RAPID GENOTYPING ANALYSIS AND KITS THEREOF

CROSS-REFERENCE TO RELATED APPLICATION

[00011 This application claims priority of U.S. Serial No. 61/791 ,933, filed March 15, 2013. The content of the preceding application is hereby incorporated in its entirety by reference into this application.

FIELD OF INVENTION

[0002] The present invention is related to the field of identification of various genotypes associated with human diseases.

BACKGROUND OF THE INVENTION

[0003] The present invention is related to identification of various genotypes. Various techniques such as sequence-specific primers polymerase chain reaction (SSP-PCR), DNA sequencing, DNA fingerprinting and single nucleotide polymorphism (SNP) genotyping have been employed for genotyping (PCT Application Publication WO/201 1 / 1 39750). Among these techniques, single nucleotide polymorphism (SNP) genotyping is more advantageous for its higher discrimination power. However, most genotyping assays involve hybridization processes of DNA which require high running cost and hand-on time. Therefore, there is a need to develop more effective genotyping assays which are faster, cheaper andable to cover more genotypes.

Tubuculosis Detection

[0004] Tuberculosis (TB) is caused by Mycobacterium tuberculosis (MTB). The emergence of anti-tuberculosis drug resistance is a serious problem for TB control programs in industrialized and developing countries alike. In addition to its clinical and epidemiological importance, multidrug-resistant tuberculosis (DR-MTB) has important economic impact because the cost of treatment is higher than that of normal MTB. DR-MTB is defined as resistance to at least two of the most effective first-line drugs, rifampin (RIF) and isoniazid (INH). These cases are on the rise globally, resulting in significant morbidity and mortality. Resistance to first-line anti-tuberculosis drugs has been linked to mutations in several genes in the MTB genome: rpoB for RIF resistance; katG and inn A for INH resistance.

[0005] Several technologies exist for DR-MTB detection. Conventional phenotypic Drug susceptibility testing (DST) remains the gold standard for MTB drug resistance testing but can take up to eight weeks to complete. Mycobacterium tuberculosis is a slow-growing bacterium. It divides every 15-20 hours and it takes from 4 to 6 weeks to grow the colonies depending on the medium used. After that, when MTB culture is identified, drug susceptibility test will be performed which usually takes 2 additional weeks. The test hence requires a long hand-on time and leads to delay treatment of the disease if therapy starts after diagnosis is completed. Therefore, the usual practice is to begin the treatment before the results are confirmed. Alternative culture medium has been developed to shorten the time required for the test; however, some of the specimen types of MTB cannot be used on this culture medium. Conventional DNA sequencing for detection of MTB drug resistance mutations is not routinely available in the commercial setting because of the expense, necessary expertise and time-consuming nature. There are kits available in the market using different technologies including real time PCR and conventional hybridization for detecting single type of MTB or multi-drug resistant MTB. Particularly for real time PCR, due to the limited number of channels available, it is usually difficult to design assays for simultaneous detection of multidrug resistant MTB. Conventional hybridization is applicable for detecting multidrug resistant MTB; however, it usually involves long incubation time (at least 4 hours) to perform the assay. Alternatively, by utilizing polymerase chain reaction (PCR) and "Flow-through" hybridization technology, the present invention provides an array test that can simultaneously detect single-drug and multi-drug resistant types of MTB in one platform with a much shorter detection time (-35 min) than the conventional hybridization. The whole test would need less than 4 hours, from DNA extraction from samples to analysis, and gives highly specific and sensitive results.

Beta Thalassemia Detection

[0006] Beta Thalassemia is a common hemoglobinopathy that is caused by autosomal mutations, which can be sub-divided into categories depending on the extent to which beta-globin production is affected. Some mutations result in mild reductions in the production of beta-globin (denoted as β ⁺ ), whereas some cause absolute silencing of the beta-globin gene, or the production of non-functional beta-globin (denoted as β°). It is estimated that around 1 .5% of the world's population are beta-thalassemia heterozygotes, or carriers, and the coupling of two carriers may produce offsprings that are homozygous for the disease. Disease severity manifests in three different degrees: from mild (thalassemia minor, β ⁺ /β or β°/β) to intermediary (thalassemia intermedia, β ⁺ /β or β°/β to severe (thalassemia major, β ⁺ /β ⁺ , β°/β ⁺ or β°/β°). Individuals that inherit the thalassemia major trait develop hypochromic anemia, and may require life-long blood transfusion. The best method of beta-thalassemia control is prevention of birth of thalassemic children, by genetic counseling of prospective parents and prenatal diagnosis, which have proven to be the most effective management for the disease. Beta-thalassemia is endemic in temperate regions such as Mediterranean countries, Middle East and Southeast Asia. The molecular bases for beta-thalassemia has been extensively studied and micro-mapped to point mutations along the beta-globin gene. Different geographic regions have different mutation spectra, and the frequency of mutations is not homogeneous in each region.

[0007] Current detection technologies include microarray, Allele-specific PCR (AS-PCR) and direct sequencing. Microarray can detect multiple targets simultaneously on a DNA chip and hence applicable for detecting multiple samples simultaneously. However, its application is limited for its high cost, and the result cannot be observed by naked eyes but has to be processed and interpreted using high performance scanner and sophisticated analysis software. Allele-specific PCR is a PCR technology using allele-specific primer to detect polymorphism or mutation in which only the perfectly matched oligonucleotide is able to act as a primer for amplification. The limitation of this technology is the limited throughput in one reaction. For direct sequencing, which is based on the selective incorporation of chain-terminating dideoxynucleotides by DNA polymerase during in vitro DNA replication, has a low efficiency in detection because of its low throughput and long hand-on time. Alternatively, the present invention provides a DNA testing using a combination of PCR and reverse dot blot hybridization which offers a highly sensitive and specific detection of beta-globin gene mutation, assisting diagnosis of beta-thalassemia.

Hepatitis B Virus Detection

[0008] HBV is the smallest DNA virus comprising 3000 nucleotides surrounded by a protein capsid. It can be transmitted through contact with blood or body fluids of an infected individual. Approximately 2 billion people are infected with HBV; in which over 350 million become HBV carriers. About one-fifth would develop HBV-related cirrhosis or eventually liver cancer. Detection of HBV can be diagnosed by surface antigen using simple blood tests and HBV DNA measurement using polymerase chain reaction (PCR). In addition, analysis of the divergence of HBV genome sequences has led to the identification of 10 HBV genotypes (A to J) and several subtypes. HBV genotypes and subtypes show a distinct geographical distribution. It has been discovered that pathogenic and therapeutic differences exist among various HBV genotypes. The determination of HBV genotypes can provide information for the management of chronic HBV infection and pre-treatment evaluation. DNA sequencing has been considered as the gold standard method for the detection of HBV genotypes. However, it is less efficient in detecting mixed genotypes. Alternatively, using molecular DNA techniques has offered a highly sensitive and specific method for HBV genotype detection.

