Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
REDUCTION OF HAIR GROWTH
Document Type and Number:
WIPO Patent Application WO/2007/099503
Kind Code:
A2
Abstract:
A method of reducing hair growth includes topical application of a TRPM8 and/or a TRPAl agonist, alone or in conjunction with heat.

Inventors:
BOTCHKAREV, Natalia (52 Apple Valley Drive, Sharon, Massachusetts, 02067, US)
SHANDER, Douglas (2A Farmstead Way, Acton, Massachusetts, 01720, US)
Application Number:
IB2007/050654
Publication Date:
September 07, 2007
Filing Date:
February 28, 2007
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
THE GILLETTE COMPANY (Prudential Tower Building, Boston, Massachusetts, 02199, US)
BOTCHKAREV, Natalia (52 Apple Valley Drive, Sharon, Massachusetts, 02067, US)
SHANDER, Douglas (2A Farmstead Way, Acton, Massachusetts, 01720, US)
International Classes:
A61K8/34; A61K8/35; A61K8/37; A61K8/49; A61Q7/02
Attorney, Agent or Firm:
THE GILLETTE COMPANY (The Procter & Gamble Company Winton Hill Business Center, 6110 Center Hill Roa, Cincinnati OH, 45224, US)
Download PDF:
Claims:

CLAIMS

What is claimed is:

L A method of reducing hair growth in a mammal, comprising:

(a) selecting an area of skin on the mammal from which reduced hair growth is desired; and

(b) applying to the area of skin a dermatologically acceptable composition comprising a cold receptor agonist chosen from a Transient Receptor Potential Melastatin-8 (TRPM8) agonist, a transient receptor potential channel ankyrin-repeat 1 (TRPAl) agonist, or a combination thereof.

2. The method of claim 1 , wherein the composition does not include alpha- difluoromethylornithine.

3. The method of claims 1 or 2, wherein the TRPM8 agonists is a non-terpene TRPM8 agonist.

4. The method of claim 3, wherein the composition further comprises a terpene.

5. The method of claims 1 or 2, wherein the TRPM8 agonist is a terpene.

6. The method of claim 5, wherein the terpene is menthol or menthyl lactate.

7. The method of claims 1 or 2, wherein the TRPM8 or TRPAl agonist is icilin.

8. The method of any one of the preceding claims, wherein the composition does not include a heat shock protein inhibitor or a compound that promotes apoptosis.

9. The method of any one of the preceding claims, further comprising the step of (c) contacting the area of skin with a heat depilatory.

10. The method of claim 9, wherein a laser is used for step (c).

11. The method of claim 10, wherein the area of skin is treated with a laser within 48 hours subsequent to the application of the composition.

12. The method of claim 9, wherein a flashlamp is used for step (c).

13. The method of any one of the preceding claims, wherein the composition includes between 0.1% and 30% of the agonist by weight.

14. The method of any one of the preceding claims, wherein the area of skin of a human selected from the group consisting of the face, axillae, legs, eyebrows, and bikini area.

Description:

REDUCTION OF HAIR GROWTH

BACKGROUND OF THE INVENTION

The invention relates to reducing hair growth in mammals, particularly for cosmetic purposes. A main function of mammalian hair is to provide environmental protection. However, that function has largely been lost in humans, in whom hair is kept or removed from various parts of the body essentially for cosmetic reasons. For example, it is generally preferred to have hair on the scalp but not on the face.

Various procedures have been employed to remove unwanted hair, including shaving, electrolysis, depilatory creams or lotions, waxing, plucking, and therapeutic antiandrogens. These conventional procedures generally have drawbacks associated with them. Shaving, for instance, can cause nicks and cuts, and can leave a perception of an increase in the rate of hair regrowth. Shaving also can leave an undesirable stubble. Electrolysis, on the other hand, can keep a treated area free of hair for prolonged periods of time, but can be expensive, painful, and sometimes leaves scarring. Depilatory creams, though very effective, typically are not recommended for frequent use due to their high irritancy potential. Waxing and plucking can cause pain, discomfort, and poor removal of short hair. Finally, antiandrogens — which have been used to treat female hirsutism - can have unwanted side effects.

