"REAGENTS AND METHODS FOR DIAGNOSING SHIGELLA SPECIES"

RELATED APPLICATION DATA

This application claims the right of priority to Australian Provisional Application No. 2021901594, filed 27 May 2021, and Australian Provisional Application No. 2021901644, filed 2 June 2021, the complete contents of each of which is incorporated by reference herein in its entirety.

TECHNICAL FIELD

The present disclosure relates generally to methods and test kits for detecting Shigella spp. in biological and environmental samples. In particular, the present disclosure relates to rapid diagnostic methods for detecting Shigella spp. based on species-specific DNA biomarkers which permit detection of Shigella in a sample, as well as determination of the specific Shigella species present. The present disclosure also provides test kits and reagent mixtures for use in the diagnostic method.

BACKGROUND

Worldwide, Shigella is estimated to cause 80-165 million cases of disease and more than 600,000 deaths annually (Centers for Disease Control and Prevention). Of these, 20-119 million illnesses and 6,900-30,000 deaths are attributed to foodborne transmission. Shigella spp. are endemic in temperate and tropical climates. Transmission of Shigella spp. is most likely when hygiene and sanitation are insufficient. Shigella bacteria, which causes dysentery (or shigellosis) has four species; namely Shigella sonnei, Shigella flexneri, Shigella boydii and Shigella dysenteriae. However, shigellosis is caused predominantly by S. sonnei in industrialized countries, whereas S. flexneri prevails in the developing world. Infections caused by S. boydii and S. dysenteriae are less common globally, but can make up a substantial proportion of Shigella spp. isolated in sub-Saharan Africa and South Asia. Given the huge impact of Shigella infection worldwide, the ability to rapidly and accurately detect Shigella is important.

Rapid diagnostic tests for shigellosis are increasingly available. However, culture of a stool specimen or rectal swab is typically required when a rapid test returns a positive result in order to obtain an isolate for species determination and antimicrobial susceptibility testing to guide treatment. This process is time consuming and necessitates culturing a sample. Further, recent research has shown that only around 30% of the Shigella species can be cultured from stool samples, meaning that up to 70% of Shigella species cannot be confirmed in a laboratory from a stool sample in the absence of an alternative method of characterisation. Shigella species which cannot be confirmed via culture are referred to as ‘Culture-negative PCR-positive’ Shigella. The ‘culture-positive’ shigellosis cases are different to the culture- negative PCR-positive shigellosis cases in terms of the severity of symptoms, hospitalisation and epidemiology ( See e.g., Quinn et al (2019), Australian and New Zealand Journal of Public Health , 43:41-45). The availability of diagnostic test which is capable of discriminating Shigella at the species level would therefore be useful for diagnosis and treatment of shigellosis, particularly for those species which are not amenable to culture.

Accordingly, there is a need for improved methodologies and means for detecting Shigella infection which permit rapid diagnosis at the species level.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.

SUMMARY

The present disclosure is based, at least in part, on the recognition by the inventor that there is a need for improved means of diagnosing shigellosis, and to be able to accurately and efficiently discriminate between Shigella species. The ability to rapidly and accurately diagnose Shigella infection, as well as discriminate between Shigella species, is important for the effective and timely treatment of shigellosis in infected individuals. To this end, the present inventor has developed a panel of species- specific genomic markers which are capable of differentiating between the four Shigella species and which can be used to improve diagnostic power of current tests for detecting Shigella bacteria.

The present disclosure is directed to a method of detecting Shigella in a sample and/or determining species thereof, said method comprising:

(a) determining the presence or absence of one or more nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332, or one or more homologues of the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332 having at least 75% identity thereto, in DNA extracted from the sample, or determining the presence or absence of one or more polypeptides encoded by said nucleic acid sequences in a lysate prepared from the sample; and

(b) determining the presence or absence of Shigella sonnei, Shigella flexneri, Shigella boydii and/or Shigella dysenteriae in the sample based on the presence or absence of one or more of the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332 or the homologues thereof or the polypeptides encoded by said nucleic acid sequences, wherein:

(i) the presence of at least one of the nucleic acid sequences set forth in SEQ ID NOs: 1 and 332, a homologue thereof having at least 75% identity thereto, or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella sonnei in the sample, and the absence of the nucleic acid sequences set forth in SEQ ID NOs: 1 and 332, the homologue thereof having at least 75% identity thereto, and the polypeptides encoded by said nucleic acid sequences, is indicative that Shigella sonnei is not present in the sample;

(ii) the presence of at least one of the nucleic acid sequences set forth in SEQ ID NOs: 2 and 3, a homologue thereof having at least 75% identity thereto, or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella flexneri in the sample, and the absence of the nucleic acid sequences set forth in SEQ ID NOs: 2 and 3, the homologues thereof having at least 75% identity thereto, and the polypeptides encoded by said nucleic acid sequences, is indicative that Shigella flexneri is not present in the sample;

(iii) the presence of at least one of the nucleic acid sequences set forth in SEQ ID NOs: 4-10, a homologue thereof having at least 75% identity thereto, or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella boydii in the sample, and the absence of the nucleic acid sequences set forth in SEQ ID NOs: 4-10, the homologues thereof having at least 75% identity thereto, and the polypeptides encoded by said nucleic acid sequences, is indicative that Shigella boydii is not present in the sample; and

(iv) the presence of at least one of the nucleic acid sequences set forth in SEQ ID NOs: 11- 14, a homologue thereof having at least 75% identity thereto, or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella dysenteriae in the sample, and the absence of the nucleic acid sequences set forth in SEQ ID NOs: 11-14, the homologues thereof having at least 75% identity thereto, and the polypeptides encoded by said nucleic acid sequences, is indicative that Shigella dysenteriae is not present in the sample.

In one example, the presence of at least one of the nucleic acid sequence set forth in SEQ ID NOs: 1 and 332, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella sonnei in the sample, and the absence of the nucleic acid sequences set forth in SEQ ID NOs: 1 and 332, homologues thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), and polypeptides encoded by said nucleic acid sequences, is indicative that Shigella sonnei is not present in the sample.

In one example, the presence of at least one of the nucleic acid sequences set forth in SEQ ID NOs: 2 and 3, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella flexneri in the sample, and the absence of the nucleic acid sequences set forth in SEQ ID NOs: 2 and 3, homologues thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), and polypeptides encoded by said nucleic acid sequences, is indicative that Shigella flexneri is not present in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 2, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella flexneri of one or more serotypes selected from serotype 15, la, lb, lc, 1, 2a, 2b, 2, 3a, 3b, 3c, 3, 4a, 4av, 4b, 4bv, 4c, 4, 5a, 5b, 5, 6, 7, X, Xv, Y, and/or Yv in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 3, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella flexneri of one or more serotypes selected from serotype 6 and/or 2 in the sample.

In one example, the presence of at least one of the nucleic acid sequences set forth in SEQ ID NOs: 4-10, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella boydii in the sample, and the absence of the nucleic acid sequences set forth in SEQ ID NOs: 4-10, homologues thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), and polypeptides encoded by said nucleic acid sequence, is indicative that Shigella boydii is not present in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 4, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 1, 3, 6, 8, 10, 11, 18, 19 and/or 20 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 5, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of serotype 2 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 6, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 4 and/or 6 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 7, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 11, 13, 16, 17, 5, 7 and/or 9 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 8, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of serotype 11 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 10, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 14 and/or 2 in the sample.

In one example, the presence of at least one of the nucleic acid sequences set forth in SEQ ID NOs: 11-14, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella dysenteriae in the sample, and the absence of the nucleic acid sequences set forth in SEQ ID NOs: 11-14, homologues thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), and polypeptides encoded by said nucleic acid sequence, is indicative that Shigella dysenteriae is not present in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 11, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella dysenteriae of serotype 1 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 12, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella dysenteriae of one or more serotypes selected from serotype 3, 4, 6, 8, 9, 11, 12, 13, 14, 15, 17 and/or 18 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 13, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella dysenteriae of one or more serotypes selected from serotype 12 and/or 2 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 14, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella dysenteriae of serotype 8 in the sample.

In one example, the method comprises determining the presence or absence of each of the following in the sample: a nucleic acid sequence set forth in SEQ ID NO: 1 or 332, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 1 or 332, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 2, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 2, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 3, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 3, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 4, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 4, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 5, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 5, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 6, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 6, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 7, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 7, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 8, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 8, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 9, homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 9, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 10, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 10, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 11, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 11, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 12, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 12, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 13, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 13, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; and a nucleic acid sequence set forth in SEQ ID NO: 14, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 14, or a polypeptide encoded by said nucleic acid sequence or homologue thereof.

In one example, the method comprises determining the presence or absence of each of the following in the sample: a nucleic acid sequence set forth in SEQ ID NO: 1, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 1, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 332, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 332, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 2, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 2, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 3, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 3, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 4, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 4, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 5, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 5, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 6, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 6, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 7, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 7, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 8, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 8, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 9, homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 9, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 10, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 10, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 11, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 11, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 12, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 12, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; a nucleic acid sequence set forth in SEQ ID NO: 13, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 13, or a polypeptide encoded by said nucleic acid sequence or homologue thereof; and a nucleic acid sequence set forth in SEQ ID NO: 14, a homologue thereof having at least 75% identity (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity) to the nucleic acid sequence set forth in SEQ ID NO: 14, or a polypeptide encoded by said nucleic acid sequence or homologue thereof.

In some examples, the method may comprise determining:

(i) the presence or absence of each of the nucleic acid sequences set forth in SEQ ID NOs: 2-14 or homologue(s) of the nucleic acid sequences set forth in SEQ ID NOs: 2-14 having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) in DNA extracted from the sample and the presence or absence of at least one of the nucleic acid sequences set forth in SEQ ID NOs: 1 or 332 or homologue(s) of the nucleic acid sequences set forth in SEQ ID NOs: 1 or 332 having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) in DNA extracted from the sample;

(ii) the presence or absence of each of the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332 or homologue(s) of the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332 having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), in DNA extracted from the sample; or

(iii) the presence or absence of polypeptides encoded by the nucleic acid sequences defined in (i) or (ii) in a lysate prepared from the sample.

In some examples, the method comprises determining the presence or absence of Shigella sonnei, Shigella flexneri, Shigella boydii and/or Shigella dysenteriae in the sample based on the presence or absence of one or more polypeptides encoded by the one or more nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof. In accordance with other examples, the method comprises determining the presence or absence of Shigella sonnei, Shigella flexneri, Shigella boydii and/or Shigella dysenteriae in the sample based on the presence or absence of one or more of the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof. In yet other examples, the method comprises determining the presence or absence of Shigella sonnei, Shigella flexneri, Shigella boydii and/or Shigella dysenteriae in the sample based on the presence or absence of a combination of one or more of the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332, homologues thereof having at least 75% identity thereto, and/or one or more polypeptides encoded by said nucleic acids.

In one example, the method may comprise determining the presence or absence of one or more of, or each of, the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332, or one or more homologues of the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332 having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), in DNA extracted from the sample, wherein: the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 1 is indicative of the sequence set forth in SEQ ID NO: 1 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 332 is indicative of the sequence set forth in SEQ ID NO: 332 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 2 is indicative of the sequence set forth in SEQ ID NO: 2 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 3 is indicative of the sequence set forth in SEQ ID NO: 3 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 4 is indicative of the sequence set forth in SEQ ID NO: 4 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides, or at least 100 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 5 is indicative of the sequence set forth in SEQ ID NO: 5 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides ( e.g ., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 6 is indicative of the sequence set forth in SEQ ID NO: 6 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 7 is indicative of the sequence set forth in SEQ ID NO: 7 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 8 is indicative of the sequence set forth in SEQ ID NO: 8 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 9 is indicative of the sequence set forth in SEQ ID NO: 9 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 10 is indicative of the sequence set forth in SEQ ID NO: 10 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 11 is indicative of the sequence set forth in SEQ ID NO: 11 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 12 is indicative of the sequence set forth in SEQ ID NO: 12 or a homologue thereof being present in the DNA sample; the presence of at least 18 contiguous nucleotides ( e.g ., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 13 is indicative of the sequence set forth in SEQ ID NO: 13 or a homologue thereof being present in the DNA sample; and/or the presence of at least 18 contiguous nucleotides (e.g., at least 20 contiguous nucleotides, or at least 35 contiguous nucleotides, or at least 50 contiguous nucleotides, or at least 75 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 14 is indicative of the sequence set forth in SEQ ID NO: 14 or a homologue thereof being present in the DNA sample.

In one example, the method comprises determining the presence or absence of one or more or each of the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332, or one or more homologues of the nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332 having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), in DNA extracted from the sample, wherein: the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

1 is indicative of the sequence set forth in SEQ ID NO: 1 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 332 is indicative of the sequence set forth in SEQ ID NO: 332 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

2 is indicative of the sequence set forth in SEQ ID NO: 2 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

3 is indicative of the sequence set forth in SEQ ID NO: 3 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 4 is indicative of the sequence set forth in SEQ ID NO: 4 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 5 is indicative of the sequence set forth in SEQ ID NO: 5 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides ( e.g ., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

6 is indicative of the sequence set forth in SEQ ID NO: 6 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

7 is indicative of the sequence set forth in SEQ ID NO: 7 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

8 is indicative of the sequence set forth in SEQ ID NO: 8 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

9 is indicative of the sequence set forth in SEQ ID NO: 9 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

10 is indicative of the sequence set forth in SEQ ID NO: 10 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 11 is indicative of the sequence set forth in SEQ ID NO: 11 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO: 12 is indicative of the sequence set forth in SEQ ID NO: 12 or a homologue thereof being present in the DNA sample; the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

13 is indicative of the sequence set forth in SEQ ID NO: 13 or a homologue thereof being present in the DNA sample; and/or the presence of at least 100 contiguous nucleotides (e.g., at least 100 contiguous nucleotides, or at least 150 contiguous nucleotides, or at least 200 contiguous nucleotides, or at least 250 contiguous nucleotides or more) from within a sequence set forth in SEQ ID NO:

14 is indicative of the sequence set forth in SEQ ID NO: 14 or a homologue thereof being present in the DNA sample.

In some examples, the method may further comprise determining whether a sample comprises Shigella spp. and/or Enteroinvasive Escherichia coli (EIEC). In accordance with this example, the method may comprise determining the presence or absence of a biomarker associated with the presence of Shigella spp. and/or EIEC. For example, the method may comprise determining the presence or absence of a nucleic acid sequence corresponding to the IpaH gene in DNA extracted from the sample, and/or determining the presence or absence of an IpaH polypeptide encoded by the IpaH gene in a lysate prepared from the sample. For example, the method may comprise determining the presence or absence of the IpaH polynucleotide sequence set forth in SEQ ID NO: 325 or its corresponding polypeptide in the sample. The presence of a nucleic acid sequence corresponding to the IpaH gene, or an IpaH polypeptide encoded thereby, in the sample (i.e., an IpaH positive test result) indicates that the sample comprises Shigella spp., EIEC or both. Conversely, the absence of a nucleic acid sequence corresponding to the IpaH gene, or an IpaH polypeptide encoded thereby, in the sample (i.e., an IpaH negative test result) indicates that the sample does not comprise Shigella spp. or EIEC.

The method may also comprise detecting the presence or absence of one or more biomarkers capable of distinguishing between Shigella spp. and EIEC in the sample e.g., when the sample is IpaH positive. In accordance with this example, the method may comprise determining the presence or absence of the polynucleotides sequence set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in a sample (e.g., an IpaH positive sample). For example, the presence of one or none of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in a IpaH positive sample indicates the presence of Shigella spp. and not EIEC in the sample, whereas the presence of two or more of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in an IpaH positive sample indicates the presence of EIEC and not Shigella spp. in the sample. In some examples, the method comprises determining whether a sample comprises Shigella spp., EIEC or both and/or whether the sample is positive for Shigella spp. specifically or EIEC specifically, prior to determining the species of Shigella in the sample.

In other examples, the method comprises determining whether a sample comprises Shigella spp., EIEC or both and whether the sample is positive for Shigella spp. specifically or EIEC specifically, at the same time as determining the species of Shigella in the sample. For example, the method may comprise performing a multiplex assay configured to determine the presence or absence of: (i) a nucleic acid sequence corresponding to the IpaH gene (e.g., a polynucleotide sequence set forth in SEQ ID NO: 325) or an IpaH polypeptide encoded thereby; (ii) the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or polypeptides encoded thereby; and (iii) the polynucleotides sequences set forth in SEQ ID NOs: 2-14, homologues thereof or polypeptides encoded thereby and at least one of the polynucleotides sequences set forth in SEQ ID NOs: 1 or 332, homologues thereof or polypeptides encoded thereby .

In some examples, the method of the disclosure comprises determining whether a sample is IpaH positive or negative and/or determining whether an IpaH positive sample comprises Shigella spp. or EIEC prior to determining the species of Shigella in the sample based on the presence or absence of the Shigella biomarkers in the sample as described herein. For example, the method may comprise:

(a) determining the presence or absence of Shigella spp. and/or EIEC in a sample by determining the presence or absence of a nucleic acid sequence corresponding to the IpaH gene in DNA extracted from the sample, and/or determining the presence or absence an IpaH polypeptide encoded by the IpaH gene in a lysate prepared from the sample; and

(b) when a sample is determined as being IpaH positive indicating the presence of Shigella spp., EIEC or both , determining is the presence of Shigella spp. or EIEC by determining the presence or absence of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in the IpaH positive sample, where: (i) the presence of one or none of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in a IpaH positive sample indicates the presence of Shigella spp. and not EIEC in the sample, and (ii) the presence of two or more of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in a IpaH positive sample indicates the presence of EIEC and not Shigella spp. in the sample; and

(c) when a sample is determined as comprising Shigella spp., determining the species of Shigella in the sample based on the presence or absence of one or more nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332, one or more homologues thereof having at least 75% identity thereto, or one or more polypeptides encoded by said nucleic acid sequences as described herein. In one example, the presence or absence of the one or more sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof in the DNA sample is determined by sequencing the DNA sample. Similarly, the presence or absence of a polynucleotide corresponding to the IpaH gene (e.g., a sequence set forth in SEQ ID NO: 325) and/or the polynucleotide sequences set forth in SEQ ID NOs: 326-331, in the DNA sample may be determined by sequencing the DNA sample.

In one example, the presence or absence of the one or more sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof in the DNA sample is determined using a restriction endonuclease digestion of the DNA sample. Similarly, the presence or absence of a polynucleotide corresponding to the IpaH gene (e.g., a sequence set forth in SEQ ID NO: 325) and/or the polynucleotide sequences set forth in SEQ ID NOs: 326-331, in the DNA sample may be determined using a restriction endonuclease digestion of the DNA sample.

In one example, the presence or absence of the one or more sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof in the DNA sample is determined using specific high- sensitivity enzymatic reporter unlocking (SHERLOCK) platform. Similarly, the presence or absence of a polynucleotide corresponding to the IpaH gene (e.g., a sequence set forth in SEQ ID NO: 325) and/or the polynucleotide sequences set forth in SEQ ID NOs: 326- 331, in the DNA sample may be determined using specific high- sensitivity enzymatic reporter unlocking (SHERLOCK) platform.

In one example, the presence or absence of the one or more sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof in the DNA sample is determined by one or more nucleic acid amplification assays. Alternatively, or in addition, the presence or absence of a polynucleotide corresponding to the IpaH gene (e.g., a sequence set forth in SEQ ID NO: 325) and/or the polynucleotide sequences set forth in SEQ ID NOs: 326-331 in the DNA sample is determined by one or more nucleic acid amplification assays.

