RETINOID-GLITAZONE COMBINATIONS FIELD OF THE INVENTION This invention concerns a combination of a retinoid and a glitazone for treating diseases associated with uncontrolled cellular proliferation, such as cancer, restenosis, and atherosclerosis BACKGROUND OF THE INVENTION Many disease states are characterized by the uncontrolled proliferation and differentiation of cells. These disease states encompass a variety of cell types and maladies such as, cancer, atherosclerosis, and restenosis. Growth factor stimulation, autophosphorylation, and the phosphorylation of intracellular protein substrates are important biological events in the pathomechanisms of proliferative diseases.

Cell proliferation is a tightly controlled process in higher organisms.

Defects in cell proliferation control can induce tumorigenesis, augment atherosclerotic lesion development, and induce restenosis following angioplasty.

Cell proliferation defects may also block normal proliferative responses such as in symptomatic complications of diabetes (e. g., wound healing). Identification of genes that control the cell cycle progression has attracted a great deal of attention, since this knowledge may lead to the practical development of new therapies for cancer, cardiovascular diseases, and diabetes.

PPARy is a nuclear hormone receptor which belongs to the peroxisome proliferator activated receptor (PPAR) family. Currently, three types of PPAR receptors have been cloned from various species and includes PPARa, PPARß (also known as PPAR8), and PPARy. Two PPARy subtypes, PPARyl and PPARy2, are generated from alternate splicing of the same gene. PPARyl and PPARy2 share the same amino acid sequence, except that PARy2 has 30 additional amino acids in its N terminal. Chimeric nuclear hormone receptors containing a PPAR ligand-binding domain identified the compound Wy 14643 as

a ligand for PPARa, and the thiazolidinedione, BRL 49653 (rosiglitazone), as a ligand for PPARy (Wahli et al., Chem. Biol., 1995; 2: 261-266). Upon ligand binding, PPAR receptors activate the transcription of many PPAR responsive genes, including acyl CoA oxidase, apolipoprotein A-1, and aP2.

Retinoids play an essential role in controlling the normal growth and differentiation of various tissues and are therefore important for prevention and treatment of premalignant and malignant lesions. It has even been found that retinoids can cause cellular repair of hyperplastic, metaplastic, and dysplastic lesions caused by carcinogens. Moreover, retinoid deficiency has been shown to enhance susceptibility to chemical carcinogenesis. Indeed, retinoids are essential for the normal cellular growth and differentiation of epithelial tissues where more than half of the total primary cancers develop in both men and women. These epithelial tissues include the mouth, bronchi, larynx, pharynx, breast, esophagus, stomach, colon, uterus, kidney, bladder, testis, prostate, pancreatic ducts, and skin.

In the absence of retinoids in the diet, normal cellular growth and differentiation is disturbed.

We have now discovered that 9-cis-retinoic acid (RA) and PPARy play important roles in the regulation of cellular growth and differentiation. In THP-1 cells, a human monocytic leukemia cell line, RA markedly induced PARyl RNA, whereas PPARy2 RNA was undetected. Nuclear PPARyl protein content, as well as cell growth suppression, paralleled the concentration dependent RA induction of PARyl RNA. During a 2-day culture period, THP-1 cell number increased nearly 2-fold in the absence of RA, whereas cell number remained unchanged with 500 nM RA treatment. Addition of a glitazone PPARy ligand, BRL 49653 significantly and concentration dependently enhanced the growth suppression ability of RA. The simultaneous treatment of THP-1 cells with a suboptimal inhibitory concentration of RA (5 nM) plus BRL 49653 (10) lu) completely arrested cell growth.

An object of this invention is thus to provide combinations of a retinoid and a glitazone and a method of treating proliferative diseases by administering a combination of a retinoid and a glitazone.

SUMMARY OF THE INVENTION This invention provides a composition which is a combination of a retinoid and a glitazone. The invention further provides a method for inhibiting and controlling cell proliferation comprising administering an effective amount of a retinoid and an effective amount of a glitazone. The invention further provides a method for inducing cellular expression of PPARyl RNA and protein.

A preferred embodiment is a combination of 9-cis-RA and a glitazone selected from troglitazone, pioglitazone, and rosiglitazone.

Numerous compounds are known which are characterized as retinoids. A comprehensive discussion of retinoids is given by Dawson and Hobbs, in Chapter 2 of The Retinoids: Biology, Chemistry, and Medicine, 2nd ed., Sporn, Roberts, and Goodman, Raven Press, Ltd., New York, 1994. That reference is incorporated herein by reference for its teaching of the synthesis of retinoids. All that is required by this invention is that a compound characterized as a retinoid is administered to an animal in combination with a glitazone.

Preferred retinoids to be utilized in the present invention include retinoic acid of the formula Retinoic acid derivatives also are preferred, for example, compounds of the formula COOester Ar wherein Ar is an aryl group and"ester"is an organic ester forming group.

Retinoids which are dienyl benzoic acid and enzynylaryl carboxylic acids also are preferred. For example, compounds of the formula where R I is cycloalkyl or aryl, and R2 is a typical phenyl substituted group such as halo, alkyl, alkoxy, alkylthio, and the like.

Compounds such as

where R3 is, for instance

also are preferred.

All of the retinoids required for this invention are known and available by well-known synthetic methodologies.

The glitazones are a family of antidiabetic agents characterized as being thiazolidinediones or related analogs. They are described in Current Pharmaceutical Design, 1996; 2: 85-101. Typical glitazones have the formula

where n is 1,2, or 3, Y and Z independently are O or NH; and E is a cyclic or bicyclic aromatic or non-aromatic ring, optionally containing a heteroatom selected from oxygen or nitrogen.

Preferred glitazones have the formula

wherein: R1 and R2 independently are hydrogen or C1-Cs alkyl; R3 is hydrogen, a C1-C6 aliphatic acyl group, an alicyclic acyl group, an aromatic acyl group, a heterocyclic acyl group, an araliphatic acyl group, a (C 1-C6 alkoxy) carbonyl group, or an aralkyloxycarbonyl group; R4 and Rs independently are hydrogen, C 1-C5 alkyl, C 1-C5 alkoxy, or R4 and Rs together are C 1-C4 alkylenedioxy; W is-CH2-, >CO, or CHOR6, where R6 is any one of the atoms or groups defined for R3 and may be the same as or different from R3; n, Y, and Z are as defined above, and pharmaceutically acceptable salts thereof.

An especially preferred glitazone is troglitazone having the formula

Other glitazones that can be employed in this invention are described in United States Patent No. 5,457,109, which is incorporated herein by reference.

Other specific glitazones which are preferred include ciglitazone, pioglitazone, englitazone, TA 174, which has the formula and BRL 49653, which is now called rosiglitazone and has the formula

Additionally preferred glitazones include: 5- (4- [2- [I- (4-2'-Pyridylphenyl) ethylideneaminooxylethoxy] benzyl]- thiazolidine-2,4-dione; 5- (4- [5-Methoxy-3-methylimidazo [5,4-b] pyridin-2-yl-methoxy) benzyl]- thiazolidine-2,4-dione, or its hydrochloride; 5-[4-(6-Methoxy-1-methylbenzimidazol-2-yl-methoxy) benzyl]- thiazolidine-2,4-dione; 5- [4- (l-Methylbenzimidazol-2-ylmethoxy) benzyl] thiazolidine-2,4-dione; and 5- [4- (5-Hydroxy-1,4,6,7-tetramethylbenzimidazol-2-ylmethoxy) benzyl]- thiazolidine-2,4-dione.

Another embodiment of the invention is a method for inhibiting cell proliferation comprising administering a glitazone together with a retinoid. A preferred method comprises treating cancer.