It has previously been disclosed that the rate and character of hair growth can be altered by applying to the skin inhibitors of certain enzymes. These inhibitors include inhibitors of 5- alpha reductase, ornithine decarboxylase, S-adenosylmethionine decarboxylase, gamma-glutamyl transpeptidase, and transglutaminase. See, for example, Breuer et al., U.S. Pat. No. 4,885,289; Shander, U.S. Pat. No. 4,720,489; Ahluwalia, U.S. Pat. No. 5,095,007; Ahluwalia et al., U.S. Pat. No. 5,096,911; and Shander et al., U.S. Pat. No. 5,132,293. The transient receptor potential (TRP) family of ion channels comprises more than 30 cation channels, and can be divided into seven main subfamilies: TRPC, TRPV, TRPM, TRPP, TRPML, TRPA, and the TRPN. Two members of two distinct subfamilies of TRP channels have been identified as being responsible for cold sensation: TRPM8 and TRPAl.

Transient Receptor Potential Melastatin-8 (TRPM8) belongs to the melastatin subfamily of TRP ion channels (Tominaga M. et al. (2004) /. Neurobiol. 61(1):3-12). TRPM8 is a Ca(2+) - permeable nonselective cation channel that mediates a direct influx of Ca(2+) ions in response to

specific stimuli. It is activated by cold (temperatures below 24°C) and by cooling compounds, such as menthol and icilin (Tsavaler et al. (2001) Cancer Res. 61(9):3760-9; McKemy et al.

(2002) Nature 416:52-8; Peier et al. (2002) Cell 108(5):705-15). The TRPM8 channel is expressed in a subset of temperature-sensing small dorsal root and trigeminal ganglion neurons (McKemy et al. (2002) supra; Peier et al. (2002) supra; Babes et al. (2004) Eur J Neurosci. 20(9):2276-82; Nealen et al. (2003) / Neurophysiol. 90(l):515-20). The trigeminal ganglion neurons supply sensory nerves for facial skin areas above the mouth, the area of the lower jaw, as well as above the forehead and around the eye. Therefore, TRPM8 has been implicated in sensing cold temperatures at mammalian thermoreceptor nerve endings. In addition to its presence on sensory neurons, functional TRPM8 receptor has also been identified on various non-neuronal cell types. TRPM8 mRNA expression was reported at moderate levels in normal prostate tissue and appears to be elevated in prostate cancer, where it involves in a number of Ca(2+) -dependent processes, including proliferation and apoptosis (Thebault et al, 2005) / Biol Chem 280(47):39423-35). It is also expressed in a number of primary tumors of breast, colon, lung, and skin origin (Tsavaler et al. (2001) supra).

Another ion channel, transient receptor potential channel ankyrin-repeat 1 (TRPAl) also referred to as ankyrin-like protein 1 (ANKTMl) receptor is activated by cold temperatures (below 18°C), cinnamaldehyde, allicin, eugenol, gingerol, and methyl salicylate, and similar to TRPM8, by icilin. TRPAl is expressed in a subset of sensory neurons expressing nociceptive markers, such as TRPVl, calcitonin gene related peptide (CGRP) and substance P (Story et al.

(2003) Cell 112:819-829). It has also been reported to be expressed in cultured fibroblasts, where it is down-regulated after fibroblast oncogenic transformation (Jaquemar et al. (1999) /. Biol. Chem. 274:7325-7333).

SUMMARY OF THE INVENTION

In one aspect, the invention provides a method (typically a cosmetic method) of reducing unwanted mammalian (preferably human) hair growth. The method includes applying a composition including one or more cold receptor agonists, e.g., an agonist of Transient Receptor Potential Melastatin-8 (TRPM8) and/or an agonist of transient receptor potential channel ankyrin-repeat 1 (TRPAl) to an area of skin. The unwanted hair growth may be undesirable from, e.g., a cosmetic standpoint.

TRPM8 and/or TRPAl agonists include compounds that activate at least one activity of one or more hair follicle TRPM8(s) and/or TRPAl(s) (e.g., one or more TRPM8(s) and/or TRPAl(s)) by strongly interacting with the TRPM8(s) and/or TRPAl(s); compounds that increase the levels and/or expression of one or more TRPM8(s) and/or TRPAl(s) in hair follicles; and/or compounds that increase the expression of one or more TRPM8 and/or TRPAl mRNA's in hair follicles. "Strongly interacts" means a compound binds or preferentially binds to the TRPM8(s) and/or TRPAl(s). The compound can be selected, for example, from one of the types of compounds discussed below. Exemplary TRPM8 agonists include terpenes, e.g., cyclic terpenes (e.g., menthol or menthyl lactate), WS-3, cooling agent 10, Frescolat MGA, and Frescolat ML. The TRPM8 agonist may also be a TRPAl agonist, for example, icilin and eugenol. Other exemplary TRPAl agonists include gingerol, methyl salicylate, allicin and cinnamaldehyde. Additional examples of TRPM8 and/or TRPAl agonists are described herein.

