CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority from United States Provisional Application Serial Number 61/941,551, entitled A TIGHTLY CONTROLLED OFF SWITCH FOR SACCHAROMYCES CEREVISIAE REGULATED BY CAMPHOR and filed on February 19, 2014, the specification of which is incorporated herein by reference in its entirety.

STATEMENT OF GOVERNMENT RIGHTS

This invention was made with government support under N66001-12-C-4020 awarded by Defense Advanced Research Projects Agency (DARPA). The government has certain rights in the invention.

TECHNICAL FIELD

This invention relates to the field of biotechnology and more specifically to a system and method for control of gene expression.

BACKGROUND ART

Budding yeast Saccharomyces cerevisiae ("5 ^* . cerevisiae ") is one of the most important organisms in biotechnology. An enormous number of studies have been performed, and currently there are two types of regulated promoters in the yeast. The first type is an innate yeast promoter, such as the set of GAL promoters, expression of which is repressed by glucose and activated by galactose. The GAL1 promoter is used in many cases because its induction ratio is very high, but the high concentration of galactose required in the system can be problematic. Apart from the GAL promoters, researchers can use repressive promoters from the MET3 gene (negatively regulated by methionine) and PH05 (negatively regulated by inorganic phosphate). However, the use of these promoters has multiple potentially undesirable effects on metabolism and host gene transcription and, importantly, can lead to a slow growth rate or a high cost incompatible with biotechnological applications. In other words, they are suboptimal, especially for biotechnology applications.

The other type of promoters consists of synthetic functional units derived from other organisms, such bacteria and viruses. One of the most studied switches, called the Tet system, has been applied to regulate expression in yeast. In that system, a transcription factor, the TetR protein from Escherichia coli ("E. coli"), can bind to its operator sequence depending on the presence or absence of tetracycline or derivative compounds such as anhydrotetracycline or doxycycline. However, use of the antibiotics hinders large-volume fermentation in industry because of their expense and moreover the use of the antibiotics is undesirable from a regulatory standpoint. Thus, a low-cost alternate system is desirable to facilitate regulated protein and pathway expression for yeast fermentation in a large-scale of millions of liters at one time. In addition, an increase in the number of available ligand- activated switches provides more options for fundamental and applied studies. The vast number of known and unknown promoters, however, makes it very difficult to identify possible new candidates that would overcome the problems of the existing systems.

Previous articles have described an autoregulated camphor oxidation operon in the 240-kb plasmid PpGl from Pseudomonas putida (" . putida"). Expression of the enzymes in this operon is induced by the presence of camphor, because a TetR-homolog transcription factor, camR, when bound to camphor dissociates from the bound operator. Notably, camphor is very inexpensive and widely used, even in human daily life. None of the literature, however, has shown that the autoregulated camphor operon of P. putida would be active in S. cerevisiae or other systems.

DISCLOSURE OF THE INVENTION

A system for controlling gene expression in yeast comprises a repressible gene expression plasmid that has a regulator binding sequence for camR and a target gene sequence. The system also includes a transcription enhancer expression plasmid; wherein said transcriptional activator protein binds to the regulator binding sequence in the absence of a transcriptional inhibitor. The system is used in a method for controlling expression of the target gene through the use of camphor. The target gene is expressed in the absence of camphor but unexpressed if camphor is added to a solution of cells containing the plasmids.

A recombinantly engineered cell comprises a recombinant sequence for expression of a camphor dependent transcription activator and a recombinant gene expression sequence comprising a camphor operator sequence, which is capable of binding the camphor dependent transcription activator to prevent gene expression when the cell is placed in media containing camphor. The gene of interest is expressed constitutively in the absence of camphor.

A transcription enhancer expression plasmid comprises a nucleic acid sequence encoding a camR transcription regulator domain, and a transcriptional activation domain, wherein the resulting camR transcription regulator domain and transcriptional activation domain are operatively connected and form a cam-TA. A recombinantly expressed transcriptional enhancer comprises a camR transcription regulator domain and a transcriptional activator domain. A repressible gene expression plasmid comprises a regulator binding sequence capable of binding a camR activator in the absence of camphor, which binding leads to expression of the target gene downstream from the regulator binding sequence.

A system for expression control of at least two peptide molecules comprises a first peptide molecule expressed under control of a first repressible promoter, and a second peptide molecule expressed under control of a transcriptional enhancer comprising a camR transcription regulator domain and a transcriptional activator domain, wherein the at least two peptide molecules are capable of being expressed in a eukaryotic cell.