In one example, the method of the disclosure comprises: performing one or more nucleic acid amplification assays on the DNA extracted from the sample, wherein the one or more nucleic acid amplification assays are configured to specifically amplify a region within each template sequence set forth in SEQ ID NOs: 2-14 or homologues thereof having at least 75% identity thereto and at least one of the template sequences set forth in SEQ ID NOs: 1 or 332 or homologues thereof having at least 75% identity thereto; determining the presence or absence of amplification products corresponding to regions within the template sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof having at least 75% identity thereto; and determining the presence or absence of Shigella sonnei, Shigella flexneri, Shigella boydii and/or Shigella dysenteriae in the sample based on the presence or absence of one or more amplification products corresponding to one or more regions within the template sequences set forth in SEQ ID NOs: 1-14 or 332 or homologues thereof having at least 75% identity thereto.

In one example, the one or more nucleic acid amplification assays are polymerase chain reactions (PCR). For example, the PCR may be quantitative PCR (qPCR) - also referred to as real time PCR.

In one example, the one or more nucleic acid amplification assays are isothermal nucleic acid amplification assays. For example the one or more isothermal nucleic acid amplification assays may be selected from the group consisting of loop-mediated isothermal amplification (FAMP), recombinase polymerase amplification (RPA), helicase-dependent amplification (HDA), strand displacement amplification (SDA), rolling-circle amplification (RCA), and salutatory rolling-circle amplification (SRCA).

In each of the foregoing examples, the one or more amplification assays produce one or more detectably- labelled amplification products.

In accordance with any of the foregoing examples in which the amplification assay is a PCR-based assay:

(i) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 1 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 15;

(ii) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 2 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 16;

(iii) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 3 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 17;

(iv) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 4 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 18;

(v) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 5 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 19;

(vi) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 6 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 20;

(vii) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 7 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 21; (viii) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 8 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 22;

(ix) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 9 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 23;

(x) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 10 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 24;

(xi) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 11 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 25;

(xii) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 12 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 26;

(xiii) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 13 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 27;

(xiv) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 14 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 28; and/or

(xv) the amplification product corresponding to the template sequence set forth in SEQ ID NO: 332 or homologue thereof comprises or consists of the sequence set forth in SEQ ID NO: 333.

In one example, the one or more nucleic acid amplification assays use one or more of the following primer sets:

(i) primer set SS 1 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 29 (SS1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 30 (SS1_R);

(ii) primer set SS2 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 334 (SS2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 335 (SS2_R);

(iii) primer set SF2 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 31 (SF2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 32 (SF2_R);

(iv) primer set SF4 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 33 (SF4_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 34 (SF4_R); (v) primer set SB 1 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 35 (SB1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 36 (SB1_R);

(vi) primer set SB2 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 37 (SB2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 38 (SB2_R);

(vii) primer set SB3 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 39 (SB3_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 40 (SB3_R);

(viii) primer set SB4 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 41 (SB4_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 42 (SB4_R);

(ix) primer set SB 12 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 43 (SB12_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 44 (SB12_R);

(x) primer set SB6 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 45 (SB6_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 46 (SB6_R);

(xi) primer set SB7 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 47 (SB7_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 48 (SB7_R);

(xii) primer set SD1 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 49 (SD1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 50 (SD1_R);

(xiii) primer set SD3 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 51 (SD3_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 52 (SD3_R);

(xiv) primer set SD5 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 53 (SD5_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 54 (SD5_R); and/or

(xv) primer set SD7 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 55 (SD7_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 56 (SD7_R).

In accordance with examples in which the nucleic acid amplification assay is quantitative ( e.g qPCR), the method may comprise detecting the amplification product using a detection probe comprising a nucleotide sequence which is substantially complementary to a region of corresponding length in the amplification product. The detection probe may be detectably labelled. For example, the probe may be detectably labelled such that it emits a detectable signal ( e.g ., fluorescence) when it hybridises to the region of corresponding length in the amplification product but does not emit the detectable signal when it is not hybridised to the region of corresponding length in the amplification product.

In accordance with examples describing methods for detecting polypeptides encoded by the nucleic acid sequence set forth in SEQ ID NOs:l-14 or homologues thereof, the polypeptides may be detected in the sample or a lysate thereof using an immunological assay or a mass spectrometry (MS). In one example, the immunoassay is Enzyme-Linked Immunosorbant Assay (ELISA). In one example, the immunoassay is immunofluorescence. In one example, the MS method is matrix assisted laser desorption ionization time of flight (MALDI-TOF) MS.

In one example, the sample is a biological sample. For example, the biological sample is a faecal sample. For example, the biological sample may be a food sample. For example, the biological sample may be a bacterial culture.

In another example, the sample is an environmental sample. For example, the environmental sample may be a soil sample. For example, the environmental sample may be a water sample. For example, a water sample may be a wastewater sample.

In one example, the method of detecting Shigella in a sample and determining species thereof as described herein comprises the step of isolating DNA from the sample prior to step (a) and/or preparing a cell lysate from the sample prior to step (a).

The present disclosure also provides a test kit for detecting and differentiating species of Shigella in a sample, said test kit comprising one or more of the following:

(a) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 1 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(b) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 332 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(c) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 2 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(d) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 3 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(e) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 4 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(f) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 5 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(g) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 6 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(h) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 7 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(i) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 8 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(j) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 9 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(k) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 10 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay; (l) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 11 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(m) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 12 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay;

(n) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 13 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay; and

(o) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 14 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example the test kit comprises each of the reagent mixtures of (a) and (c)-(o) described herein. In one example the test kit comprises each of the reagent mixtures of (b)-(o) described herein. In one example the test kit comprises each of the reagent mixtures of (a)-(o) described herein.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 1 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 332 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 2 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 3 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 4 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 5 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 6 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 7 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 8 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 9 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay. In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 10 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 11 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 12 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 13 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

In one example, the test kit comprises a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 14 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay.

Each reagent mixture may comprise amplification primers specific for a region of DNA within the template sequence (i.e., the respective Shigella biomarker).

In some examples, the one or more of the reagent mixtures are combined to thereby permit multiplex DNA amplification.

In one example, the test kit comprises: at least one DNA polymerase enzyme; dinucleotide triphosphates (dNTPs); one or more salts; and a buffer.

In one example, the DNA amplification assay is polymerase chain reaction (PCR).

In one example, the DNA amplification assay is an isothermal amplification assay. For example, the isothermal DNA amplification assay may be selected from the group consisting of loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), helicase-dependent amplification (HDA), strand displacement amplification (SDA), rolling-circle amplification (RCA), and salutatory rolling-circle amplification (SRCA).

In some examples, the reagent mixtures comprise amplification primers selected from: (i) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 1 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 15;

(ii) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 332 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 333;

(iii) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 2 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 16;

(iv) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 3 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 17;

(v) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 4 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 18;

(vi) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 5 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 19;

(vii) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 6 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 20;

(viii) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 7 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 21;

(ix) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 8 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 22;

(x) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 9 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 23;

(xi) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 10 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 24;

(xii) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 11 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 25; (xiii) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 12 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 26;

(xiv) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 13 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 27; and/or

(xv) amplification primers which are configured to amplify the template sequence set forth in SEQ ID NO: 14 produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 28.

In one example, the reagent mixture is selected from one or more of the following:

(i) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 1 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 29 (SS1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 30 (SS1_R);

(ii) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 332 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 334 (SS2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 335 (SS2_R);

(iii) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 2 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 31 (SF2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 32 (SF2_R);

(iv) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 3 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 33 (SF4_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 34 (SF4_R);

(v) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 4 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 35 (SB1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 36 (SB1_R);

(vi) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 5 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 37 (SB2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 38 (SB2_R);

(vii) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 6 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 39 (SB3_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 40 (SB3_R); (viii) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 7 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 41 (SB4_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 42 (SB4_R);

(ix) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 8 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 43 (SB12_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 44 (SB12_R);

(x) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 9 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 45 (SB6_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 46 (SB6_R);

(xi) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 10 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 47 (SB7_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 48 (SB7_R);

(xii) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 11 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 49 (SD1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 50 (SD1_R);

(xiii) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 12 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 51 (SD3_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 52 (SD3_R);

(xiv) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 13 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 53 (SD5_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 54 (SD5_R); and/or

(xv) a reagent mixture which is configured to amplify a region of DNA within the template sequence set forth in SEQ ID NO: 14 comprising a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 55 (SD7_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 56 (SD7_R).

In one example, the or each reagent mixture is stable at ambient temperature.

In one example, one of the primers in each primer set is detectably labelled.

In accordance with an example in which the PCR is quantitative PCR (qPCR), the kit further comprises a unique nucleic acid probe (also referred to as a detection probe) for each amplification product, wherein the probes each comprise a polynucleotide sequence of at least 18 nucleotides in length which is sufficiently complementary to a region of corresponding length within the respective amplification product such that the nucleic acid probe and respective amplification product are hybridisable, wherein each nucleic acid probe is detectably labelled.

In accordance with examples in which the reagent mixtures are configured for multiplexing, each primer or detection probe which is labelled comprises a detectable label which is unique to the respective primer set or detection probe to permit discrimination of the respective amplification products.

In one example, the kit comprises one or more reagents or reagent mixtures for isolating DNA from the sample to be tested.

In one example, the kit comprises one or more positive controls.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Venn diagram with each circle representing a marker for Shigella species. Areas of circle for each species represent the number of isolates of that species showing genomic regions similar to the marker or amplified regions using the primers. Area of circles are not to the scale among different species. Data shown for A) S.flexneri B) S. dysenteriae C) S. boydii D) S. sonnei.

Figure 2. (A) Multiplex PCR amplification and gel analysis of spiked stool samples: L indicates 50bp DNA ladder. A, B C, D, E and F indicates mastermix sets which have the exemplary primers from Table 1. Lane 2-7 is S. sonnei with SSI and SS2 marker, lane 9-14 is S. flexneri with SF4 marker, lane 16-21 is S. flexneri with SF2 marker. (B) Lane 2-7 is S. boydii with SB1 marker, lane 9-14 is S. boydii with SB2 marker, lane 16-21 is S. boydii with SB3 marker, lane 23-28 is S. boydii with SB4 marker. (C) Lane 2-7 is S. dysenteriae with SD3 marker. The gel picture reveals similar pattern and amplicon sizes for S. boydii and ipaH markers as would be concluded using bio informatics. In (A)-(C), Set A contains primers for SD3 (86bp), SD7 (150bp) and SF4 (257bp); Set B contains primers for SB1 (56bp), SB2 (70bp), SB4 (87bp) and SF2 (427bp); Set C contains primers for SB3 (103bp), SB6 (426bp) and SD5 (189bp); Set D contains primers for SB7 (279bp), IpaH (65bp) and SD1 (118 bp); Set E contains primers for SSI (223bp); Set F contains primers for SS2 (96pb) and primers for SSI (223bp)-with one SNP each on both forward and reverse primer- meant to see the difference in brightness of band on introducing SNP on each primer.

KEY TO THE SEQUENCE LISTING

SEQ ID NO: 1 Polynucleotide sequence for Shigella biomarker designated SSI.

SEQ ID NO:2 Polynucleotide sequence for Shigella biomarker designated SF2.

SEQ ID NO:3 Polynucleotide sequence for Shigella biomarker designated SF4.

SEQ ID NO:4 Polynucleotide sequence for Shigella biomarker designated SB1.