In one embodiment, the composition consists essentially of a TRPM8 or a TRPAl agonist, e.g., a composition having a TRPM8 or a TRPAl agonist as the only active hair growth inhibitor. In other embodiments, the composition does not include one or more of: alpha- difluoromethylornithine (DFMO), a heat shock protein inhibitor, a compound that promotes apoptosis, or a combination thereof. In yet another embodiment, the composition does not include a terpene, e.g., menthol. In other embodiments, the composition includes 25% or higher of the TRPM8 and/or TRPAl agonist by weight. In other embodiments, the method includes a composition that includes one or more agonist(s) of TRPM8 and/or a TRPAl. In one embodiment, the agonist activates a TRPM8 and a TRPAl ; for example, the agonist is icilin, which binds to and activates both channels. In other embodiments, a combination of one or more agonists selective for TRPM8 or TRPAl is used.

Typically, in practicing the methods described herein, the composition will also include a dermatologically or cosmetically acceptable vehicle.

In another embodiment, the method further includes treating the area of skin with heat, a chemical depilatory (including, e.g., one or more hair growth reducing agents as described herein), or other methods of hair removal (including, one or more of, e.g., shaving, waxing, mechanical epilation, or electrolysis). In one embodiment, the heat depilatory treatment includes heating the area of skin with, for example, a laser or flashlamp. Typically, the heating is applied within ten, seven, five days, and more typically within three, two days or one day of, or simultaneously with, applying the composition. The appropriate time period depends on the

specific agonist, and could be as short as one day. Treatment can even be simultaneous. Typically, the composition is applied multiple times and heating is performed within seven days, and more preferably within three, two days or one day, or simultaneously with, one of the applications. In other embodiments, the TRPM8 and/or TRPAl agonist(s) enhances the efficacy of thermal-mediated hair inhibition and/or reduces the fluency of photo thermal devices. For example, the energy output of the light and/or photothermal device can be reduced to about 10 to 30 J/cm2, more typically, about 1 to 3 J/cm2.

In other embodiments, the composition including the TRPM8 and/or TRPAl agonist(s) is applied to the skin prior to, during, or after, application to the skin of a chemical depilatory or other methods of hair removal, e.g., waxing. For example, the composition can be applied once or multiple times and waxing is performed within seven days, and more preferably within three, two days or one day, or simultaneously with, one of the applications. The composition can also be applied after hair removal, e.g., waxing, thus providing an additional advantage of ameliorating the pain associated with hair removal. In some embodiments, the TRPM8 and/or TRPAl agonist(s) decreases one or more undesirable effects induced by the heat, chemical, or other methods of depilation, including pain transmission, irritation and/or inflammation.

The present invention also relates to topical (e.g., cosmetic) compositions comprising a dermatologically or cosmetically acceptable vehicle and a cold receptor agonist, e.g., a TRPM8 and/or TRPAl agonist as described herein, or a composition thereof. In addition, the present invention relates to the use of a cold receptor agonist, e.g., a TRPM8 and/or TRPAl agonist as described herein, for the manufacture of a topical composition (e.g., a composition as described herein). Embodiments of these aspects of the invention may include one or more of the features discussed above.

Specific compounds mentioned herein include both the compound itself and pharmaceutically acceptable salts thereof.

Other features and advantages of the invention will be apparent from the detailed description, and from the claims.

DETAILED DESCRIPTION OF THE INVENTION An example of a composition includes a cold receptor agonist, e.g., a TRPM8 and/or

TRPAl agonist, in a cosmetically and/or dermatologically acceptable vehicle. The composition

may be a solid, semi-solid, or liquid. The composition may be, for example, a cosmetic and dermatologic product in the form of an, for example, ointment, lotion, foam, cream, gel, or solution. The composition may also be in the form of a shaving preparation or an aftershave. The vehicle itself can be inert or it can possess cosmetic, physiological and/or pharmaceutical benefits of its own.