BRIEF DESCRIPTION OF THE DRAWINGS The above and other features, aspects, and advantages of the present invention are considered in more detail, in relation to the following description of embodiments thereof shown in the accompanying drawings, in which:

Fig. 1. Diagram of camphor-Off switch components in S. cerevisiae. (A) camR-based transcriptional regulator (cam-TA) consisting of camR, a trimeric repeat of VP 16 transcription activation domain, and SV40 nuclear localization signal (NLS). (B) Plasmid pSIB619 for expressing cam-TA. Not! digestion releases an integration cassette ready to integrate into a neutral site in chromosome XI. (C) Architecture of a promoter designed to regulate the expression of genes of interest. The promoter camPr consists of the ADH1 transcriptional terminator, six repeats of the camR operator (camO), and the CYC1 minimal promoter, C7C7pr(min). (D) Plasmid pSIB426 (SEQ ID No. 1), harboring a GFP reporter. A similar plasmid pSIB791, contains an ADE2 (SEQ ID No. 10) gene in place of the gfp reporter in pSIB426.

Fig. 2. Schematic diagram of the camphor-Off switch system (A) and chemical structure of D-camphor (B) .

Fig. 3. Characteristics of the camphor-Off switch. (A-F) Cells were cultured in SC medium without camphor (A, B, C) and with 100 μΜ (D), 25 μΜ (E), and 13 μΜ (F) of camphor. The strains were BY4741 (A), camG (B), and camG-TA (C-F). FITC-A shows the intensity of GFP fluorescence. (G) Time course of GFP fluorescence. The j-axis is equal to mean values of fluorescence out of 10,000 counts. Open and closed squares represent the camG-TA cells grown in the absence or presence of camphor respectively (N=5). Open circle shows BY4741 grown without camphor (N=3). Error bars reflect standard deviations.

Fig. 4. Camphor responsive ADE2 -reporter. Cells were cultured for 1 day at 30°C in SC (A), SC-Ade (B), SC with 100 μΜ of camphor (C), and SC-Ade with 100 μΜ of camphor (D). The cells were 10-fold diluted in across each row. Fig. 5. Effects of camphor on the growth of BY4741 strain. Doubling time in the presence of various concentrations of camphor. The values are means and standard deviations calculated from eight experiments.

Fig. 6. Independent regulation of fluorescent reporters, RFP and GFP, with camphor- Off and Tet-Off systems. (A) pSIB859 can be used for integrating the camphor-Off system at a single transformation. Its derivative plasmid pSIB872 carries mCherry as a reporter. (B) Plasmid pSIB498 for the Tet-Off system. Its derivative pSIB527 carries gfp as a reporter. (C)- (F) Strain BY-TeCaOFF carries both pSIB872 and pSIB527. Cell images in SC medium (C), SC with camphor (D), SC with Dox (E), and SC with camphor and Dox. The top, middle, and bottom rows represent images of RFP, GFP, and DIC, respectively. Strain BY-TeCaOFF was grown for 1 day in SC medium with the indicated compounds. Camphor and Dox were supplemented at 25 μΜ each.

Fig. 7. Acceptor vectors (see Fig. 8) that have rfp gene flanked by Bsal recognition sequence. (A) pSIB230. An integration target of this plasmid was an intergenic region between GAT1IYFL021W and PAU5IYFL020C. (B) pSIB233. A dubious gene, YKL162c-a, was the integration target of the plasmid. (C) pSIB843. The integration target of this plasmid is the HO gene which is nonfunctional in most laboratory yeast strains. All plasmid maps were drawn with SnapGene Viewer (GSL Biotech, Chicago, IL).

Fig. 8. Schematic diagram of yeast Golden Gate assembly (yGG). Type IIS restriction enzyme Bsal was used to yield sticky ends that ligate with each other. In this study, plasmids called acceptor vectors that were used for the backbone plasmids in yGG reaction had rfp gene flanked by convergent Bsal sites. The overhang sequences for li gating with other DNA fragments were marked with asterisks*. In order to replace the rfp gene with three DNA fragments [a promoter, a coding sequence (CDS), and a terminator], the fragments had nonpalindromic sticky ends that were generated by digestion with Bsal, unless otherwise described.

BEST MODE(S FOR CARRYING OUT THE INVENTION The invention summarized above may be better understood by referring to the following description. This description of an embodiment, set out below to enable one to practice an implementation of the invention, is not intended to limit the preferred embodiment, but to serve as a particular example thereof. Those skilled in the art should appreciate that they may readily use the conception and specific embodiments disclosed as a basis for modifying or designing other methods and systems for carrying out the same purposes of the present invention. Those skilled in the art should also realize that such equivalent assemblies do not depart from the spirit and scope of the invention in its broadest form.

There are enormously increasing needs for effective switches in biotechnology-related fields. The camphor-Off system described in this application can realize a tight regulation of transcription in yeast with camphor, an inexpensive waste product of the Kraft pulping process. This camphor-Off system provides a switch that turns off the expression of genes of interest only by supplementing camphor in a micromolar-order concentration that does not have a big impact on yeast physiology, differently from most of other repressive switches previously developed, such as the MET3 and PH05 promoters. In other words, this new system can be useful in many contexts, not only in laboratories, but also in industry where kilo- to mega-liter scale fermentation are often performed. From this point of view, the camphor-Off switch is expected to be one of the most valuable switches to regulate gene expression.

