Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
PYRIDINE DERIVATIVES AND METHODS OF USE
Document Type and Number:
WIPO Patent Application WO/2015/132577
Kind Code:
A1
Abstract:
The invention relates to compounds for use in the modification of compounds comprising nucleic acid sequences (such as oligonucleotides or the like), to modified oligonucleotides, to the delivery of modified oligonucleotides to cells and the like, and to the treatment of conditions by the delivery of modified oligonucleotides. The invention provides pyridine derived phosphoramidites, phosphorothioates, phosphate esters, solid supported equivalents, related oligonucleotides and the delivery of these to cells.

Inventors:
MCGEOCH, Grant (16 Ella Gardens, Bellshill ML4 2NT, GB)
MCKEEN, Catherine (26 Ogilvie Way, Livingston Lothian EH54 8HL, GB)
OSNOWSKI, Andrew (24D Steppshill Terrace, Cumbernauld Road, Stepps G33 6EL, GB)
WILSON, Jennifer (7 Arthur Place, Eaglesham Road, Clarkston Strathclyde G76 7DQ, GB)
Application Number:
GB2015/050611
Publication Date:
September 11, 2015
Filing Date:
March 03, 2015
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
LINK TECHNOLOGIES LIMITED (3 Mallard Way, Strathclyde Business Park Bellshill, Lanarkshire ML4 3BF, GB)
International Classes:
C07H15/26; A61K31/455; A61K31/7064; A61K31/7088; A61P35/00; C07D213/55; C07D213/56; C07D213/66; C07D213/81; C07H19/073; C07H21/02; C07H21/04
Domestic Patent References:
WO2007128874A12007-11-15
Foreign References:
US20070149462A12007-06-28
Other References:
REDDY K R ET AL: "Stereoselective synthesis of nucleoside monophosphate HepDirect(TM) prodrugs", TETRAHEDRON LETTERS, PERGAMON, GB, vol. 46, no. 25, 20 June 2005 (2005-06-20), pages 4321 - 4324, XP027863911, ISSN: 0040-4039, [retrieved on 20050620]
UENO Y ET AL: "Synthesis of nuclease-resistant siRNAs possessing universal overhangs", BIOORGANIC & MEDICINAL CHEMISTRY, PERGAMON, GB, vol. 17, no. 5, 1 March 2009 (2009-03-01), pages 1974 - 1981, XP025992070, ISSN: 0968-0896, [retrieved on 20090121], DOI: 10.1016/J.BMC.2009.01.033
PADMANABHAN SEETHARAMAIYER ET AL: "Anti-HBV nucleotide prodrug analogs: Synthesis, bioreversibility, and cytotoxicity studies", BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 16, no. 6, 2006, pages 1491 - 1494, XP028755074, ISSN: 0960-894X, DOI: 10.1016/J.BMCL.2005.12.058
KRIEG A M ET AL: "MODIFICATION OF ANTISENSE PHOSPHODIESTER OLIGODEOXYNUCLEOTIDES BY A 5' CHOLESTERYL MOIETY INCREASES CELLULAR ASSOCIATION AND IMPROVESEFFICACY", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 90, no. 3, 1 February 1993 (1993-02-01), pages 1048 - 1052, XP000565644, ISSN: 0027-8424
AHMADIAN MOHAMMAD ET AL: "A comparative study of the thermal stability of oligodeoxyribonucleotides containing 5-substituted 2'-deoxyuridines", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 26, no. 13, 1 July 1998 (1998-07-01), pages 3127 - 3135, XP002246216, ISSN: 0305-1048, DOI: 10.1093/NAR/26.13.3127
FRANK VANDENDRIESSCHE ET AL: "Synthesis, enzymatic stability and base-pairing properties of oligothymidylates containing thymidine dimers with different N-substituted guanidine linkages", JOURNAL OF THE CHEMICAL SOCIETY, PERKIN TRANSACTIONS 1, no. 14, 1 January 1993 (1993-01-01), pages 1567, XP055193132, ISSN: 0300-922X, DOI: 10.1039/p19930001567
KADY I O ET AL: "Synthesis of iron-binding oligonucleotides and their reactions with single-stranded DNA", BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, PERGAMON, AMSTERDAM, NL, vol. 3, no. 6, 1 June 1993 (1993-06-01), pages 1367 - 1370, XP026679615, ISSN: 0960-894X, [retrieved on 19930601], DOI: 10.1016/S0960-894X(00)80350-9
NICOLE ZIMMERMANN ET AL: "A second-generation copper(II)-mediated metallo-DNA-base pair", BIOORGANIC CHEMISTRY, vol. 32, no. 1, 1 February 2004 (2004-02-01), pages 13 - 25, XP055193151, ISSN: 0045-2068, DOI: 10.1016/j.bioorg.2003.09.001
MEGGERS E ET AL: "A Novel Copper-Mediated DNA Base Pair", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, AMERICAN CHEMICAL SOCIETY, US, vol. 122, 1 January 2000 (2000-01-01), pages 10714 - 10715, XP002320180, ISSN: 0002-7863, DOI: 10.1021/JA0025806
MICHAEL SMIETANA ET AL: "Solid-Phase Synthesis and Screening of Macrocyclic Nucleotide-Hybrid Compounds Targeted to Hepatitis?C?NS5B", CHEMISTRY - A EUROPEAN JOURNAL, vol. 10, no. 1, 5 January 2004 (2004-01-05), pages 173 - 181, XP055193155, ISSN: 0947-6539, DOI: 10.1002/chem.200305402
SOYOUNG PARK ET AL: "Development of DNA-Based Hybrid Catalysts through Direct Ligand Incorporation: Toward Understanding of DNA-Based Asymmetric Catalysis", ACS CATALYSIS, vol. 4, no. 11, 7 November 2014 (2014-11-07), pages 4070 - 4073, XP055193164, ISSN: 2155-5435, DOI: 10.1021/cs501086f
Attorney, Agent or Firm:
LAWRIE IP LIMITED (The Hub, Pacific Quay Pacific Drive, Glasgow Strathclyde G51 1EA, GB)
Download PDF:
Claims:
A compound having formula I, II or III:

wherein:

R1, R2, R3, R4 and R5 independently are selected from H, a C-i-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a Ci 20 heteroalkyl group, a C1-20 aryl group, a C1-20 heteroaryl group, a C1-20 hydroxyalkyl group, a C1-20 hydroxyaryl group, a C1-20 ketone group, a C1-20 aldehyde group, a C1-20 amine group, a C1-20 ester group, a C1-20 carboxylic acid group, a C1-20 amide group, a C1-20 enone group, a C1-20 enamine group, a C1-20 alkyl sulphide group, a C-i-20 alkyl disulphide group, and G;

X1 is selected from S, 0, NRa; Y1 is selected from S, 0, NRa';

Ra and Ra' independently are selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C1-20 hydroxyalkyl group;

wherein G comprises a phosphoramidite group configured to attach to a nucleotide; and

wherein at least one of R1, R2, R3, R4 and R5 is G.

The compound as claimed in claim 1 , wherein one of R1, R2, R3, R4 and R5 is G.

The compound as claimed in claim 1 or claim 2, wherein R1, R2, R3, R4 and R5 independently comprise a protecting group to protect the functionality thereof.

The compound as claimed in claim 3, wherein the protecting group is selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups.

The compound as claimed in claim 4, wherein the protecting group is selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β-methoxyethoxymethyl ether (MEM), dimethoxytrityl, [bis-(4-methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4- methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri- iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers), methyl ethers, and ethoxyethyl ethers (EE).

6. The compound as claimed in any preceding claim, wherein the

reactive group is reactive to a nucleophilic group.

7. The compound as claimed in claim 6, wherein the nucleophilic

group is a hydroxyl group, an amine group, an amino group or a sulphur group.

8. The compound as claimed in any preceding claim, wherein the

reactive group is configured to attach to an oligonucleotide at the 5'- terminus or the 3'-terminus of an oligonucleotide.

9. The compound as claimed in any preceding claim, wherein the

reactive group is configured to attach to a nucleotide within an oligonucleotide sequence, and that is not the 5'-terminus or the 3'- terminus of the oligonucleotide.

10. The compound as claimed in any preceding claim, wherein the

reactive group is a phos horamidite group having the formula:

wherein:

R6 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20

hydroxyalkyl group, and a C1-20 alkylamide group; R7 comprises a protecting group;

Rb and Rbl are independently selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C1-20 hydroxyalkyl group; and

n is 0 or 1 .

The compound as claimed in claim 10, wherein R7 is phosphate protecting group, optionally selected from: a C1-20 alkyl group, a C2- 20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C1-20 hydroxyalkyl group.

The compound as claimed in claim 10 or claim 1 1 , wherein R7 is a C1-20 nitrile group, optionally a C1-10 nitrile group, optionally a C1-5 nitrile group, optionally a cyanoethyl group.

The compound as claimed in any one of claims 10 to 12, wherein R6 is a C-i-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

The compound as claimed in any one of claims 10 to 13, wherein Rb and Rbl independently are selected from H and a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

The compound as claimed in any one of claims 1 to 9, wherein the reactive group is a phosphoramidite group having the formula:

wherein:

B is a nucleobase;

R7 comprises a protecting group;

R8 is selected from H and a protecting group;

R9 is selected from H, OH, O-(tert-butyldimethylsilyl) (0- TBDMS), O-propargyl, ORc, halogen optionally F, NHRC and SRC;

R10 is selected from propargyl, propargyl amino, -NH(CH2)i- 20NH-, -NHCO(CH2)i-2oNH-, -NHCO(CH2)i-2oCO-, -NH(CH2)i-2oO-, - NH(CH2)1-20S-, -NHCO(CH2)1-20O-, -NHCO(CH2)1-20S-, - NHCO(CH2)1-20NH-, -NHCO(CH2)1-20O-, -NHCO(CH2)1-20S-, - 0(CH2)i-2oO-, -0(CH2)i-2oNH- -O(CH2)i-20S-, or a group having the formula:

R11 is selected from a Ci-2o alkyl group, a C2-2o alkenyl group, a C-i-20 haloalkyl group, a Ci-2o heteroalkyl group, a Ci-2o

hydroxyalkyl group;

R12 is selected from amide, ether, amine, thioether or a group having the formula:

X2 is selected from S, O and NRa;

Y2 and Y3 independently are selected from S, O and NR1 Z1, Z2 and Z2' independently are selected from CH2, S, 0,

NRa";

R13 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20

hydroxyalkyl group;

Ra, Ra', Ra", Rb and Rb' independently are selected from H, a C-i-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C-i- 20 heteroalkyl group, and a C1-20 hydroxyalkyl group;

Rc is selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C1-20 hydroxyalkyl group, and a protecting group; and

m, p and q independently are 0 or 1 .

16. The compound as claimed in claim 15, wherein R7 is selected from the list consisting of: a C1-20 nitrile group, a C2-20 alkenyl group, a C-i- 20 haloalkyl group, a C1-20 heteroalkyl group, and a C1-20

hydroxyalkyl group, and a C1-20 alkyl group.

17. The compound as claimed in claim 15 or claim 16, wherein R7 is a C-i-20 nitrile group, optionally a C1-10 nitrile group, optionally a C1-5 nitrile group, optionally a cyanoethyl group.

18. The compound as claimed in any one of claims 15 to 17, wherein B is pyrimidine or purine, or a derivative thereof.

19. The compound as claimed in any one of claims 15 to 18, wherein B is selected from the group consisting of: adenine, guanine, cytosine, thymine, uracil, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine or 5-hydroxymethylcytosine. The compound as claimed in any one of claims 15 to 19, wherein B is selected from:

21 The compound as claimed in any one of claims 15 to 20, wherein R8 and Rc independently comprise a protecting group to protect the functionality thereof.

The compound as claimed in claim 21 , wherein the protecting group is selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups.

23. The compound as claimed in claim 22, wherein the protecting group is selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β-methoxyethoxym ethyl ether (MEM), dimethoxytrityl, [bis-(4-methoxyphenyl)phenylmethyl] (DMT), methoxym ethyl ether (MOM), methoxytrityl [(4- methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr),

fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri- iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers) methyl ethers, and ethoxyethyl ethers (EE).

The compound as claimed in any one of claims 15 to 23, wherein R11 is a d-20 alkyl group, optionally a C-MO alkyl group, optionally a C-i-6 alkyl group.

The compound as claimed in any one of claims 15 to 24, wherein X2 is selected from O and NRa.

The compound as claimed in any one of claims 15 to 25, wherein Y2 and Y3 independently are selected from O and NRa'.

The compound as claimed in any one of claims 15 to 26, wherein Z1, Z2 and Z2' independently are selected from O and NRa".

The compound as claimed in any one of claims 15 to 27, wherein R13 is a d-20 alkyl group, optionally a C-MO alkyl group, optionally, a C-i-5 alkyl group.

The compound as claimed in any one of claims 15 to 28, wherein Ra, Ra', Ra", Rb, Rb' and Rc independently are selected from H and a C-i-20 alkyl group, optionally a C-M O alkyl group, optionally a C1-5 alkyl group.

30. The compound as claimed in any preceding claim, wherein R1, R2, R3, R4 and R5 independently are selected from H, a C1-10 alkyl group, a C1-10 hydroxyalkyl group, a C1-10 hydroxyaryl group, a C1-10 ketone group, a C1-10 aldehyde group, a C1-10 amine group, a C1-10 ester group, a C1-10 carboxylic acid group, a C1-10 amide group, a C-i-10 enone group, a C1-10 enamine group, a C1-10 alkyl sulphide group, a C1-10 alkyl disulphide group, and G.

31 . The compound as claimed in any preceding claim, wherein R1, R2, R3, R4 and R5 independently are selected from H, a C1-5 alkyl group, a C1-5 hydroxyalkyl group, a C1-7 hydroxyaryl group, a C1-5 ketone group, a C1-5 aldehyde group, a C1-5 amine group, a C1-5 ester group, a C1-5 carboxylic acid group, a C1-5 amide group, a C1-5 enone group, a C1-5 enamine group, a C1-5 alkyl sulphide group, a C1-5 alkyl disulphide group, and G.

