"RECOMBINANT MICROORGANISMS"

FIELD OF THE INVENTION

[0001] This application claims priority to Australian Provisional Application No.

2017903848 entitled "Recombinant microorganisms" filed 21 September 2017 and Australian

Provisional Application No. 2017903865 entitled "Recombinant microorganisms" filed 22 September 2017, the contents of which are incorporated herein by reference in their entirety.

[0002] This invention relates generally to recombinant microorganisms and methods of producing propionate (propionic acid) and 1-propanol. The present invention particularly relates to microorganisms engineered to produce propionate and 1-propanol via a recombinant Wood-

Werkman cycle and methods of using the recombinant microorganisms to produce propionate and 1-propanol from sugars and other substrates.

BACKGROUND OF THE INVENTION

[0003] The biological production of fuels and chemicals is gaining momentum due to the finite nature of fossil-fuel resources and mounting environmental concerns about their continued use [Abbott et al. , FEMS Yeast Res. 9: 1123-1136 (2009) ; Sauer et al., Trends Biotechnol. 26: 100- 108 (2008)]. Currently, ethanol is the major form of biofuel, with 84 billion liters of bioethanol produced in the world in 2011. While both the production capacity and the demand for bioethanol are increasing rapidly, ethanol properties are incompatible with existing fuel infrastructure. Indeed, ethanol's tendency to absorb water poses distribution problems in currently used pipelines and its low energy density (30% lower than gasoline) requires vehicle retrofitting in the fuel system when using high percentage blends with gasoline [Yan, Y. & J. C. Liao, (2009) J Ind Microbiol Biotechnol 36: 471-479].

[0004] These problems with ethanol hinder large-scale replacement of gasoline. As an alternative, production of higher chain alcohol biofuels, fatty acid esters and isoprenoids from renewable sources are of increasing interest because of their high energy densities and their low hygroscopicity, which reduce problems in storage and distribution and allow usage in current engines.

[0005] Propionate is a platform C3 petro-chemical with a variety of industrial applications. Propionate is used as a mould-inhibitor in food-preservatives, as well as an intermediate in the synthesis of various polymers, pharmaceuticals, and herbicides [Ammar et al., Appl. Microbiol. Biotechnol. 98: 7761-7772 (2014)], and is considered by the US Department of Energy as one of the top 30 candidate platform chemicals [Liu et al., Scientific Reports 6: 19963 (2016) ; Werpy and Petersen (2004) Top Value Added Chemicals from Biomass: Volume I - Results of Screening for Potential Candidates from Sugars and Synthesis Gas, p Medium : ED; Size: 76 pp. pages; National Renewable Energy Lab., Golden, CO (US)]. At present, propionate is industrially synthesized by petrochemical processes, predominantly through the Reppe process, which converts ethylene, carbon monoxide and steam into propionate, and the Larson process, which converts ethanol and carbon monoxide into propionate in the presence of boron trifluoride. Other less common synthesis techniques include oxidation of propionaldehyde, the Fischer-Tropsch process and pyrolysis of wood. [0006] 1-Propanol is another important industrial chemical that has been used as a major component of resins and as a carrier and extraction solvent in the pharmaceutical, paint, cosmetic (lotion, soap, and nail polish) and cellulose ester industries. It also has high biofuel potential in terms of combustion efficiency, storage convenience and transportation with an energy density and a flashpoint higher than methanol and ethanol. Importantly, it can be readily dehydrated to produce propylene which is the second largest chemical commodity in the world with production of >70 million tons/ per year.

[0007] Production and uses of 1-propanol are associated with its transformation into compounds such as propionate, iso-propanol, propionaldehyde and tri hydroxy methyl ethane, all of which are important chemical commodities. Hundreds of thousands of tons of 1-propanol are produced by a two-step process requiring the catalytic hydroformylation of ethylene to produce propanal and then catalytic hydrogenation of the 1-propanol. Alternatively, 1-propanol can also be produced as a by-product of fermentation of potatoes, but unlike ethanol and butanol, very few "green" biofermentation processes exist for the production of this very important commodity.

[0008] The biological production of chemicals such as propionate and 1-propanol is highly desirable as a sustainable and environmentally friendly alternative to petroleum refining. The metabolic networks of microorganisms can now be optimized to over-produce a particular chemical/fuel metabolite by manipulating genes and metabolic pathways with the tools of synthetic biology. Microbial production of fuels and chemicals not only utilizes renewable biomass as a feedstock, but also requires lower capital expenditure on production facilities, and results in less toxic waste generation during production [Haynes et al., Nat. Chem. Biol. 10: 331-339 (2014)]. However, biofuel compounds with high fuel-quality are not commonly produced biologically and/or in large enough quantities for fuel applications.

[0009] Propionibacteria are anaerobic native producers of propionate from pyruvate using the Wood-Werkman cycle [Zidwick et al. In The Prokaryotes 2013 (pp. 135-167). Springer Berlin Heidelberg. (2013) ; Gonzalez-Garcia et al. Fermentation 3(21) : l-20 (2017)] through seve enzymatic steps:

1) methylmalonyl-CoA carboxyltransferase, a biotin-dependent enzyme that uses

pyruvate as substrate and turns it into oxaloacetate by transcarboxylation of C0 ₂ from S-methylmalonyl-CoA;

2) malate dehydrogenase, which reduces oxaloacetate to malate;

3) fumarate hydratase, which converts malate into fumarate;

fumarate reductase/succinate dehydrogenase, a membrane-bound enzyme that catalyzes the reduction of fumarate to succinate and is linked to the electron transport chain by the action of the NADH dehydrogenase that couples the electrochemical proton gradient to the synthesis of ATP;

propionyl-CoA:succinate CoA transferase, which performs the transference of CoA fro propionyl-CoA to succinate to form succinyl-CoA, releasing a molecule of propionate; methylmalonyl-CoA mutase, which catalyzes the conversion of succinyl-CoA into R- methylmalonyl-CoA; and

methylmalonyl-CoA epimerase, which is a specific racemase able to isomerase the R- methylmalonyl-CoA enantiomer into the S-enantiomer, S-methylmalonyl-CoA. [0010] In Propionibacterium, 1-propanol has been observed as the by-product of the Wood-Werkman cycle when glycerol is used, which is a more reduced substrate when compared to glucose or sucrose, but with low yields (4% by weight).

[0011] While several strategies have been proposed to improve the performance of Propionibacteria strains for the production of propionate [Gonzalez-Garcia et al., (2017) supra], just a few have been tested in P. jensenii [Liu et al. (2016) supra], as a consequence of limited genetic tools for these organisms. Random mutagenesis for improved phenotypes has also been successful in P. acidipropionici, [Luna-Flores et a/., Biotechnology Journal, 12(2) (2017)]. However, the complexity associated with identifying the modified genes and verification of such mutations by direct mutagenesis remains challenging [Jang et al., Biotechnology Advances 30(5) :989-1000 (2012)].

[0012] As well as a lack of suitable genetic systems for strain engineering, these strains also have several shortcomings, such as long fermentation cycles, and complex and expensive media requirements. In addition, Propionibacterium strains are only able to be grown under anaerobic conditions. The amount of ATP released per mole of glucose oxidized is severely limited under anaerobic glycolysis as compared to aerobic glycolysis. Aerobic glycolysis is up to 15 times more efficient than anaerobic glycolysis (which yields 2 molecules ATP per 1 molecule glucose). In addition, organisms which grow under aerobic conditions demonstrate a higher flux in the tricarboxylic acid (TCA) cycle which results in a greater availability of the precursor substrates required to produce metabolic compounds which rely on the TCA cycle to provide precursor compounds. Aerobic fermentation is thus an attractive option for the large scale production of chemical compounds using biological systems. To date, most of the research on native producers of propionate has focused on traditional strategies, such as random mutagenesis and fermentation process optimization, with only limited research on metabolic engineering.

[0013] Extensive metabolic engineering is normally required to achieve the high metabolite yields necessary for commercial-scale production. These approaches usually entail repeated rounds of trial and error because organisms have evolved complex metabolic networks that facilitate the growth and survival. Engineering metabolic networks to over-produce a single metabolite often conflicts with these phenotypes because an engineered pathway requires the same inputs as native metabolism. For example, an engineered metabolic pathway typically competes with native metabolism for carbon flux, ATP, and redox power.

[0014] Furthermore, the expression of genes in an engineered metabolic cycle, and the flux of carbon through it can be repressed by native and often unknown regulatory mechanisms. Native regulation can operate at the various levels of evolved "regulatory currency' such as transcription (e.g. transcriptional regulator proteins), translation (RNA interference, mRNA degradation, ribosome binding affinity), post-translation (phosphorylation, protein degradation and localization, allosteric metabolite regulation), and via the distal effects of native carbon fluxes in a metabolic network. In addition, many of the microorganisms which are able to be genetically manipulated and which are amenable to large scale industrial fermentation require the presence of oxygen for at least a part of their growth cycle which conflicts with the use of the Wood-Werkman cycle enzymes from Propionibacteria. Engineering biological systems therefore usually proceeds as part of an expensive and time-consuming design-build-test cycle. [0015] There remains a need for alternative biological methods for propionate and 1- propanol production. In particular, there remains a need to develop an engineered biological system for high yield large scale production of 1-propanol and propionate without high downstream processing costs.

SUMMARY OF THE INVENTION

[0016] In an effort to generate a recombinant microorganism that produces propionate and 1-propanol in high yields when grown under aerobic conditions using established large scale cultivation techniques, the present inventors surprisingly discovered that it is possible to do so by genetically modifying a microorganism that does not naturally produce propionate so that it produces all the enzymes involved in the Wood-Werkman cycle, wherein the enzymes include a methyl malonyl-CoA mutase that is not oxygen sensitive. This synthetic 'aerobic-competent' Wood- Werkman cycle has also been introduced in other fermentation microorganisms such as Escherichia coli facilitating the production of propionate and 1-propanol under both aerobic and anaerobic conditions, demonstrating that it is possible to create the Wood-Werkman cycle in microorganisms generally and to produce propionate and 1-propanol under aerobic or anaerobic conditions.

[0017] Accordingly, the present invention provides a recombinant microorganism, which is other than a Propionibacterium, and which produces each of methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase, wherein the methyl malonyl-CoA mutase catalyzes conversion of succinyl-CoA to R-methyl malonyl-CoA under aerobic or anaerobic conditions.

[0018] In a related aspect, the present invention provides a recombinant

microorganism where at least one of the methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase is heterologous to a microorganism from which the recombinant microorganism was derived.

[0019] Suitably, the methyl malonyl-CoA mutase is derived from any microorganism which produces a methyl malonyl-CoA mutase which is able to catalyze conversion of succinyl-CoA to R-methyl malonyl-CoA under aerobic or anaerobic, conditions. In some embodiments the methyl malonyl-CoA mutase is selected from the list of enzymes in Table 8 or an enzyme corresponding thereto. In certain embodiments, the methyl malonyl-CoA mutase is from Saccharopolyspora erythraea or Escherichia coli.

[0020] In some embodiments, the coding sequence for the mutA subunit of the methyl malonyl-CoA mutase comprises the sequence set forth in SEQ ID NO: 6 or SEQ ID NO: 26, and the coding sequence of the mutB subunit comprises the sequence set forth in SEQ ID NO: 5 or SEQ ID NO: 25.

[0021] In some embodiments, the coding sequence for the methyl malonyl-CoA mutase comprises the sequence set forth in SEQ ID NO: 7.

[0022] Suitably the methyl malonyl-CoA epimerase is selected from any one of the enzymes listed in Table 9 or an enzyme corresponding thereto. In some embodiments, the methyl malonyl-CoA epimerase is from Propionibacterium acidipropionici. In certain embodiments, the coding sequence for the methyl malonyl-CoA epimerase comprises the sequence set forth in SEQ ID Nos: 8, 9 or 20. [0023] The methyl malonyl-CoA carboxytransferase may be selected from any one of the enzymes listed in Table 10 or an enzyme corresponding thereto. In some embodiments, the methyl malonyl-CoA carboxytransferase is from Propionibacterium acidipropionici. In some embodiments, the coding sequence for the mtcA subunit of the methyl malonyl-CoA

carboxytransferase comprises the sequence set forth in SEQ ID NO: 10, 11 or 21, the coding sequence for the mutB subunit comprises the sequence set forth in SEQ ID NO: 12, 13 or 22, the coding sequence for the mutC subunit comprises the sequence set forth in SEQ ID NO: 14, and the coding sequence for the mutD subunit comprises the sequence set forth in SEQ ID NO: 15. In specific embodiments, the coding sequence for the mutC and D subunits comprises the sequence set forth in SEQ ID NO: 16 or SEQ ID NO: 23.

[0024] Suitably the propionyl-CoA succinyl-CoA transferase is selected from any one of the enzymes listed in Table 11 or an enzyme corresponding thereto. In some embodiments, the propionyl-CoA succinyl-CoA transferase is from Propionibacterium acidipropionici or from

Escherichia coli. In certain embodiments, the recombinant microorganism produces two propionyl- CoA succinyl-CoA transferase enzymes. In some embodiments, the coding sequence for the propionyl-CoA succinyl-CoA transferase comprises the sequence set forth in SEQ ID NO: 17, 18, 19 or 24.

[0025] Yet another aspect of the present invention provides an expression construct for expressing of one or more of the enzymes of the Wood-Werkman cycle in a microorganism.

Expression constructs include, but are not limited to, plasmids and phage. The expression construct typically comprises a coding sequence for one or more Wood-Werkman cycle enzymes operably linked to an expression control element, representative examples of which include promoters, enhancers, ribosome binding sites, operators, activating sequences, terminators and target sequences such as loxP. Such expression elements may be regulatable, for example via the addition of an inducer. In some embodiments, the expression control element is heterologous to the coding sequence.

[0026] In specific embodiments in which the expression construct is introduced into a yeast (e.g., Saccharomyces), promoters that may be used are suitably selected from TDH3, TEF1, TP11, TEF2 and PGK1 and terminators that my be used are suitably selected from ADH1, CYC1, STE2, MFA1, PH05 and TSynth25.

[0027] In some embodiments, the recombinant microorganism is selected from industrially relevant microorganisms including yeast, bacteria, microalgae or algae, and mold and fungi.

[0028] In some embodiments, the recombinant microorganism is a yeast selected from the genus Saccharomyces, Pichia and Yarrowia (e.g. , Yarrowia lipolytica). In some embodiments, the yeast is selected from Saccharomyces cerevisiae, Saccharomyces arboricolus, Saccharomyces bayanus, Saccharomyces boulardii, Saccharomyces bulderi, Saccharomyces cariocanus,

Saccharomyces cariocus, Saccharomyces chevalieri, Saccharomyces dairenensis, Saccharomyces ellipsoideus, Saccharomyces eubayanus, Saccharomyces exiguus, Saccharomyces florentinus, Saccharomyces fragilis, Saccharomyces kluyveri, Saccharomyces kudriavzevii, Saccharomyces martiniae, Saccharomyces mikatae, Saccharomyces monacensis, Saccharomyces norbensis, Saccharomyces paradoxus, Saccharomyces pastorianus, Saccharomyces spencerorum, Saccharomyces turicensis, Saccharomyces unisporus, Saccharomyces uvarum, and Saccharomyces zonatus, Pichia pastoria, Pichia stipites and Yarrowia lipolytica.

[0029] In some embodiments, the recombinant microorganism is a bacterium. Suitably, the bacterium is an industrially relevant bacterial species is from a genus selected from

Escherichia, Bacillus, Clostridium, Streptomyces and Corynebacterium.

[0030] In some embodiments, the bacterium includes, but not limited to, E. coli, Clostridium acetobutylicum, Clostridium baratii, Clostridium bifermentans, Clostridium botulinum, Clostridium butyricum, Clostridium celerecrescens , Clostridium cellulolyticum, Clostridium clostridioforme, Clostridium difficile, Clostridium drakei, Clostridium fallax, Clostridium ljungdahlii, Clostridium malenominatum, Clostridium perfringens, Clostridium phytofermentans, Clostridium sordelli, Clostridium thermocellum, Clostridium chartatabidum, Bacillis. subtilis, Bacillis licheniformi, Bacillis halodurans and Bacillis megaterium.

[0031] In certain embodiments, the recombinant microorganism is a fungi. Suitably the fungi is an industrially relevant fungal species is from a genus selected from Aspergillus, Rhizopus, Penicillium, Nocardia, Hypomyces, Paecilomyces, Trichoderma, Cephalosporium, Tolypocladium and Cylindrocarpon.

[0032] In some embodiments, the recombinant microorganism is a microalgae or algae. Suitably, the microalgae is an industrially relevant species selected from Chlamydomonas,

Phaeodactylum, Thalassiosira, Cyanidioschyzon, , Ostreococcus , Micromonas, Fragilariopsis, Pseudo-nitzschia, Thalassiosira, Botryococcus, Chlorella, Dunaliella, Micromonas, Galdieria, Porphyra, Volvox, Aureococcus, Chlorella, Haematococcus, Ulva, Nannochloropsis, Navicula, Cylindrotheca, Cyclotella, Laminaria, Undaria, Porphyra, Kappaphycus, Gracilaria,, Porphyridium sp., Amphidinium sp., Symbiodinium and Euglena gracilis.

[0033] In some of the same and other embodiments, the coding sequence of an individual Wood-Werkman enzyme is codon optimized for expression in the particular

microorganism to which it is introduced.

[0034] In a related aspect, the present invention provides a recombinant

microorganism which produces each of methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase, wherein the methyl malonyl-CoA mutase catalyzes conversion of succinyl-CoA to R-methyl malonyl-CoA under aerobic or anaerobic conditions, whereby the genome of the microorganism has been further modified to reduce or inhibit expression of at least one gene encoding a protein involved in a metabolic cycle which uses a carbon source to produce a product other than succinate and/or which uses succinate to produce products which are not propionate and/or 1-propanol, e.g.

byproducts. In some embodiments, the modification reduces or inhibits expression of at least one gene that encodes a protein involved in a metabolic cycle which produces lactate, ethanol and or formate. In an embodiment, the at least one gene is selected from adhE (ethanol), IdhA (lactate), pfIB (formate), or combination thereof.

[0035] In a related aspect, the present invention provides a recombinant

microorganism which produces each of methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase, wherein the methyl malonyl-CoA mutase catalyzes conversion of succinyl-CoA to R-methyl malonyl-CoA under aerobic or anaerobic conditions, whereby the genome of the microorganism has been further modified to overexpress at least one gene encoding a protein involved in increasing the carbon flux through the metabolic cycles involved in pyruvate cycling. In some embodiments, the

overexpression is of a gene involved a metabolic cycle which produces succinate and/or which produces substrates involved in succinate production.

[0036] Another aspect of the present invention provides methods of producing a recombinant microorganism. These methods generally comprise introducing into the genome of a microorganism at least one construct comprising a coding sequence for at least one (e.g., 1, 2, 3 or 4) Wood-Werkman cycle enzyme selected from the group consisting of methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase and methyl malonyl-CoA carboxytransferase, wherein the methyl malonyl-CoA mutase catalyzes conversion of succinyl-CoA to R-methyl malonyl-CoA under aerobic or conditions, whereby introduction of the at least one construct into the genome yields a recombinant microorganism that produces each of the Wood-Werkman cycle enzymes.

[0037] In some embodiments, the at least one construct comprises an expression cassette for each of a plurality of the Wood-Werkman cycle enzyme coding sequences, wherein individual expression cassettes comprise a corresponding coding sequence operably connected to at least one expression control element. In an embodiment, the corresponding coding sequence is operably connected to a promoter and a transcriptional terminator. In another embodiment, a single construct comprises a coding sequence for each of methyl malonyl-CoA mutase, propionyl- CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase, wherein the coding sequence is operably connected to an expression control element that is operable in the microorganism. Suitably, a respective coding sequence is operably connected to a promoter and a transcriptional terminator.

[0038] Yet a further aspect of the present invention provides a method of producing propionate, 1-propanol, or a combination thereof, comprising :

(a) culturing a recombinant microorganism as broadly described above and elsewhere herein under aerobic or anaerobic conditions and in a growth medium that is suitable for growth of the microorganism; and

(b) recovering the propionate, 1-propanol, or a combination thereof produced by the microorganism from the growth medium.

[0039] In some embodiments, the growth medium comprises vitamin B12. In some embodiments, the microorganism is a yeast (e.g., a Saccharomyces) and during step (a) the growth medium is at a pH between about 3.5 to about 6.0. In specific embodiments, during step (a) the growth medium is pH 3.5.

BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 is a schematic representation depicting the synthetic Wood-Werkman cycle enzymes, subunits, and metabolites, and their interaction with native yeast metabolism. The synthetic Wood-Werkman cycle enzymes, genes, metabolites, and reactions are depicted in blue, while native metabolism, and its proposed interaction with the Wood-Werkman cycle is shown in black. Propionibacterium enzyme subunit genes names are in blue, Saccharopolyspora erythraea genes are in red, Escherichia coli genes are in green, and Saccharomyces cerevisiae genes are in black.

[0041] Figure 2 is a schematic representation depicting the synthetic Wood-Werkman cycle genes and regulatory elements. The genes encoding the various proteins that make up the enzymes of the Wood-Werkman cycle are depicted with their promoters, terminators, and flanking LoxPSym sites. The genes were distributed over two commonly used low-copy yeast vectors with auxotrophic uracil (pRS416) and leucine (pRS415) selective markers respectively.

[0042] Figure 3 is a graphical representation depicting anaerobic growth characteristics and fermentation products. Control and ScPAl strains were grown in anaerobic serum bottles and growth measured via absorbance at 600nm (A). Total glucose consumed and extracellular end- point concentrations of organic acids and alcohols (B) were measured. Mean values and error bars representing ± 1 standard deviation from three replicates are shown.

[0043] Figure 4 is a graphical representation depicting aerobic propionate production and fermentation products. Growth curve (A) and total glucose consumption and metabolic products from ScPAl strain aerobic shake-flask fermentations at 0 hours, 11 hours and 32 hours. Mean values and error bars representing ± 1 standard deviation from three replicates are shown.

[0044] Figure 5 is a graphical representation depicting propionate production at different pH-levels. The ScPAl strain was grown aerobically in 96-well microtitre plates, with growth over 48 hours (A-F) (OD600 nm), and propionic acid (G), and ethanol (H) measured at pH values of; 6.0 (A), 5.5 (B), 5.0 (C), 4.5 (D), 4.0 (E), and 3.5 (F) at both 24 and 48 hours. Mean values and error bars representing ± 1 standard deviation from eight replicates are shown.

[0045] Figure 6 is a graphical representation depicting microtiter plate cultivation and propionate production at different biotin and vitamin B ₁₂ concentrations. Strain ScPAl was grown with the indicated concentrations of both vitamins E> _t and B ₁₂ in 96-well microtiter plates.

OD660nm values and specific growth rates (A-F), and end-point extracellular propionic acid concentrations (G) are shown with mean values and error bars representing ± 1 standard deviation from eight replicates, lx concentrations refer to 0.27 mg/L and 10 mg/L for vitamins B12 and Bl respectively.