Detection of Sexually Transmitted Disease

[0009] Sexually transmitted diseases (STDs) are common world-wide problems. According to 2005 WHO estimates, 448 million new cases of curable STDs (syphilis, gonorrhoea, chlamydia and trichomoniasis) occur annually throughout the world in adults aged 15-49 years. In Hong Kong, around 1 in 550 was diagnosed with Sexually Transmitted diseases (not including HIV) in 2010. For pregnant woman, STDs can infect her baby before, during, or after the baby's birth. Untreated gomorrhea and chlamydia may result in infertility. Therefore, pre-married couples and pre-pregnancy women are also potential users of STDs detection. In addition, China is also a potential market of STDs diagnosis, as the number of STDs patient increase dramatically in past 20 years. The fast, low-price and accurate STDs diagnostic kit is necessary for controlling STDs in China. Current STD testing kits on the market are for detecting single parameter or multiplex of 3-4 parameters, and usually miss out human papillomavirus (HPV). Regarding the increased prevalence of STDs, screening assays that can simultaneously detect a plurality of STD-causing pathogens are highly desirable.

Thrombophilia Identification

[0010] Thrombophilia is an abnormality of blood coagulation that increases the risk of thrombosis. Studies report that about 40% of thrombophilia cases presenting with thrombosis are inherited and has been shown to be a risk factor for cardiovascular disease including venous thrombosis as well as reproductive disorders including recurrent miscarriage. There is a growing view that inherited thrombophilia would predispose women towards adverse pregnancy outcomes including recurrent pregnancy losses, intrauterine fetal death, intrauterine growth retardation, preeclampsia and placental abruption.

[0011] Over the past two decades, several gene variants have been identified for inherited thrombophilia. The top 4 mutations are located at Factor V Leiden (FVL) [ 1691 G>A], Factor II (Prothrombin) [20210OA], ethylenetetrahydrofolate Reductase (MTHFR) [677C>T] and Methylenetetrahydrofolate Reductase (MTHFR) [ 1298A>C]. Testing for these genetic variations can greatly contribute to identification of high risk population of venous thrombosis and recurrent miscarriage, so as to help lowering the individual's risk and preventing the diseases and also providing prophylactic treatment guidance.

SUMMARY OF THE INVENTION SNP genotyping as a diagnostic tool

[0012] Other than DNA fingerprinting, SNP genotyping can be utilized for identification of gene fragments, or polymorphism of genes that have altered or attenuated the function of the gene in question. The present invention provide methods and kits for rapid, definitive identification of infectious agents, inherited disease caused by the specific DNA sequences, or the presence or absence of such infectious agents or DNA sequences that cause inherited diseases.

[0013] As discussed above, commercially available hybridization format requires high resolution image analyzer for analysis. The membrane-based micro-array Allelic-Specific-Oligonucleotide Reversed-Dot-Blotting (ASO-RDB) flow-through hybridization format (e.g., as in U.S. Patent No. 5,741 ,647) may be used to facilitate SNP genotyping. Micro-array hybridization format produces visible dots which can be analyzed by visual inspection and/or by using a less costly image analyzer. Flow-through hybridization

[0014] DNA hybridization has been the most essential method for research in modern biological science involving the molecular studies of genes. The complexity of nucleic acid sequences of various genomes were revealed by solution hybridization through the annealing process of the complementarity of specific DNA sequences. In brief, the DNA in question is amplified or digested, and allowed to hybridize with complementary DNA probes on a solid support such as a nitrocellulose membrane. However, conventional immobilization and hybridization techniques are in principle limited by the area of the membrane, and usually involve long incubation time.

[0101] Alternatively, flow-through hybridization methods and devices which can accurately control the hybridization conditions have been developed. The flow-through DNA hybridization method and device reduce hybridization time from many hours or days to minutes (the whole hybridization assay can be completed in 5-30 m inutes depending the method used to generate detection signal). The device is also inexpensive to manufacture, and uses 10 times less reagents than conventional hybridization devices which will lead to more affordable DNA diagnosis technology. Flow-through hybridization technology also gives more sensitive and accurate results of detection/identification, and can be universally applied to various techniques such as conventional Southern, Northern, Dot-Blot, Slot-Blot and Reversed-Dot Blot hybridization. Because of its higher efficiency, accuracy and sensitivity, flow-through hybridization is more advantageous in comparison to conventional hybridization techniques. [0102] PCT application WO/201 1 / 139750 describes multiple lateral flow-through detection devices connected to a central control unit. The hybridization device comprises a central controlling unit connected to one or more lateral flow device. The central controlling unit provides power to and controls the lateral flow device where the hybridization process and developing procedures are carried out. Several reactions (or several samples and/or analytes) can be tested simultaneously in a single lateral flow device or in several devices (controlled individually at different conditions) at the same time. The lateral flow device can be in a format of 'n x m' dot matrix (array) or in the form of linear arrays. More descriptions on methods and devices for performing flow-through hybridization can be found in the U.S. Patent No. 5,741 ,647, U.S. Patent No. 6,020, 1 87 and PCT application WO/201 1/ 139750. One of ordinary skill in the art would be able to use flow-through hybridization as similar to those described in the U.S. Patent No. 5,741 ,547 or 6,020, 187, or any new embodiments capable of carrying out flow-through hybridization for rapid detection of infectious agents, inherited disease caused by the specific DNA sequences, or the presence or absence of such infectious agents or DNA sequences that cause inherited diseases. Signal detection can be digitized using the imaging system accompanying the hybridization device, such as FT-Pro. The hybridization device to be used in the present invention can be auto-device with all analysis build-in with digitizing capability. Multidrug-Resistance Tuberculosis Detection

[0015] This invention provides method and kit to detect rifampicin (RIF) and isoniazid (INH) resistant strains of Mycobacteriu Tuberculosis (MTB) using Polymerase Chain Reaction (PCR) and "Flow-through" hybridization technology. Mutation of the MTB gene encoding beta subunit of RNA polymerase (rpoB) is found associated with rifampin resistance, while mutation in genes katG and InhA, which respectively encode for catalase peroxidase and enoyl-ACP-reductase, are reported to be associated with isoniazid resistance. In the present invention, primers specific to rpoB, katG and InhA are used to amplify corresponding genes, and they have been verified not cross-reacting with human genome. Primer RS-IAC, which does not target at any human or MTB genome, serves as an internal amplification control for monitoring the PCR amplification process. Ten mutation DNA probes are included for detection of drug resistant mutations in rpoB (D516V, D516G, H526D, H526Y, H526L 1 , S53 1 L and S53 1 W), katG (S3 15T 1 and S315T2), and inhA (-15TC/T). Five wild-type MTB DNA probes are also included for detection of wild-type MTB variants, which helps to validate if the PCR reaction and amplification of rpoB, katG and inhA genes have been successfully performed. The primers can be biotinylated for hybridization. Beta Thalassemia Detection

[0016] This invention provides method and kit for the detection of beta-globin mutations including TATA -28 (A>G), TATA -29 (A>G), Initiation Codon (G>A), Codon 5 (-CT), Codons 8/9 (+G), Codon 15 (G>A), Codon 16 (-C), Codon 17 (A>T), Codon 19 (A>G), Codon 26 (G>A) (Hb E), Codons 27/28 (+C), Codon 30 G>C, IVS 1 .1 (G>T), 1VS 1.1 (G>A), 1VS 1.5 (G>C), Codons 41/42 (-TCTT), Codon 43 (G>T), Codons 71/72 (+A), IVS2.1 (G>A), IVS2.654 (OT), and 619 bp deletion.

Hepatitis B Virus detection

[0017] This invention provides method and kit to detect the presence of 8 HBV genotypes (HBV Genotypes A, B, C, D, E, F, G and H) in human serum samples.