32. The compound as claimed in any preceding claim, wherein R1, R2, R3, R4 and R5 independently are selected from H , -CH3, -OH , -CH2- OH , -CH2-N H2,

O

, and G.

The compound as claimed in any preceding claim, wherein one or more of R1, R2, R3, R4 and R5 inde endently are

wherein Ar is an aromatic heterocycle, optionally as defined in formula I, II or III.

34. The compound as claimed in any preceding claim, wherein X1 is selected from 0 and NRa.

35. The compound as claimed in any preceding claim, wherein Y1 is selected from 0 and NRa'.

36. The compound as claimed in any preceding claim, wherein Ra and Ra' independently are selected from H and a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1 alkyl group.

37. An oligonucleotide compound having the formula IV, V or VI:

VI

wherein:

R1, R2, R3, R4 and R5 independently are selected from H, a C-i-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C-i- 20 heteroalkyl group, a C1-20 aryl group, a C1-20 heteroaryl group, a C-i-20 hydroxyalkyl group, a C1-20 hydroxyaryl group, a C1-20 ketone group, a C-i-20 aldehyde group, a C-i-20 amine group, a C-i-20 ester group, a C-i-20 carboxylic acid group, a C-i-20 amide group, a C1-20 enone group, a C-i-20 enamine group, a C-i-20 alkyl sulphide group, a C-i-20 alkyl disulphide group, and L;

X1 is selected from S, 0, NRa;

Y1 is selected from S, 0, NRa'; Ra and Ra' are independently selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C1-20 hydroxyalkyl group;

wherein L is a phosphate ester linker group or a phosphorothioate linker group, or a suitable analogue or derivative thereof, attached to an oligonucleotide; and

wherein at least one of R1, R2, R3, R4 and R5 is L.

38. The compound as claimed in claim 37, wherein one of R1, R2, R3, R4 and R5 is L.

39. The compound as claimed in claim 37 or claim 38, wherein R1, R2, R3, R4 and R5 independently comprise a protecting group to protect the functionality thereof.

40. The compound as claimed in claim 39, wherein the protecting group is selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups.

41 . The compound as claimed in claim 40, wherein the protecting group is selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β-methoxyethoxymethyl ether (MEM), dimethoxytrityl, [bis-(4-methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4- methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri- iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers), methyl ethers, and ethoxyethyl ethers (EE).

42. The compound as claimed in any one of claims 37 to 41 , wherein the linker group is attached to the oligonucleotide at the 5'-terminus or the 3'-terminus.

43. The compound as claimed in any one of claims 37 to 41 , wherein the linker group is attached to a nucleotide within an oligonucleotide sequence, and that is not the 5'-terminus or the 3'-terminus of the oligonucleotide.

44. The compound as claimed in any one of claims 37 to 43, wherein the linker group comprises a phosphate ester.

45. The compound as claimed in claim 44, wherein the linker group is a phosphate ester group having the formula:

wherein:

R6 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20

hydroxyalkyl group, and a C1-20 alkylamide group;

R15 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20

hydroxyalkyl group, C1-20 alkyl ester, C1-20 alkylthioester;

D is an oligonucleotide; and

n and r independently are 0 or 1 .

46. The compound as claimed in claim 45, wherein the compound

comprises one or more spacer moieties located between the oligonucleotide and the phosphate ester group, the one or more spacer moieties optionally having the formula: -0-R1 -0- wherein

R14 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20

hydroxyalkyl group, [-(0-CH2CH2)-]i-2o C1-20 alkyldisulphane, C1-20 aminoalkyl, C1-20 alkylether, C1-20 alkylthioether;

wherein optionally the spacer moiety is attached to the oligonucleotide via a phosphate ester; and

wherein the spacer moiety is optionally photocleavable.

47. The compound as claimed in claim 45 or claim 46, wherein R6 is a C-i-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group, [-(0-CH2CH2)-]i -20 , C1-20 alkyldisulphane, C1-20 aminoalkyl, C-i-20 alkylether, C1-20 alkylthioether.

The compound as claimed in any one of claims 37 to 44, wherein the linker roup is a phosphate ester group having the formula:

wherein:

B is a nucleobase;

D is an oligonucleotide; R is selected from H and a protecting group;

R9 is selected from H, OH, O-(tert-butyldimethylsilyl) (O- TBDMS) O-propargyl, ORc, halogen optionally F, NHRC and SRC;

R10 is selected from propargyl, propargyl amino, -NH(CH2)i- 20NH-, -NHCO(CH2)i-2oNH-, -NHCO(CH2)i-2oCO-, -NH(CH2)i-2oO-, - NH(CH2)1-20S-, -NHCO(CH2)1-20O-, -NHCO(CH2)1-20S-, - NHCO(CH2)1-20NH-, -NHCO(CH2)1-20O-, -NHCO(CH2)1-20S-, - O(CH2)i-20O-, -O(CH2)i-20NH-, -O(CH2)i-20S-, or a group having the formula:

R11 is selected from a Ci-2o alkyl group, a C2-2o alkenyl group, a Ci-2o haloalkyl group, a Ci-2o heteroalkyl group, a Ci-2o

hydroxyalkyl group;

R12 is selected from amide, ether, amine, thioether or a group having the formula:

X2 is selected from S, O and NRa;

Y2 and Y3 independently are selected from S, O, NRa';

Z1, Z2 and Z2' independently are selected from CH2, S, O,

NRa";

R13 is selected from a Ci-2o alkyl group, a C2-2o alkenyl group, a Ci-2o haloalkyl group, a Ci-2o heteroalkyl group, a Ci-2o

hydroxyalkyl group;

R15 is selected from a Ci-2o alkyl group, a C2-2o alkenyl group, a Ci-2o haloalkyl group, a Ci-2o heteroalkyl group, a Ci-2o

hydroxyalkyl group, Ci-2o alkyl ester, Ci-2o alkylthioester; Ra, Ra', Ra", Rb and Rb' independently are selected from H, a C-i-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C-i- 20 heteroalkyl group, and a C1-20 hydroxyalkyl group;

Rc is selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 hydroxyalkyl group, and a protecting group; and

m, p, q and r independently are 0 or 1 .

49. The compound as claimed in claim 48, wherein the compound

comprises one or more spacer moieties located between the oligonucleotide and the phosphate ester group, the one or more spacer moieties optionally having the formula: -0-R1 -0- wherein

R14 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20

hydroxyalkyl group, C-i-20 alkyldisulphane, C-i-20 aminoalkyl, C-i-20 alkylether, C-i-20 alkylthioether;

wherein optionally the spacer moiety is attached to the oligonucleotide via a phosphate ester; and

wherein the spacer moiety is optionally photocleavable.

50. The compound as claimed in claim 48 or claim 49, wherein B is pyrimidine or purine, or a derivative thereof.

51 . The compound as claimed in any one of claims 48 to 50, wherein B is selected from the group consisting of: adenine, guanine, cytosine, thymine, uracil, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine or 5-hydroxymethylcytosine.

52. The compound as claimed in any one of claims 48 to 51 , wherein B is selected from:

53. The compound as claimed in any one of claims 48 to 52, wherein R8 and Rc independently comprise a protecting group to protect the functionality thereof, optionally, wherein the protecting group is selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups.

54. The compound as claimed in claim 53, wherein the protecting group is selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β-methoxyethoxym ethyl ether (MEM), dimethoxytrityl, [bis-(4-methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4- methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri- iso-propylsilyloxymethyl (TOM), and thisopropylsilyl (TIPS) ethers) methyl ethers, and ethoxyethyl ethers (EE).

55. The compound as claimed in any one of claims 48 to 54, wherein R11 is a d-20 alkyl group, optionally a C-M O alkyl group, optionally a C-i-6 alkyl group.

56. The compound as claimed in any one of claims 48 to 55, wherein X2 is selected from O and NRa.

57. The compound as claimed in any one of claims 48 to 56, wherein Y2 and Y3 independently are selected from O and NRa'.

58. The compound as claimed in any one of claims 48 to 57, wherein Z1, Z2 and Z2' independently are selected from O and NRa".

59. The compound as claimed in any one of claims 48 to 58, wherein R13 and R15 independently are a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally, a C1-5 alkyl group.

60. The compound as claimed in any one of claims 48 to 59, wherein Ra, Ra', Ra', Rb, Rb' and Rc independently are selected from H and a d-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

61 . The compound as claimed in any one of claims 37 to 60, wherein R1, R2, R3, R4 and R5 independently are selected from H, a C-M O alkyl group, a C-MO hydroxyalkyl group, a C-MO hydroxyaryl group, a C-i-10 ketone group, a C-MO aldehyde group, a C-M O amine group, a C-i-10 ester group, a C-MO carboxylic acid group, a C-MO amide group, a C-MO enone group, a C-MO enamine group, a C-MO alkyl sulphide group, a C-MO alkyl disulphide group, and L.

62. The compound as claimed in any one of claims 37 to 61 , wherein R1, R2, R3, R4 and R5 independently are selected from H, a Ci-5 alkyl group, a C1-5 hydroxyalkyl group, a C1-7 hydroxyaryl group, a C1-5 ketone group, a C1-5 aldehyde group, a C1-5 amine group, a C1-5 ester group, a C1-5 carboxylic acid group, a C1-5 amide group, a C1-5 enone group, a C1-5 enamine group, a C1-5 alkyl sulphide group, a C1-5 alkyl disulphide group, and L.

63. The compound as claimed in any one of claims 37 to 62, wherein R1, R2, R3, R4 and R5 independently are selected from

H, -CH3, -OH, -CH2-OH, -CH2-NH2,

The compound as claimed in any one of claims 37 to 63, wherein one or more of R1, R2, R3, R4 and R5 independently are

wherein Ar is an aromatic heterocycle, optionally as defined in formula I, II or III.

65. The compound as claimed in any one of claims 37 to 64, wherein X1 is selected from 0 and NRa.

66. The compound as claimed in any one of claims 37 to 65, wherein Y1 is selected from 0 and NRa .

67. The compound as claimed in any one of claims 37 to 66, wherein Ra and Ra' independently are selected from H and a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

68. The compound as claimed in any one of claims 37 to 67, wherein the oligonucleotide is siRNA.

69. The compound as claimed in any one of claims 37 to 68, wherein the oligonucleotide comprises the sequence

G AC G AAG AAG AAG C G AG AAAC [SEQ ID NO. 1 ].

70. The compound as claimed in any one of claims 37 to 69, wherein the oligonucleotide comprises the sequence

GUUUCUCGCUUCUUCUUCGUC [SEQ ID NO. 2].

71 . A duplex comprising the compound of claim 69 and the compound of claim 70.

72. Use of a compound as a delivery agent for delivering an

oligonucleotide to a cell, the compound having formula I, II, III as claimed in claims 1 to 36, or having formula IV, V or VI as claimed in claims 37 to 71 .

73. A compound for use in the delivery of an oligonucleotide to a cell, the compound having formula I, II, III as claimed in claims 1 to 36, or having formula IV, V or VI as claimed in claims 37 to 71 .

74. A method of modifying an oligonucleotide by attaching to the

oligonucleotide a compound having formula I, II, III as claimed in claims 1 to 36.

75. A method of delivering an oligonucleotide to a cell using a

compound having formula I, II, III as claimed in claims 1 to 36, or having formula IV, V or VI as claimed in claims 37 to 71.

76. A compound having formula IV, V or VI as claimed in claims 37 to 71 for use as a medicament, a therapeutic agent or a

pharmaceutical.

77. A compound having formula IV, V or VI as claimed in claims 37 to 71 for use in the modulation of PTEN gene.

78. A compound having formula IV, V or VI as claimed in claims 37 to 71 for use in the treatment of cancer.

79. A compound having formula VII, VIII or IX:

VII

IX

wherein:

R1, R2, R3, R4 and R5 independently are selected from H, a C-i-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C-i- 20 heteroalkyl group, a C1-20 aryl group, a C1-20 heteroaryl group, a C-i-20 hydroxyalkyl group, a C1-20 hydroxyaryl group, a C1-20 ketone group, a C-i-20 aldehyde group, a C-i-20 amine group, a C-i-20 ester group, a C-i-20 carboxylic acid group, a C-i-20 amide group, a C1-20 enone group, a C-i-20 enamine group, a C-i-20 alkyl sulphide group, a C-i-20 alkyl disulphide group, and M;

X1 is selected from S, 0, NRa;

Y1 is selected from S, 0, NRa';

Ra and Ra' independently are selected from H, a C-i-20 alkyl group, a C2-20 alkenyl group, a C-i-20 haloalkyl group, a C-i-20 heteroalkyl group, and a C-i-20 hydroxyalkyl group;

wherein M is a cleavable linker group attached to a solid support; and wherein at least one of R1, R2, R3, R4 and R5 is M.

80. The compound as claimed in claim 79, wherein one of R1, R2, R3, R4 and R5 is M.

81 . The compound as claimed in claim 79 or claim 80, wherein R1, R2, R3, R4 and R5 independently comprise a protecting group to protect the functionality thereof.

82. The compound as claimed in claim 81 , wherein the protecting group is selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups.

83. The compound as claimed in claim 82, wherein the protecting group is selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β-methoxyethoxymethyl ether (MEM), dimethoxytrityl, [bis-(4-methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4- methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr),

fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri- iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers), methyl ethers, and ethoxyethyl ethers (EE).

84. The compound as claimed in any one of claims 79 to 83, wherein the cleavable linker group is reactive to a base.

85. The compound as claimed in any one of claims 79 to 84, wherein the cleavable linker group is configured to attach to an

oligonucleotide at the 5'-terminus or the 3'-terminus of an oligonucleotide.

86. The compound as claimed in any one of claims 79 to 85, wherein the solid support is selected from the list consisting of: glass and polystyrene.

87. The compound as claimed in any one of claims 79 to 86, wherein the solid support is controlled-pore glass (CPG).

88. The compound as claimed in any one of claims 79 to 87, wherein the cleavable linker group comprises a succinate group, phenoxyacetate or a glycolate group.

