificación, inserción y/o deleción de uno o más aminoácidos siempre y cuando se mantenga sustancialmente la función de dicha enzima. En concreto, las variantes funcionalmente equivalentes mantendrán la capacidad de incrementar la concentración de ácido oleico a partir de ácidos de 16 carbonos, particularmente del ácido palmítico y esteárico. Métodos para determinar la producción ácido oleico a partir de dichos precursores son conocidos en el estado de la técnica. A modo ilustrativo, la determinación de la producción de ácido oleico puede llevarse a cabo mediante cualquier método que permita detectar componentes orgánicos en una muestra como por ejemplo, métodos cromatográficos que incluyen cromatografía de gases y cromatografía de masas. Técnicas que permiten la extracción del aceite del interior celular son conocidas en el estado de la técnica y comprenden métodos de extracción mecánica como prensado y métodos de extracción química sólido-líquido.

Variantes funcionalmente equivalentes de dicha delta-9 desaturasa incluyen aquellas que muestran al menos un 25%, al menos un 30%, al menos un 35%, al menos un 40%, al menos un 45%, al menos un 50%, al menos un 55%, al menos un 60%, al menos un 65%, al menos un 70%, al menos un 75%, al menos un 80%, al menos un 85%, al menos un 90%, al menos un 95%, al menos un 96%, al menos un 97%, al menos un 98% o al menos un 99% de identidad de secuencia de aminoácidos con respecto a la secuencia SEQ ID NO: 1 de dicha delta-9 desaturasa indicada anteriormente.

Variantes funcionalmente equivalentes de dicha 3-cetoacil-CoA sintasa incluyen aquellas que muestran al menos un 25%, al menos un 30%, al menos un 35%, al menos un 40%, al menos un 45%, al menos un 50%, al menos un 55%, al menos un 60%, al menos un 65%, al menos un 70%, al menos un 75%, al menos un 80%, al menos un 85%, al menos un 90%, al menos un 95%, al menos un 96%, al menos un 97%, al menos un 98% o al menos un 99% de identidad de secuencia de aminoácidos con respecto a la secuencia SEQ ID NO: 2 de dicha Ci 6 3-cetoacil-CoA sintasa indicada anteriormente. El grado de identidad entre dos secuencias de aminoácidos puede determinarse por métodos convencionales mencionados en el contexto del primer método de la invención tales como, por ejemplo BLAST (Altschul S. F. et al. Basic Local Alignment Search Tool. J Mol Biol. 1990 Oct 5; 215(3):403-10). El experto en la materia entenderá que las secuencias de aminoácidos a las que se hace referencia en esta descripción pueden estar modificadas químicamente, por ejemplo, mediante modificaciones químicas que son fisiológicamente relevantes, tales como, fosforilaciones, acetilaciones, etc.

En una realización preferida de la invención, dicho gen que codifica una enzima con actividad delta-9 desaturasa consiste en la secuencia mostrada en SEQ ID NO: 1. En otra realización preferida de la invención, dicho gen que codifica una enzima con actividad Ci 6 3-cetoacil-CoA sintasa consiste en la secuencia mostrada en SEQ I D NO: 2.

En una realización particular, el microorganismo de la invención se refiere a un muíante de la cepa Rhodosporidium toruloides CECT 13085. El término "cepa", tal y como se utiliza en el presente documento, se refiere a una variante genética o subtipo de un organismo determinado.

La cepa Rhodosporidium toruloides CECT 13085 se refiere a un microorganismo de la especie Rhodosporidium toruloides que tiene la capacidad de crecer en presencia de hidrolizados de biomasa sin detoxificar y/o tiene la capacidad de metabolizar xilosa. Dicha cepa está depositada en la Colección Española de Cultivos Tipo (CECT) con fecha 7 de Mayo de 2013. Las características de dicha cepa se describen en la solicitud de patente ES2526617A1 .

En una realización particular, el gen FAD del microorganismo de la invención no es funcional. El término "FAD2" tal y como se usa en el presente documento, se refiere al gen que codifica la enzima con actividad delta-12 desaturasa que cataliza la introducción de un doble enlace en la posición delta-12 del ácido palmítico o del ácido oleico. En una realización preferida de la invención, dicho gen codifica una enzima con actividad delta-12 desaturasa cuya secuencia se muestra en la secuencia SEQ I D NO: 3.

La expresión "el gen FAD2 no es funcional" tal y como se usa en el presente documento, se refiere a que dicho gen codifica una proteína FAD2 cuya capacidad de introducir un doble enlace en la posición delta-12 de la cadena carbonada de los ácidos palmítico u oleico, está disminuida con respecto a la capacidad de llevar a cabo dicha síntesis por una proteína codificada por dicho gen FAD2 funcional. De acuerdo a la presente invención, el microorganismo de la invención presenta un gen FAD2 no funcional si la capacidad de introducir un doble enlace en la posición delta-12 de la cadena carbonada de los ácidos palmítico u oleico por la proteína FAD2 codificada por dicho gen FAD2 no funcional está reducida al menos un 50%, al menos un 60%, al menos un 70%, al menos un 80% al menos un 90%, al menos un 95% o más con respecto a dicha síntesis realizada por un gen FAD2 funcional. El gen FAD2 de R. toruloides, preferiblemente de R. toruloides CECT 13085 puede ser no funcional consecuencia de una mutación en la secuencia de dicho gen. La expresión "gen FAD2 no es funcional" también se refiere a que dicho gen está ausente en el genoma del microorganismo de la invención, consecuencia de una deleción total de la secuencia de dicho gen. En una realización preferida de la invención, el microrganismo de la invención presenta el gen FAD2 delecionado en su totalidad. La determinación de la funcionalidad del gen FAD2 en R. toruloides, preferiblemente en R. toruloides CECT 13085, puede llevarse a cabo mediante cualquier método conocido en el estado de la técnica que permita detectar la actividad enzimática de FAD2.

El término "mutación" se refiere a sustituciones, inserciones o deleciones que se producen a nivel de la secuencia nucleotídica. Por "inserción", se entiende la ganancia de uno o más nucleótidos. Dentro de la inserción se encuentra las duplicaciones que consisten en la repetición de un segmento de ADN del interior de una secuencia, pudiendo producirse tres (triplicación) o más veces. Por "deleción" tal y como se usa el presente documento, se entiende la pérdida de uno o más nucleótidos. Las deleciones pueden ser totales o parciales. El término "deleción total" de la secuencia de un gen, según se emplea en la presente invención, se refiere a la pérdida del 100% de los nucleótidos que constituyen la secuencia nucleotídica de dicho gen. El término "deleción parcial" de la secuencia de un gen, según se emplea en la presente invención, se refiere a la pérdida de al menos 0,5%, 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% o 99% de los nucleótidos que componen la secuencia nucleotídica de dicho gen. Como el experto en la materia sabe, en la técnica existen métodos apropiados para realizar mutaciones en la secuencia de un gen como la mutagénesis de sitio dirigido por PCR o mutagénesis de sitio dirigido por PCR en un plásmido.