Detection of Sexually Transmitted Disease

[0018] This invention provides method and kit to detect the presence of protozoa, bacteria and viruses in various specimens such as urine, urogential swab (urethral, vaginal, cervical and lesion) and Liquid-based cytology specimens (PreservCyt™ and SurePath™). Amplification Control (AC) is included for detection of human DNA materials to check for the presence of sufficient cellular content and validity of the results. AC can be used to monitor the presence of PCR inhibitors and the presence of sufficient amount of extracted DNA during PCR amplification. Absence of Amplification Control signal may indicate either failure of the PCR amplification (PCR inhibitor present) or insufficient amount of DNA (or absence of specimen) during PCR amplification. Positive Control (PC) which contains a positive template is also included to monitor the performance of PCR reagents. [0019] DNA hybridization and PCR technologies enable a faster detection of STD-causing pathogens in urine, urogential swab (urethral, vaginal, cervical and lesion) and Liquid-based cytology specimens (PreservCyt™ and SurePath™). In one embodiment, the method and kit can detect the presence of 12 common pathogens: 1 protozoan (Trichomonas vaginalis), 7 bacteria (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genital ium, Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum, Treponema pallidum) and 4 viruses (Herpes simplex virus 1 & 2, Human papillomavirus type 6 & 1 1 ). These pathogens are related to cervicitis, urethritis, trichomoniasis and pelvic inflammatory disease.

[0020] The present invention provides universal primers and pathogen-specific primers for detecting STD-causing pathogens. Universal primers are used to achieve a balanced amplification among different targets in the multiplex PCR. Sequences were tested by PCR and gel electrophoresis on their specificity on pathogen targets and human DNA to prove that they do not cross-react with other pathogens and human genome. Two universal sequences that do not cross-react with the pathogen targets and human DNA were designed and added to the 5 'end of pathogen specific primers. The same was done to the AC specific primers. The resulting universal primers and pathogen-specific primers tagged with the universal sequences were further tested by PCR and gel electrophoresis and proven not cross-reacting with other pathogens and human genome (Figure 1 ). In one embodiment, pathogen-specific primers tagged with universal sequences and two universal primers were included in a single PCR. In the first round of PCR, pathogen-specific primers bind to their specific target and create a PCR product carrying the universal sequence. Next in the second round of PCR, the universal primers bind to the universal-sequence-tagged PCR products (Figure 2). Under an optimized PCR condition, we can achieve a balanced amplification and avoid the loss of amplification due to different amplification efficiencies of different pathogen targets. It also ensures only pathogen-specific amplicons would be generated using the universal primers, leading to a more accurate detection by the DNA probes. The universal primers system described herein can be also applied to other methods and kits detecting nucleic acids or gene associated with DR-MTB, Beta-globin, HBV and thrombophilia, and also other diseases or conditions that are not described in the present invention.

Thrombophilia Identification

[0021] This invention provides method for the identification of gene variants related to inherited thrombophillia, including Factor V Leiden (FVL) [ 1691 G>A], Factor II (Prothrombin)

[20210OA], Methylenetetrahydrofolate Reductase (MTHFR) [6770T] and Methylenetetrahydrofolate Reductase (MTHFR) [ 1298A>C] .

[0022] Although PCR was used for amplification in the data validating examples, any method that can produce specific target sequence(s) in sufficient quantity for the identification and flow-through hybridization analysis may be used. Amplification may not be necessary if sufficient quantity of the target sequence(s) can be obtained for the identification and analysis. Detection can be accomplished by labeling of the target DNA or conjugates.

DETAILED DESCRIPTION OF THE DRAWINGS

[0023] Figure la shows an electrophoretic image of PCR reactions on human clinical samples using universal primers (SEQ ID NO. 285 and 286). Specific bands are only observed in positive samples in which the pathogens are present (i.e. CT-positive, NG-positive, HPV-6 and HPV-11 positive), indicating that the universal primers do not cross react with human DNA. Figure lb shows an electrophoretic image of PCR reactions on human clinical samples using pathogen-specific primers (SEQ ID NO. 263-282) and universal primers (SEQ ID NO. 285 and 286). Specific bands are observed in each sample in which the corresponding pathogens are present, indicating that the primers are highly specific to their respective pathogens. Similar observation can be found in both monoplex and multiplex PCR reactions.

[0024] Figure 2 shows one embodiment of a PCR amplification scheme using Universal primers and gene-specific primers in one single reaction.

[0025] Figure 3 shows one embodiment of DR-MTB cassette (left panel) and signal position (right panel) (grids shown for illustration purpose only) for DR-MTB detection. IAC is the internal amplification control for monitoring PCR Amplification process. HC is the hybridization control which monitors the hybridization process. Validity of PCR amplification and specimen are also accessed by various controls.

[0026] Figure 4 shows one example of visual interpretation of different MTB mutants. [0027] Figure 5 shows one embodiment of beta-thalassemia cassette and signal position (grids shown for illustration purpose only).

[0028] Figure 6a shows one example of visual interpretation of different beta-thalassemia genotypes. Figure 6b shows testing results on various clinical samples using the beta-thalassemia cassette.

[0029] Figure 7 shows one embodiment of a HBV test kit detecting the presence of 8 HBV genotypes (HBV A, B, C, D, E, F, G and H). Universal primer, IAC and HC are also included. [0030] Figure 8 shows one example of visual interpretation of different HBV genotypes.

[0031] Figure 9a shows a comparison of sensitivity of the present invention and a STD testing kit from other manufactory. Figure 9b shows a side-by-side comparison of performance of the present invention and an STD testing kit from other manufactory on clinical samples. [0032] Figure 10a shows one embodiment of a STD array, cassette format and signal position. The array can detect the presence of 12 common pathogens: 1 protozoan (Trichomonas vaginalis), 7 bacteria (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum, Treponema pallidum) and 4 viruses (Herpes simplex virus 1 & 2, Human papillomavirus type 6 & 1 1 ). Amplification Control (AC) is used to monitor the presence of PCR inhibitors and the presence of sufficient amount of extracted DNA during PCR amplification. Absence of Amplification Control signal indicates either failure of the PCR amplification (PCR inhibitor present) or insufficient amount of DNA (or absence of specimen) during PCR amplification. Treponema pallidum (TP) can be provided as a positive control (PC) which contains a positive template to monitor the performance of PCR reagents. Figure 10b shows one example of visual interpretation of the STD array.

[0033] Figure 11 shows one embodiment of a Thrombophilia array.

[0034] Figure 12 shows one example of visual interpretation of the Thrombophilia array.

DETAILED DESCRIPTION OF THE INVENTION

[0035] The following terms shall be used to describe the present invention. In the absence of a specific definition set forth herein, the terms used to describe the present invention shall be given their common meaning as understood by those of ordinary skill in the art.

[0036] As used herein, the expression "Allelic-Specific-Oligonucleotide Reversed-Dot-Blotting (ASO-RDB)" refers to assays using Allelic-Specific-Oligonucleotide probes immobilized on a solid matrix capable of capturing target molecules for detection through hybridization processes.

