REGULATORY MOLECULES

RELATED APPLICATION DATA

The present application claims priority from Australian Provisional Patent Application No. 2013903423 filed on 6 September 2013 and entitled "Regulatory molecules". The entire contents of that earlier application are hereby incorporated by reference.

SEQUENCE LISTING

The present application is filed with a Sequence Listing in electronic form. The entire contents of the Sequence Listing are hereby incorporated by .reference.

FIELD OF THE INVENTION

The present disclosure generally relates to regulatory molecules that have been found to be downregulated in patients suffering from neurodegenerative disease. The regulatory molecules include long non coding RNA (iiicRNA) molecules and fragments thereof. The present disclosure also relates to diagnostic and prognostic methods based on the detection of these regulatory molecules. In addition, the present disclosure relates to therapeutic methods based on the modulation of the expression of these regulatory molecules:.

BACKGROUND OF THE INVENTION

IncRNAs are generall understood to be RNA transcripts of greater than 200 nucleotide bases (distinct from mieroRNAs, which typically contain 20-25 nucleotide bases). IncRNAs ^■ typically do not encode proteins, but function instead by binding to RN A, DNA or proteins to modulate transcription, alternative splicing, mRNA stability, mRNA translation, and epigesetic events, such as chromatin remodelling (Taft et a!.., {2010); Qureshi et al, (2010)). Since almost all human: genes generate multiple distinct mRNA transcript variants via alternative splicing of their exons and variable 5' and 3' untranslated regions (UTRV) (Kelemen et ah, (201.3); Sanchez-Pla et al.. (2012); irimia et al., (201,2)), and display alternative splicing in both tissue and/or cell-type-specific manners (Kalsotra and Cooper, (201.1); Grabo ski (2011)* the potential power of IncRN As to exert regulatory control via mechanisms such as alternative splicing is vast.

IncRNAs have been found to play a, role in modulating alternative mRNA splicing in human disease. In one example, the elevated expression of a lncRNA in Alzheimer's disease has been shown to play a potentially causative role by altering SORL1 mRNA splicing, resulting in increased beta-amyloid (Α formation (Ciarlo et al., (2012)). In another example, the ^■ IncRNA named " i/mmfu" was found to bind RNA splicing factors and its downreguiation, observed in Schizophrenia patients, has been, shown to result in disease related alternative splicing patterns (Barry et a!., (2013)).

Like mRNA, IneRNAs themselves typically consist of multiple exons and undergo alternative splicing to produce a diverse range of transcripts with distinct regulatory functions. Therefore, elucidating the roles of different IneRNAs is a difficult task. Thus, despite the increasing recognition of the important role that IncRNA plays in modulating gene expression, many IneRNAs and their specific roles in modulating disease states have yet to be characterised.

The prevalence of neurodegenerative diseases is increasing as the average age of the population increases, and such diseases are therefore becoming an increasing health and economic concern. Many neurodegenerative diseases share similarities in their pathology, providing hope for the production of a therapy which might be used successfully to treat multiple neurodegenerative diseases.

One example of a neurodegenerative disease is Parkinson' disease (PD), a debilitating neurodegenerative disorder that affects over 80,000 Australians. The molecular mechanisms of PD development remain unclear but diverse approaches have shown that abnormalities in the synaptic protein a Synuclein (o> Syn) play a central role in both sporadic and familial PD. Precise regulation of neuronal a Syn expression is essential, as only modest increases can result in PD (Chartier-Harlm et al, (2004); Ibanez et al., (2004)). However, the exact mechanisms by which a Syn is regulated have yet to be characterised fully. Currently there is no test for earl diagnosis, .no cure and no long-term effective therapy for PD.

SUMMARY OF THE INVENTION

Hie present inventors have characterised, for the first time, a functional IncRNA transcribed from a region closely flanking the a synuclein gene, whose expression is significantly reduced in brain tissue derived from patients suffering from a neurodegenerative disease.

Accordingly, in one aspect, the present disclosure provides an isolated or exogenous polynucleotide comprising or consisting of a sequence at least 70% identical or complementary to a sequence as defined in any one of SEQ ID NQs: 1 , 2, 3, 4, 5, 6, 7 or 8, or a fragment thereof. Preferably, the polynucleotide i at least 80%, at least 85%, at least 90%, at least 95%, at least 98 ^< ¾, at least 99% or is 100% identical or complementary to a sequence a defined in any one of SEQ ID NOs: l-8< Fragments of the isolated or exogenous polynucleotides disclosed herein (which may alternatively be- referred to herein as "IncRNA polynucleotides") ca be used as primers in the detection of IncRNA expression levels, or a agents which modulate the expression of the IncRNA. Accordingly, the present disclosure also provides a pol nucleotide, which is complementary t a fragment containing from 10 to 30 consecutive nucleotides of the polynucleotide sequence as defined in any one of SEQ ID NOs: 1-8.

Larger, functional fragments of the IncRNA polynucleotides disclosed herein may retain the same function of the full length IncRNA polynucleotides disclosed herein. Such functional fragments can also be used in the methods and compositions disclosed herein. Thus, in one example, the present disclosure also provides a polynucleotide as disclosed herein, which comprises or consists of the first 600 nucleotides of SEQ ID NO: 4.

In another aspect, the present disclosure provides a vector comprising the polynucleotide disclosed herein. Preferably, the vector comprises the polynucleotide disclosed herein, operably linked to a promoter.

In another aspect, the present disclosure provides an in vitro cell comprising the polynucleotide or vector disclosed herein.

In another aspect, the present disclosure provides a non-human transgenic animal comprising the polynucleotide or vector disclosed herein.

The inventors have demonstrated mat the IncRNA disclosed herein is expressed at significantly reduced levels in patients suffering from neurodegenerative disease. The inventors have also shown that tlte IncRNA can be detected in human bodily fluid samples (including blood) and ca therefore be used to perform simple and rapid diagnostic and prognostic methods. Accordingly, _: in another aspect, the present disclosure provides a method of diagnosing a neurodegenerative disease or a predisposition thereto in a subject, the method comprising detecting the level of expression or activity of a polynucleotide comprising a sequence at least 70% identical to any one of SEQ ID NOs: 1 -8 or a fragment thereof in a sample taken from a subject, wherein a modified level of expression or activity of the polynucleotide in the sample compared to a control sample indicates an increased or decreased likelihood of the subject having or being predisposed t the neurodegenerative disease. In one example, the control sample is derived from patients known not to suffer from the neurodegenerative disease.

In one example, a decreased level of expression or activity of the polynucleotide in the sample taken from the subject compared to the control sample indicates that the subject has an increased likelihood of having or of developing the neurodegenerative disease.

In another aspect, the present disclosure provides a method of monitoring ^• patient response to treatment of a neurodegenerative disease, the method comprising:

- detecting the level of expression or activity o a polynucleotide comprising a sequence at least 70% identical to any one of SEQ ID NOs: 1-8 or a fragment thereof in a sample taken from a subject at a first time point before the- subject receives treatment for the neurodegenerative disease; and

- defecting the level of expression, or activity of a polynucleotide comprising a sequence at least 70% identical to any one of SEQ ID NOs: .1 -8 or fragmen t thereof in. a -sample taken from a subject at a second time point after the subject has received treatment for the neurodegenerative disease;

wherein a modified level of expression or activity of the polynucleotide in the sample at the. second time point compared to the first time point indicates that the subject is responding to the treatment.

In one example, an increased level of expression or activity of the polynucleotide in the sample taken -at the second time point compared to the sample taken at the first rime point indicates that the subject is responding positivel t the treatment.

Any method known in the art to be suitable for detecting the level of expression or activity of the IncRNA can be used In one example, the level of expression of the polynucleotide is determined by quantitative PC .

The diagnostic methods disclosed herein may be performed to diagnose the presence, likely predisposition to, or patient response to treatment of any neurodegenerative disease. In one example, the neurodegenerative disease is characterised at least in part by neuronal cell death. In another example, the neurodegenerative disease is Parkinson ^' s Disease. In another example, the neurodegenerative disease .is sporadic Parkinson's disease.