En una realización todavía más particular, el gen KU70 y/o el gen KU80 del microorganismo de la invención, preferiblemente de la cepa R. toruloides CECT 13085, no es funcional. El término "KU70", tal y como se utiliza en el presente documento se refiere al gen de R. toruloides que codifica una proteína que participa en la recombinación no homologa durante el proceso de reparación del ADN. La secuencia de KU70 de R. toruloides se encuentra depositada en la base de datos GenBank (versión del 27 de mayo de 2014) bajo el número KF850470.

La expresión "gen KU70 no es funcional", tal y como se usa en el presente documento, se refiere a que dicho gen codifica una proteína KU70 cuya capacidad de unión al DNA dañado y/o cuya capacidad de reclutamiento de las proteínas que interviene en la reparación de dicho DNA está disminuida con respecto a la capacidad de llevar a cabo dicha función por una proteína codificada por dicho gen KU70 funcional. De acuerdo a la presente invención, el microorganismo de la invención presenta un gen KU70 no funcional si la capacidad mencionada anteriormente está reducida al menos un 50%, al menos un 60%, al menos un 70%, al menos un 80% al menos un 90%, al menos un 95% o más con respecto a dicha síntesis realizada por un gen KU70 funcional. El gen KU70 de R. toruloides, preferiblemente de R. toruloides CECT 13085 puede ser no funcional consecuencia de una mutación en la secuencia de dicho gen.

En otra realización preferida de acuerdo a la presente invención, la expresión "gen KU70 no es funcional" también se refiere a que dicho gen está ausente en el genoma del microorganismo de la invención, consecuencia de una deleción total de la secuencia de dicho gen. En una realización preferida de la invención, el microrganismo de la invención presenta el gen KU70 delecionado en su totalidad. La determinación de la funcionalidad del gen KU70 en R. toruloides, preferiblemente en R. toruloides CECT 13085, puede llevarse a cabo mediante cualquier método conocido en el estado de la técnica que permita detectar la actividad enzimática de KU70.

El término "KU80", tal y como se utiliza en el presente documento se refiere al gen de R. toruloides que codifica una proteína que participa en la recombinación no homologa durante el proceso de reparación del ADN. La secuencia de KU80 de R. toruloides se encuentra depositada en la base de datos GenBank (versión del 27 de mayo de 2014) bajo el número KF850471.

La expresión "gen KU80 no es funcional", tal y como se usa en el presente documento, se refiere a que dicho gen codifica una proteína KU80 cuya capacidad de unión al DNA dañado y/o cuya capacidad de reclutamiento de las proteínas que interviene en la reparación de dicho DNA está disminuida con respecto a la capacidad de llevar a cabo dicha función por una proteína codificada por dicho gen KU80 funcional. De acuerdo a la presente invención, el microorganismo de la invención presenta un gen KU80 no funcional si la capacidad mencionada anteriormente está reducida al menos un 50%, al menos un 60%, al menos un 70%, al menos un 80% al menos un 90%, al menos un 95% o más con respecto a dicha síntesis realizada por un gen KU80 funcional. El gen KU80 de R. toruloides, preferiblemente de R. toruloides CECT 13085 puede ser no funcional consecuencia de una mutación en la secuencia de dicho gen.

En otra realización preferida de acuerdo a la presente invención, la expresión "gen KU80 no es funcional" también se refiere a que dicho gen está ausente en el genoma del microorganismo de la invención, consecuencia de una deleción total de la secuencia de dicho gen. En una realización preferida de la invención, el microrganismo de la invención presenta el gen KU80 delecionado en su totalidad. La determinación de la funcionalidad del gen KU70 en R. toruloides, preferiblemente en R. toruloides CECT 13085, puede llevarse a cabo mediante cualquier método conocido en el estado de la técnica que permita detectar la actividad enzimática de KU80. Procedimiento para obtener una biomasa microbiana enriquecida en aceite rico en ácido oleico

En otro aspecto, la presente invención se relaciona con un procedimiento para obtener una biomasa microbiana enriquecida en aceite rico en ácido oleico, en adelante "primer procedimiento de la invención", que comprende

i) cultivar el microorganismo de la invención en un medio de cultivo que comprende al menos una fuente de carbono y al menos una fuente de nitrógeno, en condiciones adecuadas para el crecimiento de dicho microorganismo, y

ii) separar la biomasa microbiana del caldo de cultivo,

El término "biomasa microbiana", tal y como se utiliza en la presente invención, se refiere al material biológico de organismos vivos o recientemente vivos, en particular del microorganismo de la invención, y a la materia orgánica originada en un proceso biológico, espontáneo o provocado, utilizable como fuente de energía. Como una fuente de energía renovable, la biomasa puede ser utilizada directa o indirectamente, previa conversión en otro tipo de producto tal como biocombustible. En el caso particular de la presente invención, la biomasa microbiana es rica en ácido oleico. El término "aceite", tal y como se utiliza en el presente documento, hace referencia a una composición grasa formada por acilglicéridos, es decir ésteres en los que uno, dos o tres moléculas de ácidos grasos se unen a una molécula de glicerina, formando monoglicéridos, diglicéridos y triglicéridos, respectivamente. Además, dicho aceite puede comprender ácidos grasos libres, y otras sustancias liposolubles tales como fosfolípidos, esfingolípidos o esteróles. Típicamente, el aceite está compuesto por triacilgliceroles en más de un 90% del total de la composición.

El término "biomasa microbiana enriquecida en aceite rico en ácido oleico", tal y como se utiliza en la presente invención, se refiere a una biomasa microbiana con un contenido en aceite rico en ácido oleico de al menos el 40%, al menos el 50%, al menos el 60% o al menos el 70% de su peso seco total. Dicho término también se refiere a una biomasa microbiana cuyo contenido en ácido oleico representa al menos el 65% (p/p), al menos el 70% (p/p), al menos el 75% (p/p), al menos el 80% (p/p), o al menos el 85% (p/p) con respecto al total de ácidos grasos de dicho microorganismo. En una realización particular de la invención, el ácido oleico representa al menos el 70% (p/p) con respecto al total de ácidos grasos de dicho microorganismo. Técnicas para determinar el contenido en ácidos grasos, particularmente en ácido oleico, se han mencionado anteriormente en el contexto del primer aspecto de la invención. El término "microorganismo de la invención", así como las realizaciones particulares y preferidas del mismo han sido detallados en el contexto del primer aspecto de la invención y aplican de igual manera al primer procedimiento de la invención.