[0037] As used herein, the term "flow-through hybridization" refers to the hybridization process utilizing the technology described in U.S. Patent No. 5,741 ,647. [0038] As used herein, the term "flow-through hybridization device" or "flow-through device" refers to the device depicted in U.S. Patent No. 6,020, 187 and/or the lateral flow device depicted in PCT application WO/201 1 /139750 or any flow-through device designed subsequently.

Detection of pathogens and DNA targets

[0103] The present invention provides methods, primers, probes and kits for identification and/or W detection of various nucleic acids, mutations, agents, pathogens and/or diseases. In one embodiment, the present invention is applied to detecting the presence of Tuberculosis, HBV, HCV, SARS, respiratory infectious viruses, sexually-transmitted diseases-causing agents, beta-globin, thrombophilia and/or the nucleic acids associated thereof, individually or in combinations. The method involves PCR amplification using specific primers to generate amplicons, hybridizing said amplicons with oligonucleotide probes. The resulting hybridization profile would indicate the presence of the nucleic acids, mutations, agents, pathogens and/or diseases in question. [0104] In one embodiment, the hybridization of the amplicons with oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process, or a reversed flow-through process. In one embodiment, the oligonucleotide probes are immobilized for hybridization. In one embodiment of a flow-through process, the sensitivity of the hybridization depends on the ratio of the area comprising the probes to the total area of the membrane of the array. In one embodiment of a lateral flow-through process, the sensitivity of the hybridization depends on the ratio of the cross-sectional area comprising the probes to the total cross-sectional area of the membrane across the flow direction.

[0105] In one embodiment, the present invention provides a method for detecting the presence of nucleic acid and/or exogenous agent in a subject, comprising the steps of: (a) amplifying a template nucleic acid from a sample obtained from the subject with primers selected from SEQ ID NOs: 174-181 , 201 -205, 241 -244, 263-286 and 299-306 to generate amplicons, alone or in combination thereof; and (b) hybridizing said amplicons with oligonucleotide probes selected from SEQ ID NOs: 182-200, 206-240, 245-260, 287-298, and 307-314, alone or in combination thereof wherein the resulting hybridization profile would indicate the presence of nucleic acid and/or exogenous agent in said subject. In one embodiment, the number of primers selected is 2-49 and the number of probes selected is 2-92. In another embodiment, the number of primers selected is 2-24 and the number of probes selected is 2-35. [0106] In another embodiment, the present invention provides a method for detecting the presence of nucleic acid and/or exogenous agent in a subject, comprising the steps of: (a) amplifying a template nucleic acid from a sample obtained from the subject with primers selected from SEQ ID NOs: 174-181 , 201 -205, 241 -244, 263-286 and 299-306 to generate sufficient amplicons, alone or in combination thereof; and (b) hybridizing said amplicons with oligonucleotide probes selected from SEQ ID NOs: 182-200, 206-240, 245-260, 287-298, and 307-314, alone or in combination thereof wherein the resulting hybridization profile would indicate the presence of nucleic acid and/or exogenous agent in said subject.

[0107] In one embodiment, the present invention provides a method for detecting the presence of multidrug-resistant Mycobacterium tuberculosis (DR-MTB), or nucleic acid of DR-MTB, comprising the steps of: (a) obtaining a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs: 174- 181 , thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs: 182-200, wherein the resulting hybridization profile would indicate the presence of multidrug-resistant Mycobacterium tuberculosis or nucleic acid of DR-MTB. In another embodiment, the method for detecting the presence of multidrug-resistant Mycobacterium tuberculosis (DR-MTB), or nucleic acid of DR-MTB comprises the steps of: (a) obtaining a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers of SEQ ID NOs: 174-181 , thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes of SEQ ID NOs: 182-200, wherein the resulting hybridization profile would indicate the presence of multidrug-resistant Mycobacterium tuberculosis or nucleic acid of DR-MTB. In one embodiment, the primers comprise a signal generating label. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process or a reversed flow-through process and/or related devices.

[0108] In one embodiment, the above methods can detect the presence of multidrug-resistant Mycobacterium tuberculosis (DR-MTB), or nucleic acid of DR-MTB having one or more of the following mutations: one of seven mutations in the rpoB gene; one of two mutations in the katG gene; and one mutation in the inhA gene. The present invention also provides a kit for detecting the presence of multidrug-resistant Mycobacterium tuberculosis (DR-MTB), or nucleic acid of DR-MTB, comprising primers selected from the group consisting of SEQ ID NOs: 174-181 and oligonucleotide probes selected from the group consisting of SEQ ID NOs: 1 82-200. In one embodiment, the kit for detecting the presence of multidrug-resistant Mycobacterium tuberculosis (DR-MTB), or nucleic acid of DR-MTB, comprises primers of SEQ ID NOs: 174- 181 and oligonucleotide probes of SEQ ID NOs: 182-200.

[0109] The present invention also provides a method of detecting beta-globin mutations in a subject having beta-thalassemia, comprising the steps of: (a) obtaining from the subject a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs:201 -205, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs:206-240, wherein the resulting hybridization profile would indicate the genotypes of beta-thalassemia. In one embodiment, the method of detecting beta-globin mutations in a subject having beta-thalassemia comprises the steps of: (a) obtaining from the subject a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers of SEQ ID NOs:201 -205, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes of SEQ ID NOs:206-240, wherein the resulting hybridization profile would indicate the genotypes of beta-thalassemia. In one embodiment, the primers comprise a signal generating label. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process, or a reversed flow-through process and/or related devices. In one embodiment, the above method of detecting beta-globin mutations can detect one of twenty one beta-globin mutations. [0110] The present invention also provides a kit for detecting beta-globin mutations, comprising primers selected from the group consisting of SEQ ID NOs:201 -205 and oligonucleotide probes selected from the group consisting of SEQ ID NOs: 206-240. In one embodiment, the kit for detecting beta-globin mutations comprises primers of SEQ ID NOs:201 -205 and oligonucleotide probes of SEQ ID NOs: 206-240.