BRIEF DESCRIPTION OF THE FIGURES Figure 1. RA induced growth suppression in THP-1 cells. THP-1 cells were plated out at around 150000 cells/mL and cultured for up to 2 days in the presence of RA at different concentrations. Cell number was counted daily, and

the average of the experimental data from three independent experiments were showing.

Figure 2. Induction of PPARyl expression by RA in THP-1 cells.

(A) Total cellular RNA was isolated from the THP-1 cells treated with either DMSO or 500 nM RA for 1 day. RNase protection assay was performed as described under"Experimental Procedures."RNA was hybridized to both PPARy probe and GAPDH probe. The PPARy probe recognizes both PPARyl RNA (94 bp signals) and PPARy2 (163 bp signals). (B) Top panel, total cellular RNA was isolated from the THP-1 cells treated with either DMSO or 500 nM RA at different concentrations (5 nM to 500 nM) for 1 day and hybridized to PPARy probe. Bottom panel, nuclear extracts were isolated from the THP-1 cells treated with either DMSO or RA at different concentrations (0.05 nM to 500 nM) for 1 day and assayed for PPARyl protein by western blot analysis. The strong band above the PPARyl band is nonspecific.

Figure 3. The simultaneous treatment of the THP-1 cells with RA and BRL 49653 resulted in an additive effect on the growth suppression. THP-1 cells were plated out at around 150000 cells/mL and cultured for up to 2 days in the presence of different stimulators. Cell number was counted daily. (A) The THP-1 cells were cultured with either DMSO or BRL 49653 at the indicated concentrations. (B) The THP-1 cells were cultured with either DMSO or the combination of RA and BRL 49653 at the indicated concentrations. (C) THP-1 cells were harvested after treated with RA, or BRL 49653, or the combination of RA and BRL 49653 for 1 day. The cell cycle flow cytometry analysis was then carried out as described under"Experimental Procedures."The results showing were the average of the experimental data from three independent experiments.

Figure 4. The RA-induced growth suspension did not result in the differentiation of the THP-1 monocytes into macrophages. (A) Florescence activated cell sorting (FACS) histogram of CD 14 and CD15 cell surface antigens of the THP-1 cells. THP-1 cells were treated with RA or DMSO for 1 day and harvested for the immunocytometry analysis as described under"Experimental Procedures." (B) The cell numbers of the suspended THP-1 cells were counted after treated with DMSO, RA, PMA, or RA plus PMA for 1 day and expressed as

the percent of the initial cell number when THP-1 cells were plated out for different treatments. The results showing were the average of the experimental data from three independent experiments.

Figure 5. The induction of PPARy expression by RA was specific to undifferentiated THP-1 monocytes. (A) Total cellular RNA was isolated from the THP-1 cells treated with the indicated stimulators for 1 day. RNase protection assay was performed as described under"Experimental Procedures."RNA was hybridized to both PPARy probe and GAPDH probe. (B) THP-1 cells were first differentiated with 2 x 10-7 M PMA for 1 day, and then treated with either DMSO or 500 nM 9-cis-RA for another day. Total cellular RNA was isolated afterward and used for the RNase protection assay with both PPARy probe and GAPDH probe.

DETAILED DESCRIPTION OF THE INVENTION All that is required for this invention is to administer an effective amount of a retinoid to an animal in combination with an effective amount of a glitazone, said amounts being effective for reducing cell proliferation, and/or inducing cellular expression of PPARyl.

Preferred retinoids to be utilized are benzoic acids and carboxylic acids and esters thereof, particularly Cl-C6 alkyl esters, such as methyl, ethyl, isopropyl, isopentyl, and n-hexyl.

Typical benzoic acids to be utilized include those of the formula

wherein R1 is cycloalkyl or aryl and R2 independently are: R2 substituent group such as halo, hydroxy, amine, mono-and dialkyl amino, C1-C6 alkyl, C1-C6 alkoxy, or C1-C6 alkylthio, and n is 0 or 1. The cycloalkyl group can be a single ring, for instance a C3-C7 cycloalkyl ring, optionally

substituted with halo, alkyl, alkoxy, alkylthio, or the like, or bicyclic. Similarly, the aryl can be monocyclic or bicyclic, for instance, phenyl or naphthyl, it can be cycloalkyl fused to an aromatic ring, for instance, a benzocyclohexane or benzocycloheptane, and any of the ring systems can contain heteroatoms, for instance, 1,2, or 3 heteroatoms selected from sulfur, oxygen, and nitrogen. The rings can also be substituted, for example, with 1,2, or 3 groups such as R2 and R2. Many of the retinoids have an alkylene chain which can exist as cis and trans isomers. Both the all cis and all trans, as well as mixtures, can be used herein.

Examples of preferred retinoids to be utilized in the method of this invention include those having the following structures: where R l is, for instance and R2 is hydrogen, halo, or alkoxy;

where RI is where R I is alkyl or dialkylphenyl, or a bi-or tricyclic ring such as:

The typical specific retinoids which can be utilized in the method of the invention include the following: 4- [4- (4, 4-Dimethyl-thiochroman-6-yl)-2-methyl-buta-1, 3-dienyl]-benzoic acid; 3-Fluoro-4- [2-methyl-4- (2,6,6-trimethyl-cyclohex-1-enyl)-buta- 1,3-dienyl]-benzoic acid;

3-Methoxy-4- [2-methyl-4- (2,6,6-trimethyl-cyclohex-1-enyl)-buta- 1,3-dienyl]-benzoic acid; 5- [4- (2,6,6-Trimethyl-cyclohex-1-enyl)-but-3-en-1-ynyl]-thiophene - 2-carboxylic acid ethyl ester; 5- [4- (2,6,6-Trimethyl-cyclohex-1-enyl)-but-3-en-1-ynyl]-furan- 2-carboxylic acid ethyl ester; 6- [4- (2,6,6-Trimethyl-cyclohex-1-enyl)-but-3-en-1-ynyl]-nicotinic acid; 4- [2- (3-tert-Butyl-phenyl)-propenyl]-benzoic acid; 4- [2- (4-tert-Butyl-phenyl)-propenyl]-benzoic acid; 4- [2- (3, 4-Dimethyl-phenyl)-propenyl]-benzoic acid; 4- [2- (3,4-Diethyl-phenyl)-propenyl]-benzoic acid; 4- [2- (3,4-Diisopropyl-phenyl)-propenyl]-benzoic acid; 4- [2- (5-Isobutyl-tricyclo 6-trien-4-yl)-propenyl]- benzoic acid; 4- [2- (3,6-Dimethoxy-tricyclo [6.2.1.0>2,7_] undeca-2,4,6-trien-4-yl)- propenyl]-benzoic acid; Benzoic acid, 4- [2- (2,3,4,4a-tetrahydro-4a, 10,10-trimethyl-lH-3,9b- methanodibenzofuran-8-yl)ethenyl]- ; 4- [2- (6,7,8,9-Tetrahydro-5H-benzocyclohepten-2-yl) propenyl]-benzoic acid; 4- [2- (7-Methyl-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl)-prope nyl]- benzoic acid ethyl ester; 4- [2- (5,5-Dimethyl-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl)- propenyl]-benzoic acid ethyl ester; 4- [2- (3,7,7-Trimethyl-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl )- propenyl]-benzoic acid methyl ester; 4- [2- (7,7-Dimethyl-3-octyl-6,7,8,9-tetrahydro-5H-benzocyclohepten -2-yl)- propenyl]-benzoic acid; 4- [2- (7-Ethyl-7-methyl-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-y l)- propenyl]-benzoic acid ethyl ester; Benzoic acid, 4- [2- (5,6,8,9-tetrahydro-spiro [7H-benzocycloheptene-7,1'- cyclopropane]-2-yl)-1-propenyl]-, ethyl ester;