SEQ ID NO:5 Polynucleotide sequence for Shigella biomarker designated SB2. SEQ ID NO:6 Polynucleotide sequence for Shigella biomarker designated SB3. SEQ ID NO:7 Polynucleotide sequence for Shigella biomarker designated SB4. SEQ ID NO: 8 Polynucleotide sequence for Shigella biomarker designated SB 12. SEQ ID NO:9 Polynucleotide sequence for Shigella biomarker designated SB6. SEQ ID NO: 10 Polynucleotide sequence for Shigella bio marker designated SB7. SEQ ID NO: 11 Polynucleotide sequence for Shigella bio marker designated SD1. SEQ ID NO: 12 Polynucleotide sequence for Shigella bio marker designated SD3. SEQ ID NO: 13 Polynucleotide sequence for Shigella biomarker designated SD5. SEQ ID NO: 14 Polynucleotide sequence for Shigella biomarker designated SD7. SEQ ID NO: 15 Sequence of PCR amplicon corresponding to SSI primer set. SEQ ID NO: 16 Sequence of PCR amplicon corresponding to SF2 primer set. SEQ ID NO: 17 Sequence of PCR amplicon corresponding to SF4 primer set. SEQ ID NO: 18 Sequence of PCR amplicon corresponding to SB 1 primer set. SEQ ID NO: 19 Sequence of PCR amplicon corresponding to SB2 primer set. SEQ ID NO:20 Sequence of PCR amplicon corresponding to SB3 primer set. SEQ ID NO:21 Sequence of PCR amplicon corresponding to SB4 primer set. SEQ ID NO:22 Sequence of PCR amplicon corresponding to SB 12 primer set. SEQ ID NO:23 Sequence of PCR amplicon corresponding to SB6 primer set. SEQ ID NO:24 Sequence of PCR amplicon corresponding to SB7 primer set. SEQ ID NO:25 Sequence of PCR amplicon corresponding to SD1 primer set. SEQ ID NO:26 Sequence of PCR amplicon corresponding to SD3 primer set. SEQ ID NO:27 Sequence of PCR amplicon corresponding to SD5 primer set. SEQ ID NO:28 Sequence of PCR amplicon corresponding to SD7 primer set. SEQ ID NO:29 SS1_F primer sequence SEQ ID NO:30 SS1_R primer sequence SEQ ID NO:31 SF2_F primer sequence SEQ ID NO:32 SF2_R primer sequence SEQ ID NO:33 SF4_F primer sequence SEQ ID NO:34 SF4_R primer sequence SEQ ID NO:35 SB 1_F primer sequence SEQ ID NO:36 SB 1_R primer sequence SEQ ID NO:37 SB2_F primer sequence SEQ ID NO:38 SB2_R primer sequence SEQ ID NO:39 SB3_F primer sequence SEQ ID NO:40 SB3_R primer sequence SEQ ID NO:41 SB4_F primer sequence SEQ ID NO:42 SB4_R primer sequence SEQ ID NO:43 SB12_F primer sequence SEQ ID NO:44 SB12_R primer sequence SEQ ID NO:45 SB6_F primer sequence SEQ ID NO:46 SB6_R primer sequence SEQ ID NO:47 SB7_F primer sequence SEQ ID NO:48 SB7_R primer sequence SEQ ID NO:49 SD1_F primer sequence SEQ ID NO:50 SD1_R primer sequence SEQ ID N0:51 SD3_F primer sequence SEQ ID NO:52 SD3_R primer sequence SEQ ID NO:53 SD5_F primer sequence SEQ ID NO:54 SD5_R primer sequence SEQ ID NO:55 SD7_F primer sequence SEQ ID NO:56 SD7_R primer sequence SEQ ID NO:57 SS1.1_F primer sequence SEQ ID NO:58 SS 1.1_R primer sequence SEQ ID NO:59 SS1.2_F primer sequence SEQ ID NO: 60 SS1.2_R primer sequence SEQ ID N0:61 SS1.3_F primer sequence SEQ ID NO:62 SS1.3_R primer sequence SEQ ID NO:63 SS1.4_F primer sequence SEQ ID NO:64 SS1.4_R primer sequence SEQ ID NO:65 SS1.5_F primer sequence SEQ ID NO:66 SS1.5_R primer sequence SEQ ID NO:67 SS1.6_F primer sequence SEQ ID NO:68 SS1.6_R primer sequence SEQ ID NO:69 SS1.7_F primer sequence SEQ ID NO:70 SS1.7_R primer sequence SEQ ID N0:71 SS1.8_F primer sequence SEQ ID NO:72 SS1.8_R primer sequence SEQ ID NO:73 SS1.9_F primer sequence SEQ ID NO:74 SS1.9_R primer sequence SEQ ID NO:75 SS1.10_F primer sequence SEQ ID NO:76 SSI.10_R primer sequence SEQ ID NO:77 SF2.1_F primer sequence SEQ ID NO:78 SF2.1_R primer sequence SEQ ID NO:79 SF2.2_F primer sequence SEQ ID NO:80 SF2.2_R primer sequence SEQ ID N0:81 SF2.3_F primer sequence SEQ ID NO:82 SF2.3_R primer sequence SEQ ID NO:83 SF2.4_F primer sequence SEQ ID NO:84 SF2.4_R primer sequence SEQ ID NO:85 SF2.5_F primer sequence SEQ ID NO:86 SF2.5_R primer sequence SEQ ID NO:87 SF2.6_F primer sequence SEQ ID NO:88 SF2.6_R primer sequence SEQ ID NO:89 SF2.7_F primer sequence SEQ ID NO:90 SF2.7_R primer sequence SEQ ID N0:91 SF2.8_F primer sequence SEQ ID NO:92 SF2.8_R primer sequence SEQ ID NO:93 SF2.9_F primer sequence SEQ ID NO:94 SF2.9_R primer sequence SEQ ID NO:95 SF4.1_F primer sequence SEQ ID NO:96 SF4.1_R primer sequence SEQ ID NO:97 SF4.2_F primer sequence SEQ ID NO:98 SF4.2_R primer sequence SEQ ID NO:99 SF4.3_F primer sequence SEQ ID NO: 100 SF4.3_R primer sequence SEQ ID NO: 101 SF4.4_F primer sequence SEQ ID NO: 102 SF4.4_R primer sequence SEQ ID NO: 103 SF4.5_F primer sequence SEQ ID NO: 104 SF4.5_R primer sequence SEQ ID NO: 105 SF4.6_F primer sequence SEQ ID NO: 106 SF4.6_R primer sequence SEQ ID NO: 107 SF4.7_F primer sequence SEQ ID NO: 108 SF4.7_R primer sequence SEQ ID NO: 109 SF4.8_F primer sequence SEQ ID NO: 110 SF4.8_R primer sequence SEQ ID NO:lll SF4.9_F primer sequence SEQ ID NO: 112 SF4.9_R primer sequence SEQ ID NO: 113 SF4.10_F primer sequence SEQ ID NO: 114 SF4.10_R primer sequence SEQ ID NO: 115 SB1.1_F primer sequence SEQ ID NO: 116 SB 1.1_R primer sequence SEQ ID NO: 117 SB1.2_F primer sequence SEQ ID NO: 118 SB1.2_R primer sequence SEQ ID NO: 119 SB1.3_F primer sequence SEQ ID NO: 120 SB1.3_R primer sequence SEQ ID NO: 121 SB1.4_F primer sequence SEQ ID NO: 122 SB1.4_R primer sequence SEQ ID NO: 123 SB1.5_F primer sequence SEQ ID NO: 124 SB1.5_R primer sequence SEQ ID NO: 125 SB1.6_F primer sequence SEQ ID NO: 126 SB1.6_R primer sequence SEQ ID NO: 127 SB1.7_F primer sequence SEQ ID NO: 128 SB1.7_R primer sequence SEQ ID NO: 129 SB1.8_F primer sequence SEQ ID NO: 130 SB1.8_R primer sequence SEQ ID NO: 131 SB1.9_F primer sequence SEQ ID NO: 132 SB1.9_R primer sequence SEQ ID NO: 133 SB1.10_F primer sequence SEQ ID NO: 134 SB 1.10_R primer sequence SEQ ID NO: 135 SB2.1_F primer sequence SEQ ID NO: 136 SB2.1_R primer sequence SEQ ID NO: 137 SB2.2_F primer sequence SEQ ID NO: 138 SB2.2_R primer sequence SEQ ID NO: 139 SB2.3_F primer sequence SEQ ID NO: 140 SB2.3_R primer sequence SEQ ID NO: 141 SB2.4_F primer sequence SEQ ID NO: 142 SB2.4_R primer sequence SEQ ID NO: 143 SB2.5_F primer sequence SEQ ID NO: 144 SB2.5_R primer sequence SEQ ID NO: 145 SB2.6_F primer sequence SEQ ID NO: 146 SB2.6_R primer sequence SEQ ID NO: 147 SB2.7_F primer sequence SEQ ID NO: 148 SB2.7_R primer sequence SEQ ID NO: 149 SB2.8_F primer sequence SEQ ID NO: 150 SB2.8_R primer sequence SEQ ID NO: 151 SB2.9_F primer sequence SEQ ID NO: 152 SB2.9_R primer sequence SEQ ID NO: 153 SB3.1_F primer sequence SEQ ID NO: 154 SB3.1_R primer sequence SEQ ID NO: 155 SB3.2_F primer sequence SEQ ID NO: 156 SB3.2_R primer sequence SEQ ID NO: 157 SB3.3_F primer sequence SEQ ID NO: 158 SB3.3_R primer sequence SEQ ID NO: 159 SB3.4_F primer sequence SEQ ID NO: 160 SB3.4_R primer sequence SEQ ID NO: 161 SB3.5_F primer sequence SEQ ID NO: 162 SB3.5_R primer sequence SEQ ID NO: 163 SB3.6_F primer sequence SEQ ID NO: 164 SB3.6_R primer sequence SEQ ID NO: 165 SB3.7_F primer sequence SEQ ID NO: 166 SB3.7_R primer sequence SEQ ID NO: 167 SB3.8_F primer sequence SEQ ID NO: 168 SB3.8_R primer sequence SEQ ID NO: 169 SB3.9_F primer sequence SEQ ID NO: 170 SB3.9_R primer sequence SEQ ID NO: 171 SB3.10_F primer sequence SEQ ID NO: 172 SB3.10_R primer sequence SEQ ID NO: 173 SB4.1_F primer sequence SEQ ID NO: 174 SB4.1_R primer sequence SEQ ID NO: 175 SB4.2_F primer sequence SEQ ID NO: 176 SB4.2_R primer sequence SEQ ID NO: 177 SB4.3_F primer sequence SEQ ID NO: 178 SB4.3_R primer sequence SEQ ID NO: 179 SB4.4_F primer sequence SEQ ID NO: 180 SB4.4_R primer sequence SEQ ID NO: 181 SB4.5_F primer sequence SEQ ID NO: 182 SB4.5_R primer sequence SEQ ID NO: 183 SB4.6_F primer sequence SEQ ID NO: 184 SB4.6_R primer sequence SEQ ID NO: 185 SB4.7_F primer sequence SEQ ID NO: 186 SB4.7_R primer sequence SEQ ID NO: 187 SB4.8_F primer sequence SEQ ID NO: 188 SB4.8_R primer sequence SEQ ID NO: 189 SB4.9_F primer sequence SEQ ID NO: 190 SB4.9_R primer sequence SEQ ID NO: 191 SB12.1_F primer sequence SEQ ID NO: 192 SB 12.1_R primer sequence SEQ ID NO: 193 SB12.2_F primer sequence SEQ ID NO: 194 SB12.2_R primer sequence SEQ ID NO: 195 SB12.3_F primer sequence SEQ ID NO: 196 SB12.3_R primer sequence SEQ ID NO: 197 SB12.4_F primer sequence SEQ ID NO: 198 SB12.4_R primer sequence SEQ ID NO: 199 SB12.5_F primer sequence SEQ ID N0:200 SB12.5_R primer sequence SEQ ID NO:201 SB12.6_F primer sequence SEQ ID NO:202 SB12.6_R primer sequence SEQ ID NO:203 SB12.7_F primer sequence SEQ ID NO:204 SB12.7_R primer sequence SEQ ID NO:205 SB6.1_F primer sequence SEQ ID NO:206 SB6.1_R primer sequence SEQ ID NO:207 SB6.2_F primer sequence SEQ ID NO:208 SB6.2_R primer sequence SEQ ID NO:209 SB6.3_F primer sequence SEQ ID NO:210 SB6.3_R primer sequence SEQ ID NO:211 SB6.4_F primer sequence SEQ ID NO:212 SB6.4_R primer sequence SEQ ID NO:213 SB6.5_F primer sequence SEQ ID NO:214 SB6.5_R primer sequence SEQ ID NO:215 SB6.6_F primer sequence SEQ ID NO:216 SB6.6_R primer sequence SEQ ID NO:217 SB6.7_F primer sequence SEQ ID NO:218 SB6.7_R primer sequence SEQ ID NO:219 SB6.8_F primer sequence SEQ ID NO:220 SB6.8_R primer sequence SEQ ID NO:221 SB6.9_F primer sequence SEQ ID NO: 222 SB6.9_R primer sequence SEQ ID NO:223 SB6.10_F primer sequence SEQ ID NO:224 SB6.10_R primer sequence SEQ ID NO:225 SB7.1_F primer sequence SEQ ID NO:226 SB7.1_R primer sequence SEQ ID NO: 227 SB7.2_F primer sequence SEQ ID NO:228 SB7.2_R primer sequence SEQ ID NO:229 SB7.3_F primer sequence SEQ ID NO:230 SB7.3_R primer sequence SEQ ID NO:231 SB7.4_F primer sequence SEQ ID NO:232 SB7.4_R primer sequence SEQ ID NO:233 SB7.5_F primer sequence SEQ ID NO:234 SB7.5_R primer sequence SEQ ID NO:235 SB7.6_F primer sequence SEQ ID NO:236 SB7.6_R primer sequence SEQ ID NO:237 SB7.7_F primer sequence SEQ ID NO:238 SB7.7_R primer sequence SEQ ID NO:239 SB7.8_F primer sequence SEQ ID NO:240 SB7.8_R primer sequence SEQ ID NO:241 SB7.9_F primer sequence SEQ ID NO:242 SB7.9_R primer sequence SEQ ID NO:243 SB7.10_F primer sequence SEQ ID NO:244 SB7.10_R primer sequence SEQ ID NO:245 SD1.1_F primer sequence SEQ ID NO:246 SD1.1_R primer sequence SEQ ID NO:247 SD1.2_F primer sequence SEQ ID NO:248 SD1.2_R primer sequence SEQ ID NO:249 SD1.3_F primer sequence SEQ ID NO:250 SD1.3_R primer sequence SEQ ID NO:251 SD1.4_F primer sequence SEQ ID NO:252 SD1.4_R primer sequence SEQ ID NO:253 SD1.5_F primer sequence SEQ ID NO:254 SD1.5_R primer sequence SEQ ID NO:255 SD1.6_F primer sequence SEQ ID NO:256 SD1.6_R primer sequence SEQ ID NO:257 SD1.7_F primer sequence SEQ ID NO:258 SD1.7_R primer sequence SEQ ID NO:259 SD1.8_F primer sequence SEQ ID NO: 260 SD1.8_R primer sequence SEQ ID NO:261 SD1.9_F primer sequence SEQ ID NO:262 SD1.9_R primer sequence SEQ ID NO:263 SD1.10_F primer sequence SEQ ID NO:264 SD1.10_R primer sequence SEQ ID NO:265 SD3.1_F primer sequence SEQ ID NO:266 SD3.1_R primer sequence SEQ ID NO:267 SD3.2_F primer sequence SEQ ID NO:268 SD3.2_R primer sequence SEQ ID NO:269 SD3.3_F primer sequence SEQ ID NO:270 SD3.3_R primer sequence SEQ ID NO:271 SD3.4_F primer sequence SEQ ID NO:272 SD3.4_R primer sequence SEQ ID NO:273 SD3.5_F primer sequence SEQ ID NO:274 SD3.5_R primer sequence SEQ ID N0.275 SD3.6_F primer sequence SEQ ID NO:276 SD3.6_R primer sequence SEQ ID NO:277 SD3.7_F primer sequence SEQ ID NO:278 SD3.7_R primer sequence SEQ ID NO:279 SD3.8_F primer sequence SEQ ID NO:280 SD3.8_R primer sequence SEQ ID NO:281 SD3.9_F primer sequence SEQ ID NO:282 SD3.9_R primer sequence SEQ ID NO:283 SD3.10_F primer sequence SEQ ID NO:284 SD3.10_R primer sequence SEQ ID NO:285 SD5.1_F primer sequence SEQ ID NO:286 SD5.1_R primer sequence SEQ ID NO:287 SD5.2_F primer sequence SEQ ID NO:288 SD5.2_R primer sequence SEQ ID NO:289 SD5.3_F primer sequence SEQ ID NO:290 SD5.3_R primer sequence SEQ ID NO:291 SD5.4_F primer sequence SEQ ID NO:292 SD5.4_R primer sequence SEQ ID NO: 293 SD5.5_F primer sequence SEQ ID NO:294 SD5.5_R primer sequence SEQ ID NO:295 SD5.6_F primer sequence SEQ ID NO:296 SD5.6_R primer sequence SEQ ID NO:297 SD5.7_F primer sequence SEQ ID NO:298 SD5.7_R primer sequence SEQ ID NO:299 SD5.8_F primer sequence SEQ ID N0:300 SD5.8_R primer sequence SEQ ID NO:301 SD5.9_F primer sequence SEQ ID NO:302 SD5.9_R primer sequence SEQ ID NO:303 SD5.10_F primer sequence SEQ ID NO:304 SD5.10_R primer sequence SEQ ID NO:305 SD7.1_F primer sequence SEQ ID NO:306 SD7.1_R primer sequence SEQ ID NO:307 SD7.2_F primer sequence SEQ ID NO:308 SD7.2_R primer sequence SEQ ID NO:309 SD7.3_F primer sequence SEQ ID NO:310 SD7.3_R primer sequence SEQ ID NO:311 SD7.4_F primer sequence SEQ ID NO:312 SD7.4_R primer sequence SEQ ID NO:313 SD7.5_F primer sequence SEQ ID NO:314 SD7.5_R primer sequence SEQ ID NO:315 SD7.6_F primer sequence SEQ ID NO:316 SD7.6_R primer sequence SEQ ID NO:317 SD7.7_F primer sequence SEQ ID NO:318 SD7.7_R primer sequence SEQ ID NO:319 SD7.8_F primer sequence SEQ ID NO:320 SD7.8_R primer sequence SEQ ID NO:321 SD7.9_F primer sequence SEQ ID NO:322 SD7.9_R primer sequence SEQ ID NO:323 SD7.10_F primer sequence SEQ ID NO:324 SD7.10_R primer sequence SEQ ID NO:325 Polynucleotide sequence for IpaH amplicon SEQ ID NO:326 Polynucleotide sequence encoding putative cytoplasmic hypothetical protein

SEQ ID NO:327 Polynucleotide sequence encoding addiction module toxin. SEQ ID NO:328 Polynucleotide sequence Iron-sulfur cluster assembly scaffold protein SufA

SEQ ID NO:329 Polynucleotide sequence Transposase SEQ ID NO:330 Polynucleotide sequence Transcriptional regulator SEQ ID NO:331 Polynucleotide sequence encoding hypothetical protein SEQ ID NO:332 Polynucleotide sequence for Shigella biomarker designated SS2. SEQ ID NO:333 Sequence of PCR amplicon corresponding to SS2 primer set. SEQ ID NO:334 SS2_F primer sequence. SEQ ID NO:335 SS2_R primer sequence. SEQ ID NO:336 SS2.1_F primer sequence SEQ ID NO:337 SS2.1_R primer sequence SEQ ID NO:338 SS2.2_F primer sequence SEQ ID NO:339 SS2.2_R primer sequence SEQ ID NO:340 SS2.3_F primer sequence SEQ ID NO:341 SS2.3_R primer sequence SEQ ID NO:342 SS2.4_F primer sequence SEQ ID NO:343 SS2.4_R primer sequence SEQ ID NO:344 SS2.5_F primer sequence SEQ ID NO:345 SS2.5_R primer sequence SEQ ID NO:346 SS2.6_F primer sequence

SEQ ID NO:347 SS2.6_R primer sequence

SEQ ID NO:348 SS2.7_F primer sequence

SEQ ID NO:349 SS2.7_R primer sequence

SEQ ID NO:350 SS2.8_F primer sequence

SEQ ID NO:351 SS2.8_R primer sequence

SEQ ID NO:352 SS2.9_F primer sequence

SEQ ID NO:353 SS2.9_R primer sequence

DETAILED DESCRIPTION

General Techniques and Selected Definitions

Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art.

As used herein, the singular forms of “a”, “and” and “the” include plural forms of these words, unless the context clearly dictates otherwise.

The term “and/or”, e.g., “X and/or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.

Throughout this specification, the word “comprise” or variations such as “comprises” or “comprising” will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

The term “about” is used herein to mean approximately. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the recited numerical values. In general, the term “about” is used herein to modify a numerical value, such as an amount of time, concentration, temperature etc., above and below the stated value by ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value as appropriate to perform the disclosed method.

Those skilled in the art will appreciate that the present disclosure is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features. Thus, each feature of any particular aspect or embodiment of the present disclosure may be applied mutatis mutandis to any other aspect or embodiment of the present disclosure. The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally equivalent products, compositions and methods are clearly within the scope of the disclosure, as described herein.

Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.

The present disclosure as described herein can be performed using, unless otherwise indicated, conventional techniques of molecular biology. Such procedures are described, for example, in Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Second Edition (1989), whole of vols I, II, and III; DNA Cloning: A Practical Approach, Vols. I and II (D. N. Glover, ed., 1985), IRL Press, Oxford, whole of text; Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed, 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, ppl-22; Atkinson et al, pp35-81; Sproat et al, pp 83-115; and Wu et al, pp 135-151; 4. Nucleic Acid Hybridization: A Practical Approach (B. D. Hames & S. J. Higgins, eds., 1985) IRL Press, Oxford, whole of text; Immobilized Cells and Enzymes: A Practical Approach (1986) IRL Press, Oxford, whole of text; Perbal, B., A Practical Guide to Molecular Cloning (1984); Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.), whole of series, Sakakibara, D., Teichman, J., Lien, E. Land Fenichel, R.L. (1976). Biochem. Biophys. Res. Commun. 73 336-342; Merrifield, R.B. (1963). J. Am. Chem. Soc. 85, 2149-2154; Barany, G. and Merrifield, R.B. (1979) in The Peptides (Gross, E. and Meienhofer, J. eds.), vol. 2, pp. 1-284, Academic Press, New York. 12. Wiinsch, E., ed. (1974) Synthese von Peptiden in Houben-Weyls Metoden der Organischen Chemie (Miller, E., ed.), vol. 15, 4th edn., Parts 1 and 2, Thieme, Stuttgart; Bodanszky, M. (1984) Principles of Peptide Synthesis, Springer-Verlag, Heidelberg; Bodanszky, M. & Bodanszky, A. (1984) The Practice of Peptide Synthesis, Springer-Verlag, Heidelberg; Bodanszky, M. (1985) Int. J. Peptide Protein Res. 25, 449-474; Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell, eds., 1986, Blackwell Scientific Publications); and Animal Cell Culture: Practical Approach, Third Edition (John R. W. Masters, ed., 2000), ISBN 0199637970, whole of text.

As used herein, "amplification" refers to the increase in the number of copies of a particular nucleic acid target of interest, wherein the copies are also called "amplicons" or "amplification products". Accordingly, the term “amplification assay”, as used in the context of DNA or nucleic acid amplification, shall be understood to refer to an assay configured to increase in the number of copies of a particular nucleic acid or DNA target of interest. Exemplary amplification assays are described herein. Illustrative methods include the polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), helicase dependant amplification (HD A), Nucleic Acid Sequence Based Amplification (NASBA), ramification amplification method (RAM), strand displacement amplification (SDA), recombinase-polymerase amplification (RPA), multiple strand displacement amplification (MDA), single primer isothermal amplification (SPIA), transcription mediated amplification (TMA), nicking enzyme amplification reaction (NEAR), exponential amplification reaction (EXPAR), smart-amplification process (SMAP) and others.

As used herein, "sample" refers to a substance that is being assayed for the presence of one or more DNA sequences of interest. The DNA sequence(s) of interest may be present in a mixture of other nucleic acids. A sample, containing the DNA sequence(s) of interest, may be obtained in numerous ways. It is envisioned that the following could represent samples: a purified DNA sample, an environmental sample (e.g., a soil sample, or a water sample, including waste water), a biological sample (e.g., a faecal sample from a human or animal, a clinical sample from a human or animal, food samples, or bacterial culture etc). The sample may or may not be treated to enrich or isolate the target DNA sequence prior to performing the diagnostic method disclosed herein.

As used herein, the terms "substantial complementarity", "substantially complementary" and “sufficiently complementary” as used in the context of primers and probes is intended to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between nucleic acid sequences e.g., between a nucleic acid probe or primer and the target sequence. A primer or probe which is "sufficiently complementary" to a target sequence will comprise a contiguous nucleic acid base sequence that is capable of hybridizing to the base sequence of the target sequence by hydrogen bonding between a series of complementary bases. Complementary base sequences can be complementary at each position in the oligomer sequence by using standard base pairing (e.g., G:C, A:T or A:U) or can contain one or more residues that are not complementary (including abasic positions), but in which the entire complementary base sequence is capable of specifically hybridizing with another base sequence in appropriate hybridization conditions. Accordingly, it is understood that the sequence of a primer or probe need not be 100% complementary to that of its target sequence. The term encompasses a sequence complementary to another sequence with the exception of mismatches which do not prevent hybridisation and subsequent formation of a duplex. Contiguous bases can be at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% complementary to a sequence to which an oligomer is intended to hybridize. Substantially complementary sequences can refer to sequences ranging in percent identity from 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 75, 70 or less, or any number in between, compared to the reference sequence. A skilled artisan can readily choose appropriate hybridization conditions which can be predicted based on base sequence composition, or be determined by using routine testing (see e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, 2.sup.nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). In the case of primers it is preferred that the penultimate base at the 3 ' end of the primer is able to base pair with the template nucleic acid to permit elongation (discussed below for the term “primer”).

As used herein, the term “primer” or similar refers to an enzymatically extendable oligonucleotide that comprises a defined sequence that is designed to hybridize in an antiparallel manner with a complementary, primer- specific portion of a target nucleic acid sequence. Thus, a primer, which is generally provided in molar excess relative to its target polynucleotide sequence, primes template-dependent enzymatic DNA synthesis and amplification of the target sequence. A primer nucleic acid does not need to have 100% complementarity with its template subsequence for primer elongation to occur; primers with less than 100% complementarity can be sufficient for hybridization and enzymatic (e.g., polymerase) elongation to occur provided that there is sufficient complementarity for hybridisation to the target sequence and the penultimate base at the 3' end of the primer is able to base pair with the template nucleic acid. A primer is preferably, but not necessarily, synthetic, and will generally be about 10 to about 100 nucleotides in length. . Usually primers contain about 15-26 nucleotides but longer primers may also be employed.