Examples of TRPM8 agonists include terpenes, e.g., cyclic terpenes, such as menthol and menthyl lactate (Frescolat ML). Terpenes are a class of organic compounds found in essential oils and have been employed as fragrances, flavorings and medicines. A terpene refers to a compound that is based on an isoprene unit (CsHg) and can be classified based on the number of isoprenoid units that they contain. For example, a monoterpene consists of two isoprene units (ClO), sesquiterpenes have three (C15) and diterpenes have four (C20). A commonly used terpene is menthol, which has been incorporated into inhalation and emollient preparations. Other examples of terpenes include eucalyptol (1,8-cineole), geraniol, nerolidol, menthone, cineole, terpineol, D-limonene, linalool, pulegol (e.g., isopulegol) and carvacrol. Other examples of terpene and non-terpene TRPM8 agonists include Trans-p-menthane-3,8-diol, cis-p-menthane- 3,8-diol, L-carvone (Spearmint oil), N,2,3-trimethyl-2-isopropylbutanamide (WS-23), N-ethyl paramenthane-3-carboxaminde (WS-3), menthone glycerin acetal (Frescolat MGA), menthoxypropanediol (Cooling agent 10), Coolact P, PMD-38, monomenthyl succinate (Physcool), monomenthyl glutarate and hydroxycitronellal. (See, for example, WO 2005/089206; Behrendt, H-J. et al. (2004) British Journal of Pharmacology 141:737-745; Calixto, J.B. et al. (2005) Pharmacology & Therapeutics 106:179-208 Erman, M. B. et al. (2005) Cosmetics & Toiletries 120(5): 105-118, the contents of all of which are incorporated herein by reference).

Examples of agonists that bind to and activate TRPM8 and TRPAl include eugenol, icilin and analogs thereof, e.g., icilin-like compounds. Icilin, l-(2-Hydroxyphenyl)-4-(3-nitrophenyl)- l,2,3,6-tetrahydropyrimidin-2-one (CAS No. 36945-98-9) has a chemical structure as depicted below:

Icilin-like compounds typically have a l-[Rl-phenyl] 4-[R2-phenyl]-l,2,3,6- tetrahydropyrimidine-2-one general chemical structure as shown below, wherein Rl is typically chosen from one or more of hydroxy, chloro, fluoro, alkyl (with about 2 to about 4 carbon atoms), acetoxy, or trifluoromethyl; and R2 is typically chosen from one or more of nitro, chloro, fluoro, alkyl (with about 2 to 4 carbons), or trifluoromethyl.

Methods suitable for preparing icilin and icilin-like compounds are described in U.S. Pat.

No. 3,821,221 and U.S. Pat. No. 6,919,348, the contents of both of which are incorporated herein by reference.

Examples of TRPA-I agonists include gingerol; methyl salicylate (Wintergreen oil); isothiocyanate compounds (e.g., allicin or allyl isothiocyanate (Mustard oil), as well as benzyl, phenylethyl, isopropyl, and methyl isothiocyanate); cinnamaldehyde (Cinnamon oil); and δ 9 - tetrahydrocannabinol. Methods for synthesizing and testing the TRPAl agonists disclosed herein, as well as analogs thereof, are known in the art and are described, for example, in WO

2005/089206 and Calixto, J.B. et al. (2005) supra, the contents of which is hereby incorporated by reference.

The composition may include more than one TRPM8 and/or TRPAl agonists. The composition also may include one or more other types of hair growth reducing agents, such as those described in U.S. Pat. No. 4,720,489; U.S. Pat. No. 4,885,289; U.S. Pat. No. 5,095,007;

U.S. Pat. 5,096,911; U.S. Pat. No. 5,132,293; U.S. Pat. No. 5,143,925; U.S. Pat. No. 5,328,686;

U.S. Pat. No. 5,364,885; U.S. Pat. No. 5,411,991; U.S. Pat. No. 5,440,090; U.S. Pat. No.

5,468,476; U.S. Pat. No. 5,475,763; U.S. Pat. No. 5,554,608; U.S. Pat. No. 5,648,394; U.S. Pat.

5,652,273; U.S. Pat. No. 5,674,477; U.S. Pat. No. 5,728,736; U.S. Pat. No. 5,776,442; U.S. Pat. No. 5,824,665; U.S. Pat. No. 5,840,752; U.S. Pat. No. 5,908,867; U.S. Pat. No. 5,939,458; U.S.

Pat. No. 5,958,946; U.S. Pat. No. 5,962,466; U.S. Pat. No. 6,020,006; U.S. Pat. No. 6,037,326; U.S. Pat. No. 6,060,471 ; U.S. Pat. No. 6,093,748; U.S. Pat. No. 6,121,269; U.S. Pat. No. 6,218,435; U.S. Pat. No. 6,235,737; U.S. Pat. No. 6,239,170; U.S. Pat. No. 6,248,751; U.S. Pat. No. 6,299,865; U.S. Pat. No. 6,414,017; U.S. Pat. No. 6,743,419; and U.S. Pat. No. 6,743,822, all of which are incorporated herein by reference.