[0046] Figure 7 is a graphical representation depicting bioreactor-based propionate production from a synthetic Wood-Werkman cycle. ScPAl strain expressing the synthetic Wood- Werkman cycle was grown in bioreactors with pH controlled at either 6.0 or 3.5. A OD600nm, glucose, propionic acid, and 1-propanol. B Succinate, glycerol, acetate and ethanol. Means and standard deviations from duplicate fermentations are shown.

[0047] Figure 8 is a schematic representation of the design of the synthetic operons for the expression of the Wood-Werkman cycle in E. coli. A) Version 1 (VI) of the synthetic design for the heterologous expression of the Wood Werkman cycle. The genes have been distributes in two operons controlled by the T7 promoter. This system can only be expressed in BL21 strain or any strain harbouring T7 polymerase. B) Version 2 of the synthetic design for the heterologous expression of the Wood Werkman cycle. All genes are contained in a single operon controlled by a promoter. DETAILED DESCRIPTION OF THE INVENTION

1. Definitions

[0048] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below.

[0049] The articles "a" and "an" are used herein to refer to one or to more than one (i.e. , to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. Thus, for example, reference to a "microorganism" includes reference to one or more microorganisms, and so forth.

[0050] As used herein "and/or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).

[0051] As used herein, the term "about" or "approximately" usually means within an acceptable error range for the type of value and method of measurement. For example, it can mean within 20%, more preferably within 10%, and most preferably still within 5% of a given value or range. Alternatively, especially in biological systems, the term "about" means within about a log {i.e., an order of magnitude) preferably within a factor of two of a given value.

[0052] An "anaerobic microorganism" as used herein includes both a "facultative anaerobic microorganism" which makes ATP by aerobic respiration if oxygen is present, and which is capable of switching to fermentation or anaerobic respiration if oxygen is absent, and an "obligate anaerobe" which cannot make ATP and is unviable in the presence of oxygen.

[0053] "Anaerobic conditions" are defined as conditions under which the oxygen concentration in the fermentation medium is too low for the microorganism to use as a terminal electron acceptor. "Anaerobic conditions" are further defined as conditions under which no or small amounts of oxygen are added to the medium at rates of <3 mmol/L/h, preferably <2.5 mmol/L/h, more preferably <2 mmol/L/h and most preferably < 1.5 mmol/L/h. "Anaerobic conditions" means in particular completely oxygen-free (=0 mmol/L/h oxygen) or with small amounts of oxygen added to the medium at rates of e.g. <0.5 to < 1 mmol/L/h. "Anaerobic metabolism" refers to a biochemical process in which oxygen is not the final acceptor of electrons contained in NADH. Anaerobic metabolism can be divided into anaerobic respiration, in which compounds other than oxygen serve as the terminal electron acceptor, and substrate level phosphorylation, in which the electrons from NADH are utilized to generate a reduced product via a fermentative pathway.

[0054] An "aerobic microorganism" as used herein is a microorganism that makes ATP by aerobic respiration and which can survive and grow in an oxygenated environment. This term also includes within its scope "facultative anaerobic microorganisms" which are typically considered anaerobic but which can switch to aerobic respiration if oxygen is present, as well as "strictly aerobic microorganisms" which cannot grow in the absence of oxygen.

[0055] "Aerobic conditions" are defined as conditions under which the oxygen concentration in the fermentation medium is sufficiently high for an aerobic microorganism to use as a terminal electron acceptor. "Aerobic metabolism" refers to the biochemical process in which oxygen is used as a terminal electron acceptor to make energy, typically in the form of ATP, from carbohydrates. Aerobic metabolism occurs e.g. via glycolysis and the TCA cycle, wherein a single glucose molecule is metabolized completely into carbon dioxide in the presence of oxygen.

[0056] "Bacteria" as used herein refer to any of a member of the domain of prokaryotic organisms which are suitably able to grow under aerobic conditions. In specifc embodiments, the bacteria contemplated herein are industrially relevant. Exemplary bacterial microorganisms contemplated herein but are not limited to bacteria from the genus Escherichia, Bacillus,

Clostridium , Streptomyces, Corynebacterium, Proteus, Serratia, Pseudomonas, Acromobacter, Corynebacterium, Micrococcus, Blevibacterium and Acetobacter.

[0057] A "bioreactor" refers to any device or system that supports a biologically active environment. As described herein a bioreactor is a vessel in which microorganisms including yeast and bacteria can be grown.

[0058] The term "byproduct" as used herein means an undesired product related to the production of a biofuel. Byproducts are generally disposed as waste, adding cost to a biofuel process. The term "co-product" means a secondary or incidental product related to the production of biofuel. Co-products have potential commercial value that increases the overall value of biofuel production, and may be the deciding factor as to the viability of a particular biofuel production process.

[0059] The term "carbon source" generally refers to a substrate or compound suitable for sustaining microorganism growth. Carbon sources may be in various forms, including, but not limited to polymers, carbohydrates, alcohols, acids, aldehydes, ketones, amino acids, peptides, etc. For example, these may include monosaccharides (such as glucose, fructose, and xylose), oligosaccharides (i.e. sucrose, lactose), polysaccharides (i.e. starch, cellulose, hemicellulose), lignocellulosic materials, fatty acids, succinate, lactate, acetate, glycerol, etc. or a mixture thereof. The carbon source may be a product of photosynthesis, such as glucose or cellulose.

Monosaccharides used as carbon sources may be the product of hydrolysis of polysaccharides, such as acid or enzymatic hydrolysates of cellulose, starch and pectin. The term "energy source" may be used here interchangeably with carbon source since in chemoorganotrophic metabolism the carbon source is used both as an electron donor during catabolism and as a carbon source during cell growth.

[0060] By "coding sequence" is meant any nucleic acid sequence that contributes to the code for the polypeptide product of a gene or for the final mRNA product of a gene (e.g. the mRNA product of a gene following splicing). By contrast, the term "non-coding sequence" refers to any nucleic acid sequence that does not contribute to the code for the polypeptide product of a gene or for the final mRNA product of a gene.

[0061] Throughout this specification, unless the context requires otherwise, the words "comprise," "comprises" and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. Thus, use of the term "comprising" and the like indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present. [0062] The term "codon optimization" refers to a process of modifying a nucleic acid sequence for enhanced expression in a host cell of interest by replacing at least one codon {e.g. , about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons for a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis.

Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the "Codon Usage

Database" available at www.kazusa.orjp/codon/ and these tables can be adapted in a number of ways. See Nakamura, Y., et al. "Codon usage tabulated from the international DNA sequence databases: status for the year 2000" Nucl. Acids Res. 28: 292 (2000). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.). In some embodiments, one or more codons (e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in a sequence encoding a Wood-Werkman cycle enzyme correspond to the most frequently used codon for a particular amino acid.

[0063] As used herein, the term "construct" and "synthetic construct" are used interchangeably to refer to heterologous nucleic acid sequences that are operably connected to each other and may include sequences providing the expression of a polynucleotide in a host cell, and optionally sequences that provide for expression of the construct.

[0064] By "corresponds to" or "corresponding to" is meant an amino acid sequence that displays substantial sequence similarity or identity to a reference amino acid sequence. In general the amino acid sequence will display at least about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence similarity or identity to at least a portion, and suitably over the entire length, of the reference amino acid sequence.

[0065] The term "corresponding enzyme" refers to enzymes that are related to one another in function only and are not from common descent or do not share a common ancestral sequence. Corresponding enzymes may differ in sequence but may share a similar structure, due to convergent evolution. For example, two enzymes are corresponding if the enzymes catalyze the same reaction of conversion of a substrate to a product, are unrelated in sequence, and irrespective of whether the two enzymes are related in structure. It will be understood that reference to a corresponding enzyme also includes enzyme variants.

[0066] As used herein, "culturing", "culture" and the like refer to the set of procedures used in vitro where a population of cells (or a single cell) is incubated under conditions which have been shown to support the growth or maintenance of the cells in vitro. The art recognizes a wide number of formats, media, temperature ranges, gas concentrations etc. which need to be defined in a culture system. The parameters will vary based on the format selected and the specific needs of the individual who practices the methods herein disclosed. However, it is recognized that the determination of culture parameters is routine in nature. [0067] As used herein, the terms "encode", "encoding" and the like refer to the capacity of a nucleic acid to provide for another nucleic acid or a polypeptide. For example, a nucleic acid sequence is said to "encode" a polypeptide if it can be transcribed and/or translated to produce the polypeptide or if it can be processed into a form that can be transcribed and/or translated to produce the polypeptide. Such a nucleic acid sequence may include a coding sequence or both a coding sequence and a non-coding sequence. Thus, the terms "encode", "encoding" and the like include a RNA product resulting from transcription of a DNA molecule, a protein resulting from translation of a RNA molecule, a protein resulting from transcription of a DNA molecule to form a RNA product and the subsequent translation of the RNA product, or a protein resulting from transcription of a DNA molecule to provide a RNA product, processing of the RNA product to provide a processed RNA product (e.g. , mRNA) and the subsequent translation of the processed RNA product.

[0068] The term "enzyme" as used herein refers to any substance that catalyzes or promotes one or more chemical or biochemical reactions, which usually includes enzymes totally or partially composed of a polypeptide, but can include enzymes composed of a different molecule including polynucleotides.

[0069] As used herein, "exogenous" with respect to a nucleic acid or gene encoding a protein indicates that the nucleic or gene has been introduced ("transformed") into a

microorganism, or cell by human intervention. Typically, such an exogenous nucleic acid is introduced into a cell or microorganism via a recombinant nucleic acid construct. An exogenous nucleic acid can be a sequence from one species introduced into another species, e.g. , a heterologous nucleic acid. An exogenous nucleic acid can also be a sequence that corresponds to an endogenous sequence of an organism (e.g., a nucleic acid sequence that occurs naturally in that organism or encodes a polypeptide that occurs naturally in that organism) that has been isolated and subsequently reintroduced into the organism. An exogenous nucleic acid that includes such a corresponding sequence can often be distinguished from the naturally-occurring sequence by the presence of non-natural sequences linked to the corresponding sequence, e.g. , non-native expression control element in operable connection with the corresponding sequence in a recombinant nucleic acid construct. Alternatively or in addition, a stably transformed exogenous nucleic acid can be detected and/or distinguished from a native gene by its juxtaposition to sequences in the genome where it has integrated. Further, a nucleic acid is considered exogenous if it has been introduced into a progenitor of the cell, organism, or strain under consideration.

[0070] The term "expression" and its grammatical equivalents, in the context of a gene sequence, refer to transcription of the gene to produce a RNA transcript (e.g., mRNA, antisense RNA, siRNA, shRNA, miRNA, etc.) and, as appropriate, translation of a resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a coding sequence results from transcription and translation of the coding sequence. Conversely, expression of a non-coding sequence results from the transcription of the non-coding sequence.

[0071] The term "expression cassette" as used herein, refers to a nucleic acid construct that encodes a single protein or functional RNA operably connected to expression control elements, such as but not limited to a promoter, and optionally, any or a combination of other nucleic acid sequences that affect the transcription or translation of the gene, such as, but not limited to, a transcriptional terminator, a ribosome binding site, a splice site or splicing recognition sequence, an intron, an enhancer, a polyadenylation signal, an internal ribosome entry site, or a

recombination site such as a LoxPSym recombination site.

[0072] "Expression constructs" of the present invention will generally include the necessary elements to direct expression of one or more nucleic acid sequences of interest that are also contained in the construct, such as, for example, a coding sequence for a Wood-Werkman cycle enzyme. Such expression elements may include control elements such as a promoter that is operably connected to (so as to direct transcription of) the nucleic acid sequence of interest, and often includes a polyadenylation sequence as well. An expression construct may include one or more "expression cassettes" as defined herein. Within certain embodiments of the invention, the construct may be contained within a vector. In addition to the components of the construct, the vector may include, for example, one or more selectable markers, one or more origins of replication, such as prokaryotic and eukaryotic origins, at least one multiple cloning site, and/or elements to facilitate stable integration of the construct into the genome of a host cell. An

"expression construct" generally includes at least a transcriptional control sequence operably connected to a nucleotide sequence of interest. In this manner, for example, promoters in operable connection with the nucleotide sequences to be expressed are provided in expression constructs for expression in a host cell of a microorganism. For the practice of the present invention, conventional compositions and methods for preparing and using constructs and host cells are well known to one skilled in the art, see for example, Molecular Cloning : A Laboratory Manual, 3rd edition Volumes 1, 2, and 3. J . F. Sambrook, D. W. Russell, and N . Irwin, Cold Spring Harbor Laboratory Press, 2000. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. In the present case, the construct is preferably a vector, which is operably functional in yeast and/or bacterial cells. Such a vector may be derived from yeast, plasmids, bacteriophages (such as phage λ), cosmids, and bacterial artificial chromosomes (BACs). The vector can also include a selection marker such as an antibiotic resistance gene that can be used for selection of suitable transformants. Examples of such resistance genes are known to those of skill in the art and include the nptll gene that confers resistance to the antibiotics kanamycin and G418 (Geneticin®), the hph gene which confers resistance to the antibiotic hygromycin B, and Beta-lactamase which confers ampicillin resistance to bacterial hosts.

[0073] As used herein, an "expression control element" refers to an element which affects expression of a coding sequences to which they are operatively connected. Expression control elements are typically sequences that control transcription (generally referred to as "transcriptional control sequences"), post-transcriptional events or translation of nucleic acid sequences. Expression control elements may be located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence, either directly or indirectly. Representative expression control elements include transcription initiation, termination, promoter and enhancer sequences; RNA processing signals such as splicing and polyadenylation signals; intron sequences, repetitive extragenic palindrome (REP) recognition element sequences, intergenic region sequences, sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., ribosome binding sites) ; sequences that enhance protein stability; and when desired, sequences that enhance protein secretion. The nature of such expression control elements differs depending upon the host organism; in prokaryotes, such control elements generally include promoter, ribosomal binding site, and transcription termination sequence. The term "expression control element" is intended to encompass, at a minimum, any component whose presence is essential or desired for expression of a coding sequence, and can also encompass an additional component whose presence is advantageous, for example, leader sequences and fusion partner sequences.

[0074] The term "fermentation microorganism" as used herein refers to a

microorganism which produces energy by the degradation of a carbon source anaerobically. Since facultative anaerobic microorganisms can grow either in the presence or absence of oxygen, the term "fermentation microorganism" also includes microorganisms which can produce energy by aerobic or anaerobic degradation of a carbon source..

[0075] As used herein, the term "gene" is used broadly to refer to any segment of nucleic acid molecule that encodes a protein or that can be transcribed into a functional RNA. Genes may include sequences that are transcribed but are not part of a final, mature, and/or functional RNA transcript, and genes that encode proteins may further comprise sequences that are transcribed but not translated, for example, 5' untranslated regions, 3' untranslated regions, introns, etc. Further, genes may optionally further comprise regulatory sequences required for their expression, and such sequences may be, for example, sequences that are not transcribed or translated. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.

[0076] As used herein, the term "gene disruption," or grammatical equivalents thereof

(and including "to disrupt enzymatic function," "disruption of enzymatic function," and the like), is intended to mean a genomic modification to a microorganism that renders an encoded gene product as having a reduced polypeptide activity compared with polypeptide activity in or from a microorganism cell not so modified. The genomic modification can be, for example, deletion of the entire gene, deletion or other modification of a regulatory sequence required for transcription or translation, deletion of a portion of the gene which results in a truncated gene product (e.g. , enzyme) or by any of various mutation strategies that reduces activity (including to no detectable activity level) the encoded gene product. A disruption may broadly include a deletion of all or part of the nucleic acid sequence encoding the enzyme, and also includes, but is not limited to other types of genomic modifications, e.g., introduction of stop codons, frame shift mutations, introduction or removal of portions of the gene, and introduction of a degradation signal, those genomic modifications affecting mRNA transcription levels and/or stability, and altering the promoter or repressor upstream of the gene encoding the enzyme.

[0077] "Genome" as used herein includes the DNA comprising the genes (the coding nucleic acid sequences) and the noncoding nucleic acid sequences of a microorganism, and therefore includes introduction of the nucleic acid into, for example, the coding and noncoding DNA of the microorganism.

[0078] The term "growth " as used herein in relation to the culturing of a

microorganism refers to the lag, exponential and stationary phases of the growth cycle of a microorganism when grown in cell culture.

[0079] The term "heterologous" as used herein with reference to molecules and in particular enzymes and polynucleotides, indicates molecules that are expressed in a microorganism other than the microorganism from which they originated or are found in nature. On the other hand, the term "native" or "endogenous" as used herein with reference to molecules, and in particular enzymes and polynucleotides, indicates molecules that are expressed in the organism in which they originated or are found in nature. The level of expression of both heterologous and endogenous molecules can be lower equal or higher than the level of expression of the molecule in the native microorganism. It is understood that expression of native enzymes or polynucleotides may be modified in recombinant microorganisms.

[0080] A protein has "identity" or "similarity" to a second protein if the nucleic acid sequence that encodes the protein has a similar sequence to the nucleic acid sequence that encodes the second protein. Alternatively, a protein has "identity" or "similarity" to a second protein if the two proteins have "similar" amino acid sequences.

[0081] As used herein, the term "industrially relevant microorganisms" refers to any microorganism which is capable of producing a desired product, e.g. propionate and/or 1-propanol in mass quantities.

[0082] The term "host cell" includes an individual cell or cell culture which can be or has been a recipient of any recombinant constructs or isolated polynucleotide of the invention. Host cells include progeny of a single host cell, and the progeny may not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change. A host cell includes cells transfected or infected in vivo or in vitro with a recombinant construct or a polynucleotide of the invention. A host cell which comprises a recombinant construct of the invention is a recombinant host cell of a microorganism

[0083] The term "isolated" molecule, such as an isolated nucleic acid or protein, as used herein, refers to a biomolecule removed from the context in which the biomolecule exists in nature. An isolated biomolecule can be, in some instances, partially or substantially purified. The term "substantially purified", as used herein, refers to a biomolecule separated from substantially all other molecules normally associated with it in its native state. More preferably a substantially purified molecule is the predominant species present in a preparation that is, or results, however indirect, from human manipulation of a polynucleotide or polypeptide. A substantially purified molecule may be greater than 60% free, preferably 75% free, preferably 80% free, more preferably 85% free, more preferably 90% free, and most preferably 95% free from the other molecules (exclusive of solvent) present in the natural mixture. Thus, an "isolated" nucleic acid preferably is free of sequences that naturally flank the nucleic acid (that is, the sequences naturally located at the 5' and 3' ends of the nucleic acid) in the cell of the organism from which the nucleic acid is derived.

[0084] The term "metabolic cycle", "metabolic pathway", "biosynthetic pathway" and the like, refers to a set of anabolic and/or catabolic biochemical reactions for converting one chemical species into another. Gene products {e.g. enzymes) belong to the same "metabolic cycle" if they, in parallel or in series, act on the same substrate, produce the same product, or act on or produce a metabolic intermediate (i.e. , metabolite) between the same substrate and metabolite end product.

[0085] Microorganisms disclosed herein result from genomic modification to produce metabolites in quantities not available in the parental microorganism. A "metabolite" refers to any substance produced by metabolism or a substance necessary for or taking part in a particular metabolic process. A metabolite can be an organic compound that is a starting material {e.g., glucose or pyruvate), an intermediate (e.g., succinate or acetyl-coA) in, or an end product (e.g. , propionate or 1-propanol) of metabolism. Metabolites can be used to construct more complex molecules, or they can be broken down into simpler ones. Intermediate metabolites may be synthesized from other metabolites, perhaps used to make more complex substances, or broken down into simpler compounds, often with the release of chemical energy.

[0086] The term "microorganism" includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eukarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. The terms "microbial cells" and "microbes" are used interchangeably with the term microorganism.

[0087] The term "mutation" as used herein indicates any modification of a nucleic acid which results in an altered nucleic acid or polypeptide. Mutations include, for example, point mutations, deletions, or insertions of single or multiple nucleotides in a polynucleotide, which includes alterations arising within a protein-encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences. A genomic alteration may be a mutation of any type. For instance, the mutation may constitute a point mutation, a frame-shift mutation, an insertion, or a deletion of part or all of a gene. In addition, in some embodiments of the recombinant microorganism, a portion of the microorganism genome has been replaced with a heterologous polynucleotide. In some embodiments, the mutations are naturally-occurring. In other embodiments, the mutations are the results of artificial mutation pressure. In still other embodiments, the mutations in the

microorganism genome are the result of genomic engineering.

[0088] As used herein the term "operably connected", "operably linked" and the like refer to a functional linkage between two or more sequences. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (for example, a promoter) is a functional link that allows for expression of the polynucleotide of interest. In this sense, the term "operably connected " refers to the positioning of a regulatory region and a coding sequence to be transcribed so that the regulatory region is effective for regulating transcription or translation of the coding sequence of interest. In some embodiments disclosed herein, the term "operably connected" denotes a configuration in which an expression control element is placed at an appropriate position relative to a sequence that encodes a polypeptide or functional RNA such that the control element directs or regulates the expression or cellular localization of the mRNA encoding the polypeptide, the polypeptide, and/or the functional RNA. Thus, a promoter is in operable connection with a nucleic acid sequence if it can mediate transcription of the nucleic acid sequence. Operably connected elements may be contiguous or non-contiguous. Further, when used to refer to the joining of two protein coding regions, by "operably connected" is intended that the coding regions are in the same reading frame.

[0089] The term "operon" refers two or more genes which are transcribed as a single transcriptional unit from a common promoter. In some embodiments, the genes comprising the operon are contiguous genes. It is understood that transcription of an entire operon can be modified {i.e., increased, decreased, or eliminated) by modifying the common promoter.

Alternatively, any gene or combination of genes in an operon can be modified to alter the function or activity of the encoded polypeptide. The modification can result in an increase in the activity of the encoded polypeptide. Further, the modification can impart new activities on the encoded polypeptide. Exemplary new activities include the use of alternative substrates and/or the ability to function in alternative environmental conditions.

[0090] The terms "overexpress," "overexpression," or "overexpressed" interchangeably refer to a gene {e.g., a Wood-Werkman cycle enzyme gene) that is transcribed or translated at a detectably greater level, in comparison to a control cell (e.g., a cell that does not express the gene, or expresses the gene at a lower level). Overexpression therefore refers to both overexpression of protein and RNA (due to increased transcription, post transcriptional processing, translation, post translational processing, altered stability, and altered protein degradation), as well as local overexpression due to altered protein traffic patterns (increased nuclear localization), and augmented functional activity, e.g., as in an increased enzyme conversion of substrate.

Overexpression can also be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a control cell (e.g., a cell that does not express the gene, or expresses the gene at a lower level).