Benzoic acid, 4- [2- (5,6,8,9-tetrahydro-spiro [7H-benzocycloheptene-7,1'- cyclopentane]-2-yl)-1-propenyl]-, ethyl ester; 4- [2- (7-Oxo-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl)-propenyl ]- benzoic acid ethyl ester; 4- [2- (9-Methyl-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl)-prope nyl]- benzoic acid ethyl ester; 4- [2- (5,5,9-Trimethyl-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl )- propenyl]-benzoic acid ethyl ester; 4- [2- (7,7,9-Trimethyl-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl )- propenyl]-benzoic acid ethyl ester; 4- [2- (5,9,9-Trimethyl-6,7,8,9-tetrahydro-5H-benzocyclohepten-2-yl )- propenyl]-benzoic acid ethyl ester; 4- [2- (7,7,9,9-Tetramethyl-6,7,8,9-tetrahydro-5H-benzocyclohepten- 2-yl)- propenyl]-benzoic acid; 4- [2- (6,6,8,8-Tetramethyl-7-oxo-6,7,8,9-tetrahydro-5H- benzocyclohepten-2-yl)-propenyl]-benzoic acid ethyl ester; 4- [2- (4, 4-Dimethyl-chroman-7-yl)-propenyl]-benzoic acid; 4- [2- (4,4-Dimethyl-1,1-dioxo-thiochroman-7-yl)-propenyl]-benzoic acid; 4- [2- ( 1,4,4-Trimethyl-1,2,3,4-tetrahydro-quinolin-7-yl)-propenyl]- benzoic acid; 4- [2- (2,3-Dihydro-benzo [1,4] dioxin-6-yl)-propenyl]-benzoic acid; 4- [2- (2,3-Dihydro-benzo [1,4] dithiin-6-yl)-propenyl]-benzoic acid; 4-[2-(1, 4-Dimethyl-1,[2-(1, 4-Dimethyl-1, 2,3,4-tetrahydro-quinoxalin-6-yl)-propenyl]-benzoic acid; 4- [2- (2,3,4,5-Tetrahydro-benzo [b] oxepin-8-yl)-propenyl]-benzoic acid; 4- [2- (2,3,4,5-Tetrahydro-benzo [b] oxepin-7-yl)-propenyl]-benzoic acid; 4- [2- (2,3,4,5-Tetrahydro-benzo [b] thiepin-8-yl)-propenyl]-benzoic acid; 4- [2- (5-Methyl-2,3,4,5-tetrahydro-benzo [b] thiepin-8-yl)-propenyl]- benzoic acid; 4- [2- (5,5-Dimethyl-2,3,4,5-tetrahydro-benzo [b] thiepin-8-yl)-propenyl]- benzoic acid; 4- [2- (3,3-Dimethyl-2,3,4,5-tetrahydro-benzo [b] thiepin-8-yl)-propenyl]- benzoic acid;

4- [2- (2,3,4,5-Tetrahydro-benzo [b] thiepin-7-yl)-propenyl]-benzoic acid; 4- [2- (5-Methyl-2,3,4,5-tetrahydro-benzo [b] thiepin-7-yl)-propenyl]- benzoic acid; 4- [2- (3-Methyl-2,3,4,5-tetrahydro-benzo [b] thiepin-7-yl)-propenyl]- benzoic acid; 4- [2- (3,5,5-Trimethyl-2,3,4,5-tetrahydro-benzo [b] thiepin-7-yl)-propenyl]- benzoic acid; 4- [2- (3,3-Dimethyl-2,3,4,5-tetrahydro-benzo [b] thiepin-7-yl)-propenyl]- benzoic acid; 4- [2- (1, 1-Dioxo-2,3,4,5-tetrahydro-benzo [b] thiepin-8-yl)-propenyl]- benzoic acid; 4- [2- (1, 1-Dioxo-2,3,4,5-tetrahydro-benzo [b] thiepin-7-yl)-propenyl]- benzoic acid; 4- [2- (5, 5-Dimethyl-l, 1-dioxo-2,3,4,5-tetrahydro-benzo [b] thiepin-7-yl)- propenyl]-benzoic acid; 4- [2- (3-Methyl-1, 1-dioxo-2,3,4,5-tetrahydro-benzo [b] thiepin-7-yl)- propenyl]-benzoic acid; 4- [2- (3,4-Dihydro-2H-benzo [b] [1,4] dioxepin-7-yl)-propenyl]-benzoic acid; 4- [2- (3-Methyl-3,4-dihydro-2H-benzo [b] [1,4] dioxepin-7-yl)-propenyl]- benzoic acid; 4- [2- (7,7-Dimethyl-7,8-dihydro-6H-5-oxa-9-thia-benzocyclohepten-2 -yl)- propenyl]-benzoic acid; 4- [2- (7,8-Dihydro-6H-5,9-dithia-benzocyclohepten-2-yl)-propenyl]- benzoic acid; 4- [2- (7-Methyl-7,8-dihydro-6H-5,9-dithia-benzocyclohepten-2-yl)- propenyl]-benzoic acid; 4- [2- (5-Methyl-2,3,4,5-tetrahydro-benzo [b] [1,4] thiazepin-8-yl)-propenyl]- benzoic acid; 4- [2- (3,5-Dimethyl-2,3,4,5-tetrahydro-benzo [b] [1,4] thiazepin-8-yl)- propenyl]-benzoic acid; 4- [2- (2,2-Dimethyl-benzo [1,3] dioxol-5-yl)-propenyl]-benzoic acid; 4- [2- (2,2-Dimethyl-benzo [1,3] dithiol-5-yl)-propenyl]-benzoic acid;

4-Styryl-benzoic acid; 4- [2- (4-tert-Butyl-phenyl)-vinyl]-benzoic acid; 4- (2-Tricyclo [6.2.1.0>2,7_] undeca-2,4,6-trien-4-yl-vinyl)-benzoic acid; Benzoic acid, 4- [2- (2,3,4,4a-tetrahydro-4a, 10,10-trimethyl-lH-3,9b- methanodibenzofuran-8-yl)ethenyl]- ; 4- [2- (4-Methoxy-2,3,6-trimethyl-phenyl)-vinyl]-benzoic acid; 4- {2- [4- (3-Methyl-but-2-enyloxy)-phenyl]-vinyl}-benzoic acid ethyl ester; 4- {2- [2-Methyl-4- (3-methyl-but-2-enyloxy)-phenyl]-vinyl}-benzoic acid ethyl ester; 4- {2- [2-Methyl-4- (3-methyl-but-2-enylsulfanyl)-phenyl]-vinyl}-benzoic acid ethyl ester; 4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-vin yl]- benzoic acid; 4- [2- (l-Methoxy-4,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-naphthal en- 2-yl)-vinyl]-benzoic acid; 4- [2- (l-Methoxy-3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-naphthal en- 2-yl)-vinyl]-benzoic acid; 4- [2- (1,4-Dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphth alen- 2-yl)-vinyl]-benzoic acid; 4- [2- (1, 3-Dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthale n- 2-yl)-vinyl]-benzoic acid; 4-[2- (l-Ethoxy-3-methoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalen-2-yl)-vinyl]-benzoic acid; 4-[2-(1-Isopropoxy-3-methoxy-5,5,8,8-tetramethyl-5,6,7,8-tet rahydro- naphthalen-2-yl)-vinyl]-benzoic acid; 4- [2- (3-Methoxy-5,5,8,8-tetramethyl-1-propoxy-5,6,7,8-tetrahydro- naphthalen-2-yl)-vinyl]-benzoic acid; 4-[2-(1-Butoxy-3-methoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahy dro- naphthalen-2-yl)-vinyl]-benzoic acid; 4- [2- (l-Hexyloxy-3-methoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro - naphthalen-2-yl)-vinyl]-benzoic acid; 4- (1, 1,3,3-Tetramethyl-indan-5-ylethynyl)-benzoic acid; 4- (1,1,2,3,3-Pentamethyl-indan-5-ylethynyl)-benzoic acid;