The concentration of the TRPM8 and/or TRPAl agonist in the composition may be varied over a wide range up to a saturated solution, preferably from 0.1% to 30% by weight or even more; the reduction of hair growth increases as the amount applied increases per unit area of skin. The maximum amount effectively applied is limited only by the rate of penetration of the skin. The effective amounts may range, for example, from 10 to 3000 micrograms or more per square centimeter of skin.

The vehicle can be inert or can possess cosmetic, physiological and/or pharmaceutical benefits of its own. Vehicles can be formulated with liquid or solid emollients, solvents, thickeners, humectants and/or powders. Emollients include stearyl alcohol, mink oil, cetyl alcohol, oleyl alcohol, isopropyl laurate, polyethylene glycol, petroleum jelly, palmitic acid, oleic acid, and myristyl myristate. Solvents include ethyl alcohol, isopropanol, acetone, diethylene glycol, ethylene glycol, dimethyl sulfoxide, and dimethyl formamide.

The composition optionally can include components that enhance the penetration of the TRPM8 and/or TRPAl agonist into the skin and/or to the site of action. Examples of penetration enhancers include urea, polyoxyethylene ethers (e.g., Brij-30 and Laureth-4), 3 -hydroxy- 3,7, 11- trimethyl-l,6,10-dodecatriene, cis-fatty acids (e.g., oleic acid, palmitoleic acid), acetone, laurocapram, dimethylsulfoxide, 2-pyrrolidone, oleyl alcohol, glyceryl-3-stearate, propan-2-ol, myristic acid isopropyl ester, cholesterol, and propylene glycol. A penetration enhancer can be added, for example, at concentrations of 0.1% to 20% or 0.5% to 5% by weight. The composition also can be formulated to provide a reservoir within or on the surface of the skin to provide for a continual slow release of the TRPM8 and/or TRPAl agonist. The composition also may be formulated to evaporate slowly from the skin, allowing the agonist extra time to penetrate the skin.

A cream-based topical composition containing a TRPM8 and/or TRPAl agonist is prepared by mixing together water and all water soluble components in a mixing vessel- A. The pH is adjusted in a desired range from about 3.5 to 8.0. In order to achieve complete dissolution of ingredients the vessel temperature may be raised to up to 45 0 C. The selection of pH and

temperature will depend on the stability of the TRPM8 and/or TRPAl agonist. The oil soluble components, except for the preservative and fragrance components, are mixed together in another container (B) and heated to up to 70 0 C to melt and mix the components. The heated contents of vessel B are poured into the water phase (container A) with brisk stirring. Mixing is continued for about 20 minutes. The preservative components are added at temperature of about 40 0 C. Stirring is continued until the temperature reaches about 25°C to yield a soft cream with a viscosity of 8,000 - 12,000 cps, or a desired viscosity. The fragrance components are added at about 25°C - 30 0 C while the contents are still being mixed and the viscosity has not yet built up to the desired range. If it is desired to increase the viscosity of the resulting emulsion, shear can be applied using a conventional homogenizer, for example a Silverson L4R homogenizer with a square hole high sheer screen. The topical composition can be fabricated by including the active agent in the water phase during the aforedescribed formulation preparation or can be added after the formulation (vehicle) preparation has been completed. The active agent can also be added during any step of the vehicle preparation. The components of the cream formulations are described in the examples below.

Example #1 (Cream)

a The active ingredient is a TRPM8 and/or TRPAl agonist.

Polyquartinium-51 (Collaborative Labs, NY). c Glycerin, water, sodium PCA, urea, trehalose, polyqauternium-51, and sodium hyaluronate (Collaborative Labs, NY).

Example #2 (Cream)

a The active ingredient is a TRPM8 and/or TRPAl agonist.

Example #3 (Cream)

a The active ingredient is a TRPM8 and/or TRPAl agonist.

Example #4 (cream)

A TRPM8 and/or TRPAl agonist is added to the example 4 formulation and mixed until solubilized.

Example #5 (cream)

A TRPM8 and/or TRPAl agonist is added to the example 5 formulation and mixed until solubilized.

Example #6 (cream)

A TRPM8 and/or TRPAl agonist is added to the example 6 formulation and mixed until solubilized.

Example #7 (cream)

A TRPM8 and/or TRPAl agonist is added to the example 7 formulation and mixed until solubilized.

Example #8 (cream)

A TRPM8 and/or TRPAl agonist is added to the example 8 formulation and mixed until solubilized.