En una primera etapa, el primer procedimiento de la invención comprende cultivar el microorganismo de la invención en un medio de cultivo que comprende al menos una fuente de carbono y al menos una fuente de nitrógeno, en condiciones adecuadas para el crecimiento de dicho microorganismo. El término "cultivar", tal y como se utiliza en la presente invención, se refiere al procedimiento de sembrar, mantener y hacer que se desarrollen microorganismos sobre medios de cultivo adecuados. El término "medio de cultivo", tal y como se utiliza en la presente invención, se refiere a un medio líquido, semisólido o sólido que cuenta con los nutrientes necesarios para permitir, en condiciones favorables de pH, temperatura y oxigenación, el crecimiento de microorganismos. En una forma de realización particular, el medio de cultivo es un medio líquido. Medios de cultivo adecuados para cultivar microorganismos son ampliamente conocidos en la materia. Entre otros nutrientes, el medio de cultivo comprende una fuente de carbono y una fuente de nitrógeno. Ejemplos no limitativos de medios de cultivo adecuados para llevar a cabo el primer procedimiento de la invención incluyen medio MB03-2 (composición NH 4 N0 3 0.7 g/L, CaCI 2 .2H 2 0 0.4 g/L, MgS0 4 .7H 2 0 0.4 g/L, KH 2 P0 4 0.75 g/L, liquido macerado de maíz 9,6 g/L a pH6, glicerina 1 10 g/L), medio MB03-7 (composición NH 4 N0 3 0.28 g/L, CaCI 2 .2H 2 0 0.4 g/L, MgS0 4 .7H 2 0 0.4 g/L, KH 2 P0 4 0.75 g/L, extracto de levadura 1 ,5 g/L, glucosa 40 g/L, pH 5), medio MBO3-10 (composición NH 4 N0 3 0.28 g/L, CaCI 2 .2H 2 0 0.4 g/L, MgS0 4 .7H 2 0 0.4 g/L, KH 2 P0 4 0.75 g/L, extracto de levadura 3 g/L, peptona 1 ,5 g/L, glucosa 40 g/L pH5), medio MB03-1 1 (composición hidrolizado de paja de trigo con un contenido en azúcares de 1 10 g/L, liquido macerado de maíz 9,6 g/L a pH6).

En una realización particular, la fuente de carbono es un hidrolizado de biomasa lignocelulósica. El término "hidrolizado de biomasa", según se usa en el presente documento, se refiere a cualquier producto de sacarificación, que contiene los azúcares producidos en el proceso de sacarificación, los restos de biomasa no hidrolizada y las enzimas empleadas para la hidrólisis de dicha biomasa. El término "sacarificación" o "hidrólisis de la biomasa", según se usa en el presente documento, se refiere a la producción de azúcares fermentables a partir de polisacáridos.

El término "azúcar fermentable", tal y como se utiliza en el presente documento, se refiere a los oligosacáridos y monosacáridos que pueden ser empleados como fuente de carbono por un microorganismo en el proceso de fermentación para la obtención de productos como etanol.

Los términos "biomasa" y "sustrato de biomasa", tal y como se utilizan en el presente documento, hacen referencia a cualquier material apropiado para su uso en reacciones de sacarificación. Dichos términos incluyen pero no están limitados a materiales que comprenden celulosa (por ejemplo, biomasa celulósica, materia prima celulósica y sustrato celulósico), lignina o la combinación de celulosa y lignina. La biomasa puede derivar de plantas, animales o microorganismos y pude incluir, sin estar limitada, a residuos agrícolas, industriales y forestales, desechos agrícolas y municipales y cultivos terrestres y acuáticos con fines energéticos. Ejemplos de sustratos de biomasa incluyen pero no están limitados a madera, pasta de madera, pasta de papel, fibra de maíz, grano de maíz, mazorcas de maíz, residuos de cosechas como hojas de maíz, rastrojo de maíz, pastos, trigo, paja de trigo, cebada, paja de cebada, heno, arroz, paja de arroz, mijo, residuos de papel, papel, residuos de procesamiento de pulpa, leñosas o herbáceas, pulpa de fruta o verdura, productos de destilado del grano, hierbas, cáscaras de arroz, algodón, cáñamo, lino, sisal, bagazo de caña, sorgo, soja, mijo, componentes obtenidos de la molienda de granos, árboles, ramas, raíces, hojas, virutas de madera, aserrín, arbustos y matas, verduras, frutas y flores y cualquier combinación de los mismos. En algunas realizaciones, la biomasa comprende pero no está limitada a plantas cultivadas (por ejemplo, hierbas, incluyendo gramíneas C4, tales como pasto varilla, hierba espinal, hierba de centeno, Miscanthus, hierba cinta o combinaciones de las mismas), residuos de procesamiento del azúcar, por ejemplo pero sin limitarse a, bagazo [por ejemplo, bagazo de caña de azúcar, pulpa de remolacha (por ejemplo remolacha azucarera), o una combinación de las mismas], residuos agrícolas (por ejemplo rastrojo de soja, rastrojo de maíz, fibra de maíz, paja de arroz, azúcar de caña de paja, arroz, cáscaras de arroz, paja de cebada, mazorcas de maíz, paja de trigo, paja de cañóla, paja de avena, cáscaras de avena, fibra de maíz, cáñamo, lino, sisal, algodón o cualquier combinación de los mismos), pulpa de fruta, pulpa de vegetales, productos de destilado del grano, biomasa forestal (por ejemplo madera, pasta de madera, fibra, fibras de pasta de madera reciclada, serrín, madera dura, tal y como madera de álamo, madera blanda o una combinación de las mismas). En algunas formas de realización, la biomasa comprende material de desecho celulósico y/o residuos forestales incluyendo pero sin estar limitada a, papel y residuos de procesamiento de pasta de papel, residuos municipales de papel, papel de periódico, cartón y similares. En algunas realizaciones, la biomasa comprende una especie de fibra mientras que en otras realizaciones alternativas, la biomasa comprende una mezcla de fibras que se originan a partir de diferentes biomasas. En algunas realizaciones, la biomasa puede comprender también plantas transgénicas que expresan ligninasa y/o celulasas. El término "biomasa" incluye cualquier material biológico vivo o muerto que contiene polisacáridos como sustratos incluyendo pero sin estar limitado a celulosa, almidón, otras formas de polímeros de carbohidratos de cadena larga y combinaciones de los mismos. Puede o no estar formado completamente a partir de glucosa o xilosa, y opcionalmente, puede contener otros monómeros de pentosas o hexosas. La xilosa es una aldopentosa que contiene cinco átomos de carbono y un grupo aldehido. Es el azúcar precursor de la hemicelulosa y es a menudo, el componente principal de la biomasa. En algunas realizaciones, el sustrato se pone en suspensión antes del pretratamiento. En algunas realizaciones, la consistencia de la suspensión es de entre aproximadamente 2% y aproximadamente 30% y más típicamente entre aproximadamente 4% y aproximadamente 15%. En algunas realizaciones la suspensión se lava o se trata con ácido antes del pretratamiento. En algunas formas de realización, la suspensión se deshidrata mediante cualquier método adecuado para reducir el consumo de agua y de productos químicos antes del pretratamiento. Ejemplos de dispositivos de deshidratación incluyen, pero no se limitan a prensas de tornillo a presión, filtros presurizados y extrusoras.