[0091] A "parental microorganism", "control microorganism" or "control cell", or as used herein, refers to a microorganism, or cell that is substantially identical to the subject

microorganism, or cell, except for the engineered genomic manipulation disclosed for the subject microorganism, or cell, and can provide a reference point for measuring changes in phenotype of the subject organism or cell. "Substantially identical" thus includes, for example, small random variations in genome sequence ("SNPs") that are not relevant to the genotype, phenotype, parameter, or gene expression level that is of interest in the subject microorganism. Depending on specific purposes of their use, a parental microorganism, cell or control microorganism may comprise, for example, (a) a progenitor strain or species, cell or microorganism population, with respect to the subject microorganism, or cell, where the progenitor lacks the genomically engineered constructs or alterations that were introduced into the progenitor strain, species, microorganism, or cell or microorganism population to generate the subject microorganism, or cell; b) a wild-type microorganism or cell, e.g., of the same genotype as the starting material for the genomic alteration which resulted in the subject microorganism or cell ; (c) a microorganism or cell of the same genotype as the starting material but which has been transformed with a null construct (e.g., a construct which has no known effect on the trait of interest, such as a construct comprising a reporter gene) ; (d) a microorganism or cell which is a non-transformed segregant among progeny of a subject microorganism, or cell ; or (e) the subject microorganism or cell itself, under conditions in which the gene of interest is not expressed. In some instances, "parental

microorganism" may refer to a microorganism that does not contain the exogenous nucleic acid present in the transgenic microorganism of interest, but otherwise has the same or very similar genomic background as such a transgenic microorganism.

[0092] The terms "promoter", "promoter region", or "promoter sequence", as used interchangeably herein, refer to a nucleic acid sequence capable of binding RNA polymerase to initiate transcription of a gene in a 5' to 3' ("downstream") direction. The specific sequence of the promoter typically determines the strength of the promoter. For example, a strong promoter leads to a high rate of transcription initiation. A gene is "under the control of" or "regulated by" a promoter when the binding of RNA polymerase to the promoter is the proximate cause of said gene's transcription. The promoter or promoter region typically provides a recognition site for RNA polymerase and other factors necessary for proper initiation of transcription. A promoter may be isolated from the 5' untranslated region (5' UTR) of a genomic copy of a gene. Alternatively, a promoter may be synthetically produced or designed by altering known DNA elements. Also considered are chimeric promoters that combine sequences of one promoter with sequences of another promoter. Promoters may be defined by their expression pattern based on, for example, metabolic, environmental, or developmental conditions. Some embodiments relate to promoters capable of driving gene expression preferentially in different microbial growth phases. Some embodiments of the present disclosure relate to promoters capable of driving gene expression constitutively throughout cell life cycle and/or unaffected by growth conditions, as well as at low, moderate, high, or very high transcription levels. A promoter can be used as a regulatory element for modulating expression of an operably connected polynucleotide molecule such as, for example, a coding sequence of a polypeptide or a functional RNA sequence. Promoters may contain, in addition to sequences recognized by RNA polymerase and, preferably, other transcription factors, regulatory sequence elements such as cis-elements or enhancer domains that affect the transcription of operably connected genes.

[0093] "Propionate" as used herein is the salt or ester of propionate. However, it should be understood that the terms "propionate", "propionic acid" or "propanoate" as used herein are used interchangeably to refer to a propionate metabolite produced by the Wood-Werkman cycle.

[0094] The term "polynucleotide" or "nucleic acid" as used herein designates mRNA, RNA, cRNA, cDNA or DNA. The term typically refers to polymeric forms of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA.

[0095] "Polypeptide", "peptide", "protein" and "proteinaceous molecule" are used interchangeably herein to refer to molecules comprising or consisting of a polymer of amino acid residues and to variants and synthetic analogues of the same. Thus, these terms apply to amino acid polymers in which one or more amino acid residues are synthetic non-naturally occurring amino acids, such as a chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally-occurring amino acid polymers.

[0096] Reference to 1-propanol as used herein refers to the primary alcohol with the formula CH ₃ CH ₂ CH ₂ OH (InChI Key, BDERNN FJNOPAEC-UHFFFAOYSA-N). It should be understood that the term also includes propanol, n-propanol, propan-l-ol, propyl alcohol, n-propyl alcohol, propyl alcohol, propylol, ethyl methanol, ethylcarbinol, 1-hydroxypropane, propionic alcohol, propionyl alcohol, and propionylol.

[0097] As used herein, "recombinant" may refer to a biomolecule, e.g., a gene or protein, or to a microorganism. The term "recombinant" may be used in reference to cloned DNA isolates, chemically synthesized polynucleotides, or polynucleotides that are biologically synthesized by heterologous systems, as well as proteins or polypeptides encoded by such nucleic acids, e.g. enzymes. A "recombinant" nucleic acid is a nucleic acid linked to a nucleotide or polynucleotide to which it is not linked in nature. For example, the recombinant polynucleotide may be in the form of an expression vector. Generally, such expression vectors include transcriptional and translational regulatory nucleic acid operably linked to the nucleotide sequence. A

"recombinant" protein or polypeptide may be (1 ) a protein or polypeptide linked to an amino acid or polypeptide to which it is not linked in nature; and/or (2) a protein or polypeptide made by transcription and/or translation of a recombinant nucleic acid. Thus, a protein synthesized by a bacteria is recombinant, for example, if it is synthesized from an mRNA synthesized from a recombinant nucleic acid present in the cell.

[0098] The terms "recombinant microorganism", "modified microorganism" and

"recombinant host cell" as used herein refers to inserting, expressing or overexpressing

endogenous polynucleotides, by expressing or overexpressing heterologous polynucleotides, such as those included in a vector, by introducing a mutations into the microorganism or by altering the expression of an endogenous gene. The polynucleotide generally encodes a target enzyme involved in a metabolic pathway for producing a desired metabolite. It is understood that the terms

"recombinant microorganism" and "recombinant host cell" refer not only to the particular recombinant microorganism but to the progeny or potential progeny of such a microorganism. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

[0099] The term "sequence identity" as used herein refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. , A, T, C, G, I) or the identical amino acid residue (e.g. , Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison {i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, "sequence identity" will be understood to mean the "match percentage" calculated by an appropriate method. For example, sequence identity analysis may be carried out using the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software.

[0100] "Similarity" refers to the percentage number of amino acids that are identical or constitute conservative substitutions as defined in Table A.

TABLE A

Met Leu, He,

Phe Met, Leu, Tyr

Ser Thr

Thr Ser

Trp Tyr

Tyr Trp, Phe

Val He, Leu

[0101] Similarity may be determined using sequence comparison programs such as GAP (Deveraux et al. 1984, Nucleic Acids Research 12, 387-395). In this way, sequences of a similar or substantially different length to those cited herein might be compared by insertion of gaps into the alignment, such gaps being determined, for example, by the comparison algorithm used by GAP.

[0102] Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include "reference sequence", "comparison window", "sequence identity", "percentage of sequence identity" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise (1) a sequence (i.e. , only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150 in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. The comparison window may comprise additions or deletions (i.e. , gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, WI, USA) or by inspection and the best alignment (i.e. , resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., 1997, Nucl. Acids Res.

25: 3389. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al., "Current Protocols in Molecular Biology," John Wiley & Sons Inc., 1994-1998, Chapter 15.

[0103] The term "species" is defined as a collection of closely related organisms with greater than 97% 16S ribosomal RNA sequence homology and greater than 70% genomic hybridization and sufficiently different from all other organisms so as to be recognized as a distinct unit. Species and other phylogenic identifications are according to the classification known to a person skilled in the art of microbiology.

[0104] The term "specific productivity" is defined as the rate of formation of a product. To describe productivity as an inherent parameter of the microorganism or microorganism and not of the fermentation process, productivity is herein further defined as the specific productivity in gram of product per unit of cells, the unit of cells typically measured spectroscopically as absorbance units at 600 nm (OD600 or OD) per hour (g/l_/h/OD).

[0105] The term "substrate" or "suitable substrate" refers to any substance or compound that is converted or meant to be converted into another compound by the action of an enzyme. The term includes not only a single compound, but also combinations of compounds, such as solutions, mixtures and other materials which contain at least one substrate, or derivatives thereof. Further, the term "substrate" encompasses not only compounds that provide a carbon source suitable for use as a starting material, such as any biomass derived sugar, but also intermediate and end product metabolites used in a pathway associated with a recombinant microorganism as described herein. A "biomass derived sugar" includes, but is not limited to, molecules such as glucose, sucrose, mannose, xylose, and arabinose. The term biomass derived sugar encompasses suitable carbon substrates ordinarily used by microorganisms, such as 6 carbon sugars, including, but not limited to, glucose, lactose, sorbose, fructose, idose, galactose and mannose in either D or L form, or a combination of 6 carbon sugars, such as glucose and fructose, and/or 6 carbon sugar acids including, but not limited to, 2-keto-L-gulonic acid, idonic acid (IA), gluconic acid (GA), 6-phosphogluconate, 2-keto-D-gluconic acid (2 KDG), 5-keto-D- gluconic acid, 2-ketogluconatephosphate, 2,5-diketo-L-gulonic acid, 2,3-L-diketogulonic acid, dehydroascorbic acid, erythorbic acid (EA) and D-mannonic acid.

[0106] The term "terminator" or "terminator sequence" or "transcription terminator" or the like, as used herein, refers to a regulatory section of genetic sequence that causes RNA polymerase to cease transcription.

[0107] The term "titre" or "titer" is defined as the strength of a solution or the concentration of a substance in solution. For example, as used herein the titre of a biofuel in a fermentation broth or cell culture media is described as g of biofuel in solution per liter of fermentation broth or cell culture media (g/L).

[0108] The term "total titer" is defined as the sum of all of a product produced in a metabolic process, including but not limited to the product in solution, the product in gas phase, and any product removed from the process and recovered relative to the initial volume in the process or the operating volume in the process.

[0109] The term "transformation", "transfection", and "transduction", as used interchangeably herein, refers to the introduction of one or more exogenous nucleic acid sequences into a host cell or microorganism by using one or more physical, chemical, or biological methods. Transfection, transduction or transformation can be achieved by any one of a number of means including electroporation, microinjection, gene gun delivery, retroviral infection, lipofection, superfection and the like. The choice of method is generally dependent on the type of cell being transformed and the circumstances under which the transformation is taking place {i.e. in vitro, ex viva, or in vivo). A general discussion of these methods can be found in Ausubel, et al, Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons, 1995.

[0110] The term "variants" used with respect to an original enzyme or gene of a first family or species refers to distinct enzymes or genes of a second family or species which are determined by functional, structural or genomic analyses to be an enzyme or gene of the second family or species which corresponds to the original enzyme or gene of the first family or species. Most often, variants will have functional, structural or genomic similarities. Techniques are known by which variants of an enzyme or gene can readily be cloned using genetic probes and PCR.

Identity of cloned sequences as homolog can be confirmed using functional assays and/or by genomic mapping of the genes. Typically, variants will have substantial sequence identity or similarity to a reference polynucleotide or polypeptide. Accordingly, "polynucleotide variants" include within their scope polynucleotides displaying substantial sequence identity with a reference polynucleotide sequence or polynucleotides that hybridize with a reference sequence under stringent conditions as known in the art (see for example Sambrook et al. , Molecular Cloning. A Laboratory Manual", Cold Spring Harbor Press, 1989). These terms also encompass polynucleotides in which one or more nucleotides have been added or deleted, or replaced with different nucleotides. In this regard, it is well understood in the art that certain alterations inclusive of mutations, additions, deletions and substitutions can be made to a reference polynucleotide whereby the altered polynucleotide retains a biological function or activity of the reference polynucleotide. The term "polypeptide variant" refers to polypeptides in which one or more amino acids have been replaced by different amino acids. It is well understood in the art that some amino acids may be changed to others with broadly similar properties without changing the nature of the activity of the polypeptide (conservative substitutions) as described herein for example herein. These terms also encompass polypeptides in which one or more amino acids have been added or deleted, or replaced with different amino acids.

[0111] The term "wild-type microorganism" describes a cell that occurs in nature, i.e. a cell that has not been genomically modified. A wild-type microorganism can be genomically modified to express or overexpress a first target enzyme. This microorganism can act as a parental microorganism in the generation of a microorganism modified to express or overexpress a second target enzyme. In turn, the microorganism modified to express or overexpress a first and a second target enzyme can be modified to express or overexpress a third target enzyme. Accordingly, a "parental microorganism" functions as a reference cell for successive genomic modification events. Each modification event can be accomplished by introducing a nucleic acid molecule into the reference cell. The introduction facilitates the expression or overexpression of a target enzyme. It is understood that the term "facilitates" encompasses the activation of endogenous polynucleotides encoding a target enzyme through genomic modification of e.g. , a promoter sequence in a parental microorganism. It is further understood that the term "facilitates" encompasses the introduction of heterologous polynucleotides encoding a target enzyme in to a parental microorganism.

[0112] As used herein, underscoring or italicizing the name of a gene shall indicate the gene, in contrast to its protein product, which is indicated by the name of the gene in the absence of any underscoring or italicizing. For example, "mce" shall mean the Methylmalonyl-CoA epimerase (MCE) gene, whereas "MCE" or "Methylmalonyl-CoA epimerase" shall indicate the protein product or products (e.g. enzyme) generated from transcription and translation and alternative splicing of the "mce" gene and so forth.

[0113] Each embodiment described herein is to be applied mutatis mutandis to each and every embodiment unless specifically stated otherwise. 2. Recombinant microorganisms producing Wood-Werkman cycle enzymes

[0114] The Wood-Werkman cycle utilizes the substrate succinate to produce products using four enzymes, methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase which produce propionate from pyruvate and succinate, via succinyl-CoA, methyl malonyl-CoA, and propionyl-CoA.

[0115] Methyl malonyl-CoA mutase is part of a family of coenzyme B ₁₂ -dependent acyl- CoA mutases. Methylmalonyl-CoA mutase catalyzes the interconversion of methylmalonyl-CoA and succinyl-CoA via radical intermediates generated by substrate-induced homolysis of the coenzyme carbon-cobalt bond. Without limiting the present invention to any one theory or mode of action, mutases from Propionibacterium are present as two subunits which have been shown to dissociate progressively leading to a decreased activity. This dissociation is increased under aerobic conditions and inactivation of the mutase activity in P. shermanii has been shown to occur during aerobic conditions. The present invention is predicated in part on the determination that it is possible to produce propionate and 1-propanol in an aerobic microorganism (e.g. , Saccharomyces cerevisiae) that does not normally produce the enzymes of the Wood-Werkman cycle, through genomic modification in which one or more enzymes of the Wood-Werkman cycle are introduced into the microorganism to thereby provide the microorganism with a full complement of Wood-Werkman cycle enzymes, wherein the introduced enzyme or enzymes include a methylmalonyl-CoA mutase that is functional under aerobic conditions. It was also determined that the methylmalonyl-CoA mutase that is functional under aerobic conditions is not only useful for introduction of the Wood- Werkman cycle into an aerobic organism but is also useful when introduced into anaerobic microorganisms.

[0116] It will be understood that the parent microorganism contemplated herein may also produce one or more of the enzymes methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase which function in metabolic pathways which are not the Wood-Werkman cycle. However, the parent microorganism contemplated herein does not produce the full complement of enzymes required for a functional Wood-Werkman cycle.

[0117] Accordingly, in one aspect, the present invention is specifically related to a recombinant microorganism which is distinguished from a parent microorganism by producing each of a methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase which enzymes may be heterologous or endogenous to the microorganism.

[0118] Without limiting the present invention to any one theory or mode of action, although Propionibacteria produce propionate from pyruvate using the Wood-Werkman cycle through seven enzymatic steps, the enzymes malate dehydrogenase, fumarate hydratase and fumarate reductase/succinate dehydrogenase are typically endogenous to the parent

microorganism due to their function in other metabolic cycles, including for example the tricarboxylic acid (TCA) cycle (also known as the citric acid cycle (CAC) or Krebs cycle. Also without limiting the present invention to any one theory or mode of action, in addition to a full complement of Wood-Werkman cycle enzymes, a microorganism may require the availability of the enzyme alcohol dehydrogenase (adhE) for 1-propanol production. It will be understood that the engineering of a microorganism to also express these and/or other non-Wood-Werkman cycle enzymes which provide the Wood-Werkman cycle enzymes with the necessary substrates and/or cofactors (e.g. vitamin B ₁₂ ) required to produce propionate and 1-propanol is also contemplated herein.

[0119] Accordingly, in certain embodiments, recombinant microorganisms are provided where one or more of malate dehydrogenase, fumarate hydratase, fumarate reductase/succinate dehydrogenase and/or alcohol dehydrogenase are introduced into a parent microorganism through genomic modification.

2.1 Methylmalonyl-CoA mutase

[0120] Methylmalonyl-CoA mutase (MCM) should be understood to be the vitamin B ₁₂ - dependent enzyme that catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, also known as methylmalonyl-CoA isomerase. Without limiting the present invention to any one theory or mode of action, MCM belongs to a family of enzymes that catalyze interconversion of succinyl CoA and methylmalonyl CoA via a free radical mechanism. MCM enzymes use the cofactor adenosylcobalamin (coenzyme B ₁₂ ) which breaks to form an adenosyl radical, thus initiating the enzymes catalysis of the isomerization of methylmalonyl-CoA to succinyl-CoA. It will be understood that any MCM enzyme which is able to catalyze the isomerization of methylmalonyl-CoA to succinyl-CoA under aerobic and/or anaerobic conditions is contemplated herein. In a certain embodiment, the MCM is selected from the list of enzymes in Table 8 or an enzyme corresponding thereto.

[0121] In some embodiments, the coding sequence for the mutA subunit of the methyl malonyl-CoA mutase comprises the sequence set forth in SEQ ID NO: 6 or SEQ ID NO: 26, and the coding sequence of the mutB subunit comprises the sequence set forth in SEQ ID NO: 5 or SEQ ID NO: 25.

[0122] In some embodiments, the coding sequence for the mutA and MutB subunits of the methyl malonyl-CoA mutase comprises the sequence set forth in SEQ ID NO: 7.

[0123] Also without limiting the present invention to any one theory or mode of action,

MCM is a heterodimer formed by a large subunit (a) (encoded by mutA) and a small subunit (β) (encoded by mutB), forming a 150-kDa protein. The active substrate binding site of MCM is located in the a subunit with the vitamin B ₁₂ binding site located in the β subunit. Thus, in certain embodiments, the coding sequence for the mutA subunit used to generate an expression construct for establishing expression of an MCM enzyme in a recombinant microorganism of the present invention may be from an MCM enzyme which is not able to catalyze the isomerization of methylmalonyl-CoA to succinyl-CoA in the presence of oxygen.

2.2 Methyl ma lonyl-CoA ca rboxytra nsferase

[0124] Methylmalonyl-CoA carboxytransferase is a heterodimer formed by four subunits encoded by mtcA, mtcB, mtcC, mtcD. Methylmalonyl-CoA carboxytransferase catalyzes the reaction (S)-methylmalonyl-CoA + pyruvate = propanoyl-CoA + oxaloacetate. Thus, the two substrates of this enzyme are (S)-methylmalonyl-CoA and pyruvate, whereas its two products are propanoyl-CoA and oxaloacetate. It will be understood that any Methylmalonyl-CoA

carboxytransferase which catalyzes the reaction (S)-methylmalonyl-CoA + pyruvate = propanoyl- CoA + oxaloacetate is contemplated herein, and reference to a methylmalonyl-CoA

carboxytransferase is also reference to other commonly used names e.g., transcarboxylase, methylmalonyl coenzyme A carboxyltransferase, methylmalonyl-CoA transcarboxylase, oxalacetic transcarboxylase, methylmalonyl-CoA carboxyltransferase, methylmalonyl-CoA carboxyltransferase, (S)-2-methyl-3-oxopropanoyl-CoA: pyruvate carboxyltransferase, and (S)-2- methyl-3-oxopropanoyl-CoA: pyruvate carboxytransferase. In some embodiments, the coding sequence of the four subunits of encoded by mtcA, mtcB, mtcC, mtcD of the Methylmalonyl-CoA carboxytransferase are from the same microorganism species. In some embodiments, the coding sequence of the four subunits of encoded by mtcA, mtcB, mtcC, mtcD may come from different microorganism species.

[0125] In certain embodiments, the methylmalonyl-CoA carboxytransferase is selected from the list of enzymes in Table 10 or an enzyme corresponding thereto. In some embodiments, the coding sequence of the mtcA subunit of the methyl malonyl-CoA carboxytransferase comprises the sequence set forth in SEQ ID NOs: 11 or 21, the coding sequence of the mutB subunit comprises the sequence set forth in SEQ ID NOs: 12 or 22, the coding sequence of the mutC subunit comprises the sequence set forth in SEQ ID NO: 14, the coding sequence of the mutD subunit comprises the sequence set forth in SEQ ID NO: 15. In an embodiment, the coding sequence of the mutC and D subunits comprises the sequence set forth in SEQ ID NO: 16 or SEQ ID NO: 23.

2.3 Propionyl-CoA:succinate CoA transferase

[0126] Propionyl-CoA:succinate CoA transferase catalyzes the transfer of coenzyme A from propionyl-CoA to succinate to generate succinyl-CoA + propionate. Accordingly, contemplated herein is any Propionyl-CoA:succinate CoA transferase which catalyzes the transfer of coenzyme A from propionyl-CoA to succinate to generate succinyl-CoA + propionate. In certain embodiments, the propionyl-CoA:succinate CoA transferase is selected from the list of enzymes in Table 11 or an enzyme corresponding thereto. In an embodiment, the recombinant microorganism produces two propionyl-CoA succinyl-CoA transferase enzymes. In an embodiment, the coding sequence for the Propionyl-CoA:succinate CoA transferase comprises the sequences set forth in SEQ ID NOs: 17, 18, 19 or 24.

2.4 Methylmalonyl-CoA epimerase

[0127] Methylmalonyl-CoA epimerase (MCE) is an enzyme that catalyzes the reaction that converts (S)-methylmalonyl-CoA to the (R) form in a reaction that uses a vitamin B ₁₂ cofactor and a resonance-stabilized carbanion intermediate. The (R)-methylmalonyl-CoA is then converted to succinyl-CoA in a reaction catalyzed by methylmalonyl-CoA mutase. This enzyme functions in multiple metabolic pathways in different microorganism including the 3-Hydroxypropionate/4- Hydroxybutyrate Cycle for carbon dioxide fixation. Accordingly, contemplated herein is any Methylmalonyl-CoA epimerase that catalyzes the reaction that converts (S)-methylmalonyl-CoA to the (R) form.

[0128] In certain embodiments, the methyl malonyl-CoA epimerase is selected from the list of enzymes in Table 9 or an enzyme corresponding thereto. In some embodiments, the methyl malonyl-CoA epimerase is from Propionibacterium acidipropionici. In an embodiment, the coding sequence for the methyl malonyl-CoA epimerase comprises the sequence set forth in SEQ ID NOs: 8, 9 or 20.

[0129] The parent microorganism used to generate the recombinant microorganisms of the present invention includes any industrially relevant microorganism which can used for large scale production of propionate and/or 1-propanol. In certain embodiments the parent microorganism contemplated herein is an industrially relevant microorganism selected from yeast, bacteria, microalgae, mold or fungi.

[0130] In an embodiment, the yeast is selected from the genus Saccharomyces, Pichia and Yarrowia.