In one embodiment of the present invention, a nucleic acid sequence is disclosed that comprises a promoter containing a regulator binding sequence, also known as a camR binding operator, wherein the regulator binding sequence is capable of binding a camR transcriptional activator (cam-TA) in the absence of camphor, which binding leads to expression of a target gene downstream from the regulator binding sequence. When camphor is introduced, expression of the downstream gene is turned off.

A further embodiment discloses a nucleic acid sequence for a yeast transcriptional activator protein. The nucleic acid encodes at least two components: a nucleic acid sequence encoding camR and a transcriptional activation domain. In some embodiments, the nucleic acid will also include a nuclear localization signal. The components are expressed as a hybrid peptide wherein the resulting camR, the transcriptional activation domain and, when present, the nuclear localization signal are operatively connected and form a transcriptional activator cam-TA, which is sensitive to camphor. In the presence of camphor, the cam-TA is not able to bind the camR binding operator and, thus, expression of the downstream gene is turned off.

The term "vector" is used to describe a nucleic acid molecule capable of expressing a desired peptide or protein construct in a given organism. A recombinant "vector" brings together various elements of the peptide or protein to be expressed, which provides the properties described in this application. In general, vectors used in recombinant DNA techniques are referred to as "plasmids" or double stranded DNA molecules that are capable of replicating and utilize the cellular machinery of their host to express their particular target peptide or protein. In some instances, plasmids are used to incorporate a desired gene sequence in a particular site of a chromosome of a eukaryotic cell, such as a S. cerevisiae cell.

In one preferred embodiment, a system for controlling gene expression in yeast comprises a repressible gene expression plasmid having a regulator binding sequence sequence for camR and a target gene sequence, and a transcription enhancer expression plasmid; wherein said transcriptional activator protein binds to the regulator binding sequence in the absence of a transcriptional inhibitor. The repressible gene expression plasmid may include a regulator binding sequence capable of binding a camR activator in the absence of camphor, which binding leads to expression of the target gene downstream from the regulator binding sequence. The repressible gene expression plasmid further comprises a sequence for the target gene as shown in the examples below. The target gene expression may also include a transcription terminator sequence, e.g., ADHl, located upstream of the regulator binding sequence. A person of ordinary skill in the art would recognize that the term "upstream" means that the terminator sequence is placed before the regulator binding sequence.

The regulator binding sequence is at least one copy the sequence of camO (SEQ ID No. 17). In some embodiments, multiple copies of the camO (SEQ ID No. 17) are included, which may assist in ensuring that the regulator attaches to the binding sequence to promote transcription. In a preferred embodiment, the regulator binding sequence comprises at least six copies of the camO sequence (SEQ ID No. 17). The repressible gene expression plasmid also includes a promoter downstream from said regulator binding sequence. In a preferred embodiment, the promoter lacks an upstream activating sequence in order to prevent constitutive expression of the gene in the absence of the regulator. One preferred embodiment, as described below is CYC1.

The transcription enhancer expression plasmid that is part of the system includes a nucleic acid sequence encoding camR, and a transcriptional activation domain, wherein the resulting camR, transcriptional activation domain are operatively connected and form a cam- TA (camphor transcription activator). In one preferred embodiment, the transcriptional activation domain comprises at least one VP 16 tandem repeat, in other embodiments, it may include three or more VP 16 tandem repeats. One additional component in some embodiments is a nuclear localization signal such as the nuclear localization signal is derived from SV40 described in more detail below. In yet a further embodiment, the plasmid may include a glycolytic promoter sequence, such as the sequence for TDH1 as described below.

In yet a preferred embodiment, a recombinantly engineered eukaryotic cell, e.g., S. cerevisiae, is designed to include a recombinant sequence for expression of a camphor dependent transcription activator and a recombinant gene expression sequence comprising a camphor operator sequence, which is capable of binding the camphor activator to prevent gene expression when the cell is placed in media containing camphor. The recombinant gene expression sequence includes a regulator binding sequence capable of binding a camR activator in the absence of camphor and a target gene sequence, which binding leads to expression of the target gene downstream from the regulator binding sequence. The recombinant gene expression sequence further includes a transcription terminator sequence, e.g., ADH1, located upstream of the regulator binding sequence. The regulator binding sequence also includes at least one copy, preferably at least six copies, of the sequence of camO (SEQ ID No. 17). In a further embodiment, regulator binding sequence has a promoter, preferably lacking an upstream activating sequence, downstream from said regulator binding sequence, e.g., CYC1.

The recombinantly engineered cell also includes the sequence for expression of a camphor activator. The camphor activator includes a nucleic acid sequence encoding camR, and a transcriptional activation domain, wherein the resulting camR, transcriptional activation domain are operatively connected and form a cam-TA. The transcriptional activation domain comprises at least one, preferably three copies, of a VP 16 tandem repeat. In a further embodiment, the camphor activator also includes a nuclear localization signal, which in some embodiments is derived from SV40, it is understood that other nuclear localization signals known in the art may be utilized. In some further embodiments, the transcriptional activation domain includes a glycolytic promoter sequence such as TDH1. In yet a further embodiment, a recombinantly expressed transcriptional enhancer has a camR transcription regulator domain and a transcriptional activator domain. In a preferred embodiment, the the transcriptional activator is VP 16. In a further embodiment, a nuclear localization signal is included in the transcriptional enhancer.