Normally a “set of primers” (also referred to as a “primer set”) will consist of at least two primers, one ‘upstream’ and one ‘downstream’ primer which together define the amplicon (the sequence that will be amplified using said primers).

As used herein, the phrase "DNA polymerase" refers to enzymes that are capable of incorporating deoxyribonucleotides onto the 3' hydroxyl terminus of a nucleic acid in a 5' to 3' direction thereby synthesizing a nucleic acid sequence. Thus, a DNA polymerase may also be a reverse transcriptase which is able to synthesize a DNA sequence from an RNA template.

As used herein, the term "three-prime" or "3"' refers to a specific orientation as related to a nucleic acid. Nucleic acids have a distinct chemical orientation such that their two ends are distinguished as either five-prime (5') or three-prime (3'). The 3' end of a nucleic acid contains a free hydroxyl group attached to the 3' carbon of the terminal pentose sugar. Conversely, the “five-prime” or “5'” end of a nucleic acid contains a free hydroxyl or phosphate group attached to the 5' carbon of the terminal pentose sugar.

The terms “detectably labelled”, “detectable label” or similar, as used in the context of primers, probes and amplification products of the disclosure, refer to the attachment of a label to the primer, probe or amplification product that can be used to identify an amplification product produced by the method of the disclosure. Typically, a detectable label is attached to the 3'- or 5'-end of a polynucleotide (e.g., a primer or probe). Alternatively, a detectable label may be attached to an internal portion of an oligonucleotide (i.e., not at the 3' or the 5' end), such as incorporated into a primer, probe or amplification product). Detectable labels may vary widely in size and compositions; the following references provide guidance for selecting oligonucleotide tags appropriate for particular embodiments: Brenner, U.S. Pat. No. 5,635,400; Brenner et al., Proc. Natl. Acad. Sci., 97: 1665; Shoemaker et al. (1996) Nature Genetics, 14:450; Morris et al., EP Patent Pub. 0799897A1; Wallace, U.S. Pat. No. 5,981,179; and the like. Exemplary detectable labels for use in the method and reagents of the disclosure are described herein.

As used herein, the terms "detected" and "detection" are used interchangeably and refer to the discernment of the presence or absence of a target nucleic acid or amplified nucleic acid products thereof.

The term "substantial identity", "substantially identical" or similar, as used herein in the context of primers and probes of the disclosure, is intended to indicate that, when optimally aligned with a reference sequence ( e.g as specified by reference to one or more SEQ ID NOs), there is nucleotide sequence identity in at least about 85%, and more preferably at least about 90%, 95%, 96%, 97%, 98% or 99%, of the nucleotide bases in the respective sequences, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST or Gap.

As used herein, the term “ Shigella ” refers to a genus of invasive bacteria which causes dysentery (or shigellosis). The genus Shigella is a member of the family of Enterobacteriaceae and is thus related to Escherichia coli, but remains separate for clinical reasons. The Shigella genus has four species which are sometimes referred to by a letter designation based on their serological antigen, namely: Shigella dysenteriae (A), Shigella flexneri (B), Shigella boydii (C) and Shigella sonnei (D).

The present disclosure provides a method of rapidly detecting Shigella in a sample, as well as determining the specific species of Shigella present in the sample, based on the presence or absence of one or more target nucleic acid sequences set forth in SEQ ID NOs: 1- 14 and 332 or one or more homologues of those target nucleic acid sequences having at least 75% identity to the sequence set forth in SEQ ID NOs: 1-14 and 332 (hereinafter also collectively referred to as the “ Shigella biomarkers”) in DNA extracted from the sample. The present disclosure also contemplates that the specific species of Shigella present in the sample may be determined based on the presence or absence of one or more polypeptides encoded by the target nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues of those target nucleic acid sequences having at least 75% identity thereto, in a cell lysate prepared from a sample. Accordingly, reference herein to “ Shigella biomarkers” may also encompass the polypeptides encoded by the target nucleic acids. The method of the disclosure is based, at least in part, on the identification of a novel panel of biomarkers (set forth in SEQ ID NOs: 1-14 and 332), most of which are mutually exclusive or non overlapping across 14 groups of Shigella (illustrated in Figure 1) representing the four serologically distinct species: Shigella dysenteriae Shigella flexneri, Shigella boydii and Shigella sonnei. This unique panel of Shigella biomarkers provide target nucleic acids and the corresponding polypeptides which can be used to discriminate between species of Shigella and make it possible to rapidly, accurately and simultaneously detect Shigella at the genus and species level without the need for time-consuming culture. In certain examples, the Shigella biomarkers also make it possible to identify Shigella serotypes, or serotype groups, within species.

Specifically, the method of the disclosure makes it possible to determine the presence or absence of Shigella sonnei, Shigella flexneri, Shigella boydii and/or Shigella dysenteriae in the sample based on the presence or absence of one or more of the polynucleotide sequences set forth in SEQ ID NOs: 1-14 and 332, or homologues of the polynucleotide sequences, in a DNA sample extracted from a sample or the presence or absence of one or more polypeptides encoded by said nucleic acid sequences in a lysate prepared from the sample, wherein:

(i) the presence of at least one of the polynucleotide sequences set forth in SEQ ID NOs: 1 and 332, a homologue of any one thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella sonnei in the sample, and the absence of the sequences set forth in SEQ ID NOs: 1 and 332, homologues thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), and polypeptides encoded by said nucleic acid sequences, is indicative that Shigella sonnei is not present in the sample;

(ii) the presence of at least one of the polynucleotide sequences set forth in SEQ ID NOs: 2 and 3, a homologue of anyone thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by one of said nucleic acid sequence, is indicative of the presence of Shigella flexneri in the sample, and the absence of the sequences set forth in SEQ ID NOs: 2 and 3, or homologues thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), and the polypeptides encoded by said nucleic acid sequences, is indicative that Shigella flexneri is not present in the sample;

(iii) the presence of at least one of the polynucleotide sequences set forth in SEQ ID NOs: 4-10, a homologue of anyone thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella boydii in the sample, and the absence of the sequences set forth in SEQ ID NOs: 4-10, or homologues thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), and the polypeptides encoded by said nucleic acid sequences, is indicative that Shigella boydii is not present in the sample; and

(iv) the presence of at least one of the polynucleotide sequences set forth in SEQ ID NOs: 11-14, a homologue of anyone thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by one of said nucleic acid sequences, is indicative of the presence of Shigella dysenteriae in the sample, and the absence of the sequences set forth in SEQ ID NOs: 11-14, or homologues thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), and the polypeptides encoded by said nucleic acid sequences, is indicative that Shigella dysenteriae is not present in the sample.

In one example, the diagnostic method is configured to detect the presence or absence of Shigella sonnei in the sample, and comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 1 and/or SEQ ID NO: 332, homologues thereof, and/or a polypeptide encoded by one or both of said polynucleotide sequences, in the sample (the “ Shigella sonnei biomarkers” or “SS biomarkers”). In accordance with this example, the presence of at least one of the polynucleotide sequences set forth in SEQ ID NO: 1 and 332, a homologue thereof or a polypeptide encoded by one of said polynucleotide sequences is indicative of the presence of Shigella sonnei in the sample, and the absence of the polynucleotide sequences set forth in SEQ ID NO: 1 and 332, homologues thereof and polypeptides encoded by said polynucleotide sequences, is indicative that Shigella sonnei is not present in the sample. In some examples, the diagnostic method is configured to detect the presence or absence of both the Shigella sonnei biomarkers in a sample. In other examples, the diagnostic method is configured to detect the presence or absence of just one of Shigella sonnei biomarkers in a sample. In one example, the diagnostic method is configured to detect the presence or absence of Shigella flexneri in the sample, and comprises determining the presence or absence of the polynucleotide sequences set forth in SEQ ID NO: 2 and 3, homologues thereof, or a polypeptide encoded by said polynucleotide sequences, in the sample (collectively the “Shigella flexneri bio markers” or “SF bio markers”). In accordance with this example, the presence of one of the polynucleotide sequences set forth in SEQ ID NO: 2 or 3, a homologue thereof, or a polypeptide encoded by one of said polynucleotide sequences, is indicative of the presence of Shigella flexneri in the sample, and the absence of the polynucleotide sequences set forth in SEQ ID NO: 2 and 3, their homologues and polypeptides encoded by said polynucleotide sequences, is indicative that Shigella flexneri is not present in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 2, ahomologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella flexneri of one or more serotypes selected from serotype 15, la, lb, lc, 1, 2a, 2b, 2, 3a, 3b, 3c, 3, 4a, 4av, 4b, 4bv, 4c, 4, 5a, 5b, 5, 6, 7, X, Xv, Y, and/or Yv in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 3, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella flexneri of one or more serotypes selected from serotype 6 and/or 2 in the sample.

In one example, the diagnostic method is configured to detect the presence or absence of Shigella boydii in the sample, and comprises determining the presence or absence of the polynucleotide sequences set forth in SEQ ID NOs: 4-10, homologues thereof, or a polypeptide encoded by said polynucleotide sequences, in the sample (collectively the “ Shigella boydii bio markers” or “SB bio markers”). In accordance with this example, the presence of one of the polynucleotide sequences set forth in SEQ ID NOs: 4-10, a homologue thereof, or a polypeptide encoded by one of said polynucleotide sequences, is indicative of the presence of Shigella boydii in the sample, and the absence of the polynucleotide sequences set forth in SEQ ID NOs: 4-10, their homologues and polypeptides encoded by said polynucleotide sequences, is indicative that Shigella boydii is not present in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 4, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 1, 3, 6, 8, 10, 11, 18, 19 and/or 20 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 5, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of serotype 2 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 6, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 4 and/or 6 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 7, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 11, 13, 16, 17, 5, 7 and/or 9 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 8, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of serotype 11 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 10, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 14 and/or 2 in the sample.

In one example, the diagnostic method is configured to detect the presence or absence of Shigella dysenteriae in the sample, and comprises determining the presence or absence of the polynucleotide sequences set forth in SEQ ID NOs: 11-14, homologues thereof, or a polypeptide encoded by said polynucleotide sequences, in the sample (collectively the “ Shigella dysenteriae biomarkers” or “SD biomarkers”). In accordance with this example, the presence of one of the polynucleotide sequences set forth in SEQ ID NOs: 11- 14, a homologue thereof, or a polypeptide encoded by one of said polynucleotide sequences is indicative of the presence of Shigella dysenteriae in the sample, and the absence of the polynucleotide sequences set forth in SEQ ID NOs: 11-14, their homologues and polypeptides encoded by said polynucleotide sequences, is indicative that Shigella dysenteriae is not present in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 11, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella dysenteriae of serotype 1 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 12, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella dysenteriae of one or more serotypes selected from serotype 3, 4, 6, 8, 9, 11, 12, 13, 14, 15, 17 and/or 18 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 13, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella dysenteriae of one or more serotypes selected from serotype 12 and/or 2 in the sample. For example, the presence of the nucleic acid sequence set forth in SEQ ID NO: 14, a homologue thereof having at least 75% identity thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), or a polypeptide encoded by said nucleic acid sequence, may be indicative of the presence of Shigella dysenteriae of serotype 8 in the sample.

In some examples, the diagnostic method comprises determining the presence or absence of one or more of the Shigella sonnei biomarkers and the presence or absence of one or more of the Shigella flexneri biomarkers, the Shigella boydii biomarkers, and/or the Shigella dysenteriae biomarkers. For example, the method may comprise determining the presence or absence of one or more of the Shigella sonnei biomarkers and the presence or absence of the Shigella flexneri biomarkers. For example, the method may comprise determining the presence or absence of one or more of the Shigella sonnei biomarkers and the presence or absence of the Shigella boydii biomarkers. For example, the method may comprise determining the presence or absence of one or more of the Shigella sonnei biomarkers and the presence or absence of the Shigella dysenteriae bio markers. For example, the method may comprise determining the presence or absence of one or more of the Shigella sonnei bio markers and the presence or absence of the Shigella flexneri bio markers and the Shigella boydii biomarkers. For example, the method may comprise determining the presence or absence of one or more of the Shigella sonnei biomarkers and the presence or absence of the Shigella flexneri biomarkers, and the Shigella dysenteriae biomarkers. For example, the method may comprise determining the presence or absence of one or more of the Shigella sonnei biomarkers and the presence or absence of the Shigella boydii biomarkers, and the Shigella dysenteriae biomarkers.

In some examples, the diagnostic method comprises determining the presence or absence of the Shigella flexneri bio markers and the presence or absence of one or more of the Shigella sonnei biomarkers, the Shigella boydii biomarkers, and/or the Shigella dysenteriae biomarkers. For example, the method may comprise determining the presence or absence of the Shigella flexneri biomarkers and the presence or absence of one or more of the Shigella sonnei biomarkers. For example, the method may comprise determining the presence or absence of the Shigella flexneri biomarkers and the presence or absence of the Shigella boydii biomarkers. For example, the method may comprise determining the presence or absence of the Shigella flexneri biomarkers and the presence or absence of the Shigella dysenteriae biomarkers. For example, the method may comprise determining the presence or absence of the Shigella flexneri biomarkers, one or more of the Shigella sonnei biomarkers and the Shigella boydii biomarkers. For example, the method may comprise determining the presence or absence of the Shigella flexneri bio markers, one or more of the Shigella sonnei bio markers and the Shigella dysenteriae biomarkers. For example, the method may comprise determining the presence or absence of the Shigella flexneri biomarkers, the Shigella boydii biomarkers and the Shigella dysenteriae biomarkers.

In some examples, the diagnostic method comprises determining the presence or absence of the Shigella boydii biomarkers and the presence or absence of one or more of the Shigella sonnei bio markers, the Shigella flexneri bio markers, and/or the Shigella dysenteriae biomarkers. For example, the method may comprise determining the presence or absence of the Shigella boydii biomarkers and the presence or absence of one or more of the Shigella sonnei biomarkers. For example, the method may comprise determining the presence or absence of the Shigella boydii biomarkers and the presence or absence of the Shigella flexneri biomarkers. For example, the method may comprise determining the presence or absence of the Shigella boydii biomarkers and the presence or absence of the Shigella dysenteriae biomarkers. For example, the method may comprise determining the presence or absence of the Shigella boydii biomarkers, one or more of the Shigella sonnei biomarkers and the Shigella flexneri biomarkers. For example, the method may comprise determining the presence or absence of the Shigella boydii biomarkers, one or more of the Shigella sonnei biomarkers and the Shigella dysenteriae biomarkers. For example, the method may comprise determining the presence or absence of the Shigella boydii biomarkers, the Shigella flexneri biomarkers and the Shigella dysenteriae biomarkers.

In some examples, the diagnostic method comprises determining the presence or absence of the Shigella dysenteriae biomarkers and the presence or absence of one or more of the Shigella sonnei biomarkers, the Shigella flexneri biomarkers, and/or the Shigella boydii biomarkers. For example, the method may comprise determining the presence or absence of the Shigella dysenteriae biomarkers and the presence or absence of one or more of the Shigella sonnei biomarkers. For example, the method may comprise determining the presence or absence of the Shigella dysenteriae biomarkers and the presence or absence of the Shigella flexneri biomarkers. For example, the method may comprise determining the presence or absence of the Shigella dysenteriae biomarkers and the presence or absence of the Shigella boydii biomarkers. For example, the method may comprise determining the presence or absence of the Shigella dysenteriae biomarkers, one or more of the Shigella sonnei biomarkers and the Shigella flexneri bio markers. For example, the method may comprise determining the presence or absence of the Shigella dysenteriae biomarkers, one or more of the Shigella sonnei biomarkers and the Shigella boydii biomarkers. For example, the method may comprise determining the presence or absence of the Shigella dysenteriae biomarkers, the Shigella flexneri biomarkers and the Shigella boydii biomarkers. In other examples, the diagnostic method comprises determining the presence or absence of one or more of the Shigella sonnei biomarkers, as well as the Shigella flexneri biomarkers, the Shigella boydii biomarkers and the Shigella dysenteriae biomarkers. In this regard, the method may be configured to detect each of the polynucleotide sequences set forth in SEQ ID NOs: 2-14, homologues thereof, or polypeptides encoded by said polynucleotide sequences, in the sample and at least one of the polynucleotide sequences set forth in SEQ ID NOs: 1 and 332, homologues thereof, or polypeptides encoded by said polynucleotide sequences, in the sample. Determining the presence or absence of each of the Shigella biomarkers in a sample may increase the accuracy of the diagnosis by minimising the chance of a false negative result. In this regard, the Shigella biomarkers corresponding to the sequences set forth in SEQ ID NOs: 1-14 and 332 are mostly non-overlapping across 14 groups of Shigella representing the four serologically distinct species of Shigella. The exception are the biomarkers corresponding to the sequences set forth in SEQ ID NOs: 1 and 332 which detect overlapping groups of Shigella sonnei. For this reason, one or both of the biomarkers corresponding to the sequences set forth in SEQ ID NOs: 1 and 332 can be used to detect Shigella sonnei.

As described herein, detecting the presence of a homologue of a polynucleotide sequence set forth in one of SEQ ID NOs: 1-14 and 332 may be indicative of the presence of a Shigella spp. in a sample. As used herein, a “homolog” or “homologue” is intended to refer to a nucleic acid sequence which has a common origin and functions similar to a nucleic acid sequence from another species. Homologues which may be used in determining the presence or absence of a Shigella species in the sample according to the method will have at least about 75% identity to a polynucleotide sequence set forth in one of SEQ ID NOs: 1-14 and 332. Accordingly, homologue of the polynucleotide sequences set forth in SEQ ID NOs: 1-14 and 332 which may be useful as biomarkers in the method of the disclosure will have at least about 75% identity to one of the sequences set forth in SEQ ID NOs: 1-14 and 332, preferably at least about 85% identity to one of the sequences set forth in SEQ ID NOs: 1-14 and 332, and more preferably at least about 90%, 95%, 96%, 97%, 98% or 99% identity to one of the polynucleotide sequences set forth in SEQ ID NOs: 1-14 and 332, as measured by any well- known algorithm of sequence identity, such as FASTA, BLAST or Gap.