89. The compound as claimed in any one of claims 79 to 88, wherein cleavable linker group attached to a solid support is a group having the formula:

wherein:

J comprises a cleavable linker group;

E is a solid support;

R8 is a protecting group; R16 and R17 independently are selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 hydroxyalkyl group;

and

s is 0 or 1 .

90. The compound as claimed in claim 89, wherein R8 comprises a protecting group to protect the functionality thereof, optionally, wherein the protecting group is selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups and thiol protecting groups.

91 . The compound as claimed in claim 89 or claim 90, wherein R16 is a C-i-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

92. The compound as claimed in any one of claims 89 to 91 , wherein R16 has the followin formula:

93. The compound as claimed in any one of claims 89 to 92, wherein R17 is a C-i-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

94. The compound as claimed in any one of claims 89 to 93, wherein the cleavable linker group has the formula:

The compound as claimed in any one of claims 79 to 88, wherein cleavable linker group attached to a solid support is a group having the formula:

wherein:

B is a nucleobase;

J comprises a cleavable linker group;

E is a solid support;

R8 is selected from H and a protecting group;

R9 is selected from H, OH, O-(tert-butyldimethylsilyl) (0- TBDMS), O-propargyl, ORc, halogen optionally F, NHRC and SRC;

R10 is selected from propargyl, propargyl amino, -NH(CH2)i- 20NH-, -NHCO(CH2)i-2oNH-, -NHCO(CH2)i-2oCO-, -NH(CH2)i-2oO-, - NH(CH2)1-20S-, -NHCO(CH2)1-20O-, -NHCO(CH2)1-20S-, - NHCO(CH2)1-20NH-, -NHCO(CH2)1-20O-, -NHCO(CH2)1-20S-, - 0(CH2)i-2oO-, -O(CH2)i-20NH-, -O(CH2)i-20S-, or a group having the formula:

R11 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20

hydroxyalkyl group;

R12 is selected from amide, ether, amine, thioether or a group having the formula:

X2 is selected from S, 0 and NRa;

Y2 and Y3 independently are selected from S, 0 and NRa';

Z1, Z2 and Z2' independently are selected from CH2, S, 0,

NRa";

R13 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20

hydroxyalkyl group;

Ra, Ra' and Ra" independently are selected from H, a C-i-20 alkyl group, a C2-20 alkenyl group, a C-i-20 haloalkyl group, a C1-20 heteroalkyl group, and a C-i-20 hydroxyalkyl group;

Rc is selected from H, a C-i-20 alkyl group, a C2-20 alkenyl group, a C-i-20 haloalkyl group, a C-i-20 heteroalkyl group, a C1-20 hydroxyalkyl group, and a protecting group; and

m, p and q independently are 0 or 1 .

The compound as claimed in claim 95, wherein B is pyrimidine or purine, or a derivative thereof.

The compound as claimed in claim 95 or claim 96, wherein B is selected from the group consisting of: adenine, guanine, cytosine, thymine, uracil, hypoxanthine, xanthine, 7-methylguanine, 5,6- dihydrouracil, 5-methylcytosine or 5-hydroxymethylcytosine.

The compound as claimed in any one of claims 95 to 97, wherein B is selected from:

The compound as claimed in any one of claims 95 to 98, wherein the cleavable linker group has the formula:

100. The compound as claimed in any one of claims 95 to 99, wherein R8 and Rc independently are a protecting group.

101 . The compound as claimed in claim 100, wherein the protecting group is selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, and thiol protecting groups.

102. The compound as claimed in claim 101 , wherein the protecting group is selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β-methoxyethoxym ethyl ether (MEM), dimethoxytrityl, [bis-(4-methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4- methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri- iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers) methyl ethers, and ethoxyethyl ethers (EE).

103. The compound as claimed in any one of claims 95 to 102, wherein R11 is a d-20 alkyl group, optionally a C-MO alkyl group, optionally a C-i-6 alkyl group.

104. The compound as claimed in any one of claims 95 to 103, wherein X2 is selected from O and NRa.

105. The compound as claimed in any one of claims 95 to 104, wherein Y2 and Y3 independently are selected from O and NRa'.

106. The compound as claimed in any one of claims 95 to 105, wherein Z1, Z2 and Z2' independently are selected from 0 and NRa".

107. The compound as claimed in any one of claims 95 to 106, wherein R13 is a d-20 alkyl group, optionally a CMO alkyl group, optionally, a C-i-5 alkyl group.

108. The compound as claimed in any one of claims 95 to 107, wherein Ra, Ra', Ra" and Rc independently are selected from H and a Ci-2o alkyl group, optionally a C-MO alkyl group, optionally a C1-5 alkyl group.

109. The compound as claimed in any one of claims 79 to 108, wherein R1, R2, R3, R4 and R5 independently are selected from H, a C-M O alkyl group, a C-MO hydroxyalkyl group, a CMO hydroxyaryl group, a CM O ketone group, a CMO aldehyde group, a CM O amine group, a CM O ester group, a C-MO carboxylic acid group, a CMO amide group, a C-MO enone group, a C-MO enamine group, a CMO alkyl sulphide group, a C-MO alkyl disulphide group, and M.

1 10. The compound as claimed in any one of claims 79 to 109, wherein R1, R2, R3, R4 and R5 independently are selected from H, a C-1-5 alkyl group, a C1-5 hydroxyalkyl group, a C1-7 hydroxyaryl group, a C-1-5 ketone group, a C1-5 aldehyde group, a C1-5 amine group, a C1-5 ester group, a C1-5 carboxylic acid group, a C1-5 amide group, a C1-5 enone group, a C1-5 enamine group, a C1-5 alkyl sulphide group, a C-1-5 alkyl disulphide group, and M. The compound as claimed in any one of claims 79 to 1 10, wherein R1, R2, R3, R4 and R5 independently are selected from

H, -CH3, -OH, -CH2-OH, -CH2-NH2,

O

, and M. 12. The compound as claimed in any one of claims 79 to 1 1 1 , wherein one or more of R1, R2, R3, R4 and R5 independently are

S Ar

wherein Ar is an aromatic heterocycle, optionally as defined in formula I, II or III. 13. The compound as claimed in any one of claims 79 to 1 12, wherein X1 is selected from O and NRa. 14. The compound as claimed in any one of claims 79 to 1 13, wherein Y1 is selected from O and NRa'. 15. The compound as claimed in any one of claims 79 to 1 14, wherein Ra and Ra' independently are selected from H and a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

Description:
PYRIDINE DERIVATIVES AND METHODS OF USE

Field of the Invention

This invention relates to a set of compounds and to a method of using those compounds. In particular, the invention relates to compounds for use in the modification of compounds comprising nucleic acid sequences (such as oligonucleotides or the like), to modified oligonucleotides, to the delivery of modified oligonucleotides to cells and the like, and to the treatment of conditions by the delivery of modified oligonucleotides.

Background of the Invention

The following description will refer to the term "oligonucleotide(s)", which is used to refer generally to DNA or RNA molecules, and to nucleic acid analogue structures (such as, for example, PNA) unless a specific species is stated and/or the context dictates otherwise.

The use of oligonucleotides as therapeutic agents, in particular siRNA and antisense oligonucleotides, is still of great interest. There is much activity in this area such as modifications to the oligonucleotide backbone or the use of a delivery agent attached to the oligonucleotide. With respect to the latter, there is a range of compounds reported to have improved cell delivery. Due to the hydrophobic nature of the cell membrane lipid bilayer, these compounds are hydrophobic in nature. There are many examples of these agents including, for example, lipids, cationic lipids, cell penetrating peptides and cell targeting ligands.

One specific example that has been used is tocopherol (vitamin E, 1 ). Whilst all of these compounds have all been shown to enhance delivery and in some cases improve cell targeting, there are often associated problems. For example, the compounds used are often large, and therefore it is necessary to release the oligonucleotide from the delivery agent once in the cell to ensure that antisense activity is not compromised. One method of achieving this is the use of a disulphide bridge between the delivery agent and the oligonucleotide. However, when used in vivo there are potential toxicity issues since the delivery reagent is not recognised by cells. This leads to low cellular uptake of the oligonucleotide therapeutic hence increased dosages are required to obtain the desired therapeutic effect.

Therefore, it would be desirable to have a delivery agent that enables the delivery of oligonucleotides to cells and the like without compromising the activity of the oligonucleotide. Also, it would be desirable to have a delivery agent that enables the delivery of oligonucleotides to cells and the like, and wherein recognition of the delivery agent by the cell improves cellular uptake of oligonucleotides. In addition, it would be desirable to have a compound which could be used to attach such a delivery agent to nucleotides or oligonucleotides.

It is an object of the present invention to overcome or mitigate at least some of the problems of the prior art. Summary of the Invention

According to a first aspect of the invention there is provided a compound having formula I, II or III:

III

wherein:

R 1 , R 2 , R 3 , R 4 and R 5 independently are selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 aryl group, a C1-20 heteroaryl group, a C1-20 hydroxyalkyl group, a C1-20 hydroxyaryl group, a C1-20 ketone group, a C1-20 aldehyde group, a C1-20 amine group, a C1-20 ester group, a C1-20 carboxylic acid group, a C1-20 amide group, a C1-20 enone group, a C1-20 enamine group, a C1-20 alkyl sulphide group, a C1-20 alkyl disulphide group, and G;

X 1 is selected from S, 0, NR a ;

Y 1 is selected from S, 0, NR a '; R a and R a ' independently are selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C-i-20 hydroxyalkyl group;

wherein G is a reactive group configured to attach to a nucleotide; and

wherein at least one of R 1 , R 2 , R 3 , R 4 and R 5 is G. G may comprise a phosphoramidite group. The nucleotide may be an oligonucleotide. One of R 1 , R 2 R 3 , R 4 and R 5 may be G.

R 1 , R 2 , R 3 , R 4 and R 5 independently may comprise a protecting group to protect the functionality thereof.

The protecting group may be selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups.

The protecting group may be selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β- methoxyethoxym ethyl ether (MEM), dimethoxytrityl, [bis-(4- methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4-methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri-iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers), methyl ethers, and ethoxyethyl ethers

(EE).

The reactive group may be reactive to a nucleophilic group.

The nucleophilic group may be a hydroxyl group, an amine group, an amino group or a sulphur group.

The reactive group may be configured to attach to an oligonucleotide at the 5'-terminus or the 3'-terminus of an oligonucleotide.

The reactive group may be configured to attach to a nucleotide within an oligonucleotide sequence, and that is not the 5'-terminus or the 3'-terminus of the oligonucleotide.

The reactive group may be a hosphoramidite group having the formula:

wherein:

R 6 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 hydroxyalkyl group;

R 7 comprises a protecting group;

R b and R bl independently are selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C-i-20 hydroxyalkyl group; and

n is 0 or 1 .

R 6 may be a Ci-2o alkylamide group. R 7 may be phosphate protecting group, optionally selected from: a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C1-20 hydroxyalkyl group. R 7 may be a C1-20 nitrile group, optionally a C1-10 nitrile group, optionally a C1-5 nitrile group, optionally a cyanoethyl group.

R 6 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

R b and R bl independently may be selected from H and a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

The reactive group may be a phosphoramidite group having the formula:

wherein:

B is a nucleobase;

R 7 comprises a protecting group;

R 8 is selected from H and a protecting group;

R 9 is selected from H , OH, O-(tert-butyldimethylsilyl) (O-TBDMS), O-propargyl, OR c , halogen optionally F, NHR C and SR C ;

R 10 is selected from propargyl, propargyl amino, -NH(CH 2 )i-2oNH- , -NHCO(CH 2 )i-2oN H-, -NHCO(CH 2 )i- 2 oCO-, -NH(CH 2 )i- 2 oO-, -NH(CH 2 )i- 20S-, -NHCO(CH 2 )i-2oO-, -NHCO(CH 2 )i- 2 oS-, -NHCO(CH 2 )i- 2 oNH-, - NHCO(CH 2 )i-2oO-, -NHCO(CH 2 )i-2oS-, -0(CH 2 )i- 2 oO-, -O(CH 2 ) 1 -20 NH-, - O(CH 2 )i -20 S-, or a group having the formula:

R 1 1 is selected from a Ci -2 o alkyl group, a C 2-2 o alkenyl group, a C-i- 20 haloalkyl group, a Ci -2 o heteroalkyl group, a Ci -2 o hydroxyalkyl group;

R 12 is selected from amide, ether, amine, thioether or a group having the formula:

X 2 is selected from S, 0 and NR a ;

Y 2 and Y 3 independently are selected from S, 0 and NR a ';

Z 1 , Z 2 and Z 2 ' independently are selected from CH 2 , S, 0, NR a ";

R 13 may be selected from a Ci -2 o alkyl group, a C 2-2 o alkenyl group, a Ci- 2 o haloalkyl group, a Ci -2 o heteroalkyl group, a Ci -2 o hydroxyalkyl group;

R a , R a ', R a ", R b and R b ' independently are selected from H, a Ci -20 alkyl group, a C 2-2 o alkenyl group, a Ci -2 o haloalkyl group, a Ci -2 o heteroalkyl group, and a Ci -2 o hydroxyalkyl group;

R c is selected from H, a Ci -2 o alkyl group, a C 2-2 o alkenyl group, a Ci- 2 o haloalkyl group, a Ci -2 o heteroalkyl group, a Ci -2 o hydroxyalkyl group, and a protecting group; and

m, p and q independently are 0 or 1 .

R 7 may be selected from the list consisting of: a Ci -2 o nitrile group, a C 2-2 o alkenyl group, a Ci -2 o haloalkyl group, a Ci -2 o heteroalkyl group, and a C - 20 hydroxyalkyl group, and a Ci -2 o alkyl group. R 7 may be a C1-20 nitrile group, optionally a C1-10 nitrile group, optionally a C1-5 nitrile group, optionally a cyanoethyl group.

B may be pyrimidine or purine, or a derivative thereof.

B may be selected from the group consisting of: adenine, guanine, cytosine, thymine, uracil, hypoxanthine, xanthine, 7-methylguanine, 5,6- dihydrouracil, 5-methylcytosine or 5-hydroxymethylcytosine.

B ma be selected from:

R may comprise a protecting group to protect the functionality thereof.

R c may comprise a protecting group to protect the functionality thereof.