[0131] Representative examples of yeast species contemplated herein include Pichia pastoria, Pichia stipites, Yarrowia lipytica, Saccharomyces cerevisiae, Saccharomyces arboricolus, Saccharomyces bayanus, Saccharomyces boulardii, Saccharomyces bulderi, Saccharomyces cariocanus, Saccharomyces cariocus, Saccharomyces chevalieri, Saccharomyces dairenensis, Saccharomyces ellipsoideus, Saccharomyces eubayanus, Saccharomyces exiguus, Saccharomyces florentinus, Saccharomyces fragilis, Saccharomyces kluyveri, Saccharomyces kudriavzevii ,

Saccharomyces martiniae, Saccharomyces mikatae, Saccharomyces monacensis, Saccharomyces norbensis, Saccharomyces paradoxus, Saccharomyces pastorianus, Saccharomyces spencerorum, Saccharomyces turicensis, Saccharomyces unisporus, Saccharomyces uvarum and Saccharomyces zonatus.

[0132] Representative examples of bacteria contemplated herein include industrially relevant microorganism is from a genus selected from Escherichia, Bacillus, Clostridium,

Streptomyces, Corynebacterium, Proteus, Serratia, Pseudomonas, Acromobacter,

Corynebacterium, Micrococcus, Blevibacterium and Acetobacter.

[0133] In some embodiments, the bacterium is selected from, but not limited to E. coli, Clostridium acetobutylicum, Clostridium baratii, Clostridium bifermentans , Clostridium botulinum, Clostridium butyricum, Clostridium celerecrescens , Clostridium cellulolyticum, Clostridium clostridioforme, Clostridium difficile, Clostridium drakei, Clostridium fallax, Clostridium ljungdahlii, Clostridium malenominatum, Clostridium perfringens, Clostridium phytofermentans, Clostridium sordelli, Clostridium thermocellum and Clostridium chartatabidum, Bacillis. subtilis, Bacillis licheniformi, Bacillis halodurans and Bacillis megaterium.

[0134] In certain embodiments, the recombinant microorganism is a fungi. Suitably the fungi is an industrially relevant fungal species from a genus selected from the genus Aspergillus, Rhizopus, Penicillium, Nocardia, Hypomyces, Paecilomyces, Trichoderma, Cephalosporium, Tolypocladium and Cylindrocarpon.

[0135] In some embodiments, the recombinant microorganism is a microalgae or algae.

Suitably, the microalgae is an industrially relevant species selected from Chlamydomonas, Phaeodactylum, Thalassiosira , Cyanidioschyzon,, Ostreococcus , Micromonas, Fragilariopsis, Pseudo-nitzschia, Thalassiosira, Botryococcus, Chlorella, Dunaliella, Micromonas, Galdieria, Porphyra, Volvox, Aureococcus, Chlorella, Haematococcus, Ulva, Nannochloropsis, Navicula, Cylindrotheca, Cyclotella, Laminaria, Undaria, Porphyra, Kappaphycus, Gracilaria,, Porphyridium sp., Amphidinium sp., Symbiodinium and Euglena gracilis.

[0136] It is preferable to divert as much substrate as possible to the Wood-Werkman cycle enzymes. In certain embodiments, a parent microorganism into which one or more of the Wood-Werkman cycle enzymes is introduced has been modified to reduce or inhibit the expression of genes involved in competing metabolic pathways or in the production of byproducts of the Wood-Werkman cycle and/or is modified to overexpress at least one gene involved in metabolic cycles which supply succinate to the Wood-Werkman cycle enzymes. [0137] Many different methods can be used to confer a host cell with reduced or increased polypeptide activity. For example, a cell can be engineered to have a disrupted regulatory sequence or polypeptide-encoding sequence using common mutagenesis or knock-out technology. See, e.g., Methods in Yeast Genetics (1997 edition), Adams et al., Cold Spring Harbor Press (1998). One particularly useful method of gene disruption is complete gene deletion because it reduces or eliminates the occurrence of genetic reversions in the genomically modified microorganisms of the invention. Accordingly, a disruption of a gene whose product is an enzyme thereby disrupts enzymatic function. Alternatively, antisense technology can be used to reduce the activity of a particular polypeptide. For example, a cell can be engineered to contain a cDNA that encodes an antisense molecule that prevents a polypeptide from being translated. Further, gene silencing can be used to reduce the activity of a particular polypeptide.

[0138] Polypeptide activity may be increased by overexpression of a gene.

Overexpression can be achieved, for example, through reducing the rate of transcription, either by substituting a strong promoter with a weaker one, or by weakening a strong promoter by introducing a point mutation. An alternative approach is to reduce the levels of polymerase in the host cell. For example, the levels of the T7 DNA polymerase expressed in E. coli can be modulated by altering the expression levels of the natural inhibitor T7 lysozyme, which is under the control of a tightly regulated inducible promoter, hence fine-tuning the rates of transcription. Another method which ca n be used to reduce or inhibit the activity of a polypeptide or overexpress a polypeptide is by using an engineered, non-naturally occurring Clustered Regularly Interspersed Short

Palindromic Repeat-CRISPR associated system (CRISPR-Cas). By delivering the Cas9 nuclease and appropriate guide RNAs into a cell, the cell's genome can be cut at a desired location, allowing existing polynucleotide sequences to be removed and/or new ones added. Further information regarding CRISPR techniques can for example be found in WO 2013/188638, WO 2014/093622 and Doudna et al., 2014.

[0139] Any method for gene knockdown or silencing known to the person skilled in the art can be used to reduce or inhibit the expression of a gene involved in a competing metabolic pathway and/or byproduct production. Reduced activity can be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a control cell.

[0140] The present invention thus also provides a microorganism having one or more metabolic modifications relative to a parent microorganism from which it is derived, including one or more disruptions of one or more genes involved in metabolic cycles other than the Wood- Werkman cycle. In certain embodiments, the metabolic modifications involve disruption of one or more genes which encode enzymes responsible for the production of one or more of the byproducts ethanol, lactate or formate. In an embodiment, the metabolic modifications involve disruption of one or more genes selected from aldehyde-alcohol dehydrogenase (adhE) (ethanol), lactate dehydrogenase (IdhA) (lactate), Formate acetyltransferase 1 (pfIB) (formate) or combinations thereof. It will be appreciated that such modifications can be made both before and/or after the introduction of at least one (e.g. 1, 2, 3 or 4) of the Wood-Werkman cycle enzymes.

[0141] In a related aspect, the present invention provides a recombinant

microorganism which produces each of methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase, wherein the methyl malonyl-CoA mutase catalyzes conversion of succinyl-CoA to R-methyl malonyl-CoA under aerobic or anaerobic conditions, whereby the genome of the microorganism has been further modified to overexpress at least one gene encoding a protein involved in increasing the carbon flux through the metabolic cycles involved in pyruvate cycling. In some embodiments, the

overexpression is of a gene involved a metabolic cycle which produces succinate and/or which produces substrates involved in succinate production. Overexpressed activity can be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a control cell.

3. Constructs

[0142] The present invention further provides an expression construct for expressing a coding sequence for one or more of the enzymes of the Wood-Werkman cycle in a microorganism.

[0143] Expression constructs for expressing recombinant genes can be produced in any suitable manner to establish expression of the enzymes in a microorganism. Expression constructs include, but are not limited to, plasmids and phage. The expression construct can include the exogenous polynucleotide operably connected to expression elements, such as, for example, promoters, enhancers, ribosome binding sites, operators and activating sequences. Such expression elements may be regulatable, for example, inducible (via the addition of an inducer). Alternatively or in addition, the expression construct can include additional copies of a

polynucleotide encoding a native gene product operably connected to expression elements.

Examples of suitable expression constructs for E. coli are gven in Table 5. Examples of suitable constructs for yeast are given in Table 2.

[0144] Representative examples of useful promoters include, but are not limited to: the LTR (long terminal 35 repeat from a retrovirus) or SV40 promoter, the E. coli lac, tet, or trp promoter, the phage Lambda PL promoter, and other promoters known to control expression of genes in prokaryotic or eukaryotic cells. Exemplary promoters for use in yeast constructs include TDH3, TEF1, TP11, TEF2 and PGK1. Exemplary promoters for use in bacteria include PBAD, PlacZ and PNarm. However, it will be understood that any promoter which functions to control gene expression in a particular microorganism can be used in accordance with the present invention.

[0145] In one aspect, the expression construct also includes appropriate sequences for facilitating expression of the protein encoding sequence of an exogenous coding sequence. The expression constrict can comprise elements to facilitate incorporation of polynucleotides into the cellular genome of a parent microorganism.

[0146] It will be understood, however, that expression of protein-encoding

polynucleotides in heterologous systems is now well known, and the present invention is not directed to or dependent on any particular vector, transcriptional control sequence or technique for its production. Rather, constructs prepared according to the methods as set forth herein may be introduced into selected cells or tissues or into a precursors or progenitors thereof in any suitable manner in conj unction with any suitable construct or vector, and the coding sequences of the enzymes may be expressed with known promoters in any conventional manner

[0147] Introduction of the expression construct or other polynucleotides into cells can be performed using any suitable method, such as, for example, transformation, electroporation, microinjection, microprojectile bombardment, calcium phosphate precipitation, modified calcium phosphate precipitation, cationic lipid treatment, photoporation, fusion methodologies, receptor mediated transfer, or polybrene precipitation. Alternatively, the expression constructs or other polynucleotides can be introduced by infection with a viral vector, by conjugation, by transduction, or by other suitable methods such as, for example CRISPR genome editing techniques. [0148] Coding sequences for the Wood-Werkman cycle enzymes to be expressed in the recombinant microorganism may be either endogenous to the host or heterologous and must be compatible with the parent microorganism. Accordingly, the coding sequence of interest may be optionally codon-optimized using the preferred codon usage of the host microorganism selected. The present methods are exemplified using specific genes as described by the accompanying sequence listing. The preferred codons used by different microorganisms are well known in the art.

[0149] The recombinant microorganisms may exhibit suboptimal growth rates until their metabolic networks have adjusted to their missing functionalities. To assist in this adjustment, the strains are adaptively evolved. By subjecting the strains to adaptive evolution, cellular growth rate becomes the primary selection pressure and the recombinant cells are compelled to reallocate their metabolic fluxes in order to enhance their rates of growth. In general, evolutions will be stopped once a stable phenotype is obtained. The recombinant microorganisms can be characterized by measuring the growth rate, the substrate uptake rate, and the product/byproduct secretion rate. Cultures are grown overnight and used as inoculum for a fresh batch culture for which

measurements are taken during exponential growth. The growth rate can be determined by any means known in the art, as an example, microorganism cell growth rates can be determined by measuring optical density using a spectrophotometer (A600). Concentrations of glucose and other organic acid byproducts in the culture supernatant can be determined by HPLC using an HPX-87H column (BioRad), and used to calculate uptake and secretion rates.

4. Methods of producing propionate and 1-propanol

[0150] In accordance with the present invention, a recombinant microorganism which is other than a Propionibacterium, and which produces each of methyl malonyl-CoA mutase, propionyl-CoA succinyl-CoA transferase, methyl malonyl-CoA epimerase, and methyl malonyl-CoA carboxytransferase, wherein the methyl malonyl-CoA mutase catalyzes conversion of succinyl-CoA to R-methyl malonyl-CoA under aerobic and/or anaerobic conditions, are useful for the production of propionate and/or 1-propanol.

[0151] Accordingly, the present invention further relates to a method of producing propionate, 1-propanol, or a combination thereof, comprising :

(a) culturing a recombinant microorganism as broadly described above and elsewhere herein under aerobic or anaerobic conditions and in a growth medium that is suitable for growth of the microorganism; and

(b) recovering the propionate, 1-propanol, or a combination thereof produced by the microorganism from the growth medium.

[0152] Recombinant microorganisms of the invention are cultured under conditions appropriate for growth of the cells and expression of the enzymes required for producing propionate and 1-propanol. Microorganisms expressing the Wood-Werkman enzymes can be identified by any suitable methods, such as, for example, by PCR screening, screening by Southern blot analysis, or screening for the expression of the enzyme. In some embodiments,

microorganisms that contain the polynucleotide coding sequence of one or more Wood-Werkman enzymes can be selected by including a selectable marker in the nucleic acid construct, with subsequent culturing of microorganisms containing a selectable marker gene, under conditions appropriate for survival of only those cells that express the selectable marker gene. The introduced nucleic acid construct can be further amplified by culturing recombinant microorganisms under appropriate conditions (e.g. culturing recombinant microorganisms containing an amplifiable marker gene in the presence of a concentration of a drug at which only microorganisms containing multiple copies of the amplifiable marker gene can survive).

[0153] It will be understood that any suitable media which supports the growth of the recombinant microorganism may be used. Suitable growth media are well-known in the art and include for example nutrient broths (liquid nutrient medium) or LB medium (Lysogeny broth, Luria broth, Lennox broth, LB Agar or Luria-Bertani medium), chemically defined media (CDM), in relation to bacteria, e.g. M9 media, and in relation to yeast, e.g. yeast nitrogen base media (YNB) media. The growth media may also be suitable to support growth of a microorganism on a solid support. Liquid media are often mixed with agar and poured via a sterile media dispenser into Petri dishes to solidify. These agar plates provide a solid medium on which microbes may be cultured.

[0154] To achieve high production-pathway fluxes, and production of certain metabolic pathway metabolites, it is often necessary to optimize cofactor supply to respective enzymes in a metabolic pathway. In certain embodiments, the growth media may include one or more cofactors required to facilitate production of propionate or 1-propanol by the Wood-Werkman cycle enzymes. It will be understood that any cofactor which assists or increases the production of propionate and/or 1-propanol by the Wood-Werkman cycle enzymes is contemplated herein.

[0155] In some embodiments, the growth medium comprises vitamin B ₁₂ . Suitably the concentration of vitamin B ₁₂ added to the growth medium will be dependent on the parent microorganism species which is used, as well as the origin of the methyl malonyl-CoA mutase. In some embodiments, where the microorganism is yeast, the concentration of vitamin B ₁₂ added to the growth medium is between about 0.27 mg/L and about 5.4 mg/L. Preferably, the amount of vitamin B ₁₂ added to the growth medium for S. cerevisiae is about 2.16 mg/L. Methods of determining the concentration of a cofactor to add to a growth medium are well known in the art.

[0156] When organic acids are produced at a pH level below their dissociation constant

(pKa), then they exist in their protonated form. Accordingly, in an embodiment which is required for most organic acid products. Accordingly, in an embodiment, the growth media which is used for culturing the recombinant microorganism of the present invention is maintained at a pH which is lower than the pKa of the product being produced. In an embodiment, the pH of the growth medium used to culture the recombinant microorganism is between about 3.5 to about 6.0. In certain embodiments, the growth medium used to culture the recombinant microorganism is pH 3.5.

[0157] The culture conditions described herein can be scaled up and the recombinant microorganisms grown continuously for manufacturing of propionate or 1-propanol. Exemplary growth procedures include, for example, fed-batch fermentation and batch separation; fed-batch fermentation and continuous separation, or continuous fermentation and continuous separation. All of these processes are well known in the art. Fermentation procedures are particularly useful for the biosynthetic production of commercial quantities of propionate and 1-propanol. In

"fermentative pathways," NAD(P)H donates its electrons to a molecule produced by the same metabolic pathway that produced the electrons carried in NAD(P)H. For example, in one of the fermentative pathways of certain yeast strains, NAD(P)H generated through glycolysis transfers its electrons to pyruvate, yielding lactate. Fermentative pathways are usually active under anaerobic conditions but may also occur under aerobic conditions, under conditions where NADH is not fully oxidized via the respiratory chain.

[0158] Generally, and as with non-continuous culture procedures, the continuous and/or near-continuous production of propionate or 1-propanol can include culturing a non- naturally occurring propionate or 1-propanol producing microorganism of the present invention in sufficient nutrients and medium to sustain and/or nearly sustain growth in an exponential phase. Continuous culture under such conditions can include, for example, 1 day, 2, 3, 4, 5, 6 or 7 days or more. Additionally, continuous culture can include 1 week, 2, 3, 4 or 5 or more weeks and up to several months. Alternatively, microorganisms of the invention can be cultured for hours, if suitable for a particular application. It is to be understood that the continuous and/or near-continuous culture conditions also can include all time intervals in between these exemplary periods. It is further understood that the time of culturing the microorganism of the invention is for a sufficient period of time to produce a sufficient amount of product for a desired purpose.

[0159] In addition to the above culture procedures using the recombinant

microorganisms of the present invention for continuous production of substantial quantities of propionate or 1-propanol, the recombinant microorganisms also can be, for example,

simultaneously subjected to chemical synthesis procedures to convert the product to other compounds or the product can be separated from the fermentation culture and sequentially subjected to chemical conversion to convert the product to other compounds, if desired.

[0160] In some embodiments, the recombinant microorganisms have an optimal temperature for growth that might be different to that normally encountered for growth and/or fermentation of a parent microorganism. Determination of optimal conditions for growth, including temperature, are well known in the art.

[0161] A wide variety of carbon sources may be used by the recombinant

microorganisms in the culture method used to grow the recombinant microorganisms. The choice of carbon source will be dependent on the microorganism strain which is used and the desired product. Methods of determining a suitable carbon source are generally known in the art. In an embodiment, the carbon source which is supplied to the culture is glucose.

[0162] Methods for recovering the propionate and 1-propanol from the culture medium can be performed using a variety of methods that are well-known to those of skill in the art including, but not limited to, distillation, pervaporation, liquid-liquid extraction, ion exchange, crystallization, precipitation, or vacuum distillation.

[0163] In order that the invention may be readily understood and put into practical effect, particular preferred embodiments will now be described by way of the following non-limiting examples.

EXAMPLES

EXAM PLE 1

INTRODUCTION OF WOOD-WERKMAN CYCLE ENZYMES IN YEAST

Strain design

[0164] With the goal of engineering propionate production in S. cerevisiae, the enzyme classes that the Propionibacterium acidipropionici Wood-Werkman cycle [Luna-Flores et al. (2016) supra] is comprised of were designed for heterologous expression in yeast. The Wood-Werkman cycle contains four enzymes, which produce propionate from pyruvate and succinate, via succinyl- CoA, methyl malonyl-CoA, and propionyl-CoA (Figure 1).

[0165] Re-designing a synthetic Wood-Werkman cycle for functional expression in yeast required careful consideration of several design features. For example, the species from which protein-coding sequences were used, enzyme co-factor requirements, enzyme sensitivity to oxygen, potential interaction with native yeast metabolism and known metabolic fluxes, and the choice of regulatory elements to control transcription of pathway genes were all factored into the various choices that were made in the design phase. In Propionibacteria , methyl-malonyl-CoA mutase is dependent on vitamin B ₁₂ as a cofactor, which is protected from oxygen by a protein domain involving the His244 residue in the beta subunit of the enzyme [Thorma et al., Biochemistry 39:9213-9221 (2000)]. The fact that the Propionibacterium methyl-malonyl-CoA mutase is sensitive to oxygen, and dependent on vitamin B ₁₂ as a cofactor poses two separate problems for its functional expression in yeast. First, the glyoxylate and TCA cycles in yeast have much higher carbon flux during respiratory, and therefore aerobic growth in yeast [Dduntze et al., Eur. J.

Biochem. 10: 83-89 (1969); Jouhten et al. (2008) supra]. This means that there is likely to be more succinate available for a synthetic Wood-Werkman cycle (Figure 1) during aerobic respiration (with oxygen as a terminal electron acceptor). To avoid the problem of oxygen sensitivity the protein coding sequence from Saccharopolyspora erythraea for the mutA and utB methyl malonyl-CoA mutase subunits (Figure 1, red coloured gene names) was used. These genes were chosen because the S. erythraea methyl malonyl-CoA mutase contributes significantly to erythromycin synthesis, which can be produced under aerobic conditions [Reeves et a/., Metab. Eng. 9: 293-303 (2007)]. Furthermore, the S. erythraea mutB protein sequence has only 71 % pairwise identity to the oxygen sensitive P. acidipropionici mutB protein. The second potential difficulty with the methyl malonyl-CoA mutase enzyme is its dependence on vitamin B ₁₂ as a cofactor. S. cerevisiae has no vitamin B ₁₂ dependent enzymes, does not make vitamin B ₁₂ , and has no known transporter proteins for the relatively large vitamin B ₁₂ molecule (1355 Daltons). The methyl malonyl-CoA epimerase, methyl malonyl-CoA carboxytransferase, and propionyl-CoA succinyl-CoA transferase (pst gene, Figure 1) proteins from P. acidipropionici (turquoise coloured gene names, Figure 1) were used to complete the cycle. Due to the relatively high k _m of the

Propionibacterium propionyl-CoA succinyl-CoA transferase (68 μΜ) [Allen et al. (1964) supra], the E. coli enzyme, which has a much lower k _m of 7.1 μΜ [Haller et a/., Biochemistry 39:4622-4629 (2000)] was also expressed (ScpC gene, Figure 1). This was carried out in order to enable efficient propionate formation even at relatively low pathway flux, and to increase the potential for propionate formation in general.

[0166] The protein coding sequences of each enzyme subunit were back-translated and codon-optimized for expression in yeast. This was carried out using Geneious Pro software [Kearse et al., Bioinformatics 28: 1647-1649 (2012)], where codons were optimized according to a subset of highly expressed yeast genes (Saccharomyces cerevisiae 'high' codon usage set in Geneious). For initial pathway characterization and strain testing, well-characterized, strong-constitutive yeast promoters [Peng et al., Microb. Cell. Fact. 14:91 (2015)] and terminators (Figure 2) were chosen. This pathway was originally designed using TEFl promoters and the synthetic TSynth25 terminator [Curran et a/. ACS Synth Biol 4:824-832 (2015)] for every open reading frame. However, the commercial DNA synthesis provider was unable to generate this construct after many attempts. Therefore, the Wood-Werkman cycle genes were divided between two low-copy centromeric yeast expression-vectors whereby promoters and terminators were repeated as little as possible (Figure

2) . The TDH3, TEF1 , TPI1 , TEF2, and PGK1 strong constitutive promoters as well as the ADH1 , CYC1 , STE2, MFA1 , PH05, and TSynth25 terminators were used partly due to their previously successful implementation in a large multi-gene synthetic pathway for opioid production in yeast [Galanie et al., Science 349: 1095 (2015)], but also for their well-characterized 'strong-constitutive' expression levels [Peng et al. (2015) supra].

[0167] To add 'extensibility' to the genetic constructs and their products, in the synthetic Wood-Werkman cycle, multidirectional 'LoxPSym' recombination sites were included between each gene expression cassette (Figure 2). The inducible expression of a heterologous Cre- recombinase enzyme can be used to facilitate DNA inversions, translocations, deletions, and duplications between LoxPSym sites as part of a genomic rearrangement mechanism termed 'Synthetic Chromosome Recombination and Modification by LoxP mediated Evolution', or SCRaMbLE [Jovicevic et al., Bioessays 36: 855-860 (2014) ; Shen et al., Genome Res. 26: 36-49 (2016)].

Propionate production under anaerobic and aerobic conditions

[0168] As an industrial producer of chemicals and biofuels, yeast has the advantage of being capable of both aerobic and anaerobic growth, dictated by both external glucose

concentration and oxygen availability by the well-characterized Crabtree effect [Zampar et al., Mol. Syst. Biol. 9: 651-651 (2013)]. This capacity is an advantage because in a bio-refinery setting, energy does not need to be expended ensuring that industrial medium is strictly anaerobic to begin with. Native propionate production from Wood-Werkman cycle carrying Propionibacterium species occurs anaerobically, as the vitamin B ₁₂ requiring methyl-malonyl-CoA mutase enzyme is sensitive to oxygen [Thorma et al. (2000) supra]. Therefore, in addition to testing the synthetic Wood- Werkman cycle for functionality via measurement of propionate titer, both anaerobic and aerobic culture conditions were tested for pathway productivity.