The presence of any one or more of the Shigella biomarkers in a sample may be determined by detecting the presence of the complete polynucleotide sequence of the respective biomarker(s) or a part thereof which is indicative of the presence of the biomarker(s). For example, the method may comprise determining the presence of one or more polynucleotide sequences set forth in SEQ ID NOs: 1-14 and 332 or a homologue of any one thereof in the sample based on the detection of at least 18 contiguous nucleotides from within one of the sequences set forth in SEQ ID NOs: 1-14 and 332. In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 1 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 1 (also referred to as the “SSI biomarker”) in a sample, the presence of the SSI biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 1 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SSI biomarker based on the detection of at least about 18 contiguous nucleotides to about 550 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 1 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SS 1 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 1. In other examples, the method comprises determining the presence of the SSI biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 1.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 332 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 332 (also referred to as the “SS2 biomarker”) in a sample, the presence of the SS2 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 332 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SS2 biomarker based on the detection of at least about 18 contiguous nucleotides to about 1000 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 332 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SS2 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, or at least about 600 contiguous nucleotides, or at least about 650 contiguous nucleotides, or at least about 700 contiguous nucleotides, or at least about 750 contiguous nucleotides, or at least about 800 contiguous nucleotides, or at least about 850 contiguous nucleotides, or at least about 900 contiguous nucleotides, or at least about 950 contiguous nucleotides, or at least about 1000 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 332. In other examples, the method comprises determining the presence of the SS2 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 332.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 2 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 2 (also referred to as the “SF2 biomarker”) in a sample, the presence of the SF2 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 2 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SF2 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 850 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 2 in DNA extracted from the sample. For example, the method may comprise determining the presence of SF2 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, or at least about 600 contiguous nucleotides, or at least about 650 contiguous nucleotides, or at least about 700 contiguous nucleotides, or at least about 750 contiguous nucleotides, or at least about 800 contiguous nucleotides, or at least about 850 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 2. In other examples, the method comprises determining the presence of the SF2 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 2.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 3 or a homologue thereof having at least 75% identity ( e.g ., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 3 (also referred to as the “SF4 biomarker”) in a sample, the presence of the SF4 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 3 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SF4 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 800 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 3 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SF4 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, or at least about 600 contiguous nucleotides, or at least about 650 contiguous nucleotides, or at least about 700 contiguous nucleotides, or at least about 750 contiguous nucleotides, or at least about 800 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 3. In other examples, the method comprises determining the presence of the SF4 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 3.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 4 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 4 (also referred to as the “SB1 biomarker”) in a sample, the presence of the SB 1 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 4 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SB 1 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 250 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 4 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SB 1 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 4. In other examples, the method comprises determining the presence of the SB 1 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 4.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 5 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 5 (also referred to as the “SB2 biomarker”) in the sample, the present of SB2 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 5 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SB2 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 120 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 5 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SB2 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 120 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 5. In some examples, the method comprises determining the presence of the SB2 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 5.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 6 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 6 (also referred to as the “SB3 biomarker”) in the sample, the presence of the SB3 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 6 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SB3 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 800 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 6 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SB3 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, or at least about 600 contiguous nucleotides, or at least about 650 contiguous nucleotides, or at least about 700 contiguous nucleotides, or at least about 750 contiguous nucleotides, or at least about 800 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 6. In other examples, the method comprises determining the presence of the SB3 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 6.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 7 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 7 (also referred to as the “SB4 biomarker”) in a sample, the presence of the SB4 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 7 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SB4 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 800 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 7 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SB4 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 7. In other examples, the method comprises determining the presence of the SB4 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 7.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 8 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 8 (also referred to as the “SB 12 biomarker”) in a sample, the presence of the SB 12 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 8 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SB 12 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 800 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 8 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SB 12 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 8. In other examples, the method comprises determining the presence of the SB 12 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 8.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 9 or a homologue thereof having at least 75% identity ( e.g having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 9 (also referred to as the “SB6 biomarker”) in the sample, the presence of the SB6 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 9 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SB6 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 850 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 9 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SB6 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, or at least about 600 contiguous nucleotides, or at least about 650 contiguous nucleotides, or at least about 700 contiguous nucleotides, or at least about 750 contiguous nucleotides, or at least about 800 contiguous nucleotides, or at least about 850 contiguous nucleotides, or at least about 900 contiguous nucleotides, or at least about 950 contiguous nucleotides, or at least about 1000 contiguous nucleotides, or at least about 1050 contiguous nucleotides, or at least about 1100 contiguous nucleotides, or at least about 1150 contiguous nucleotides, or at least about 1200 contiguous nucleotides, or at least about 1250 contiguous nucleotides, or at least about 1300 contiguous nucleotides, or at least about 1350 contiguous nucleotides, or at least about 1400 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 9. In other examples, the method comprises determining the presence of the SB6 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 9.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 10 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 10 (also referred to as the “SB7 biomarker”) in a sample, the presence of the SB7 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO:

10 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SB7 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 850 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 10 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SB7 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, or at least about 600 contiguous nucleotides, or at least about 650 contiguous nucleotides, or at least about 700 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 10. In other examples, the method comprises determining the presence of the SB7 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 10.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 11 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 11 (also referred to as the “SD1 biomarker”) in a sample, the presence of the SD1 bio marker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO:

11 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SD1 bio marker in the sample based on the detection of at least about 18 contiguous nucleotides to about 850 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 11 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SD1 bio marker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 11. In other examples, the method comprises determining the presence of the SD1 bio marker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 11.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 12 or a homologue thereof having at least 75% identity ( e.g ., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 12 (also referred to as the “SD3 biomarker”) in a sample, the presence of the SD3 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO:

12 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SD3 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 850 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 12 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SD3 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 12. In other examples, the method comprises determining the presence of the SD3 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 12.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 13 or a homologue thereof having at least 75% identity (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 13 (also referred to as the “SD5 biomarker”) in a sample, the presence of the SD5 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO:

13 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SD5 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 850 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 13 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SD5 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, or at least about 600 contiguous nucleotides, or at least about 650 contiguous nucleotides, or at least about 700 contiguous nucleotides, or at least about 750 contiguous nucleotides, or at least about 800 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 13. In other examples, the method comprises determining the presence of the SD5 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 13.

In accordance with examples in which the method comprises determining the presence or absence of the polynucleotide sequence set forth in SEQ ID NO: 14 or a homologue thereof having at least 75% identity ( e.g having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% identity) to the polynucleotide sequence set forth in SEQ ID NO: 14 (also referred to as the “SD7 biomarker”) in a sample, the presence of the SD7 biomarker in the sample may be based on the detection of at least about 18 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 14 in DNA extracted from the sample. Accordingly, in one example, the method comprises determining the presence of the SD7 biomarker in the sample based on the detection of at least about 18 contiguous nucleotides to about 850 contiguous nucleotides from within a sequence set forth in SEQ ID NO: 14 in DNA extracted from the sample. For example, the method may comprise determining the presence of the SD7 biomarker in the sample based on the detection of at least 20 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 35 contiguous nucleotides, or at least about 50 contiguous nucleotides, or at least about 75 contiguous nucleotides, or at least about 100 contiguous nucleotides, or at least about 150 contiguous nucleotides, or at least about 200 contiguous nucleotides, or at least about 250 contiguous nucleotides, or at least about 300 contiguous nucleotides, or at least about 350 contiguous nucleotides, or at least about 400 contiguous nucleotides, or at least about 450 contiguous nucleotides, or at least about 500 contiguous nucleotides, or at least about 550 contiguous nucleotides, or at least about 600 contiguous nucleotides, or at least about 650 contiguous nucleotides, or at least about 700 contiguous nucleotides, from within a sequence set forth in SEQ ID NO: 14. In other examples, the method comprises determining the presence of the SD7 biomarker in the sample based on the detection of the full sequence set forth in SEQ ID NO: 14.

As the skilled person will appreciate, Shigella is one of several enteric bacteria which is causative agent of infectious gastroenteritis ( e.g ., including Salmonella spp., Shigella spp., EIEC, Campylobacter spp. and/or Shiga toxin producing organisms (STEC)). Diagnostic tests and methods for detecting enteric bacteria causing infectious gastroenteritis are known in the art e.g., the BD MAX™ and the EntericBio® system described in O’Leary el ah, (2009) J. Clin. Microbiol. 47(11):3449-3453. These are based, inter alia, on the detection of the IpaH gene. Accordingly, in some examples, the method of the disclosure may comprise determining whether a sample comprises Shigella spp. and/or EIEC based on the presence or absence of the IpaH gene. This may occur prior to determining the species of Shigella in the sample using the Shigella biomarkers described herein or simultaneous thereto (e.g., in a multiplex assay). In accordance with this example, the method may comprise determining the presence or absence of a biomarker associated with enteric bacteria causing infectious gastroenteritis. For example, the method may comprise determining the presence or absence of a nucleic acid sequence corresponding to the IpaH gene in DNA extracted from the sample, and/or determining the presence or absence of an IpaH polypeptide encoded by the IpaH gene in a lysate prepared from the sample. For example, the method may comprise determining the presence or absence of the IpaH polynucleotide sequence set forth in SEQ ID NO: 325 or its corresponding polypeptide in the sample. The presence of a nucleic acid sequence corresponding to the IpaH gene, or an IpaH polypeptide encoded thereby, in the sample (i.e., an IpaH positive test result) indicates that the sample comprises Shigella spp., EIEC or both. Conversely, the absence of a nucleic acid sequence corresponding to the IpaH gene, or an IpaH polypeptide encoded thereby, in the sample (i.e., an IpaH negative test result) indicates that the sample does not comprise Shigella spp. or EIEC.

In some example, the method of the disclosure may also comprise detecting the presence or absence of one or more biomarkers capable of distinguishing between Shigella spp. and EIEC in the sample e.g., when the sample is IpaH positive. In this regard, gene marker panels which are capable of distinguishing between Shigella spp. and EIEC are known in the art e.g., as described in Dhakal el al (2018) Journal of Medical Microbiology, 67:1257-1264, the full contents of which is incorporated herein. In accordance with this example, the method may comprise determining the presence or absence of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in a sample (e.g., an IpaH positive sample). For example, the presence of one or none of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in a IpaH positive sample indicates the presence of Shigella spp. and not EIEC in the sample, whereas the presence of two or more of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in an IpaH positive sample indicates the presence of EIEC and not Shigella spp. in the sample. Primer sets for using in detecting the polynucleotides sequences set forth in SEQ ID NOs: 326-331 by PCR are described Dhakal et al (2018) Journal of Medical Microbiology, 67:1257-1264 and are contemplated herein.

In some examples, the method comprises determining whether a sample comprises Shigella spp. and/or EIEC based on the presence of IpaH and/or whether sample is positive for Shigella spp. specifically or EIEC specifically, prior to determining the species of Shigella in the sample.

In other examples, the method comprises determining whether a sample comprises Shigella spp. and/or EIEC and whether the sample comprises Shigella spp. specifically or EIEC specifically, at the same time as determining the species of Shigella in the sample. For example, the method may comprise performing a multiplex assay configured to determine the presence or absence of: (i) a nucleic acid sequence corresponding to the IpaH gene ( e.g ., a polynucleotide sequence set forth in SEQ ID NO: 325) or an IpaH polypeptide encoded thereby; (ii) the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or polypeptides encoded thereby; and (iii) the polynucleotides sequences set forth in SEQ ID NOs: 2-14, homologues thereof or polypeptides encoded thereby and at least one polynucleotide sequence set forth in SEQ ID NOs: 1 or 332, a homologue thereof or a polypeptide encoded thereby. For example, the method may comprise performing a multiplex assay configured to determine the presence or absence of: (i) a nucleic acid sequence corresponding to the IpaH gene (e.g., a polynucleotide sequence set forth in SEQ ID NO: 325) or an IpaH polypeptide encoded thereby; (ii) the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or polypeptides encoded thereby; and (iii) the polynucleotides sequences set forth in SEQ ID NOs: 1-14 and 332, homologues thereof or polypeptides encoded thereby.

In some examples, the method of the disclosure comprises determining whether a sample is IpaH positive or negative and/or determining whether an IpaH positive sample comprises Shigella spp. or EIEC prior to determining the species of Shigella in the sample based on the presence or absence of the Shigella biomarkers in the sample as described herein. For example, the method may comprise:

(a) determining the presence or absence of Shigella spp. and/or EIEC in a sample by determining the presence or absence of a nucleic acid sequence corresponding to the IpaH gene in DNA extracted from the sample, and/or determining the presence or absence an IpaH polypeptide encoded by the IpaH gene in a lysate prepared from the sample; and

(b) when a sample is determined as being IpaH positive indicating the presence of Shigella spp., EIEC or both, determining whether the sample comprises Shigella spp. specifically or EIEC specifically by determining the presence or absence of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in the IpaH positive sample, where: (i) the presence of one or none of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in a IpaH positive sample indicates the presence of Shigella spp. and not EIEC in the sample, and (ii) the presence of two or more of the polynucleotides sequences set forth in SEQ ID NOs: 326-331 or their corresponding polypeptides in a IpaH positive sample indicates the presence of EIEC and not Shigella spp. in the sample; and

(c) where a sample is determined as comprising a Shigella spp., determining the species of Shigella in the sample based on the presence or absence of one or more nucleic acid sequences set forth in SEQ ID NOs: 1-14 and 332, one or more homologues thereof having at least 75% identity thereto, or one or more polypeptides encoded by said nucleic acid sequences as described herein.

In one example, the presence or absence of the one or more sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof in the DNA sample is determined by sequencing the DNA sample. Similarly, the presence or absence of a polynucleotide corresponding to the IpaH gene ( e.g ., a sequence set forth in SEQ ID NO: 325) and/or the polynucleotide sequences set forth in SEQ ID NOs: 326-331, in the DNA sample may be determined by sequencing the DNA sample.

In one example, the presence or absence of the one or more sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof in the DNA sample is determined using a restriction endonuclease digestion of the DNA sample. Similarly, the presence or absence of a polynucleotide corresponding to the IpaH gene (e.g., a sequence set forth in SEQ ID NO: 325) and/or the polynucleotide sequences set forth in SEQ ID NOs: 326-331, in the DNA sample may be determined using a restriction endonuclease digestion of the DNA sample.

In one example, the presence or absence of the one or more sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof in the DNA sample is determined using specific high- sensitivity enzymatic reporter unlocking (SHERLOCK) platform. Similarly, the presence or absence of a polynucleotide corresponding to the IpaH gene (e.g., a sequence set forth in SEQ ID NO: 325) and/or the polynucleotide sequences set forth in SEQ ID NOs: 326- 331, in the DNA sample may be determined using specific high- sensitivity enzymatic reporter unlocking (SHERLOCK) platform.

In one example, the presence or absence of the one or more sequences set forth in SEQ ID NOs: 1-14 and 332 or homologues thereof in the DNA sample is determined by one or more nucleic acid amplification assays. Alternatively, or in addition, the presence or absence of a polynucleotide corresponding to the IpaH gene (e.g., a sequence set forth in SEQ ID NO: 325) and/or the polynucleotide sequences set forth in SEQ ID NOs: 326-331 in the DNA sample is determined by one or more nucleic acid amplification assays.

The presence or absence of the Shigella biomarkers, as well as the presence or absence of a polynucleotide of the IpaH gene and/or the polynucleotide sequences set forth in SEQ ID NOs: 326-331, in the sample may be determined by any means known in the art. In some examples, the presence or absence of one or more polynucleotide sequences set forth in SEQ ID NOs: 1-14 and 332 in the sample is determined by (i) performing one or more nucleic acid amplification assays on DNA extracted from the sample, wherein the nucleic acid amplification assay is configured to specifically amplify one or more of the polynucleotide sequences set forth in SEQ ID NOs: 1-14 and 332 or portions thereof, followed by (ii) detection of the amplification product(s) produced by the nucleic acid amplification assay (also referred to “amplicons”), wherein detection of one or more amplification products corresponding to the one or more of the polynucleotide sequences set forth in SEQ ID NOs: 1-14 and 332 (respectively) or a portion thereof indicates that the respective polynucleotide sequence is present in the sample. In some examples, the one or more nucleic acid amplification assays are configured to specifically amplify the polynucleotide sequences set forth in SEQ ID NOs: 2- 14 or portions thereof and at least one of the polynucleotide sequences set forth in SEQ ID NOs: 1 and 332 or portions thereof. In some examples, the one or more nucleic acid amplification assays are configured to specifically amplify the polynucleotide sequences set forth in SEQ ID NOs: 1-14 and 332 or portions thereof.

Likewise, the presence or absence of a polynucleotide of the IpaH gene and/or the polynucleotide sequences set forth in SEQ ID NOs: 326-331 may be determined by performing one or more nucleic acid amplification assays on DNA extracted from the sample, followed by detection of the amplification product(s) produced by the nucleic acid amplification assay.

Any assay known in the art for specifically amplifying a target nucleic acid or polynucleotide sequence of interest may be used in the method of the disclosure.

In one example, the nucleic acid amplification assay is polymerase chain reaction (PCR). The PCR assay may be a standard PCR assay or it may be quantitative PCR (qPCR). The PCR assay may be performed as a single PCR assay configured to amplify a single target nucleic acid sequence or in a multiplex format configured to simultaneously amplify multiple target nucleic acid sequences in a single assay.

In another example, the one or more nucleic acid amplification assays may be isothermal nucleic acid amplification assays. The term "isothermal amplification" in the context of the present disclosure refers to a nucleic acid amplification reaction which takes place at a temperature that does not significantly change during the reaction. Accordingly, an “isothermal amplification assay” will be understood to mean a nucleic acid amplification assay which is capable of isothermal amplification of a nucleic acid template ( e.g DNA) at a temperature that does not significantly change during the amplification reaction. Any isothermal amplification method known in the art is contemplated herein. Exemplary isothermal amplification methods which may be used in accordance with the present disclosure include loop-mediated isothermal amplification (LAMP) (Notomi el ah, (2000) Nucleic Acids Res. 28(12):e63), recombinase polymerase amplification (RPA) (Piepenburg et al., (2006) PloS Biol 4(7): 1115- 1120) and helicase-dependent amplification (HD A) (Vincent et al, (2004) EMBO rep 5(8):795-800). However, it will be appreciated that other isothermal amplification assays exist and may be used in the method or with the device of the disclosure. Other isothermal amplification assays include, for example, thermostable HDA (tHDA) (An et al, (2005) J Biol Chem 280(32):28952-28958), strand displacement amplification (SDA) (Walker et ah, (1992) Nucleic Acids Res 20(7): 1691-6), multiple displacement amplification (MDA) (Dean et ah, (2002) Proc Natl Acad Sci USA 99(8): 5261-5266), rolling-circle amplification (RCA) (Liu et ah, (1996) J Am Chem Soc 118:1587-1594), restriction aided RCA (Wang et ah, (2004) Genome Res 14:2357-2366), single primer isothermal amplification (SPIA) (Dafforn et ah, (2004) Biotechniques 37(5):854-7), transcription mediated amplification (TMA) (Vuorinen et al., (1995) J Clin Microbiol 33: 1856-1859), nicking enzyme amplification reaction (NEAR) (Maples et al, US2009017453), exponential amplification reaction (EXPAR) (Van Ness et al, (2003) Proc Natl Acad Sci USA 100(8):4504-4509), nucleic acid sequence based amplification (NASBA) (Kievits et al, (1991) J Virol Methods 35:273- 286), and smart-amplification process (SMAP) (Mitani et al, (2007) Nat Methods 4(3):257-62).

In some examples, the amplification product may be detectably labelled. As used herein, the term “detectably labelled”, “detectable label” or similar refers to a label that can be used to identify a target ( e.g ., a nucleic acid sequence of interest). Typically, a detectable label is attached to the 3'- or 5 '-end of a polynucleotide. Alternatively, a detectable label may be attached to an internal portion of an oligonucleotide (i. e., not at the 3 ' or the 5 ' end). Detectable labels may vary widely in size and compositions; the following references provide guidance for selecting oligonucleotide tags appropriate for particular embodiments: Brenner, U.S. Pat. No. 5,635,400; Brenner et al., Proc. Natl. Acad. Sci., 97: 1665; Shoemaker et al. (1996) Nature Genetics, 14:450; Morris et al., EP Patent Pub. 0799897A1; Wallace, U.S. Pat. No. 5,981,179; and the like.

Methods for incorporating detectable labels into nucleic acid probes are well known. Typically, detectable labels are incorporated into an oligonucleotide during a polymerization or amplification step, e.g., by PCR, nick translation, random primer labeling, terminal transferase tailing (e.g., one or more labels can be added after cleavage of the primer sequence), and others (see Ausubel et al., 1997, Current Protocols In Molecular Biology, Greene Publishing and Wiley-Interscience, New York).