A system for expression control of at least two peptide molecules consists of a first peptide molecule expressed under control of a first repressible promoter, and a second peptide molecule expressed under control of a transcriptional enhancer comprising a camR transcription regulator domain and a transcriptional activator domain, wherein the at least two peptide molecules are capable of being expressed in a eukaryotic cell, e.g., S. cerevisiae. Construction of a camR-based transcriptional regulator for S. cerevisiae

As shown in Figure 1 (A) the yeast transcriptional regulator named cam-TA consisting of Pseudomonas putida camR (GenBank BAA03510.1), three tandem repeats of a VP 16 transcriptional activation domain derived from herpes simplex virus Type 1, and a nuclear localization signal (NLS) from SV40 and codon-optimized using GeneDesign. The particular construct of Figure 1 (A) is pSIB619 and comprises the sequence of cam-TA (CDS) that consisted of camR (1-558) (SEQ ID No. 2), VP16 (559-684) (SEQ ID No. 3), and a nuclear localization signal (NLS: 685-708) (SEQ ID No. 4). The cam-TA was flanked by convergent Bsm l sites, and the overhangs generated by cutting are pAATG (5' side) and pTGAG (3' side). The sequence also includes the TDH1 promoter (SEQ ID No. 5) and the STRl terminator (SEQ ID No. 6). An intrinsic BsmBl recognition site was previously removed by recoding. In one embodiment, the glycolytic promoter TDH1 was used to drive cam-TA expression (Fig. IB). A person of ordinary skill would recognize that other transcriptional activation domains, nuclear localization signals, and codon-optimization can be utilized. It is also understood that sequences that are "substantially identical" homologs of the above-referenced sequence can be utilized in association with the present system. A person of ordinary skill in the art understands that "substantially identical" homologs of the sequences described herein constitute exemplary embodiments of the present invention. Two amino acid sequences are "substantially identical" if (i) have only conservative amino acid substitutions that do not significantly affect the folding activity of the resulting polypeptide; (ii) the number of gaps between or insertions in, deletions of and substitutions of, is no more than 10%, preferably 5%, of the number of amino acid residues that occur over the length of the shortest of two aligned sequences; or (ii) no more than 30%, preferably 20%>, more preferably 15%, or 10%, of the amino acid residues vary between the two sequences. Other methods as described by Houston et al. in United States Application Publication Number US2003/0161809A1 may also be used to determine whether two sequences are substantially identical.

Construction of a camphor responsive promoter - using GFP as a reporter

CamR, a component of cam-TA, binds to a specific sequence, 5'- CAGGCTCTATATCTGCGATATACTGAGCAT (camO) (SEQ. ID No. 18). A gene of interest is placed downstream of the camO binding sequence as recognized by a person of ordinary skill in the art. In one preferred embodiment, as shown in Figure 1 (C), six repeats of the operator sequence (camO) separated by a junction sequence 5'-CCCCC between the alcohol dehydrogenase ADH1 terminator and a CYC1 (cytochrome c) promoter from which the endogenous UAS (upstream activating sequence) had been removed. The architecture, consisting of a terminator, an operator, and a UAS-less promoter, was analogous to a promoter used in the yeast Tet-system. The camO -containing promoter (camPr) was designed to regulate expression of genes of interest. One preferred embodiment as shown in Figure 1 (D) provides a vector plasmid pSIB426 (SEQ ID No. 1) to insert the camPr into the yeast chromosome. The pSIB426 plasmid comprises (A) Sequence of a promoter (camPr) (SEQ ID No. 7) consisting of ADH1 terminator (1-207), camR operator (camO: 208-430), and CYC1 minimal promoter (431-577); (B) gfp gene (CDS) (SEQ ID No. 8); and (C) GSHl terminator (SEQ ID No. 9).

Performance of the new switch -GFP as a reporter

Figure 2 shows the performance of the camphor-Off system by combining the two components, cam-TA and camPr, described in the previous sections. In an effective system, we expected that a reporter gene under the control of camPr would express in the absence of camphor, a ligand of camR, but that the expression of the reporter would be repressed by a certain amount of camphor (Fig. 2). To evaluate the performance of the system, we used GFP as a reporter.

The intensity of GFP did not vary between the host strain BY4741 and a control strain camG containing the camPr-gfp expression cassette but lacking the cam-TA construct (Table 1 and Fig. 3AB). However, another strain camG-TA that was constructed by introducing the cam-TA-gfp expression cassette into the cam-TA strain produced significant amounts of GFP (Fig. 3C). From this, we conclude that cam-TA binds to camO and can activate the transcription of the reporter gene gfp. We then cultured the camG-TA strain in medium containing different camphor concentrations. The GFP signal drastically decreased in the presence of > 25 μΜ of camphor (Fig. 3D-F), indicating that the ligand camphor dissociated the binding between cam-TA and camO. The lack of overlap between the two peaks (zero vs 25 μΜ camphor) suggests that switch states will be stable.