[0169] To test for synthetic Wood-Werkman cycle functionality, a production strain containing the 9 genes required for Wood-Werkman cycle mediated propionate formation (strain 'ScPAl', Table 3) was grown alongside an equivalent strain that does not contain any Wood- Werkman cycle genes (strain 'Control', Table 3). Growth was monitored over 44 hours (Figure 3a), with the concentrations of relevant organic acids (Figure 3b), glucose (amount consumed) and ethanol (Figure 3c) being determined at the end of the fermentation. The propionate producer strain had a slower growth rate and lower final biomass relative to the control strain (Figure 3a), presumably due to metabolic burden from heterologous protein expression. The synthetic Wood- Werkman cycle containing production strain accumulated 0.048 mM propionate, while no propionate was detected in the culture supernatant of the control strain (Figure 3b). Each strain consumed all of the available glucose, and produced ethanol as the main by-product (Figure 3c). The relative concentrations of pyruvate and succinate are of interest because they are the two metabolites that connect native yeast metabolism to the synthetic Wood-Werkman cycle (Figure

3) . The control strain had a pyruvate to succinate ratio of 9: 1 while the producer strain had a ratio of 2: 1. This suggests that the methyl-malonyl carboxytransferase enzyme of the Wood-Werkman cycle effectively competes for the pyruvate pool in the producer strain, reducing the concentration of pyruvate at the end of the fermentation relative to the control strain (Figure 3 b). 1-propanol was also detected, but was not quantified because the level was below the lower limit of quantification in the HPLC method employed. 1-propanol has potential for application as a biofuel [Choi et al., (2014) Metabolic Engineering of Microorganisms for the Production of Higher Alcohols, mBio 5], and it may be possible to optimize this system for 1-propanol production in yeast. The other predominant yeast fermentation by-products acetate, lactate, and glycerol were all produced in similar amounts (Figure 3 b, glycerol data not shown).

[0170] Although it was established that the synthetic Wood-Werkman cycle functions to produce propionate in yeast, the titer achieved (0.048 mM) was very modest under anaerobic conditions (Figure 3 b). Aerobic conditions were therefore also investigated for propionate production from the synthetic Wood-Werkman cycle using shake-flask cultivation (Figure 4 a, b). The concentrations of organic acid end-products, glucose, ethanol, and 1-propanol were determined after both 11 hours and 32 hours of cultivation (Figure 4 a, b). All of the glucose was consumed by 11 hours, and as with anaerobic cultivation (Figure 3 c) ethanol was the main end product. The only metabolite that differed significantly between the two time-points was acetate, which increased by around 1 mM. propionate titer was stable at 0.31 mM between 11 and 32 hours of cultivation, while a small amount of 1-propanol was detected (but not quantified) at 32 hours (Figure 4 a). Aerobic cultivation resulted in a substantial, ~6.5-fold increase in propionate titer compared to under anaerobic conditions (Figure 3 b). Aerobic cultivation was therefore used for further experiments.

Growth medium pH affects propionate yield

[0171] The effect of pH on propionate production from the synthetic Wood-Werkman cycle was therefore investigated. Strain ScPAl was grown in a 96-well microtitre plate with starting pH levels ranging from 6 to 3.5 (Figure 5). In general, the growth rate and final biomass concentration both decreased with decreasing pH, as has been previously documented in yeast [Fletcher eta/., Metab. Eng. 39:19-28 (2017)]. There was also a trend towards higher propionate production at pH 5.5, although these differences were not significant (p≤ 0.05) (Figure 5 g). Ethanol production after 48 hours was higher when initial medium pH levels were between 5.5 and 4.5. The relationship between pH and propionate titer was further investigated using a pH- controlled bioreactor (see subsequent section below).

Optimizing vitamin Bn concentration

[0172] The methyl-malonyl-CoA mutase enzyme of the Wood-Werkman cycle requires vitamin B ₁₂ as cofactor (Figure 1). However, S. cerevisiae has no known enzymes that require vitamin B ₁₂ as a cofactor, and no known mechanisms for transporting exogenously supplied vitamin B ₁₂ inside the cell. Both growth and propionate production were tested with vitamin B ₁₂ concentrations ranging between 0.27 mg/L (lx) and 5.4 mg/L (20x) (Figure 6) was also simultaneously varied (between 10 mg/L and 200 mg/L). As a premixed vitamin B ₁₂ solution which also contained thiamine (vitamin Bi) was used, the thiamine concentration was also varied between 10 mg/L and 200 mg/L. There was a significant increase in growth-rate and maximum biomass concentration when the cofactor concentrations were increased to 6x and 8x, with no further increase being observed beyond 8x concentration (Figure 6a, b). There was a trend towards higher propionate titer at 4x cofactor concentration (Figure 6c), but this difference was not significant. Given that optimal growth was achieved with the 8x cofactor concentration but not the 4x, and that propionate titer was not significantly different at 8x compared to at 4x, the 8x concentration (2.16 mg/L) was used for subsequent experiments. Synthetic Wood- Werkman cvcle performance under industrially relevant bioreactor conditions

[0173] The synthetic yeast Wood -Werkman cycle under industrially relevant bioreactor conditions was tested with the pH controlled at either 6 or 3.5 to further investigate pH effects on production, and to assess bioreactor performance (Figure 7). Growth rate and final biomass were both lower at pH 3.5 compared to pH 6, with the glucose consumption rate also decreasing as expected for a slower growth rate phenotype (Figure 7a). This is consistent with previously observed growth limitations in yeast at low pH levels (Fletcher et al., (2017) supra). Ethanol, glycerol, and acetate are the major end-products of yeast fermentation, these metabolites were therefore measured alongside propionate under each pH-level (Figure 7a, b). Ethanol production profiles were similar during the exponential growth phase, but after the diauxic shift there was significantly less ethanol reassimilation at pH 3.5 (Figure 7a). Acetate accumulation was reduced at pH 3.5 (Figure 7 b), as previously observed in this laboratory yeast strain [Lin et al., Biomass Bioenergy 47: 395-401 (2012)], while pH had little effect on glycerol accumulation (Figure 7 b). Although the highest propionate concentrations reached in each condition were very similar (0.8 mM at pH 6 and 1 mM at pH 3.5), their accumulation profiles were different, with the pH 3.5 cultures peaking ~20 hours later than the pH 6 cultures (Figure 7 c). 1-propanol was also detected at approximately 0.1 mM at the end of the fermentation under each pH condition, further demonstrating the potential for this system to be applied to biofuel production in the future.

[0174] In both conditions all propionate was reassimilated after 70 hours.

Materials and Methods

Growth Media

[0175] Yeast strains were grown in 1 x Yeast Nitrogen Base (YNB) without amino acids (Sigma Aldrich catalogue number Y0626) supplemented with 5 g/L glucose, 25 mg/L methionine, 25 mg/L histidine, as well as vitamins B ₁₂ and E> ₁ at indicated concentrations, and 20 g/L agar when solid media were used (referred to as YNB medium). For plasmid cloning and maintenance, E. coli DH5 alpha were grown in Luria Bertani medium supplemented with 100 g/mL ampicillin. Unless stated otherwise, the initial medium pH was adjusted to 6.0.

Growth conditions

[0176] All yeast and E. coli cultivation was carried out at 30 °C, both with shaking at

200 rpm unless otherwise stated. Yeast strains used in experiments were pre-cultured on solid medium for 5 days prior to single colonies being used to inoculate 10 mL of YNB medium and cultured for 24 h. The 24 h culture was then used as inoculum of fresh media in triplicate in either anaerobic serum bottles, baffled shake-flasks, 96 well plates, or bioreactors, as indicated.

Anaerobic serum bottle (160 mL) fermentations were carried out by flushing 50 mL of YNB medium with nitrogen to remove oxygen prior to inoculation at OD600nm of 0.1. Aerobic conditions were established using baffled 250 mL shake-flasks with 50 mL YNB medium with inoculation using 1 mL of 24 hour pre-culture. For serum bottle and shake-flask fermentations, the vitamin BJB^ concentration in the medium were (20 mg/L and 0.434 mg/L respectively). 96-well plate cultivations were carried out in 100 μί of YNB medium with initial OD600nm adjusted to 0.1. Eight replicates were used for each condition (vitamin concentration or pH) with OD600nm being read automatically in a Fluostar Omega plate reader with shaking at 400 rpm. [0177] DasGip bioreactors with a total volume of 400 mL were used for controlled pH, aerobic fermentations in duplicate as follows. A colony of producer strain ScPAl was picked from an agar YNB plate and grown overnight in 10 mL of liquid media (glucose 2 g/L, methionine 25 mg/L, histidine 25 mg/L) culture. 1 mL of the overnight grown culture was then used to inoculate 100 mL of YNB media (10 g/L glucose, methionine 50 mg/L, histidine 50 mg/L) and grown in a baffled flask at 30 C, 200 rpm for 16 h. Approximately 10 mL of the seed culture were used to inoculate 250 mL of fresh YN B media (10 g/L glucose, methionine 50 mg/L, histidine 50 mg/L). Vitamins B1/B12 were supplied at 8X concentration (80 mg/L and 2.16 mg/L respectively). Two pH conditions were tested, 6.0 (control) and 3.5 (low). Cultures were performed at 30°C and 400 rpm. Air was continuously flushed at 0.66 VVM.

Analytics

[0178] Organic acids, carbohydrates, and alcohol were quantified by ion-exclusion chromatography using an Agilent 1200 HPLC system and an Agilent Hiplex H column (300 x 7.7 mm, PL1170-6830) with a guard column (SecurityGuard Carbo-H, Phenomenex PN : AJO-4490). Sugars and alcohols were monitored using a refractive index detector (Agilent RID, G1362A), set on positive polarity and optical unit temperature of 40 °C. Organic acids were monitored at 210 nm (Agilent MWD, G1365B). 30 uL of the sample was injected onto the column using an autosampler (Agilent HiP-ALS, G1367B), and column temperature kept at 40 °C using a thermostatted column compartment (Agilent TCC, G1316A). Analytes were eluted isocratically with 14 mM H2S04 at 0.4 mL/min for 50 min. Chromatograms were integrated using ChemStation software (Rev B.03.02). For glycerol quantification, 30 uL of sample was injected onto the column using an autosampler (Agilent HiP-ALS, G1367B) and column temperature kept at 65°C using a thermostatted column compartment (Agilent TCC, G1316A). Analytes were eluted isocratically with 4 mM H2S04 at 0.6 mL/min for 26 min.

Strain and plasmid construction

[0179] Primers, plasmids, and strains used in this study are shown in Tables 1, 2 and 3. Strains were constructed by transforming plasmids into the relevant yeast strain using the lithium acetate method [Gietz and Schiestl, Nat. Protocols 2: 35-37 (2007)] and selecting for growth on appropriate auxotrophic dropout agar plates. All in silico cloning, Gibson assembly, and primer design was carried out using Geneious Pro software [Kearse et a/. (2012) supra], version 9.1.5. E. coli DH5a was used for cloning using standard techniques [Sambrook and Russell, Molecular Cloning : A Laboratory Manual, Vol. 1, Cold Spring Harbor Laboratory Press (2001)] unless otherwise mentioned. An E. coli ScpC gene expression cassette including the yeast TEF1 promoter, synthetic TSynth25 terminator [Curran et a/. (2012) supra], and LozPSym sites was synthesised by Genscript. This cassette was PCR amplified using primers 1/2 and inserted into Eco53KI linearized pRS416 plasmid using the yeast assembly technique [Gibson et a/., Proc. Natl. Acad. Sci.

105: 20404-20409 (2008)] to create the ScpC-pRS416 vector. Correct assembly was determined using primers 3/4, which anneal to the pRS416 vector either side of the Eco53KI cut site. The synthetic (Genscript) PAl. b (SEQ ID NO: 31) construct was cloned into the ScpC-pRS416 vector using Kpnl and Xhol restriction sites to generate the PAl. b-ScpC-pRS416, while the synthetic PA2.b (SEQ ID NO: 32) construct was cloned into pRS415 using Xhol and Xmal sites to create PA2.b-pRS415. Full, annotated sequence maps of all expression vectors are available as supplementary material. Table 1. Primers used in this study

Primer 5 to 3' sequence

number/name

GGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGAACGACGGCCA GTGAATTCG [SEQ ID NO: 33]

GCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCAGCTATGACCATG ATTACGCC [SEQ ID NO: 34]

GTAAAACGACGGCCAGT [SEQ ID NO: 35]

GGAAACAGCTATGACCATG [SEQ ID NO: 36]

Table 2. Plasmids used in this study

Name Details Origin

PRS415 Yeast centromeric plasmid, LEU2 marker Euroscarf ⁴²

PRS416 Yeast centromeric plasmid, URA3 marker Euroscarf ⁴²

ScpC-pRS416 pTEFl-ScpC-TSynth25-pRS416 This study

PAl.b-ScpC-pRS416 pTDH3-mtcA-ADHlt-pTEFl-mtcB-CYClt-pTPIl- This study

mtcC-STE2t-pTEF2-mtcD-MFAlt-pPGKl-mce- PH05t-pTEFl-ScpC-TSynth25-pRS416

PA2.b-pRS415 pTDH3-mutA-STE2t-pTEF2-mutB-ADHlt-pTEFl- This study

pst-PH05t-pRS415

⁴² Sikorski, R. S., and Hieter, P. (1989) A System of Shuttle Vectors and Yeast Host Strains Designed for Efficient Manipulation of DNA in Saccharomyces cerevisiae, Genetics 122, 19-

27

Table 3. Yeast strains used in this study

Name Genotype, plasmids Notes Origin

BY4741 MATa his3Al leu2A0 metl5A0 Haploid auxotrophic Euroscarf ⁴² ura3A0 laboratory strain, mating

type 'a'

Control BY4741, pRS415, pRS416 Base strain with empty This study

vectors

ScPAl BY4741, PA2. b-pRS415, PAl.b- Propionate production This study

ScpC-pRS416 strain encoding a synthetic

Wood-Werkman cycle EXAM PLE 2

EVALUATION OF THE WOOD-WERKMAN CYCLE FOR PRODUCTION OF PROPIONATE UNDER AEROBIC CONDITIONS USING METHYLMALONYL-COA MUTASE SCPA IN ESCHERICHIA COLI

[0180] Two E. coli strains derived from K12 MG1655 (wild type WT; and engineered ECOPRO) harboring only the Wood-Werkman cycle genes from Propionibacteria (pBAD_WWCV2) were unable to produce propionate or 1-propanol under aerobic conditions. Micro aerobic conditions which allowed cultures to reach higher OD before reaching anaerobic conditions, also lead to the production of propionate. 1-propanol was detected below the limit of quantitation for the wild-type strain. In yeast, the use of a non-oxygen sensitive mutase allows the production of both propionate and propanol, showing the cycle is functional in such aerobic conditions and that the mutes from Propionibacteria is a limiting step. When the mutase from E. coli (scpA) was also expressed at the same time as the Wood Werkman cycle, production of propionate was possible under aerobic conditions in E. coli and titres under anaerobic conditions were higher compared to the sole expression of the cycle (Table 4).

Methods

Construct assembly

[0181] Plasmids pPBAD_WWCV2 (SEQ ID NO: 27) and pPBAD_sbm (SEQ ID NO: 29) were assembled as follows. Genes were PCR amplified from pMA-derived plasmids (Table 5) using corresponding primers (Table 6). PCR products were then purified and digested with Xbal and Hindlll. Genes were then cloned sequentially into the Spel and Hindlll sites of plasmid pPBAD in the order shown in Figure 8. Plasmid sequence was verified by Sanger sequencing (AGRF

Australia).

)

¹ Data correspond to the average of two replicates

² Total glucose consumed

Warner, 2000

TABLE 6 - E.coli Strains and Plasmids

Pri mers Sequence Gene to Plasmid / method amplify

pMA_mutA F ! GACTAGTGCGGCCGCAAG mutA ! pMAmutABl /

1 Gibson assembly

! pMA_mutA R ; TTTATTTCGCAACACCCAGGGTG

i mutB F ; CCTGGGTGTTGCGAAATAAAAGGAGAAAACCGA mutB

i TGTCTACCC

i mutB R ! AGTCGTATTACAAAAAACCCCTCAAGACCCG

! pM K_mtcA F ! ACTAGTGCGGCCGCAAGC mtcA 1 pM Kmtcl / Gibson

i assembly

! pM KmtcA R : TTTACGCCGGTTCAACGGTAAC

! mtcB F i TACCGTTGAACCGGCGTAAAAGGAGAAAACCG mtcB

i ATGGCGAAC

i mtcB R ; G l 1 1 I C I CC I 1 1 AGCACGGCA 1 G 1 I ACC I

mtcCD F i GCCGTGCTAAAGGAGAAAACCGATGACCGAC mtcCD

i mtcCD R i AGTCGTATTACAAAAAACCCCTCAAGACCCG

1 pMA_mutA F i GACTAGTGCGGCCGCAAG mutA 1 pMAmml / g ibson TABLE 6 - E.coli Strains and Plasrr lids

Gene to Plasmid / method

assembly

pMA mutA R TTTATTTCGCAACACCCAGGGTG

mutB F CCTGGGTGTTGCGAAATAAAAGGAGAAAACCGA mutB

TGTCTACCC

mutB ^' R ^' AGTCGTAlTACAAAAAACCCCfCAAGACCCG

mce F GG 1 1 1 1 1 1 G 1 A A 1 ALGAL 1 LAL 1 A 1 AGGGGAA mce

TACTCC

mce R AGCTTGCGGCCGCACTAGTCCAAAAAACCCCTC

AAGACCCG

pMK_mtcA F ACTAGTGCGGCCGCAAGC mtcA pMKmpl / Gibson assembly

pMKmtcA R ^' TITACGCCGGTTCAACGGTAAC

mtcB F TACCGTTGAACCGGCGTAAAAGGAGAAAACCG mtcB

ATGGCGAAC

mtcB R G U I 1 L 1 LL 1 1 1 AGLALGGLA i i ALL 1

mtcCD F GCCGfGCTAAAGGAGAAA mtcCD

mtcCD R

pst F GG I N N I G I AA I ALGAL 1 LAL 1 A 1 AGGGGAA pst

TACTCC

pst R ^' AAGCTTGCGGCCGCACTAGTCAAAAAACCCCTC

AAGACCCG

AxalacOlb GATATCATCGATtctagaGGAAGCGGAAGAGCGC PLacZ pLacZ / Insertion

CC using Xbal-Spel- Hindlll sites

Axalac02b ^' GATATCAAAGCTTGCGGCCGCTTATTACATCGG

1 1 1 1 L 1 CCTACTAGTATTGTTATCCGCTCACAAT

TCCACAC

Axanarolb GATATCAATCGATTCTA Pnarm pNarm / Insertion

1 L 1 GCATAAAAATCTTAATAG using Xbal-Spel- Hindlll sites

Axanaro2b GATATCAAAGCTTGCGGCCGCTTATTACATCGG

1 1 1 1 L 1 CCTACTAGTGCCTGTCGGCCCTCTGAT

Axaraolb GATATCAATCGATTCTA PBAD pBAD / Insertion

GGC using Xbal-Spel- Hindlll sites

Axaarao2b GATATCAAAGCTTGCGGCCGCTTATTACATCGG

1 1 1 1 L 1 CCTACTAGTAGCTCGAATTCCCAAAAAA

AC

Ptrc_F ^' GATATCAATCGATTCTAGATGAAATGAGCTGTT PTrc pTrc / Insertion

GACAATTAATC using Xbal-Spel- Hindlll sites

Ptrc R GATATCAAAGCTTGCG

1 1 1 1 L 1 LL 1 AL 1 AG 1 LLA 1 G 1 L 1 1 1 1 CCTGTG

mutA_cutsFl gatatcatctagaaggagaaaaccgATGACCGACCCG mutA pBAD_WWCV2 /

GACAAC Insertion using

Xbal-Spel-Hindlll sites

m ut A cutsRl g a ta tea a a g cttg eg g ccg ca eta g tttaTTATTTCGCA

ACACCCAGG

mutB cutsFl gatatcatctagaaggagaaaa ccgATGTCTACCCTGC mutB

CGCGT

mutB cutsRl gatatcaaagcttgcggccgcactag tttaff AGTCTTC A

ACGTGTTCCAGC

m ce_cu tsF Ϊ gatatcatctagaaggagaaaa ccgATGGAAAACTTCA mce

ACAACG

mce cutsKi gatatcaaagcttgcggccgcactagttta ι I ALH L I I I LH

ACGGCATACC

mtcA cutsFl GATATC Atcta gaaggagaaaa ccg AT GTCTCCGCG mtcA

TAAAATCG

mtcA_cutsRl gatatcaaagcttgcggccgcactagtttaTTACGCCGGT

[0182] Plasmid pPBAD_sbm was digested with Xbal and Hindlll. The PBAD-sbm region was then cloned at the Xbal-Hindlll sites in plasmid pACYC138. The assembled plasmid (pACYC- sbm) was then digested with Hpal to remove scpB and scpC. The DNA was recovered from agarose gel and circularized using DNA ligase to get plasmid pACYC-scpA.

[0183] All transformations were performed by electroporation using Mini Pulser (BioRad

Laboratories, USA). Conditions for electroporation were 1.8 kV, 25uF. After electroporation, cells were resuspended in 1 mL SOC medium and incubated for 1 h at 37°C. Then cells were plated on LB agar plate plus antibiotics (ampicillin 100 g/mL, kanamycin 50 μς/ιτιΙ) and incubated at 37 °C for 16 h to select antibiotic resistant colonies. Ampicillin resistant colonies were then picked and tested for proper assembly by colony PCR. The sequence was confirmed by Sanger sequencing (AGRF, Australia).

[0184] E. coli MG1655 (WT) and ECOPRO (AadhE IdhA pfIB ptsG) were transformed to harbour plasmid pBAd_WWCV2 and pACYC-scpA. A single colony was then grown in LB medium at 37°C for 16 h. 0.5 mL of overnight grown media was then used to inoculate 100 mL of chemically defined media (glucose 10 g/L, arabinose 10 mM). The medium was supplemented with the required antibiotics (ampicillin 100 ug/mL, chloramphenicol 30 ug/mL). Cells were grown in shake flask (aerobic conditions). For micro aerobic conditions, capped flasks were used. Cultures were grown for 20 h at 30°C and 200 rpm. At this stage, samples were taken for HPCL analysis and OD at 600 nm (OD600) was measured.