4- (3,8,8-Trimethyl-5,6,7,8-tetrahydro-naphthalen-2-ylethynyl)- benzoic acid; 4- (3-Methoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen - 2-ylethynyl)-benzoicacid; 6- (4,4,7-Trimethyl-chroman-6-ylethynyl)-nicotinic acid ethyl ester; 6- (3,3,4,4-Tetramethyl-chroman-6-ylethynyl)-nicotinic acid ethyl ester; 6- (3,3,4,4,7-Pentamethyl-chroman-6-ylethynyl)-nicotinic acid ethyl ester; 6- (4,4-Dimethyl-thiochroman-6-ylethynyl)-nicotinic acid ethyl ester; 6- (4,4,7-Trimethyl-thiochroman-6-ylethynyl)-nicotinic acid ethyl ester; 4- [5- (1, 1,2,3,3-Pentamethyl-indan-5-yl)-lH-pyrazol-3-yl]-benzoic acid methylester; 4- [5- (3-Methyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-1 H-pyrazol-3-yl]- benzoic acid methyl ester; 4- [3- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-pyr azol- 1-yl]-benzoicacid; 4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-1 H- imidazol-4-yl]-benzoic acid ethyl ester; 4- [5- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-1H- imidazol-2-yl]-benzoic acid methyl ester; 4- [5-Oxo-3- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- 4,5-dihydro-pyrazol-1-yl]-benzoic acid; 4- [2-Mercapto-4- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- imidazol-l-yl]-benzoic acid; 4- [4- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-oxa zol- 2-yl]-benzoic acid methyl ester; 4- [5- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-oxa zol- 2-yl]-benzoic acid methyl ester; 4- [5- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-oxa zolidin- 3-yl]-benzoic acid ethyl ester; 4- [3- (7-Hydroxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen -2-yl)- isoxazol-5-yl]-benzoic acid; 4- [4- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-thi azol- 2-yl]-benzoic acid methyl ester;

4- [3- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- [1,2,4] oxadiazol-5-yl]-benzoic acid methyl ester; 4- [6- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-pyr idazin- 4-yl]-benzoic acid methyl ester; 4- [6- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-pyr idazin- 3-yl]-benzoic acid methyl ester; 4- [2-Hydroxy-6- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- pyrimidin-4-yl]-benzoic acid butyl ester; 6-m-Tolyl-naphthalene-2-carboxylic acid; 6- (3-tert-Butyl-phenyl)-naphthalene-2-carboxylic acid; 6- (3-tert-Butyl-4-methoxy-phenyl)-naphthalene-2-carboxylic acid; 6- (3-Adamantan-1-yl-4-methoxy-phenyl)-naphthalene-2-carboxylic acid; 6- (3-Adamantan-1-yl-4-hexyloxy-phenyl)-naphthalene-2-carboxyli c acid; 6- (3-Adamantan-1-yl-4-decyloxy-phenyl)-naphthalene-2-carboxyli c acid; 2-Naphthalenecarboxylic acid, 6- (2,3,4,4a-tetrahydro-4a, 10,10-trimethyl- 1 H-3, 9b-methanodibenzofuran-8-yl)-; 6- [4-(Methoxy-3-(1-methyl-1-nonyloxy-ethyl)-phenyl]-naphthalen e- 2-carboxylic acid; 6- (3,4-Dimethoxy-phenyl)-naphthalene-2-carboxylic acid; 6- [4- (Adamantan-1-ylsulfanyl)-phenyl]-naphthalene-2-carboxylic acid; 8-Methoxy-5', 5', 8', 8'-tetramethyl-5', 6', 7', 8'-tetrahydro- [2,2] bin aphthalenyl- 6-carboxylic acid; 6- (3-Adamantan-1-yl-4-methoxy-phenyl)-4-hydroxy-1-methyl- naphthalene-2-carboxylic acid; 2- (4-tert-Butyl-phenyl)-benzofuran-6-carboxylic acid; 2- (4-tert-Butyl-phenyl)-benzo [b] thiophene-6-carboxylic acid; 2- (4-tert-Butyl-phenyl)-lH-indole-6-carboxylic acid; 2- (3-tert-Butyl-4-methoxy-phenyl)-benzofuran-6-carboxylic acid; 2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-ben zofuran- 6-carboxylic acid; 2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-ben zooxazole- 6-carboxylic acid;

2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-3H- benzoimidazole-5-carboxylic acid; 2- (3-Adamantan-1-yl-4-methoxy-phenyl)-benzofuran-6-carboxylic acid; 2- (3-Adamantan-1-yl-4-methoxy-phenyl)-benzo [b] thiophene-6-carboxylic acid; 2- (3-Adamantan-1-yl-4-methoxy-phenyl)-3H-benzoimidazole- 5-carboxylic acid; 2- (3-Adamantan-1-yl-4-hydroxy-phenyl)-3H-benzoimidazole-5-carb oxylic acid; 2- (3-Adamantan-1-yl-4-decyloxy-phenyl)-benzooxazole-6-carboxyl ic acid; Benzo [b] thiophene-6-carboxylic acid, 2- (2,3,4,4a-tetrahydro- 4a,10,10-trimethyl-1 H-3, 9b-methanodibenzofuran-8-yl)-; 6- [Hydroxy- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- methyl]-naphthalene-2-carboxyl ic acid; 6- [Acetoxy- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- methyl]-naphthalene-2-carboxyl ic acid; 6- (1, 1,3,3-Tetramethyl-indane-5-carbonyl)-naphthalene-2-carboxyli c acid; 6- [Hydroxy- ( l, 1,2,3,3-pentamethyl-indan-5-yl)-methyl]-naphthalene- 2-carboxylic acid; 6- (6,7-Dimethyl-naphthalene-2-carbonyl)-naphthalene-2-carboxyl ic acid; 6- (6-Methoxy-naphthalene-2-carbonyl)-naphthalene-2-carboxylic acid; 6- (6-Methoxy-5,8-dimethyl-naphthalene-2-carbonyl)-naphthalene- 2-carboxylic acid; 6- [Hydroxy- (6-methoxy-5,8-dimethyl-naphthalen-2-yl)-methyl]- naphthalene-2-carboxylic acid; 6- (6-Methoxy-5,8-dimethyl-naphthalen-2-ylmethyl)-naphthalene- 2-carboxylic acid; 6- (4, 4-Dimethyl-chroman-6-carbonyl)-naphthalene-2-carboxylic acid; 6-[ (4, 4-Dimethyl-chroman-6-yl)-hydroxy-methyl]-naphthalene- 2-carboxylic acid; 6- (4,4-Dimethyl-chroman-6-ylmethyl)-naphthalene-2-carboxylic acid;