[0111] The present invention also provides a method for detecting the presence of HBV, or nucleic acid of HBV, comprising the steps of: (a) obtaining a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs:241 -244, thereby generating HBV amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs:245-260, wherein the resulting hybridization profile would indicate the presence of HBV or nucleic acid of HBV. In one embodiment, the method for detecting the presence of HBV, or nucleic acid of HBV comprises the steps of: (a) obtaining a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers of SEQ ID NOs:241 -244, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes of SEQ ID NOs:245-260, wherein the resulting hybridization profile would indicate the presence of HBV or nucleic acid of HBV. In one embodiment, the primers comprise a signal generating label. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process or a reversed flow-through process and/or related devices. [0112] In one embodiment, the above method can detect the presence of HBV or nucleic acid of HBV, having a genotype selected from the group consisting of HBV genotypes A to H. The present invention also provides a kit for detecting the presence of HBV or nucleic acid of HBV, comprising primers selected from the group consisting of SEQ ID NOs:241 -244 and oligonucleotide probes selected from the group consisting of SEQ ID NOs: 245-260. In one embodiment, the kit for detecting the presence of HBV or nucleic acid of HBV comprises primers of SEQ ID NOs:241 -244 and oligonucleotide probes of SEQ ID NOs: 245-260. [0113] The present invention also provides a method for detecting the presence of sexually transmitted diseases causing pathogens, or nucleic acid of said pathogens in a subject, comprising the steps of: (a) obtaining from the subject a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs:263-286, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs:287-298, wherein the resulting hybridization profile would indicate the presence of nucleic acid originated from pathogens that may develop into disease, namely sexually transmitted diseases. In one embodiment, the present invention provides a method for detecting the presence of sexually transmitted diseases causing pathogens, or nucleic acid of said pathogens in a subject, comprising the steps of: (a) obtaining from the subject a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers of SEQ ID NOs:263-286, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes of SEQ ID NOs:287-298, wherein the resulting hybridization profile would indicate the presence of nucleic acid originated from pathogens that may develop into disease, namely sexually transmitted diseases. In one embodiment, the primers comprise a signal generating label. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process or a reversed flow-through process and/or related devices. [0114] In one embodiment, the method for detecting the presence of sexually transmitted diseases causing pathogens can detect the presence of sexually transmitted diseases caused by an organism selected from the group consisting of Trichomonas vaginalis, Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum, Treponema pallidum, Herpes simplex virus 1 , Herpes simplex virus 2, Human papillomavirus type 6, and Human papillomavirus type 1 1 . The present invention also provides a kit for detecting the presence of sexually transmitted diseases causing pathogens, or nucleic acid of said pathogens in a subject, comprising primers selected from the group consisting of SEQ ID NOs:263-286 and oligonucleotide probes selected from the group consisting of SEQ ID NOs: 287-298. In one embodiment, the kit for detecting the presence of sexually transmitted diseases causing pathogens, or nucleic acid of said pathogens in a subject comprises primers of SEQ ID NOs:263-286 and oligonucleotide probes of SEQ ID NOs: 287-298.

[0115] The present invention also provides a method for detecting mutations related to thrombophilia, comprising the steps of: (a) obtaining a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs:299-306, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs:307-314, wherein the resulting hybridization profile would indicate the presence of mutations related to thrombophilia. In one embodiment, the primers comprise a signal generating label. In another embodiment, the method for detecting mutations related to thrombophilia comprises the steps of: (a) obtaining a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers of SEQ ID NOs:299-306, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes of SEQ ID NOs:307-3 14, wherein the resulting hybridization profile would indicate the presence of mutations related to thrombophilia. In one embodiment, the primers comprise a signal generating label. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process or a reversed flow-through process and/or related devices. [0116] In one embodiment, the method for detecting mutations related to thrombophilia can detect mutation at a gene selected from the group consisting of Factor V Leiden, Factor II (Prothrombin), and Methylenetetrahydrofolate Reductase. The present invention also provides a kit for detecting the presence of mutations related to thrombophilia, comprising primers selected from the group consisting of SEQ ID NOs:299-306 and oligonucleotide probes selected from the group consisting of SEQ ID NOs: 307-3 14. In one embodiment, the kit for detecting the presence of mutations related to thrombophilia comprises primers of SEQ ID NOs:299-306 and oligonucleotide probes of SEQ ID NOs: 307-314.

[0117] The invention will be better understood by reference to the Experimental Details which follow, but those skilled in the art will readily appreciate that the specific experiments detailed are only illustrative, and are not meant to limit the invention as described herein, which is defined by the claims which follow thereafter.

[0118] Throughout this application, various references or publications are cited. Disclosures of these references or publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains. It is to be noted that the transitional term "comprising", which is synonymous with "including", "containing" or "characterized by", is inclusive or open-ended and does not exclude additional, un-recited elements or method steps.

EXAMPLE 1

Test Procedures

[0119] Procedures for isolation of DNA, PCR amplification, hybridization, detection of target and result analysis as described in WO/201 1 /139750 or relevant procedures and techniques that are known to one skilled in the art can be applied to the present invention. Various internal controls (IC) can be included in the test assay to validate the DNA samples, PCR amplification and color development. Various flow-through membrane array size and format can be used for according to individual need, or for optimizing the usage of the reaction chamber to achieve maximized cost saving.

EXAMPLE 2

Genotyping For Multidrug-Resistant Tuberculosis [0120] In one embodiment, the present invention provides methods and array test kits for DR-MTB genotyping. The methods and kits are designed to detect rifampicin (RIF) and isoniazid (INH) resistant strains of Mycobacterium Tuberculosis (MTB) using Polymerase Chain Reaction (PCR) and "Flow-through" hybridization technology. Primers specific to rpoB, katG and InhA are used to amplify corresponding genes, and they have been verified not cross-reacting with human genome. Primer RS-IAC is an internal amplification control which does not target at human or MTB genome but serves as an internal amplification control for monitoring the PCR amplification process. Ten mutation probes are included for detection of drug resistant mutations in rpoB (D516V, D516G, H526D, H526Y, H526L 1 , S53 1 L and S531 W), katG (S315T1 and S3 15T2), and inhA (- 15TC/T). Five wild-type MTB probes are also included for detection of wild-type MTB variants, which helps to validate if the PCR reaction and amplification of rpoB, katG and inhA genes have been successfully performed. In one embodiment, the primers are biotinylated for hybridization. [0121] In one embodiment, the present invention provides a method for detecting the presence of multidrug-resistant Mycobacterium tuberculosis (DR-MTB), comprising the steps of: (a) obtaining a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs: 174- 18 1 , thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs: 182-200, wherein the resulting hybridization profile would indicate the presence of multidrug-resistant Mycobacterium tuberculosis. In one embodiment, the present invention can detect the presence of multidrug-resistant Mycobacterium tuberculosis having one or more of the following mutations: one of seven mutations in the rpoB gene; one of two mutations in the katG gene; and one mutation in the inhA gene. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process, or a reversed flow-through process. [0122] Figure 3 shows one embodiment of DR-MTB cassette (left panel) and the respective positions of probes and signals (right panel). IAC is the internal amplification control for monitoring PCR amplification process. HC is the hybridization control which monitors the hybridization process. Figure 4 shows one embodiment of DR-MTB array profile for DR-MTB detection. In one embodiment, RIF and ΓΝΗ resistant strains of MTB are detected separately. In another embodiment, MTB strains resistant to both RIF and 1NH are detected (multi-drug resistant). In one embodiment, strains that are neither resistant to rifampicin (RIF) nor isoniazid (INH) are detected (out of panel mutation). Validity of PCR amplification and specimen are also accessed by various controls. Primer Sequences

Probe Sequences Probe Probe sequence (5'-3') 5' Modification SEQ ID NO TB-DR-Rpob-CTRL GCTGGTGCCGAAGAA AMINO 1 82

MTB-DR-KatG-CTRL CGGGGTGTTCGTCCATAC AMINO 1 83

MTB-DR-inhA-CTRL GGTATGTCCACGAGCGTAAC AMINO 1 84

MTB-DR-Rpob-WTc GGTTGTTCTGGTCCATG AMINO 1 85

MTB-DR-Rpob-Wte TGACCCACAAGCGCCGA AMINO 186

MTB-DR-Rpob-Wtf GACTGTCGGCGCTGG AMINO 187

MTB-DR-KatG-WT GATGCCGCTGGTGATCG AMINO 188 TB-DR-inhA-WT AACCTATCGTCTCGCCG AMINO 1 89

MTB-DR-Rpob-MUTc l GGTTGTTCTGGACCATGA AMINO 1 90

MTB-DR-Rpob-MUTc2 GGTTGTTCTGGCCCATG AMINO 191

MTB-DR-Rpob- UTe 1 GACCGACAAGCGCCGA AMINO 192

MTB-DR-Rpob-MUTe2 GCGCTTGTAGGTCAACC AMINO 193

MTB-DR-Rpob-MUTe3 GCGCTTGAGGGTCAAC AMINO 194

MTB-DR-Rpob-MUTfl CCCCAGCGCCAACAGT AMINO 1 95 TB-DR-Rpob-MUTf2 GACTGTGGGCGCTGG AMINO 196

MTB-DR-KatG-MUTl GATGCCGGTGGTGATC AMINO 197

MTB-DR-KatG-MUT2 GATGCCTGTGGTGATCG AMINO 198

MTB-DR-inhA- UTl CAACCTATCATCTCGCCG AMINO 199

RS-IAC-P CTCGAATGCCTCGTATCAT AMINO 200

Below are some example protocols for PCR and hybridization:

