Regulatory gene element comprising promotor/enhancer protected from DNA methylation and gene expression silencing

Field of the invention In general, the invention relates to the field of molecular biology, virology, and gene therapy where various vectors, particularly viral and retroviral vectors, might be used for gene transfer either into in vitro cultured cells or into living organisms. Specifically, the invention provides solution to the problem of silenced gene expression and methylation of the vector DNA in eukaryotic cells, particularly in mammalian cells. The aforementioned solution consists in the use of a specific regulatory gene element containing a promoter/enhancer based on the retroviral long terminal repeat (LTR) modified by insertion of at least one internal element (IE) from the CpG island. The LTR modified in this way ensures strong and long-term expression of the integrated vector together with the transduced gene of interest (transgene) and, at he same time, its efficient protection from transcriptional silencing and gradual methylation. This effect is brought about even in human cells. The regulatory gene element according to the invention is of broad use, e.g. as an experimental tool in biology research or as a vehicle for compensation of hereditary defects in clinical gene therapy. It might be used for construction of vectors aimed at expression of therapeutic proteins, peptides, and small RNA molecules.

Background of the invention

The transfer of genes, e.g. in gene therapy or in transgenesis, is performed by virtue of vectors, which are able to ensure both the transfer (transduction) of foreign genes (transgenes) and their expression. Viral vectors have been recognized as very efficient for this purpose (Osten et al., 2007; Zhang et al., 2006). Adenoviruses, adeno-associated virus, lentiviruses, and retroviruses are the most commonly used vectors among other viruses.

Adenoviral vectors are frequently designed and used for gene therapy thanks to the detailed knowledge of their replication, stability of viral particles, and easy propagation of high-titre stocks. Adenoviruses efficiently transduce genes into both proliferating and

quiescent cells, in vivo and in vitro. However, the gene of interest persists in episomal form and its expression vanishes when the episomal vector becomes diluted.

Retroviruses, including lentiviruses, are central in the development of vectors because of their ability to integrate the transgene stably into the genome of host cell. Current retroviral vectors can transduce inserts nearly 10 kb in length while their titre falls behind that of adenoviruses. Retroviral vectors mediate gene transfer into cell cultures as well as into experimental animals.

Retroviral vectors take advantage of the replication cycle comprising the phase of proviral DNA integration into the host cell genome. Non-replicative vectors do not induce any pathology of infected cells and ensure high expression of transduced genes thanks to the strong promoter/enhancer sequences within their LTRs. The most commonly used retroviral vectors have been derived from replication-defective strains of Moloney murine leukemia virus (MoMuLV).

Among retroviral vectors used for gene transfer, transgenesis, or even gene therapy, the avian sarcoma and leukosis virus-based vectors (ASLV vectors) are of special importance. The main advantage is that mammalian cells do not contain any endogenous retroviruses, which are capable of recombination with ASLVs. In addition, ASLVs display a specific integration profile, thus being safe from the point of view of genotoxicity, insertional mutagenesis, and tumour induction. The replication-competent RCAS vectors (Federspiel and Hughes, 1994) with a splice donor from Rous sarcoma virus (RSV) play an important role since the replication of retroviruses requires cellular cofactors to complete their life cycle. ASLVs therefore cannot replicate in mammalian cells because of the lack of these specifically avian cofactors (Svoboda et al. 2000). Therefore, RCAS vectors do not produce any infectious progeny in mammalian cells in vitro or in vivo (Federspiel et al., 1994, Barsov and Hughes, 1996). In addition, mammalian cells do not contain any endogenous retroviruses, which are capable of recombination with ASLVs, but a high-titre virus can be produced by using the DF-I chicken cell line that is free of endogenous viruses (Himley et al., 1998). The ASLV-based vectors are thus very stable and safe for gene therapy. Another advantage of ASLV-based vectors is their integration pattern, which differs from murine leukemia virus (MLV) or human immunodeficiency virus type

1 (HIV-I). Genome-wide analyses of retrovirus integration showed that, comparing to MLV and HIV-I, ASLVs display the weakest preference for integration into genes and has no bias for promoter regions (Narezkina et al., 2004, Reinisova et al, 2008). Hence, in this way ASLV-based vectors might be safer than the widely used lentiviral or MLV-based vectors.

There is a general problem that the genes transduced into mammalian cells (in vitro and in vivo) are expressed to a sufficient level only transiently and the expression is then suppressed (at the transcriptional level) and sometimes fully ceased {i.e. transcriptional silencing). Mechanisms causing the transcriptional silencing are epigenetic, comprising especially DNA methylation, post-transcriptional gene silencing (PTGS) mediated by RNAi, histone methylation/deacetylation, and influence of the integration site (position effect). These epigenetic regulatory mechanisms are the major obstacle in clinical applications of gene therapy. DNA methylation mechanisms have been studied and it is well known that DNA methylation in vertebrates applies almost exclusively to cytosine, which can be 5 'methylated (5mC) within the dinucleotide sequence CpG.

CpG dinucleotides are underrepresented in the vertebrate genomes in comparison with the expected frequency corresponding to the free combination of nucleotides. They have been eliminated by mutations during evolution and are maintained particularly in so-called CpG islands at the beginnings of genes with constitutive expression. CpG islands are at least 200 bp long, GC rich, and contain at least 60 % of the expected frequency of CpG dinucleotides. The presence of SpI sites is usually observed. CpG islands are kept methylation-free, with the exception of inactive X chromosome, imprinted loci, and aberrantly methylated genomes in tumour cells. The mechanism of their resistance to methylation remains to be elucidated (Suzuki and Bird, 2008); this knowledge is, however, not necessary for the practical application of the present invention.

The major obstacle to the use of ASLV-derived vectors in mammalian cells is the efficient transcriptional silencing of integrated proviruses. It is widely known that the expression of retrovirus-driven gene reporters is not stable in long-term in vitro cultures, and gradual silencing of transduced vectors correlates with epigenetic changes of retroviral LTRs. LTR

sequences contain well-understood segments U3, R, and U5. These sequences bear signals for initiation and termination of transcription, and particularly promoters and enhancers.