Un sustrato de biomasa está "pretratado" cuando ha sido sometido a procedimientos físicos y/o químicos para facilitar la sacarificación. En algunas realizaciones, el sustrato de biomasa es "pretratado" o "tratado" para aumentar la susceptibilidad de dicha biomasa a la hidrólisis de la celulosa mediante el empleo de métodos conocidos en el estado de la técnica, tales como métodos de pretratamiento físico-químicos (por ejemplo, tratamiento con amonio, pretratamiento con ácido diluido, pretratamiento con álcalis diluida, exposición a disolventes, explosión de vapor, molienda, extrusión), métodos de pretratamiento biológico (por ejemplo, la aplicación de microorganismos lignina-solubilizantes) y combinaciones de los mismos. La molienda consiste en un proceso de trituración de la materia vegetal hasta su reducción a partículas de diferentes tamaños que pueden ser separadas por procedimientos mecánicos.

La extrusión es un procedimiento mediante el cual el material vegetal es forzado a fluir bajo una o más de una variedad de condiciones de mezclado, calentamiento y cizallamiento, a través de una boquilla diseñada para dar forma o expandir los ingredientes. Puede realizarse en frío donde el material se extruye sin expansión o en caliente o en caliente, donde las macromoléculas de los componentes pierden su estructura nativa discontinua y se forma una masa continua y viscosa que dextriniza y gelatiniza el almidón, se desnaturalizan las proteínas, se inactivan las enzimas responsables de posibles deterioros, se destruyen algunos compuestos no nutricionales y se destruye al carga microbiana.

La hidrólisis ácida consiste en tratar el material vegetal con ácidos como ácido sulfúrico o ácido clorhídrico empleando altas temperaturas. Mediante este proceso se favorece la hidrólisis de la celulosa pero requiere una neutralización del pH al finalizar la hidrólisis para permitir el crecimiento posterior de microrganismos.

El tratamiento con álcalis consiste en la adición de bases diluidas a la biomasa vegetal. La eficiencia de este procedimiento depende del contenido de lignina de los materiales. El hidróxido de sodio diluido produce un hinchamiento, permitiendo un incremento en el área de superficie interna reduciendo el grado de polimerización y cristalinidad de la celulosa, causando la separación de las uniones estructurales entre la lignina y los carbohidratos.

El tratamiento con disolventes orgánicos consiste en utilizar solventes como el metanol, etanol o acetona para la ruptura de los enlaces de la lignina y la celulosa. La remoción de los solventes del sistema es necesaria, ya que inhiben el crecimiento de los organismos.

El tratamiento con líquidos iónicos (por ejemplo, con una disolución de cloruro sódico) favorece la degradación de la celulosa debido a que los átomos de hidrógeno y oxígeno que forman parte de la misma interactúan por separado con el solvente de manera que se produce la ruptura de los enlaces puentes de hidrógeno entre las cadenas de celulosa.

El tratamiento con explosión de vapor consiste en tratar la biomasa con vapor saturado a una temperatura de 160-260°C (0,69-4,83 MPa) durante un cierto tiempo que dependerá del tipo de material vegetal de origen.

El tratamiento con microorganismos lignina-solubilizantes consiste en tratar a la biomasa con microorganismos que producen enzimas con capacidad de degradar el material lignocelulósico como por ejemplo, Trichoderma reesei, Fusarium oxysporium, Piptopus betulinus, Penicillum echinalatum, Penicillum purpurogenum, Aspergillus niger, Aspergillus fumigatus, Anaeromyces sp., Caecomices sp., Cyllamcyces sp., Neocallimastix sp., Orpinomyces sp., Piromyces sp., Sporotrichum thermophile, Scytalidium thermophillu, Thermonospora cubata, Rhodosporillum rubrum, Cellulomonas fimi, Clostridium stercocarium, Bacillus polymyxa, Pyrococcus furiosus, Acidothermus cellulotycus, Saccharophagus degradans, etc.

Como el experto en la materia entenderá, el hidrolizado de biomasa lignocelulosica puede obtenerse de diferentes orígenes vegetales o subproductos de los mismos. El término "subproducto", tal y como se utiliza en la presente invención, hace referencia al producto resultante de someter a dicho vegetal a procedimientos físico y/o químicos. En una realización particular, el medio de cultivo comprende como fuente de carbono un hidrolizado de biomasa lignocelulosica que se obtiene a partir de paja de trigo, bagazo de caña de azúcar, racimos vacíos de palma aceitera, poda de palma aceitera, fibra de palma aceitera, poda de vid, poda de olivo y combinaciones de las mismas. En una realización preferida, dicho hidrolizado procede de paja de trigo. En otra realización preferida, dicho hidrolizado procede de bagazo de caña. En otra realización preferida, dicho hidrolizado procede de racimos vacíos de palma aceitera. Preferiblemente, dichas combinaciones de hidrolizados mencionadas anteriormente tienen al menos un 5%, al menos un 10%, al menos un 20%, al menos un 30%, al menos un 40% de biomasa lignocelulosica hidrolizada.

En otra realización particular, la fuente de carbono empleada para el cultivo del microorganismo de la invención procede de una mezcla de un hidrolizado de biomasa lignocelulósica y glicerol. Como entenderá el experto en la materia, la proporción de hidrolizado y glicerol podrá variar para que las condiciones de crecimiento y de producción lipídica del microrganismo de la invención sean óptimas. Así, preferiblemente la relación de hidrolizado de biomasa:glicerina es 60:40; más preferiblemente, la relación de hidrolizado de biomasa:glicerina es 70:30; y aún más preferiblemente la relación de hidrolizado de biomasa:glicerina es 75:25.

En otra realización particular, la fuente de carbono se selecciona del grupo que consiste en glucosa, glicerol, glicerina, melazas, xilosa, arabinosa, mañosa, fructosa, acetato, almidones y combinaciones de las mismas. En una realización preferida, la fuente de carbono es glucosa. En otra realización preferida, la fuente de carbono es xilosa. En una realización más preferida, la concentración de xilosa en el medio de cultivo es de 20 g/l. En otra realización más preferida, la concentración de xilosa en el medio es de 40 g/l.

En otra realización particular, la fuente de la fuente de nitrógeno se selecciona del grupo que consiste en extracto de levadura, peptona, líquido macerado de maíz, urea, glutamato sódico, diferentes fuentes de nitrógeno inorgánico, como sales de amonio y combinaciones de las mismas. En una realización preferida, la fuente de nitrógeno es una sal de amonio, preferiblemente cloruro de amonio.

En otra realización particular, el medio de cultivo comprende inhibidores sólidos. El término "inhibidores sólidos", tal y como se utiliza en la presente invención, hace referencia a compuestos que inhiben el metabolismo microbiano y afectan negativamente al crecimiento del organismo. En una forma de realización más particular, dichos inhibidores sólidos proceden de la degradación de la biomasa sin detoxificar (por ejemplo, proceden de la degradación de la lignocelulosa) y se seleccionan del grupo formado por ácido acético, ácido fórmico, ácido levulínico, ácido cumárico, ácido ferúlico, ácido succínico, 4-hidroxibenzaldehído, vanillina, ácido vaníllico, siringaldehido, ácido 4-hidroxibenzoico, catecol, guaiacol, ácido siríngico, furfural, 5-hidroximetilfurfural y combinaciones de los mismos. Métodos adecuados para determinar la capacidad de una cepa de R. toruloides de crecer en presencia de inhibidores sólidos procedentes de hidrolizados de biomasa sin detoxificar incluyen, por ejemplo, métodos que permiten determinar la adaptación del microorganismo a un medio de cultivo en el que se incrementa progresivamente la concentración de inhibidores.