One embodiment of hybridization protocol :

EXAMPLE 3

Beta Thalassemia Genotyping

[0123] This invention provides a system for the detection of beta-globin mutations including TATA-28 (A>G), TATA-29 (A>G), Initiation Codon (G>A), Codon 5 (-CT), Codons 8/9 (+G), Codon 15 (G>A), Codon 16 (-C), Codon 17 (A>T), Codon 19 (A>G), Codon 26 (G>A) (Hb E), Codons 27/28 (+C), Codon 30 G>C, IVS l . l (G>T), IVS l . l (G>A), IVS 1 .5 (G>C), Codons 41/42 (-TCTT), Codon 43 (G>T), Codons 71/72 (+A), IVS2.1 (G>A), IVS2.654 (C>T), and 619 bp deletion. W

[0124] The present invention also provides a method of detecting beta-globin mutations in a subject having beta-thalassemia, comprising the steps of: (a) obtaining from the subject a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs:201 -205, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs:206-240, wherein the resulting hybridization profile would indicate the genotypes of beta-thalassemia. In one embodiment, the primers comprise a signal generating label. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process, or a reversed flow-through process. In one embodiment, the above method can detect one of twenty one beta-globin mutations.

[0125] Figure 5 shows one embodiment of beta-thalassemia cassette and signal position (grids shown for illustration purpose only). Figure 6a shows one example of visual interpretation of different beta-thalassemia genotypes. Figure 6b shows testing results on various clinical samples using the beta-thalassemia cassette, indicating that the present invention can successfully identify the genotypes of beta-thalassemia in human samples. Primer Sequences (Accession # AF007546.1 ):

Probe Sequences (Accession # AF007546.1 ):

HBB2-A5 Anti-sense Amine CCCTGACTTTCATGCCC 21 1

HBB2-B 1 Sense Amine GCATCTGACTCCTGAGGA 212

HBB2-B la Sense Amine GCACCTGACTCCTGAGG 213

HBB2-B2 Anti-sense Amine ACTTCTCCTCGAGTCAGAT 214

HBB2-B3 Anti-sense Amine CAGGGCCTCACCACCA 215

HBB2-B4 Sense Amine GTTGGTGGTAAGGCCCT 216

HBB2-B5 Anti-sense Amine CCAGGGGCCTCACCA 217

HBB2-C1 Sense Amine AGGAGAAGTCTGCCGTTACT 218

HBB2-C2 Sense Amine AGGAGAAGGTCTGCCGTTA 219

HBB2-C3 Sense Amine GAGGTTCTTTGAGTCCTTTGG 220

HBB2-C4 Anti-sense Amine CAAAGGACTCAACCTCTGG 221

HBB2-C5 Sense Amine CCCAGAGGTTCTTTTAGTC 222

HBB2-D1 Sense Amine TGTGGGGCAAGGTGAAC 223

HBB2-D2 Sense Amine CCGTTACTGCCCTGTAGG 224

HBB2-D3 Sense Amine CTGTGGGGAAGGTGAAC 225

HBB2-D4 Anti-sense Amine TGTGGGGCTAGGTGAACG 226

HBB2-D5 Anti-sense Amine CTTCATCCACGCTCACCT 227

HBB2-E1 Anti-sense Amine TGATACCAACCTGCCCAG 228

HBB2-E2 Sense Amine CTGGGCAGATTGGTATCA 229

HBB2-E3 Sense Amine CCCTGGGCAGTTTGGTATC 230

HBB2-E4 Sense Amine GCAGGTTGCTATCAAGGTTAC 231

HBB2-E5 Anti-sense Amine ATACCAACGTGCCCAGG 232

HBB2-F1 Sense Amine GGTGCCTTTAGTGATGGC 233

HBB2-F2 Sense Amine TCGGTGCCTTTAAGTGATG 234

HBB2-F3 Sense Amine TGGGTTAAGGCAATAGCAATAT 235

HBB2-F4 Anti-sense Amine ATATTGCTATTACCTTAACCC 236

HBB2-G 1 Sense Amine CATACCTCTTATCTTCCTCC 237

HBB2-G2 Sense Amine TGTAACAAGTAGAGATTCAAGTA 238

HBB2-G3 Sense Amine GAACTTCAGGGTGAGTCTAT 239

HBB2-G4 Anti-sense Amine GAACTTCAGGATGAGTCTATG 240

Below are some example protocols for PCR and hybridization:

Program Temperature

Step 1 Denature 94°C 9 min

Step 2 Denature 94°C 1 min

Step 3 Annealing 60°C 30 sec

Step 4 Extension 72°C 30 sec

Step 5 Go to step 2 for 39 cycles

(Total: 40 cycles)

Step 6 Final 72°C 7 min

Extension

Step 7 Final Hold 4°C forever

Step 8 End One embodiment of hybridization protocol:

Data interpretation for Beta globin mutation:

Mutation points Genotype Type specific signal

1 Initiation codon T>G β° Α2

2 TATA -28 A->G P ⁺ Α4

3 TATA -29 A->G f Α5

4 Codon 5-CT Β3

5 Codon 26 G->A β ⁺ Β4

6 Codons 27/28 +C β° Β5

7 Codons 8/9 +G β° C2

8 Codons 41/42- TCTT β° C4

9 Codon 43 G>T β° C5

10 Codon 15 G>A β° D2

11 Codon 16-C β° D3

12 Codon 17 A>T β° D4

13 Codon 19 A>G β ⁺ D5

14 IVS1.1 G>A β° E2

15 IVS1.1 G>T β° E3

16 IVS 1.5 G>C β ⁺ E4

17 Codon 30 G>C β° E5

18 Codons 71/72 +A β° F2 19 IVS2,654 OT F4

20 619-bp deletion G2 21 1VS2.1 OA G4

EXAMPLE 4

HBV Genotyping [0126] The present invention also provides a method for detecting the presence of HBV, comprising the steps of: (a) obtaining a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs:241 -244, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs:245-260, wherein the resulting hybridization profile would indicate the presence of HBV. In one embodiment, the primers comprise a signal generating label. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process, or a reversed flow-through process. In one embodiment, a universal probe of SEQ ID NO.: 257 is included for capturing nucleic acids of HBV of various genotypes.

[0127] Figure 7 shows one embodiment of a HBV test kit detecting the presence of 8 HBV genotypes (HBV A, B, C, D, E, F, G and H). Figure 8 shows one example of visual interpretation of different HBV genotypes.