HPLC a nalysis

[0185] Organic acids, carbohydrates, and alcohol were quantified by ion-exclusion chromatography using an Agilent 1200 HPLC system and an Agilent Hiplex H column (300 x 7.7 mm, PL1170-6830) with a guard column (SecurityGuard Carbo-H, Phenomenex PN : AJO-4490). Sugars and alcohols were monitored using a refractive index detector (Agilent RID, G1362A), set on positive polarity and optical unit temperature of 40 °C. Organic acids were monitored at 210 nm (Agilent MWD, G1365B). 30 uL of the sample was injected onto the column using an autosampler (Agilent HiP-ALS, G1367B), and column temperature kept at 40 °C using a thermostatted column compartment (Agilent TCC, G1316A). Analytes were eluted isocratically with 4 mM H2S04 at 0.4 mL/min for 50 min. Chromatograms were integrated using software ChemStation.

roseoc romogenus su sp. TABLE 9

Methyl Malonyl CoA epimerase

NCIB NCIB entry entry number

Organism Name number Organism Name

Rattus norvegicus 293829 Halobacterium salinarum Rl 5952550

Haloquadratum walsbyi DSM

Caenorhabditis elegans 172514 16790 4194042

Bos taurus 508170 Halobacterium salinarum NRC-1 1447318

Chrysemys pi eta 101931821 Frankia casuarinae 32157657

Thalassospira xiamenensis M-5 =

Parasteatoda tepidariorum 107448903 DSM 17429 31927778

Geobacillus thermodenitrificans

Oncorhynchus mykiss 110526316 NC80-2 31761545

Salmo salar 106587249 Rhodobacter capsulatus SB 1003 31489489

Geobacter sulfurreducens PCA 2688251 Lysinibacillus fusiformis 29439448

Cricetulus griseus 100763022 Metallosphaera sedula 25465840

Rhinopithecus bieti 108524574 Metallosphaera sedula 25463491

Limulus polyphemus 106473384 Metallosphaera sedula 25458794

Sulfolobus acidocaldarius

Macaca mulatta 704094 Ronl2/I 14551434

Marmota marmota marmota 107148484 Haloarcula hispanica ATCC 33960 11050171

Microcebus murinus 105871303 Halopiger xanaduensis SH-6 10799169

Haloarcula marismortui ATCC

Rhinopithecus roxellana 104661338 43049 3127703

Alligator mississippiensis 102565803 Pseudomonas entomophila L48 32805724

Bubal us bubal is 102409105 Rhizobium tropici CI AT 899 32497844

Macaca fascicularis 102136623 Streptomyces albulus 32395993

Rhizobium mesoamericanum

Oncorhynchus kisutch 109886769 STM3625 31825670

Flavobacterium johnsoniae

Gallus gallus 415385 UW101 31766099

Xenopus laevis 734678 Agrobacterium vitis S4 31495061

Rhodococcus pyridinivorans

Equus caballus 100059601 SB3094 29938251

Equus asinus 106834047 Mycobacterium fortuitum 29425269

Streptomyces venezuelae ATCC

Aotus nancymaae 105733308 10712 28672937

My otis davidii 102765907 Rhizobium etli CFN 42 24299459

Streptomyces acidiscabies 84-

Bos mutus 102282081 104 33083597

Bradyrhizobium japonicum USDA

Pongo abelii 100454995 6 29267761

Natrinema pellirubrum DSM

Leptomonas pyrrhocoris 26901086 15624 14332848

Danio rerio 553804 Natronobacterium gregoryi SP2 14210038

Halogeometricum borinquense

Canis lupus familiaris 479018 DSM 11551 9993680

Pan troglodytes 459310 Natrialba magadii ATCC 43099 8823382

Nannospalax galili 103748074 Sulfolobus acidocaldarius 33345476

Callithrix jacchus 100399370 Sulfolobus acidocaldarius 33343114

Necator americanus 25352079 Sulfolobus acidocaldarius 33340698

Oryzias latipes 101169277 Sulfolobus acidocaldarius 33338373

Numida meleagris 110403859 Sulfolobus acidocaldarius 33335990

Odocoileus virginianus texanus 110124723 Gordonia terrae 32688138 TABLE 9

Methyl Malonyl CoA epimerase

NCIB NCIB entry entry number

Organism Name number Organism Name

Hippocampus comes 109514419 Streptomyces sp. SAT1 32625736

Streptomyces violaceusniger Tu

Nothobranchius furzeri 107381615 4113 32482251

Austrofundulus limnaeus 106534832 Selenomonas noxia ATCC 43541 32475307

Anser cygnoides domesticus 106033721 Mycobacterium sp. KMS 32418342

Cercocebus atys 105576556 Mycobacterium mucogenicum 32362758

Mandrillus leucophaeus 105540149 Bradyrhizobium sp. 32226671

Leisingera daeponensis DSM

Bison bison bison 104990924 23529 32201899

Chlorocebus sabaeus 103220075 Methylobacterium populi 32089388

Balaenoptera acutorostrata

scammoni 103016270 Rhizobium sp. BR10423 32043571

Ovis aries 101117702 Methylobacterium populi BJ001 31775184

Rhizobium rhizogenes NBRC

Oreochromis niloticus 100692528 13257 31557027

Nomascus leucogenys 100582694 Streptomyces albidoflavus 31254397

Sus scrofa 100037986 Streptomyces lividans TK24 29658558

Lingula anatina 106180158 Anoxybacillus gonensis 29574130

Streptomyces rimosus subsp.

Acanthaster planci 110988969 rimosus 29534417

Parageobacillus

Myotis lucifugus 102422453 thermoglucosidans 29240020

Xenopus tropica lis 448311 Haloferax gibbonsii 25245643

Galdieria sulphuraria 17086930 Natronococcus occultus SP4 14402362

Mustela putorius furo 101675426 Aciduliprofundum sp. MAR08-339 14306316

Polysphondylium pallidum PN500 31358889 Aciduliprofundum boonei T469 8828323

Methylobacterium radiotolerans

Dictyostelium purpureum 10499066 JCM 2831 6138072

Trichinella spiralis 10905540 Salinispora arenicola CNS-205 5704879

Phascolarctos cinereus 110195733 Rhodococcus jostii RHA1 4219237

Mycobacterium smegmatis str.

Sturnus vulgaris 106851861 MC2 155 4534545

Candidatus Nitrosomarinus

Fundulus heteroclitus 105916324 catalina 32901289

Pteropus alecto 102890862 Candidatus Nitrosotenuis cloacae 24875127

Candidatus Nitrosopelagicus

Tupaia chinensis 102502962 brevis 24816644

Alligator sinensis 102378122 Thermococcus barophilus 26135397

Myotis brandtii 102239835 Thermococcus barophilus 26135305

Anas platyrhynchos 101790690 Thermococcus eurythermalis 25152745

Heterocephalus glaber 101724683 Palaeococcus pacificus DY20341 24842700

Saimiri boliviensis 101041483 Palaeococcus pacificus DY20341 24842092

Papio a nub is 100999745 Caulobacter crescentus NA1000 7333339

Rhodospirillum rubrum ATCC

Pan paniscus 100984837 11170 3834989

Otolemur garnettii 100949302 Streptomyces sp. CB02488 32601170

Streptomyces natalensis ATCC

Cavia porcellus 100715623 27448 32549072

Spizellomyces punctatus DAOM

BR117 27690468 Mycobacterium heraklionense 32458287

Salpingoeca rosetta Sinorhizobium americanum 32143006 TABLE 9

Methyl Malonyl CoA epimerase

NCIB NCIB entry entry number

Organism Name number Organism Name

Capsaspora owczarzaki ATCC

30864 14896150 Sinorhizobium americanum 32140384

Dictyostelium fasciculatum 14875250 Agrobacterium arsenijevicii 31903259

Mesorhizobium ciceri biovar

biserrulae WSM1271 10118777 Paenarthrobacter aurescens 7 ^' CI 29624390

Exaiptasia pallida 110243151 Pseudomonas fluoresceins Fl . 13 11831702

Salmo salar 106562156 Sinorhizobium medicae WSM ^< U 9 5321747

Corynebacterium Streptomyces roseochromoge '.nus

pseudotuberculosis C231 12299262 subsp. oscitans DS 12.976 33112221

Elizabethkingia anophelis NUHP1 23374225 Streptomyces griseoruber 32320310

Corynebacterium diphtheriae 29421149 Streptomyces griseoruber 32313303

Pyrococcus yayanosii CHI 10838260 Leishmania donovani 13388836

Candidatus Nitrosopumilus

sediminis 13696880 Amycolatopsis mediterranei L 132 9435794

Metallosphaera cuprina Ar-4 10493706 Lates calcarifer 108889699

Thermococcus barophilus MP 10041374 Acidovorax sp. Root217 33121974

Ferroglobus placidus DSM 10642 8779361 Rhizobium sp. Rootl334 32610752

Thermococcus gammatolerans

EJ3 7988333 Sphingomonas sp. Leaf34 29954786

Thermococcus sp. AM4 7419559 Rhinolophus sinicus 109459023

Natronomonas pharaonis DSM

2160 3702757 Hipposideros armiger 109372172

Propionibacterium acnes

KPA171202 2931984 Crocodylus porosus 109308953

Sulfolobus tokodaii str. 7 1458500 Scleropages formosus 108931154

Prevotella ruminicola 23 31500800 Nanorana parkeri 108783664

Bacillus amyloliquefaciens DSM 7 9781389 Lepidothrix coronata 108507706

Mycobacterium avium subsp.

paratuberculosis K-10 2719186 Kryptolebias marmoratus 108228359

Rhodococcus equi 103S 32491254 Pteropus vampyrus 105304831

Flavobacterium johnsoniae

UW101 31763532 Corvus comix comix 104684031

Rhodococcus erythropolis

CCM2595 31543428 Manacus vitellinus 103761359

Mycobacterium colombiense

CECT 3035 31528911 Corvus brachyrhynchos 103619374

Sulfolobus islandicus REY15A 12417107 Callorhinchus milii 103179162

Mycobacterium intracellular

ATCC 13950 11908356 Python bivittatus 103047981

Bacteroides thetaiotaomicron 31615845 Astyanax mexicanus 103042912

Bacteroides cellulosilyticus 29608869 Ficedula albicollis 101813177

Bacteroides ovatus 29456114 Monodelphis domestica 100021595

Sulfolobus solfataricus 24887889 Thermococcus thioreducens 33334459

Sulfolobus solfataricus 24866817 Thermococcus thioreducens 33333207

Sulfolobus islandicus Y.N.15.51 7810776 Thermococcus gorgonari us 33330987

Sulfolobus islandicus Y. G.57.14 7806370 Thermococcus radiotolerans 33328326

Sulfolobus islandicus M.14.25 7796457 Thermococcus radiotolerans 33327280

Flavonifractor plautii 33068672 Thermococcus barossii 33325276

Gordonia amicalis NBRC 100051

= JCM 11271 31833479 Thermococcus celer 33323291

Bacteroides stercoris ATCC 31795837 Thermococcus chitonophagus 33322778

TABLE

TABLE 9

NCIB NCIB entry entry number

Organism Mame number Organism Name

Pyrococcus abyssi GE5 1495138 Nocardia mikamii NBRC 108933 29871230

Leishmania major strain Friedlin 5652737 Mycobacterium sp. GA-1331 27920029

Leishmania braziliensis

MHOM/BR/75/M2904 5416356 Mycobacterium sp. GA-1331 27917718

Leishmania infantum JPCM5 5069718 Haloferax gibbonsii 25247766

Thermanaero vibrio

acidaminovorans DSM 6589 8630100 Halobacterium sp. DL1 25140654

Bradyrhizobium genosp. SA-4 str.

Rhodococcus fascians D188 29801269 CB756 23259915

Auxenochlorella protothecoides 23617379 Caenorhabditis remanei 9804350

Leishmania panamensis 22575907 Sulfolobus islandicus L.D.8.5 8760061

Galdieria sulphuraria 17088890 Ixodes scapularis 8051513

Dictyoglomus turgidum DSM

Schistosoma haematobium 24589270 6724 7082761

Leishmania mexicana

MHOM/GT/2001/U1103 13449355 Chloroflexus aurantiacus J-10-fl 5827511

Panthera pardus 109273319 Caldivirga maquilingensis IC-167 5709921

Pygocentrus nattereri 108413430 Sulfolobus solfataricus P2 1453897

Bacillus subtilis subsp. subtilis

Manis javanica 108396842 str. 168 938689

Mycobacterium smegmatis str.

Ictalurus punctatus 108259323 MC2 155 4533011

Mycobacterium tuberculosis

Larimichthys crocea 104919241 H37Rv 3205097

Bradyrhizobium diazoefficiens

Fukomys damarensis 104872059 USD A 110 1051717

Thecamonas trahens ATCC

50062 25560750 Mycobacterium leprae TN 910255

Rhodobacter sphaeroides 2.4.1 3718390 Sinorhizobium meliloti 1021 1233967

Branchiostoma belcheri 109469659 Rhodopirellula baltica SH 1 1796046

Sinocyclocheilus anshuiensis 107700438 Deinococcus radiodurans Rl 1798608

Rhodococcus erythropolis

Sinocyclocheilus grahami 107595079 CCM2595 31540588

Sinocyclocheilus grahami 107585993 Mycobacterium abscessus 5964898

Dictyostelium discoideum AX4 8619910 Mycobacterium abscessus 5963983

Streptomyces griseus subsp.

griseus NBRC 13350 6215637 Aureococcus anophagefferens 20219426

Pyrococcus yayanosii CHI 10837161 Aureococcus anophagefferens 20218602

Veillonella parvula DSM 2008 8636716 Trichoplax adhaerens 6752137

Halobi forma lacisalsi AJ5 30922123 Lottia gigantea 20234368

Bacillus megaterium NBRC

15308 = ATCC 14581 29909687 Helobdella robusta 20200172

Cutibacterium avidum 44067 29842788 Trichomonas vaginalis G3 5463999

Candidatus Nitrosopumilus

sediminis 13696734 Methylobacterium aquaticum 32428781

Haloquadratum walsbyi C23 12447399 Mycobacterium bovis AF2122/97 32286265

Lachnospiraceae bacterium

Acidianus hospitalis Wl 10601722 3 1 57FAA CT1 29726547

Thermococcus barophilus MP 10040400 Bacillus simplex 29413577

Haloferax volcanii DS2 8926349 Sphaeroforma arctica JP610 25900729

Thermococcus sibiricus MM 739 8096543 Acytostelium subglobosum LB1 24524298

Thermococcus sibiricus MM 739 8096403 TABLE 10

TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Pedobacter agri PB92 32180002 Leuconostoc mesenteroides 29576429 subsp. mesenteroides ATCC

8293

Frankia casuarinae 32155700 Lactobacillus brevis ATCC 367 4413816

Curtobacterium flaccumfaciens UCD- 31843454 Lactobacillus delbrueckii 4083535

AKU subsp. bulgaricus ATCC

11842 = J CM 1002

Geobacillus thermodenitrificans NG80-2 31761544 Oryza rufipogon 12486634

Prevotella ruminicola 23 31500801 Oryza meridionalis 11763657

Rhodobacter capsulatus SB 1003 31489845 Flavobacterium 5300584 psychrophilum JIP02/86

Sphingobium japonicum UT26S 29273320 Acinetobacter pittii PHEA-2 11638184

Metallosphaera sedula 25466586 Homo sapiens 5096

Metallosphaera sedula 25464231 Mus musculus 66904

Metallosphaera sedula 25459533 Nomascus leucogenys 100602191

Haloarcula hispanica ATCC 33960 11050415 Mandrillus leucophaeus 105553870

Haloarcula hispanica ATCC 33960 11049647 Rattus norvegicus 24624

Halopiger xanaduensis SH-6 10797647 Arabidopsis thaliana 829549

Haloarcula marismortui A TCC 43049 3130168 Bos taurus 515902

Rhizobium mesoamericanum STM3625 31826135 Heterocephalus glaber 101699369

Mycobacterium colombiense CECT3035 31528490 Sus scrofa 100158147

Agrobacterium vitis S4 31497680 Danio rerio 405861

Variovorax paradoxus EPS 29719694 Pan troglodytes 104001059

Paenarthrobacter aurescens TCI 29626265 Colobus angolensis palliatus 105523361

Streptomyces venezuelae ATCC 10712 28673847 Rhinopithecus roxellana 104663562

Streptomyces venezuelae ATCC 10712 28673102 Haliaeetus albicilla 104320851

Streptomyces venezuelae ATCC 10712 28672499 Loxodonta africana 100667917

Delftia acidovorans SPH-1 24117181 Streptomyces coelicolor 1100367

A3(2)

Sulfolobus islandicus REY15A 12417146 Haliaeetus leucocephalus 104827855

Sulfolobus islandicus HVE10/4 12414288 Ursus maritimus 103678842

Streptomyces acidiscabies 84-104 33085098 Chrysemys picta 101935285

Streptomyces acidiscabies 84-104 33084982 Macaca mulatto 716964

Streptomyces acidiscabies 84-104 33082366 Callorhinchus mi Hi 103174815

Bacteroides ovatus 29451882 Macaca fascicularis 101864812

Bradyrhizobium japonicum USDA 6 29268814 Cricetulus griseus 100759926

Bradyrhizobium japonicum USDA 6 29267418 Ailuropoda melanoleuca 100471039

Sulfolobus solfataricus 24887925 Acinonyx jubatus 106976830

Sulfolobus solfataricus 24866854 Austrofundulus limnaeus 106525538

Haloferax volcanii DS2 8924759 Apteryx australis mantelli 106485693

Sulfolobus islandicus Y.N.15.51 7808853 Fundulus heteroclitus 105935374

Sulfolobus islandicus Y.G.57.14 7806245 Aotus nancymaae 105716496

Sulfolobus islandicus M.14.25 7796493 Cercocebus atys 105586409

Streptomyces aureofaciens 20472995 Macaca nemestrina 105469912

Wolbachia endosymbiont wPip_Mol of 33019539 Aquila chrysaetos canadensis 105411780

Culex molestus

Gordonia terrae 32688032 Fukomys damarensis 104863184 TABLE LO

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Streptomyces violaceusniger Tu 4113 32485453 Cynoglossus semilaevis 103379014

Streptomyces violaceusniger Tu 4113 32480391 Python bivittatus 103052006

Mycobacterium mucogenicum 32362084 Panthera tigris altaica 102965518

Bradyrhizobium sp. 32226308 Myotis lucifugus 102434764

Methylobacterium populi 32086682 Xiphophorus maculatus 102221338

Acidovorax radicis N35 31813009 Chrysemys picta 101953867

Bacteroides stercoris ATCC 43183 31795838 Ovis aries 101113555

Methylobacterium populi BJOOl 31774535 Felis catus 101082847

Brachyspira hyodysenteriae ATCC 27164 31720570 Cavia porcellus 100729570

Rhizobium rhizogenes NBRC 13257 31556541 Leptomonas pyrrhocoris 26902086

Streptomyces albidoflavus 31252952 Ciona intestinalis 100177738

Corynebacterium amycolatum SK46 29693072 Pelodiscus sinensis 102448257

Corynebacterium amycolatum SK46 29693054 Corynebacterium jeikeium 3432023

K411

Gardnerella vaginalis 409-05 29692256 Nothobranchius furzeri 107394313

Streptomyces lividans TK24 29662957 Emiliania huxleyi CCMP1516 17258570

Streptomyces lividans TK24 29659022 Parus major 107208737

Streptomyces lividans TK24 29657618 Octopus bimaculoides 106867520

Corynebacterium diphtheriae 29422173 Esox lucius 105011683

Bifidobacterium breve DSM 20213 = 29242344 Pygoscelis adeliae 103913981 JCM 1192

Actinomyces odontolyticus ATCC 17982 25045222 Aptenodytes forsteri 103898459

Sulfolobus islandicus L.D.8.5 8760098 Dictyostelium discoideum 8620450

AX4

Salinispora arenicola CNS-205 5705196 Gallus gallus 768706

Thermofilum pendens Hrk 5 4601265 Leishmania major strain 5653255

Friedlin

Rhodococcus jostii RHA1 4225824 Leishmania major strain 5649808

Friedlin

Rhodococcus jostii RHA1 4223843 Leishmania braziliensis 5416957

MHOM/BR/75/M2904

Rhodococcus jostii RHA1 4221295 Leishmania infantum JPCM5 5067238

Sulfolobus solfataricus P2 1453929 Xenopus tropicalis 613054

Streptomyces griseus subsp. griseus 6209253 Giardia lamblia ATCC 50803 5698516 NBRC 13350

Candidatus Nitrosotenuis cloacae 24874506 Entamoeba histolytica HM- 3406137

l.-IMSS

Candidatus Nitrosopelagicus brevis 24817057 Mycobacterium tuberculosis 886064

H37Rv

Thermofilum sp. 1910b 16572990 Bradyrhizobium 1053929

diazoefficiens USD A 110

Desulfurococcus mucosus DSM 2162 10153077 Bradyrhizobium 1051292

diazoefficiens USD A 110

Thermosphaera aggregans DSM 11486 9165434 Bradyrhizobium 1049879

diazoefficiens USD A 110

Desulfurococcus kamchatkensis 1221n 7170846 Cyanidioschyzon merolae 16997748

strain 10D TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Corynebacterium aurimucosum 31608273 Cyanidioschyzon merolae 16995147 strain 10D

Haloquadratum walsbyi C23 12448355 Thalassiosira pseudonana 7443812

CCMP1335

Haloquadratum walsbyi DSM 16790 4193679 Thalassiosira pseudonana 7443455

CCMP1335

Arthrobacter sp. ATCC 21022 32617278 Metarhizium robertsii ARSEF 19255944

23

Halanaeroarchaeum sulfurireducens 25159850 Xenopus laevis 399045

Microbacterium maritypicum MF109 23837512 Xenopus laevis 399045

Sulfolobus acidocaldarius Ron 12/1 14550791 Auxenochlorella 23617137 protothecoides

Caulobacter crescentus NA1000 7333386 Leishmania panamensis 22576495

Mycobacterium smegmatis str. MC2 4534965 Galdieria sulphuraria 17085990 155

Haloarcula marismortui A TCC 43049 3130295 Penicillium expansum 27677027

Streptomyces natalensis ATCC 27448 32548369 Coprinopsis cinerea 6015553 okayama7#130

Mycobacterium heraklionense 32460038 Equus caballus 100065950

Mycobacterium heraklionense 32459566 Saprolegnia parasitica CBS 24127352

223.65

Curtobacterium oceanosedimentum 32451837 Acanthamoeba castellanii 14915292 str. Neff

Streptomyces albulus 32393106 Trichinella spiralis 10904760

Sinorhizobium americanum 32143856 Metarhizium majus ARSEF 26278007

297

Agrobacterium arsenijevicii 31900510 Leishmania mexicana 13454828

MHOM/GT/2001/U1103

Kocuria kristinae 31636137 Leishmania mexicana 13450544

MHOM/GT/2001/U1103

Rhodococcus pyridinivorans SB3094 29939038 Sphaerulina musiva SO2202 27907528

Mycobacterium fortuitum 29425832 Trametes versicolor FP- 19419776

101664 SSI

Streptomyces roseochromogenus subsp. 33111552 Poecilia reticulata 103458424 oscitans DS 12.976

Streptomyces roseochromogenus subsp. 33111303 Poecilia formosa 103146540 oscitans DS 12.976

Streptomyces roseochromogenus subsp. 33109736 Astyanax mexicanus 103029063 oscitans DS 12.976