In vitro silenced proviruses were found to comprise CpG methylation and/or histone modification in nucleosomes associated with the promoter region. The silencing of MLV and HIV-I has been characterized in detail (Hoeben et al, 1991; Lorincz et al, 2001; Mok et al, 2007). Various anti-methylation and insulation strategies have been applied to increase the stability of lentiviral and MLV-based vectors (Rivella et al., 2000; Yannaki et al., 2002; Swindle et al, 2004; Zhang et al, 2007).

Rous sarcoma virus (RSV)- and ASLV-derived vectors are not progressively silenced in chicken cells; however, in the cells of heterologous mammalian hosts, they are efficiently methylated and transcriptionally silenced (Searle et al, 1984; Hejnar et al, 1994). Protection from silencing and position-dependent suppressive effects of surrounding chromatin is, therefore, highly needed in order to use advantageous features of ASLV-based vectors in transgenesis or gene therapy. As mentioned above, the retroviral LTR sequences are well known, e.g. HIV-I LTRs are described in document US 7 232 654. The use of retroviruses for constructing gene transfer vectors has been described, see e.g. document WO 91/02805. Retroviral vectors particularly suitable for the gene expression in embryonic stem cells are disclosed in document EP 0 801 575. Patent Application US 2006/0153810 deals with retroviral vectors suitable for the gene therapy. Modifications of retroviral LTRs aimed at regulating the expression of transduced genes are described in document US 5 814 493. The contribution to the problem of targeted gene silencing in fungus Candida albicans is described in document WO 01/48229. A specific promoter regulatory element and the strategy of gene expression silencing are described in document WO 2007/11 1968. The invention disclosed in WO 2007/111968, however, solves the opposite problem, i.e. targeted silencing of specific genes. None of the aforementioned patent documents addresses the question how to protect retroviral vectors from DNA methylation and/or gene silencing.

Description of the invention

The inventors of the present invention observed previously that RSV, normally very sensitive to DNA methylation and transcriptional silencing in mammalian cells, surprisingly resists this transcriptional suppression in the vicinity of CpG island from the mouse adenosyl phosphoribosyltransferase (aprt) gene (Hejnar et al., 2001). The present invention is based on this discovery.

The aim of the invention was therefore to construct a generally useful regulatory gene element that would protect the retroviral vectors from DNA methylation-mediated gene silencing and make the ASLV -based vectors effective in mammalian cells. The aim was reached by the modification of retroviral LTR by insertion of one or more internal elements (IE) from the CpG island of the aprt gene of Syrian hamster {Mesocricetus auratus). Such regulatory gene element ensures efficient expression of the transduced gene and protects the integrated vector from gradual methylation and silencing.

The inventors have found and described the surprising ability of IE from hamster aprt gene CpG island (Siegfried et al., 1999) to stabilize long-term expression of the retroviral vector and protect it from transcriptional silencing. In the study where IE was inserted into RSV

LTR and resulting vectors turned out to be position-independent in the expression of reporter vector, the inventors evidenced that this modification can be used for construction of vectors, particularly retroviral and most preferably ASLV-based vectors, with prolonged transcriptional activity suitable for gene therapy.

Conclusions of the study, which is exemplified later, evidence that insertion of 120 bp long IE into a specific position within the RSV LTR ensures efficient transcription of ASLV-based vector and overcomes the repressive epigenetic effects in non-permissive mammalian cells. The best protective effect was observed with a tandem of two IEs inserted in inverted orientation between the enhancer and promoter sequences. None of 19 analyzed cellular clones transduced with reporter vectors bearing the aforementioned modification displayed significant transcriptional silencing of the reporter even after thirteen weeks of continuous cultivation. This optimized construction of vectors might be therefore an example of a new strategy improving retroviral vectors as a tool for gene transfer and gene therapy.

The first aspect of the present invention is therefore a regulatory gene element containing the promoter/enhancer protected from DNA methylation and gene silencing comprising a retroviral LTR modified by insertion of at least one IE in any orientation into any site, wherein IE comprises SEQUENCE ID. No. 2 or any other sequence that is derived from the CpG island or has the functional features of CpG sequence (equivalent sequence). It is clear to any person skilled in the art that the DNA sequence of IE can be obtained from the natural source or prepared synthetically by procedures notoriously known to any skilled person. Skilled persons are also familiar with the properties of sequences functionally equivalent to IE. A functional equivalent of IE might be the sequence of a CpG island and/or the sequence with functional properties of the CpG island as generally known in the field. The skilled person is able to find such a sequence, isolate it from the natural source or prepare it synthetically, and on the basis of the present invention, to use it for preparation of the regulatory gene element protected from DNA methylation and gene silencing. Whenever used in the next description and patent claims, the term internal element of the CpG island or, shortly, IE, also includes the equivalent sequence, i.e. sequence derived from the CpG island or with the properties of the CpG island known to the person skilled in the art, which has in the LTR the same function as IE sequence (SEQUENCE ID No. 2) described in the present invention.

Another embodiment of the present invention is the regulatory gene element described above preferably comprising at least one SpI site.

Further, the embodiment of the invention is the regulatory gene element described above where at least one IE sequence is inserted between the enhancer and the promoter.

A further embodiment of the invention is the regulatory gene element comprising a tandem of IE sequences, preferably in the anti-sense orientation, and most preferably in the anti- sense orientation in the position -89 nucleotides to the transcription start.

Another aspect of the invention is a vector comprising at least one above-mentioned regulatory gene element, at least one gene of interest to be expressed in the target cell, the terminator sequence, and optionally other sequences, provided that all sequences are operatively linked so that the gene of interest to be expressed in the target cell is controlled by the regulatory gene element.

A further embodiment of the invention is the aforementioned vector, which may be a retroviral vector, preferably an ASLV-based vector.

A further aspect of the invention is a method for preventing methylation of the enhancer/promoter and transcriptional gene silencing, which comprises a step of modification of at least one enhancer/promoter region in the vector where the enhancer/promoter from retroviral LTR is operatively linked with the gene to be expressed in the target cell. The modification consists in insertion of at least one IE sequence in any orientation into any position within the LTR, wherein the sequence of IE is the sequence set forth here as SEQUENCE ID No. 2 or an equivalent sequence. Further embodiment of the invention includes the method as described above, wherein the IE sequence or equivalent sequence comprises at least one SpI site and/or at least one IE is inserted between the promoter and enhancer sequences and/or a tandem of IE sequences is inserted, preferably in the anti-sense orientation, and most preferably in the anti-sense orientation in the position -89 nucleotides to the transcription start. A further aspect of the invention is a vertebrate cell, preferably mammalian cell, containing the vector according to the description.