A hydroalcoholic formulation containing a TRPM8 and/or TRPAl agonist is prepared by mixing the formulation components in a mixing vessel. The pH of the formulation is adjusted to a desired value in the range of 3.5 - 8.0. The pH adjustment can also be made to cause complete dissolution of the formulation ingredients. In addition, heating can be applied to up to 45°C, or even up to 70 0 C depending on the stability of the active in order to achieve dissolution of the formulation ingredients. Several hydroalcoholic formulations are listed below.

Example #9 (hydro-alcoholic)

a The active ingredient is a TRPM8 and/or TRPAl agonist. b Caprylic/capric triglyceride (Abitec Corp., OH).

Example #10 (hydro-alcoholic)

a The active ingredient is a TRPM8 and/or TRPAl agonist.

Example #11 (hydro-alcoholic)

A TRPM8 and/or TRPAl agonist is added to the formulation and mixed until solubilized.

Heating can be performed, for example, using a laser, flashlamp or an Intense Pulse Light

(IPL) device. For example, the device can be a Diode laser in the wavelength range of 700 - 1300nm (e.g., 810nm), a Ruby laser at 654nm, an Alexandrite laser at 755 nm, a Nd: YAG laser at

1064nm, a Nd: YAG laser in the range of 600 - 850nm, a Pulsed Light, Intense Pulsed Light, or a Flash Lamp in the wavelength range of 400 - 1200nm, a Fluorescent Pulsed Light at 550, 580, or 615 - 1200 nm, a Light Emitting Diode (LED) in the wavelength range of 400 - 700 nm, and an optical (580 - 980nm) or Diode (800 + 25nm) energy combined with Radio-Frequency electrical energy. The energy output (J/cm2) of the light and photothermal devices can be, for example, from 0.5 - 50 J/cm2, 2 - 20 J/cm2, or 1 - 10 J/cm2. Other laser and light source parameters that effect heating include pulse duration, spot size and repetition rate. The ranges for these parameters depend on the heating device used. The pulse duration can range, for example, from 0.1ms to up to 500ms or it can be a continuous wave (CW) as described in U.S. Pat. 6,273,884. During heating, the temperature of the skin generally is heated to at least 40 0 C, for example, between 40 0 C and 55°C. However, the skin can be heated, as high as, for example, 70 0 C using short millisecond pulses, and avoiding skin burn. For the lower temperature range of 40 - 60 0 C, one should keep the exposure time to between 0.5 min to several minutes. For temperatures above 60 0 C, one should stay within exposure time of 1 -500 msec. The temperature of the skin obtained by heating by a particular mechanism generally can be determined as follows. A subject having a normal body temperature is placed in a room having a temperature of 25 0 C. A 0.009-inch-diameter thermocouple is placed in an area in the skin. The thermocouple output is connected to a National Instruments SCXI- 1112 thermocouple signal conditioner. A National Instruments 6052E data acquisition board, having a maximum acquisition rate of 333 kilo-samples per second controlled the data acquisition and signal gain. The SCXI-1112 and NI 6052E DAQ combination could simultaneously detect up to eight thermocouple outputs at a rate of 42 kilo-samples per second. The sampling rate can be conducted, for example, at 1000 samples/sec.

A similar method is used to determine the temperature range in the hypodermal region. In this case, a thermocouple is inserted to a depth of about 5 mm in an ex-vivo human skin and treatment is applied at the skin surface.

The composition should be applied topically to a selected area of skin from which it is desired to reduce hair growth. The time period for the topical composition application, before or after, the heating treatment may vary from as short as 1 day or even a simultaneous application, depending on the nature of the active chemical in the topical composition. Preferably, the composition is applied (multiple, for example, two, three, or four times) within seven days of

heating, and more preferably at least once within one or two days of heating. Compositions can be applied once a day for at least two or three days prior to heating.

The composition, for example, can be applied to the face, particularly to the beard area of the face, i.e., the cheek, neck, upper lip, and chin. The composition can also be applied to the legs, arms, torso, axillae, eyebrows, and/or bikini area. The composition is particularly suitable for reducing the growth of unwanted hair in women having hirsutism or other conditions. The composition/heating combination may be used as an adjunct to other methods of hair removal, including shaving, waxing, mechanical epilation, chemical depilation, and electrolysis. For example, TRPM8 and/or TRPAl agonist(s), can be used in combination with any of the aforesaid other methods of hair removal, e.g., waxing. Such combination treatment can further include a heat depilatory treatment (e.g., laser). Any combination and/or sequence of the aforesaid treatments with a TRPM8 and/or TRPAl agonist(s) is within the scope of the invention.