In some examples, the amplification product may be detectably labelled during the nucleic amplification process. For example, one or more of the oligonucleotide primers used in the amplification assay may be detectably labelled with a “fluorescent label” or “fluorescent dye” (also referred to as a “fluorophore”), such that the fluorescent dye is incorporated into the amplification product. As used herein, the term “fluorescent label” includes a signaling moiety that conveys information through the fluorescent absorption and/or emission properties of one or more molecules. Such fluorescent properties include fluorescence intensity, fluorescence life time, emission spectrum characteristics, energy transfer and the like.

Exemplary fluorescent dyes which may be conjugated or attached to a oligonucleotide primer incluide, but not limited to fluorescein/Oregon Green, fluorescein isothiocyanate (FITC), 6-Carboxyfluorescein, tetramethylrhodamine, Texas Red, dansyl, Alexa Fluor 488, BODIPY FF, lucifer yellow, and Alexa Fluor 405/Cascade Blue fluorophores. Fluorescent labels and their attachment to oligonucleotides are described in many reviews, including Haugland, Handbook of Fluorescent Probes and Research Chemicals, Ninth Edition (Molecular Probes, Inc., Eugene, 2002); Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New York, 1993); Eckstein, editor, Oligonucleotides and Analogues: A Practical Approach (IRE Press, Oxford, 1991); Wetmur (1991), Critical Reviews in Biochemistry and Molecular Biology, 26:227-259; and the like.

Commercially available fluorescent nucleotide analogues which may be readily incorporated into the polynucleotides during the nucleic acid amplification process include, for example, Cy3-dCTP, Cy3-dUTP, Cy5-dCTP, Cy5-dUTP (Amersham Biosciences, Piscataway, N.J.), fluorescein- 12-dUTP, tetramethylrhodamine-6-dUTP, TEXAS RED™-5- dUTP, CASCADE BLUE™-7-dUTP, BODIPY TMFL-14-dUTP, BODIPY TMR-14-dUTP, BODIPY TMTR- 14-dUTP, RHOD AMINE GREEN™-5-dUTP, OREGON GREENR™ 488- 5-dUTP, TEXAS RED™- 12-dUTP, BODIPY TM 630/650- 14-dUTP, BODIPY TM 650/665- 14-dUTP, ALEXA FLUOR™ 488-5-dUTP, ALEXA FLUOR™ 532-5-dUTP, ALEXA FLUOR™ 568-5-dUTP, ALEXA FLUOR™ 594-5-dUTP, ALEXA FLUOR™ 546- 14- dUTP, fluorescein- 12-UTP, tetramethylrhodamine-6-UTP, TEXAS RED™-5-UTP, mCherry, CASCADE BLUE™-7-UTP, BODIPY TM FL-14-UTP, BODIPY TMR-14-UTP, BODIPY TM TR-14-UTP, RHOD AMINE GREEN™-5-UTP, ALEXA FLUOR™ 488-5- UTP, ALEXA FLUOR™ 546-14-UTP (Molecular Probes, Inc. Eugene, Oreg.). Protocols are available for custom synthesis of nucleotides having other fluorophores. Henegariu et al., “Custom Fluorescent-Nucleotide Synthesis as an Alternative Method for Nucleic Acid Labeling,” Nature Biotechnol. 18:345-348 (2000).

Other fluorophores available for post- synthetic attachment include, inter alia, ALEXA FLUOR™ 350, ALEXA FLUOR™ 532, ALEXA FLUOR™ 546, ALEXA FLUOR™ 568, ALEXA FLUOR™ 594, ALEXA FLUOR™ 647, BODIPY 493/503, BODIPY FL, BODIPY R6G, BODIPY 530/550, BODIPY TMR, BODIPY 558/568, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/665, Cascade Blue, Cascade Yellow, Dansyl, lissamine rhodamine B, Marina Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, rhodamine 6G, rhodamine green, rhodamine red, tetramethyl rhodamine, DYLIGHT™ DYES (e.g., DYLIGHT™ 405, DYLIGHT™ 488, DYLIGHT™ 549, DYLIGHT™ 594, DYLIGHT™ 633, DYLIGHT™ 649, DYLIGHT™ 680, DYLIGHT™ 750, DYLIGHT™ 800 and the like) (available from Thermo Fisher Scientific, Rockford, Ill.), Texas Red (available from Molecular Probes, Inc., Eugene, Oreg.), and Cy2, Cy3.5, Cy5.5, and Cy7 (available from Amersham Biosciences, Piscataway, N.J. USA, and others).

FRET tandem fluorophores may also be used, such as PerCP-Cy5.5, PE-Cy5, PE- Cy5.5, PE-Cy7, PE-Texas Red, and APC-Cy7; also, PE-Alexa dyes (610, 647, 680) and APC- Alexa dyes.

Metallic silver particles may be coated onto the surface of the array to enhance signal from fluorescently labelled oligonucleotide sequences bound to an array. Lakowicz et al. (2003) BioTechniques 34:62.

Labelling can also be carried out with quantum dots, as disclosed in the following patents and patent publications: U.S. Pat. Nos. 6,322,901; 6,576,291; 6,423,551; 6,251,303; 6,319,426; 6,426,513; 6,444,143; 5,990,479; 6,207,392; 2002/0045045; 2003/0017264; and the like.

In another example, the amplification product may be detected directly by fluorescence, i.e., a fluorochrome may be included as a component of the amplification reagent mixture so that detection is simultaneous with the production of the amplification products. Examples of such fluorescing compounds include Bodipy-derivatives, Cy- derivatives, fluorescein-derivatives, and rhodamine-derivatives all of which are well known in the art. Alternatively, detection of the amplification products may be carried out directly using chemiluminescence or electrochemiluminescence. Chemiluminescence incorporates the use of an enzyme linked to a reporter oligonucleotide which, when activated with an appropriate substrate, emits a luminescent signal. Examples of such enzymes include horseradish peroxidase and alkaline phosphatase both of which are well known in the art.

The amplification products generated using the methods disclosed herein may also be detected by a characteristic size, for example, on polyacrylamide or agarose gels stained with ethidium bromide. Alternatively, amplified target sequences may be detected by means of a detection probe, which is an oligonucleotide tagged with a detectable label that hybridizes specifically to a target sequence in a nucleic acid, under conditions that allow hybridization, thereby allowing detection of the target sequence or amplification product. In one example, at least one tagged detection probe may be used for detection of amplification product by hybridization and extension as described by Walker, et al. (992, Nucl. Acids Res. 20:1691 1696) (a detector primer) or by hybridization, extension and conversion to double stranded form as described in EP 0678582 (a signal primer). Preferably, the detection probe is designed to hybridize to a sequence in the target sequence that is between the amplification primers, i.e., it is an internal detection probe which hybridizes to the amplification product. Alternatively, an amplification primer or the target binding sequence thereof may be used as the detection probe. The detection probe may be detected either directly or indirectly as an indication of the presence of the amplification product. For direct detection, the detection probes may be tagged with a radioisotope and detected by autoradiography or tagged with a fluorescent moiety and detected by fluorescence as is known in the art. Alternatively, the detection probes may be indirectly detected by tagging with a label that requires additional reagents to render it detectable. Indirectly detectable labels include, for example, chemiluminescent agents, enzymes which produce visible reaction products and ligands which may be detected by binding to labeled specific binding partners. Ligands are also useful immobilizing the ligand- labeled oligonucleotide (the capture probe) on a solid phase to facilitate its detection. Particularly useful labels include biotin (detectable by binding to labeled avidin or streptavidin) and enzymes such a horseradish peroxidase or alkaline phosphatase (detectable by addition of enzyme substrates to produce colored reaction products). Methods for adding such labels to, or including such labels in, oligonucleotides are well known in the art and any of these methods are suitable for use in the present disclosure.

For example, the detection probe can also be a complementary oligonucleotide immobilized on a solid phase, like in a sandwich hybridization assay. In this case the amplification product is bound to the solid phase by hybridizing to the complementary oligonucleotide immobilized on the solid phase and can be detected by hybridizing the immobilized amplification product with a second, labelled, complementary oligonucleotide.

In some examples, detection of the amplification product is performed in real-time. Detection in “real-time” refers to detection that occurs continuously or semi-continuously while the target polynucleotide sequence is being amplified. Such methods allow the accumulation of amplicons to be measured over the course of the amplification assay.

In one example, a molecular beacon is used as a detection probe to detect the amplification product. The terms "molecular beacon" and "labeled molecular beacon" refer to single- stranded oligonucleotide hybridization probes that form a stem-and-loop structure and can report the presence of specific nucleic acids in homogenous solutions (Tyagi and Kramer, Nature Biotechnology, 1996, 14:303-308; Fang et al., Anal. Chem., 2000, 72:747a-753a; Fang et al., Cell Biochem. Biophys., 2002, 37:71-81; Marras et al., Clin. Clim. Acta, 2006, 363:48- 60; Keightley et al., J. Med. Virol., 2005, 77:602-608; and Leone et al., Nucleic Acids, 1998, 26:2150-2155). They are particularly useful in situations where it is either not possible or desirable to isolate the probe-target hybrids from an excess of the hybridization probes, such as in real time monitoring of NASB A reactions in sealed tubes. Molecular beacons are hairpinshaped molecules with an internally quenched fluorophore whose fluorescence is restored when they bind to a target nucleic acid. They are designed in such a way that the loop portion of the molecule is a probe sequence complementary to a target nucleic acid molecule. The stem is formed by the annealing of complementary arm sequences on the ends of the probe sequence. A fluorescent moiety is attached to the end of one arm and a quenching moiety is attached to the end of the other arm. The stem keeps these two moieties in close proximity to each other, causing the fluorescence of the fluorophore to be quenched by energy transfer. Since the quencher moiety is a non-fluorescent chromophore and emits the energy that it receives from the fluorophore as heat, the probe is unable to fluoresce. When the probe encounters a target molecule, it forms a hybrid that is longer and more stable than the stem and its rigidity and length preclude the simultaneous existence of the stem hybrid. Thus, the molecular beacon undergoes a spontaneous conformational reorganization that forces the stem apart, and causes the fluorophore and the quencher to move away from each other, leading to the restoration of fluorescence. In order to detect multiple targets in the same solution, molecular beacons can be made in many different colors utilizing a broad range of fluorophores (Tyagi et al., Nature Biotechnology, 1998; 16: 49-53.) DABCYL, a non- fluorescent chromophore, serves as a universal quencher for any fluorophore in molecular beacons. Owing to their stem, the recognition of targets by molecular beacons is so specific that single-nucleotide differences can be readily detected. In some examples, a FAM fluorophore reporter and a BHQ (Black Hole Quencher) quencher are used.

In other examples, detection of the amplification product(s) may be determined by sequencing the amplification product(s), optionally after one or more purification steps. The term “sequencing,” as used herein, refers to a method by which the identity of a consecutive stretch of nucleotides within a nucleic acid molecule is identified. That is, the identity of individual nucleotides within the nucleic acid molecule are identified which collectively provide the sequence of the nucleic acid or a part thereof. A number of methods and platforms are known in the art for sequencing of nucleic acid molecules and these are contemplated for use herein. Exemplary sequencing methods include next generation sequencing methods such as sequencing-by-hybridization (e.g., from Affymetrix Inc. (Sunnyvale, CA)), sequencing-by- synthesis (e.g., from 454 Life Sciences (Bradford, CT), Illumina/Solexa (San Diego, CA) and Helicos Biosciences (Cambridge, MA)), sequencing-by-ligation platform (e.g., from Applied Biosystems (Foster City, CA)), combinatorial probe anchor synthesis (cPAS) using the MGI Tech Platforms from BGI (China), ion semiconductor sequencing ((also referred to as “Ion Torrent” sequencing) e.g., from ThermoFisher Scientific), nanopore sequencing (e.g., from Oxford Nanopore Technologies) and single molecule real time (SMRT) sequencing (e.g., from SMRT™ technology of Pacific Biosciences). However, chain termination (Sanger sequencing) may also be used.

Methods and software for designing primers for amplification and detection of a target DNA will be known to those skilled in the art (Ye et al., (2012) BMC Bioinformatics, 13: 134. Exemplary primer design software which may be used for designing amplification primers for use in the method of the disclosure include, but are not limited to, Primer-BLAST, Primer3, Primer3Plus, PrimerQuest, OligoPerfect, PerlPrimer, OLIGO, AutoPrime, RExPrimer, BatchPrimer3 and others. In designing amplification primers suitable for amplifying a region of the Shigella biomarkers (such as polynucleotide sequences set forth in SEQ ID NOs: 1-14 and 332), a skilled person will appreciate that a number of possible primer sets may be designed, each with differing amplification product sequences depending on the location of the primers within the target sequence. Exemplary primer sets and the corresponding amplification products for each of the Shigella biomarkers are provided in Table 1 below. However, additional exemplary primer sets designed using Primer-BLAST, are also contemplated for amplifying regions of the Shigella biomarkers in the method of the disclosure. These are provided in Table 2. However, a skilled person could readily design alternative primer sets to those presented in Table 1 and 2 using appropriate primer design software, such as those described herein.

In certain examples, the presence or absence of any one or more of the Shigella biomarkers in a sample may be determined by directed sequencing of DNA extracted from the sample. Various methods of sequencing DNA have been described and are contemplated herein.

In other examples, the presence or absence of any one or more of the Shigella biomarkers in a sample may be determined by endonuclease digestion of DNA extracted from the sample. Endonuclease digestion may applied directly to DNA extracted from the sample, or used in conjunction with a nucleic acid amplification method as described herein.

In one example, the presence or absence of the SSI biomarker ( e.g ., the polynucleotide sequence set forth in SEQ ID NO: 1) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SSI in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SSI biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 1) or a portion thereof indicates that the sample is positive for the biomarker designated SS 1. In a preferred example, the primer set corresponding to SSI in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 15, or a homologue thereof, to determine the presence or absence of the biomarker designated SSI. The presence of the amplification product set forth in SEQ ID NO: 15, or a homologue thereof, is indicative of the presence of Shigella sonnei in the sample.

In one example, the presence or absence of the SS2 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 332) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SS2 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SS2 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 332) or a portion thereof indicates that the sample is positive for the biomarker designated SS2. In a preferred example, the primer set corresponding to SS2 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 333, or a homologue thereof, to determine the presence or absence of the biomarker designated SS2. The presence of the amplification product set forth in SEQ ID NO: 333, or a homologue thereof, is indicative of the presence of Shigella sonnei in the sample.

In one example, the presence or absence of the SF2 biomarker ( e.g ., the polynucleotide sequence set forth in SEQ ID NO: 2) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SF2 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SF2 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 2) or a portion thereof indicates that the sample is positive for the biomarker designated SF2. In a preferred example, the primer set corresponding to SF2 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 16, or a homologue thereof, to determine the presence or absence of the biomarker designated SF2. The presence of the amplification product set forth in SEQ ID NO: 16, or a homologue thereof, is indicative of the presence of Shigella flexneri in the sample. The presence of the amplification product set forth in SEQ ID NO: 16, or a homologue thereof, is indicative of the presence of Shigella flexneri of one or more serotypes selected from serotype 15, la, lb, lc, 1, 2a, 2b, 2, 3a, 3b, 3c, 3, 4a, 4av, 4b, 4bv, 4c, 4, 5a, 5b, 5, 6, 7, X, Xv, Y, and/or Yv in the sample.

In one example, the presence or absence of the SF4 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 3) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SF4 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SF4 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 3) or a portion thereof indicates that the sample is positive for the biomarker designated SF4. In a preferred example, the primer set corresponding to SF4 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 17, or a homologue thereof, to determine the presence or absence of the biomarker designated SF4. The presence of the amplification product set forth in SEQ ID NO: 17, or a homologue thereof, is indicative of the presence of Shigella flexneri in the sample. The presence of the amplification product set forth in SEQ ID NO: 17, or a homologue thereof, is indicative of the presence of Shigella flexneri of one or more serotypes selected from serotype 6 and/or 2 in the sample.

In one example, the presence or absence of the SB1 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 4) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SB1 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SB1 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 4) or a portion thereof indicates that the sample is positive for the biomarker designated SB 1. In a preferred example, the primer set corresponding to SB1 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 18, or a homologue thereof, to determine the presence or absence of the biomarker designated SB 1. The presence of the amplification product set forth in SEQ ID NO:

18, or a homologue thereof, is indicative of the presence of Shigella boydii in the sample. The presence of the amplification product set forth in SEQ ID NO: 18, or a homologue thereof, is indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 1, 3, 6, 8, 10, 11, 18, 19 and/or 20 in the sample.

In one example, the presence or absence of the SB2 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 5) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SB2 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SB2 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 5) or a portion thereof indicates that the sample is positive for the biomarker designated SB2. In a preferred example, the primer set corresponding to SB2 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 19, or a homologue thereof, to determine the presence or absence of the biomarker designated SB2. The presence of the amplification product set forth in SEQ ID NO:

19, or a homologue thereof, is indicative of the presence of Shigella boydii in the sample. The presence of the amplification product set forth in SEQ ID NO: 19, or a homologue thereof, is indicative of the presence of Shigella boydii of serotype 2 in the sample.

In one example, the presence or absence of the SB3 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 6) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SB3 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SB3 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 6) or a portion thereof indicates that the sample is positive for the biomarker designated SB3. In a preferred example, the primer set corresponding to SB3 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 20, or a homologue thereof, to determine the presence or absence of the biomarker designated SB3. The presence of the amplification product set forth in SEQ ID NO: 20, or a homologue thereof, is indicative of the presence of Shigella boydii in the sample. The presence of the amplification product set forth in SEQ ID NO: 20, or a homologue thereof, is indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 4 and/or 6 in the sample.

In one example, the presence or absence of the SB4 biomarker ( e.g ., the polynucleotide sequence set forth in SEQ ID NO: 7) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SB4 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SB4 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 7) or a portion thereof indicates that the sample is positive for the biomarker designated SB4. In a preferred example, the primer set corresponding to SB4 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 21, or a homologue thereof, to determine the presence or absence of the biomarker designated SB4. The presence of the amplification product set forth in SEQ ID NO:

21, or a homologue thereof, is indicative of the presence of Shigella boydii in the sample. The presence of the amplification product set forth in SEQ ID NO: 21, or a homologue thereof, is indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 11, 13, 16, 17, 5, 7 and/or 9 in the sample.

In one example, the presence or absence of the SB 12 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 8) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SB 12 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SB 12 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 8) or a portion thereof indicates that the sample is positive for the biomarker designated SB 12. In a preferred example, the primer set corresponding to SB 12 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 22, or a homologue thereof, to determine the presence or absence of the biomarker designated SB 12. The presence of the amplification product set forth in SEQ ID NO: 22, or a homologue thereof, is indicative of the presence of Shigella boydii in the sample. The presence of the amplification product set forth in SEQ ID NO: 22, or a homologue thereof, is indicative of the presence of Shigella boydii of serotype 11 in the sample.

In one example, the presence or absence of the SB6 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 9) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SB6 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SB6 biomarker ( e.g ., the polynucleotide sequence set forth in SEQ ID NO: 9) or a portion thereof indicates that the sample is positive for the biomarker designated SB6. In a preferred example, the primer set corresponding to SB6 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 23, or a homologue thereof, to determine the presence or absence of the biomarker designated SB6. The presence of the amplification product set forth in SEQ ID NO:

23, or a homologue thereof, is indicative of the presence of Shigella boydii in the sample.