The diagnostic methods disclosed herein can be performed on any suitable sample taken from a subject. For example, the sample may be a tissue sample or a bodily fluid sample. In. one example, the tissue -sample comprises brain tissue. In another example, the sample is a bodily fluid sample comprising blood and/or cerebrospinal fluid.

The diagnostic methods disclosed herein may be performed with the use of a computer-based system which comprises the reagents necessaiy to detect the level of expression or activit of a IneRNA polynucleotide as disclosed herein, and the computer hardware and/or software required to facilitate detection and transmission of a report to a clinician. Thus, the present disclosure also provides a kit or computer- based system which comprises the reagents necessary to detect the level of expression or activity of a IncRNA polynucleotide as disclosed herein, and the computer hardware and/or software required to facilitate detection and transmission of a report to a clinician.

The inventors have demonstrated that overexpression of the IncRNA polynucleotides disclosed herein protects against the development of neurodegenerative disease pathology in disease, models. Modulated expression of the IncRNA polynucleotides disclosed herein, therefore represents a therapeutic modality for the treatment and/or prevention of neurodegenerative disease. Accordingly, in a further aspect, the present, disclosure provides a method of treating a neurodegenerative disease in a subject, the. method comprising modulating the level of expression or activity of a polynucleotide comprising a sequence at least 70% identical to any one of SEQ ID NOs: 1 -8 in the subject.

In one example, modulating the level of expression or activity of the polynucleotide comprises administering t the subject an agent capable of modulating the level of expression or activity of the polynucleotide. Any suitable agent can be used. In one example, the agent is capable of increasing the level of expression or activity of the polynucleotide. In one example, the agent is a vector comprising a polynucleotide comprising a sequence at least 70% identical to any one of SEQ ID NOs: 1 -8,

In. another aspect, the present disclosure provides a polynucleotide as disclosed herein, a vector as disclosed herein, or a cell as disclosed herein, for use in treating a neurodegenerative disease in a subject.

In another aspect, the present disclosure provides the use of a polynucleotide as disclosed herein, a vector as disclosed herein, or a ceil as disclosed herein, in the manufacture of a medicament tar treating a neurodegenerati ve disease in a subject

The therapeutic methods disclosed herei can be used to treat any neurodegenerative, disease. In one example, the neurodegenerative disease is characterised at least in part by neuronal cell death. In. another example, the neurodegenerative disease is Parkinson's Disease. in another example, the neurodegenerative disease is sporadic Parkinson's disease.

The features of any embodiment described herein shall be taken to apply mutatis mutandis to any other embodiment unless specificall stated otherwise. The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, composition and methods are clearly within the scope of the invention, as described herein.

Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of step or group of compositions o matter.

The invention is hereinafter described by way of the following non-limiting

Examples and with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS Figure 1 illustrates features of the human a Syn encoding SNCA (Synuekin, Alpha) locus, including the a Syn coding region, a Syn. exons (shaded boxes) and the location of a three-exon IncRNA (A; referred to elsewhere herein as "IncRNA- A"),

Figure 2 show that the level of expression of the functional IncRNA disclosed herein is significantly reduced in the hippocampal region of 6 sporadic PD patients (right column) compared to age-matched healthy controls (left column).

Figure 3 shows that the level of expression of the functional IncRNA- A and its target gene PDSS2 in HeLa cells is reduced when knocked down with an exon 1 -targeting construct ("exon-1 "; right column) compared to untreated HeL cell ('"UTC"; left column).

Figure 4 shows that the level of expression of the functional IncRNA- A and its tai'get gene PDSS2 in HeLa cells is reduced when knocked down with an exon. 3-targetin construct ("cxon-3"; right column) compared to untreated HeLa. cells .("UTC"; left column),

Figure S shows that the level of expression of IncRNA.- A. i increased in. HS Y5 Y cells exposed to a low concentration of rotenone (25nM) for 2 days in P12:DMEM media (right. column) compared to untreated controls (left column). Figure 6 show that elevated lncRNA-A expression provides considerable neuroprotection against tw PD stresses. SHSYSY-TET- Svn/lenti-ln RNA-A (right columns) and SHSYSY-TET-aSy^ienti-eontrol cells (left columns) were grown, both differentiated and induced for aSynitclein expression for 4 days prior to being assessed for cell death involving ethidium homodimer- .1 staining and FACS analysis.

KEY TO THE SEQUENCE LISTING

SEQ ID NO; 1 - DNA sequence encoding a full length functional IncRNA,

SEQ ID NO: 2 - DNA sequence encoding a valiant of a full length functional IncRNA. SEQ ID NO: 3 - DNA sequence encoding a variant of a full length functional IncRNA,

SEQ ID NO: 4 - D sequence encoding exon 3 of a functional IncRNA.

SEQ ID NO: 5 - DNA sequence encoding a variant exon 3 of a functional IncRN A.

SEQ ID NO: 6 - DNA sequence encoding exon 1 of a functional IncRNA,

SEQ ID NO: 7 - DNA sequence encoding exon 2 of a functional IncR .

SEQ ID NO: 8 - DNA sequence encoding exon 1.5 of a functional IncRNA.

SEQ ID NO; 9 - B2M forward primer,

SEQ ID NO: 10 - B2M reverse primer.

SEQ ID NO: 1 1 - HPRT forward primer.

SEQ ID NO: 12 - HPRT forward primer,

SEQ ID NO: 13 - IncRNA- A forward primer,

SEQ ID NO: 14 - IncRNA- A reverse primer.

SEQ ID NO: 15 - alpha synuclein forward primer.

SEQ ID NO: 16 - alpha synuclein reverse primer.

SEQ ID NO: 17 - initial 5' IncRNA- A primer.

SEQ ID NO: 18 - ini rial 3 ' IncRNA- A primer.

SEQ ID NO: 1 - Gapmer targeting exon i .

SEQ ID NO: 20 - Antisense targeting exon 3,

SEQ ID NO: 21 - PDSS2 forward primer,

SEQ ID NO: 22 - PDSS2 reverse primer.

SEQ ID NO: 23 - PDSS2 encoding sequence (GenBank Accession No. AF254956.1).

DETAILED DESCRIPTION OF THE INVENTION

General Techniques and Definitions

Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics,: immunology, immunohisto heraistry , protein chemistry, and biochemistry).

Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, I Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J.. Sambrook et al.,. Molecular ^' Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), Τ.Λ. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Barnes (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and P.M. Aosubel et al, (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley- Interscience (1988, including all updates until present), Ed Harlow and David Lute (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory. (1988), and J.E, G^iigan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

The term "and/or", e.g., ^' 'X and/or Y" shall be understood to mean .either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning.

As used herein, the term "about", unless stated to the contrary, refers to +/- 20%, more preferably +·/- 10%, of the designated value. For the avoidance of doubt, the term "about" followed by a designated value is to be interpreted as also encompassin the exact designated value itself (for example, "about 10" also encompasses 10 exactly).

Throughout this specification, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

As used herein, the terms "treating", "treat" or "treatment" include administering a therapeutically effective amount of an agent sufficient to reduce or eliminate at least one symptom of disease.

As used herein, the terms "preventing", "prevent" or "prevention" include administering a therapeutically effective amount of a agent sufficient t prevent the manifestation of at least one symptom of disease.

As used herein, the term 'reducing" includes reducin by any quantifiable amount. Similarly, the term "increasing" includes increasing by any quantifiable amount. As used herein, the tarn "subject" refers to an animal, e.g., a mammal _* In a preferred embodiment, the subject is mammalian, for example a human. Other preferred embodiments include livestock animals such as horses, cattle, sheep and goats, as well as companion animals such as cats and dogs.

As used herein, the terras ^" linked", "attached", "conjugated", ^" hound", "coupled ^" or variations thereof arc used broadly to refer to any form of covalent or non-covalent association which joins one entity to another for any period of time.