The protecting group may be selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups. The protecting group may be selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β- methoxyethoxym ethyl ether (MEM), dimethoxytrityl, [bis-(4- methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4-methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri-iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers) methyl ethers, and ethoxyethyl ethers (EE).

R 11 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-6 alkyl group.

X 2 may be selected from O and NR a .

Y 2 and Y 3 independently may be selected from O and NR a '. Z 1 , Z 2 and Z 2 ' independently may be selected from O and NR a ".

R 13 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally, a C1-5 alkyl group. R a , R a ', R a ", R b , R b ' and R c independently may be selected from H and a C-i-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

R 1 , R 2 , R 3 , R 4 and R 5 independently may be selected from H, a C1-10 alkyl group, a C1-10 hydroxyalkyl group, a C1-10 hydroxyaryl group, a C1-10 ketone group, a C-MO aldehyde group, a C-MO amine group, a C-MO ester group, a C-i-10 carboxylic acid group, a C-MO amide group, a C-MO enone group, a C-i- 10 enamine group, a C-MO alkyl sulphide group, a C-MO alkyl disulphide group, and G.

R 1 , R 2 , R 3 , R 4 and R 5 independently may be selected from H, a C1-5 alkyl group, a C1-5 hydroxyalkyl group, a C1-7 hydroxyaryl group, a C1-5 ketone group, a C1-5 aldehyde group, a C1-5 amine group, a C1-5 ester group, a Ci 5 carboxylic acid group, a C1-5 amide group, a C1-5 enone group, a C1-5 enamine group, a C1-5 alkyl sulphide group, a C1-5 alkyl disulphide group, and G.

R 1 , R 2 , R 3 , R 4 and R 5 independently may be selected from

H, -CH 3 , -OH, -CH2-OH, -CH2-NH2,

One or more of R 1 , R 2 , R 3 , R 4 and R 5 inde endently may be

wherein Ar is an aromatic heterocycle, optionally as defined in formula I, II or III. may be selected from O and NR 1 may be selected from O and NR 1 R a and R a ' independently may be selected from H and a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

According to second aspect of the invention there is provided

oligonucleotide compound having the formula IV, V or VI:

VI

wherein:

R 1 , R 2 , R 3 , R 4 and R 5 independently are selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 aryl group, a C1-20 heteroaryl group, a C1-20 hydroxyalkyl group, a C1-20 hydroxyaryl group, a C1-20 ketone group, a C1-20 aldehyde group, a C1-20 amine group, a C1-20 ester group, a C1-20 carboxylic acid group, a C1-20 amide group, a C1-20 enone group, a C1-20 enamine group, a C1-20 alkyl sulphide group, a C1-20 alkyl disulphide group, and L;

X 1 is selected from S, 0, NR a ;

Y 1 is selected from S, 0, NR a ';

R a and R a ' independently are selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C-i-20 hydroxyalkyl group;

wherein L is a linker group attached to an oligonucleotide; and wherein at least one of R 1 , R 2 , R 3 , R 4 and R 5 is L.

L may comprise a phosphate ester linker group or a phosphorothioate linker group; or a suitable derivative or analogue thereof.

One of R 1 , R 2 R 3 , R 4 and R 5 may be L.

R 1 , R 2 , R 3 , R 4 and R 5 independently may comprise a protecting group to protect the functionality thereof.

The protecting group may be selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups.

The protecting group may be selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β- methoxyethoxym ethyl ether (MEM), dimethoxytrityl, [bis-(4- methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4-methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri-iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers), methyl ethers, and ethoxyethyl ethers (EE).

The linker group may be attached to the oligonucleotide at the 5'-terminus or the 3'-terminus.

The linker group may be attached to a nucleotide within an oligonucleotide sequence, and that is not the 5'-terminus or the 3'-terminus of the oligonucleotide.

The linker group may comprise a phosphate ester, a phosphorothioate; or a suitable analogue or derivative thereof.

The linker group ma be a phosphate ester group having the formula:

wherein:

R 6 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 hydroxyalkyl group;

R 15 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i- 20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 hydroxyalkyl group, C-i-20 alkyl ester, C1-20 alkylthioester;

D is an oligonucleotide; and

n and r independently are 0 or 1 . R may be a C-i-2o alkylamide group.

The compound may comprise one or more spacer moieties located between the oligonucleotide and the phosphate ester group, the one or more spacer moieties optionally having the formula: -0-R 1 -0- wherein R 14 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i- 20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 hydroxyalkyl group, [- (O-CH2CH2H1-20 C1-20 alkyldisulphane, C1-20 aminoalkyl, C1-20 alkylether, C1-20 alkylthioether;

wherein optionally the spacer moiety is attached to the

oligonucleotide via a phosphate ester; and

wherein the spacer moiety is optionally photocleavable.

R may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group, [-(0-CH 2 CH 2 )-]i-2o , C1-20 alkyldisulphane, C1-20 aminoalkyl, C1-20 alkylether, C1-20 alkylthioether.

The linker group may be a phosphate ester group having the formula:

wherein:

B is a nucleobase;

D is an oligonucleotide;

R 8 is selected from H and a protecting group;

R 9 is selected from H, OH, O-(tert-butyldimethylsilyl) (O-TBDMS),

O-propargyl, OR c , halogen optionally F, NHR C and SR C ; R 10 is selected from propargyl, propargyl amino, -NH(CH 2 )i-2oNH- , -NHCO(CH 2 )i-2oN H-, -NHCO(CH 2 )i- 2 oCO-, -NH(CH 2 )i- 2 oO-, -NH(CH 2 )i- 2oS-, -NHCO(CH 2 )i- 20 O-, -NHCO(CH 2 )i.2oS-, -NHCO(CH 2 )i -2 oNH-, - NHCO(CH 2 )i-2oO-, -NHCO(CH 2 )i-2oS- -O(CH 2 ) 1-20 O-, -O(CH 2 ) 1-20 NH-, - O(CH 2 )i -20 S-, or a group havin the formula:

R 1 is selected from a d- 2 o alkyl group, a C 2-2 o alkenyl group, a d- 20 haloalkyl group, a Ci -20 heteroalkyl group, a Ci- 20 hydroxyalkyl group;

R 2 is selected from amide, ether, amine, thioether or a group having the formula:

X 2 is selected from S, 0 and NR a ;

Y 2 and Y 3 independently are selected from S, 0, NR a ';

Z 1 , Z 2 and Z 2 ' independently are selected from CH 2 , S, 0, NR a ";

R 13 is selected from a Ci -2 o alkyl group, a C 2-2 o alkenyl group, a d. 20 haloalkyl group, a Ci -20 heteroalkyl group, a Ci -20 hydroxyalkyl group;

R 15 is selected from a Ci -2 o alkyl group, a C 2-2 o alkenyl group, a d- 20 haloalkyl group, a Ci -20 heteroalkyl group, a Ci -20 hydroxyalkyl group, Ci- 2 o alkyl ester, Ci -2 o alkylthioester;

R a , R a ', R a ", R b and R b ', independently are selected from H, a Ci -20 alkyl group, a C 2-2 o alkenyl group, a Ci -2 o haloalkyl group, a Ci -2 o heteroalkyl group, and a Ci- 20 hydroxyalkyl group;

R c is selected from H, a Ci -2 o alkyl group, a C 2-2 o alkenyl group, a Ci- 20 haloalkyl group, a Ci -20 heteroalkyl group, a Ci -20 hydroxyalkyl group, and a protecting group; and

m, p, q and r independently are 0 or 1 . The compound may comprise one or more spacer moieties located between the oligonucleotide and the phosphate ester group, the one or more spacer moieties optionally having the formula: -0-R 1 -0- wherein R 14 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i- 20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 hydroxyalkyl group, C-i-20 alkyldisulphane, C1-20 aminoalkyl, C1-20 alkylether, C1-20

alkylthioether;

wherein optionally the spacer moiety is attached to the

oligonucleotide via a phosphate ester; and

wherein the spacer moiety is optionally photocleavable.

B may be pyrimidine or purine, or a derivative thereof.

B may be selected from the group consisting of: adenine, guanine, cytosine, thymine, uracil, hypoxanthine, xanthine, 7-methylguanine, 5,6- dihydrouracil, 5-methylcytosine or 5-hydroxymethylcytosine.

B may be selected from:

, and

R may comprise a protecting group to protect the functionality thereof. R c may comprise a protecting group to protect the functionality thereof.

The protecting group may be selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups.

The protecting group may be selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β- methoxyethoxym ethyl ether (MEM), dimethoxytrityl, [bis-(4- methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4-methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl

(TMS), tert-butyldimethylsilyl (TBDMS), tri-iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers) methyl ethers, and ethoxyethyl ethers (EE). R 11 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-6 alkyl group.

X 2 may be selected from O and NR a . Y 2 and Y 3 independently may be selected from O and NR a '.

Z 1 , Z 2 and Z 2 ' independently may be selected from O and NR a ".

R 13 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally, a C1-5 alkyl group. R 15 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally, C1-5 alkyl group.

R a , R a ', R a ', R b , R b ' and R c independently may be selected from H and a C-i-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

R 1 , R 2 , R 3 , R 4 and R 5 independently may be selected from H, a C1-10 alkyl group, a C1-10 hydroxyalkyl group, a C1-10 hydroxyaryl group, a C1-10 ketone group, a C1-10 aldehyde group, a C1-10 amine group, a C1-10 ester group, a C1-10 carboxylic acid group, a C1-10 amide group, a C1-10 enone group, a C-i- 10 enamine group, a C1-10 alkyl sulphide group, a C1-10 alkyl disulphide group, and L.

R 1 , R 2 , R 3 , R 4 and R 5 independently may be selected from H, a C1-5 alkyl group, a C1-5 hydroxyalkyl group, a C1-7 hydroxyaryl group, a C1-5 ketone group, a C1-5 aldehyde group, a C1-5 amine group, a C1-5 ester group, a C-i- 5 carboxylic acid group, a C1-5 amide group, a C1-5 enone group, a C1-5 enamine group, a C1-5 alkyl sulphide group, a C1-5 alkyl disulphide group, and L.

R 1 , R 2 , R 3 , R 4 and R 5 independently may be selected from

H, -CH 3 , -OH, -CH2-OH, -CH2-NH2,

One or more of R 1 , R 2 , R 3 , R 4 and R 5 inde endently may be

wherein Ar is an aromatic heterocycle, optionally as defined in formula I, II or III.

X 1 may be selected from O and NR a .

Y 1 may be selected from O and NR a .

R a and R a ' independently may be selected from H and a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

The oligonucleotide may be siRNA.

The oligonucleotide may comprise the sequence

G AC G AAG AAG AAG C G AG AAAC [SEQ ID NO. 1 ].

The oligonucleotide may comprise the sequence

GUUUCUCGCUUCUUCUUCGUC [SEQ ID NO. 2].

According to a third aspect of the invention there is provided a duplex comprising the compound of the second aspect, wherein the

oligonucleotide may comprise the sequence

GACGAAGAAGAAGCGAGAAAC, and the compound of the second aspect, wherein the oligonucleotide may comprise the sequence

GUUUCUCGCUUCUUCUUCGUC.

According to a fourth aspect of the invention, there is provided use of a compound as a delivery agent for delivering an oligonucleotide to a cell, the compound having formula I, II, III as described in the first aspect, or having formula IV, V or VI as described in the second aspect.

According to a fifth aspect of the invention, there is provided a compound for use in the delivery of an oligonucleotide to a cell, the compound having formula I, II, III as described in the first aspect, or having formula IV, V or VI as described in the second aspect.

According to a sixth aspect of the invention, there is provided a method of modifying an oligonucleotide by attaching to the oligonucleotide a compound having formula I, II, III as described in the first aspect.

According to a seventh aspect of the invention, there is provided a method of delivering an oligonucleotide to a cell using a compound having formula I, II, III as described in the first aspect, or having formula IV, V or VI as described in the second aspect.

According to an eighth aspect of the invention, there is provided a compound having formula IV, V or VI as described in the second aspect or the third aspect for use as a medicament, a therapeutic agent or a pharmaceutical.

According to a ninth aspect of the invention, there is provided a compound having formula IV, V or VI as described in the second aspect or as described in the third aspect for use in the modulation of PTEN gene.

According to a tenth aspect of the invention, there is provided a compound having formula IV, V or VI as described in the second aspect of as described in the third aspect for use in the treatment of cancer. According to an eleventh aspect of the invention, there is provided a compound having formula VII, VIII or IX:

VIII

IX

wherein:

R 1 , R 2 , R 3 , R 4 and R 5 independently are selected from H, a C 1 - 2 0 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C 1 - 2 0 aryl group, a C 1 - 2 0 heteroaryl group, a C 1 - 2 0 hydroxyalkyl group, a C 1 - 2 0 hydroxyaryl group, a C 1 - 2 0 ketone group, a C 1 - 2 0 aldehyde group, a C1-20 amine group, a C1-20 ester group, a C1-20 carboxylic acid group, a C1-20 amide group, a C1-20 enone group, a C1-20 enamine group, a C 1 - 2 0 alkyl sulphide group, a C 1 - 2 0 alkyl disulphide group, and M;

X 1 is selected from S, 0, NR a ; Y 1 is selected from S, 0, NR a ';

R a and R a ' independently are selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C-i-20 hydroxyalkyl group;

wherein M is a cleavable linker group attached to a solid support; and

wherein at least one of R 1 , R 2 , R 3 , R 4 and R 5 is M. One of R 1 , R 2 R 3 , R 4 and R 5 may be M.

R 1 , R 2 , R 3 , R 4 and R 5 independently may comprise a protecting group to protect the functionality thereof.

The protecting group may be selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, carbonyl protecting groups, carboxylic acid protecting groups, phosphate protecting groups, thiol protecting groups, and terminal alkyne protecting groups.

The protecting group may be selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β- methoxyethoxym ethyl ether (MEM), dimethoxytrityl, [bis-(4- methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4-methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri-iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers), methyl ethers, and ethoxyethyl ethers (EE). The cleavable linker group may be reactive to a base.