Finally, another aspect of the present invention is a transgenic organism, with the exception of human, containing the cell described in the previous paragraph.

The present invention is explained in more detail with the help of the following examples and attached figures.

Brief description of the figures

Fig. 1. Schematic representation of retroviral vectors used in the study

(A) The basic vectors RNIG and MNIG containing the neo ^r and EGFP genes driven from the 5'LTR of RSV or MLV, respectively. PBS, primer-binding site; ψ ⁺ , encapsidation signal from MLV; PPT, polypurine tract; IRES, internal ribosomal entry site.

(B) Nucleotide sequence of the IE of the hamster aprt CpG island. The SpI binding sites are in frames, and CpG dinucleotides are in bold. The substitution of three bases in each SpI binding site that abolished the SpI binding capacity is depicted.

(C) Modifications of the RNIG vector LTRs. Single or duplicated IEs with intact or mutated SpI binding sites were inserted in the depicted unique restriction sites in sense and/or anti-sense orientation. The orientation of IE is indicated with an arrow; the bicistronic coding regions and 3 'LTR are not shown.

Fig. 2. FACS analysis of GFP expression from modified and unmodified vector LTRs

NIL-2, HEK 293, and QT6 cell lines transduced with RNIG and RNIG2-2IE vectors were selected with G418 and FACS analyzed 57 days after G418 removal. One clone from each cell line with each of the two vectors is shown. In histograms, the relative GFP fluorescence is plotted against the cell count, and the range of GFP-positive cells is indicated with a horizontal bar.

FIG. 3. Stability of GFP expression from retroviral vectors with modified and unmodified LTRs during long-term cultivation of transduced cells

NIL-2 cells were infected with retroviral vectors modified by IE inserted into the U5 region of LTR (A), between the LTR promoter and enhancer (B), and at the beginning of the U3 region (C). Transduced cells were selected with G418 for 15 days, the percentage of GFP-positive cells was quantified by FACS at regular intervals after G418 removal, and the cells were cultivated without selection. Each point represents the mean from three culture dishes. (D and E) NIL-2 cells were infected with the modified and unmodified vectors, and individual clones of G418-resistant cells were isolated after 7 days of selection and cultivated separately without selection. The time course of vector silencing was followed by FACS at regular intervals. (E) Stability of GFP expression after G418 removal in 19 individual cell clones transduced with the RNIG2-2IE vector. The diagrams of 17 non-silenced cell clones were merged into one. (D) Stability of the GFP expression of nine

individual cell clones transduced with the control RNIG vector. (F) Stability of expression of vectors modified by insertion of IE with mutated SpI binding sites. The population of NIL-2 cells was transduced with the vectors and selected with G418, and individual clones were isolated and cultivated separately. Each curve represents the mean for all cell clones transduced with the same vector construct.

Fig. 4. Reactivation of silenced vectors

NIL-2 cells were infected with silencing-prone vectors RNIG and RNIG3-MIE with mutated SpI binding sites. The cells were selected with G418, and after 6 days of selection, the antibiotic was removed. After 18-day cultivation, the GFP-negative cells were sorted by FACS. Each GFP-negative population was then divided into two subpopulations 6 days after the sorting: one was treated with 5-AzaC and/or TSA for 4 days, and the proportion of GFP-expressing cells was assessed. The nontreated GFP-negative cell population was cultivated further, and the treatment was repeated at regular intervals. Each experiment was done in triplicate.

Fig. 5. DNA methylation of integrated vectors

The methylation status of CpGs within the LTR of integrated vectors was assayed by the bisulfite technique. (A) CpG methylation status of the 5XTR sequence of silencing-prone vectors RNIG and RNIG3-IE in three cell clones with different levels of GFP silencing. NIL-2 cells transduced with vectors were sampled 9 weeks after antibiotic removal and subjected to bisulfite sequencing. Each line with circles represents one independent LTR sequence of the PCR product obtained from the bisulfite-treated DNA. Methylated CpGs are depicted by solid circles; non-methylated CpGs are indicated by open circles. Percentages of GFP-positive cells and methylated CpGs are depicted.

(B) CpG methylation status of the 5'LTR sequence of the RNIG2-2IE vector protected from CpG methylation in two cell clones. NIL-2 cells transduced with RNIG2-2IE vector were sampled 9 weeks after G418 removal and subjected to bisulfite sequencing.

(C) CpG methylation status of the 5 ' LTR sequence of silencing-prone vectors RNIG and RNIG3-MIE in two cell cultures enriched with GFP-negative cells early after vector infection. NIL-2 cells transduced with vectors and enriched with GFP-negative cells by FACS 3 weeks after G418 removal were sampled and subjected to bisulfite sequencing. Each line with circles represents one independent LTR sequence of the PCR product obtained from the bisulfite-treated DNA. Methylated CpGs are depicted by solid circles; non-methylated CpGs are indicated by open circles. Percentages of GFP-positive cells and methylated CpGs are depicted.

Examples

Example 1: Study of the effect of IE on the expression of retroviral vectors

In the study that is the basis of this invention, the inventors investigated the effect of the short IE sequence from the aprt gene CpG island of the Syrian hamster (Mesocricetus auratus) on the expression of reporter retroviral vectors based on RSV and MLV and their resistance against the transcriptional silencing.

The IE sequence from the CpG island stabilizes long-term expression of the retroviral vector driven by RSV LTR The inventors constructed retroviral vectors RNIG and MNIG with the gene for resistance to neomycin (neo ^r ) and the gene for green fluorescence protein (GFP) under the control of RSV LTR (RNIG) or MLV LTR (MNIG). Both genes are expressed from one bicistronic mRNA by the use of internal ribosomal entry site (IRES) from the encephalomyocarditis virus (Fig. IA). The RSV LTR contains a strong enhancer/promoter, which is, however, prone to be transcriptionally suppressed by DNA methylation in mammalian cells (Searle et al, 1984; Hejnar et al, 1994).