Adicionalmente, si se desea, el medio de cultivo comprende otros medios específicos para conseguir la producción del metabolito deseado. Dichos medios de cultivo son ampliamente conocidos en el estado de la técnica y prepararlos constituye práctica rutinaria para el experto en la materia. Típicamente, el cultivo es sometido un estrés metabólico, de forma que produzcan y acumulen intracelularmente grandes cantidades de ácidos grasos. El estrés metabólico se puede inducir por un exceso de fuente de carbono en relación con la fuente de nitrógeno en el medio de cultivo. La acumulación de triglicéridos se produce cuando una fuente de carbono se encuentra en exceso y la fuente de nitrógeno limita el crecimiento. Bajo estas condiciones de crecimiento, las células utilizan la fuente de carbono para la síntesis de lípidos neutros y sus intermediarios (acil-CoA). En realizaciones preferidas, el microorganismo de la invención está manipulado genéticamente para favorecer la acumulación de ácido oleico con al menos un gen seleccionado de un grupo que consiste en un gen que codifica una enzima con actividd delta-9 desaturasa y un gen que codifica una enzima con actividad 3-cetoacil-CoA sintasa y, con la deleción del gen FAD2. Los métodos para el cultivo de microorganismos son estándares en la técnica y son ampliamente conocidos por el experto en la materia. El cultivo puede llevarse a cabo en matraces o biorreactores hasta alcanzar una producción máxima de ácido oleico. La duración del cultivo es variable, aunque típicamente el cultivo se realiza durante 5 días.

El término "condiciones adecuadas para el crecimiento del microorganismo de la invención", tal y como se utiliza en la presente invención, se refiere a condiciones que soportan el crecimiento del microorganismo de la invención. Tales condiciones pueden incluir pH, nutrientes, temperatura, humedad, oxigenación, ambiente y otros factores.

En una realización particular, las condiciones adecuadas para el crecimiento de dicho microorganismo de la etapa i) comprenden

- una temperatura en un rango entre 18 °C y 37 °C, preferentemente entre 23 °C y 32 °C, más preferentemente entre 28 °C y 30°C,

- una concentración de oxígeno disuelto de al menos el 20%, y/o - agitación constante.

Las condiciones en las que se lleva a cabo el cultivo del microorganismo de la invención pueden ajustarse para aumentar el porcentaje de aceite por unidad de peso seco en la biomasa microbiana resultante. Por ejemplo, es posible cultivar el microorganismo en presencia de concentraciones limitantes de algún nutriente, como por ejemplo, nitrógeno, fósforo o azufre a la vez que se mantiene un exceso de la fuente carbono. La limitación de la fuente de nitrógeno permite aumentar el rendimiento en aceite de la biomasa por unidad de peso seco. El microorganismo se puede cultivar en condiciones limitantes de alguno de los nutrientes durante todo el tiempo de cultivo o se puede cultivar alternando ciclos de cultivo en concentraciones limitantes y ciclos de cultivo sin concentraciones limitantes.

El cultivo de acuerdo al primer procedimiento de la invención se lleva a cabo hasta que se ha alcanzado la cantidad de biomasa deseada y/o hasta que la biomasa contiene la cantidad intracelular de aceite rico ácido oleico deseada. El experto en la materia entenderá que es posible llevar a cabo una monitorización del cultivo para determinar la cantidad de biomasa alcanzada a lo largo del tiempo (por ejemplo, mediante la determinación de la densidad óptica a 600 nm o mediante la determinación del peso sólido por unidad de volumen de cultivo). El experto en la materia entenderá que es posible llevar a cabo una monitorización del cultivo para determinar el porcentaje de ácido oleico que se acumulan en la biomasa a lo largo del tiempo (por ejemplo, mediante la determinación de la cantidad de ácido oleico por unidad de masa en el cultivo usando cualquier método apropiado para ello conocido en el estado de la técnica).

Una vez alcanzada la cantidad de biomasa deseada y/o la cantidad intracelular de aceite rico en ácido oleico deseada, en una segunda etapa, el primer procedimiento de la invención comprende separar la biomasa microbiana del caldo de cultivo. Las células se recogen mediante alguno de los procedimientos habitualmente utilizados para este fin, tales como, centrifugación, filtración, decantación, flotación o sedimentación, adicionalmente ayudados por floculacion o evaporación para eliminar parte o la totalidad del agua o del medio de la fracción acuosa del medio de cultivo. En una realización particular, la segunda etapa del primer procedimiento de la invención se realiza mediante un método seleccionado del grupo que consiste en filtración, microfiltración, centrifugación, presión, decantación y combinaciones de los mismos.

En una realización particular, el primer procedimiento de la invención comprende además secar la biomasa microbiana obtenida en la segunda etapa.

Biomasa microbiana

En otro aspecto, la presente invención también se refiere a la biomasa microbiana enriquecida en aceite rico en ácido oleico obtenible según el primer procedimiento de la invención, en adelante "biomasa microbiana de la invención". El término "biomasa microbiana" se ha descrito en el segundo aspecto de la invención y se aplica de igual manera en el presente aspecto.

En una realización particular, la biomasa enriquecida en aceite rico en ácido oleico tiene un contenido en aceite de al menos el 40% del peso seco, al menos el 50% del peso seco, al menos el 60% del peso seco, o al menos el 70% del peso seco.

En una realización particular, el contenido en ácido oleico es al menos el 65% (p/p), al menos el 70% (p/p), al menos el 75% (p/p), al menos el 80% (p/p) o al menos el 85% (p/p) con respecto al total de los ácidos grasos del microorganismo de la invención. Procedimiento para obtener una preparación enriquecida en aceite rico en ácido oleico

En otro aspecto, la presente invención se relaciona con un procedimiento para obtener una preparación enriquecida en aceite rico en ácido oleico, en adelante "segundo procedimiento de la invención", que comprende:

i) cultivar el microorganismo de la invención en un medio de cultivo que comprende al menos una fuente de carbono y al menos una fuente de nitrógeno, en condiciones adecuadas para el crecimiento de dicho microorganismo,

ii) separar la biomasa microbiana del caldo de cultivo, iii) extraer el aceite rico en ácido oleico de la biomasa microbiana obtenida en la etapa (iii).

La primera etapa del segundo procedimiento de la invención comprende cultivar el microorganismo de la invención en un medio de cultivo que comprende al menos una fuente de carbono y al menos una fuente de nitrógeno, en condiciones adecuadas para el crecimiento de dicho microorganismo. Los términos "microorganismo de la invención", "cultivar", medio de cultivo", "condiciones adecuadas para el crecimiento del microorganismo de la invención", "biomasa microbiana" así como las realizaciones particulares y preferidas de dichos términos han sido detallados anteriormente y se interpretan de igual manera en el contexto del segundo procedimiento de la invención.