The cleavable linker group may be configured to attach to an

oligonucleotide at the 5'-terminus or the 3'-terminus of an oligonucleotide.

The solid support may be selected from the list consisting of: glass and polystyrene.

The solid support may be controlled-pore glass (CPG).

The cleavable linker group may comprise a succinate group,

phenoxyacetate or a glycolate group.

The cleavable linker group attached to a solid support is a group may have the formula:

wherein:

J comprises a cleavable linker group;

E is a solid support;

R 8 is a protecting group;

R 16 and R 17 independently are selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C-i - 20 hydroxyalkyl group;

and

s is O or l R may comprise a protecting group to protect the functionality thereof, optionally, wherein the protecting group is selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups, and thiol protecting groups.

R 16 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group. a have the following formula:

R 17 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

The cleavable linker group may have the form

The cleavable linker group attached to a solid support is a group may have the formula:

wherein:

B is a nucleobase;

J comprises a cleavable linker group;

E is a solid support;

R is selected from H and a protecting group;

R 9 is selected from H, OH, O-(tert-butyldimethylsilyl) (O-TBDMS), O-propargyl, OR c , halogen optionally F, NHR C and SR C ;

R 10 is selected from propargyl, propargyl amino, -NH(CH 2 )-i -20 NH- , -NHCO(CH 2 )i-2oN H-, -NHCO(CH 2 )i- 2 oCO-, -NH(CH 2 )i- 2 oO-, -NH(CH 2 )i- 2oS-, -NHCO(CH 2 )i.2oO-, -NHCO(CH 2 ) 1 -20 S-, -NHCO(CH 2 ) 1 -20 NH-, - NHCO(CH 2 ) 1 -20 O-, -NHCO(CH 2 ) 1 -20 S-, -O(CH 2 ) 1 -2 oO-, -O(CH 2 ) 1 -20 NH-, - O(CH 2 )i -20 S-, or a group havin the formula:

R 1 1 is selected from a Ci -2 o alkyl group, a C 2-2 o alkenyl group, a Ci

20 haloalkyl group, a Ci -2 o heteroalkyl group, a Ci- 20 hydroxyalkyl group;

R 12 is selected from amide, ether, amine, thioether or a group having the formula:

X 2 is selected from S, O and NR a ;

Y 2 and Y 3 independently are selected from S, O and NR a ';

Z 1 , Z 2 and Z 2 ' independently are selected from CH 2 , S, O, NR a "; R 13 is selected from a C1-20 alkyl group, a C2-20 alkenyl group, a C-i - 20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 hydroxyalkyl group;

R a , R a ' and R a " independently are selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, and a C1-20 hydroxyalkyl group;

R c is selected from H, a C1-20 alkyl group, a C2-20 alkenyl group, a C1-20 haloalkyl group, a C1-20 heteroalkyl group, a C1-20 hydroxyalkyl group, and a protecting group; and

m, p and q independently are 0 or 1 .

B may be pyrimidine or purine, or a derivative thereof.

B may be selected from the group consisting of: adenine, guanine, cytosine, thymine, uracil, hypoxanthine, xanthine, 7-methylguanine, 5,6- dihydrouracil, 5-methylcytosine or 5-hydroxymethylcytosine.

B ma be selected from:

The cleavable linker group may have the formula:

R may be a protecting group. R c may be a protecting group.

The protecting group may be selected from one or more of the list consisting of: alcohol protecting groups, amine protecting groups and thiol protecting groups.

The protecting group may be selected from one or more of the list consisting of: acetyl (Ac), benzoyl (Bz), benzyl (Bn, Bnl) β- methoxyethoxym ethyl ether (MEM), dimethoxytrityl, [bis-(4- methoxyphenyl)phenylmethyl] (DMT), methoxymethyl ether (MOM), methoxytrityl [(4-methoxyphenyl)diphenylmethyl] (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl (triphenylmethyl, Tr), fluorenylmethoxy carbonyl (Fmoc), levulinyl (Lev), silyl ether (for example, trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri-iso-propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers) methyl ethers, and ethoxyethyl ethers (EE).

R 11 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-6 alkyl group. X 2 may be selected from 0 and NR a .

Y 2 and Y 3 independently may be selected from 0 and NR a '. Z 1 , Z 2 and Z 2 ' independently may be selected from 0 and NR a ".

R 13 may be a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally, a C1-5 alkyl group. R a , R a ', R a " and R c independently may be selected from H and a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

R 1 , R 2 , R 3 , R 4 and R 5 independently may be selected from H, a C1-10 alkyl group, a C1-10 hydroxyalkyl group, a C1-10 hydroxyaryl group, a C1-10 ketone group, a C1-10 aldehyde group, a C1-10 amine group, a C1-10 ester group, a C-i-10 carboxylic acid group, a C1-10 amide group, a C1-10 enone group, a C-i- 10 enamine group, a C1-10 alkyl sulphide group, a C1-10 alkyl disulphide group, and M. R 1 , R 2 , R 3 , R 4 and R 5 independently may be selected from H, a C1-5 alkyl group, a C1-5 hydroxyalkyl group, a C1-7 hydroxyaryl group, a C1-5 ketone group, a C1-5 aldehyde group, a C1-5 amine group, a C1-5 ester group, a C-i- 5 carboxylic acid group, a C1-5 amide group, a C1-5 enone group, a C1-5 enamine group, a C1-5 alkyl sulphide group, a C1-5 alkyl disulphide group, and M.

R 1 , R 2 , R 3 , R 4 and R 5 independently may be selected from

H, -CH 3 , -OH, -CH2-OH, -CH2-NH2,

One or more of R 1 , R 2 , R 3 , R 4 and R 5 inde endently may be

wherein Ar is an aromatic heterocycle, optionally as defined in formula I, II or III.

X 1 may be selected from O and NR a .

Y 1 may be selected from O and NR a '.

R a and R a ' independently may be selected from H and a C1-20 alkyl group, optionally a C1-10 alkyl group, optionally a C1-5 alkyl group.

Brief Description of the Drawings

Embodiments of the invention will now be described, by way of example only, with reference to the drawings, in which: Figure 1 is a graph showing the effects of chemically modified antisense oligonucleotides on PTEN expression where the

oligonucleotides were screened in stable 293HEK cells stably expressing the PTENpgl asRNA alpha exon 1

Figure 2 is a typical RP-HPLC trace of compound 112, C18, 0-50% MeCN in 0.1 M TEAA(aq), 1 ml_/min, 254nm UV detection; Figure 3 is a typical RP-HPLC trace of compound 113, C18, 0- 100% MeCN in 0.1 M TEAA(aq), 1 ml_/min, 254nm UV detection;

Figure 4 is typical LCMS data of compound 112; Calculated Mass; 3320.60Da; and

Figure 5 is typical LCMS data of compound 113; Calculated Mass;

3970.90Da.

Detailed Description

A range of pyridine based synthesis reagents derived from vitamins such as niacin (2) and pyridoxine 3) was prepared.

2

Niacin is an essential vitamin and is one of only five where deficiency results in a pandemic deficiency disease, in this case pellagra. It is known for its therapeutic effects as a lipid lowering drug. This works by inhibiting the production of cyclic AMP thereby preventing the liver from producing LDL. Recently niacin has been shown to improve the ability of immune cells to kill staphylococcus bacteria (responsible for MRSA).

Pyridoxine has several biological functions such as, for example: red blood cell production, homocysteine reduction, inflammation reduction and neurotransmitter production.

Niacin Derived Synthesis Reagents

Niacin and nicotinamide (4) have many derivatives including picolinic acid derivatives that can easily be converted to reagents for use in

oligonucleotide synthesis. Examples of these are shown below (5, 6, 7, 8, 9 and 10) where OR' is replaced with 'NHR' in the case of nicotinamide derivatives.

Examples of niacin derivatives for use in the preparation of oligonucleotide synthesis reagents

10

One advantage of using compounds where the carboxylic acid is protected as an ester (e.g., R = methyl) is that once incorporated into an

oligonucleotide, the deprotection method used will determine whether the resulting modifier is a niacin or a nicotinamide derivative. For instance 6- hydroxymethyl nicotinic acid (11) is easily converted to a phosphoramidite. A cyanoethyl phosphoramidite for incorporation into the 5'-end of an oligonucleotide is shown at 12. This is achieved by reaction with a suitable phosphitylating reagent, in this case 2-cyanoethyl-N,N- diisopropylchlorophosphoramidite. The reaction conditions are described below.

Synthesis of 5'-6-hydroxymethylniacin CE phosphoramidite

11 12

5'-6-hvdroxymethylniacin CE phosphoramidite

6-hydroxymethyl nicotinic acid methyl ester (11 ) (10.0 g, 59.8 mmol) was azeotroped with acetonitrile ( 2 x 100 mL) then dissolved in

dichloromethane (alcohol free, 150 mL) and treated with

diisopropylethylamine (12.5 mL, 71 .8 mmol) followed by 2-cyanoethyl-N,N- diisopropylchlorophosphoramidite (13.4g, 56.8 mmol). The reaction mixture was stirred at RT, under argon for 1 .5 hours. TLC (1 : 1 hexane: EtOAc, visualised by PMA/heat) showed reaction completion (SM Rf ~ 0.3, prod Rf ~ 0.5).

The mixture was washed with sat. NaHC03( aq ) (100 mL) and the layers were separated. The organic phase was washed with 100 mL sat. then dried over anhydrous sodium sulphate, filtered and concentrated in vacuo to give a brown oil. This was triturated with pentane (2 x 150 mL).

The crude material was purified by flash column chromatography on pre- equilibrated silica gel (1 : 1 EtOAc : pentane + 1 % NEt 3 ) eluting with 1 : 1 EtOAc : pentane, the crude product was loaded in DCM. Product containing fractions were selected by TLC and concentrated in vacuo to give a colourless oil. This was azeotroped with MeCN and dried on the freeze-drier overnight to give 12 (6.55g, 30%).

The amidite (12) was incorporated into the 5'-end of oligonucleotides using automated solid phase phosphoramidite chemistry on an ABI394

DNA/RNA synthesiser. Cleavage and deprotection was achieved using the conditions shown in Table 1 where the solid support containing the fully protected modified oligonucleotide from the synthesis column was transferred to a suitable sample tube for cleavage and deprotection. The cleavage and deprotection reagent was added (600μΙ_) and the reaction carried out as per the conditions detailed in Table 1 .

Table 1 : Oligonucleotide deprotection conditions In all cases niacin modified oligonucleotides were stable to the

deprotection conditions shown in Table 1 , but the conditions used determine whether a niacin or a nicotinamide derivative is formed as shown in the reaction scheme below. Reaction Scheme: Incorporation of 12 into an oligonucleotide and deprotection to give niacin and nicotinamide derivatives

Reaction conditions used are as follows: i: 0.4M NaOH in MeOH/water 4: 1 , ii: ammonium hydroxide, iii: ammonium hydroxide/methylamine (AMA).

Synthesis and Deprotection of 5'-Niacin Labelled Oligonucleotides

A series of 5'-niacin-dTi 0 oligonucleotides were synthesised to determine the optimum oligonucleotide deprotection conditions. In all cases these were synthesised on an ABI394 DNA/RNA synthesiser at 1 pmol scale using 0.25M ETT activator, 0.1 M amidites in anhydrous acetonitrile, 0.02M oxidiser solution, acetic anhydride/pyridine/N-methylimidazole capping agents and 3% TCA/DCM. 10OOA dT functionalised CPG was used throughout. Compound 12 was coupled for 15m in and dT bases coupled for 30s.

Cleavage and deprotection was achieved using the methods outlined in Table 1 . The deprotection solution was removed by passing through a G25 sephadex column prior to quantification and analysis by RP-HPLC (C18; 0-50% MeCN in 0.1 M TEAA over 20m in, 1 ml_/min) and LCMS (C18; 0-100%MeOH in 190mM HFIP / 7mMTEA with 5% MeOH over 16min, 0.4ml_/min).

Niacin modified oligonucleotides proved stable to all deprotection conditions shown in Table 1 . The conditions used determine whether a niacin (13) or a nicotinamide (14 or 15) derivative is formed are shown in the reaction scheme below.

Reaction scheme showing incorporation of 12 into an oligonucleotide and deprotection to give niacin and nicotinamide derivatives

Pyridoxine Derived Synthesis Reagents

As with niacin, pyridoxine has many derivatives that can be converted into oligonucleotide synthesis reagents. Examples of these are given as compounds 16, 17, 18, 19, 20 and 21.

Examples of pyridoxine derivatives for use in the preparation of

oligonucleotide synthesis reagents

Unlike the niacin derivatives, some protection of these molecules is required prior to the phosphitylation reaction. Since pyridoxal phosphate (22) is thought to be the active form of this vitamin, it was decided that these modifiers will be conjugated to the oligonucleotide via the phenolic OH group, thereby leaving the other functionalities available as potential active sites as illustrated the reaction scheme iven below.

22

Reaction scheme for incorporation of pyridoxine derivative to the 5'-end of oligonucleotides

The synthesis of two different amidites is described below. 5'-Pyridoxine CE Phosphoramidite

Synthetic Route to 5'-Pyridoxine CE Phosphoramidite

Preparation of Compound 23

Pyridoxine hydrochloride (20g, 97mmol) was azeotroped with acetonitrile then dissolved in dichloromethane (195ml_) and triethylamine (54ml_, 397mmol) added followed by acetic anhydride (18.3ml_, 194mmol). The reaction was stirred overnight at ambient temperature under argon.

The mixture was washed with sat. NaHC03( aq ) (200 ml_) and the layers separated. The organic phase was washed with 200 ml_ sat. then dried over anhydrous sodium sulphate, filtered and concentrated in vacuo to give a thick oil. The crude material was purified by flash column chromatography on silica gel eluting with 1 : 1 EtOAc : pentane, the crude product was loaded in DCM. Product containing fractions were selected by TLC and concentrated in vacuo to give a white solid which was dried under vacuum overnight resulting in 23 (5.36g, 22%).