Polynucleotides

The present disclosure characterises, for the first time, novel long non-coding

RNA molecules. Many of the sequences disclosed herein provide DMA sequences encoding the IncRNAs. An reference herein to a " ncRNA" refers both to the polynucleotide sequence encoding the IncRNA and to the RNA transcript produced from that encoding polynucleotide sequence. Thus, the "polynucleotides" disclosed herein may comprise DNA or RNA (Le,» _: may be deoxyribonucleotides or ribonucleotides), and may be identical or complementary to the sequences disclosed herein. Tims, for example, the polynucleotides disclosed herein ma be complementary DNA molecules ("cDNA" molecules). It will be appreciated that the RNA sequences transcribed, from the encoding DNA sequences can readily be determined from the DNA sequences disclosed, herein. For example, the person skilled in the art will be aware that a representation of a polynucleotide as DNA may also be construed as RNA if the "T" nucleotides of the DNA are replaced in the sequence by "IJ". Accordingly, in one example, the polynucleotides disclosed herein may be ribonucleotides comprising or consisting of a sequence at least 70% identical, or complementary to a sequence as defined in any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7 or 8, or a fragment thereof.

Representative IncRNAs are disclosed in SEQ ID NOs: 1, 2 and 3. The present disclosure therefore provides polynucleotides comprising or consisting of a sequence as defined in any one of SEQ ID NOs: 1, 2 or 3, or a fragment thereof, o comprisin or consisting of a sequence which is complementary to a sequence as defined in any one of SEQ ID NOs: ^' 1. 2 or 3, or a fragment, thereof.

The term "IncRNA" as used herein is intended to encompass any naturally occurring variants of any of the IncRNAs defined by sequences disclosed herein. Naturally occurring variants can. be isolated by methods known in the art. in addition, the amplification methods disclosed in the Examples section can be used to isolate naturally occurring variants of the IncRNAs disclosed hereto. The methods disclosed in the Examples section can also be modified, (e.g., by selecting alternative primer sequences based on alternative fragments of any of SEQ ID NOs: 1, 2 or 3) in order to identify any naturally occurring variants of the IncRNAs disclosed herein.

It will be appreciated that a certain number of mutations, deletions or insertions could be made to the sequences disclosed herein without impeding their function. For example, it will be appreciated that guanine, eytosine, adenine, and uracil ma be replaced by other moieties without substantially altering the base pairing properties of a polynucleotide comprising such a replacement moiety. For example, a nucleotide comprisin inosme as its base may base pair with, nucleotides containing adenine, eytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the polynucleotide sequences disclosed herein by a nucleotide containing, for example, mosine.

Accordingly, the polynucleotides disclosed herein may comprise or consist of a sequence which is at least 70% identical or complementary to a sequence as defined in any one of SEQ ID NOs: 1, 2 or 3, or a fragment thereof. For example, the polynucleotides disclosed herein may comprise a sequence, which is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or is 100% identical or complementary to a sequence as defined in any one of SEQ ID NOs: 1 , 2 or 3, or a fragment thereof.

Percentage identity to any of the polynucleotide sequences disclosed herein may be determined by methods known in the art. For example, polynucleotide sequences can be compared manually or by using computer-based sequence comparison and identification tool that employ algorithms such as BLAST (Basic Local Alignment Search Tool; Altsehul et ai, 1993); see also www.nchi.nlm.ttib.gov/BLAST/),· the Clustal method of alignment (Higgins and Sharp, 1989) and others, wherein appropriate parameters for each specific sequence comparison can be selected as would be understood by a person skilled in the art.

The polynucleotides disclosed herein may comprise or consist of a. fragment of any of the sequences disclosed herein. The fragment may be of any length. For example, the fragment ma comprise or consist of at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900 or at least 1000 contiguous nucleotides of any one of SEQ ID NOs: 1-3.

The fragments disclosed herein may comprise any one or more exons of the IncRNA disclosed herein, such as the exons described in SEQ ID NOs: 4, 5, 6, 7 or 8.

In another example, fragments of any of the polynucleotides disclosed herein can be used to prepare primers, which may be used to detect the IncRNA in a sample. 1.1

Suitable primers can be prepared from fragments comprising or consisting of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19. 20, 2.1, 22, 23, 24, 25, 26, 27. 28, 29, 30, 35, 40, 45, 50 or more contiguous nucleotide bases of any of the sequences disclosed herein. Thus, the present disclosure provides, a polynucleotide comprising or consisting of a sequence- 5 which is identical or complementary to a fragment containing 10, 1 1 . 1 . 13, .14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50 or more contiguous nucleotide bases of an of die sequences disclosed herein (e.g., of SEQ ID NO: 1). The polynucleotides may be capable of allowing amplification of a. IncRNA polynucleotide- a disclosed herein from a sample.

1.0 In another example, polynucleotides can be designed t inhibit the expression of any of the tncRNA polynucleotides, disclosed herein, based on a sequence which is identical or complementary to a fragment of any of the polynucleotides disclosed herein. Such "inhibitory" polynucleotides may be, for example, small interfering RNAs (siRNA), double stranded RNAs (dsRNAs), inverted repeats, short hairpin

15 RNAs (shRNAs), small temporally regulated RNAs (stRNA), clustered inhibitory RNAs (cRNAs), including radial, clustered inhibitory RNA, asymmetric clustered inhibitor RNA, linear clustered inhibitory RNA, and complex or compound clustered inhibitory RNA, dicer substrates, DNA-directed RNAi (ddRNAiJ, single-stranded RNAi (ssR ^' NAi), microRNA (miRNA) antagonists, microRNA mimics, microRNA

20 agonists, blockniirs (a.k.a. Xmirs), microRNA mimetics, microRNA addbacks, supermiRs, and any other polynucleotides as known in the ait. Antisense polynucleotides can also be designed as will be understood by a person skilled in the art. Thus, the present disclosure provides inhibitory polynucleotides capable of inhibiting the expressio and/or activity of a polynucleotide comprising a sequence

25 which is at least 70%: identical or complementary to a sequence as defined in an one of SEQ ID NOs: 1, 2 or 3, or a fragment thereof.

Such inhibitory molecules can be prepared, for example, based on a nucleotide sequence which is identical or complementary to a fragment comprising or consisting of from 10 to 30 contiguous nucleotide bases of any of the sequences disclosed herein,

30 Thus, the present disclosure provides a polynucleotide comprising or consisting of a sequence which, is identical or complementary to a fragment containing from 10 to 30 contiguous nucleotide bases of any of the sequences disclosed herein (e.g., SEQ ID NO: 1.). Preferably, the polynucleotide comprises or consists of a sequence which is identical or complementary to a fragment containing from 15 to 25, such a from. 1. to

35 23, such a 20, 21 or 22 contiguous nucleotide bases of any of the sequences disclosed herein (e.g., SEQ ID NO; 1). In another example, the fragment may comprise any length of a polynucleotide sequence disclosed herein, which is shown to be essential for the function of the IncRNA, For example, a preferred fragment comprises or consists of about the first 600 nucleotide bases of exon 3 (SEQ ID NO: 4 or SEQ ID NO: 5) of the IncRNA disclosed herein. This fragment has been shown to have over 80% identity to intronic sequences found in several "target" genes. One such target gene is PDSS2, which encodes an enzyme which synthesizes ubiquinone (Coenzyme Q10), and whose reduced expression has been shown to contribute to the development of Parkinson's Disease pathology. Accordingly, thi fragment is considered to play an important role in carrying out the regulatory function of the IncRNA disclosed herein. Thus, one function of any of the polynucleotides disclosed herein may be to bind specifically to a polynucleotide sequence encoding PDSS2 (e.g., a sequence as set out in SEQ ID NO: 23). By "bind specifically" it is meant that the polynucleotide hybridizes with a polynucleotide sequence encoding PDSS2 more readily than to any other unrelated -polynucleotide sequence under any suitable conditions (e.g., under physiological conditions). Another function of the polynucleotide di closed herei may be to decrease the level of expression of PDSS2. Any potential decrease in. the level, of expression of PDSS2 ma be determined under any suitable experimental conditions. The extent of the decrease may not be important for the purposes of determining the function of a given polynucleotide, provided that a detectable decrease is observed in the presence, compared, to the absence, of a given polynucleotide disclosed herein.