The sequence of the RSV LTR from Prague strain C is as follows (SEQUENCE ID. No. 1):

tgtagtcgtacgcaatactcctg[tagtcttgc|aacatgcttatgtaacgatgagt tagcaatatgccttacaaggaaagaaaaggcac cgt|gcatgccga|ttggtggtagtaaggtggtacgatcgtgccttattaggaaggtatc agacgggtctaacatggattggacgaac cactgaattccgcatcgcagagatattgtatttaagtgcctagctcgatacaataaacgc cα/Wαcca^cαccαcαttggtgtgc acctgggttgatggccggaccgtcgattccctaacgattgcgaacacctgaatgaagcag aaggcttca, where two enhancer motifs are depicted in frames, promoter sequences attgg (inverted ccaat) and tatttaa (TATA box) are depicted in bold and underlined, and the repetitive element R separating the U3 segment (left) and the U5 segment (right) is depicted in italics and underlined. The first nucleotide of the R element represents the transcription start.

For the protection from transcriptional silencing, the inventors have chosen the IE sequence from the hamster aprt gene CpG island characterized previously (Siegfried et al., 1999) as the core element protecting the homologous gene. The IE sequence is 120 bp long and contains seven CpG dinucleotides and two highly active SpI binding sites (Fig IB). This sequence is responsive for the most of CpG island features. The sequence of IE is as follows (SEQUENCE ID No. 2):

tccagcaaatgctttacttcctgccaaaagccagcctccc|c3caacccactctccc agaggccclc3ccc|c^tcc|c^ccccctcc [cg|gcctctcct|cgjtgctggat|cg|ctccctaagga,

where CpG dinucleotides are depicted in bold and in frames and SpI binding sites are underlined.

The RSV LTR sequence was modified in the following way. A single IE was inserted in both orientations into three positions within the RSV LTR: in the U5 region downstream of the promoter and transcription start sites; in the middle of the U3 region between the enhancer and the promoter; and at the beginning of the U3 region, upstream of the enhancer. Furthermore, two IEs were inserted in an antisense orientation between the enhancer and the promoter. The U5 region was targeted in the 5'LTR and U3 in the 3 'LTR, so that after reverse transcription of the corresponding RNA, all modifications appeared within both LTRs of the resulting provirus. The complete set of modified RSV LTRs with the names of corresponding retroviral vectors is shown in Fig. 1C.

To study the stability of the long-term expression, the wild-type and modified vectors were packaged into GP293 cells and transduced into two avian cell lines, chicken DFl and quail QT6, and two mammalian cell lines, hamster NIL-2 and human HEK 293. The cells that contained transcriptionally active transduced genes were selected with G418, and the expression of GFP was monitored at regular intervals after G418 removal by microscopic inspection of GFP variegation and FACS. All vectors with either wild-type or modified LTRs exhibited very stable expression in DFl cells during in vitro cultivation. Only a few GFP-negative cells appeared after 2 months of cultivation without selective pressure (data not shown). A similar lack of variegation was also observed in QT6 cells transduced with RNIG, RNIG2-2IE, and MNIG vectors. Six monocellular clones of the G418-resistant cells were isolated after transduction with each of these three vectors and cultivated separately for more than 2 months. All clones exhibited very stable expression, often without any sign of silencing (data not shown). There was only one clone from the QT6 cell line transduced with the vector carrying an unmodified RSV LTR that was progressively silenced, and after 70 days of cultivation (without selection), 22% of the cells were GFP negative.

It is important that the different behaviour of integrated vectors was observed after the transduction of mammalian cells. The vectors RNIG and IvINIG were progressively silenced in NIL-2 cells, whereas the vectors with inserted IE elements exhibited various degrees of protection from transcriptional silencing (Fig. 2 and 3 A to C). The insertion of a single or duplicated IE between the promoter and the enhancer nearly completely stabilized the long-term expression of RNIG vectors, irrespective of the orientation (Figs. 2 and 3B). Because of the significant variability among cell cultures transduced with the same vector modification, several G418-resistant NIL-2 clones were isolated after infection with individual vectors and the GFP expression was monitored over time. Various numbers of clones were inspected, from six clones with the RNIG2-IE vector up to 19 clones with the RNIG2-2IE vector. The data are shown individually for both the wild-type RNIG and RNIG2-2IE vectors and cumulatively for the remaining vectors. The RNIG vector was progressively silenced in most cell clones. Out of the nine clones isolated, only two were without variegation and exhibited stable GFP expression (Fig. 3D), probably due to insertion into a particular site in the host cell genome, which supported efficient transcription of the integrated retrovirus. In contrast, almost no silencing was observed in

clones bearing the vector RNIG2-2IE modified by insertion of double IE in the -89 position. Nineteen clones of NIL-2 cells transduced with this vector were isolated and weak silencing of GFP expression was observed only in two of them. They exhibited 2 % and 8 % GFP-negative cells after 91 days of cultivation. The remaining 17 clones did not exhibit any sign of silencing (Fig. 3E).

All experiments mentioned were confirmed in the human HEK 293 cell line. Data concerning silencing and anti-silencing protection correspond to the data obtained in NIL-2 cells. The only difference was represented by generally slower progression of silencing in the HEK 293 cell line. The intensity of GFP fluorescence was similar in NIL-2 and HEK 293 cells and strikingly higher in QT6 cells. This corresponds with the higher level of transcription driven by the RSV LTR in avian cells. The insertion of IE, even in tandem between the enhancer and the promoter, did not significantly increase the mean intensity of GFP fluorescence, which means that the transcription and titres of modified vectors were not affected. The insertion of one IE and preferably a tandem of two IEs between the enhancer and the promoter efficiently prevented transcriptional silencing.

It is clear to a person skilled in the art that the DNA sequence of LTR can be obtained from the natural source or prepared synthetically by procedures notoriously known to any skilled person. Skilled persons are also familiar with the properties of sequences functionally equivalent with IE. A functional equivalent of IE might be the sequence derived from a CpG island and/or the sequence with functional properties of the CpG island as generally known in the field. The skilled person is able to find such a sequence, isolate it from the natural source or prepare it synthetically, and, based on the description of this invention, use it for preparation of a regulatory gene element protected from DNA methylation and gene silencing. Whenever used in the following description and patent claims, the term internal element of the CpG island, or shortly IE, also comprises the equivalent sequence, i.e. sequence derived from the CpG island or with the properties of the CpG island known to the specialist, which has in the LTR the same function as the described sequence IE.