In one example, the presence or absence of the SB7 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 10) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SB7 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SB7 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 10) or a portion thereof indicates that the sample is positive for the biomarker designated SB7. In a preferred example, the primer set corresponding to SB7 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 24, or a homologue thereof, to determine the presence or absence of the biomarker designated SB7. The presence of the amplification product set forth in SEQ ID NO:

24, or a homologue thereof, is indicative of the presence of Shigella boydii in the sample. The presence of the amplification product set forth in SEQ ID NO: 24, or a homologue thereof, is indicative of the presence of Shigella boydii of one or more serotypes selected from serotype 14 and/or 2 in the sample.

In one example, the presence or absence of the SD1 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 11) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SD1 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SD1 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 11) or a portion thereof indicates that the sample is positive for the biomarker designated SD 1. In a preferred example, the primer set corresponding to SD1 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 25, or a homologue thereof, to determine the presence or absence of the bio marker designated SD1. The presence of the amplification product set forth in SEQ ID NO: 25, or a homologue thereof, is indicative of the presence of Shigella dysenteriae in the sample. The presence of the amplification product set forth in SEQ ID NO: 25, or a homologue thereof, is indicative of the presence of Shigella dysenteriae of serotype 1 in the sample. In one example, the presence or absence of the SD3 biomarker ( e.g ., the polynucleotide sequence set forth in SEQ ID NO: 12) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SD3 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SD3 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 12) or a portion thereof indicates that the sample is positive for the biomarker designated SD3. In a preferred example, the primer set corresponding to SD3 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 26, or a homologue thereof, to determine the presence or absence of the bio marker designated SD3. The presence of the amplification product set forth in SEQ ID NO: 25, or a homologue thereof, is indicative of the presence of Shigella dysenteriae in the sample. The presence of the amplification product set forth in SEQ ID NO: 26, or a homologue thereof, is indicative of the presence of Shigella dysenteriae of one or more serotypes selected from serotypes 3, 4, 6, 8, 9, 11, 12, 13, 14, 15, 17 and/or 18 in the sample.

In one example, the presence or absence of the SD5 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 13) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SD5 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SD5 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 13) or a portion thereof indicates that the sample is positive for the biomarker designated SD5. In a preferred example, the primer set corresponding to SD5 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 27, or a homologue thereof, to determine the presence or absence of the biomarker designated SD5. The presence of the amplification product set forth in SEQ ID NO: 25, or a homologue thereof, is indicative of the presence of Shigella dysenteriae in the sample. The presence of the amplification product set forth in SEQ ID NO: 27, or a homologue thereof, is indicative of the presence of Shigella dysenteriae of one or more serotypes selected from serotypes 12 and/or 2 in the sample.

In one example, the presence or absence of the SD7 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 14) is determined by (i) performing a nucleic acid amplification assay on DNA extracted from the sample using one or more amplification primer sets corresponding to SD7 in Table 1 or 2, and (ii) detecting the amplification product of the assay, wherein detection of an amplification product corresponding to the SD7 biomarker (e.g., the polynucleotide sequence set forth in SEQ ID NO: 14) or a portion thereof indicates that the sample is positive for the biomarker designated SD7. In a preferred example, the primer set corresponding to SD7 in Table 1 is used in the amplification assay, and the method comprises detecting the presence or absence of the amplification product set forth in SEQ ID NO: 28, or a homologue thereof, to determine the presence or absence of the biomarker designated SD7. The presence of the amplification product set forth in SEQ ID NO: 25, or a homologue thereof, is indicative of the presence of Shigella dysenteriae in the sample. The presence of the amplification product set forth in SEQ ID NO: 28, or a homologue thereof, is indicative of the presence of Shigella dysenteriae of serotype 8 in the sample.

Table 1. Exemplary primer sets for amplifying Shigella bio markers

Table 2. Alternative primer sets for amplifying Shigella biomarkers

In yet another example, the presence or absence of the Shigella biomarkers in the sample is determined by using the specific high- sensitivity enzymatic reporter unlocking (SHERLOCK) platform. The SHERLOCK platform combines nucleic acid pre-amplification with CRISPR-Cas enzymology for specific recognition of desired DNA or RNA sequences, and is described in more detail in Kellner et ah, (2019) Nature Protocols , 14(10):2986-3012, the full content of which is incorporated herein by reference.

As described herein, the method of the disclosure also contemplates detection of Shigella and discrimination between species thereof based on the presence or absence of polypeptides encoded by the polynucleotides set forth in SEQ ID NOs: 1-14 and 332. In accordance with examples describing methods for detecting polypeptides encoded by the nucleic acid sequence set forth in SEQ ID NOs: 1-14 and 332, the polypeptides may be detected in the sample or a cell lysate thereof using an immunological assay and/or a mass spectrometry (MS). In one example, the immunoassay is Enzyme-Linked Immunosorbant Assay (ELISA). In one example, the immunoassay is immunofluorescence. In one example, the MS method is matrix assisted laser desorption ionization time of flight (MALDI-TOF) MS.

As used herein, a “sample” refers to a substance that is being assayed for the presence or absence of one or more of the biomarkers described herein which is indicative of the presence of Shigella. Accordingly, a sample may be any substance suspected of being contaminated with or comprising Shigella spp. which is to be subjected to the method described of the disclosure. In one example, the sample is a biological sample. The biological sample may be, for example, a faeces ( e.g ., from a human or animal), vomit (e.g., from a human or animal), a swab (such as a rectal swab from a human or animal), a food substance, or a bacterial culture. In another example, the sample may be an environmental sample. The environmental sample may be, for example, a soil sample or a water sample (including waste water).

In some examples, the sample may be treated to isolate DNA therefrom. Accordingly, the method described herein may comprise the step of isolating DNA from the sample prior to the step of determining the presence or absence of one or more of the Shigella markers described herein. The term “isolation”, “isolating” or “isolate” as used herein in the context of DNA, and as applied to the methods and assays described herein for preparing DNA from a sample, refers to and encompasses any method or approach known in the art whereby DNA can be obtained, procured, prepared, purified or isolated such that it is suitable for analysis, amplification and/or sequencing as provided in the methods and assays of the present disclosure. Various methods for the isolation or procurement of nucleic acid may be employed, as any skilled artisan may know and practice. Such methods may include methods employed for the isolation of DNA in various forms and states of purity and may not necessarily involve or require the separation of DNA from all cellular debris, protein, etc.

In other examples, a sample may be treated to extract and/or isolate protein or polypeptides therefrom. Accordingly, the method described herein may comprise the step of isolating protein from the sample prior to the step of determining the presence or absence of one or more of the Shigella markers described herein. The term “isolation”, “isolating” or “isolate” as used herein in the context of proteins and polypeptides, and as applied to the methods and assays described herein for preparing proteins and polypeptides from a sample, refers to and encompasses any method or approach known in the art whereby proteins and polypeptides can be obtained, procured, prepared, purified or isolated such that it is suitable for analysis and/or detection as provided in the methods and assays of the present disclosure. Various methods for the isolation or extracting proteins/polypeptides may be employed, as any skilled artisan may know and practice. In some examples, the protein or polypeptides may be provided in the form of a cell lysate. In other examples, the protein or polypeptides may be purified from a cell lysate (e.g., separated from the non-soluble parts of cells). Furthermore, the method may incorporate the use of an internal control as a check on the nucleic acid amplification procedure and to prevent the occurrence of false negative test results due to failures in the amplification procedure.

Test Kits

The present disclosure also provides a test kit for detecting Shigella spp., as well as for identifying the species of Shigella, present in a sample. The test kit of the disclosure is based on the identification of a novel panel of biomarkers (referred to herein as the Shigella biomarkers), most of which are mutually exclusive or non-overlapping cross 14 groups of Shigella representing the four serologically distinct species: Shigella dysenteriae (A), Shigella flexneri, (B), Shigella boydii (C) and Shigella sonnei (D). This unique panel of Shigella biomarkers provide target nucleic acids, and the corresponding polypeptides, which can be used to discriminate between species of Shigella using the method and test kit of the disclosure, thereby making it possible to rapidly, accurately and simultaneously detect Shigella at the genus and species level without the need for time-consuming culture.

Accordingly, in one example, the present disclosure provides a test kit for detecting and differentiating species of Shigella in a sample, said test kit comprising one or more reagent mixtures selected from the group consisting of:

(a) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 1, or a homologue thereof having at least 75% identity to thereto ( e.g ., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SSI reagent mixture”);

(b) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 332 or a homologue thereof having at least 75% identity to thereto (such as, for example, at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto) by a DNA amplification assay (hereinafter the “SS2 reagent mixture”);

(c) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 2, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SF2 reagent mixture”);

(d) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 3, or a homologue thereof having at least 75% identity to thereto ( e.g ., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SF4 reagent mixture”);

(e) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 4, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SB1 reagent mixture”);

(f) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 5, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SB2 reagent mixture”);

(g) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 6, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SB3 reagent mixture”);

(h) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 7, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SB4 reagent mixture”);

(i) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 8, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SB 12 reagent mixture”);

(j) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 9, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SB6 reagent mixture”);

(k) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 10, or a homologue thereof having at least 75% identity to thereto ( e.g ., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SB7 reagent mixture”);

(l) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 11, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SD1 reagent mixture”);

(m) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 12, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SD3 reagent mixture”);

(n) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 13, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SD5 reagent mixture”); and

(o) a reagent mixture comprising oligonucleotide primers configured to amplify a region of DNA within a template sequence set forth in SEQ ID NO: 14, or a homologue thereof having at least 75% identity to thereto (e.g., having at least 80%, or at least 85%, or at least 90% or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%, identity thereto), by a DNA amplification assay (hereinafter the “SD7 reagent mixture”).

In one example, the test kit comprises a reagent mixture configured to detect the presence or absence of Shigella sonnei in a sample. In accordance with this example, the test kit will comprise the SSI reagent mixture and/or the SS2 reagent mixture. The test kit may comprise the SSI reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SS2 reagent mixture and one or more ( e.g ., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture.

In one example, the test kit comprises at least one reagent mixture configured to detect the presence or absence of Shigella flexneri in a sample. In accordance with this example, the test kit will comprise the SF2 reagent mixture or the SF4 reagent mixture or both. The test kit may comprise the SF2 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SS 1 reagent mixture, SS2 reagent mixture, SF4 reagent mixture, SB 1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SF4 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SSI reagent mixture, SF2 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture.

In one example, the test kit comprises at least one reagent mixture configured to detect the presence or absence of Shigella boydii in a sample. In accordance with this example, the test kit will comprise the SB1 reagent mixture, or the SB2 reagent mixture, or SB3 reagent mixture, or SB4 reagent mixture, or SB 12 reagent mixture, or SB6 reagent mixture, or SB7 reagent mixture or any combination thereof. The test kit may comprise the SB1 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SS 1 reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SB2 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SS 1 reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB 1 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SB3 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SS 1 reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB 1 reagent mixture, SB2 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SB4 reagent mixture and one or more ( e.g ., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SSI reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SB 12 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SSI reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SB6 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SS 1 reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SB7 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SSI reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SD1 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture.

In one example, the test kit comprises at least one reagent mixture configured to detect the presence or absence of Shigella dysenteriae in a sample. In accordance with this example, the test kit will comprise the SD1 reagent mixture, or the SD3 reagent mixture, or SD5 reagent mixture, or SD7 reagent mixture, or any combination thereof. The test kit may comprise the SD1 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SS 1 reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD3 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SD3 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SSI reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD5 reagent mixture and SD7 reagent mixture. The test kit may comprise the SD5 reagent mixture and one or more ( e.g ., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SSI reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture and SD7 reagent mixture. The test kit may comprise the SD7 reagent mixture and one or more (e.g., 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13) reagent mixtures selected from the SSI reagent mixture, SS2 reagent mixture, SF2 reagent mixture, SF4 reagent mixture, SB1 reagent mixture, SB2 reagent mixture, SB3 reagent mixture, SB4 reagent mixture, SB 12 reagent mixture, SB6 reagent mixture, SB7 reagent mixture, SD1 reagent mixture, SD3 reagent mixture and SD5 reagent mixture.

In some examples, the test kit comprises the SSI reagent mixture and/or SS2 reagent mixture, and each of the SF2 reagent mixture, the SF4 reagent mixture, the SB1 reagent mixture, the SB2 reagent mixture, the SB3 reagent mixture, the SB4 reagent mixture, the SB 12 reagent mixture, the SB6 reagent mixture, the SB7 reagent mixture, the SD1 reagent mixture, the SD3 reagent mixture, the SD5 reagent mixture and SD7 reagent mixture. For example, the test kit comprises the SSI reagent mixture, the SF2 reagent mixture, the SF4 reagent mixture, the SB1 reagent mixture, the SB2 reagent mixture, the SB3 reagent mixture, the SB4 reagent mixture, the SB 12 reagent mixture, the SB6 reagent mixture, the SB7 reagent mixture, the SD1 reagent mixture, the SD3 reagent mixture, the SD5 reagent mixture and SD7 reagent mixture. For example, the test kit comprises the SS2 reagent mixture, the SF2 reagent mixture, the SF4 reagent mixture, the SB1 reagent mixture, the SB2 reagent mixture, the SB3 reagent mixture, the SB4 reagent mixture, the SB 12 reagent mixture, the SB6 reagent mixture, the SB7 reagent mixture, the SD1 reagent mixture, the SD3 reagent mixture, the SD5 reagent mixture and SD7 reagent mixture. In some examples, the test kit comprises the SSI reagent mixture, the SS2 reagent mixture, the SF2 reagent mixture, the SF4 reagent mixture, the SB1 reagent mixture, the SB2 reagent mixture, the SB3 reagent mixture, the SB4 reagent mixture, the SB 12 reagent mixture, the SB6 reagent mixture, the SB7 reagent mixture, the SD1 reagent mixture, the SD3 reagent mixture, the SD5 reagent mixture and SD7 reagent mixture.

In accordance with examples in which the test kit comprises multiple reagent mixtures, the reagent mixtures may be provided separately within the test kit. Alternatively, two or more (e.g., 2, or 3, or 4, or 5, or 6, or more) of the reagent mixtures may be combined together so that the any DNA amplification assay performed with the combined reagent mixtures is a multiplex assay. As described herein, the test kit comprises one or more reagent mixtures, each comprising reagents configured to amplify a region of DNA within one of the Shigella biomarkers using a nucleic acid amplification assay and produce an amplification product which may be detected. In one example, the nucleic acid amplification assay is PCR. The PCR assay may be a standard PCR assay or it may be qPCR. In another example, the nucleic acid amplification assay may be an isothermal nucleic acid amplification assay. Exemplary isothermal amplification assays are described herein, and may include LAMP, RPA, HDA, tHDA, SDA, MDA, RCA, restriction aided RCA, SPIA, TMA, NEAR, EXPAR, NASBA and SMAP. The skilled person is readily able to design suitable primers and select appropriate reagents ( e.g ., DNA polymerase enzyme, dinucleotide triphosphates (dNTPs), salts and/or buffers) for inclusion in the reagent mixture depending on the choice of nucleic acid amplification assay. However, in one example, the choice of nucleic acid amplification assay is a PCR assay and each reagent mixture comprises at least one DNA polymerase enzyme, amplification primers specific for the DNA sequence of the respective Shigella biomarker, dNTPs, one or more salts, and at least one buffer.

In one example, the SSI reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SSI biomarker set forth in SEQ ID NO: 1 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 15. For example, the reagent mixture configured to amplify a region of DNA within the SSI biomarker (e.g., the sequence set forth in SEQ ID NO: 1) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 29 or a sequence which is substantially identical thereto (SS 1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 30 or a sequence which is substantially identical thereto (SS1_R). For example, the reagent mixture configured to amplify a region of DNA within the SS 1 biomarker may comprise a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 29 (SS1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 30 (SS1_R). In another example, the SSI reagent mixture comprises amplification primers corresponding to the SSI biomarker as described in Table 2.

In one example, the SS2 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SS2 biomarker set forth in SEQ ID NO: 332 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 333. For example, the reagent mixture configured to amplify a region of DNA within the SS2 biomarker (e.g., the sequence set forth in SEQ ID NO: 332) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 334 or a sequence which is substantially identical thereto (SS2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 335 or a sequence which is substantially identical thereto (SS2_R). For example, the reagent mixture configured to amplify a region of DNA within the SS2 biomarker may comprise a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 334 (SS2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 335 (SS2_R). In another example, the SS2 reagent mixture comprises amplification primers corresponding to the SS2 biomarker as described in Table 2.

In one example, the SF2 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SF2 biomarker set forth in SEQ ID NO: 2 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 16. For example, the reagent mixture configured to amplify a region of DNA within the SF2 biomarker ( e.g ., the sequence set forth in SEQ ID NO: 2) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 31 or a sequence which is substantially identical thereto (SF2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 32 or a sequence which is substantially identical thereto (SF2_R). For example, the reagent mixture configured to amplify a region of DNA within the SF2 biomarker comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 31 (SF2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 32 (SF2_R). In another example, the SF2 reagent mixture comprises amplification primers corresponding to the SF2 biomarker as described in Table 2.

In one example, the SF4 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SF4 biomarker set forth in SEQ ID NO: 3 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 17. For example, the reagent mixture configured to amplify a region of DNA within the SF4 biomarker (e.g., the sequence set forth in SEQ ID NO: 3) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 33 or a sequence which is substantially identical thereto (SF4_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 34 or a sequence which is substantially identical thereto (SF4_R). For example, the reagent mixture configured to amplify a region of DNA within the SF4 biomarker comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 33 (SF4_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 34 (SF4_R). In another example, the SF4 reagent mixture comprises amplification primers corresponding to the SF4 biomarker as described in Table 2.

In one example, the SB1 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SB1 biomarker set forth in SEQ ID NO: 4 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 18. For example, the reagent mixture configured to amplify a region of DNA within the SB1 biomarker (e.g., the sequence set forth in SEQ ID NO: 4) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 35 or a sequence which is substantially identical thereto (SB1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 36 or a sequence which is substantially identical thereto (SB1_R). For example, the reagent mixture configured to amplify a region of DNA within the SB1 comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 35 (SB1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 36 (SB1_R). In another example, the SB1 reagent mixture comprises amplification primers corresponding to the SB1 biomarker as described in Table 2.

In one example, the SB2 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SB2 biomarker set forth in SEQ ID NO: 5 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 19. For example, the reagent mixture configured to amplify a region of DNA within the SB2 biomarker (e.g., the sequence set forth in SEQ ID NO: 5) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 37 or a sequence which is substantially identical thereto (SB2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 38 or a sequence which is substantially identical thereto (SB2_R). For example, the reagent mixture configured to amplify a region of DNA within the SB2 biomarker comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 37 (SB2_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 38 (SB2_R). In another example, the SB2 reagent mixture comprises amplification primers corresponding to the SB2 biomarker as described in Table 2.

In one example, the SB3 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SB3 biomarker set forth in SEQ ID NO: 6 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 20. For example, the reagent mixture configured to amplify a region of DNA within the SB3 biomarker (e.g., the sequence set forth in SEQ ID NO: 6) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 39 or a sequence which is substantially identical thereto (SB3_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 40 or a sequence which is substantially identical thereto (SB3_R). For example, the reagent mixture configured to amplify a region of DNA within the SB3 biomarker comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 39 (SB3_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 40 (SB3_R). In another example, the SB3 reagent mixture comprises amplification primers corresponding to the SB3 biomarker as described in Table 2.