Preparation of Compound 24

Compound 23 (4g, 15.8mmol) was azeotroped with acetonitrile then dissolved in alcohol free dichloromethane (80ml_) and

diisopropylethylamine (4.1 ml_, 23.7mmol) added. This was followed by the addition of 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite (3.4g, 14.2mmol). The reaction was allowed to stir at ambient temperature under argon for 1 hr after which time the mixture was reduced in volume and purified by column chromatography on pre-equilibrated silica gel (1 : 1 EtOAc : pentane + 1 % NEt 3 ) eluting with 1 : 1 EtOAc : pentane. Product containing fractions were selected by TLC and concentrated in vacuo to give a colourless oil which was dried under vacuum overnight resulting in 24 (2.1 g, 30%).

The amidite (23) was incorporated into the 5'-end of oligonucleotides using solid phase phosphoramidite chemistry. Dimethoxytrityl Protected Pyridoxine CE Phosphoramidite

Synthetic route to DMT protected pyridoxine CE phosphoramidite

25 26

This amidite (26) allows cartridge purification of the oligonucleotide in addition to further modification of the pyridoxine unit e.g. by the incorporation of phosphate groups via the use of a chemical

phosphorylation reagent such as 27.

27

Preparation of Compound 25

Pyridoxine hydrochloride (25g, 148mmol) was azeotroped with pyridine then dissolved in pyridine (500ml_) and the solution stirred at ambient temperature under argon. A solution of 4,4'-dimethoxytritylchloride (1 OOg, 295mmol) in dichloromethane (200ml_) and pyridine (50ml_) was added dropwise over the course of 1 hr. The reaction was allowed to stir overnight after which time the solution was reduced in volume and diluted with dichloromethane. The resulting solution was washed with water (500ml_) and brine (500ml_). The organic phase was dried (Na 2 S0 4 ) and evaporated to dryness to give a thick orange oil. This was taken up in dichloromethane (30ml_) and purified by column chromatography on silica gel eluting with a gradient of hexane/ethyl acetate 2:1 to 1 : 1 . Product containing fractions were selected by TLC and concentrated in vacuo to give an orange foam which was dried under vacuum overnight resulting in 25 (85g, 75%).

Preparation of Compound 26

Compound 25 (5g, 6.5mmol) was azeotroped with acetonitrile then dissolved in alcohol free dichloromethane (40ml_) and

diisopropylethylamine (2ml_, 1 1 .5mmol) added. This was followed by the addition of 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite (1 .5g, 6.5mmol). The reaction was allowed to stir at ambient temperature under argon for 1 hr after which time the mixture was reduced in volume and purified by column chromatography on pre-equilibrated silica gel (1 : 1 EtOAc : pentane + 1 % NEt 3 ) eluting with 1 : 1 EtOAc : pentane. Product containing fractions were selected by TLC and concentrated in vacuo to give a colourless oil which was dried under vacuum overnight resulting in 26 (6.3g, 50%).

The amidite was incorporated into the 5'-end of oligonucleotides using solid phase phosphoramidite chemistry.

Therefore, in one embodiment of the invention there is provided the compounds as described herein. In a further embodiment of the invention there is provided a method of modifying an oligonucleotide by attaching to the oligonucleotide a compound as described herein.

Further synthetic routes to niacin and pyridoxine phosphoramidites

Et 3 N (45.0 mL, 323 mmol) and TBSCI (38.8 g, 257 mmol) were added sequentially to a stirred solution of 6-aminohexanol 101 (25.0 g, 213 mmol) and DMAP (3.00 g, 24.6 mmol) in CH 2 CI 2 (375 mL) at rt. The reaction was stirred for 15 h at rt whereupon it was judged complete by TLC (CH 2 Cl2/MeOH, 9:1 , stained ninhydrin dip). The mixture was concentrated under vacuum, dissolved in Et 2 0 (250 mL) and washed with sat. aq. NaHC0 3 (3 x 200 mL) and brine (200 mL). The isolated organic layer was dried over Na 2 S0 4 , filtered and concentrated to a crude yellow oil. Purification of the crude material was achieved by flash chromatography on silica gel (eluting CH 2 CI 2 to CH 2 Cl 2 /MeOH, 9: 1 ) to afford the desired silyl ether 102 (47 g, 95%) as a colourless oil; 1 H NMR (CDCI3, 400 MHz) δ 3.46 (2H, t, J = 6.5 Hz, CH 2 -C1 ), 3.24 (2H, bs, NH 2 ), 2.55 (2H, m, CH 2 -C6), 1 .36 (4H, m, CH 2 -C5 and CH 2 -C6), 1 .20 (4H, m, CH 2 -C4 and CH 2 -C3), 0.74 (9H, s, CHs-'BuSi), 0.00 (6H, s, CH 3 -MeSi); 13 C NMR (CDCI3, 100 MHz) δ 63.0 (CH 2 -C1 ), 41 .5 (CH 2 -C6), 32.7 (CH 2 -C2), 32.5 (CH 2 -C5), 25.9 (CH 2 -C3 and CH2-C4), 25.54 (CHs-'BuSi), 18.25 C-'BuSi), 5.4 (CHs-MeSi).

102

Dimethyl 2,5-pyridine dicarboxylate 103 (5.00 g, 25.6 mmol) was suspended in a mixture of THF (55 mL) and MeOH (105 mL) in a 500 mL RBF. Calcium chloride (1 1 .4 g, 102 mmol) was added in a single portion and the mixture stirred at rt for 5 mins. TBS-aminohexanol 102 (7.10 g, 30.7 mmol) was then added via syringe over 10 mins and the reaction stirred at rt overnight. The solution was concentrated in vacuo to give a yellow gum which was dissolved in EtOAc (150 mL) and washed with deionised water (150 mL). The aqueous phase was back-extracted with EtOAc (100 mL) and combined organic phases dried over Na 2 SO 4 .

Filtration and concentration afforded a pale yellow, opaque oil. Purification of the crude product was achieved by flash chromatography on silica gel (eluting hexane/EtOAc, 85:15) to afford a colourless oil. On drying under vacuum overnight the desired amide 104 was isolated as waxy white solid (5.41 g, 53%); R f 0.62 (hexane/EtOAc, 4: 1 , KMnO 4 stain); 1 H NMR (500 MHz, CDCI3) δ 9.10 (1 H, dd, J = 2.1 , 0.9 Hz, CH-C12), 8.41 (1 H, dd, J = 8.2, 2.1 Hz, CH-C10), 8.25 (1 H, dd, J = 8.2, 0.9 Hz, CH-C9), 8.06 (1 H, br s, NH amide) 3.95 (3H, s, CH 3 -C14), 3.57 (2H, t, J = 6.5 Hz, CH 2 -C1 ), 3.46 (2H, dt, J = 7.1 , 6.5 Hz, CH-C6), 1 .67-1 .60 (2H, m, CH 2 -C2), 1 .54-1 .47 (2H, m, CH 2 -C5), 1 .43-1 .32 (4H, m, CH 2 -C3 and CH 2 -C4), 0.86 (9H, s, CHs-'BuSi), 0.01 (6H, s, CH 3 -MeSi); 13 C NMR (125 MHz, CDCI 3 ) δ 165.2 (C-C13), 163.3 (C-C7), 153.1 (C-C8), 149.4 (CH-C12), 138.7 (CH-C10), 128.0 (C-C1 1 ), 121 .9 (CH-C9), 63.2 (CH 2 -C1 ), 52.7 (CH 3 -C14), 39.7 (CH 2 - C6), 32.8 (CH 2 -C2), 29.7 (CH 2 -C5), 26.9 (CH 2 -C3), 26.1 (CHs-'BuSi), 25.7 (CH 2 -C4), 18.4 (C-'BuSi), -5.18 (CH 3 -MeSi).

104 105

TBAF (16 mL, 16 mmol, 1 .0 M solution in THF) was added to a stirred solution of silyl ether 104 (5.2 g, 13 mmol) in THF (70 mL) at rt. The reaction was monitored by TLC (hexane/EtOAc, 2: 1 ) at 30 minutes and judged incomplete. A further portion of TBAF (8.0 mL, 8.0 mmol) was added and the solution stirred for a further 45 min whereupon the reaction was judged complete. The reaction material was partitioned between CH 2 CI 2 (200 mL) and deionised water (200 mL). The organic phase was isolated and the aqueous back extracted with further CH 2 CI 2 (50 mL), the combined organic layers were dried over Na 2 S0 4 , filtered and

concentrated to a yellow oil. The material was purified by column chromatography on silica gel (eluting with hexane/EtOAc, 2: 1 ) fractions judged pure by TLC were collected and concentrated to a clear, colourless oil (1.7 g, 45%) on drying overnight under high vacuum; R f 0.23

(hexane/EtOAc, 2: 1 , PMA stain); 1 H NMR (CDCI 3 , 500 MHz): δ 9.12 (1 H, dd, J = 2.1 , 0.9 Hz, CH-C12), 8.43 (1 H, dd, J = 8.2, 2.1 Hz, CH-C10), 8.26 (1 H, dd, J = 8.2, 0.9 Hz, CH-C9), 8.1 1 (1 H, br s, NH), 3.97 (3H, s, CH 3 - C14), 3.63 (2H, t, J = 6.5 Hz, CH 2 -C1 ), 3.48 (2H, dt, J = 7.2, 6.2 Hz, CH 2 - C6), 1 .97 (1 H, s, OH), 1.69-1 .62 (1 H, m, CH 2 -C2), 1 .61-1 .54 (2H, m, CH 2 - C5), 1 .46-1 .36 (4H, m, CH 2 -C3 and CH 2 -C4); 13 C NMR (CDCI 3 , 125 MHz) δ 165.2 (C-C13), 163.3 (C-C7), 152.9 (C-C8), 149.3 (CH-C12), 138.9 (CH-C10), 128.1 (C-C1 1 ), 122.1 (CH-C9), 62.8 (CH 2 -C1 ), 52.8 (CH 3 -C14), 39.6 (CH 2 -C6), 32.7 (CH 2 -C2), 29.7 (CH 2 -C5), 26.7 (CH 2 -C4), 25.4 (CH 2 - C3).

105 106

Alcohol 105 (1.6 g, 5.6 mmol) was azeotroped with MeCN (2 x 10 mL) and dissolved in CH 2 CI 2 (30 mL, alcohol free) under an Ar blanket.

Phosphitylating reagent (1 .7 g, 5.6 mmol) was added, followed by DIHT (0.5 g, 2.8 mmol) and the mixture stirred at rt overnight. Reaction progress was monitored by RP-HPLC (HPLC [C18, 0-100% MeCN: 0.1 M TEAA gradient, 25 mins]: product, 23.0 mins, starting material, 9.6 mins; HPLC [C18, 70% MeCN:30% 0.1 M TEAA isocratic, 20 mins]: product 8.9 mins, starting material 1.7 mins. showed 4% SM remaining). The reaction mixture was transferred to a separating funnel and washed sequentially with NaHCO 3 (30 mL, 5% aq. solution) and brine (30 mL). The organic phase was back-extracted with CH 2 CI 2 (10 mL) and the combined organic phases dried over Na 2 SO 4 , filtered and concentrated in vacuo.. The material was purified by flash column chromatography on silica gel

(packed hexane/EtOAc/Et 3 N, 66:33: 1 , washed hexane/EtOAc, 2: 1 and eluted hexane/EtOAc, 1 : 1 ). Pure fractions were identified by RP-HPLC (C18, 70% MeCN:30% 0.1 M TEAA isocratic, 20 mins) and concentrated to a clear oil. Upon dissolution in acetonitrile (40 mL) the material was filtered through a 10 micron sinter to remove particulates, washed with further acetonitrile (30 mL) concentrated and dried overnight under vacuum. The desired phosphoramidite 106 (2.2 g, 81 %) was isolated as a clear, colourless oil. 1 H NMR (CD 3 CN, 500 MHz) δ 9.04 (1 H, dd, J = 2.1 , 0.9 Hz, CH-C12), 8.36 (1 H, dd, J = 8.1 , 2.1 Hz, CH-C10), 8.19 (1 H, t, J = 6.2 Hz, NH amide), 8.14 (1 H, dd, J = 8.1 , 0.9 Hz, CH-C9), 3.90 (3H, s, CH 3 -C14), 3.81-3.68 (2H, m, CH-C15 and CH-C15'), 3.65-3.48 (4H, m, CH 2 -C1 and CH 2 -C17), 3.42-3.32 (2H, m, CH 2 -C6), 2.66-2.58 (2H, m, CH 2 -C18),

1 .63-1 .51 (4H, m, CH 2 -C2 and CH 2 -C5), 1 .37 (4H, m, CH 2 -C3 and CH 2 - C4), 1 .13 (1 H, dd, J = 6.8, 5.3 Hz, CH 3 -C16 and CH 3 -C16'); 13 C NMR (125 MHz, CD 3 CN): δ 165.9 (C-C13), 163.9 (C-C7), 154.2 (C-C8), 150.1 (CH- C12), 139.3 (CH-C10), 128.9 (C-C1 1 ), 122.5 (CH-C9), 1 19.5 (C-C19), 64.2 (d, 2 JC-P= 16 Hz, CH 2 -C1 ), 59.2 (d, 19 Hz, CH 2 -C17), 53.2

(CH 3 -C14), 43.6 (d, 2 J C -p = 12 Hz, CH-C15), 40.0 (CH 2 -C6), 31 .8 (d, 3 J C -p = 7 Hz, CH 2 -C2) 30.3 (CH 2 -C5), 27.3 (CH 2 -C4), 26.4 (CH 2 -C3), 24.9 (d, 3 J C -p = 7 Hz, CH 3 -C16) 21.0, (d, 3 J C -p = 12 Hz, CH-C18); 31 P NMR: δ 147.6 (>99%)