La segunda etapa del segundo procedimiento de la invención comprende separar la biomasa microbiana del caldo de cultivo. La biomasa microbiana puede separarse del caldo de cultivo mediante cualquier método apropiado conocido del estado de la técnica. Métodos que permiten separar la biomasa microbiana del caldo de cultivo han sido detallados en el contexto del primer procedimiento de la invención. Dichos métodos incluyen pero no están limitados a filtración, microfiltración, centrifugación, presión, decantamiento y combinaciones de los mismos.

El término "caldo de cultivo", tal y como se usa en el presente documento, se refiere al medio de cultivo obtenido tras el cultivo del microorganismo de la invención y que comprende nutrientes procedentes del medio de cultivo y compuestos producidos por el microorganismo de la invención como consecuencia de su metabolismo.

La tercera etapa del segundo procedimiento de la invención comprende extraer el aceite rico en ácido oleico de la biomasa microbiana obtenida en la segunda etapa de dicho procedimiento. Métodos adecuados para extraer el aceite incluyen cualquier método de extracción mecánica y dentro de estos, cualquier método de extracción sólido-líquido o mecánico químico conocidos en el estado de la técnica.

En una realización particular, el método de extracción mecánica se realiza utilizando prensa de tornillo, prensa francesa o molino de bolas. Así, en otra realización particular, el método de extracción sólido-líquido se realiza usando un disolvente orgánico inmiscible en agua. El término "disolvente orgánico", tal y como se utiliza en la presente invención, se refiere a una sustancia que disuelve un soluto cuyas moléculas contienen átomos de carbono. El término "disolvente orgánico inmiscible en agua", tal y como se utiliza en la presente invención, se refiere a un disolvente orgánico con poca o ninguna capacidad para mezclarse con el agua. Ejemplos no limitativos de disolventes orgánicos inmiscibles en agua incluyen n- hexano, acetato de etilo, éter de petróleo, éter-etílico, terc-butil-mtil éter, acetato de etilo, acetona, etil-metil cetona, benceno, tolueno, xileno. Así, en una realización preferida, dicho disolvente orgánico inmiscible en agua se selecciona del grupo que consiste en n-hexano, acetato de etilo, éter de petróleo, éter-etílico y combinaciones de los mismos. En una realización particular, el segundo procedimiento de la invención comprende además secar la biomasa microbiana obtenida en la segunda etapa.

Procedimiento para obtener biolubricantes La preparación enriquecida en ácido oleico obtenida a partir de la biomasa microbiana de acuerdo a la presente invención puede ser procesada químicamente para dar lugar a productos de interés en la industria.

Por lo tanto, en otro aspecto, la presente invención se relaciona con un procedimiento para obtener biolubricantes a partir de la preparación enriquecida en aceite rico en ácido oleico, obtenida según el segundo procedimiento de la invención, en adelante "tercer procedimiento de la invención", que comprende:

i) obtener una preparación enriquecida en aceite rico en ácido oleico a partir de la biomasa microbiana de la invención;

ii) refinar el aceite rico en ácido oleico obtenido en la etapa (i)

iii) convertir el aceite rico en ácido oleico obtenido en la etapa (ii) en biolubricantes.

El término "biolubricante", tal y como se utiliza en la presente invención, se refiere a un lubricante que se deriva de la biomasa, tal como residuos animales, de plantas o microbianos que no es tóxicos para la vida animal ni para la vida acuática y que puede degradarse mediante la acción de microorganismos en un periodo de tiempo relativamente breve. En una realización preferida de la invención dichos biolubricantes se obtienen a partir de una biomasa microbiana rica en ácido oleico. El término "biomasa microbiana enriquecida en aceite rico en ácido oleico" ha sido definido previamente en el contexto del primer método de la invención y aplica de igual manera en el contexto del tercer procedimiento de la invención.

En una primera etapa, el tercer procedimiento de la invención comprende obtener una preparación enriquecida en aceite rico en ácido oleico según el procedimiento del segundo aspecto de la invención.

En una segunda etapa, el tercer procedimiento de la invención comprende refinar el aceite rico en ácido oleico obtenido a partir del segundo procedimiento de la invención.

El término "refinación" o "refino", tal y como se utiliza en la presente invención, se refiere al proceso de purificación de una sustancia química obtenida muchas veces a partir de un recurso natural. Numerosos métodos son conocidos en el estado de la técnica para la refinación de sustancias. Por ejemplo, la refinación de aceites, tal como un aceite rico en ácido oleico, se logra a menudo a través de la destilación o fraccionamiento. Un gas se puede refinar también de esta manera enfriándolo o comprimiéndolo hasta su licuefacción. Los gases y líquidos también se pueden refinar por extracción con un solvente que disuelva la sustancia de interés o bien las impurezas.

En una realización particular, el aceite rico en ácido oleico obtenido de acuerdo al segundo procedimiento de la invención se refina mediante alcoholisis en medio ácido. En esta reacción se puede utilizar un catalizador para mejorar la velocidad y el rendimiento final. La alcoholisis en medio ácido se realiza empleando un ácido como catalizador. La acidificación puede realizarse mediante el uso de cualquier ácido como, por ejemplo, ácido clorhídrico o ácido fosfórico. El alcohol utilizado en la reacción está preferentemente en exceso entre 5 y 40 veces con respecto a la biomasa microbiana de la que se obtiene la preparación enriquecida en aceite rico en ácido oleico. Típicamente, la reacción se deja proceder con agitación constante entre 20 y 36 horas a una temperatura de entre 40 y 70°C. De manera preferida, la alcoholisis se realiza con alcoholes que presentan 1 , 2, 3 o 4 carbonos, siendo el metanol el alcohol más preferido.

En una tercera etapa, el tercer procedimiento de la invención comprende convertir el aceite rico en ácido oleico refinado obtenido en la etapa ii) en biolubricantes. El experto en la materia entenderá que existen en la técnica numerosos procedimientos para convertir ácidos grasos, tales como ácido oleico en biolubricantes que incluyen, sin limitación los procedimientos mostrados en el documento US8357643 B2. Dichos métodos están basados en una etapa de modificación química de los ácidos grasos obteniendo derivados epoxi en presencia de un catalizador básico para la obtención de un diester, seguida de una etapa de hidrogenación que da lugar a mono alcoholes y de acilación que finalmente genera monoésteres.

Típicamente, las modificaciones químicas realizadas a dichos ácidos grasos libres incluyen reacciones de alquilación, adición de un radical, acilación, reacciones eno, aminoalquilación, co-oligomerización, hidroformilación, epoxidación y aciloxilación.

A modo ilustrativo, no limitativo la obtención de biolubricantes de acuerdo a la tercera etapa de dicho tercer procedimiento de la invención puede llevarse a cabo mediante un primer paso de expoxidación de los ácidos grasos y un segundo paso en donde se lleva a cabo una reacción entre dichos ácidos grasos modificados con anhídridos carboxílicos en presencia de un catalizador dando lugar a un biolubricante. Dicha tercera etapa también puede llevarse a cabo mediante un primer paso de expoxidación de los ácidos grasos, un segundo paso de hidrogenación de dichos ácidos grasos obteniéndose así un intermediario con grupos hidroxilos y un tercer paso de acilación de dichos grupos hidroxilos con un agente acilante teniendo como resultado la obtención de un biolubricante. Típicamente los catalizadores básicos comprenden una amina terciaria como la trietilamina. Usos de la invención

En otro aspecto, la presente invención se relaciona con el uso del microorganismo de la invención, en adelante "primer uso de la invención", para obtener una biomasa microbiana enriquecida en aceite rico en ácido oleico según el primer procedimiento de la invención. En otro aspecto, la presente invención se relaciona con el uso del microorganismo de la invención, en adelante "segundo uso de la invención", para obtener una preparación enriquecida en aceite rico en ácido oleico según el segundo procedimiento de la invención.