2-Naphthalenecarboxylic acid, 6- [ (2,3,4,4a-tetrahydro-4a, 10,10-trimethyl- lH-3,9b-methanodibenzofuran-8-yl) carbonyl]- ; 6- (2,2-Dimethyl-chroman-6-carbonyl)-naphthalene-2-carboxylic acid; 6- (4-tert-Butyl-benzoyl)-naphthalene-2-carboxylic acid; 6-[(2, 4-Di-tert-butyl-phenyl)-hydroxy-methyl]-naphthalene-2-carbox ylic acid; 6- (2,4-Diisopropyl-benzoyl)-naphthalene-2-carboxylic acid; 6- (2, 4-Diisopropyl-benzyl)-naphthalene-2-carboxylic acid; 6- (4-Cyclohexyl-benzoyl)-naphthalene-2-carboxylic acid; 6- (4-Phenoxy-benzoyl)-naphthalene-2-carboxylic acid; 6- (4-Methoxy-benzoyl)-naphthalene-2-carboxylic acid; 6- (6-Methoxy-biphenyl-3-carbonyl)-naphthalene-2-carboxylic acid; 6- (3-Adamantan-1-yl-4-methoxy-benzoyl)-naphthalene-2-carboxyli c acid; 6- (4-Methoxy-2,3,6-trimethyl-benzoyl)-naphthalene-2-carboxylic acid; 2- (1,1,3,3-Tetramethyl-indane-5-carbonyl)-benzoic acid; 2- (1,1,2,3,3-Pentamethyl-indane-5-carbonyl)-benzoic acid; 2- (3,6-Dimethoxy-tricyclo [6.2.1.0>2,7_] undeca-2 (7), 3,5-triene- 4-carbonyl)-benzoic acid; 2- (l, 1,2,3,3-Pentamethyl-indane-5-carbonyl)-cyclohex-1-enecarboxy lic acid; 2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carbon yl)- cyclohexanecarboxylic acid; 2- (l, 1,2,3,3-Pentamethyl-indane-5-carbonyl)-cyclohexanecarboxylic acid ; 4- (Tricyclo [6.2.1.0>2,7_] undeca-2 (7), 3,5-triene-4-carbonyl)-benzoic acid; 4- (1,1,2,3,3-Pentamethyl-indane-5-carbonyl)-benzoic acid; 4- [Hydroxy- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- methyl]-benzoic acid; 4- (2,4-Diisopropyl-benzoyl)-benzoic acid; 4- [ (2,4-Diisopropyl-phenyl)-hydroxy-methyl]-benzoic acid; 4- (3,5-Di-tert-butyl-4-hydroxy-benzoyl)-benzoic acid; 4- [Hydroxy- (6-methoxy-5,8-dimethyl-naphthalen-2-yl)-methyl]-benzoic acid; 4- [ (4, 4-dimethyl-thiochroman-6-yl)-hydroxy-methyl]-benzoic acid;

4- (3-Oxo-3-phenyl-propenyl)-benzoic acid; 4- [3- (3, 4-Diethyl-phenyl)-3-oxo-propenyl]-benzoic acid; 4- [3- (3, 4-Diisopropyl-phenyl)-3-oxo-propenyl]-benzoic acid; 4- [3- (4-tert-Butyl-phenyl)-3-oxo-propenyl]-benzoic acid; 4- [3- (3-tert-Butyl-phenyl)-3-oxo-propenyl]-benzoic acid; 4- [3- (3, 5-Di-tert-butyl-phenyl)-3-oxo-propenyl]-benzoic acid; 4- [3- (2, 5-Di-tert-butyl-phenyl)-3-oxo-propenyl]-benzoic acid; 4- [3-Oxo-3- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- propenyl]-benzoic acid; 4- [3-Oxo-3- (3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- propenyl]-benzoic acid; 2-Hydroxy-4- [3-oxo-3- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalen-2-yl)-propenyl]-benzoic acid; 4- [3- (4, 4-Dimethyl-chroman-6-yl)-3-oxo-propenyl]-benzoic acid; 4- [3- (4, 4-Dimethyl-chroman-7-yl)-3-oxo-propenyl]-benzoic acid; 4- [3- (4, 4-Dimethyl-thiochroman-6-yl)-3-oxo-propenyl]-benzoic acid; 4- [3- (3,4-Dimethoxy-phenyl)-3-oxo-propenyl]-benzoic acid; 4- [1-Hydroxy-3- (2-hydroxy-phenyl)-3-oxo-propenyl]-benzoic acid; 4- [3- (5-tert-Butyl-2-hydroxy-phenyl)-l-hydroxy-3-oxo-propenyl]-be nzoic acid; and 4-[3- (4-tert-butyl-2-hydroxy-phenyl)-l-hydroxy-3-oxo-propenyl]-be nzoic acid.

Other retinoids which can be utilized to lower plasma levels of Lp (a) include polyolefinic carboxylic acids, aldehydes, and alcohols having the general formula

where Ru includes the cycloalkyl and aryl groups such as those described above, andnis0or 1.

Typical RI groups additionally include the following: alkyl such as ethyl and hexyl; cycloalkyl such as cyclohexyl, alkylcyclohexyl, dialkylcyclohexyl, cyclohexenyl, cyclopentyl, dialkylcyclopentyl, cyclopentenyl, mono-and dialkyl- cyclopentyl; and aryl such as phenyl, hydroxyphenyl, methoxyphenyl, halophenyl, thienyl, furanyl, pyridyl, and polycyclic systems, such as

The retinoids to be utilized in this invention also include the various stereochemical isomers, for example, the all transisomers (E, E, E, E), the 9-cis isomers (E, E, Z, E), and the 13-cis isomers (Z, E, E, E).

Typical retinoids of the above class which can be utilized to lower Lp (a) include the following: 3,7-Dimethyl-undeca-2,4,6,8-tetraenal; 9-Cyclohexyl-3,7-dimethyl-nona-2,4,6,8-tetraenal; 6-trimethyl-cyclohexyl)-nona-2,4,6,8-tetraenal; 9-Cyclohex-1-enyl-3,7-dimethyl-nona-2,4,6,8-tetraenal; 3,7-Dimethyl-9- (2-methyl-cyclohex-1-enyl)-nona-2, 4,6,8-tetraenal; 9- (6, 6-Dimethyl-cyclohex-I-enyl)-3,7-dimethyl-nona-2,4,6,8-tetrae nal; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenal; 9-(2, 6-Dimethyl-cyclohex-1-enyl)-3,(2, 6-Dimethyl-cyclohex-1-enyl)-3, 7-dimethyl-nona-2,4,6,8-tetraenal; 3-Methyl-9- (2,5,5-trimethyl-cyclopent-1-enyl)-nona-2,4,6,8-tetraenal; 10-Isopropyl-3-methyl-dodeca-2,4,6,8,10-pentaenal;

3-Methyl-dodeca-2,4,6,8,10-pentaenal; 6-trimethyl-cyclohexa-1,3-dienyl)-nona- 2,4,6,8-tetraenal; 3,7-Dimethyl-9-phenyl-nona-2,4,6,8-tetraenal; 9- (3-Hydroxy-2,6,6-trimethyl-cyclohex-1-enyl)-3,7-dimethyl-non a- 2,4,6,8-tetraenal; 6-trimethyl-3-oxo-cyclohex-1-enyl)-nona- 2,4,6,8-tetraenal; 6-trimethyl-7-oxa-bicyclo hept-1-yl)-nona- 2,4,6,8-tetraenal; 6-trimethyl-7-oxa-bicyclo [4.1.0] hept-4-en-1-yl)- nona-2,4,6,8-tetraenal; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona- 2,4,6,8-tetraenal; 3-Methyl-9- (2,4,5-trimethyl-thiophen-3-yl)-nona-2,4,6,8-tetraenal; 6-trimethylcyclohex-1-enzyl)-nona-2,4,6,7-tetraen- 1-ol; All trans-9- (4-Dimethylamino-phenyl)-3,7-dimethyl-nona- 2,4,6,8-tetraenal; 3,7,11-Trimethyl-dodeca-2,4,6,8,10-pentaenal; 6-trimethyl-cyclohexylidene)-nona-2,4,6,8-tetraenal; 3-Methyl-7- (4,4,7a-trimethyl-2,4,5,6,7,7a-hexahydro-benzofuran-3-yl)- octa-2,4,6-trienal; 9- (2,2-Dimethyl-6-methylene-cyclohexyl)-3,7-dimethyl-nona- 2,4,6,8-tetraenal; 9-Adamantan-2-ylidene-3,7-dimethyl-nona-2,4,6,8-tetraenal; 6-trimethyl-cyclohex-1-enyl)-undeca- 2,4,6,8,10-pentaenal; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,8-trienal; 6-trimethyl-cyclohex-1-enyl)-nona-2,8-dienal; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6-trienal; 6-trimethyl-cyclohex-1-enyl)-nona-2,6,8-trien-1-ol; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenal;