Reduced hair growth can be demonstrated quantitatively by reduced hair length, hair diameter, hair pigmentation, and/or hair density in the treated area. Reduced hair growth can be demonstrated cosmetically by less visible hair, shorter hair stubble, finer/thinner hair, softer hair, and/or a longer-lasting shave in the treated area.

The protocols used in the appended Examples are set forth below.

Human hair follicle growth assay Human hair follicles in growth phase (anagen) were isolated from face-lift tissue

(obtained from plastic surgeons). The skin was sliced into thin strips exposing 2-3 rows of follicles that could readily be dissected. Follicles were placed into William's E medium (Life Technologies, Gaithersburg, MD.) supplemented with 2 mM L-glutamine, 10 Dg/ml insulin, 10 ng/ml hydrocortisone, and an antibiotic/antimicotic mixture as described in Philpott et al. (1990) /. Cell ScL 97 (Pt3):463-71. The follicles were incubated in 24-well plates (1 follicle/well) at 37°C in an atmosphere of 5% CO 2 and 100% humidity for different periods of time (Philpott et al. (1990) supra). The length of hair follicle was assessed using an image analysis software system. To determine the effect of molecules modulating TRPM8 /TRPAl activity on hair growth, hair follicles were incubated with icilin (Tocris Bioscience) and L-Menthol, L-menthyl lactate (Sigma). Hair follicle images were taken in the 24-well plates under the dissecting scope under a power of 2Ox. Hair follicle length was measured on day 0 (day follicles were placed in

culture) and again on day 6. The growth of hair fiber was calculated by the subtracting the follicle length on day 0 from that determined on day 6.

Immunohistochemistry

To determine TRPM8 expression in the hair follicle indirect immunofluorescence protocol was employed. Cryostat sections (8 Dm) of hair follicles were freshly prepared and fixed in acetone, and preincubated with 10% goat normal serum, followed by an incubation with the primary antibody against TRPM8 (1 :50; Novus-Biologicals) overnight at room temperature. Sections were then incubated with TRITC-labeled goat ant-rabbit IgG (Jackson ImmunoResearch; 45 min, 37°C). For detection of proliferating cells the indirect immunofluorescence protocol using rabbit monoclonal antibody against Ki-67. Eight Dm hair follicle sections were fixed in formalin and postfixed in ethanol/acetic acid. Next, the sections were incubated with antibody against Ki-67 (1 : 50; Dako; M 7187) overnight at room temperature, followed by incubation with TRITC- labeled goat ant-rabbit IgG (Jackson ImmunoResearch; 45 min, 37°C). Counterstaining was performed using HOECHST 33342 dye (lOmg/ml in PBS; 10 minutes). Each phase was interspersed by a washing step (three times) in PBS. Finally, sections were mounted using VectaShield Vector Laboratories).

For the immunodetection of melanogenic proteins, sections were incubated with either mouse monoclonal antibody against human tyrosinase or chicken monoclonal antibody against human p-mel 17 (Neomarker and Zymed, respectively; 1: 100, overnight), followed by incubation with TRITC-labeled goat anti-rabbit IgG (Jackson ImmunoResearch; 45 min, 37°C) and FITC- labeled goat anti-chicken IgG, respectively . Next, sections were counterstained with Hoechst 33342 (1: 300, 15 min) for identification of cell nuclei, and mounted using VectaShield (Vector Laboratories). All sections were examined under a Olympus BX 60 fluorescent microscope and photodocumented with the help of a digital image analysis system (CoolSnapTM cooled CCD camera, Alpha Innotech)

Western blot analysis Total cellular proteins of human melanocytes were harvested in a lysis buffer (Total protein extraction kit; CHEMICON International, Inc). Twenty D g protein were loaded per lane, separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis, and transferred to nitrocellulose membrane at 100 V for 1 h. Following overnight blocking with 5% nonfat dry

milk/bovine serum albumin (BSA) in Tris-phosphate-buffered saline (PBS) (0.5% Tween-20 in PBS) at 4°C, the membrane was incubated overnight with a monoclonal antibody against either tyrosinase or tyrosinase-related protein- 1 or actin at a dilution of 1:1000. After incubation, the membrane was briefly washed in PBS, then three times with Tris-PBS, and incubated with corresponding secondary antibody at 1: 1000 dilution (Pierce, Rockford, IL) in 1% milk/0.2% BSA for 1 hour. After extensive washing the membrane was incubated for 1 min with the enzyme-linked chemiluminescence Western Blotting Detection Reagent (Amersham, Buckinghamshire, U.K.), and bands were detected on preflashed Kodak X-Omat film and developed after several seconds of exposure. RT-PCR