Streptomyces griseoruber 32315994 Peromyscus maniculatus 102917404 bairdii

Streptomyces griseoruber 32314427 Pteropus alecto 102883888

Bacteroides thetaiotaomicron 31615615 Myotis davidii 102753857

Amycolatopsis japonica 29591903 Alligator mississippiensis 102562961

Amycolatopsis japonica 29585283 Vicugna pacos 102535054

Acidovorax sp. Root217 33120357 Tupaia chinensis 102501295

Methylobacterium sp. Leaf456 32606194 Columba livia 102093066

Sphingomonas sp. Leaf34 29954760 Ficedula albicollis 101821408 TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Sulfolobus acidocaldarius 33344835 Anolis carolinensis 100558858

Sulfolobus acidocaldarius 33342418 Oryctolagus cuniculus 100340508

Sulfolobus acidocaldarius 33340027 Monodelphis domestica 100016647

Sulfolobus acidocaldarius 33337703 Spizellomyces punctatus 27691253

DAOM BR117

Sulfolobus acidocaldarius 33335350 Sphaeroforma arctica JP610 25907311

Brevundimonas nasdae 33055278 Thecamonas t rah ens ATCC 25565910

50062

Streptomyces seoulensis 33046319 Exophiala aquamarina CBS 25278990

119918

Streptomyces seoulensis 33044446 Aphanomyces astaci 20805706

Streptomyces sp. AS58 32588550 Fonticula alba 20525936

Prevotella sp. FD3004 32573194 Exophiala dermatitidis 20313376

NIH/UT8656

Rhizobium leucaenae USDA 9039 32527341 Phytophthora parasitica 20183907

INRA-310

Microbacterium testaceum StLB037 32515675 Aphanomyces invadans 20084333

Streptomyces iranensis 32470396 Entamoeba nuttalli P19 20076103

Methylobacterium aquaticum 32432099 Saprolegnia diclina VS20 19940873

Mycobacterium sp. KMS 32419469 Cladophialophora yegresii 19174894

CBS 114405

Caulobacter henricii 32403380 Salpingoeca rosetta 16077804

Streptomyces resistomycificus 32391631 Dictyostelium fasciculatum 14871042

Streptomyces resistomycificus 32387010 Phytophthora infestans T30-4 9478653

Streptomyces resistomycificus 32385744 Ixodes scapularis 8032893

Kitasatospora purpeofusca 32380355 Pyrenophora tritici-repentis 6344805

Pt-lC-BFP

Kitasatospora purpeofusca 32379914 Tribolium castaneum 661503

Streptomyces lydicus 32333336 Strongylocen trot us 592281 purpuratus

Streptomyces lydicus 32330957 Chelonia mydas 102929332

Agrobacterium rhizogenes 32305072 Anas platyrhynchos 101800887

Agrobacterium rhizogenes 32296647 Ceratotherium simum simum 101408687

Bradyrhizobium sp. 32221357 Galendromus occidentalis 100898601

Leisingera daeponensis DSM 23529 32201712 Hydra vulgaris 100211938

Mesorhizobium amorphae 32102936 Wolbachia endosymbiont of 32545718

CCNWGS0123 Drosophila simulans wNo

Mycobacterium heraklionense 32094771 Capnocytophaga ochracea 29675612

DSM 7271

Mycobacterium heraklionense 32093974 Frankia casuarinae 32158333

Rhizobium sp. BR10423 32044955 Halopiger xanaduensis SH-6 10797605

Rhizobium sp. BR10423 32043956 Haloarcula marismortui ATCC 3130762

43049

Microbacterium hydrocarbonoxydans 32039639 Rhizobium tropici CI AT 899 32497322

NBRC 103074

Leisingera aquaemixtae 32016082 Mycobacterium colombiense 31526763

CECT3035

Microbacterium foliorum 31895539 Mycobacterium fortuitum 29426099 TABLE LO

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Mesorhizobium plurifarium 31890336 Streptomyces venezuelae 28670497

ATCC 10712

Mesorhizobium plurifarium 31889043 Bacteroides 31616261

thetaiotaomicron

Actinomyces oris 31655414 Bacteroides 31615844

thetaiotaomicron

Rhizobium rhizogenes NBRC 13257 31562172 Amycolatopsis japonica 29586727

Streptomyces ciscaucasicus 31300205 Natrinema pellirubrum DSM 14333504

15624

Streptomyces ciscaucasicus 31296916 Natronobacterium gregoryi 14209565

SP2

Streptomyces ciscaucasicus 31296281 Halogeometricum 9993611

borinquense DSM 11551

Streptomyces ciscaucasicus 31292613 Haloferax volcanii DS2 8926573

Streptomyces reticuli 31267168 Natrialba magadii ATCC 8824965

43099

Streptomyces reticuli 31265692 Gordonia terrae 32689327

Sphingomonas paucimobilis NBRC 29861735 Gordonia terrae 32686414 13935

Rothia dentocariosa ATCC 17931 29744393 Mycobacterium 32363212

mucogenicum

Anoxybacillus gonensis 29575164 Mycobacterium 32362687

mucogenicum

Bacillus simplex 29412165 Gordonia amicalis NBRC 31833874

100051 = JCM 11271

Mycobacterium sp. GA-1331 27921469 Gordonia amicalis NBRC 31832845

100051 = JCM 11271

Mycobacterium sp. GA-1331 27919050 Gordonia amicalis NBRC 31830638

100051 = JCM 11271

Halobacterium hubeiense 26659510 Fusobacterium nucleatum 31730967

Thermofilum carboxyditrophus 1505 25406832 Fusobacterium necrophorum 31520985

subsp. funduliforme ATCC

51357

Thermofilum sp. 1807-2 25400698 Streptomyces albus subsp. 26156464

albus

Halostagnicola larsenii XH-48 25144902 Haloferax gibbonsii 25246758

Bradyrhizobium genosp. SA-4 str. CB756 23255154 Salinispora arenicola CNS- 5708171

205

Bradyrhizobium genosp. SA-4 str. CB756 23253712 Rhodococcus jostii RHA1 4224121

Streptomyces virginiae 23222147 Rhodococcus jostii RHA1 4221617

Streptomyces virginiae 23221511 Rhodococcus jostii RHA1 4217557

Streptomyces virginiae 23219775 Mycobacterium smegmatis 4537303

str. MC2 155

Natronococcus occultus SP4 14404536 Mycobacterium leprae TN 909674

Pyrenophora tritici-repentis Pt-lC-BFP 6338437 Mycobacterium smegmatis 4536218

str. MC2 155

Pyrococcus abyssi GE5 1496238 Caulobacter crescentus CB15 942750

Anaplasma phagocytophilum str. HZ 3930228 Mycobacterium leprae TN 910005 TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Tropheryma whipplei str. Twist 29577975 Mycobacterium leprae TN 908326

Thermotoga petrophila RKU-1 29653493 Sinorhizobium fredii NGR234 7789410

Hyperthermus butylicus DSM 5456 4782288 Agrobacterium fabrum str. 1135460

C58

Corynebacterium aurimucosum ATCC 31923183 Rickettsia prowazekii str. 883628 700975 Madrid E

Sulfolobus islandicus LAL14/1 15296735 Gardnerella vaginalis ATCC 9904807

14019

Bacillus licheniformis DSM 13 = ATCC 3027820 Thermotoga maritima MSB8 898383 14580

Microbacterium testaceum StLB037 32511700 Corynebacterium 31608130 aurimucosum

Ruegeria mobilis F1926 28249111 Halobacterium salinarum Rl 5952621

Metallosphaera sedula 25461882 Salinibacter ruber DSM 3850675

13855

Metallosphaera sedula 25457184 Halobacterium salinarum 1447433

NRC-1

Haloarcula hispanica N601 23805723 Marinobacter sp. ES-1 32569514

Haloarcula hispanica N601 23803802 Acinetobacter pittii PHEA-2 11637004

Bacillus atrophaeus subsp. globigii 23410505 Mycobacterium smegmatis 4535868 str. MC2 155

Halomicrobium mukohataei DSM 12286 8412119 Bacteroides fragilis YCH46 3084613

Halomicrobium mukohataei DSM 12286 8411822 Bacteroides fragilis YCH46 3082134

Mesorhizobium amorphae 32100251 Bacteroides fragilis YCH46 3082066 CCNWGS0123

Cupriavidus taiwanensis LMG 19424 29764233 Deinococcus radiodurans Rl 1800332

Ochrobactrum anthropi ATCC 49188 5379348 Deinococcus radiodurans Rl 1799452

Salinispora tropica CNB-440 5057299 Leptospira interrogans 1151776 serovar Lai str. 56601

Sulfolobus solfataricus 27428763 Mustela putorius furo 101694429

Sulfolobus solfataricus 25402711 Mycobacterium 32462258 heraklionense

Streptomyces scabiei 87.22 24312912 Mycobacterium 32460353 heraklionense

Streptomyces scabiei 87.22 24308448 Rhodococcus pyridinivorans 29939100

SB3094

Bacteroides vulgatus ATCC 8482 5304063 Rhodococcus pyridinivorans 29938548

SB3094

Bacteroides vulgatus ATCC 8482 5303455 Pseudomonas syringae pv. 3367037 syringae B728a

Bacteroides vulgatus ATCC 8482 5302431 Bacteroides 1076212 thetaiotaomicron VPI-5482

Halogeometricum borinquense DSM 9988952 Bacteroides 1075528 11551 thetaiotaomicron VPI-5482

Sulfolobus islandicus M.16.27 7813378 Bacteroides 1071623 thetaiotaomicron VPI-5482

Sulfolobus islandicus L.S.2.15 7797353 Nannospalax galili 103740965 TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Rhizobium giardinii bv. giardinii HI 52 32524191 Bordetella parapertussis 13889371

Bpp5

Micromonospora aurantiaca ATCC 32161486 Leishmania donovani 13389525

27029

Mesorhizobium loti NZP2037 31702830 Leishmania donovani 13386864

Bacteroides uniformis ATCC 8492 31506040 Leishmania donovani 13386862

Streptomyces ghanaensis ATCC 14672 29710676 Nothobranchius furzeri 107392065

Corynebacterium amycolatum SK46 29693573 Oryzias latipes 101168086

Bradyrhizobium elkanii USDA 76 23090132 Miniopterus natalensis 107546075

Bradyrhizobium elkanii USDA 76 23088942 Rousettus aegyptiacus 107508499

Bradyrhizobium elkanii USDA 76 23085125 Coturnix japonica 107317853

Sulfolobus solfataricus 98/2 12256797 Protobothrops 107285889 mucrosguamatus

Halanaeroarchaeum sulfurireducens 26011019 Marmota marmota marmota 107143372

Corynebacterium aurimucosum ATCC 31925016 Gekko japonicus 107123561

700975

Corynebacterium simulans 29535890 Cyprinodon variegatus 107085097

Corynebacterium simulans 29534669 Poecilia latipinna 106947755

Candidatus Nitrosopumilus adriaticus 24821139 Poecilia mexicana 106912615

Halalkalicoccus jeotgali B3 9419193 Calidris pugnax 106889332

Sulfolobus acidocaldarius DSM 639 3474819 Sturnus vulgaris 106849700

Myroides profundi 31882988 Eguus asinus 106823176

Sulfolobus acidocaldarius N8 14548482 Thamnophis sirtalis 106540168

Streptomyces collinus Tu 365 32542670 Clupea harengus 105900598

Comamonas testosteroni TK102 31565622 Microcebus murinus 105884059

Sphingopyxis fribergensis 29949283 Propithecus coguereli 105825539

Sphingopyxis fribergensis 29946884 Pteropus vampyrus 105300824

Neorhizobium galegae bv. orientalis str. 24259527 Camelus dromedarius 105085280

HAMBI 540

Haloterrigena turkmenica DSM 5511 8742329 Camelus bactrianus 105063242

Streptomyces scabiei 87.22 24310521 Esox lucius 105019798

Frigoribacterium sp. Leaf254 31951610 Bison bison bison 105001820

Methylobacterium aguaticum 32427170 Mesitornis unicolor 104533561

Caulobacter henricii 32401090 Antrostomus carolinensis 104518057

Mesorhizobium loti NZP2037 31700652 Haliaeetus albicilla 104310782

Streptomyces albidoflavus 31256376 Gavia stellata 104258496

Streptomyces atroolivaceus 31232659 Pelecanus crisp us 104036967

Streptomyces atroolivaceus 31232099 Galeopterus variegatus 103606113

Streptomyces rimosus subsp. rimosus 29529393 Eguus przewalskii 103561449

Ensifer adhaerens 29521151 Calypte anna 103526040

Haloarcula sp. CBA1115 25157229 Stegastes partitus 103356059

Haloarcula sp. CBA1115 25156435 Eptesicus fuscus 103296318

Halobacterium sp. DL1 25142203 Chlorocebus sabaeus 103241626

Rothia mucilaginosa DY-18 25056071 Orycteropus afer afer 103194158 halophilic archaeon DL31 11095244 Lipotes vexil lifer 103069553

Halorubrum lacusprofundi ATCC 49239 7401589 Balaenoptera acutorostrata 102998024 scammoni TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Thermococcus barophilus MP 10040399 Physeter catodon 102984437

Thermococcus gammatolerans EJ3 7987083 Chelonia mydas 102937312

Bacillus megaterium NBRC 15308 = 29909689 Elephantulus edwardii 102848612

ATCC 14581

Selenomonas noxia ATCC 43541 32475304 Chrysochloris asiatica 102840671

Lysinibacillus fusiform is 29441477 Leptonychotes weddellii 102750575

Pyrococcus yayanosii CHI 10837162 Lepisosteus oculatus 102690697

Thermococcus barophilus 26135396 Camelus ferus 102512849

Thermococcus barophilus 26135304 Pelodiscus sinensis 102450414

Thermococcus eurythermalis 25152744 Myotis lucifugus 102419645

Palaeococcus pacificus DY20341 24842701 Bubalus bubalis 102400075

Thermococcus sibiricus MM 739 8096542 Alligator sinensis 102380210

Thermococcus sp. AM4 7418674 Latimeria chalumnae 102364951

Paeniclostridium sordellii 31745045 Pantholops hodgsonii 102341990

Bacillus simplex 29410564 Haplochromis burtoni 102291839

Thermococcus peptonophilus 27140301 Bos mutus 102281393

Geoglobus ahangari 24804150 Pundamilia nyererei 102195406

Archaeoglobus fulgidus DSM 8774 24795967 Pseudopodoces humilis 102113699

Pyrococcus furiosus DSM 3638 1468517 Zonotrichia albicollis 102062602

Pyrococcus sp. ST04 13021998 Falco cherrug 102049424

Pyrococcus horikoshii OT3 1443609 Geospiza fortis 102032119

Thermococcus litoralis DSM 5473 16550074 Chinchilla lanigera 102018112

Pyrococcus furiosus COM1 13302484 Microtus ochrogaster 101989813

Thermococcus cleftensis 13038346 lctidomys tridecemlineatus 101975980

Thermococcus sp. 4557 11015680 Echinops telfairi 101658390

Pyrococcus sp. NA2 10555352 Condylura cristata 101633329

Thermococcus onnurineus NA1 7017687 Jaculus jaculus 101601455

Thermococcus kodakarensis KOD1 3234141 Jaculus jaculus 101599818

Archaeoglobus fulgidus DSM 4304 1485447 Octodon degus 101567808

Selenomonas flueggei ATCC 43531 32476519 Ochotona princeps 101528954

Selenomonas ruminantium subsp. 31522306 Maylandia zebra 101478066 lactilytica TAM6421

Brevibacillus brevis NBRC 100599 29259984 Dasypus novemcinctus 101419647

Thermoanaerobacter wiegelii Rt8.Bl 11083949 O rein us orca 101277040

Archaeoglobus veneficus SNP6 10393898 Takifugu rubripes 101066926

Propionibacterium freudenreichii subsp. 29491822 Saimiri boliviensis 101045593 freudenreichii

Thermococcus sp. 2319x1 26650601 Pan paniscus 100979513

Thermococcus paralvinellae 24906218 Otolemur garnettii 100962050

Geoglobus acetivorans 24797348 Sarcophilus harrisii 100932360

Archaeoglobus sulfaticallidus PM70-1 15392156 Oreochromis niloticus 100698741

Centipeda periodontii DSM 2778 32173844 Taeniopygia guttata 100220499

Thermococcus guaymasensis DSM 27134688 Pongo abelii 100173745

11113

Thermococcus nautili 24958386 Streptomyces seoulensis 33045285

Corynebacterium pseudotuberculosis 12298318 Chryseobacterium 32138573

C231 indologenes TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Corynebacterium pseudotuberculosis 12298232 Mycobacterium 32095612 C231 heraklionense

Corynebacterium pseudotuberculosis 12298231 Pseudomonas koreensis 32069881 C231

Dehalococcoides mccartyi CG5 29935533 Chryseobacterium gallinarum 31907925

Bifidobacterium animalis subsp. lactis 29695178 Pseudomonas knackmussii 29899817 DSM 10140 B13

Bifidobacterium dentium JCM 1195 = 31605586 Acinetobacter beijerinckii CIP 29856692 DSM 20436 110307

Natronomonas pharaonis DSM 2160 3702470 Mycobacterium sp. GA-1331 27918831

Propionibacterium acnes KPA171202 2933139 Halobacterium hubeiense 26658362

Thalassospira xiamenensis M-5 = DSM 31926928 Haloferax gibbonsii 25245703 17429

Bacillus amyloliquefaciens DSM 7 9781390 Halostagnicola larsenii XH-48 25144591

Mycobacterium avium subsp. 2718637 Blastocysts hominis 24922107 paratuberculosis K-10

Rhodococcus equi 103S 32494044 Blastocysts hominis 24922017

Rhizobium etli CFN 42 24299263 Blastocysts hominis 24921391

Delftia acidovorans SPH-1 24115358 Blastocysts hominis 24921183

Mycobacterium intracellulare ATCC 11910863 Blastocysts hominis 24920162 13950

Bacteroides ovatus 29456169 Blastocysts hominis 24917924

Bacteroides ovatus 29452159 Blastocysts hominis 24917649

Halobiforma lacisalsi AJ5 30923350 Blastocysts hominis 24917516

Corynebacterium diphtheriae 29422380 Bradyrhizobium genosp. SA-4 23258810 str. CB756

Parageobacillus thermoglucosidans 29240019 Chloroflexus aurantiacus J- 5825237

10-fl

Prevotella melaninogenica ATCC 25845 9497401 Rhodobacter sphaeroides 3720067

2.4.1

Methylobacterium radiotolerans JCM 6138879 Therm us thermophilus HB8 3169461 2831

Candidatus Nitrosomarinus catalina 32901887 Therm us thermophilus HB8 3169364

Clavibacter michiganensis subsp. 29471706 Lingula anatina 106158332 sepedonicus

Mycobacterium avium subsp. 2719592 Parasteatoda tepidariorum 107438842 paratuberculosis K-10

Mycobacterium asiaticum DSM 44297 32559706 Acropora digitifera 107340305

Mycobacterium asiaticum DSM 44297 32555681 Acropora digitifera 107327488

Streptomyces natalensis ATCC 27448 32548235 Octopus bimaculoides 106873570

Agrobacterium arsenijevicii 31903262 Priapulus caudatus 106810656

Mycobacterium chelonae CCUG 47445 31681171 Vigna radiata 106780469

Mycobacterium chelonae CCUG 47445 31677760 Salmo salar 106575421

Mycobacterium colombiense CECT3035 31527644 Salmo salar 106574468

Streptomyces rubrolavendulae 33066215 Lingula anatina 106177186

Natrialbaceae archaeon JW/NM-HA 15 32892484 Biomphalaria glabrata 106055804

Cellulosimicrobium cellulans 136 32511286 Vollenhovia emeryi 105557737

Geobacillus subterraneus 32408672 Crassostrea gigas 105329204 TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Streptomyces viridifaciens 32354438 Buceros rhinoceros silvestris 104497808

Rothia dentocariosa 32323435 Cuculus canorus 104066596

Geobacillus thermoleovorans 32064196 Diaphorina citri 103520328

Bacillus pumilus 31668743 Poecilia reticulata 103463128

Streptomyces reticuli 31265131 Neolamprologus brichardi 102797562

Streptomyces reticuli 31261087 Lepisosteus oculatus 102690218

Nocardia mikamii NBRC 108933 29872704 Pantholops hodgsonii 102345054

Mycobacterium kansasii ATCC 12478 29700954 Pantholops hodgsonii 102335696

Pyrodictium delaneyi 26099577 Pantholops hodgsonii 102334999

Culex quinquefasciatus 6048360 Pantholops hodgsonii 102332676

Brucella melitensis bv. 1 str. 16M 29593610 Pantholops hodgsonii 102331480

Propionibacterium freudenreichii subsp. 29491625 Pantholops hodgsonii 102328581 freudenreichii

Porphyromonas gingiva lis ATCC 33277 29255732 Pantholops hodgsonii 102326839

Chromobacterium violaceum ATCC 24945725 Pantholops hodgsonii 102317405

12472

Parabacteroides distasonis ATCC 8503 5305812 Pantholops hodgsonii 102315076

Parabacteroides distasonis ATCC 8503 5305254 Aplysia calif ornica 101862941

Parabacteroides distasonis ATCC 8503 5305166 Odobenus rosmarus 101363296 divergens

Bacteroides uniformis ATCC 8492 31504898 Trichechus manatus 101354598 latirostris

Micrococcus luteus NCTC 2665 7986479 Sarcophilus harrisii 100934782

Bifidobacterium adolescentis ATCC 4556546 Amphimedon queenslandica 100639421

15703

Rhodococcus fascians D188 29800847 Anolis carolinensis 100555942

Rhodococcus fascians D188 29796865 Saccoglossus kowalevskii 100375821

Rhizobium sp. Root651 32006893 Corynebacterium 31923182 aurimucosum ATCC 700975

Ha /oriental is sp. IM1011 30961504 Halalkalicoccus jeotgali B3 9420099

Ha /oriental is sp. IM1011 30961226 Haloarcula hispanica N601 23802839

Haloterrigena daqingensis 30955193 Natrinema sp. 17-2 13352825

Rhizobium leguminosarum bv. trifolii 23436276 Haloarcula hispanica ATCC 11052351

WSM1689 33960

Corynebacterium amycolatum SK46 29693575 Halomicrobium mukohataei 8412465

DSM 12286

Phialophora attae 28737268 Haloterrigena turkmenica 8740571

DSM 5511

Culex quinquefasciatus 6048928 Salinispora tropica CNB-440 5059849

Propionibacterium freudenreichii subsp. 29491815 Salinispora tropica CNB-440 5059227 freudenreichii

Veillonella parvula DSM 2008 8636715 Streptomyces davawensis 31225486

JCM 4913

Ferroglobus placid us DSM 10642 8779362 Streptomyces davawensis 31224896

JCM 4913

Caldicellulosiruptor bescii DSM 6725 31772665 Streptomyces davawensis 31224509

JCM 4913 TABLE LO

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Streptomyces sp. CB02488 32600322 Streptomyces davawensis 31224188