SpI binding sites are important for the protective function of the CpG island IE

The IE used in this study comprises two SpI binding sites. Point mutations were introduced into the SpI binding sites that abolished the protein SpI binding capacity of the DNA sequence. RNIG2-IE, RNIG3-IE, and RNIG3-IE vectors were mutated in this manner, and the resulting vectors were named RNIG2-MIE, RNIG3-MIE, and RNIG3-MIE, respectively. All SpI -mutated vectors exhibited a significantly decreased protective effect on GFP expression in NIL-2 cells compared to their non-mutated counterparts. Mutated vectors RNIG3-MIE and RNIG3-MIE were silenced more rapidly than the original vector without any element inserted (Fig. 3F). In avian DF-I and QT6 cells, GFP expression from RNIG3-MIE was stable and no silencing was observed (data not shown). It turned out that one active SpI binding site is substantially required for the IE function in preventing the gene silencing (with the reservations given in more detail in further discussion).

Reactivation of the silenced vectors by 5-azacytidine and trichostatin A

The inventors assessed the possibility of reverting the transcriptional suppression of integrated proviruses by DNA methyltransferase inhibitor 5-azacytidine (5-AzaC) and/or the histone deacetylase inhibitor trichostatin A (TSA). The GFP-negative cells from silencing-prone NIL-2 clones transduced with RNIG and RNIG3-MIE 1 1 days after neomycin removal were FACS-sorted and treated at regular intervals with the drugs, either alone or in combination. The increase in the percentage of GFP-positive cells was assessed by FACS analysis. Both 5-AzaC and TSA applied separately reactivated GFP expression, but the combination of both inhibitors provided the strongest effect (Fig. 4). The majority of silenced vectors were reactivated by 5-AzaC and TSA 21 days after G418 removal. However, the effect of these drugs gradually decreased, and after 112 days of cultivation without selection, only 2 % of the vectors were reactivated by the treatment (Fig. 4).

DNA methylation analysis of the integrated vectors

Because transcriptional silencing of genes or proviruses is usually caused by DNA methylation of promoters, the CpG methylation patterns of the vector LTRs that were either silenced or transcriptionally active were analyzed and compared. For this analysis, two NIL-2 clonal cell cultures transduced by the RNIG vector were chosen, one with a high and the other with a very low percentage of GFP-positive cells, and one clonal cell culture transduced by the RNIG3-IE vector with 30% GFP-positive cells. These clones were sampled approximately 9 weeks after G418 selection of transduced cells. Bisulfite sequencing of the vectors displayed almost fully methylated 5 'LTR sequences in the cell clone with silent RNIG proviruses. In contrast, we found almost no CpG methylation in the cell clone without RNIG vector silencing. The cell clone with 30% GFP-positive cells was intermediate with regard to the methylation of 5'LTR of the RNIG3-IE vector (Fig. 5A). There was no obvious methylation pattern, and the methylated CpG dinucleotides were observed throughout the entire LTR. The clones transduced with vector RNIG2-2IE, which did not display any transcriptional silencing of integrated vectors, were also negligibly methylated in the 5'LTR sequence. The inserted IE sequences were without methylation as well (Fig. 5B).

In order to see the early phase of vector silencing, CpG methylation in the rare GFP-negative cells that appeared soon after the selection of vector-transduced cells was examined. The inventors selected these cells from two NIL-2 cell cultures transduced with RNIG and RNIG3-MIE vectors by FACS after 21 days of cultivation without selective pressure. As it is difficult to separate weakly expressing cells, the resulting cell cultures were enriched for GFP-negative cells but also contained 15 % and 28 % positive cells, respectively (Fig. 5C). The density of CpG methylation within LTR sequences was 28 % and 19 %, respectively, much lower than that of the 9-week-old cell culture transduced with RNIG3IE, which contained a comparable percentage of silenced cells (Fig. 5C).

Based on the aforementioned results, it is possible to conclude that the silencing of integrated proviruses is associated with CpG methylation of the promoter sequence; however, there are other mechanisms of silencing that precede the onset of heavy methylation of proviral LTRs.

The inventors confirmed in this experiment that insertion of at least one IE protects the retroviral LTR from both types of transcriptional suppression.

Discussion The results obtained by the inventors are discussed here by reason of the completeness of the study and the scientific integrity. Disregarding various theories and explanations, the results fully support the claimed solution and they do not dispute the possibility of practical use described above.

There are two basic strategies aimed at anti-silencing protection of retroviral and lentiviral vectors. The first is the elimination of so called silencer sequences defined e.g. in the LTR and primer binding site of MLV. Multiple single-nucleotide mutagenesis of all CpGs within the LTR stabilize expression of MLV-based vectors even in embryonic stem cells

(Swindle et al., 2004). Alternatively, DNA sequences of matrix attachment regions and insulators were used to prevent the positional effects of adjacent cellular silencer (Rivella et al, 2000; Yannaki et al., 2002; Zhang et al., 2007).

Previous experiments of the inventors with the whole mouse aprt CpG island adjacent to the integrated RSV-derived reporter provirus showed that the protection from transcriptional silencing could also be caused by some insulatory effects. The inventors realized that the insertion of the CpG island protects the downstream enhancer/promoter in orientation-dependent manner and without increasing the strength of the promoter.

In the experiments described in the present application, the inventors employed the short core element of the hamster aprt CpG island as defined by Siegfried et al. (1999), which was inserted into the retroviral LTR. This IE comprises the protective effect of the whole CpG island but differs from it in several respects. The observed stabilization of reporter expression was strongly dependent on the position of the IE within the LTR. The IE inserted at the beginning of the U3 region had only a minor effect, but insertion between viral enhancers and promoter ensured efficient anti-silencing protection.

The inventors do not possess exact data on the promoter strength of IE-modified LTRs, but an estimate of the expression level (measured as the mean fluorescence intensity, see

Fig. 2) of non-cloned cell cultures infected with individual vectors demonstrates that there are only negligible differences in comparison with the wild-type RSV LTR. These data contradict the effect of insulator elements defined as sequences capable of obstructing outside enhancers to influence promoters. The range of anti-methylation effect is limited to approximately 150 bp from the IE (Hejnar et al., 2001). This might explain the weak - or even no - protection effect of the IE inserted upstream of the enhancer and the best protection from the IE inserted between the enhancer and the promoter. Both transcriptional regulators are in this way within the range of IE anti-silencing influence. The position 89 bp upstream of the transcription start site best corresponds to the position of the element within the hamster aprt gene, 107 bp upstream of the transcription start site. This distance is probably favorable for keeping the promoter transcriptionally active. In contrast to the full-length mouse CpG island, the effect of the IE orientation is only weak.