Subsequently, the kinetics of the system was investigated using the camG-TA strain.

The intensity of GFP began high in the absence of camphor, whereas it went to almost the same level to that of BY4741 over a 7-hour period in the presence of camphor (Fig. 3G). It was reasonable that the signal did not disappear just after the addition of camphor because native GFP has a half-life of about 7 hours in yeast.

Camphor-Off system with an ADE2 reporter Another gene ADE2 (SEQ ID No. 10) was used to further evaluate the camphor-Off system. Specifically, we investigated availability of the system to complement the adenine- auxotrophy in a camphor-dependent manner. When cam-TA was not expressed in a strain that had camPr-controlled ADE2 gene (SEQ ID No. 10), the strain named camA-EmV grew in SC medium but not in SC-Ade medium irrespective of camphor addition (Fig. 4). On the other hand, another strain camA-TA, which had cam-TA differently from camA-EmV, grew in camphor-free SC-Ade media (Fig. 4B). By contrast, the strain hardly proliferated at all on SC-Ade media that contained camphor (Fig. 4D). The reversion frequency is approximately 10 ^" . The behavior of each strain was thoroughly consistent with the schematic model of the camphor- system (Fig. 2). The result showed that the new system constructed in this study was useful for tight regulation of two different genes in yeast.

Growth effects of camphor treatment

The effective concentration for the camphor-Off system was found to be 25 μΜ in the previous experiment (Fig. 3). Based on this, we investigated how yeast cells were affected by camphor. When the doubling time of BY4741 was determined quantitatively in five different concentrations of camphor (none, 25 μΜ, 50 μΜ, 100 μΜ, and 200 μΜ), there was no significant difference between the conditions (Fig. 5).

Orthogonality: Two different Off switches in a single strain

The experiments in this section were performed to examine whether the camphor-Off system was orthogonal/compatible with the Tet-Off system in a yeast strain. Firstly, we developed new two acceptor vectors: one was used for the camphor-Off switch and the other was the Tet-Off switch. The plasmids were designed to make it easy to clone genes of interest at a BsmBl gap with yeast Golden Gate assembly (Fig. 6AB) and deliver the relevant transcription unit and its transactivator in a single simple step. Here, the mCherry and GFP genes were used as reporters in the camphor- and Tet-Off systems, respectively. When a strain BY-TeCaOFF in which both the systems were integrated was grown lacking both camphor and doxycycline (Dox), significant expression of both fluorescent proteins was observed (Fig. 6C). Moreover, the addition of either drug resulted in drastic decrease of a corresponding reporter protein, while the other fluorescence was detected robustly (Fig. 6DE). In accordance with those data, expression of both the reporters was repressed when both camphor and Dox were supplied in media (Fig. 6F). These results indicated that it was possible to regulate genes separately with the two systems in a single strain.

Example 1.

Materials and methods

Media

Yeast strains were cultured in YPD medium or SD-based media supplemented with appropriate amino acids; fully supplemented medium is referred to as SC; SC missing one compoenent, e.g. adenine, would be labeled SC-Ade. D-Camphor was purchased from Sigma-Aldrich (St. Louis, MO), and 5-fluoroorotic acid (5-FOA) was from US Biological (Massachusetts, MA). Besides, doxycycline (Dox) was obtained from Clontech laboratories (Mountain View, CA). Escherichia coli was grown in Luria Broth (LB) media. In order to select strains with drug-resistant genes, carbenicillin (Sigma-Aldrich), kanamycin (Sigma- Aldrich), or zeocin (Life Technologies, Carlsbad, CA) were used at final concentrations of 75 μg/ml, 50 μg/ml, and 25 μg/ml respectively. Agar was added to be 2% for preparing agar- media.