The polynucleotides disclosed herein may be modified by any suitable means. For example, the polynucleotides may be chemically modified to improve their stability or to add one or more functional groups thereto. For example, artificial nucleotide analogues can be incorporated into the polynucleotides disclosed herein. Functional groups can be incorporated in or bound to the polynucleotides disclosed herein to improve their stability, to allow conjugation of a second compound (such as a label) thereto, or for any other purpose. Thus, the polynucleotides disclosed herein may be conjugated t any other compound. In one example, the other compound is a detectable label The detectable label may be a fluorescent label.

Hie polynucleotides disclosed herein may be. isolated or exogenous polynucleotides. The term "isolated polynucleotide", which includes ON A. RNA, or a combination of these, single or double stranded, in the sense or anti sense orientation or a combination of both, dsRNA or otherwise, refers to a polynucleotide which is at least partially separated from the polynucleotide sequences with which it is associated or linked in its native state, Preferably* the isolated polynucleotide is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated. Furthermore, the term "polynucleotide" is used interchangeabl herein with the term "nucleic acid".

The term "exogenous" in the context of a polynucleotide refer to the polynucleotide when present in a cell, or in a cell-free expression system, in an altered amount compared to its native state. In one embodiment, the cell is a cell that does not naturally comprise the polynucleotide. However, the cell may be a cell which comprises a non-endogenous polynucleotide resulting in a altered, preferably increased, amount of production of the polynucleotide. An. exogenous polynucleotide of the invention includes polynucleotides which have not been separated from, ther components of the transgenic (recombinant) ceil, or cell-free expression system, in which it is present, and polynucleotides produced in such cells or cell-free systems which are subsequently purified away from at least some other components. Vectors

The polynucleotides disclosed herein can be incorporated into any suitable vector t enable their expression. Accordingly, the vector disclosed herei preferably comprises a polynucleotide disclosed herein operably linked to a promoter. Thus, the vector is preferably an expression vector.

Suitable expression vectors are known in the art. Generally, expression vectors are either DNA plasmids or viral vectors. Thus, the vector can be a D A plasmid or a viral vector. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an Inc ^' RNA. polynucleotide as disclosed herein. Eukary tic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired polynucleotide segment.

Viral vectors which can be used in the. methods and compositions disclosed herein include, but are not limited to, .adenovirus vectors, retrovirus vectors,: (including but not limited to lentivkal vectors, moloney murine leukemia virus, etc.), adeno- associated yiru& vectors, herpes: simplex virus vectors, SV 40 vectors, polyoma virus vectors, papilloma vims vectors, pieomavirus vectors, pox virus vectors such as. an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox, and a helper- dependent or gutless adenovirus. Preferably, the vector is a lentiviral vactor. Replication-defective viruses can also be used in the methods and compositions disclosed herein. Host cells

The polynucleotides or vectors disclosed herein may be inserted by any suitable means into a host. The host may be, for example, a host cell in vitro. In vitro host cells can be used, for example, to screen for potential therapeutic agents.

In one example, the host cell is a HeLa, MCF-7 or 8H-SY5Y eeil. in another example, the host cell is a SHSY5Y-TET-aSyn as disclosed herein. Other suitable cells will be apparent to a person skilled in tile art. Transgeni animals

The polynucleotides, vectors, or host cells disclosed herein may be inserted by any suitable means into a host animal, thereby creating a transgenic animal. Preferably, the transgenic animal is a non-human animal For example, the non-human animal may be a mammal, such as a rodent (for example, a mouse or rat).

Transgenic animal hosts can be used, for example, to screen for potential therapeutic agents.

Screening methods

The host cells or transgenic animals disclosed herein may be used to screen for agents which are capable of treating a neurodegenerative disease. Thus, the present disclosure also provides a method of screening for an agent which is capable of treating a neurodegenerative disease, the method comprising (i) reducing the level of expression of a IncRNA polynucleotide as disclosed herein in a host cell or transgenic animal, thereby inducing one or more characteristics of a neurodegenerative disease; (ii) contacting the host cell or transgenic animal in (i) with a candidate agent; and (iii) identifying the candidate agent as being capable of treating the neurodegenerative disease if one or more characteristics of the neurodegenerative disease is ameliorated i the presence, compared to the absence, of the candidate agent.

The one or more characteristics of the neurodegenerative disease may he any detectable characteristic. In one example, the characteristic is cell death, such as neuronal, ceil death. Similarly, the candidate agent; may be any suitable potential therapeutic agent.

Diagnostic methods

The IncRNA disclosed herein has been shown to be expressed at reduced levels in samples taken from subjects suffering from neurodegenerative disease, compared to health controls, Significantly, reduced expression levels of the IncRNA disclosed herein have been detected in regions of the human brain before pathological features of disease are observed in those regions. Therefore, detection of reduced expression levels (or activity levels) of the IncRNA disclosed herein (such as the IncRNA of SEQ ID NO: 1 ) can provide an early indication of disease.

By ''reduced" it is meant that the level of expression and/or activity of a IncRNA as disclosed herein in a sample taken from a subject is reduced in comparison to the level of expression and/or activity of the IncRNA in a normal/healthy cell. For example, the level of expression and/or activity of a IncRNA may he reduced in comparison to the level of expression and/or activity of the IncRNA in a normal/healthy neuronal cell.

Hie extent of the reduction may vary. For example, the level of expression and/or activity of the IncRNA may be reduced to a level that is less than 5%. less than 1.0%, less than 15%, less than 20%, less than 25%, less than 30%, less than 35%, less than 40%, less than 45%, less thai: 50%, less than 55%, less than 60%, les than 65%, less than 70%, less than 75%, less than 80%, less than 85%, less than 90%, or less than ^• 95% of that in a normal/health cell (for example, a norm al heal thy neuronal cell).

The diagnostic methods disclosed herein may comprise a step of comparing the level of expression and/or activity of a IncRNA in a sample with a reference level. For example, a lower level of expression or activity of the IncRNA in the sample than the reference level may indicate that the subject from which the sample was derived is more likel to have or to be predisposed to developing the neurodegenerative disease, By contrast, a higher level of expression or activity of the IncRNA m the sample than the reference level may indicate that the subject from which the sample was derived is less likely to have or to be predisposed to developing the neurodegenerative disease.

The diagnostic methods disclosed herein may further comprise a step of determining a reference level. The reference level may be determined from any suitable population of healthy/control subjects.

Alternatively, the reference level may be redetermined

Of course, it will be appreciated that the exact reference level chosen a the comparator for the level of expression and/or activity determined in. a sample can be varied, depending on several factors including the sample used for the diagnosis, the population used to prepare the reference level, and other factors as will be understood by a person ski lled in the art.