3 25

Pyridoxine hydrochloride 3 (25.0 g, 0.121 mol) was azeotroped with pyridine (200 mL), suspended in pyridine (250 mL) and placed under an Ar blanket. DMTrCI (90.6 g, 0.267 mol) dissolved in a mixture of CH 2 CI 2 (300 mL) and pyridine (50 mL) was added to the suspension dropwise, complete dissolution was observed after approximately half the DMTrCI solution was added and the solution stirred at rt overnight. The reaction mixture was concentrated in vacuo to afford a yellow gum which was subsequently dissolved in CH 2 CI 2 (750 ml_) and washed sequentially with deionised water (500 ml_) and brine (500 ml_). The aqueous phase was back-extracted with CH 2 CI 2 (50 ml_), the combined organic phases were then dried over Na 2 S0 4 , filtered and concentrated in vacuo. The crude material was purified by flash chromatography on silica gel (packed hexane/EtOAc/NEts, 2: 1 :0.01 and eluted with hexane/EtOAc, 2: 1 to 1 : 1 ), pure fractions were identified by TLC (hexane/EtOAc, 1 : 1 ), pooled and concentrated to afford a bright yellow foam. Acetonitrile (200 ml_) was added to the product and the solids from the resulting suspension isolated by filtration. The solids were washed with further acetonitrile (2 x 100 ml_) to afford a free-flowing pale yellow powder, which on drying for 2 h under vacuum afforded the desired bis-ether 25 (79.4 g, 85%); R f 0.26

(hexane/EtOAc, 1 : 1 , PMA stain); 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.76 (s, 1 H, OH), 8.29 (s, 1 H, CH-C1 ), 7.35-7.30 (m, 2H, CH-Ph), 7.28-7.13 (m, 14H, CH-Ph), 7.06 (d, J = 8.9 Hz, 4H, CH-Ph), 6.79 (d, J = 8.9 Hz, 4H, CH-Ph), 6.73 (d, J = 8.9 Hz, 4H, CH-Ph), 4.09 (s, 2H, CH 2 -C7), 3.97 (s, 2H, CH 2 -C8), 3.72 (s, 6H, CH 3 -MeOPh), 3.71 (s, 6H, CH 3 -MeOPh), 2.43 (s, 3H, CH3-C6); 13 C NMR (125 MHz, DMSO) δ 158.1 (C-Ph), 158.0 (C- Ph), 148.5 (C-C5), 145.9 (C-C4), 145.0 (C-Ph), 144.6 (C-C2), 138.0 (CH- C1 ), 135.6 (C-Ph), 135.3 (C-Ph), 131 .9 (C-C3), 129.5 (CH-Ph), 129.4 (CH- Ph), 127.8 (CH-Ph), 127.7 (C-Ph), 127.5 (CH-Ph), 127.4 (CH-Ph), 126.6 (C-Ph), 126.6 (C-Ph) 1 13.1 (CH-Ph), 1 13.0 (CH-Ph), 86.1 (C-CPh 3 ), 86.1 (C-CPh 3 ), 61 .2 (CH 2 -C7), 57.3 (CH 2 -C8), 55.0 (CH 3 -OMe), 19.9 (CH 3 -C1 );

25 109

To a solution of alcohol 25 (54.9 g, 70.9 mmol) in DMF (450 mL) was added a single portion of CS2CO3 (92.4 g, 284 mmol) and methyl bromoacetate (14.1 g, 92.2 mmol), the resulting mixture was stirred overnight under an argon blanket. The dark brown solution was

concentrated under vacuum and the crude oil partitioned between EtOAc (500 mL) and brine (500 mL). The organic layer was isolated, the aqueous back extracted with further EtOAc (100 mL) and the combined organic layers dried over Na 2 S0 4 . Filtration and concentration of the mixture provided a crude product, which was purified by chromatography on silica gel (eluent hexane/EtOAc, 1 :1 ). Pure fractions were identified by TLC analysis (hexane/EtOAc, 1 : 1 , SWUV and KMn0 4 ), pooled, concentrated and dried under high vacuum to afford the desired ester 109 (54.1 g, 90%) as an off-white solid; TLC R f 0.28 (hexane/EtOAc, 1 : 1 , PMA stain); 1 H NMR (400 MHz, CDCI 3 ) δ 8.87 (1 H, s, CH-C1 ), 7.48-7.44 (2H, m, CH-Ph), 7.34-7.16 (16H, m, CH-Ph), 6.77 (4H, d, J = 8.9 Hz, CH-Ph), 6.72 (4H, d, J = 8.9 Hz, CH-Ph), 4.44 (2H, s, CH 2 -C9), 4.25 (2H, s, CH 2 -C7), 4.13 (2H, s, CH 2 -C8), 3.79 (6H s, CHs-MeOPh), 3.77 (6H, s, CH 3 -MeOPh), 3.69 (3H s, CH3-CI I ), 2.58 (3H s, CH3-C6); 13 C NMR (101 MHz, CDCI 3 ) δ 168.6 (C- C10), 158.5 (C-Ph), 158.5 (C-Ph), 150.7 (C-C5), 150.6 (C-C4), 145.1 (C- Ph), 144.7 (C-Ph), 144.0 (CH-C1 ), 137.0 (C-C2), 136.1 (C-Ph), 135.6 (C- Ph), 133.9 (C-C3), 130.1 (CH-Ph), 130.0 (CH-Ph), 128.0 (CH-Ph), 128.0 (CH-Ph), 127.8(CH-Ph), 126.8 (CH-Ph), 126.8 (CH-Ph), 1 13.2 (CH-Ph), 1 13.1 (CH-Ph DMTr), 87.0 (C-CPh 3 ), 70.1 (CH 2 -C9), 62.0 (CH 2 -C7), 57.5 (CH 2 -C8), 55.2 (CH 3 -OMe DMTr), 52.0 (CH 3 -C1 1 ), 19.6 (CH3-C6).

A solution of ester 109 (10.0 g, 1 1 .8 mmol) and 6-aminohexanol (2.80 g, 23.9 mmol) in EtOH (55 mL) was warmed to vigorous reflux for 120 h. Conversion of the starting material to a new product was judged largely complete by TLC (EtOAc) whereupon the reaction was cooled to rt and concentrated under vacuum. The crude material was partitioned between EtOAc (100 mL) and brine (200 mL), the organic layer isolated, dried over Na 2 SO 4 , filtered and concentrated to yield a pale yellow foam. The foam was dissolved in a mixture of EtOAc (20 mL) and MeOH (10 mL) to which was added silica gel (20 g). The volatiles were removed and the absorbed product placed on top of silica column (170 g SiO 2 packed with

pentane/EtOAc, 1 : 1 , eluted pentane/EtOAc, 1 : 1 to EtOAc to EtOAc/MeOH, 9: 1 ). Pure fractions were identified by TLC analysis (EtOAc), combined and concentrated to afford an off-white solid (8.3 g, 77%). R f (EtOAc)

0.18; 1 H N MR (500 MHz, CDCI 3 ) δ 8.80 (1 H, s, CH-C1 ), 7.42-7.36 (2H, m, CH-Ph), 7.30-7.14 (12H, m, CH-Ph), 7.1 1 (4H, d, J = 8.9 Hz, CH-Ph), 6.73 (4H, d, J = 8.9 Hz, CH-Ph), 6.69 (4H, d, J = 8.9 Hz, CH-Ph), 6.54 (1 H, t, J = 6.2 Hz, NH amide), 4.34 (2H, s, CH 2 -C-9), 4.04 (2H, s, CH 2 -C7), 3.92 (2H, s, CH 2 -C8), 3.76 (6H, s, CH 3 -MeOPh), 3.75 (6H, s, CH 3 -MeOPh),

3.65 (2H, t, J = 6.5 Hz, CH 2 -C16), 3.13 (2H, q, J = 6.8 Hz, CH 2 -C1 1 ), 2.53 (3H, s, CH3-C6), 1 .58 (dt, J = 14.8, 6.5 Hz, CH 2 -C15), 1 .46-1 .35 (m, 4H, CH 2 -C12 and CH 2 -C14), 1 .35-1 .29 (2H, m, CH 2 -C13); 13 C NMR (125 MHz, CDCI3) δ 167.6 (C-C10), 158.6 (C-Ph), 158.5 (C-Ph), 150.7 (C-C5), 149.7 (C-C4), 145.0 (C-Ph), 144.6 (C-Ph), 144.6 (CH-C1 ), 136.6 (C-C2), 136.0 (C-Ph), 135.6 (C-Ph), 134.0 (C-C3), 130.0 (CH-Ph), 129.9 (CH-Ph), 128.0 (CH-Ph), 127.9 (CH-Ph), 127.9 (CH-Ph), 127.0 (CH-Ph), 126.8 (CH- Ph), 1 13.1 (CH-Ph), 87.0 (C-CPh 3 ), 87.0 (C-CPh 3 ), 72.0 (CH 2 -C9), 62.6 (CH 2 -C16), 62.0 (CH 2 -C7), 57.5 (CH 2 -C8), 55.2 (CH 3 -MeOPh), 55.2 (CH 3 - MeOPh), 38.9 (CH 2 -C1 1 ), 32.7 (CH 2 -C15), 29.7 (CH 2 -C12), 26.6 (CH 2 - C14), 25.4 (CH 2 -C13), 19.7 (CH 3 -C6).

Alcohol 110 (8.10 g, 8.69 mmol) was azeotroped with acetonitrile (2 x 40 mL) and dissolved in CH 2 CI 2 (45 mL) under an argon blanket.

Phosphitylating reagent (2.61 g, 8.69 mmol) was added followed by DIHT (1 .50 g, 8.70 mmol) and the reaction mixture stirred overnight. The reaction was monitored by RP-HPLC (C18, 95% MeCN: 5% 0.1 M TEAA, 20 min isocratic run: 8.22 mins [85.5%, product], 3.08 mins [3.8%, SM]) to judge conversion and quenched by the addition of 5% NaHC0 3 sat. aq. (45 ml). The solution was transferred to a separating funnel, the organic layer isolated and washed with brine (45 mL). The organic component was dried over Na 2 S0 4 , filtered, concentrated under vacuum and the resulting oil precipitated from pentane (100 mL). The pentane was decanted off and the residual oil dissolved in EtOAc (4 mL), the crude was further precipitated with pentane (100 mL). The crude material was purified by flash chromatography on silica gel (75 g Si0 2 , packed

hexane/EtOAc/Et 3 N, 25:75:0.01 , eluted with hexane/EtOAc, 1 :3) the fractions of purity >98% by RP-HPLC (method as previous) were combined and concentrated to a white foam. The material was dissolved in acetonitrile (50 mL), filtered through a 10 micron sinter and

concentrated. The material was further azeotroped with acetonitrile (2 x 30 mL) and the resulting white foam dried overnight under vacuum to yield the desired phophoramidite 111 (5.8 g, 59%) as a white foam. 1 H NMR (500 MHz, DMSO-de) δ 8.65 (1 H, s, CH-C1 ), 7.86 (1 H, t, J = 5.9 Hz, NH amide), 7.36 (2H, d, J = 7.4 Hz, CH-Ph), 7.30-7.16 (12H, m, CH-Ph), 7.07 (4H, d, J = 8.6 Hz, CH-Ph), 6.80 (4H, d, J = 8.7 Hz, CH-Ph), 6.73 (4H, d, J = 8.7 Hz, CH-Ph), 4.22 (2H, s, CH 2 -C9), 4.10 (2H, s, CH 2 -C7), 3.91 (2H, s, CH 2 -C8), 3.81 - 3.72 (2H, m, CH 2 -C-17 and CH 2 -C17'), 3.73 (6H, s, CH 3 - MeOPh), 3.71 (6H, s, CH 3 - MeOPh), 3.67 - 3.52 (4H, m, CH 2 -C16 and CH 2 -C20), 3.08 (2H, ap q, J = 6.8 Hz, CH 2 -C1 1 ), 2.75 (2H, t, J = 5.9 Hz,), 2.48 (3H, s, CH3-C6), 1 .60 - 1 .51 (2H, m, CH 2 -C15), 1 .43 - 1 .30 (4H m, CH 2 -C12 and CH 2 -C14), 1 .29 - 1 .21 (2H, m, CH 2 -C13), 1 .14 (12H, dd, J = 6.1 , 6.1 Hz, CH3-CI 8 and CH 2 -C18'); 13 C NMR (125 MHz, DMSO-d 6 ) δ 166.7 (C-C10), 158.1 (C-Ph), 158.1 (C-Ph), 150.8 (C-C5), 149.9 (C-C4), 144.9 (C-Ph), 144.4 (C-Ph), 142.6 (CH-C1 ), 135.8 (C-C2), 135.5 (C-Ph), 135.0 (C-Ph), 132.9 (C-Ph), 129.6 (CH-Ph), 129.5 (CH-Ph), 127.8 (CH- Ph), 127.7 (CH-Ph), 127.4 (CH-Ph), 127.4 (CH-Ph), 126.7 (CH-Ph DMTr), 126.6 (CH-Ph) 1 18.9 (C-C20), 1 13.1 (CH-Ph), 1 13.0 (CH-Ph), 86.3 (C- CPh 3 ), 86.2 (C-CPh 3 ), 72.0 (CH 2 -C9), 63.1 (d, 2 J C -p = 16.6 Hz, CH 2 -C16), 61 .0 (CH 2 -C7), 58.1 (d, 2 J C -p = 18.3 Hz, CH 2 -C19), 56.6 (CH 2 -C8), 54.9 (CH 3 -MeOPh), 54.9 (CH 3 -MeOPh), 42.4 (d, 2 J C -p = 12.5 Hz, CH-C17), 38.2 (CH 2 -C1 1 ), 30.7 (d, 3 Jc-p = 6.9 Hz, CH 2 -C15), 26.1 (CH 2 -C14), 25.2 (CH 2 - C13), 24.3 (d, 3 J C -p = 6.9 Hz, CH 3 -C18), 19.86 (d, 3 J C -p = 6.9 Hz, CH 2 -

C20), 19.38 (CH 3 -C6); 31 P NMR (20 MHz, DMSO-d 6 ) δ 147.2 (Pill > 99%).

Further preparation of modified oligonucleotides and testing Both compounds 106 and 111 were tested in oligonucleotide synthesis of modified dT-io sequences using the following conditions:

• 0.1 M amidites in MeCN

• 900s coupling time

• 0.25M ETT in MeCN

· 0.02M oxidiser 1 μηιοΙ scale on 10OOA CPG dT column.

Deprotection in AMA, RT, 2h followed by G25.

Note, these deprotection conditions with niacin labelled oligonucleotides result in the formation of the amide (112) rather than the free acid.

112

The pyridoxine labelled oligonucleotides were synthesised DMT-ON (113).