Plasmids

The TOP10 strain of E.coli (F mcrAA(mrr-hsdKMS-mcrBC) O80/acZAM15 AlacX14 rec Al araD139 A(araleu) 1691 galUgalK psL (StrR) endAl nupG) was used for the construction and amplification of plasmids. Plasmids pSIB230, pSIB233, and pSIB843 (Fig. 7) were designed for use with the yeast Golden Gate assembly method (yGG, Fig. 8) which was developed based on previously described methods. In the yGG, Type II restriction enzymes such as Bsal and BsmBl are used to generate sticky ends that ligate with one another in a predetermined order and directionality. Plasmids pSIB230 and 233 are "convertible", meaning they can be used either as a CEN (single copy, episomal) plasmid directly, or, upon cutting with Notl, for integration at chromosomes VI, XI, or IV at sites empirically determined to be non-deleterious to yeast growth. The plasmids were constructed with protocols described previously, and the plasmids were used as "acceptor" vectors in which the rfp gene in them turned the host E. coli colonies bright red, facilitating the identification of plasmids with inserts, which make white colonies. The CEN plasmid containing the rDHpr-camTA-iS i?itr expression cassette, pSIB619 was made by yGG as follows. The rfp gene in pSIB233 was replaced with the TDH1 promoter (ZDHipr), the coding sequence (CDS) for cam-TA, and STR1 terminator (STRltr) to construct pSIB619 (Figs. 1 (A) and (B)). Similarly, the GFP reporter plasmid pSIB426 was built from pSIB230, camPr (as described below), the gfp CDS, and the GSHI terminator (SEQ ID No. 9). A second ADE2 reporter plasmid, pSIB791, was constructed in which the ADE2 CDS (SEQ ID No. 10). was cloned in place of gfp in the above yGG reaction.

The specialized acceptor vector pSIB859, which is "yGG-ready" for putting any gene under cam-TA control in yeast in an integrated state (at the HO gene on Chr. IV) in one step was constructed as follows. The 7DHipr(vl) part described in the section above consists of a native TDHI yGG part, but in order to sequentially incorporate two yGG cassettes 7DHipr(v2) was constructed. It consists of the same native promoter part but with a pair of BsmBl sites, ready to accommodate a second TU ("transcription unit") cassette, engineered into the left end. The rfp gene in acceptor vector pSIB843 was replaced with ZDHipr(v2), the cam-TA CDS, and STRl x. Upon BsmBl digestion of the resulting plasmid it was possible to insert the camPr, rfp, and SOL3 terminator parts using the yGG to generate pSIB859 (Fig. 6A). pSIB859 has a cassette of TDH1 promoter named TDHlpr(v2) (SEQ ID No. 11); Two divergent Bsm l sites lie adjacent to the Bsal site. The overhang produced by the BsmBl sites can be used for the next yGG reaction. pSIB859 also has a rfp gene (CDS) that had Bsal sites at both ends (SEQ ID No. 12). Another type II restriction enzyme BsmBl sites located just inside the Bsal sites, which can be used for the next yGG reaction. Finally, the pSIB859 has a SOL3 terminator (SEQ ID No. 13) in which the innate BsmBl recognition sequence was disrupted.

In order to build a combined mCherry reporter/camR-TA plasmid pSIB872, we swapped the rfp gene in pSIB859 with the mCherry gene (SEQ ID No. 14). To make an analogous tet-GFP integrating construct, the rfp gene of pSIB230 was replaced with a similarly engineered (paired BsmBl sites) human CMV promoter from human cytomegalovirus, tTA (consisting of a TetR-VP16 fusion, and the STRlxx) (SEQ ID No. 15 and 16). The resultant plasmid was digested with BsmBl and then ligated to three DNA fragments, tet promoter (tetPr), rfp, and GSHltx. The tetPr (SEQ ID No. 17) itself consists of three subparts, the ADHlxx, tet operator, and CYC1 minimal promoter. Subsequently, the CENIARS region was removed from this plasmid by EcoRV cutting and religation to generate pSIB498 (Fig. 6B). Plasmid pSIB527 was build by replacing rfp of pSIB498 with gfp gene. The construction of pSIB527 has a cassette of CMV promoter from human cytomegalovirus (SEQ ID No. 15). The 5'-side of Bsal site was followed by two BsmBl sites. The gap of the BsmBl can be used for the next yGG reaction. Plasmid pSIB527 also has a sequence of tTA (CDS) that consists of TetR (1-618) and VP16 (619-747) (SEQ. ID No. 16). Finally, Plasmid pSIB527 has a sequence of a promoter (tetPr) (SEQ ID No. 17) consisting of ADH1 terminator (1-207), TetR operator (216-508), and CYC1 minimal promoter (521-667).

Yeast strains Yeast strains are listed in Table 1. Particularly, strain BY-ade2A was constructed as follows: BY4741 was transformed with 5amHI-digested pAADE2 followed by the selection of Ura ⁺ colonies, and then Ura ^~ Ade ^~ derivatives were subsequently identified by screening for Ade ^~ colonies after selection on SC + 100 μg/ml 5-FOA medium. The other strains were constructed by integrating the expression cassettes that were prepared by digesting the aforementioned pSIB-series of plasmids with Notl and selecting for the appropriate marker. Yeast cells were cultured at 30°C.

Table 1. Yeast strains used in this study.