The neurodegenerative disease which may h diagnosed can he any neurodegenerative disease or disorder which shares similar pathological features (which features may be visual or may only be detectable at a molecular level) to those of Parkinson's Disease. The neurodegenerative disease may be any neurodegenerative disease or disorder (including a neuropathy) associated with degeneration, dysfunction or death of neurons or other neural cells. Accordingly, the neurodegenerative disease which may he diagnosed includes, without limitation, any of Alexander's disease, Alper's disease, Alzheimer's disease, amyotrophic lateral sclerosis (Lou Gehrig's Disease), ataxia telangiectasia, Batten disease (also known as Spielmeyer-Vogt- Sjogren -Batten disease), bovine spongiform encephalopathy (BSE), Canavan disease, Cockayne syndrome, corticobasal degeneration, Creutzfeldt-Jakob disease, diabetic neuropathy, frontotemporal lobar degeneration, Huntington's disease, HTV-associated dementia, Kennedy's disease, Krabbe's disease, Lewy body dementia, neuroborreiiosis, Maehado-Josepfi disease (Spinocerebellar ataxia type 3), wet or dry macular degeneration, Multiple System Atrophy, multiple sclerosis, Niemann Pick disease, Parkinson's Disease, Peiizaeus-Merzhacher Disease, photoreceptor degenerative diseases such as retinitis pigmentosa and associated diseases. Pick's disease, primary lateral sclerosis, prion diseases, Progressive Supranuclear Palsy, Refsum's disease, Sandhoff s disease, Sehilder's disease, subacute combined degeneration of spinal cord secondary to pernicious anemia, Spielmeyer-Vogt-Sjogren-Batten disease (also known as Batten disease), spinocerebellar ataxia (multiple types with varying characteristics), spinal muscular atrophy, Steele-Richardson-Olszewski disease, tabes dorsalis, and others. Traumatic injury or other damage t neuronal cells (e.g., .trauma due to accident, blunt-force injury, gunshot injury, spinal cord injury, ischemic conditions of the nervous system such as stroke, cell damage due to aging or oxidative stress, and. the like) is also intended to be encompassed by the term "neurodegenerative disease or disorder", in one example, the neurodegenerative disease may be an alpha synueleinopathy (AS) or any disease characterised by abnormal expression or processing of alpha synuclein,

Preferably, the neurodegenerative disease is Parkinson's Disease (PD). The neurodegenerative disease may be any known form of PD, For example, the neurodegenerative disease may be familial or sporadic PD. Preferably, the neurodegenerative disease is sporadic PD.

Any known methods may be used to determine the level of expression or activit of the pol nucleotide or fragment thereof disclosed herein. For example, the level of expression of the inc N A disclosed herein may be determined by quantitati ve PGR. Any suitable activity of the IncRNA disclosed herein may be measured in the diagnostic methods disclosed herein. For example, the activity may be any polynucleotide "function" as described herein. Thus, the activity may be the ability to bind specifically to a polynucleotide sequence encoding PDSS2 (e.g., a sequence as set out in SEQ ID NO: 23). By "'bind specifically" it is meant that the polymicleotide hybridizes with a polynucleotide sequence encoding PD$$2 more readily than to any other unrelated polynucleotide sequence under any suitable conditions (e.g., under physiol gic l conditions). Another activit of the IncRNA disclosed herein ma be to decrease the level of expression of PDSS2. Any potential decrease in the level of expression of ^" PDSS2 may be determined under an suitable experimental conditions. Other suitable activities can be determined using standard methods known in the art.

The methods disclosed herein may be used to monitor a subject's response to treatment for a neurodegenerative disease. For example, meausring the level of expression and/or activity' of a IncRNA as disclosed herein at a first time point prior to administration of a particular course of a therapeutic agent (which need not necessarily be the first administration of that therapeutic agent), and at a second time point after administration, of the particular course of a therapeutic agent, can provide an indication, of the subject's response to the therapeutic agent. For example, a higher level of expression and/or activity of the IncRN A at the second time point compared, to the first time point may indicate that the subject is responding successfully to treatment. Of course, the particular time points can be chosen depending on the particular disease being treated and on the particular therapeutic agent being administered

The diagnostic methods disclosed herein may .additionally or alternatively comprise determining the presence of any disruptive sequence alterations in the IncRNA derived from a sample, compared to the IncRNA sequences disclosed herein. The disruptive sequence alterations may he any alteration that prevents the IncRNA from erforati g a function as disclosed herein. For example, the disruptive sequence alteration may hinder the ability of the IncRNA to hybridize to a target sequence in a polynucleotide encoding PDSS2. Disruptive sequence alterations may include, for example and without limitation, mutations (including single nucleotide polymorphisms or SNPs), insertions or deletions. Thus, if a IncRNA sequence detected in a sample taken fro a subject has a disrputive sequence alteration compared to any one of the sequences disclosed herein (e.g., SEQ ID NO: 1), the subject from which the sample was derived may be determined to have an increased or decreased likelihood of having or being predisposed to a neurodegenerative disease. The diagnostic methods disclosed herein may further comprise a step of determining a treatment for a subject. For example, the diagnostic methods disclosed herein may further comprise a ste of determining whether a subject would benefit from treatment with any agent known to treat a neurodegenerative disease (suc as Parkinson's Disease), wherein an increased likelihood of a subject having or being predisposed to a neurodegenerative disease indicates that the subject may benefit from administration with one or more agents known to treat the neurodegenerative disease. The one or more agents may be any agents approved for use in treating the neurodegenerative disease. In. addition, the diagnostic methods disclosed herein may further comprise step of administeiing agent know to treat a neurodegenerative disease to a subject.

Hie diagnostic methods disclosed herein may be combined, with any other known method of diagnosing a neurodegenerative disease. Combining the diagnostic method disclosed herein with other, known diagnostic methods .may increase the power of the diagnosis, providing a more reliable indication of a subject's likelihood of having or bein predisposed to a neurodegenerative disease. Thus, the diagnostic methods disclosed herein may further comprise detecting one or more additional markers of neurodegenerative disease (such as one or more additional, markers of Parkinson's Disease). Such markers may be biochemical (such as SNPs in genes known to be associated with a neurodegenerative disease, for example, a Syii, PD5S2, DJ-1 and others known to be associated with PD)» physical, (including non-motor or motor features typical of a neurodegenerative disease, including sleep abnormalities _. , neurobehaviourai symptoms, olfactory dysfunction, and others .associated with PD), imaging methods (suc as transcranial Doppler ultrasonography, radiolabeled tracer imaging, magnetic resonance imaging (MRi), positon emission tomography (PET) and others).

The diagnostic methods disclosed herein may be performed, on a sample taken from a subject. In one example, the sample is taken from a mammalian subject, such as a human subject. The sample may be a biological sample. The biological sample may he, for example, any material, biological fluid, tissue, or cell obtained or otherwise derived from a subject including, but not limited to, brai tissue, blood (including whole blood, leukocytes, peripheral blood mononuclear ceils, plasma, and serum), sputum, mucus, nasal aspirate, urine, semen, saliva, meningeal fluid, lymph fluid, milk, bronchial aspirate, a cellular extract, and cerebrospinal fluid. The sample may include experimentally separated fractions of any of the preceding samples. For example, a blood sample can be fractionated into serum or into fractions containing particular types of blood cells, such a red blood cells or white blood cells (leukocytes), If desired, a sample may be a combination of samples from, an individual, such as a combination of a tissue and fluid sample. A biological sample may also include materials containing homogenized solid material, such as from, a stool sample, a tissue sample, or a tissue biopsy;; or materials derived from a tissue culture or a cell culture. Preferably, the sample is a brain tissue sample, a cerebrospinal fluid sample, or a blood sample.

The diagnostic methods disclosed herein may further comprise a step of administering a treatment to a subject. For example, the diagnostic methods disclosed herein may further comprise a step of administering a known treatment for a neurodegenerative disease to a subject. Alternatively or in addition, the diagnostic methods disclosed herein may further comprise a step of increasing the level of expression and/or activity of a IncRNA a disclosed herein, in accordance with any of the therapeutic methods disclosed herein.

Therapeutic methods

Increased expression of the IncRNA disclosed herein has been, shown to protect against cellular damage t neurons and neuron-like cells. Thus, the present disclosure provides a method of treating a neurodegenerative disease in a subject by increasing the level of expression and or activity of a IncRNA as disclosed herein (such as the IncRNA of SEQ ID NO; 1 or any naturally occurring variants thereof). By "increasing" it is meant that the level of expression and or activity of the IncRNA in the subject is increased above -the level observed in a reference sample. The reference sample may be, for example, sample derived from one or. more subjects known to be suffering from the neurodegenerative disease.

The therapeutic methods disclosed herein may comprise administering to a subject a therapeutically effective amount of an agent which is capable of increasing the level of expression or activity of a IncRNA in the subject corresponding to a IncRNA as disclosed herein (e.g., as defined in SEQ ID NO: .1 ).