Primer se uences:

Probe sequences:

HBV Universal HBV-U-4 GTCACCATATTCTTGG 257 5'-Amine

IAC 1AC-R-P2 CTCGAATGCCTCGTATCAT 258 5'-Amine

HC Bio-HC GTTCCAACTAGGAACATCA 259 5 '-Amine

3'-Biotin

HC Amine-HC GTTCCAACTAGGAACATCA 260 5 '-Amine

HBV Positive Control sequence [560 bp] (cloned in vector pUC57):

TGGGATTCTATATAAGAGGGAAACTACACGTAGCGCCTCATTTTGCGGGTCACCATATT CTTGGGAACAAGAGCTACATCATGGGAGGTTGGTCATCAAAACCTCGCAAAGGCATG GGGACGAACCTTTCTGTTCCCAACCCTCTGGGATTCTTTCCCGATCATCAGTTGGACC CTGCATTCGGAGCCAATTCAAACAATCCAGATTGGGACTTCAACCCCATCAAGGACC ACTGGCCACAAGCCAACCAGGTAGGAGTGGGAGCATTCGGGCCAGGGTTCACTCCC CCACACGGAGGTGTTTTGGGGTGGAGCCCTCAGGCTCAGGGCATATTGGCCACAGTG CCAGCAGTGCCTCCTCCTGCCTCCACCAATCGGCAGTCAGGAAGGCAGCCTACTCCC ATCTCTCCACCTCTAAGAGACAGTCATCCTCAGGCC ATGCAGTGGAATTCCACAGCTT TCCACCAAGCTCTGCAAGATCCCAGAGTCAGGGGCCTGTATTTTCCTGCTGGTGGCTC CAGTTCAGGAACACTCAACCCTGTTCCAACTATTGCCTCTCAC (SEQ ID NO:261 )

Internal Amplification Control sequence [500 bp] (cloned in vector pUC57):

GAG ACAGGTTCGTCCAATCCCGTGCCGCGGCCTTGGCAGGGGGTTCGCAGGCCCCAC CCGAAGCGTTGCTGAAGGCTCAGGCCTCTGAGCGACAAAAGCTTTAAACGCGAGTT CCCGCCCATAACCTGGACCGAATGCGGGACCATGCATCGTTCCACTGTGTTTGTCCCA TGTAGGACGGGCGCAAGGCGTGCTTAGCTCAGCCTCGAATGCCTCGTATCATTGTGCA CCCGCCGGTCACCAGCCAACGATGTGCGGACGGCGTTGCAACTTCCGGGGCCCAAC CTGACCGTCCTGGGTACCGCACTCTGGGCAGTGCGAGGTAATGCCAGTCGCCCAGTG CCGAACAACACCTGACCTAACGGTAAGAGGCTCACATAATGGCTCCGCCGGCGCGCC CAGGGTACATTAGGTCAGCATCGGATGGACTGACATGAACCTTCACACCGAAGCGGA AACGGGTGCGTGGACCAGCGAGGAGCAAACGAAAATTCCTGGCC (SEQ ID NO:262) Below are some example protocols for PCR and hybridization:

* Suggested range of total HBV viral DNA in serum is greater than 4000 IU/mL. Annealing 58 30 sec

Extension 72 30 sec

Hold Final Extension 72 5 min

Hold Final Hold 4 oo

This thermal profile is suitable for Applied Biosystems Perkin Elmer (ABI-PE) 9600, GeneAmp PCR System 9700, Veriti (Applied Biosystems), PTC-200 (MJ Research).

One embodiment of hybridization protocol :

EXAMPLE 5

Genotyping and Simultaneous Detection of Multiple Pathogens For Sexually Transmitted

Diseases

[0128] In one embodiment, this invention provides method to detect the presence of pathogens related to sexually transmitted disease (STD) including, but not limited to, protozoa, bacteria and viruses. In one embodiment, STD related pathogens present in urine, urogential swab (urethral, vaginal, cervical and lesion) and Liquid-based cytology specimens (PreservCyt™ and SurePath™) are detected. In one embodiment, Amplification Control (AC) is included for detection of human DNA materials. DNA hybridization and amplification of target DNA by PCR technologies enable a faster, more sensitive and specific detection of STDs in urine, urogential swab (urethral, vaginal, cervical and lesion) and Liquid-based cytology specimens (PreservCyt™ and SurePath™). I n one embodiment, the method can detect the presence of 12 common pathogens including 1 protozoan (Trichomonas vaginalis), 7 bacteria (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum, Treponema pallidum) and 4 viruses (Herpes simplex virus 1 & 2, Human papillomavirus type 6 & 1 1 ). These pathogens are related to cervicitis, urethritis, trichomoniasis and pelvic inflammatory disease. In another embodiment, universal primer(s) and/or amplification control is included in the test.

[0129] The present invention also provides a method for detecting the presence of sexually transmitted diseases causing pathogens in a subject, comprising the steps of: (a) obtaining from the subject a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs:263-286, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs:287-298, wherein the resulting hybridization profile would indicate the presence of nucleic acid fragments originated from pathogens that may develop into disease, namely sexually transmitted diseases. In one embodiment, the primers comprise a signal generating label. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process or a reversed flow-through process and/or related devices.

[0130] Below table shows the primer sequences of SEQ ID NOs.: 263-284, whereas these sequences consist of two parts: in the 5 ' portion is an artificial synthetic nucleic acid sequences not homologous to any of these target pathogens and not related to any organisms that may be found in human that may be amplified; the 3' portion of the primer consists of pathogen-specific sequence so that each can effectively bind to the nucleic acid of corresponding pathogen to generate amplicons to enable detection. This 5 ' portion of the sequence is common to all hybridprimers called Universal sequence. The art of designing such Universal sequences for use as Universal primers such as those disclosed in the present invention are selected after thorough consideration and experimentation to rule out any possibility of amplifying any organisms that may be found in the sample source, i.e. pathogens and human genomic DNA (Figure 1). Universal sequences verified to be specific are then combined with various pathogen-specific sequences to give pathogen-specific primers, which are capable of generating amplicons containing the Universal sequences. These amplicons become new templates for the second PCR, which uses Universal primers of SEQ ID NO.: 285 and 286 to effectively amplify all different amplicons with the same efficiency, therefore linearly generating amplicons which has a final concentration directly proportional to the initial concentrations of the target DNA. This is especially crucial to samples containing multiples targets, because target at low copy number can still be amplified to achieve considerable concentration for positive detection, using Universal primers can help rectifying such error and therefore increasing sensitivity drastically. In one embodiment, the PCR reaction was carried out in a single tube but is in fact a two-step PCR where the pathogen-specific primer bind to target molecules by its gene-specific 3' region to generate the initial amplicons containing Universal sequence at the end. These amplicons serve as templates for the second set of primers (the Universal primers) to start the main portion of amplification and generate signal-containing amplicons, which are finally detected through subsequent hybridization. One embodiment of the amplification scheme is shown in Figure 2. [0131] By using the Universal primers, the present method gives more accurate and sensitive detection in comparison with other commercially available STD testing kits. As seen in Figure 9a, the present invention can detect STD-causing pathogens with a copy number as low as 50-300, while the kit from another manufactory can only detect STD-causing pathogens with a copy number of at least 500. The present invention is able to detect pathogens of low abundance in samples.