Strain Alternate name Genotype Source

BY4741 MATa his3Al leu2A0 metl5A0 ura3A0 Laboratory stock camG SIY504 BY4741 targetChVI*.vpSIB426 (Sphis5, camPr-; This study camG-TA SIY733 BY4741 targetChVI.vpSIB426 (Sphis5, camPr- This study ykll62c::pSlB6\9 (K1URA3, camTA)

BY-ade2A SIY390 BY4741 ade2A::hisG (derived from ρΔΑΕ ⁾ Ε2) This study camA-TA SIY794 BY-ade2A targetChVI.vpSIB791 (Sphis5, camPr-ADE2) This study ykll62c::pSlB6\9 (K1URA3, camTA) camA-EmV SIY795 BY-ade2A targetChVI::pSIB791 (Sphis5, camPr-ADE2) This study yM162c::pSIB233 (K1URA3)

BY4742 MATa pha his3Al leu2A0 fys2A0 ura3A0 Laboratory stock

TetOffG SIY555 BY4742 targetChVI::pSIB527 (Sphis5, tetPr-g^, tTA) This study

BY-TeCaOFF SIY797 BY4742 .vpSIB872 (KIURA3, camPr- , camTA) This study targetChVI.vpSIB527 (Sphis5, tetPr-g^, tTA)

* targetChVI: an intergenic region between GAT1/YFL021 W and PA U5/YFL020C.

Flow cytometry Cellular fluorescence from GFP was determined using a LSRII flow cytometer (Becton Dickinson, Franklin Lakes, NJ) equipped with 488-nm argon ion laser (blue laser) and a 530/30-filter. All samples were suspended in sterile water, and 10,000 cells were analyzed per sample. Data acquisition and analysis were performed using FACSDiva software (Becton Dickinson) and Flow Jo (Tree Star, Ashland, OR).

Growth tests

Yeast growth was monitored using an Eon Microplate Spectrophotometer with Gen5 software (BioTek, Winooski, VT), and 96 Well Clear Flat Bottom plates (Corning, NY) were used to culture the cells. Fresh cells were suspended in the required medium, and then 200 μΐ of the samples were filled in each well. Typically, the initial value of A ₆ oo was 0.20 to 0.25, and the absorbance was measured at 600 nm every 10 minute. Doubling time was determined from cells that were in logarithmic phase.

Microscopy

Cells were viewed with an Axioskop-2 microscope (Carl Zeiss, Oberkochen, Germany) equipped with an X-citel20 light source (ExFo, Ontario, Canada) and a fluorescence filter set. A 100X objective and Axio Vision software were used to capture fluorescence and differential interference contrast (DIC) images.

A person of ordinary skill would understand that the present system can be used in multiple industrial applications. For example, the system can be utilized for the large scale fermentation of yeast producing pharmaceuticals, including biologies and biosimilars applications. The company would have a yeast strain suitable for industrial expression of the molecule(s) of interest at hand, containing all genes but one (typically this would be the first gene in the pathway) under the control of previously optimized constitutive promoters. Then, the critical gene (or the only gene in the case of production of a single protein) could be placed under the control of the camPr (camphor regulated promoter). For example, a seed culture of yeast containing a gene of interest under the control of the camPr as well as the cam-TA expression construct described here, would be grown up in the presence of 25 μΜ camphor in the appropriate yeast growth medium such as YPD, or minimal (e.g. SD) medium. The volume of the seed culture might be 1 L for a 100L fed-batch fermentor or 100 L for a 10,000 L fermentor, or 10,000 L for a 1,000,000 L fermentor. The seed culture would then be diluted 1 : 100 into medium lacking camphor, causing growth of the yeast and, simultaneously, expression of the protein of interest. Alternatively, the yeast could be diluted into such medium containing an empirically determined optimal concentration of camphor, if lower levels of expression were more desirable for optimal production.

In other embodiments, the system can be used for large scale fermentation of yeast producing biofuels. The company would have a yeast suitable for industrial expression of the fuel molecule(s) of interest at hand, containing all genes but one (typically this would be the first gene in the pathway) under the control of previously optimized constitutive promoters. Then, the critical gene could be placed under the control of the camPr (camphor regulated promoter). For example, a seed culture of yeast containing a gene of interest under the control of the camPr as well as the camTA expression construct described here, would be grown up in the presence of 25 μΜ camphor in the appropriate yeast growth medium such as YPD, or minimal (e.g. SD) medium. The volume of the seed culture might be 1 L for a 100L fed- batch fermentor or 100 L for a 10,000 L fermentor, or 10,000 L for a 1,000,000 L fermentor. The seed culture would then be diluted 1 : 100 into medium lacking camphor, causing growth of the yeast and, simultaneously, expression of the protein of interest. Alternatively, the yeast could be diluted into such medium containing an empirically determined optimal concentration of camphor, if lower levels of expression were more desirable for optimal production. In yet a further embodiment, the system can be utilized for small or large scale fermentation of yeast producing any recombinant protein.

The system described herein may also be utilized for biological circuit components in yeast or other species in which the camphor switch-off system is implemented. For example, it is possible to produce Boolean "logic gates" control using small molecules. One such gate, the NOR gate, is considered universal because using a series of NOR gates linked together in various ways, one can produce any other type of logic gate.