In one example, the agent may be an agent that increases the level of endogenous expressio of the IncRNA from, the subject's genome. For example, the agent may interact with one or more transcription factors that coordinate expression of the endogenous IncRNA so as to increase the IncRNA ^* s expression.

in another example, the agent may be a polynucleotide or vector encoding the IncRNA as disclosed herein. Thus, an exogenous polynucleotide encoding the IncRNA disclosed herein can be administered to a subject and expressed in that subject. The therapeutic methods disclosed herein may comprise administering an agent whic increases the level of expression and/or activity of a IncRNA as disclosed herein to subject in combination with another therapeutic agent. The ^' other therapeutic agent can be any agent which is approved for use in treating the neurodegenerative disease.

Pharmaceutical compositions

The present disclosure provides a pharmaceutical composition comprising a polynucleotide or a vector as disclosed herein, and a pharmaceutically acceptable carrier.

A pharmaceutically acceptable carrier includes a veterinarily acceptable carrier, in. one example, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil soybean il, mineral oil, sesame oil and the like.

Therapeutic compositions can be prepared by mixing the desired compounds having the appropriate degree of purity with optional pharmaceutically acceptable earners, excipients, or stabilizers (Remington's Pharmaceutical Sciences, 16th edition, Osol, A. ed. (1980)), in the form of lyophilized formulations, aqueous solutions or aqueous suspensions < Acceptable carriers, excipients, or stabilizers are preferably nontoxic to rec pients at the dosages and concentrations employed, and include buffers such as Tris, HEPES, PIPES, phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadeeyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkoniu.m chloride, benzetlionium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl, or propyl parahen catechol; resorcmoi; cyelohexanol 3-pentanol; and m- cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydropMIic polymers such as polyvinylpyrrolidone; ^' amino acids such as glycine, glutamine, asparagme, histMme, arginine. or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; and/or non-ionic surfactants such as TWEEN ^TM , PLURO ICS™ or polyethylene glycol (PEG). Additional examples of such carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum ^• proteins,: such as human serum albumin, buffer substances such as glycine,: sorbic acid, potassium sorbate. partial giyceride mixtures of saturated vegetable fatt acids, wafer, salts, or electrolytes such as protamine sulfate, di sodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, colloidal silica, magnesium, trisiiicate, polyvinyl pyrrolidone, and cellulose-based substances.

A pharmaceutical composition as disclosed herein is formulated, to be compatible with its intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal, intrathecal), mucosal (e.g., oral, rectal, intranasal, buccal, vaginal, respiratory), enteral (e.g., orally, such as by tablets, capsules or: drops, rectaily) and transdermal (topical, e.g., epicutaneous, inhalational., intranasal, eyedrops, vaginal). Solutions or suspensions used for parenteral, intradermal, enteral or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such a ascorbic acid or sodium bisulfite; chelating agents such, as etbylenediammetetraacettc add; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium. hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solution or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Q'emophor™ (BASF, Parsippany, NJ.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringahi lify exists, it must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of .microorganisms such as bacteria and fungi. The carrier is a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants, Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, ehlorobutanol, phenol, ascorbic add and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions is brought about by including in the •composition an agent which delays absorption, for example, aluminum monostearate- and gelatin.

Sterile injectable solutions, may be prepared by incorporating the active compctund in the. required amount in an appropriate solvent with one or a combination of ingredients enumerated above,: as required, followed by filtered sterilization, ^• Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium, and the required other ingredients from those enumerated above, in the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze -drying which yields a powder of the active ingredient plus any additional desired ingredient from, a previously sterile-filtered solution thereof.

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound is incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions are also prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar- nature: a binder such as mi.crocrystalline cellulose, gum tragaeantb or gelatin; an excipient such, as starch or lactose, a disintegrating agent such a alginic acid, Primogei, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

A pharmaceutically acceptable vehicle is understood to designate a compound or a combination of compounds entering into a pharmaceutical composition which does not cause sid effects and which makes it possible, for example,, to facilitate: the administration of the active compound, to increase its life and/or its efficac in the body, to increase its solubility in solution or alternatively to enhance its preservation. These pharmaceutically acceptable vehicles are well known and will be adapted by persons skilled in. the art according to the nature and the mode of administration of the active compound chosen. Pharmaceutical compositions to be used for in vivo administration should be sterile. This is readily accomplished by filtration through sterile filtration membranes, prior to or foilowing lyophilization and reeonstitution. The composition may be stored in Jyophilized form or in. solution if administered system) catiy. if in lyophilized form., it is typically formulated in combination with other ingredients for reeonstitution with an appropriate diluent at the time for use. An example of a liquid formulation is a sterile, clear, colourless unpreserved solution filled in a single-dose vial for subcutaneous injection.

Pharmaceutical composition generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceahk by a hypodermic injection needle. The compositions are preferably administered parenterally, for example, as intravenous injections or infusions or administered into a body cavity.

The inventio will now be further described with reference to the following, non-limiting examples.

EXAMPLES

EXAMPLE 1: identification of a functional IncRNA from the human S ^' NCA locus. Methods

Based on a bioinformatie analysis we predicted the existence of a multi-exonic IncRNA ClncRNA-A"; Figure ,1 ) flanking the a Syn gene. However, since sequence predictions based on such analyses are not always accurate, we undertook to isolate and verify the sequence of the putative IncRNA from cultured human cell li es and from human brain tissue.

Total RNA was extracted using Trizol reagent (Life Technologies) as per manufacturer's instructions, For brain tissue, 1ml Trizol was added to 50mg brain tissue and homogenised using RNase-free pellet pestle (ThermoFisher). 60xl0 ⁴ cells were used for cell culture lines. RNA was resuspended in 20μΙ nuclease free water and concentration determined ^' by NanoDrop. 2-4pg RNA was converted to cDNA using Superscript® II First Strand Synthesis System (Life Technologies) and oligo 4(f)¾) primers as per manufacturer's instructions.

Quantitative reverse transcriptase PCR (qRT PCR) was performed using either SensiMix™ probe (Bioline) and Syto 9 dye (Life Technologies) or Li.ghtcycl.er® 480 Probe Master Mix (Roche) and Untversal Probe Library (Roche). Reactions were run on a LigiitCyeIer®48Q using standard conditions. Primers used were as follows; Control Primers:

a) B2M

F- TTCTGGCCTGGAGGCTATC (SEQ; ID NO: 9)

R- TC AGGA AATTTG ACTTTCCATTC {SEQ ID NO : 10)

b) HPRT

F- TGACCTXGATTTATTTTGCATACC (SEQ ID NO: 11)

R- CATCTCGAGCAAGACGTTCA (SEQ ID NO: 12)

Experimental primers:

a) SNCA lncRN A~A

F- GAGTCTTCTAAAATAAAACCTC AAATTC (SEQ ID NO: 13)

R- CACTTAGGTGGCTTCCAAATCTTG (SEQ ID NO: 14)

b) Alpha Synuclein

F- AGAAGCAGCAGG AAGACAAAAG (SEQ ID NO: 15)

R- TCTTTGGTCTTCTCAGCCACTGT (SEQ ID NO: 16)

The cultured cell lines HeLa, MCE- 7 and SH-SY5Y (a dopaminergic neuroblastoma cell line commonly used as a PD model) were examined for IneRNA-A expression. Differentiated SH-SY5Y neuronal cells with stably integrated titrable TET-OFF promoter driving expression of a human a Synuclein transgene (SHSY5Y- TET-aSyn) were used as an. experimental model of PD because we have found that lo induced aSynuelein expression in combination with a low concentration of the complex I inhibitor rotenone (an insecticide and PD mimic) in these cells produced a significantly greater degree of ceil death (as detected by ethidium nomodimer-l staining and subsequent FACS analysis) relative to unstressed cells.

The ethidium dimer celt death assessment assay was performed as follows. Cells were stained for an hour in fresh media containing the appropriate concentration: of Ethidium Homcxlimer-1 (Sigma).