13- (2,6,6-Trimethyl-cyclohex-1-enyl)-trideca-2,4,6,8,10,12-hexa enal; 17- (2,6,6-Trimethyl-cyclohex-1-enyl)-heptadeca- 2,4,6,8,10,12,14,16-octaenal; 7-Ethyl-3-methyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona- 2,4,6,8-tetraenal; 6-trimethyl-cyclohex-1-enyl)-nona- 2,4,6,8-tetraenal; 7-Methyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenal; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraen- 1-ol; (E, E, E)-3,7-dimethyl-undeca-2,6,8-trien-4-yn-1-ol; (Z, E, E)-3,7-dimethyl-undeca-2,6,8-trien-4-yn-1-ol; (E, E, 8-trienoic acid; (Z, E, E, E)-2,3,7-trimethyl-undeca-2,4,6,8-tetraenoic acid; 7-Methyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenal; {5- [1-Methyl-3- (2,6,6-trimethyl-cyclohex-1-enyl)-allylidene]-cyclohept- 3-enylidene}-acetaldehyde; {4- [1-Methyl-3- (2,6,6-trimethyl-cyclohex-1-enyl)-allylidene]-cyclohept- 2-enylidene}-acetaldehyde; 3-Bromo-7-methyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona- 2,4,6,8-tetraenal; 6-Fluoro-7-methyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona- 2,4,6,8-tetraenal; 7-Methyl-9- (2,6,6-trimethyl-cyclohex-l-enyl)-nona-4,6,8-trien-2-ynal; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenal; 3-Methyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenal; 9- (2,6,6-Trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenal; 7-Methyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenal; {5- [1-Methyl-3- (2,6,6-trimethyl-cyclohex-1-enyl)-allylidene]-cyclohept- 3-enylidene}-acetaldehyde; {4- [1-Methyl-3- (2,6,6-trimethyl-cyclohex-1-enyl)-allylidene]-cyclohept- 2-enylidene}-acetaldehyde;

6-trimethyl-cyclohex-1-enyl)-deca-3,5,7,9-tetraen- 2-one; 6-trimethyl-cyclohex-1-enyl)-nona- 2,4,6,8-tetraenal; 6-trimethyl-cyclohex-1-enyl)-nona- 2,4,6,8-tetraenal; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid; 3-Methyl-6- (1,1,4,4-tetramethyl-1,4,5,6,7,7 a-hexahydro-inden-2-ylidene)- hexa-2,4-dienoic acid; 3-Methyl-6- (1,1,4,4-tetramethyl-1,4,5,6,7,7a-hexahydro-inden-2-ylidene) - hexa-2,4-dienoic acid; (E, Z, E, E)-3-tert.-butyl-7-methyl-undec-2,4,6,8-tetraen-1-ol; 3-Methyl-6- (1, 1,4,4-tetramethyl-4,5,6,7-tetrahydro-1 H-inden-2-yl)-hexa- 3,5-dienoic acid; 3-Methyl-6- (1,1,4,4-tetramethyl-4,5,6,7-tetrahydro-lH-inden-2-yl)-hexa- 3,5-dienoic acid; 3-Methyl-6- (3,3a,7,7-tetramethyl-4,5,6,7-tetrahydro-3aH-inden-2-yl)- hexa-3,5-dienoic acid; 3-Methyl-6- (3,3a,7,7-tetramethyl-4,5,6,7-tetrahydro-3aH-inden-2-yl)- hexa-3,5-dienoic acid; 3-Methyl-6- (2,4,4-trimethyl-1-methylene-2,3,4,5,6,7-hexahydro-1 H- inden-2-yl)-hexa-2,4-dienoic acid; 6-trimethyl-cyclohexa-1,3-dienyl)-nona- 2,4,6,8-tetraenoic acid; 9- (4-dimethylaminophenyl)-2,3,7-trimethyl-nona-2,4,6,8-tetraen oic acid; and 3-Methyl-6- (2,4,4-trimethyl-1-methylene-2,3,4,5,6,7-hexahydro-lH- inden-2-yl)-hexa-2,4-dienoic acid.

Additional retinoids which can be utilized are aryldienoic acids of the general formula

where Ru vis aryl, especially phenyl substituted with further aryl, cycloalkyl, and fused cycloalkylaryl groups.

Preferred retinoids have the formula (or alkyl such as methyl) where R1 v is aryl, cycloalkyl, or polycyclo of the following general formulas :

Specific retinoids included within the above general formulas include the following:

5- (4-Cycloundecylidenemethyl-phenyl)-3-methyl-penta-2,4-dienoi c acid; 5- (4-Bicyclo [2.2.1] hept-2-ylidenemethyl-phenyl)-3-methyl-penta- 2,4-dienoic acid; 5- {4- [2- (4-Methoxy-2,3,6-trimethyl-phenyl)-vinyl]-phenyl}-3-methyl- penta-2,4-dienoic acid; 2,4-Pentadienoic acid, 3-methyl-5- (2,3,4,4a-tetrahydro-4a, 10,10-trimethyl- 1 H-3, 9b-methanodibenzofuran-8-yl)-; 3- {4- [2- (4-Methoxy-2,3,6-trimethyl-phenyl)-vinyl]-phenyl}-acrylicaci d; 3-{4- [4- (4-Methoxy-2,3,6-trimethyl-phenyl)-2-methyl-buta-1,3-dienyl] - phenyl}-acrylic acid; 3- {4- [2- ( I, 3-Dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalen-2-yl)-vinyl]-phenyl}-acrylic acid; 3- {4- [Hydroxy- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- methyl]-phenyl}-acrylic acid; 3- {4- [ (4, 4-Dimethyl-thiochroman-6-yl)-hydroxy-methyl]-phenyl}- 2-methyl-acrylic acid; 3-[4- (1,2,3,4-Tetrahydro-1,4-methano-naphthalene-6-carbonyl)-phen yl]- acrylic acid; 3- [4- (2, 4-Diisopropyl-benzoyl)-phenyl]-2-methyl-acrylic acid; 3- [4- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carbon yl)- phenyl]-acrylic acid; 2-Methyl-3- [4- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalene- 2-carbonyl)-phenyl]-acrylic acid; 2-Methyl-3- [4- (1,1,2,3,3-pentamethyl-indane-5-carbonyl-carbonyl)- phenyl]-acrylic acid; 3- [4- (4-Methoxy-2, 5-dimethyl-benzoyl)-phenyl]-2-methyl-acrylicacid; {2- [3-Methyl-5- (2,6,6-trimethyl-cyclohex-1-enyl)-penta-2,4-dienylidene]- <BR> <BR> <BR> <BR> <BR> cycloheptylidene}-acetaldehyde;<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 2-Methyl-3- [3-methyl-5- (2,6,6-trimethyl-cyclohex-1-enyl)-penta- 2,4-dienylidene]-cyclopent-1-enecarbaldehyde; 3-Methyl-4- {3- [2- (2,6,6-trimethyl-cyclohex-1-enyl)-vinyl]-cyclohex- 2-enylidene}-but-2-enal;

{2- [3-Methyl-5- (2,6,6-trimethyl-cyclohex-1-enyl)-penta-2,4-dienylidene]- <BR> <BR> <BR> cyclohexylidene}-acetaldehyde;<BR> <BR> <BR> {3- [2-Methyl-4- (2,6,6-trimethyl-cyclohex-1-enyl)-buta-l, 3-dienyl]-<BR> <BR> <BR> cyclohex-2-enylidene}-acetaldehyde; {4- [1-Methyl-3- (2,6,6-trimethyl-cyclohex-1-enyl)-allylidene]-cyclohept- 2-enylidene}-acetaldehyde; and <BR> <BR> <BR> {4- [1-Methyl-3-(2,6,6-trimethyl-cyclohex-1-enyl)-allylidene]-cy clopent-<BR> <BR> <BR> 2-enylidene}-acetaldehyde.