A NOR gate conforms to a logic table indicated below

A simple example of a biological NOR gate is one in which a pathway's expression is under the control of two small molecules, such as doxycycline and camphor. Consider a three step pathway A-B-C in which all three proteins are required to make product molecule P. In the example below the presence of a compound is indicated by a one (1) and its absence by a zero (0). If the expression of the A protein is controlled by doxycycline and the B protein is controlled by camphor, then production of product P requires the absence of both doxycycline and camphor. This might be desirable if the product P is particularly toxic to cells but the intermediates in the pathway were not, as it would afford tighter "dual control" of the product. In the presence of either compound alone, very little if any P would be made, but in the absence of both the pathway would be maximally expressed.

The well-known tetracycline controlled switch comes in two formats, Tet-OFF, and

Tet-ON; where OFF and ON relates to the expression logic of the target gene in the presence of the ligand (doxycycline or tetracycline). All of the above examples relate to a Camphor- OFF switch format, in which the presence of camphor leads to repression of a gene. Using the methods described to develop the Tet-ON system (Braselmann et al. 1993), it may be possible to isolate a Camphor-ON system.

INDUSTRIAL APPLICABILITY

This invention relates to the field of biotechnology and more specifically to a system and method for control of gene expression in eukaryotic cells. The method and devices described herein can be made and practiced in industry in the field of biotechnology.

References

The following references are incorporated herein by reference in their entirety.

Aparicio, O. M., B. L. Billington and D. E. Gottschling, 1991 Modifiers of position effect are shared between telomeric and silent mating-type loci in S. cerevisiae. Cell 66: 1279-1287. Aramaki, FL, Y. Sagara, M. Hosoi and T. Horiuchi, 1993 Evidence for autoregulation of camPv, which encodes a repressor for the cytochrome P-450cam hydroxylase operon on the pseudomonas putida CAM plasmid. J. Bacteriol. 175: 7828-7833.

Aramaki, FL, H. Kabata, S. Takeda, H. Itou, H. Nakayama et al, 2011 Formation of repressor- inducer-operator ternary complex: Negative cooperativity of o-camphor binding to CamR. Genes Cells 16: 1200-1207. Baron, U., M. Gossen and H. Bujard, 1997 Tetracycline-controlled transcription in eukaryotes: Novel transactivators with graded transactivation potential. Nucleic Acids Res. 25: 2723-2729.

Braselmann, S., Graninger, P., and Busslinger, M., 1993 A selective transcriptional induction system for mammalian cells based on Gal-4-estrogen receptor fusion proteins. Proc. Natl. Acad. Sci. U.S.A. 90: 1657-1661.

Engler, C, and S. Marillonnet, 2011 Generation of families of construct variants using golden gate shuffling. Methods Mol. Biol. 729: 167-181.

Fujita, M., H. Aramaki, T. Horiuchi and A. Amemura, 1993 Transcription of the cam operon and camR genes in pseudomonas putida PpGl . J. Bacteriol. 175: 6953-6958.

Gari, E., L. Piedrafita, M. Aldea and E. Herrero, 1997 A set of vectors with a tetracycline- regulatable promoter system for modulated gene expression in saccharomyces cerevisiae. Yeast 13: 837-848.

Kalderon, D., B. L. Roberts, W. D. Richardson and A. E. Smith, 1984 A short amino acid sequence able to specify nuclear location. Cell 39: 499-509.

Maya, D., M. J. Quintero, M. de la Cruz Munoz-Centeno and S. Chavez, 2008 Systems for applied gene control in saccharomyces cerevisiae. Biotechnol. Lett. 30: 979-987.

Mitchell, L. A., Y. Cai, M. Taylor, A. M. Noronha, J. Chuang et al, 2013 Multichange isothermal mutagenesis: A new strategy for multiple site-directed mutations in plasmid DNA. ACS Synth. Biol. 2: 473-477.

Richardson, S. M., S. J. Wheelan, R. M. Yarrington and J. D. Boeke, 2006 GeneDesign: Rapid, automated design of multikilobase synthetic genes. Genome Res. 16: 550-556.

Tsuge, K., K. Matsui and M. Itaya, 2003 One step assembly of multiple DNA fragments with a designed order and orientation in bacillus subtilis plasmid. Nucleic Acids Res. 31: el33. The invention has been described with references to a preferred embodiment. While specific values, relationships, materials and steps have been set forth for purposes of describing concepts of the invention, it will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the basic concepts and operating principles of the invention as broadly described. It should be recognized that, in the light of the above teachings, those skilled in the art can modify those specifics without departing from the invention taught herein. Having now fully set forth the preferred embodiments and certain modifications of the concept underlying the present invention, various other embodiments as well as certain variations and modifications of the embodiments herein shown and described will obviously occur to those skilled in the art upon becoming familiar with such underlying concept. It is intended to include all such modifications, alternatives and other embodiments insofar as they come within the scope of the appended claims or equivalents thereof. It should be understood, therefore, that the invention may be practiced otherwise than as specifically set forth herein. Consequently, the present embodiments are to be considered in all respects as illustrative and not restrictive. All references cited herein are incorporated by reference in their entireties.