[0132] Figure 9b shows a side-by-side comparison of performance of the present invention and a commercially available STD testing kit. Inconsistent results are observed in the four tests and the actual genotypes are confirmed by quantitative PCR (qPCR). After confirming the genotypes of pathogens using qPCR, it is found that the present invention (Test 3 and 4) has less false result than the other kit (Test 1 and 2). In addition, the present invention can detect 5 more pathogens (as noted in Figure 9b), hence detects 12 pathogens simultaneously which is the highest number as compared to those available in the market. Coverage of human papillomavirus (HPV) type 6 and 1 1 (HPV 6/1 1 ) in the present invention is very useful because of the high incidence of infection of HPV6 and HPV 1 1 . HPV6 and HPV 1 1 are found causing 90% of the cases of Genital wart, which is a highly contagious sexually transmitted disease.

[0133] Figure 10a shows one embodiment of a STD array that can detect the presence of 12 common pathogens: 1 protozoan (Trichomonas vaginalis), 7 bacteria (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum, Treponema pallidum) and 4 viruses (Herpes simplex virus 1 & 2, Human papillomavirus type 6 & 1 1 ). Amplification control (AC) is included to check for validity of the results. Figure 10b shows one example of visual interpretation of the STD array. In one embodiment, protozoan, bacterium and virus are detected separately. In another embodiment, protozoan, bacterium and virus are detected simultaneously (Multiple infections).

[0134] In one embodiment, pathogen Treponema pallidum (TP) is provided as a positive template in a positive control (PC) for monitoring the performance of PCR reagents. If a TP signal does not appear in a positive control (PC) test, it may be because the DNA has been degraded during long storage or nuclease contamination. However, if the test sample produces positive signal for any of the pathogens, the test is still valid. In the positive control (PC) test, since the positive control sample only contains the DNA of Treponema pallidum (TP) but no endogenous human genomic DNA, an absence of AC signal will be resulted. A presence of an AC signal in the positive control (PC) test indicates the control test is invalid, which may be due to contamination and the test should be repeated.

[0135] An absence of the AC signal in the test sample indicates an insufficient amount of DNA added or absence of specimen DNA in the test sample. However, if the test sample produces positive signal for any of the pathogens, the test is still valid. An AC signal may be absent in some samples due to competition from other pathogenic DNA. In this case, the test would still be valid as long as one or more positive signal(s) is detected on the array.

[0136] In another embodiment, the array cassette to be used in the flow-through process and/or device is of different forms and sizes. Instead of using the 10 dots array, a 35 dot is readily available whereas addition of dot can be used for detecting extra pathogens subtypes and/or more drug resistant strains caused by, for example, gene mutation. Signal can also be digitized using imaging system accompanying the hybridization device such as FT-Pro. In another embodiment, the hybridization device available is an auto-device with all analysis build-in with digitizing capability.

[0137] The present invention is advantageous over existing testing methods and kits because it can amplify multiple targets quantitatively and detect multiple targets simultaneously with high sensitivity, and covers 12 types of STD-causing pathogens including HPV subtypes which are excluded in most of the existing kits. Coupling with the flow-through hybridization process, the present invention allows a rapid, sensitive and high throughput detection of the STD-causing pathogens.

Primer sequences:

Probe Sequences: MH MHPr CAGCTATGCTGCGGTGAATA Amine 294

HSV1/2 HSV_Pr1 (minus strand) CTTGTCGATCACCTCCTCG Amine 295

HPV6 HPV6JN2 TTATGTGCATCCGTAACTA Amine 296

HPV11 hPV11_Pr (minus strand) GTAGCAGATTTAGACACAGATG Amine 297

AC b-globin-402T AAGGTGAACGTGGATGAAGTTGGTGG Amine 298

Below are some example protocols for PCR and hybridization:

This thermal profile is suitable for the Veriti Thermal Cycler (Life technologies), S 1000 Thermal Cycler (Bio-rad). A modification of the cycling program may be necessary when using other thermal cyclers (ramp rate 3°C / sec).

One embodiment of hybridization protocol:

Adjust Device Temperature (DOWN)

Blocking

Blocking 150 μΐ 5 min

Solution

25 °C

Enzyme Enzyme

150 μΐ 5 min

Conjugation Conjugate

Adjust Device Temperature (UP)

Post-reaction

A Solution 200 μί x 4 times

Wash

Detection

150 μΐ 3 min

Color Solution 36 °C

Development

A Solution 200 μΐ x 3 times

Stop Reaction Stop Solution 150 μΐ 1 min

EXAMPLE 6

Genotvping For Thrombophilia

[0138] The present invention also provides a method for detecting mutations related to thrombophilia, comprising the steps of: (a) obtaining a sample comprising a template nucleic acid; (b) amplifying the template nucleic acid with primers selected from the group consisting of SEQ ID NOs:299-306, thereby generating amplicons; and (c) hybridizing the amplicons with oligonucleotide probes selected from the group consisting of SEQ ID NOs:307-3 14, wherein the resulting hybridization profile would indicate the presence of mutations related to thrombophilia. In one embodiment, the primers comprise a signal generating label. In one embodiment, hybridization of the amplicons with the plurality of oligonucleotide probes is carried out in a flow-through process, a lateral flow-through process, or a reversed flow-through process. In one embodiment, the above method can detect mutation at a gene selected from the group consisting of Factor V Leiden, Factor II (Prothrombin), and Methylenetetrahydrofolate Reductase.

[0139] Figure 1 1 shows one embodiment of a Thrombophilia array. Figure 12 shows one example of visual interpretation of the Thrombophilia array.

Primer sequences: Primer Probe sequence (5'-3') 5' Modification SEQ ID NO

FVL F GAAAATGATGCCCAGTGCTT 299

FVL R TTGAAGGAAATGCCCCATTA Biotin 300

FII F GAACCAATCCCGTGAAAGAA 301

FU R AGCTGCCCATGAATAGCACT Biotin 302

MTHFR677 F GGTTACCCCAAAGGCCACC Biotin 303

MTHFR677 R AAGCGGAAGAATGTGTCAGC Biotin 304

MTHFR1298_F TTTGGGGAGCTGAAGGACTA 305

MTHF 1298_R CTTTGTGACCATTCCGGTTT Biotin 306

Probe sequences:

Below are some example protocols for PCR and hybridization:

* Suggested range of total DNA is l Ong - 100 ng.

One embodiment of hybridization protocol: Pre-hybridization Hybridization Solution 750 μΐ 5 mins

520 μί

Hybridization Hybridization Solution (500 μΐ 5 mins

+PCR Product + 20 μΐ)

41 °C

Stringent Wash Stringent Wash Solution 750 μΐ -

1 min

Stringent Wash Stringent Wash Solution 750 μΐ

x 3 times

Adjust Device Temperature (DOWN)

Blocking Blocking Solution 500 μΐ 5 mins

25 °C

Enzyme Conjugation Enzyme Conjugate 500 μΐ 5 mins

Adjust Device Temperature (UP)

Post-reaction Wash A Solution 750 μΐ x 4 times

Posting Blocking Blocking Solution 500 μΐ 1 min

Detection Solution 500 μΐ 36 °C 5 mins

Color Development

B Solution 750 μΐ x 3 times

Stop Reaction Stop Solution 750 μΐ 1 min