Several studies have described the important role of SpI binding sites in the anti-methylation capacity of CpG islands (Macleod et al., 1994; Brandeis et al., 1994); however, the exact mechanism of their effect is not known. The inventors tested the effect of SpI mutations in three of our modified LTRs. In all three vectors, mutation of the SpI sites significantly increased the provirus silencing during prolonged cultivation, abrogating the protective effect of the inserted IE. In particular, the vector RNIG3-MIE was silenced even more efficiently than the vector with an unmodified LTR. This is probably due to the accumulation of CpG dinucleotides that, without the context of SpI sites, become a target of DNA methyltransferases. On the other hand, the most stable vector, RNIG2-IE, retains a part of this anti-silencing capacity even after mutation of SpI sites. This indicates that SpI binding sites are involved in the anti-silencing capacity of IE, but these sites are not the only c/s-acting elements involved. The reactivation experiments revealed that vector silencing was associated with DNA methylation and/or histone deacetylation. The interdependence of both mechanisms of provirus silencing was described in detail in reports of experiments with lentiviral vectors (He et al, 2005).

The efficient silencing of ASLV-based vectors in rodent cells has been described. To be sure that this phenomenon and our approach to anti-silencing protection of vectors can be

applied to human cells, the inventors performed these experiments in parallel with the human HEK 293 cell line. The results were basically the same as those seen in NIL-2 cells for all vectors with modified 5'LTRs, but the silencing of the wild-type RNIG vector was slower and, correspondingly, the anti-silencing effects of IE insertions were less pronounced.

Transcriptional silencing is a major obstacle to the use of retroviral and lentiviral vectors in gene transfer and gene therapy (Ellis, 2005). The described strategy of anti-methylation protection of ASLV-based vectors by the CpG island core element indicates that retroviral vectors completely resistant to silencing can be constructed. Such a vector or the procedure disclosed in the present invention may prove immediately useful whenever, e.g., RCAS vectors are used in mammalian cells, and it could be part of a general optimized vector design.

Example 2: Materials and procedures used in the study

Construction of retroviral vectors

The inventors used the plasmids pLPCX, pLXRN, pIRES2-EGFP (all from Clontech, Mountain View, CA), and pH19KE to generate the series of constructs used in this study. The neomycin resistance (neo ^r ) gene was inserted as a 1,419-bp Bglll-EcoRV fragment from pLXRN into the multiple cloning site of pIRES2-EGFP cut with BgIII and Smal to form pN-IRES-G. The pRMR construct was made by ligation of the 3,445-bp BstEII-Ball RSV LTR-bearing fragment of pH19KE and the 2,548-bp PshAI-PvuII inner fragment of pLPCX. The cassette containing the neo ^r gene, internal ribosomal entry site (IRES), and enhanced green fluorescent protein (EGFP) gene, the 2,864-bp Eco47III-HpaI fragment of pN-IRES-G, was then ligated into the 4,579-bp pRMR backbone fragment cut with Smal and Xhol. The resulting retrovirus vector pRNIG (Fig. IA) was used for the construction of all insertion variants of the RSV LTR. The pMNIG vector was constructed by ligation of the 3,509-bp BstEII-Clal Neor, IRES, and EGFP cassette from pRNIG and the 4,458-bp BstEII-Clal LTR fragment of pLPCX. The 5 'and 3'LTR sequences in pLPCX come from Moloney MLV and its replication-defective derivative Moloney murine sarcoma virus,

respectively. Minor sequence differences between these LTRs enabled discrimination of the cloned plasmid retrovirus DNA from the proviral DNA that went through reverse transcription.

Three unique restriction sites were introduced into the LTRs of the pRNIG by in vitro mutagenesis (see below). The BsiW I site at position -226 upstream from the transcription start site and the BstZ17I site at position -89 were introduced into the 3'LTR and Hpal site at position +27 in the 5'LTR. The unique restriction sites were used for the insertion of the IE element. pRNIGl-IE and pRNIGl-IE were constructed by insertion of the IE element into the Hpal restriction site in the sense and antisense orientations, respectively. The pRNIG2 and pRNIG3 variants were formed analogically by insertion of the IE element into the BstZ17I and BsiWI restriction sites, respectively. The pRNIG2-2IE variant was created analogically by inserting two copies of the IE element into the BstZ17I restriction site in antisense orientation (Fig. 1C). Vectors with insertion of the IE with mutated SpI binding sites (see below) were designated RNIG3-MIE, RNIG3-MIE, and RNIG2-MIE. The correct insertion and orientation of IEs was confirmed by DNA sequencing.

Assembly of the IE

The internal element (IE) of the CpG island of the aprt gene (Siegfried et al., 1999) was constructed by gene assembly PCR using eight oligonucleotides: IF: 5'-agtcgtatactccagcaaatgcgttacttcctgcc-3';

2F: 5'-aaaagccagcctccccgcaacccac-3';

3F: 5 '-tctcccagaggccccgccccgtccc-3 ';

4F: 5'-gccccct cccggcctctcctcgtgctgg-3';

1 R: 5 '-tgcggggaggctggcttttggcagg-3 ' ; 2R: 5 '-gggcggggcctctgggagagtgggt-3 ' ;

3R: 5'-cgaggagaggccgggagggggcgggacg-3'; and

4R: 5 '-atgcgtatactccttagggagcgatccagca-3 '.

These oligonucleotides were combined in pairs (IF + IR, 2F + 2R, 3F + 3R, and 4F + 4R) in four assembly reactions (reactions 1 to 4, respectively). The cycling conditions were as follows: 96 °C for 2 min; 4 cycles of 95 °C for 40 s, 70 °C for 10 s, a 0.3 °C/s ramp to 25 °C, and 72 °C for 1 min; and 35 cycles of 95 °C for 30 s, 54 °C for 30 s, and 72 °C for 30 s; the final extension was at 72 °C for 3 min. Products of reactions 1 and 2 were mixed, and PCR was set up with primers IF and 2R. Reactions 3 and 4 were processed analogically with primers 3F and 4R. The PCR conditions were as follows: 96 °C for 2 min and 35 cycles of 95 ⁰ C for 30 s, 50 °C for 30 s, and 72 ⁰ C for 40 s; the final extension was at 72 °C for 5 min. The products of these two reactions were mixed and PCR, under the conditions used for the secondary PCR, was performed using primers IF and 4R, which provide a 142-bp product with BstZ17I restriction sites on both ends. To prepare the IE with BsiWI restriction sites, the inventors performed a PCR of the final product with primers

IFb: 5 '-agtccgtacgtccagcaaatgcgttacttcctgc-3 ' and 4Rb : 5 ' -agtccgtacgtccttagggagcgatccagc-3 ' .