Still other compounds which are included within the general class of retinoids are retinoidal oxiranes, such as (or aklyl ester) with preferred oximes having the formula: (or aklyl ester)

Typical retinoidal oxiranes include 4- [3- (4-tert-Butyl-phenyl)-oxiranyl]-benzoic acid; 4- [3- (3-tert-Butyl-phenyl)-oxiranyl]-benzoic acid; 4- [3- (3, 4-Diethyl-phenyl)-3-methyl-oxiranyl]-benzoic acid; and 4- [3-Methyl-3- (5,5,8,8-tetra-methyl-5,6,7,8-tetra-hydro-naphthalen-2-yl)- oxiranyl]-benzoic acid.

Related compounds are diketones, diols, and acetonides of the formula (or ester) (or ester) an and (or ester) Certain retinoids have a carboxyamide linkage rather than an alkylene or oxidized alkylene. For example, carboxamide retinoids which can be utilized include those of the formula (or alkyl ester)

where R1 is an organic radical and includes groups such as Typical carboxamide retinoids which can be utilized include:

4-benzoylamino-benzoicacid; 4- (3-tert-Butyl-benzoylamino)-benzoic acid; 4- (4-tert-Butyl-benzoylamino)-benzoic acid; 4- (3,5-Di-tert-butyl-benzoylamino)-benzoic acid; 4- (3,4-Diisopropyl-benzoylamino)-benzoic acid; 4- [ (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carbon yl)- amino]-benzoic acid; 4- [Methyl-5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-naphthalene- 2-carbonyl)-amino]-benzoic acid; 4- [ (4,4-Dimethyl-chroman-7-carbonyl)-amino]-benzoic acid; 4- [ (5-Chloro-4,4-dimethyl-chroman-7-carbonyl)-amino]-benzoic acid; 4- [ (2,3-Dihydro-benzo [1,4] dioxine-6-carbonyl)-amino]-benzoic acid; 4- [ (3,3-Dimethyl-3,4-dihydro-2H-benzo [b] [1,4] dioxepine-7-carbonyl)- amino]-benzoic acid; 4- [ (5-Methyl-2,3,4,5-tetrahydro-benzo [b] thiepine-8-carbonyl)-amino]- benzoic acid; 4- [ (4, 4-Dimethyl-thiochroman-7-carbonyl)-amino]-benzoic acid 4- [ (Thiochroman-6-carbonyl)-amino]-benzoic acid; 4- [ (2,3-Dihydro-benzo [1,4] dithiine-6-carbonyl)-amino]-benzoic acid; 4-[ (4, 4-Dimethyl-1, 1-dioxo-11>6_-thiochroman-7-carbonyl)-amino]- benzoic acid; 4-[(3-Methyl-l, l-dioxo-11>6_-thiochroman-6-carbonyl)-amino]-benzoic acid; 4- [ ( 1,4,4-Trimethyl-1,2,3,4-tetrahydro-quinoline-7-carbonyl)-ami no]- benzoic acid; 4-[ ( 1-Decyl-4,4-dimethyl-1,2,3,4-tetrahydro-quinoline-7-carbonyl )- amino]-benzoic acid; 4- (3-tert-Butyl-4-methoxy-benzoylamino)-benzoic acid; 4- (3-Adamantan-1-yl-4-hydroxy-benzoylamino)-benzoic acid; 4- (3-Adamantan-1-yl-4-methoxy-benzoylamino)-benzoic acid; 4- (3-Adamantan-1-yl-4-methoxy-benzoylamino)-2-hydroxy-benzoic acid; 4- (3-Adamantan-1-yl-4-hexyloxy-benzoylamino)-benzoic acid; 4- (3-Adamantan-1-yl-4-decyloxy-benzoylamino)-benzoic acid;

4- [3- (1, 1-Dimethyl-decyl)-4-methoxy-benzoylainino]-benzoicacid; N-Phenyl-terephthalamicacid; N-m-Tolyl-terephthalamicacid; N- (3-Ethyl-phenyl)-terephthalamic acid; N- (3-Isopropyl-phenyl)-terephthalamic acid; N- (4-Isopropyl-phenyl)-terephthalamic acid; N- (3-tert-Butyl-phenyl)-terephthalamic acid; N- (4-tert-Butyl-phenyl)-terephthalamic acid; N- (3-Cyclohexyl-phenyl)-terephthalamic acid; N-Biphenyl-3-yl-terephthalamicacid; N- (3-Bromo-phenyl)-terephthalamic acid; N- (3-Dimethylamino-phenyl)-terephthalamic acid; N- (3-Trifluoromethyl-phenyl)-terephthalamic acid; N- (3,4-Diethyl-phenyl)-terephthalamic acid; N- (2-Isopropyl-phenyl)-terephthalamic acid; N- (2,4-Diisopropyl-phenyl)-terephthalamic acid; N- (2,5-Diisopropyl-phenyl)-terephthalamicacid; N- (2,6-Diisopropyl-phenyl)-terephthalamic acid; N- (3,4-Diisopropyl-phenyl)-terephthalamic acid; N- (3,5-Diisopropyl-phenyl)-terephthalamic acid; N- (2,4-Di-tert-butyl-phenyl)-terephthalamicacid; N- (3,5-Di-tert-butyl-phenyl)-terephthalamic acid; N- (3,4-Dichloro-phenyl)-terephthalamic acid; N- (5,6,7,8-Tetrahydro-naphthalen-1-yl)-terephthalamic acid; N- (5,6,7,8-Tetrahydro-naphthalen-2-yl)-terephthalamic acid; N- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-1-yl)- terephthalamicacid; N- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- terephthalamicacid; N- (3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- terephthalamicacid; N-Methyl-N- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- terephthalamicacid;

N-Isopropyl-N- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen- 2-yl)-terephthalamic acid; and N- (3-Bromo-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2 -yl)- terephthalamic acid.

Retinoids similar to the carboxamides are carboxy esters such as (or ester) and (or ester) for example, where Rl includes As noted before, any of these groups can be substituted in the ring system by R2 and R2', as well as by other art-recognized substituent groups.

Typical (aroyloxy) benzoic acids and thio acids which can be utilized include Benzoic acid, 3,5-bis (1, 1-dimethylethyl)-4-hydroxy-, carboxyphenyl ester; Benzoic acid, 4-ethyl-3- (tricyclo [3.3.1.13, dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-ethenyl-3- (tricyclo [3.3.1.13o7] dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1.13 7] dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1.13s7] dec-l-yl)-, 4-carboxy- 3-methylphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1.13o7] dec-1-yl)-, 4-carboxy- 2- (hydroxymethyl) phenyl ester; 4- (4-Adamantan-1-yl-3-methoxy-benzoyloxy)-isophthalic acid;

Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1.13s7] dec-1-yl)-, 4-carboxy- 3-hydroxyphenyl ester; Benzoic acid, 2,4-dimethoxy-5- (tricyclo [3.3.1.13v7] dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1.13s7] dec-1-yl)-, 4-carboxy- 2-methoxyphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1.13s7] dec-1-yl)-, 4-carboxy- 3-methoxyphenyl ester; Benzoic acid, 2-fluoro-4-methoxy-5- (tricyclo [3.3.1.13 7] dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1. 13o7]dec-1-yl)-, 4-carboxy- 3-fluorophenyl ester; Benzoic acid, 4- (2-propenyloxy)-3- (tricyclo 4-carboxyphenyl ester; Benzoic acid, 4- (acetyloxy)-3-(tricyclo [3.3.1.13,7]dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4- (2-methoxy-2-oxoethoxy)-3- (tricyclo [3.3.1.13, 7] dec- 1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4- [2- (phenylmethoxy)-2-oxoethoxy]- 3- (tricyclo [3.3.1.13 7] dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4- (methylsulfonyl)-3- (tricyclo [3.3.1.13,7]dec-1-yl)-, 4-carboxyphenyl ester; 4,4-Dimethyl-chroman-6-carboxylic acid; 4-ethoxycarbonyl-phenyl ester; 2,2,4,4-Tetramethyl-chroman-6-carboxylic acid; 4-ethoxycarbonyl-phenyl ester; 2,2,4,4,7-Pentamethyl-chroman-6-carboxylic acid; 4-ethoxycarbonyl-phenyl ester; 4,4,7-Trimethyl-thiochroman-6-carboxylic acid; 4-ethoxycarbonyl-phenyl ester; 2,2,4,4-Tetramethyl-thiochroman-6-carboxylic acid;