113

In all cases the coupling efficiency was >99% as shown by RP-HPLC, Figures 2 and 3 show typical HPLC traces of these modified

oligonucleotides. The unlabelled dTi 0 oligonucleotides elute at 1 1 .3min and 7.6m in respectively. LCMS shows only the expected mass in either case; see Figures 4 and 5.

Optimum synthesis and deprotection conditions were evaluated for both modifiers in terms of diluent, coupling time and deprotection conditions. Although not a typical deprotection condition, the use of 10% DBU in anhydrous methanol 18h, RT to cleave and deprotect 5'-Niacin C6 modified oligonucleotides (112) was included to allow the formation of the free acid when used in RNA synthesis. The results are summarised below in Table 2. Step Step Optimum Conditions

Diluent MeCN

Coupling time 30s

Deprotection conditions: PDX AMA, 10min, 65°C

Deprotection conditions; Niacin- 0.4M NaOH in MeOH/H 2 O 4: 1 , DNA (free acid) 17h, RT

Deprotection conditions; Niacin- 1 . 0.1 M DBU in anhydrous MeOH, RNA (Methyl ester) 18h, RT

2. Et 3 N/Et 3 N:3HF/NMP (1 .5:2:3), 2.5h, 65°C

Deprotection conditions; Niacin- 0.05M potassium carbonate in RNA (Methyl ester) methanol, 4h, RT

Table 2: Optimal Synthesis and Deprotection Conditions for compounds 112 and 113.

Analysis of Bis-DMT-PDX-C6 labelled oligonucleotides often show loss of one DMT group; 0-12%, but more often less than 2%. This is not an issue if DMT-ON purification is required as one DMT group would be sufficient. 5'-Niacin-C6-CE Phosphoramidite (106) and Bis-DMT-Pyridoxine-C6-CE Phosphoramidite (111 ) have been shown to be stable to oligonucleotide synthesis and deprotection therefore are an efficient means of

modifying oligonucleotides with pyridine based vitamins. The

deprotection method used with niacin labelled oligonucleotides such as 112 will determine the nature of the niacin derivative formed.

Various structures of niacin and pyridoxine synthesis reagents can be obtained as illustrated in the example structures given below. Examples of niacin and pyridoxine synthesis reagents

It will be appreciated from the examples given above that solid supports with cleavable linkers are used in some embodiments of the present invention. Further details are provided below.

Solid supports (also called resins) are the insoluble particles, typically 50- 200 pm in diameter, to which the nucleotide/oligonucleotide is bound during synthesis. Many types of solid support can be used, but controlled pore glass (CPG) and polystyrene have proved to be the most useful.

Controlled-pore glass (CPG)

Controlled-pore glass is rigid and non-swelling with deep pores in which oligonucleotide synthesis takes place. Glass supports with 500 A (50 nm) pores are mechanically robust and are used routinely in the synthesis of short oligonucleotides. However, synthesis yields fall off dramatically when oligonucleotides more than 40 bases in length are prepared on resins of 500 A pore size. This is because the growing oligonucleotide blocks the pores and reduces diffusion of the reagents through the matrix. Although large-pore resins are more fragile, 1000 A CPG resin has proved to be satisfactory for the synthesis of oligonucleotides up to 100 bases in length, and 2000 A supports can be used for longer oligonucleotides.

Polystyrene (PS)

Highly cross-linked polystyrene beads have the advantage of good moisture exclusion properties and they allow very efficient oligonucleotide synthesis, particularly on small scale (e.g. 40 nmol).

Solid supports for conventional oligonucleotide synthesis are typically manufactured with a loading of 20-30 pmol of nucleoside per gram of resin. Oligonucleotide synthesis at higher loadings becomes less efficient owing to steric hindrance between adjacent DNA chains attached to the resin; however, polystyrene supports with loadings of up to 350 mol / g are used in some applications, particularly for short oligonucleotides, and enable the synthesis of large quantities of oligonucleotides.

In one example, oligonucleotide synthesis is carried out on a solid support where the support is functionalised with the first base or modification in the sequence. In most cases this is the 3'-end of the oligonucleotide but there are some instances where this can be the 5'-end.

As noted above, in general one of two solid supports is used, mainly CPG but also polystyrene, although it is possible to use other supports. The modified nucleotide/oligonucleotide is attached to the support typically through a succinate from a hydroxyl group on the backbone to which the modifier is attached. This is most often via the 2' or 3' position of the sugar unit of a nucleoside or sugar, or from a non-nucleosidic backbone containing at least 2 hydroxyl groups, the backbone is linked to the support via the succinate and one other hydroxyl is protected (generally DMT) to allow the formation of a phosphate bond during oligonucleotide synthesis by the addition of phosphoramidites. During the cleavage step the succinate is hydrolysed releasing the oligonucleotide from the support to give a free hydroxyl group at the 3'-end of the oligonucleotide.

Some other examples of solid supported synthesis reagents are given below where "X" is a niacin, nicotinamide or pyridoxine derivative.

Examples of other solid supported synthesis reagents

Evaluation of modified siRNA oligonucleotides in terms of their action on the tumour suppressor gene PTEN.

The oligonucleotides shown in Table 3 were synthesised, deprotected using the following conditions: i. AMA, 10mins, 65°C; ii.

TEA:3HF/TEA/NMP 2: 1.5:3, 2.5h, 70°C; and analysed by LCMS and RP-

HPLC. Structures of the modified oligonucleotides are shown below.

5'-Chol-TEG-pg1as alpha siRNA Sense

5'-Chol-pg1 as alpha siRNA Sense

5'-Toc-pg1as alpha siRNA Sense

'-Nia-C12-pg1as alpha siRNA Sense

'-Nia-3'-chol-pg1as alpha siRNA Sense

5'-Nia-3'- alm-pg1as alpha siRNA Sense

5'-Nia-pg1as alpha siRNA Sense

5'-Oct-Toc-pg1as alpha siRNA Sense

'-Palm-pg1 as alpha siRNA Sense

'-chol-pg1as alpha siRNA Sense

3'-palm-pg1 as alpha siRNA Sense These were generated to target the PTENpgl asRNA alpha variant 3 . The oligonucleotides were screened in stable 293HEK cells stably expressing the PTENpgl asRNA alpha exon 1 .

Oligo name Modification Sequence

5'-Chol-TEG-pg1 as alpha 5'-cholesterol- r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense TEG [SEQ ID NO. 5]

5'-Chol-pg1 as alpha 5'-cholesterol r(GACGAAGAAGAAGCGAGAAAC)Dtt siRNA Sense [SEQ ID NO. 5]

5'-Toc-pg1 as alpha 5'-tocopherol r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense [SEQ ID NO. 5]

pgl as alpha siRNA r(GACGAAGAAGAAGCGAGAAAC)dTT Sense [SEQ ID NO. 5]

RGT-1 -pgl as alpha 5'-Niacin-C12 r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense [SEQ ID NO. 5]

RGT-2-pg1 as alpha 5'-Niacin / 3'- r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense Cholesterol [SEQ ID NO. 5]

RGT-3-pg1 as alpha 5'-Niacin / 3'- r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense Palmitate [SEQ ID NO. 5]

RGT-4-pg1 as alpha 5'-Niacin r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense [SEQ ID NO. 5]

5'-Oct-Toc-pg1 as alpha 5'-Octyl r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense tocopherol [SEQ ID NO. 5]

5'-Palm-pg1 as alpha 5'-Palmitate r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense [SEQ ID NO. 5]

3'-Chol-pg1 as alpha 3'-cholesterol r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense [SEQ ID NO. 5]

3'-Palm-pg1 as alpha 3'-Palmitate r(GACGAAGAAGAAGCGAGAAAC)dTT siRNA Sense [SEQ ID NO. 5]

pgl as alpha siRNA 5'-Phosphate r(GUUUCUCGCUUCUUCUUCGUC)dT Antisense T [SEQ ID NO. 6]

PTENpgl asRNA ODN d(TTTCTCGCTTCTTCTTCGTC)

[SEQ ID NO. 3]

Control ODN (miR367s) d(ACTGACCTTTGGATGGTGCT)

[SEQ ID NO. 4]

Table 3: Modified siRNA oligonucleotides svnthesised

The experimental details are outlined below.

0.2 x 10 6 293pg1 cells were seeded in 1 ml of medium per well in 12-well plates. After a day, the cells were then transfected with 50nM

oligonucleotides, 1 μΙ_ lipofectamine and 50μΙ_ opti-MEM ® , before being incubated for 72 hours.

After 72 hours, the cells were harvested using qiagen RNEasy plus kit. After a further two days, the cells were reverse transcribed into cDNA using M-MLV reverse transcriptase (M-MLV reverse transcriptase from the Moloney murine leukaemia virus). After a further six days, qPCR (quantitative polymerase chain reaction) was carried out using PTEN and RPL10 (Ribosomal Protein L10) primers.

The effects of these chemically modified antisense oligonucleotides on PTEN expression are shown in Figure 1. It is clear from Figure 1 that the oligonucleotide modified at the 5'-end with niacin modulates PTEN (Phosphatase and tensin homolog) activity. This illustrates that the compound is delivered to the cells. Therefore, in one embodiment of the invention there is provided use of a compound as described herein as a delivery agent for delivering an oligonucleotide to a cell. In another embodiment of the invention there is provided a compound as described herein for use in the delivery of an oligonucleotide to a cell. In a further embodiment of the invention there is provided a method of delivering an oligonucleotide to a cell using a compound as described herein.

In addition, Figure 1 illustrates that this compound reduces the amount of PTEN being produced, suggesting that the oligonucleotide is delivered to the cell and then inhibits PTEN expression. Expression of PTEN is associated with a number of conditions including, notably, cancer.

Therefore, in one embodiment of the invention there is provided a compound as described herein for use as a medicament, a therapeutic agent or a pharmaceutical.

In another embodiment of the invention there is provided a compound as described herein for use in the modulation of PTEN gene. In a further embodiment of the invention there is provided a compound as described herein for use in the treatment of cancer.

References 1 and 2 noted below are useful for as background information and reference 3 is useful for performing the types of experiments described herein.

Reference 1 : Modification of antisense phosphodiester

oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy. Krieg, A. M., Tonkinson, J., Matson, S., Zhao, Q., Saxon, M., Zhang, L.-M., Bhanja, U., Yakubov, L. & Stein, C. A., Proc. Natl. Acad. Sci. USA 90: 1048-1052, 1993.

Reference 2: Therapeutic silencing of an endogenous gene by systematic administration of modified siRNAs. J.Soutscheck, A.Akinc, B.Bramlage, K.Charisse, R.Constein, M.Donoghue, S.EIbashir, A.Gieck, P.Hadwiger, J.Harborth, M.John, V.Kesavan, G.Lavine, R.K.Pandey, T.Racie,

K.G.Rajeev, I.Rohl, I.Tourjarska, G.Wang, S.Wuschko, D.Bumcort, V.Koteliansky, S.Limmer, M.Manoharan and H.-P.Vornlocher, Nature, 432, 173-178, 2004.

Reference 3: A Pseudogene long non-coding-RNA network regulates PTEN transcription and translation in human cells. Per Johnsson, Amanda Ackley, Linda Vidarsdottir, Weng-Onn Lui, Martin Corcoran, Dan Grander and Kevin V Morris, Nature Structural and Molecular Biology, 2013, 20, 440-446.

Both niacin and pyridoxine are important in the biosynthesis of NAD and NADH, and hence are recognised by cells. Without wishing to be bound by theory, it is proposed that as niacin and pyridoxine are much less hydrophobic and bulky than more commonly used delivery reagents, it is no longer necessary to remove these modifiers after delivery of an oligonucleotide to a cell. Also, and again without wishing to be bound by theory, since niacin and pyridoxine are important in several biological pathways it is thought that once in the cell it is possible that these modifiers will in any event be removed by hydrolysis of the phosphate linkage to the oligonucleotide.

Without wishing to be bound by theory, it is thought that the present invention provides a delivery agent that, when attached to an

oligonucleotide (therapeutic), is recognised by a cell. As a result, it is believed that the delivery reagent may participate in a biochemical pathway delivering the therapeutic oligonucleotide into the cell. Once in the cell, it is thought that the therapeutic oligonucleotide is then in turn involved in a biological pathway (potentially without having to remove the delivery agent) resulting in the desired therapeutic effect but without the need for a trade-off between that therapeutic effect and any toxic effects normally associated with the use of delivery agents with oligonucleotides. A further potential benefit of the present invention is that it may increase cellular uptake of an oligonucleotide therapeutic, which means that the required dosage of the oligonucleotide therapeutic can be lower than might otherwise be necessary.

While this invention has been described with reference to the sample embodiments thereof, it will be appreciated by those of ordinary skill in the art that modifications can be made to the structure and elements of the invention without departing from the spirit and scope of the invention as a whole. Sequence Listing Free Text

SEQ ID NO. 1 : ( G AC G AAG AAG AAG C G AG AAAC ) ; SEQ ID NO. 2

(GUUUCUCGCUUCUUCUUCGUC); SEQ ID NO. 5:

( r( G AC G AAG AAG AAG C GAG AAAC ) dTT) and SEQ ID NO. 6:

(r(GUUUCUCGCUUCUUCUUCGUC)dTT) are siRNA designed to target PTENpgl asRNA alpha variant.

SEQ ID NO. 3: d(TTTCTCGCTTCTTCTTCGTC); and SEQ ID NO. 4: d(ACTGACCTTTGGATGGTGCT) are single strand DNA negative controls designed not to target PTENpgl asRNA alpha variant.

Listing of Relevant Sequences

SEQ ID NO. 1

G AC G AAG AAG AAG C GAG AAAC

SEQ ID NO. 2

GUUUCUCGCUUCUUCUUCGUC

SEQ ID NO. 3

d(TTTCTCGCTTCTTCTTCGTC)

SEQ ID NO. 4

d(ACTGACCTTTGGATGGTGCT) SEQ ID NO. 5

r(GACGAAGAAGAAGCGAGAAAC)dTT

SEQ ID NO. 6

r(GUUUCUCGCUUCUUCUUCGUC)dTT