Site-directed mutagenesis

All site-directed mutagenesis experiments were performed with a Transformer site-directed mutagenesis kit (Clontech, Mountain View, CA) according to the manufacturer's protocol. The assembled IE was cloned into the pGEM-T Easy vector (Promega, Madison, WI). For mutation of SpI binding sites, the inventors used a mutagenic primer:

5 '-ctcccagaggcccattcccgtcctttcccctcccggc-3 ', which also served as a selection primer. The selection was performed with the restriction enzyme Drall. To introduce unique cloning sites into the pRNIG construct, the inventors used the mutagenic primer:

5 '-ggaaatgtagtcgtacgcaatactcctg-3 ' for introduction of the BsiWI cloning site, the mutagenic primer:

5 '-cttattaggaaggtatacagacgggtc-3 '

for introduction of the BstZ17I site, and the mutagenic primer: 5 '-acattggtgttaacctgggttg-3 ' for introduction of the Hpal site.

The selection of the vectors with the new sites was performed with alternate use of two selection primers, the selection Scal/Bglll primer:

5'-gtgactggtgagatctcaaccaag-3' and the reselection Bglll/Scal primer: 5 '-gtgactggtgagtactcaaccaag-3 ' .

Cell cultures

The packaging GP293 cell line (Clontech, Mountain View, CA) was maintained in D-MEM/F12 medium (Sigma, St. Louis, MO) supplemented with 5% newborn calf serum, 5% fetal calf serum (both from Gibco-BRL, Gaithersburg, MD), and penicillin/streptomycin (100 mg/ml each). HEK 293 human embryo kidney cells, NIL-2 hamster fibroblastoid cells, QT6 quail methylcholanthrene-transformed cells , and DFl chicken fibroblastic cells (Himly et al., 1998) were maintained in D-MEM/F12 medium supplemented with 5% newborn calf serum, 2% fetal calf serum, 1% chicken serum (Gibco BRL, Gaithersburg, MD), and penicillin/streptomycin (100 mg/ml each). The tissue cultures were cultivated at 37 °C in a 3% CO ₂ atmosphere. In reactivation experiments, 5-azacytidine (5-AzaC) and trichostatin A (TSA) treatment was performed with 4 μM 5-AzaC (Sigma) and with 0.5 μM or 1 μM TSA (Sigma) for 4 days.

Vector propagation

The MNIG and RNIG vectors and their modified forms were propagated by transfection of plasmid DNA containing the proviral forms of reporter vectors together with the plasmid pVSV-G (Clontech, Mountain View, CA) into GP293 cells. GP293 cells (1.5 x 10 ⁷ ) were seeded on 140-mm Petri dishes. After 24 h, the cells were cotransfected with 10 μg of

pVSV-G and 50 μg of the vector plasmid. Cotransfection was performed by calcium phosphate precipitation. The culture medium containing the vector particles was collected 1, 2, and 3 days posttransfection. The collected viral stocks were clarified by centrifugation at 200 x g for 10 min at 4 °C. The supernatant was collected and centrifuged at 24,000 rpm for 2 h 30 min at 4 °C in an SW28 rotor, Beckman Optimal 00 (Beckman, Fullerton, CA). The pellet was resuspended in a culture medium with 10% newborn calf serum, frozen, and stored in -80 °C. The titration of infectious virus particles was performed by serial dilution of the virus stock and subsequent infection of DFl cells. In repeated experiments, vectors with modified and unmodified LTRs reached similar titers within the range of 2 x 10 ⁴ to 1 x 10 ⁵ IU/ml. Twenty-four hours postinfection, 400 μg/ml of G418 (Sigma, St. Louis, MO) was introduced, and the cells were selected for 15 days. The number of G418-resistant colonies was counted after the selection.

Transduction of cells and FACS analysis

Cells were seeded at 5 x 10 ⁵ per 60-mm Petri dish, and after 5 h, 200 μl of viral suspension with 15 μg/ml polybrene was applied to the cell culture and allowed to adsorb for 40 min at room temperature. After the adsorption, fresh medium was added up to 4 ml and the cells were placed at 37 °C and 3% CO2. Twenty-four hours postinfection, selection with 400 μg/ml G418 (Sigma) was introduced, and medium with fresh G418 was changed every 2 or 3 days. After 15 days of selection (6 days in the reactivation experiment), G418 was removed. At 1-week intervals, the cell cultures were analyzed with an LSR II cytometer (Becton-Dickinson, San Jose, CA), and the frequencies of GFP-positive cells were assessed. At specific intervals, the cultures were sorted with a FACSVantage SE (Becton-Dickinson) device according to the presence or absence of GFP expression. In the case of clonal fluorescence-activated cell sorting (FACS) analysis, the cell clones were obtained by limiting dilution of transduced cell cultures.

Methylation analysis

The genomic DNA isolated from infected cells was treated with sodium bisulfite using an EpiTect bisulfite kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.

Seminested PCR of the upper strand was performed with primers complementary to the U3 region of the RSV LTR and the leader region (see Fig. 5B) comprising all but one CpG within the LTR. The sequences of the primers were as follows:

5 '-gttttataaggaaagaaaag-3 ' (upper), 5 '-aacccccaaataaaaaacccc-3 ' (lower-inner), and 5 '-aaacaaaaatctccaaatcc-3 ' (lower-outer).

PCRs were carried out with 200 ng of DNA at 25 cycles of 95 °C for 1 min, 58 ⁰ C for 2 min, and 72 °C for 90 s. The PCR products were cloned into pGEM-T Easy vector (Promega) and sequenced by using the universal pUC/M13 forward primer.