En otro aspecto, la presente invención se relaciona con el uso del microorganismo de la invención, en adelante "tercer uso de la invención", para obtener biolubricantes según el tercer procedimiento de la invención

Los términos "microorganismo", "biomasa microbiana", "biolubricantes" y sus particularidades han sido descritos en el contexto del microorganismo y del primer procedimiento de la invención, y son aplicables al primer, segundo y tercer uso de la invención. Asimismo, también son aplicables de igual manera los modos de realización particulares y preferidos del microorganismo y del segundo procedimiento de la invención.

La invención se describe en detalle a continuación por medio de los siguientes ejemplos, que han de interpretarse como meramente ilustrativos y no limitativos del alcance de la invención.

EJEMPLOS

Ejemplo 1 : Construcción de casetes integrativos en Rhodosporidium toruloides.

A partir de la secuencia del genoma de R. toruloides se sintetizó el gen que codifica la enzima con actividad Δ9 desaturasa correspondiente a la SEQ ID NO: 1. El fragmento de 1650 pb obtenido se clonó en un vector bajo control del promotor de la glicerol-3- fostato deshidrogenasa de R. toruloides y del terminador Tnos de Agrobacterium tumefaciens dando lugar a pNEOL121. A continuación, el vector pNEOL121 se digirió con la endonucleasa mitocondrial l-Scel y el cásete de expresión, conteniendo el promotor, el gen A9Rt y Tnos, se clonó en el vector pNEOL85, originando el vector pNEOL122. El vector pNEOL85 contiene otro cásete conteniendo el gen de resistencia a la geneticina con uso de codón de R. toruloides (G418Rt) bajo el control del promotor de la fosfoglicerato quinasa de R. toruloides (pPGK) y del terminador T35S del virus mosaico de la coliflor. Por último, el vector pNEOL122 se cortó con Pací y un fragmento de 5 kb, portando los dos casetes de expresión, se clonó en el plásmido pNEOL57 dando lugar al cásete integrativo pNEOL124 (Figura 1a).

A partir de la secuencia del genoma de R. toruloides se sintetizó el gen que codifica una enzima con actividad β-cetoacil-CoA sintasa (elongasa). La secuencia de este polipéptido es la que se muestra en la SEQ ID NO: 2. El fragmento de 990 pb obtenido se clonó en un vector bajo control del promotor de la glicerol-3-fostato deshidrogenasa de R. toruloides y del terminador Tnos de Agrobacterium tumefaciens dando lugar a pNEOL114. A continuación, el vector pNEOL114 se digirió con la endonucleasa mitocondrial l-Scel y el cásete de expresión, conteniendo el promotor, el gen eloIRt y Tnos, se clonó en el vector pNEOL77, originando el vector pNEOL115. El vector pNEOL77 contiene otro cásete conteniendo el gen de resistencia a la higromicina con uso de codón de R. toruloides (hphRt) bajo el control del promotor de la fosfoglicerato quinasa de R. toruloides (pPGK) y del terminador T35S del virus mosaico de la coliflor. Por último, el vector pNEOL115 se cortó con Pací y un fragmento de 4600 pb, portando los dos casetes de expresión, se clonó en el plásmido pNEOL105 dando lugar al cásete integrativo pNEOL116 (Figura 1 b).

A partir de la secuencia del genoma de R. toruloides se amplificó un fragmento correspondiente al extremo 5' del gen FAD2 (SEQ ID NO: 12) con los oligonucleótidos 089+, CGGAATTCACTCAGCGACACCAGCAATG (SEQ ID NO: 14) y 089-, ATTACCCTGTTATCCCTAAGCCAGTGGTTGCTGTAGAC (SEQ ID NO: 15) y otro fragmento correspondiente al extremo 3' del mismo gen (SEQ ID NO: 13) con los oligonucleótidos O90+, TAGGGATAACAGGGTAATTGGAGATTGGTGGCTGACTT (SEQ ID NO: 16) y O90-, CCCAAGCTTGCATGGCGTGTACA (SEQ ID NO: 17). Ambos fragmentos se clonaron en un vector comercial dando lugar a pNEOL134. A continuación, el vector pNEOL134 se digirió con la endonucleasa mitocondrial l-Scel y el cásete de expresión, conteniendo el gen de resistencia a la geneticina con uso de codón de R. toruloides (G418Rt) bajo el control de la glicerol-3-fostato deshidrogenasa de R. toruloides (pGPD1) y el terminador Tnos, se clonó en el sitio l-Scel, originando el vector pNEOL180. Por último, el vector pNEOL180 se cortó con Pací y un fragmento de 4520 kb, portando las dos regiones homologas del gen fad2 a ambos lados del cásete de expresión, se clonó en el plásmido pNEOL57 dando lugar al cásete integrativo pNEOL194 (Figura 1 C).

Ejemplo 2: Transformación de R. toruloides

La transformación de R. toruloides CECT 13085 se realizó mediante el sistema de transformación mediado por Agrobacterium tumefaciens (ATMT). Para ello, se cultivaron el pre-inóculo de A. tumefaciens llevando el plásmido integrativo en el medio de crecimiento MM (preparado según Hooykaas y col., 1979) y el pre-inóculo de R. toruloides CECT 13085 en medio YPD (extracto de levadura 10g/L, glucosa 20g/L, peptona 20g/L) durante 24h. A partir del pre-inoculo de Agrobacterium, se inocula 10 mL de medio MI (preparado según Bundock y col., 1995) suplementado en acetosiringona a 200 μΜ con una D0 6 6o inicial de 0.5, y se incuba 6h a 30°C, con agitación de 250 rpm. En paralelo, se inocula la cepa R. toruloides CECT 13085 en 10 mL de YPD con una D0 6 oo inicial de 1.5. Tras 6h de incubación se recogen 100μΙ de cada cultivo y se realiza un co-cultivo sobre una membrana de nitrocelulosa de 0.45 μηι en medio MI suplementado en acetosiringona a 200 μΜ, se incuba a 25°C durante 72h. A continuación, el co-cultivo o mezcla de transformación se recoge con 2 mL de medio YPD y se siembra en placas de Petri con medio YPD suplementado con cefotaxima (200 μg/mL) y geneticina (35 μg/mL) o higromicina (40 μg/mL). Los transformantes se picaron en medio YPD suplementado con geneticina (35 μg/mL) o higromicina (40 μg/mL). La integración del cásete conteniendo el gen A9Rt en el genoma de la levadura se comprobó mediante PCR con oligonucleotidos específicos 021+, GGACTAGTCGCCGGGATGCCAACGTCGTT (SEQ ID NO: 4); 022-, CCACTAGTAAATGTATAATTGCGGGACTC (SEQ ID NO: 5); y con 074+, TCTGCGTCAACTCGCTTGC (SEQ ID NO: 6) y 074-, GCTCTTCAGCTGAGGGTCG (SEQ ID NO: 7). La integración del cásete conteniendo el gen Elo1 Rt en el genoma de la levadura se comprobó mediante PCR con los oligonucleotidos específicos 021+ y 022-, así como con 081 +, CAGTCCTCGTGCACAATATC (SEQ ID NO: 8) y 081-, CAGCCTCGAAGCTCGAAGT (SEQ ID NO: 9). La deleción del gen FAD2 se comprobó mediante PCR con los oligonucleotidos específicos 0107+, CAGGTCCTCATCTCGGACG (SEQ ID NO: 10) y 0107-, TTGGACGAGAGGTGGTGCG (SEQ ID NO: 1 1).