In one example, the SB4 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SB4 biomarker set forth in SEQ ID NO: 7 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 21. For example, the reagent mixture configured to amplify a region of DNA within the SB4 biomarker ( e.g ., the sequence set forth in SEQ ID NO: 7) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 41 or a sequence which is substantially identical thereto (SB4_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 42 or a sequence which is substantially identical thereto (SB4_R). For example, the reagent mixture configured to amplify a region of DNA within the SB4 comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 41 (SB4_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 42 (SB4_R). In another example, the SB4 reagent mixture comprises amplification primers corresponding to the SB4 biomarker as described in Table 2.

In one example, the SB 12 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SB 12 biomarker set forth in SEQ ID NO: 8 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 22. For example, the reagent mixture configured to amplify a region of DNA within the SB 12 biomarker (e.g., the sequence set forth in SEQ ID NO: 8) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 43 or a sequence which is substantially identical thereto (SB12_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 44 or a sequence which is substantially identical thereto (SB12_R). For example, the reagent mixture configured to amplify a region of DNA within the SB 12 biomarker (comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 43 (SB12_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 44 (SB12_R). In another example, the SB 12 reagent mixture comprises amplification primers corresponding to the SB 12 biomarker as described in Table 2.

In one example, the SB6 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SB6 biomarker set forth in SEQ ID NO: 9 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 23. For example, the reagent mixture configured to amplify a region of DNA within the SB6 biomarker (e.g., the sequence set forth in SEQ ID NO: 9) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 45 or a sequence which is substantially identical thereto (SB6_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 46 or a sequence which is substantially identical thereto (SB6_R). For example, the reagent mixture configured to amplify a region of DNA within the SB6 biomarker comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 45 (SB6_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 46 (SB6_R). In another example, the SB6 reagent mixture comprises amplification primers corresponding to the SB6 biomarker as described in Table 2.

In one example, the SB7 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SB7 biomarker set forth in SEQ ID NO: 10 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 24. For example, the reagent mixture configured to amplify a region of DNA within the SB7 biomarker ( e.g ., the sequence set forth in SEQ ID NO: 10) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 47 or a sequence which is substantially identical thereto (SB7_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 48 or a sequence which is substantially identical thereto (SB7_R). For example, the reagent mixture configured to amplify a region of DNA within the SB7 biomarker comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 47 (SB7_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 48 (SB7_R). In another example, the SB7 reagent mixture comprises amplification primers corresponding to the SB7 biomarker as described in Table 2.

In one example, the SD1 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SD1 biomarker set forth in SEQ ID NO:

11 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 25. For example, the reagent mixture configured to amplify a region of DNA within the SD1 biomarker (e.g., the sequence set forth in SEQ ID NO: 11) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 49 or a sequence which is substantially identical thereto (SD1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 50 or a sequence which is substantially identical thereto (SD1_R). For example, the reagent mixture configured to amplify a region of DNA within the SD1 biomarker comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 49 (SD1_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 50 (SD1_R). In another example, the SD1 reagent mixture comprises amplification primers corresponding to the SD1 bio marker as described in Table 2.

In one example, the SD3 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SD3 biomarker set forth in SEQ ID NO:

12 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 26. For examples, the reagent mixture configured to amplify a region of DNA within the SD3 biomarker (e.g., the sequence set forth in SEQ ID NO: 12) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 51 or a sequence which is substantially identical thereto (SD3_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 52 or a sequence which is substantially identical thereto (SD3_R). For example, the reagent mixture configured to amplify a region of DNA within the SD3 biomarker comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 51 (SD3_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 52 (SD3_R). In another example, the SD3 reagent mixture comprises amplification primers corresponding to the SD3 biomarker as described in Table 2.

In one example, the SD5 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SD5 biomarker set forth in SEQ ID NO:

13 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 27. For example, the reagent mixture configured to amplify a region of DNA within the SD5 biomarker ( e.g ., the sequence set forth in SEQ ID NO: 13) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 53 or a sequence which is substantially identical thereto (SD5_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 54 or a sequence which is substantially identical thereto (SD5_R). For example, the reagent mixture configured to amplify a region of DNA within the SD5 biomarker comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 53 (SD5_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 54 (SD5_R). In another example, the SD5 reagent mixture comprises amplification primers corresponding to the SD5 biomarker as described in Table 2.

In one example, the SD7 reagent mixture comprises amplification primers which are configured to amplify a DNA sequence within the SD7 biomarker set forth in SEQ ID NO:

14 and thereby produce an amplification product comprising or consisting of the sequence set forth in SEQ ID NO: 28. For example, the reagent mixture configured to amplify a region of DNA within the SD7 biomarker (e.g., the sequence set forth in SEQ ID NO: 14) comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 55 or a sequence which is substantially identical thereto (SD7_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 56 or a sequence which is substantially identical thereto (SD7_R). For example, the reagent mixture configured to amplify a region of DNA within the SD7 comprises a forward oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 55 (SD7_F) and a reverse oligonucleotide primer comprising a sequence set forth in SEQ ID NO: 56 (SD7_R).In another example, the SD7 reagent mixture comprises amplification primers corresponding to the SD7 biomarker as described in Table 2.

One or more of the primers in each respective primer set may be detectably labelled in order to facilitate detection of the amplification product. Exemplary detectable labels suitable for use in PCR-based applications are described herein in context of the diagnostic method and shall be taken to apply mutatis mutandis to each and every example describing a test kit comprising a detectably- labelled primer. However, in preferred example, one of the primers in each respective primer set is labelled with a fluorescent label, examples of which are described herein.

Alternatively, where PCR is qPCR (or “real time PCR”), amplification products may be detected by means of a detection probe and the kit may further comprises one or more unique detection probes corresponding to the sequence of the expected amplification products i.e., it is an internal detection probe which hybridizes to the amplification product. For example, each detection probe may comprise a polynucleotide sequence of at least 18 nucleotides in length which is sufficiently complementary to a region of corresponding length within the respective amplification product such that the nucleic acid probe and respective amplification product are hybridisable. In accordance with this embodiment, the detection probe is detectably labelled permitting detection of the amplification product when hybridised thereto. Exemplary detectable labels suitable for use with a detection probe, as well as different probe configurations/designs, are described herein in context of the diagnostic method and shall be taken to apply mutatis mutandis to each and every example describing a test kit comprising a detection probe.

As described herein, each reagent mixture will comprise a DNA polymerase to facilitate DNA amplification. A skilled person will appreciate that there are a number of DNA polymerase enzyme that may be included in the reagent mixture(s). For example, in the case of a PCR-based amplification, a thermostable DNA polymerase derived from a thermophile may be used ( e.g ., Taq polymerase, Pfu polymerase, a Pfx polymerase, Bst polymerase, Tfi polymerase, Tth polymerase etc), including Hot Start and/or high fidelity versions thereof.

In some examples, the or each reagent mixture is stable at ambient temperature. Accordingly, the or each reagent mixtures may comprise one or more buffers or other agents to improve temperature stability.

In some example, the test kit comprises one or more reagents or reagent mixtures for isolating DNA from the sample to be tested.

As discussed herein, the test kit of the disclosure may also comprise one or more positive controls for use in a diagnostic method of the disclosure. For example, the positive control may be an isolated or synthetic Shigella spp. nucleic acid (e.g., DNA) or a fragment thereof which is capable of acting as a template for the nucleic acid amplification assay in the method of the disclosure. When used as a template in the nucleic acid amplification assay alongside sample templates, the positive control can be used to confirm that the nucleic acid amplification assay or assays have worked. For example, the positive control may be purified genomic DNA obtained from one or more Shigella species. In one example, the nucleic acid amplification assay positive control is synthesized (i.e., a synthetic nucleic acid). In one example, the nucleic acid amplification assay positive control is produced by PCR. EXAMPLES

Example 1: Identification of DNA markers for detection of Shigella spp.

Genome sequences from Public database:

Genome sequences in Sequence Reads Archive (SRA) at National Centre for Biotechnology Information (NCBI) public database were used for analysis. De novo assembled contigs of genomes in SRA are readily available in another database for enteric pathogens called Enterobase. The de novo genomes (coverage more than or equal to 40) of Shigella species ( S . sonnei= 9410, S. fl exn e ri = 6399 , S. boydii=766, S. dysenteriae=978 ) were collected from Enterobase in June 2020. These represented the majority of high quality (coverage 40 or more) and geographically diverse Shigella genomes in SRA at the time.

Set of senes:

De novo genomes from Enterobase were annotated using Prokka (version.1.14.1). The .gff format output files from Prokka were inputted to Panaroo (version.1.2.4). A list of combined genes available in all genomes were obtained as Panaroo output.

Similarity searches:

The list of genes obtained using Panaroo was then used as the query using blastn in blast+ (version.2.3.0) to perform similarity searches against de novo Shigella genomes as the database. For each Shigella species, all genes which were present for the respective Shigella species and not in other Shigella species were selected. The genes collected were also checked for their presence in completed Shigella genomes for all four species in Genbank. In this way two markers for S. sonnei, two markers for S. flexneri, seven for S. boydii and four for S. dysenteriae were identified (Fig 1). The markers (i.e., the “ Shigella biomarkers”) are described in Table 3. A significant percentage of known isolates of Shigella species were covered by the markers which were respectively 9274/9410 (98.5%), 6189/ 6399 (96.7%), 920/978 (94.06%) and 713/766 (93.08%). With the exception of two gene markers which were shared by 14 genomes of S. boydii , the markers were mutually exclusive or non overlapping among the genomes.

Table 3. Target sequence differentiating Shigella species

To further validate the test for Shigella genus in silico, the sequence of the ipaH amplicon region i.e. 5

CCTTTTCCGCGTTCCTTGACCGCCTTTCCGATACCGTCTCTGCACGCAATACCTCC GGATTCCG-3 " (SEQ ID NO: 325) was extracted from Genbank accession M32063.1 using primers previously described in Thiem el al (2004), Journal of Clinical Microbiology, 42: 2031-35 and included for analysis in the query list. 97-99.5% of Shigella species showed the presence of ipaH region indicating ipaH as still the best marker for screening Shigella genus. On this basis, ipaH may still be useful when combined with the novel Shigella biomarkers in Table 3, which are capable of differentiating Shigella into its four species.

The Shigella bio marker sequences in Table 3 were then translated along 6 query frames and searched for similarity in genomes using tblastx in blast+ (version.2.3.0). Consistent with the polynucleotide sequences, the translated open reading frames (ORF) for the Shigella biomarkers were also able to assign the 14 groups of Shigella representing the four serologically distinct species as illustrated in Figure 1. This suggests that any protein-based diagnostic test developed using these biomarkers will also be effective for diagnosing Shigella at the genus and species level.

The presence/absence of the Shigella biomarkers was also determined in E. coli genomes sampled from human using blastn p in blast+ (version.2.3.0). Altogether, 12330 genomes were obtained from Enterobase based on the same criteria applied for the Shigella genomes. The Shigella biomarkers were found in the following proportion: SSI (1.6%), SS2 (0.7%), (SF2 (0.1%), SF4 (0.03%), SB1 (0.6%), SB2 (0.01%), SB3 (0.06%), SB4 (0), SB 12 (0), SB6 (0.3%), SB7 (0), SD1 (4.8%), SD3 (0), SD5 (0.01%) and SD7 (0).

The presence/absence of the Shigella biomarkers was also determined in the genomes of organisms other than Shigella using blastn in web BLAST at NCBI. Other than Shigella spp., no other organisms tested possessed the Shigella biomarkers.

The presence/absence of EIEC loci (Dhakal et al, 2018) was also determined in each of the Shigella spp. genomes previously analysed using blastn in blast+ (version.2.3.0). The EIEC loci was negligible in each of the Shigella spp. i.e., S. boydii (0%), S. dysenteriae (1.6%), S. Flexneri (0.03%) and S. sonnei (0%).

To determine whether the Shigella bio markers are also specific to serotypes or group of serotypes within the four Shigella species, serotype data for each of the Shigella genomes was obtained from enterobase and interogated with the various markers. The presence/absence of the markers within each of the respective genomes was determined using blastn in blast+ ( version.2.3.0). Based on this analysis, the results of which are presented in Table 4, it was determined that is is possible to assign serotypes or serotype groups containing one or more serotypes using the Shigella biomarkers. Table 4. Ability of Shigella biomarkers to assign Shigella spp. serotype

Desisn of primers:

Specific primers for all selected loci were designed using Primer BLAST program using the default parameters. Then, the presence of full regions or partial primer amplified regions in the genomes in our collection was checked. Primer sets are presented in Table 1.

Typeable and non-typeable Shigella genomes

Data from the analysis of Shigella genomes are shown in Table 5. Table 5. Genomes having the Shigella biomarker sequences based on specific diagnostic criteria.

pident= percent identity; qcovhsp= query coverage per high scoring pair; more than one criteria was included for the confidence in call; in silico sensitivity means the number of isolates covered by one or more marker(s) divided by total number of isolates of that particular species;

^* all of these isolates were untypeable with respect to the species being analysed;

^# most of these isolates were untypeable with respect to the species being analysed; program for analysis was BLAST+ and e-value criteria was that it should be less than 10 ^-6 .

Also the calculation was made for the count of the marker of one species in the isolates of other three Shigella species divided by total number of isolates of those three species. This value for each marker was always less than 0.7%.

For S. dysenteriae, the Shigella bio markers designated SD1, SD3, SD5 and SD7 (i.e. SEQ ID NOs: 11, 12, 13 and 14 respectively), also collectively referred to herein as the “SD biomarkers”, were present in 372, 347, 161, and 26 genomes respectively. Thus, over 92% of the 978 S. dysenteriae genomes analysed were typeable using these biomarkers. The remainder of the S. dysenteriae genomes were classified as non-typeable using these biomarkers. SSI and SB2 were present in small number of S. dysenteriae genomes, the majority of which were non- typeables, whereas SB1 and SB4 were present only in small number of non-typeable S. dysenteriae genomes. PCR amplicons corresponding to the SD biomarkers {i.e., SEQ ID Nos 25, 26, 27 and 28) contributed to a slightly higher typeability relative to the full length bio markers (i.e. over 94%).

For S. boydii, the Shigella biomarkers designated SB1, SB2, SB3, SB4, SB6, SB7 and SB 12 (i.e. SEQ ID NOs: 4, 5, 6, 7, 9, 10 and 8 respectively), also collectively referred to herein as the “SB Biomarkers”, were identified in 323,124, 68, 67, 47, 43 and 41 S. boydii genomes respectively with 93% of the 766 analysed S. boydii genomes typeable using these biomarkers. SSI, SD1 and SD3 were present in small number of S. boydii genomes which were typeable and SF2 and SD7 were present in small number of S. boydii genomes majority of which were non-typeable. PCR amplicons corresponding to the SB biomarkers (i.e. SEQ ID NOs: 18, 19, 20, 21, 23, 24 and 22) contributed similar typeability.

For S. sonnei, the Shigella biomarker designated SSI and SS2 (i.e. SEQ ID NO: 1 and 332 respectively), also referred to herein as the “SS biomarkers”, were identified in 9171 and 8880 S. sonnei genomes respectively with 97.5% of the S. sonnei genomes typeable using the SSI biomarker and 94.3% of the S. sonnei genomes typeable using the SS2 biomarker. SF2, SF4, SD1, SD5, SD7, SB2 and SB6 were present in small number of S. sonnei genomes, the majority of which were non-typeable. The PCR amplicons corresponding to SS 1 and SS2 (SEQ ID NO: 15 and SEQ ID NO: 332 respectively) contributed to higher typeability (i.e. 98.5% and 95.6% respectively).

For S. flexneri, the Shigella biomarkers designated SF2 and SF4 (i.e. SEQ ID NOs: 2 and 3 respectively), also collectively referred to herein as the “SF biomarkers”, were identified in 5731 and 457 S. flexneri genomes respectively making 96.7% of the analysed genomes typeable using these biomarkers. SD1 and SB6 were present in small number of S. flexneri genomes, all of which were non-typeable. SD5 was present in one typeable S. flexneri genome. SS 1 and SD7 were present in small number of S. flexneri genomes the majority of which were typeable that also bear SF2, except few of them which were non-typeable. PCR amplicons corresponding to the SF biomarkers SF2 and SF4 (SEQ ID Nos: 16 and 17) contributed similar typeablity.

Based on above observations, the inventors propose the biomarker profiles presented in Table 6 for making decisions regarding the presence of, and differentiation between, Shigella species in a sample. Table 6 Biomarker profiles for use in inferring Shigella species.

Example 2: Validation of biomarkers for diagnosing Shigella isolates

Testing in laboratory samples For those cultures which could be obtained from clinical samples, the presence of the

Shigella bio markers in Table 4 was assessed in isolates in Enteric reference lab, CIDM-PH, WSLHD using whole genome sequencing. The isolates assessed could be grouped using ten of the Shigella biomarkers, indicating that these biomarkers are useful for identifying those isolates prevalent in New South Wales, namely SSI, SS2, SF2, SF4, SB1, SB2, SB3, SB4, SD3 and SD5. The number of isolates tested were: S. sonnei (n=537), S.flexneri (n=72), S. boydii (n=8) and S. dysenteriae (n=4). Limited clinical testing was possible for the rest of the Shigella biomarkers since isolates predicted to be identifiable using these biomarkers were unavailable in circulating pool in Australia, probably because of geographical restrictions of isolates.

As shown in Table 7, the Shigella bio markers were effective in identifying Shigella isolates in clinical samples, supporting the findings generated using public genome data in Example 1. Table 7. Ability of Shigella biomarkers to identify Shigella isolates in clinical samples

Testing of markers/primers in spiked stool samples

Shigella negative stool matrix was spiked with a range of dilutions of culture of all species of Shigella. The presence of the Shigella biomarkers in the spiked stool matrix was then determined using either multiplex or uniplex PCR assays. Each PCR assay was performed using one or more primer sets, each designed to amplify a Shigella bio marker (See Table 1) within one of the Shigella species. This was done with the intention of being able to distinguish between biomarker-specific amplicons based on gel band separation and size analysis. The following protocol was used: For a single reaction of each multiplex PCR set, 28 μL master mix was prepared using 10X Hotstar Buffer (QIAGEN) 3 μL, 25 mM MgCh 1.2 μL, HotStar Taq Polymerase (5 units/μL) 0.2 μL (HotStarTaq DNA polymerase, QIAGEN), 25 mM dNTPs 0.24 μL, primers 100 nM (Sigma- Aldrich) each 0.12 μL and the remainder H2O (i.e. to make a 28 μL reaction volume) followed by the addition of 2 μL DNA. The DNA was prepared by spiking >10 ⁷ cells/ml of the respective species of Shigella in 50 μL Shigella negative stool, adding 5 μL casein to reduce the PCR inhibitory effect of bile salts, boiling the sample for five minutes, centrifuging the sample at 16100 g for 3 min and collecting the supernatant therefrom. Following addition of the DNA-containing supernatant, t PCR was performed under the following conditions: 95°C/15 min, 30 cycles of (94°C/30 s, 60°C/30 s, 72°C/45 s), 72°C/10 min, 22°C hold. Once thermocycling was completed, the PCR reactions were electrophoresed on a 2% agarose gel to separate PCR amplicons from other DNA products. The results are presented in Figure 2. Agreement was seen in the result obtained from two separate analysis: gel electrophoresis and genome sequencing. Example 3: Additional amplification primers designed for markers

Additional PCR primers against the Shigella biomarkers were designed using Primer- BLAST tool at NCBI. These are presented in Table 2.