Patent documents cited in the description

US 7 232 654 WO 91/02805 EP 0 801 575 2006/0153810 US 5 814 493 WO 01/48229 WO 2007/111968

Non-patent literature cited in the description

Barsov, E. V., and S.H. Hughes. 1996. Gene transfer into mammalian cells by a Rous sarcoma virus-based retroviral vector with the host range of the amphotropic murine leukemia virus. J. Virol. 70:3922-3929.

Brandeis M., D. Frank, I. Keshet, Z. Siegfried, M. Mendelsohn, A. Nemes, V. Temper, A. Razin, H. Cedar. 1994. SpI elements protect a CpG island from de novo methylation. Nature 371: 435-8.

Ellis, J. 2005. Silencing and variegation of gammaretrovirus and lentivirus vectors. Human Gene Ther. 16: 1241-1246.

Federspiel, M. J., and S.H. Hughes. 1994. Effects of the gag region on genome stability: avian retroviral vectors that contain sequences from the Bryan strain of Rous sarcoma virus. Virology 203:21 1-220.

Federspiel, M. J., D.A. Swing, B. Eagleson, S. W. Reid, and S.H. Hughes. 1996. Expression of transduced genes in mice generated by infecting blastocysts with avian leukosis virus- based retroviral vectors. Proc. Natl. Acad. Sci. USA 93: 4931-4936.

He J., Q. Yang, and L.J. Chang. 2005. Dynamic DNA methylation and histone modifications contribute to lentiviral transgene silencing in murine embryonic carcinoma cells. J Virol. 79:13497-508.

Hejnar, J., J. Svoboda, J. Geryk, V.J. Fincham, and R. Hak. 1994. High rate of morphological reversion in tumor cell line H- 19 associated with permanent transcriptional suppression of the LTR, v-src, LTR provirus. Cell Growth Differ. 5: 277-285. Hejnar, J., P. Hajkova, J. Plachy, D. Elleder, V. Stepanets, and J. Svoboda. 2001. CpG island protects Rous sarcoma virus-derived vectors integrated into nonpermissive cells from DNA methylation and transcriptional suppression. Proc. Natl. Acad. Sci. USA 98: 565-569.

Himly, M., D.N. Foster, I. Bottoli, J.S. Iacovoni, and P.K. Vogt. 1998. The DF-I chicken fibroblast cell line: transformation induced by diverse oncogenes and cell death resulting from infection by avian leukosis viruses. Virology 248:295-304.

Hoeben, R.C., A.A. Migchielsen, R.C. van der Jagt, H. van Ormondt, and AJ. van der Eb. 1991. Inactivation of the Moloney murine leukemia virus long terminal repeat in murine fibroblast cell lines is associated with methylation and dependent on its chromosomal position. J. Virol. 65: 904-912.

Lorincz, M.C., D. Schuebeler, S.C. Goeke, M. Walters, M. Groudine, and D.I.K. Martin. 2000. Dynamic analysis of proviral induction and De Novo methylation: implications for a histone deacetylase-independent, methylation density-dependent mechanism of transcriptional repression. MoI. Cell. Biol. 20: 842-850. Macleod, D, J. Charlton, J. Mullins, A.P. Bird. 1994. SpI sites in the mouse aprt gene promoter are required to prevent methylation of the CpG island. Genes Dev. 8: 2282-92.

Mok, H.P., S. Javed, and A. Lever. 2007. Stable gene expression occurs from a minority of integrated HIV-I -based vectors: transcriptional silencing is present in the majority. Gene Ther. 14:741-751. Narezkina, A., K.D. Taganov, S. Litwin, R. Stoyanova, J. Hayashi, C. Seeger, A.M. Skalka, and R.A. Katz. 2004. Genome-wide analyses of avian sarcoma virus integration sites. J Virol. 78:11656-11663.

Osten P, Grinevich V, Cetin A. 2007. Viral vectors: a wide range of choices and high levels of service. Handb. Exp. Pharmacol. 178: 177-202. Reinisova, M., A. Pavlicek, P. Divina, J. Geryk, J. Plachy, and J. Hejnar. 2008. Target site preferences of subgroup C Rous sarcoma virus integration into the chicken DNA. The Open Genomics J. 1 : 6-12.

Rivella, S., J.A. Callegari, C. May, CW. Tan, and M. Sadelain. 2000. The cHS4 insulator increases the probability of retroviral expression at random chromosomal integration sites. J. Virol. 74: 4679-4687.

Searle, S., D. A. Gillespie, D.J. Chiswell, and J.A. Wyke. 1984. Analysis of the variations in proviral cytosine methylation that accompany transformation and morphological reversion in a line of Rous sarcoma virus-infected Rat-1 cells. Nucleic Acids Res. 12:5193-5210.

Siegfried, Z., S. Eden, M. Mendelsohn, X. Feng, B.Z. Tsuberi, and H. Cedar. 1999. DNA methylation represses transcription in vivo. Nat. Genet. 22: 203-206. Suzuki MM and Bird A. 2008. DNA methylation landscapes: provocative insights from epigenomics. Nat. Rev. Genet. 9: 465-476.

Svoboda, J, J. Hejnar, J. Geryk, D. Elleder, and Z. Vernerova. 2000. Retroviruses in foreign species and the problem of provirus silencing. Gene 261:181-188.

Swindle, C.S., H.G. Kim, and CA. Klug. 2004. Mutation of CpGs in the murine stem cell virus retroviral vector long terminal repeat represses silencing in embryonic stem cells. J. Biol. Chem. 279: 34-41.

Yannaki, E., J. Tubb, M. Aker, G. Stamatoyannopoulos, and D. W. Emery. 2002. Topological constraints governing the use of the chicken HS4 chromatin insulator in oncoretrovirus vectors. MoI. Ther. 5: 589-598. Zhang X and Godbey WT. 2006. Viral vectors for gene delivery in tissue enginering. Adv. Drug Deliv. Rev. 58: 515-534.

Zhang, F., S.I. Thornhill, SJ. Howe, M. Ulaganathan, A. Schambach, J. Sinclair, C Kinnon, H. B. Gaspar, M. Antoniou, and A.J. Thrasher. 2007. Lentiviral vectors containing an enhancer-less ubiquitously-acting chromatin opening element (UCOE) provide highly reproducible and stable transgene expression in haematopoietic cells. Blood 110: 1448- 1457.