- Media was removed and 2ml of pfe-prepared media+stain was added and the cells i ncubated at 37°C for 1 hour.

- At end of the staining period, media was removed and cell washed with 1 ml media.

- 400μ1 of TiypLE™ (Invitrogen was added to dislodge ceils.

- Using I mi of media the well was washed to get all cells in suspension.

- The 1.4ml cell suspension was transferred to a micro tube and spun down at lOOg for 1 Grain.

- Supernatant was removed and the pellet brought up in 500ul FACS buffer.

- 5Ό0μ1 was pipetted through a FACS tube strainer. - Ethidiura-Homodiiner Hu resence was read on flow cytometer LSRII (BD Biosciences) i Y.G610 channel , counting approx. 10,000 - 50,000 ceils.

- Data was analysed using FlowJo.

Brain tissue samples were obtained from Neuroscience Research Australia (NeuRa Asutralia),

Initially, the following primers were used to amplify the IneRNA sequence from HeLa cells and control (healthy) human brain hippocampal tissue.

5 ' cloning oligo;

S'-CGAAGCTTGTCTGTG^

3 ^' (SEQ ID NO: 1?)

3 ' cloning oligo:

5 ' -CGCTCG AGAT AG AGAGCCG A A ATATTTTATTTTGATTAAATACATAAT AGTTAT GGTCTTGGT ATTG-3 ' (SEQ ID NO: 18)

Results

PGR amplification and sequencing revealed the existence of three variant transcripts of the functional hicRNA-A (SEQ ID NOs: 1, 2 and 3). The first variant (SEQ ID NQ: 1) was isolated from all human brain hippocampal tissue examined. This variant comprises a first exon containing 179 nucleotide bases (SEQ ID NO: 6), a second exon containing 121 nucleotide bases (SEQ ID NO; 7) and a third exon containing 1716 nucleotide bases (SEQ ID NO: 4i.

Hie second variant (SEQ I NO: 2) was isolated from some HeLa cells but was not found in the human brain hippocampal tissue examined. This variant comprises the same first, second and third exons (i.e., SEQ ID NOs: 6, 7 and 4) but also comprised an additional exon (referred to herein as "'exon 1.5") between the first and second exons, containing 105 rcucelotide bases (SEQ ID NO: 8).

The third variant (SEQ ID NO: 3) comprises the same first and second exons (i.e., SEQ ID NOs: 6 and 7). but comprises a shorter, 1522 -nucleotide base third exon (SEQ ID NO: 5).

Due to its proximity to the Syn gene, the IncRNAs disclosed herein are considered likely to modulate Syn expression and/or post transcriptional modification (such as niRNA splicing). EXAMPLE 2: Expression of an liicRNA from the SNCA locus is significantly reduced in brains of sporadic PD patients.

Methods

Using q-RT-PCR we examined the expression of ineRNA~A in human, brain tissue samples derived mm PD patients and healthy patients (coatrols). Primers used were targeted to exons 2 and 3 of IncRNA-A, thereby amplifying across an exon junction and reducing the- risk of amplifying contaminating DNA. RNA was extracted from brain, tissue samples and cDNA synthesis and qRT-PCR was performed as- described in Example 1 above.

Results

cRNA-A was expressed in PD sensitive brain regions (hippocampus and frontal cortex; Table 1), PD pathology has been seen to follo a consistent pattern based on the rate, and location of deposition of a Syn, resulting in the categorisation of six distinct "Braak" stages of disease (Braak et ah, 2003; Goedert et ail., 2012). These stages are outlined in Table 1.. At present, PD diagnosis is not feasible until the mid stage of the disease hen progressive loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNc) is thought to result in the majority of motor symptoms (Table 1 ; stages 3-4).

Table 1 : Braak disease stages of PD and examples of brain regions affected at each- stage.

in examining expression levels m the hippocampus in a cohort of 6 sporadic mid stage PD samples (Braak stage 4; Table 1), we found that incR A-A was reduced > 5 fold relative to age-matched controls (p=0.O01; Figure 2). In addition, reduced expression of IncRNA-A could be detected in the frontal cortex before the development of PD pathology in the frontal cortex, suggesting that the change in IneRNA-A expression occurs early in PD. These results indicate that' IncRNA-A can be used to diagnose the presence of PD in patients at a relati vely early stage of disease. EXAMPLE 3: lncRN A-A coordinately regulates a large network of genes required for normal neuronal function.

Methods

We determined that exon 3 of IncRN -A has >80% identity, over a 600 base pair continuous sequence (specifically, at about the first 600 nucleotides of exon 3), to mtronic/non-protein coding sequences found in at least 57 genes.

One of these genes is PDSS2 (prenyl (decaprenyl) diphosphate synthase, subunit 2; HGNC ID No. 23041; GenBank Accession No, AF2S4956.1), which encodes an enzyme (hat synthesizes ubiquinone (Coenzyme QIO). Coenzyme QI O plays a role in the mitochondrial O.XPHOS complex 1 that provides most neuronal ATP. Mitochondiial OXPHOS Comple I deficiency is strongly associated with PD. In mice, reduced PDS52 expression causes both decreased complex I activity and oxidative stress (Quinzii et al., 2013) while inactivatton in .substantia nigra dopaminergic (DA) neurons produces PD movement symptoms- (Ziegler et al, 2012), Thus, PDSS2 mactivation has been shown to be directly causative of PD symptoms.

Another of these genes is ΗΪΡΚΊ. (Homeodomain interacting protei kinase 1 ; HGNC ID No. 19006; GenBank Accession No. AB089957.1), whose protein has been shown to interact with the known PD gene DJ-1 (also known as PARK? (Parkinson Protein 7); HGNC ID No. 16369; GenBank Accession No. D61380.2). DJ-1 is a neuroprotective oxidative stress sensitive chaperone that directly interacts with HIPKl , whose knockdown renders cells sensitive to oxidative stress (Sekito et al., 2006).

Other IncRNA "target" genes include genes which encode components, of pathways whose dysfunction is intimately associated with. PD, Such pathways include mitochondrial oxidative phosphorylation (OXPHOS) complex I and exocytosis/endocytosis of synaptic vesicles.

The high degree of identity over a long sequence of the regulatory molecule IncRNA-A with a number of known PD genes, and the d wnregulation of IncRNA-A in PD tissue, suggests that lncRN A- A plays a role in protecting against the development of. PD. Similarly, tihese data suggest that reduced expression of IncRNA-A may play a causati e role in the development of PD~ltke symptoms. In addition, the .finding that IncR A-A interacts with at least 57 "target" genes suggests that IncRNA-A acts as a master regulator by modulating the expression of this gene network. This has exciting implications, revealing the potential to develop a therapeutic treatment based on modulating IncRNA-A expression that can impact multiple PD pathways in a single treatment. To demonstrate that these predicted target genes are indeed regulated by IncRNA-A we knocked down IncRNA-A expression in human HeLa cells using either a custom gapmer (Exiqon) having the sequence 5' GATGGTGGCATTT GT 3' (SEQ ID NO; 1 ) targeted to exon .1 of IncRNA-A so as to reduce IncRNA-A expression, or a modified antisense oligo having the sequence 5' TGTACTGTCTCCTCTCTTGG 3' IDT (SEQ ID NO: 20) targeted, to exon 3 of IncRNA-A so as to reduce IneRNA-A expression. HeLa cells were transfec ed with lipofectamine 200·}, and cultured for 24- 48 hours prior to RNA extraction. cDNA synthesis and subsequent qRT-PCR analysis was performed to assess the impact on several potential IncRNA-A target genes including PDSS2.

Results

When targeting exon 1 to achieve IncRNA-A knockdown, we observed significantly decreased expression of IncRNA-A and each IncRNA-A target gene examined, including a 67% reduction for PDSS2.(Figure 3).

When targeting exon 3 to achieve IncRNA-A knockdown, we achieved a 75% reduction in. IneRNA-A expression. We als observed significantly decreased expression of each IncRNA-A target gene examined, including a 42% reduction for PDSS2 (Figure 4).