La presencia de los casetes en el genoma de la levadura también se comprobó mediante hibridación. Para ello, ADN genómico de los transformantes se cortó con una enzima de restricción (Kpnl o Bglll) y en cada caso se hibridaron con sondas específicas para los genes A9Rt o EloI Rt. Las sondas se marcaron según el protocolo descrito en el kit de Roche (DIG High Prime DNA labeling and detection Starter kit I). Tanto los ensayos de hibridación como los de PCR confirmaron la integración de los casetes de expresión en el genoma de los diferentes transformantes.

Ejemplo 3: Producción de aceite enriquecido en ácido oleico mediante la expresión de EloI Rt.

Clones conteniendo al menos una copia del gen EloI Rt se cultivaron en matraces de 500 ml_ conteniendo 100 ml_ de los siguientes medios: MB03-2 (composición NH 4 N0 3 0.7 g/L, CaCI 2 .2H 2 0 0.4 g/L, MgS0 4 .7H 2 0 0.4 g/L, KH 2 P0 4 0.75 g/L, liquido macerado de maíz 9,6 g/L a pH6, glicerina 1 10 g/L), y MB03-1 1 (hidrolizado de biomasa con un contenido en azúcares de 1 10 g/L, liquido macerado de maíz 9,6 g/L a pH 6). Los cultivos crecieron a 250 rpm, 30°C durante 96 h. Finalizados los cultivos, las células se recogieron por centrifugación y la biomasa de cada matraz se secó en una estufa a 65°C durante 24 horas. A partir de la biomasa de cada matraz se determinó el contenido en aceite por gravimetría mediante extracción con n-hexano. La composición de los ácidos grasos de los aceites se determinó mediante CG-FID. La Figura 2 muestra los resultados obtenidos en dos de los medios de cultivo ensayados. Varios de los clones analizados mostraron una reducción en el contenido de ácido palmítico (14-31 %) y un incremento en el contenido de ácido oleico (4-11 %) con respecto a la cepa parental o cepa control dependiendo del medio de cultivo utilizado.

Ejemplo 4: Producción de aceite enriquecido en ácido oleico mediante la expresión de A9Rt.

Clones conteniendo al menos una copia del gen delta-9 desaturasa se cultivaron en matraces de 500 mL conteniendo 100 mL de los siguientes medios: MB03-2 (composición NH 4 N0 3 0.7 g/L, CaCI 2 .2H 2 0 0.4 g/L, MgS0 4 .7H 2 0 0.4 g/L, KH 2 P0 4 0.75 g/L, liquido macerado de maíz 9,6 g/L a pH6, glicerina 1 10 g/L) y MB03-11 (hidrolizado de biomasa con un contenido en azúcares de 100 g/L, liquido macerado de maíz 9,6 g/L a pH6). Los cultivos crecieron a 250 rpm, 30°C durante 96h. La extracción de aceite y la composición de los ácidos grasos se determinaron como se indica en el ejemplo 3. La Figura 3 muestra los resultados obtenidos con varios clones en diferentes medios de cultivo. Varios de los clones analizados mostraron una reducción en el contenido de ácido esteárico (20-46%) y un incremento en el contenido de ácido oleico (5-12%) con respecto a la cepa parental dependiendo del medio de cultivo utilizado.

Ejemplo 5: Producción de aceite enriquecido en ácido oleico en R. toruloides mediante la co-expresión de una elongasa (EloI Rt) y una desaturasa (A9Rt). La cepa R. toruloides T124-347 (Figura 3) conteniendo al menos una copia del gen delta-9 desaturasa se transformó con el cásete pNEOL116 conteniendo el gen EloI Rt. Los clones obtenidos se cultivaron en matraces de 500 mL conteniendo 100 mL de los siguientes medios: MB03-2 (composición NH 4 N0 3 0.7 g/L, CaCI 2 .2H 2 0 0.4 g/L, MgS0 4 .7H 2 0 0.4 g/L, KH 2 P0 4 0.75 g/L, liquido macerado de maíz 9,6 g/L a pH6, glicerina 1 10 g/L) y MB03-11 (hidrolizado de biomasa con un contenido en azúcares de 1 10 g/L, liquido macerado de maíz 9,6 g/L a pH6). Los cultivos crecieron a 250 rpm, 30°C durante 96 h. La extracción de aceite y la composición de los ácidos grasos se determinaron como se indica en el ejemplo 3. La Figura 4 muestra los resultados obtenidos al cultivar algunos clones en diferentes medios de cultivo. Varios de los clones analizados mostraron una reducción en el contenido de ácido palmítico (30-37%) y un incremento en el contenido de ácido oleico (20-27%) con respecto a la cepa parental dependiendo del medio de cultivo utilizado. Ejemplo 6: Producción de aceite enriquecido en ácido oleico mediante la expresión de EloI Rt en una cepa AFAD2

La cepa R. toruloides T194-39 contiene una deleción del gen FAD2. Clones de la cepa R. toruloides T194-39 conteniendo al menos una copia del gen EloI Rt se cultivaron en matraces de 500 mL conteniendo 100 mL del medio MB03-2 (composición NH 4 N0 3 0.7 g/L, CaCI 2 .2H 2 0 0.4 g/L, MgS0 4 .7H 2 0 0.4 g/L, KH 2 P0 4 0.75 g/L, liquido macerado de maíz 9,6 g/L a pH6, glicerina 1 10 g/L). Los cultivos crecieron a 250 rpm, 30°C durante 96 h. Finalizados los cultivos, las células se recogieron por centrifugación y la biomasa de cada matraz se secó en una estufa a 65°C durante 24 horas. A partir de la biomasa de cada matraz se determinó el contenido en aceite por gravimetría mediante extracción con n-hexano. La composición de los ácidos grasos de los aceites se determinó mediante CG-FID. La Figura 5 muestra los resultados obtenidos. La cepa R. toruloides T194-39 muestra un incremento en el contenido de ácido oleico (23%) con respecto a la cepa parental.

El clon T194-116-1 mostró un incremento en el contenido de ácido oleico del 25% con respecto a la cepa parental.