JCM 4913

Streptomyces sp. CB02488 32597718 Streptomyces albus subsp. 26155606

albus

Thermococcus thioreducens 33333208 Haloarcula sp. CBA1115 25154198

Thermococcus gorgonarius 33330988 Halobacterium sp. DL1 25141166

Thermococcus radiotolerans 33328325 Corynebacterium accolens 23250561

ATCC 49725

Thermococcus barossii 33325277 Corynebacterium accolens 23249442

ATCC 49725

Thermococcus celer 33323290 halophilic archaeon DL31 11096703

Thermococcus profundus 33319217 Corynebacterium simulans 29534627

Thermococcus siculi 33317493 Salinarchaeum sp. Harcht- 16180327

Bskl

Thermococcus sp. 5-4 33173686 Streptomyces collinus Tu 365 32539192

Flavonifractor plautii 33068832 Streptomyces ghanaensis 29708694

ATCC 14672

Streptomyces rubrolavendulae 33064774 Haloarcula sp. CBA1115 25157116

Streptomyces sp. SAT1 32631315 Halorubrum lacusprofundi 7400573

ATCC 49239

Streptomyces sp. SAT1 32626756 Mycobacterium bovis 32287700

AF2122/97

Acidovorax sp. RACOl 32622830 Penicillium expansum 27682491

Bradyrhizobium neotropicale 32582439 Penicillium expansum 27677390

Bradyrhizobium neotropicale 32582370 Aquifex aeolicus VF5 1193080

Bradyrhizobium neotropicale 32581696 Clostridium botulinum A str. 5186552

ATCC 3502

Streptomyces viridifaciens 32353249 Monoraphidium neglectum 25731432

Streptomyces lydicus 32339911 Solan um lycopersicum 101248139

Streptomyces lydicus 32339153 Solanum pennellii 107004153

Bradyrhizobium sp. AS23.2 32151645 Solan um tuberosum 102584328

Bradyrhizobium sp. AS23.2 32146531 Caenorhabditis elegans 180596

Ensifer sp. LC163 32106828 Aureococcus 20225809

anophagefferens

Achromobacter denitrificans NBRC 32054559 Pseudomonas sp. ATCC 32563092

15125 13867

Eisenbergiella tayi 31714609 Rhodococcus erythropolis 31539998

CCM2595

Streptomyces subrutilus 31291155 Mycobacterium colombiense 31529536

CECT3035

Streptomyces sp. MJM8645 31280497 Cupriavidus taiwanensis LMG 29764234

19424

Streptomyces sp. MJM8645 31280233 Variovorax paradoxus EPS 29714223

Nocardia mikamii NBRC 108933 29874567 Delftia acidovorans SPH-1 24114644

Sulfolobus sp. A20 28696391 Mycobacterium intracellulare 11910235

ATCC 13950

Thermococcus piezophilus 28495756 Paraburkholderia xenovorans 4009839

LB400 TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Nitrososphaera viennensis EN76 30682290 Bradyrhizobium japonicum 29265206

USDA 6

Pyrococcus kukulkanii 28490987 Pseudomonas protegens 29824499

CHA0

Streptomyces sp. CB02488 32599095 Bradyrhizobium elkanii USDA 23088041

76

Rhodococcus fascians D188 29799144 Ralstonia pickettii 121 6287917

Thermococcus sp. P6 33329334 Pseudomonas mendocina 5106072 ymp

Thermococcus pacificus 33315388 Rhodococcus jostii RHA1 4222948

Streptomyces subrutilus 31289255 Rhodococcus jostii RHA1 4220334

Streptomyces subrutilus 31288757 Caulobacter crescentus CB15 940958

Streptomyces ghanaensis ATCC 14672 29714051 Bradyrhizobium 1048504 diazoefficiens USDA 110

Aureobasidium namibiae CBS 147.97 25415861 Rhodococcus aetherivorans 29564520

Pseudomonas sp. ATCC 13867 32562181 Caulobacter crescentus 7330344

NA1000

Rhodococcus equi 103S 32494302 Deinococcus radiodurans Rl 1797979

Streptomyces albulus 32399856 Comamonas testosteroni 31567714

TK102

Mycobacterium colombiense CECT3035 31528977 Sphingopyxis fribergensis 29949537

Variovorax paradoxus EPS 29719988 Rhodococcus pyridinivorans 29939378

SB3094

Mycobacterium intracellulare ATCC 11907685 Moesziomyces antarcticus 26306485 13950

Pseudomonas fluorescens F113 11829833 Acidovorax sp. Root217 33123751

Bradyrhizobium japonicum USDA 6 29264182 Acidovorax radicis N35 31814953

Natrinema pellirubrum DSM 15624 14332506 Pseudomonas knackmussii 29897712

B13

Mycobacterium sp. KMS 32421727 Cupriavidus metallidurans 24154319

CH34

Acidovorax radicis N35 31814687 Cupriavidus metallidurans 24153427

CH34

Leptospira weilii serovar Topaz str. 29810885 Bradyrhizobium genosp. SA-4 23259767 LT2116 str. CB756

Anoxybacillus gonensis 29573668 Trichosporon asahii var. 25988742 asahii CBS 2479

Cupriavidus metallidurans CH34 24149244 Kalmanozyma brasiliensis 27418900

GHG001

Leptospira noguchii serovar Panama str. 23201255 Pseudozyma hubeiensis SY62 24107062 CZ214

Afipia broomeae ATCC 49717 23186745 Ustilago maydis 521 23567458

Acinetobacter gyllenbergii NIPH 230 23000323 Anthracocystis flocculosa PF- 19320239

1

Natronococcus occultus SP4 14402176 Aureococcus 20222153 anophagefferens

Pseudomonas mendocina ymp 5107842 Fonsecaea multimorphosa 27707281

CBS 102226 TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Geobacter sulfurreducens PCA 2687567 Cladophialophora bantiana 27703210

CBS 173.52

Mycobacterium fortuitum 29428679 Spizellomyces punctatus 27690812

DAOM BR117

Amycolatopsis mediterranei U32 9441010 Exophiala oligosperma 27353828

Amycolatopsis mediterranei U32 9437565 Cladophialophora immunda 27351287

Amycolatopsis mediterranei U32 9435163 Exophiala spinifera 27329656

Acidovorax sp. Root217 33123316 Exophiala xenobiotica 25332750

Mycobacterium sp. GA-1331 27917638 Fonsecaea pedrosoi CBS 25306957

271.37

Haloferax mediterranei ATCC 33500 13027675 Exophiala aquamarina CBS 25283495

119918

Marinobacter hydrocarbonoclasticus 31822082 Cladophialophora carrionii 19987689 ATCC 49840 CBS 160.54

Leptospira borgpetersenii serovar 4408068 Cladophialophora 19196863 Hardjo-bovis str. L550 psammophila CBS 110553

Mycobacterium colombiense CECT3035 31530286 Cladophialophora yegresii 19183819

CBS 114405

Haloferax mediterranei ATCC 33500 13028635 Streptomyces coelicolor 1100975

A3(2)

Acinetobacter bereziniae LMG 1003 = 23294780 Entamoeba dispar SAW760 5880557 CIP 70.12

Natronomonas moolapensis 8.8.11 14653202 Entamoeba invadens IP1 14889000

Streptomyces collinus Tu 365 32542733 Trichoplax adhaerens 6759887

Streptomyces collinus Tu 365 32540336 Sinorhizobium medicae 5318000

WSM419

Phaeobacter gallaeciensis DSM 26640 31845665 Necator americanus 25354492

Scedosporium apiospermum 27728576 Necator americanus 25349098

Scedosporium apiospermum 27722646 Nocardia mikamii NBRC 29873764

108933

Hammondia hammondi 20165949 Mesorhizobium ciceri biovar 10119154 biserrulae WSM1271

Neospora caninum Liverpool 13443549 Chlorella variabilis 17353705

Aciduliprofundum sp. MAR08-339 14306318 Trichoplax adhaerens 6755932

Galdieria sulphuraria 17087293 Batrachochytrium 18244262 dendrobatidis JAM81

Monoraphidium neglectum 25732110 Bifidobacterium 31839784 thermophilum RBL67

Monoraphidium neglectum 25732109 Butyrivibrio proteoclasticus 31782396

B316

Monoraphidium neglectum 25727790 Bacillus atrophaeus subsp. 23409941 globigii

Streptomyces griseus subsp. griseus 6213423 Natrinema sp. 17-2 13351212 NBRC 13350

Rhodococcus aetherivorans 29569442 Salinispora tropica CNB-440 5056458

Pseudomonas sp. ATCC 13867 32564297 Natrinema pellirubrum DSM 14335707

15624 TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Streptomyces venezuelae ATCC 10712 28672096 Natronobacterium gregoryi 14207764

SP2

Streptomyces violaceusniger Tu 4113 32486615 Natrialba magadii ATCC 8825952

43099

Mycobacterium sp. KMS 32418173 Mycobacterium sp. KMS 32417997

Mycobacterium mucogenicum 32363582 Mycobacterium 32362087 mucogenicum

Streptomyces albidoflavus 31257799 Micromonospora aurantiaca 32160724

ATCC 27029

Streptomyces lividans TK24 29656799 Anaerostipes hadrus DSM 31624286

3319

Streptomyces rimosus subsp. rimosus 29533802 Streptomyces rimosus subsp. 29529042 rimosus

Ralstonia pickettii 12J 6286546 Brevibacillus brevis NBRC 29261099

100599

Salinispora arenicola CNS-205 5707484 Salinispora arenicola CNS- 5707334

205

Mycobacterium smegmatis str. MC2 4533251 Penicillium chrysogenum 8304668 155 Wisconsin 54-1255

Podocarpus lambertii 18668466 Mycobacterium smegmatis 4532823 str. MC2 155

Chloroflexus aurantiacus J-10-fl 5826094 Streptomyces coelicolor 1101725

A3(2)

Frankia casuarinae 32156485 Lysinibacillus fusiformis 29439811

Acinetobacter pittii PHEA-2 11638930 Archaeoglobus profundus 8739637

DSM 5631

Bordetella pertussis Tohama 1 2664106 Bacillus megaterium NBRC 29909884

15308 = ATCC 14581

Xanthomonas campestris pv. campestris 1000858 Arthrobacter sp. ATCC 21022 32617361 str. ATCC 33913

Streptomyces griseoruber 32312679 Salinarchaeum sp. Harcht- 16180831

Bskl

Bordetella parapertussis Bpp5 13892533 Rhodospirillum rubrum ATCC 3834383

11170

Amycolatopsis mediterranei U32 9442063 Rhodospirillum rubrum ATCC 3834381

11170

Amycolatopsis mediterranei U32 9437091 Mycobacterium 32462055 heraklionense

Kitasatospora purpeofusca 32376423 Mycobacterium 32458116 heraklionense

Leisingera aguaemixtae 32015499 Mycobacterium fortuitum 29426846

Streptomyces ciscaucasicus 31295528 Blastocysts sp. subtype 4 26163289

Nocardia mikamii NBRC 108933 29876169 Tilletiaria anomala UBC 951 25265560

Mycobacterium kansasii ATCC 12478 29702018 Coccidioides posadasii C735 9696801 delta SOWgp

Mycobacterium sp. GA-1331 27920353 Bordetella bronchiseptica 13977564

253 TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Juniperus cedrus 26120179 Moniliophthora roreri MCA 19293537

2997

Lathyrus pubescens 24287469 Caenorhabditis briggsae 8586316

Retrophyllum piresii 20355856 Bacteroides oleiciplenus YIT 32502059

12058

Dictyoglomus turgidum DSM 6724 7081740 Geobacillus thermoleovorans 32063507

Dictyoglomus turgidum DSM 6724 7081739 Sphingobium yanoikuyae 31531176

ATCC 51230

Corynebacterium pseudotuberculosis 23675328 Bacillus simplex 29409986 C231

Lactobacillus sakei subsp. sakei 23K 29637789 Mycobacterium sp. GA-1331 27917079

Lactobacillus helveticus CNRZ32 16795114 Streptomyces albus subsp. 26153076 albus

Mycobacterium fortuitum 29425223 Afipia broomeae ATCC 49717 23185041

Pediococcus pentosaceus ATCC 25745 33062866 Afipia broomeae ATCC 49717 23184909

Pediococcus pentosaceus ATCC 25745 33061903 Capsaspora owczarzaki ATCC 14895037

30864

Oenococcus oeni PSU-1 4416207 Naegleria gruberi strain NEG- 8858372

M

Pediococcus acidilactici 31728474 Monosiga brevicollis MX1 5891846

Bacillus subtilis subsp. subtilis str. 168 936186 Chloroflexus aurantiacus J- 5826824

10-fl

Haemophilus parasuis SH0165 23375458 Bacteroides cellulosilyticus 29608927

Rhodopirellula baltica SH 1 1794220 Aureococcus 20228246 anophagefferens

Rhodopirellula baltica SH 1 1790530 Pyrenophora teres f. teres 0- 10513758

1

Gracilaria firma 31080772 Dictyostelium purpureum 10508038

Gracilaria firma 31080734 Trichoplax adhaerens 6750043

Geranium palmatum 9829827 Aspergillus nidulans FGSC A4 2869689

Juniperus virginiana 19019092 Phytophthora sojae 20649511

Juniperus scopulorum 19018971 Opisthorchis viverrini 20326168

Juniperus monosperma 19018850 Agaricus bisporus var. 18831514 burnettii JB137-S8

Juniperus bermudiana 19018731 Agaricus bisporus var. 18084392 bisporus H97

Pelargonium alternans 18129706 Phaeodactylum tricornutum 7200978

CCAP 1055/1

Viviania marifolia 18129445 Nematostella vectensis 5509452

Lactobacillus helveticus CNRZ32 16795323 Lottia gigantea 20231320

Desulfovibrio vulgaris str. 2795552 Helobdella robusta 20210422 Hildenborough

Amycolatopsis mediterranei U32 9434963 Emiliania huxleyi CCMP1516 17284515

Oryza meyeriana 32891162 Branchiostoma floridae 7248336

Oryza grandiglumis 32891029 Pseudocercospora fijiensis 19335089

CIRAD86

Oryza alta 32890896 Pantholops hodgsonii 102334736 TABLE L0

Methyl Ma lonyl CoA C. irboxytransferase

Organism Name NCIB Organism Name NCIB entry entry number number

Oryza eichingeri 32890763 Fonsecaea multimorphosa 27712943

CBS 102226

Oryza rhizomatis 32890630 Cladophialophora bantiana 27694779

CBS 173.52

Leersia japonica 32886802 Cladophialophora immunda 27348132

Oryza ridleyi 32886669 Verruconis gallopava 27316086

Oryza longiglumis 32886535 Verruconis gallopava 27312687

Oryza latifolia 32886403 Thecamonas t rah ens ATCC 25569966

50062

Ipomoea trifida 32880809 Exophiala xenobiotica 25332932

Gracilaria chilensis 27219457 Fonsecaea pedrosoi CBS 25307289

271.37

Gelidium vagum 27216065 Exophiala aquamarina CBS 25278844

119918

Gelidium elegans 27215831 Pandoraea pnomenusa 25003409

Sporolithon durum 27215595 Blastocysts hominis 24917968

Gracilariopsis lemaneiformis 26995341 Acytostelium subglobosum 24522573

LB1

Pelargonium australe 26046468 Guillardia theta CCMP2712 17312092

Pelargonium cotyledonis 26046323 Parastagonospora nodorum 5979473

SN15

Pelargonium dichondrifolium 26046178 Aspergillus terreus NIH2624 4353315

Komagataeibacter xylinus E25 25557572 Trichoderma reesei 0M6a 18487159

Caenorhabditis remanei 9800506

Caenorhabditis remanei 9804721

TABLE 11

Propionyl Co A Succinyl C oA Transferases

Organism Name NCIB Organism Name NCIB entry entry number number

Escherichia coli DH1 12873382 Pseudomonas 34132848 psychrotolerans

Acinetobacter towneri 31751435 Propionibacterium 13948540 acidipropionici A TCC 4875

Xanthomonas gardneri 31741034 Escherichia coli str. K-12 947408 substr. MG1655

Acidovorax soli 34233366 Streptomyces fulvissimus 15406103

DSM 40593

Acetobacter pasteurianus subsp. 34212717 Streptomyces fulvissimus 15404991 ascendens DSM 40593

Corynebacterium coyleae 34027415 Streptomyces fulvissimus 15404970

DSM 40593

Pseudomonas resinovorans NBRC 16145570 Streptomyces fulvissimus 15400165 106553 DSM 40593

Pseudomonas putida NBRC 14164 16133865 Streptomyces fulvissimus 15400164

DSM 40593

Escherichia coli str. K-12 substr. MDS42 14969320 Methylobacterium 29617876 extorguens AMI

Escherichia coli str. K-12 substr. W3110 12933335 Pseudomonas stutzeri DSM 13326458

10701

Escherichia coli W 12696931 Neurospora crassa OR74A 3881786

Escherichia coli 07:K1 str. CE10 12676159 Chaetomium thermophilum 18255552 var. thermophilum DSM 1495

Salmonella bongori NCTC 12419 10970061 Propionibacterium 9283801 freudenreichii subsp.

shermanii CIRM-BIAl

Pseudoalteromonas sp. SM9913 10038054 Aspergillus nidulans 3974706

Escherichia coli 0111:1-1- str. 11128 8488016 Escherichia coli O103:H2 str. 8476749

12009

Escherichia coli 026:1-111 str. 11368 8482559 Escherichia coli O103:H2 str. 8474133

12009

Escherichia coli 0157 :H7 str. TW14359 8218452

subunit Optimised sequence of S. cerevisiae

[0186] The disclosure of every patent, patent application, and publication cited herein is hereby incorporated herein by reference in its entirety.

[0187] The citation of any reference herein should not be construed as an admission that such reference is available as "Prior Art" to the instant application.

[0188] Throughout the specification the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. Those of skill in the art will therefore appreciate that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention. All such modifications and changes are intended to be included within the scope of the appended claims.

BIBLIOGRAPHY

Abbott et al. , FEMS Yeast Res. 9: 1123-1136 (2009)

Adams et al., Methods in Yeast Genetics (1997 edition), Cold Spring Harbor Press (1998) Ammar et al. , Appl Microbiol Biotechnol. 97:4677-90 (2013)

Am ma r et al., Appl. Microbiol. Biotechnol. 98: 7761-7772 (2014)

Annaluru et al., Science 344: 55-58 (2014)

Balzer et al. Microbial Cell Factories.12(l):26 (2013)

Carey et al. , IUBMB life.56(10):575-83 (2004)

Causey et al. Proceedings of the National Academy of Sciences: 101(8):2235-40 (2004)

Causey et al. Proceedings of the National Academy of Sciences: 825-832 (2003)

Choi et al., (2014) Metabolic Engineering of Microorganisms for the Production of Higher Alcohols, mBio 5

Corrette-Bennett et al., Nucleic Acids Res. 29:4134-4143 (2001)

Curran et al. ACS Synth Biol 4: 824-832 (2015)

Dduntze et al., Eur. J. Biochem. 10: 83-89 (1969)

Doudna, J. A and Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9.

Science 346 (2014).

Dragosits and Mattanovich, Microbial Cell Factories.12(1):64 (2013)

Dymond and Boeke, Bioengineered Bugs 3: 168-171 (2012)

Espah et al., Nucleic Acids Research.42(4):2646-59 (2013)

Fletcher et al., Metab. Eng. 39: 19-28 (2017)

Galanie et al., Science 349: 1095 (2015)

Gibson et al., Proc. Natl. Acad. Sci. 105: 20404-20409 (2008)

Gietz and Schiestl, Nat. Protocols 2: 35-37 (2007)

Gonzalez-Garcia et al. Fermentation 3(21) : 1-20 (2017)

Gonzalez-Garcia et al. Microbial Cell Factories.16(1):I2I (2017b)

Gonzalez-Garcia et al. , Fermentation.;3(2):21 (2017a)

Haller et al., Biochemistry 39:4622-4629 (2000)

Haynes et al., Nat. Chem. Biol. 10: 331-339 (2014)

Jang et al., Biotechnology Advances 30(5) :989-1000 (2012)

Jantama, Metabolic engineering of Escherichia coii to efficiently produce succinate in mineral salts media. University of Florida, (2008)

Jovicevic et al., Bioessays 36: 855-860 (2014)

Kearse et al., Bioinformatics 28 : 1647-1649 (2012)

Lin et al., Biomass Bioenergy 47: 395-401 (2012)

Liu et al., Scientific Reports 6: 19963 (2016)

Luna-Flores et al., Biotechnology Journal, 12(2) (2017)

Luna-Flores et al., Biotechnology Journal. 12(2) (2017)

Mancia et al. , Biochemistry. 38(25) : 7999-8005 (1999)

Nakamura, Y., et al. Nucl. Acids Res. 28: 292 (2000)

Parizzi et al. , BMC Genomics. 13( 1) : 562 (2012)

Peng et al., Microb. Cell. Fact. 14:91 (2015)

Portnoy et /. , Current Opinion in Biotechnology.22(4):590-4 (2011)

Puigbo, et al. Nucleic Acids Research, 35(suppl 2), W126-W131 (2007) Reeves et al., Metab. Eng. 9: 293-303 (2007)

Salis et al., Nature Biotechnology.27(iG):946-50 (2009)

Sambrook and Russell, Molecular Cloning : A Laboratory Manual, Vol. 1, Cold Spring Harbor

Laboratory Press (2001 )

Sauer et al., Trends Biotechnol. 26: 100-108 (2008)

Shen et al., Genome Res. 26: 36-49 (2016)

Sikorski, R. S., and Hieter, P. (1989) A System of Shuttle Vectors and Yeast Host Strains Designed for Efficient Manipulation of DNA in Saccharomyces cerevisiae, Genetics 122, 19-27

Tang et al., Applied Microbiology and Biotechnology.97(6):2513-20 (2013)

Terpe, Applied Microbiology and Biotechnology.72(2):211 (2006)

Thakker et al. , Biotechnology Journal, 7(2) : 213-224 (2012)

Thorma et al., Biochemistry 39:9213-9221 (2000)

Tian and Salis, Nucleic Acids Research.43(14):7137-5i (2015)

Walker and DeMoss, Journal of Bacteriology. 174(4) : 1119-23 (1994)

Warnecke and Gill, Microb Cell Fact.4(1):25 (2005)

Werpy and Petersen (2004) Top Value Added Chemicals from Biomass: Volume I -- Results of

Screening for Potential Candidates from Sugars and Synthesis Gas, p Medium : ED; Size: 76 pp. pages; National Renewable Energy Lab., Golden, CO (US)

Williams et al., Trends Biotechnol. 34: 371-381 (2016)

Wu et al., Applied and Environmental Microbiology.73(24):7837-43 (2007)

Yan, Y. & J. C. Liao, (2009) J Ind Microbiol Biotechnol 36: 471-479

Yim et al. , Nature Chemical Biology.7(7):445-52 (2011)

Zampar et al., Mol. Syst. Biol. 9: 651-651 (2013)

Zhang et al., Applied and Environmental Microbiology.75(24):7807-13 (2009a)

Zhang et al., Proceedings of the National Academy of Sciences.106(48):2G180-5 (2009b) Zidwick et al. In The Prokaryotes 2013 (pp. 135-167). Springer Berlin Heidelberg. (2013)