These data validate our prediction that IncRNA-A is regulating a large gene network intimately associated with major PD pathological pathways. Since reduced expression of IncRNA-A conrelates with reduced expression of many IncRNA-A target genes, IncRNA-A appears to promote target gene transcription. Without being bound, by theory, one possible mechanism by which mcRNA~A may exert its effect is by .recruiting transcription promoting histone-modifying complexes. X MPLE 4: .UTCRNA-A target gene expression is significantly reduced in brains of sporadic PD patients.

Methods

Using qRT-PCR we examined the expression levels of a representative number of IneRNA-A target genes in brain tissue samples taken from, human sporadic PD patients. RNA was extracted from brain tissue samples and cDNA was synthesised as. described in Example 1 above. qRT-PCR was performed as described in Example 1 above. Primers used were as follows: Control Primers;

a) B2M

F- T CTGOCCTGGAOGCTATC (SEQ JD NO: 9)

R- TCAGGAAATTTGACTTTCCATTC (SEQ ID NO: 10)

b) HPRT

F- TGACC TGATTTATTTTGCATACC (SEQ ID NO: 1)

R- CATCTCGAGC A AG ACGTTC A (SEQ ID NO: 12)

Experi mental Primers :

a) PDSS2

F- CAC CAGCACCCTCTGCTT (SEQ ID NO: 21 )

R- CCCCTCAACTGGAGGCTATT (SEQ ID NO: 22)

Results

We found: that expression of the IncRNA-A target ge e PDSS2 was already reduced by 60% (p=0.00003) in frontal cortex tissue (tissue only affected in the last stage of disease) taken from six sporadic PD patients (Braak stage 4). The expression of two other IncRN A- target genes was also significantly reduced (64% (p=0.0081) and 45% Q?=0.0GQ3)) relati ve to age-matched controls in the hippocampal region of the same six patients.

These data indicate that IncRNA-A is regulating gene expression in the human brain. The observed reduction of an IncRNA-A target gene in frontal cortex tissue taken from patients at Braak stage 4, despite the fact that PD pathology is only typically seen in the frontal cortex in the last stage of disease (stage 6), indicates that the changes in IncRNA-A expression in PD patients occurs early on in the development of disease and suggests that IncRNA-A dysfunction plays a causative role hi the development of disease. Interestingly, these data also indicate that IncRNA-A expression levels can be used to provide an early diagnosis of neurodegenerative diseases such as PD. EXAMPLE 5: IncRNA-A expression is increased in cells challenged with a neurodegenerative disease-causing agent.

Methods

Altered expression level of IncR A-A upon exposure to mimics of PD in experimental models would be a further indication of an. association, between IncRNA- A and neurodegenerative, diseases such as PD. Rotenone is an insecticide/pesticide inhibitor of mitochondrial OXPHOS complex, which is widely used as a PD model sy stem. SHSY5Y cells were exposed to a low concentration of rotenone (25nM) for 2 days in F12:DMEM media, their viability assessed by alamarBlue® (Life Technology) and RNA extracted and analysed for IncRNA-A expression levels relative to untreated controls.

Results

IncRNA-A expression was found to increase >2.5 fold (>250%) upon exposure to rotenone relative to untreated cells (Figure 5). This indicates that lne-RNA-A plays a protective role in preventing the development of PD-iike symptoms, since its expression increased on exposure to the PD mimic rotenone. This is consistent with the other data provided herein, which indicate that higher levels of expression of IncRNA- A are required to protect against PD-like pathology,

EXAMPLE 6; Over-expression of IBCRJMA-A provides neuroprotection against PD associated stress.

Methods

Given the ~ 5-fold reduction in IncRNA-A expression i PD relevant brain region of sporadic PD patients we undertook to determine if elevated IncRNA-A expression could provide a neuroprotective effect in. the S.HSY5 Y-TET-aSyn PD model system. IneKNA- A (SEQ ID NO; 1) was amplified fay PGR from the hippocampus of a human control This was sequenced (confirming that the amplified sequence was identical to SEQ ID NO: 1) and inserted into a Ientiviral expression plasmid which in turn was used to make lentivirus .in LentiX cells (Clonteeh), The resulting IncRNA-A encoding lentivirus was purified from the cell culture media and used to infect SY5Y- TET- Syn cells. Bkstieidin was used to positively select for those SHSY5 Y-TET-aSyn cells infected by the lnc.RNA-A encoding lentivirus. RNA cDNA/qRT-PC ^' R analysis from these SHSY5Y-TET-aSyn/ien.ti-hicRNA-A cells found significant elevated expression of IncRNA-A relative to the SHSY5Y-TET-aSyn/lenti-eontroL

Two distinct PD relevant stresses that induce cell loss (cell death) were applied to the SHSYSY-TET-aSw/lenti-lncRNA-A and SHSY5Y-TET-aSyn/lenft-controI cells: (1) full induction of aSynuclein expression (Full aSyn) and (2) low induced elevated, expression of aSynuclein and a low exposure to rotenone (50μΜ) - a combination that we have found displays potentiating toxic effects (Low aSyn + low Rot).

Results

Over-expression of IncRNA-A provided a considerable neuroprotective effect in stress conditions to both stresses (Figure 6), These data clearly indicate that IncRNA-A plays a protective role against the development of PD-like symptoms (e.g.,: neuronal cell death) and that increasing IncRN -A. expression produces a therapeutically beneficial effect by reducing neuronal cell death associated with neurodegenerative diseases such as PD.

EXAMPLE 7; Detection of IncRNA A in blood samples.

Methods

Given the validation of IncRNA-A's role in the development of neurodegenerative diseases as described herein, we attempted to isolate lncRNA-A from human blood samples in order to assess the potential for this IncR A to be used conveniently in diagnostic and prognostic methods. Total NA was extracted from human blood (~ 3x 10 ⁶ human PBMCs), cDNA synthesized, and qRT PCT performed as described in Example 1. Results

IncRNA-A was detected in human blood cells, demonstrating the feasibility of basing prognostic and diagnostic methods OR IncRNA A. levels determined from blood samples. It will be appreciated by persons skilled in the art that numerous variations and/or modifications may he made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered i all respects as illustrative and not restrictive.

All publications discussed above are incorporated herein in their entirety.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in lite field relevant to the present invention as it existed before the priority date of each elaim of this application.

REFERENCES

Braak, 1 1., et al., (2003) Neurobiol Aging 24: 197-21 1 .

Goedert, M.» e al, (2012) Nat Rev Neurol 9: 13-24.

Qufflzii, C. M., et al„ (2013) FASEB /27: 612-621. Ziegler, C. G., et al, (2.012) Mitochondrion 12: 248-257.

Sekito, A., et al., (2006) Fre Radic Res 40: 155-165.

Taft, R. J., et al., (2010) J Pathol 220: 126- 139.

Qureshi, 1. A., et al, (2010) Brain Res 1 38: 20-35.

Kelemen, O., et al., (2013) Gene 514: 1-30.

Sanchez-Pla, A,, et al., (2012) Nmroimmunol 248: 23-31.

lrimia, M., and B. J. Blencowe (2012) Curr Opin Cell Biol 24: 323-332.

Kalsotra, A., and T. A. Cooper (2011) Nat Rev Genet 12: 715-729.

Grabowski, P. (2011) Curr Opin Genet Dev 21 : 388-394.

Ciario, E. , et al, (2 12) Dis Model Meek

Barry. G., et al.. (2013) 'The long non -coding RNA Gomafu is acutely regulated in response to neuronal activation and involved in schizophrenia-associated alternative fi.pl icing." Molecular Psychiatry (published online 30 April 2013) (Molecular

Psych tiry 2014 Apr; 1 (4):486-94).

Chartier-Harlin, M. C, et al., (2004) LcuKet 364: 1167-1 169.

Ibanez, P., et al, (2004) Lancet 364: 11 9-1171 .