TRPAl gene transcription in full-thickness human skin and in isolated dermal papilla cells of the hair follicle was characterized by RT-PCR analysis. Total RNA was isolated from full-thickness scalp skin samples and isolated hair follicle dermal papilla cells by using TRIzol reagent (Invitrogen, San Diego, Calif.). cDNA was synthesized by reverse transcription of 2.5 μg total RNA, using a Superscript™ First-Strand Synthesis System for RT-PCR (Invitrogen, San Diego, Calif.). The following sets of oligonucleotide primers were used to amplify specific c- DNA: human TRPAl: Primers#l: 5'-TCATGGTCCAACAGAACACATGGC-S' and 5'- GCATGACAGGCATGGTACAGTGTT-3' (Primer Product Size: 228 bp), Primers#2: 5'- TCCTCTCCATCTGGCAGCAAAGAA -3' and 5'- ATTGTGGCTCAGAAGAAGCGCAAC -3' (Primer Product Size: 262 bp). Amplification was performed using PCR SuperMix (Invitrogen) over 38 cycles, using an automated thermal cycler. Each cycle consisted of the following steps: denaturating at 94°C (1 min), annealing at 58°C (45 s), and extension at 72°C (45 s). PCR products were analyzed by gel electrophoresis (2% agarose) and enzymatic digestion using standard methods.

Example 1: Immunohistochemical Localization of TRPM8 in Anagen Hair Follicles

To localize TRPM8 in the human anagen hair follicle, immunohistochemistry was applied by using rabbit polyclonal antibody against human TRPM8. Expression of TRPM8 was found in the dermal papilla of the hair follicle, as well as in the cells of the hair matrix surrounding the dermal papilla. Double immunostaining for simultaneous detection of TRPM8 and melanocyte marker pMel-17 (gp 100) revealed co-localization of these two proteins in the hair follicle. This suggests that the TRPM8-expressing cells seen in the hair matrix are melanocytes. Thus,

TRPM8 expression was detected in the dermal papilla of the hair follicle, and in the follicular and epidermal melanocytes.

Example 2: Expression of TRPAl mRNA in human skin and hair follicle TRPAl gene transcription in full-thickness human skin and in isolated dermal papilla cells of the hair follicle was characterized by RT-PCR analysis. Total RNA from human scalp skin and from hair follicle dermal papilla cells were extracted and reverse transcribed. As a result, the detectable steady-state levels of TRPAl-mRNA were found in the skin as well as in the dermal papilla cells.

Example 3: Effect of TRPM8 and TRPAl Agonists on Hair Growth

To identify whether modulation of TRPM8 and TRPAl activity could affect hair growth, their agonists were tested in the hair follicle culture model. Hair follicle treatment with 10 uM of menthol, icilin, and menthyl lactate, caused statistically significant hair growth inhibition by 40%, 45% and 60% respectively, compared to the control. Hair follicle treatment with icilin (an agonist of TRPM8 and TRPAl) resulted in inhibition of cell proliferation in a concentration- dependent manner, which was detected by a prominent decrease in Ki-67 immunoreactivity in the hair matrix and in the outer root sheath. Thus, activation of either TRPM8 or TRPAl by a cooling agent leads to a significant reduction of hair growth rate in vitro.

Example 4: Effect of TRPM8 and TRPAl Agonists on Melanocytes

To determine whether a TRPM8 and TRPAl agonist can affect pigment producing activity of the melanocytes, expression of tyrosinase was analyzed in the hair follicles treated with 10 uM icilin by immunohistochemistry. Tyrosinase expression was decreased in treated hair follicles, compared to the control. In addition, the effects of icilin on melanogenic protein expression were tested in human epidermal melanocytes culture. A decrease in tyrosinase and tyrosinase-related protein (TRP)-I expression levels were observed 48 hours after 10 uM icilin treatment, compared to the control, as determined by Western blot analysis. Therefore, icilin exerts hair growth inhibitory effect in vitro, accompanied by a decrease in pigment producing activity of the melanocytes. These results suggest that agonists of TRPM8 and TRPAl receptors may protect melanocytes from overpigmentation.

Other embodiments are within the claims. For example, the classes of compounds and specific compounds described in the list of patents above and incorporated by reference can be used in the methods disclosed in the Summary section.

All documents cited in the Detailed Description are, in relevant part, incorporated herein by reference; the citation of any document is not to be construed as an admission that it is prior art with respect to the present invention. To the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall govern. While particular embodiments of the present invention have been illustrated and described, it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.