4-ethoxycarbonyl-phenyl ester; 4- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene- 2-carbonylsulfanyl)-benzoic acid; 4- (3-Isopropyl-4-methoxy-benzoylsulfanyl)-benzoic acid; 4- (3-Isopropylsulfanyl-4-methyl-benzoylsulfanyl)-benzoic acid; 4- (3-Adamantan-1-yl-benzoylsulfanyl)-benzoic acid; 4- (5-Adamantan-1-yl-2-fluoro-4-methoxy-benzoylsulfanyl)-benzoi c acid; 4- (5-Adamantan-1-yl-4-methoxy-2-methyl-benzoylsulfanyl)-benzoi c acid; 4- (3-Adamantan-1-yl-4-allyloxy-benzoylsulfanyl)-benzoic acid; 4- (3-Adamantan-1-yl-4-methylsulfanyl-benzoylsulfanyl)-benzoic acid; and 4- (3,5-Bis-trifluoromethyl-benzoylsulfanyl)-benzoic acid.

Other benzoic acid derivatives which are retinoids and which can be utilized to lower Lp (a) according to this invention include (arylmethyl) amino benzoic acid, for example, compounds of the formulas where aryl is an aromatic radical such as phenyl, naphthyl, thienyl, or the like, optionally substituted with from 1 to 5 substituents such as alkyl, alkenyl, alkynyl, halo, nitro, amino, mono-or dialkylamino, hydroxy, and the like, and R3 and R4 are hydrogen, alkyl, alkenyl, alkynyl, or the like.

Typical aryl methylamino benzoic acid retinoids from this class include 4- (4-tert-Butyl-benzylamino)-benzoic acid; 4- (3,5-Di-tert-butyl-4-hydroxy-benzylamino)-benzoic acid; 4- (4-tert-Butoxy-3-methoxy-benzylamino)-benzoic acid; 4- [4- (1-Methoxy-1-methyl-ethyl)-benzylamino]-benzoic acid; 4- [ (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylmethy l)- amino]-benzoic acid; 4- [ (3-Fluoro-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen- 2- ylmethyl)-amino]-benzoic acid;

4- [ (3-Methoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen - 2-ylmethyl)-amino]-benzoic acid; 4-[ (1,3-Dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphth alen- 2-ylmethyl)-amino]-benzoic acid; 4- [ ( 1-Butoxy-3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-naphthalen - 2-ylmethyl)-amino]-benzoic acid; 4- [ (5,5,8,8-Tetramethyl-5,8-dihydro-naphthalen-2-ylmethyl)-amin o]- benzoic acid; 4- [ (5,5,8,8-Tetramethyl-7-oxo-5,6,7,8-tetrahydro-naphthalen-2-y lmethyl)- amino]-benzoic acid; 4- [ (7-Hydroxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen - 2-ylmethyl)-amino]-benzoic acid; 4- [1- (7-Hydroxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen - 2-yl)-ethylamino]-benzoic acid; 4- [Methyl- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylmethy l)- amino]-benzoic acid; 4- [Acetyl- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylmethy l)- amino]-benzoic acid; 4- [ (5-tert-Butyl-2-methyl-phenylamino)-methyl]-benzoic acid; 4- [ (3, 5-Di-tert-butyl-phenylamino)-methyl]-benzoic acid; 4- [ (4-tert-Butyl-2,6-dimethyl-phenylamino)-methyl]-benzoic acid; 4- [ (1, 1,2,3,3-Pentamethyl-indan-5-ylamino)-methyl]-benzoic acid; 4- [1- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylamino )- ethyl]-benzoic acid; 4- [ ( 1,4-Dichloro-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthal en- 2-ylamino)-methyl]-benzoic acid; 4- [ (l, 4-Dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthale n- 2-ylamino)-methyl]-benzoic acid; and 4- { [Acetyl- (1,4-dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalen-2-yl)-amino]-methyl}-benzoic acid.

Another preferred group of retinoids that are effective in lowering Lp (a) include (aryloxy) methyl benzoic acid of the formulas COOH COOH R3 Ans il Aryl R R, Aryl R R' 2 2 2 2 R3

Typical members of this class include 4- (4-tert-Butyl-phenoxymethyl)-benzoic acid; 4- (3-tert-Butyl-phenoxymethyl)-benzoic acid; 4- [4- (1, 1-Dimethyl-propyl)-phenoxymethyl]-benzoic acid; 4- (2-tert-Butyl-4-methyl-phenoxymethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenoxymethyl)-benzoic acid; 4- (2, 4-Di-tert-butyl-phenoxymethyl)-benzoic acid; 4- (2,6-Di-tert-butyl-phenoxymethyl)-benzoic acid; 4- (2,5-Di-tert-butyl-phenoxymethyl)-benzoic acid; 4- (3,5-Di-tert-butyl-phenoxymethyl)-benzoic acid; 4- (2-sec-Butyl-4-tert-butyl-phenoxymethyl)-benzoic acid; 4- (2,4-Di-tert-butyl-5-methyl-phenoxymethyl)-benzoic acid; 4- (2,4,6-Tri-tert-butyl-phenoxymethyl)-benzoic acid; 4- (3,5-Di-tert-butyl-2-hydroxy-phenoxymethyl)-benzoic acid; 4- (5,5,8,8-Tetramethyl-3-nitro-5,6,7,8-tetrahydro-naphthalen-2 - yloxymethyl)-benzoic acid; 4- (1,4-Dihydroxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphth alen- 2-yloxymethyl)-benzoic acid; 4- (1,4-Diacetoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphth alen- 2-yloxymethyl)-benzoic acid; 4- (2,2,5,7,8-Pentamethyl-chroman-6-yloxymethyl)-benzoic acid; 4- [2- (2-Hydroxy-ethyl)-2,5,7,8-tetramethyl-chroman-6-yloxymethyl] - benzoic acid; and 4- [2- (2-Acetoxy-ethyl)-2,5,7,8-tetramethyl-chroman-6-yloxymethyl] - benzoic acid.

Similar compounds which have sulfur in the linkage instead of oxygen include the following: 4- (4-tert-Butyl-phenylsulfanylmethyl)-benzoic acid;

4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid; and 4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid.

Like the carboxamides and esters, some retinoids have more than one nitrogen in the linking chain, for example, there are arylazobenzoic acids such as and hydrazone-bridge benzoic acids such as Typical members of this class include: 4- (3,4-Diethyl-phenylazo)-benzoic acid; 4- (2-Isopropyl-phenylazo)-benzoic acid; 4- (3-Isopropyl-phenylazo)-benzoic acid; 4- (4-Isopropyl-phenylazo)-benzoic acid; 4- (2,4-Diisopropyl-phenylazo)-benzoicacid; 4- (2,6-Diisopropyl-phenylazo)-benzoicacid; 4- (3,4-Diisopropyl-phenylazo)-benzoic acid; 4- (3,5-Diisopropyl-phenylazo)-benzoic acid; 4- (3-tert-Butyl-phenylazo)-benzoic acid; 4- (3-Cyclohexyl-phenylazo)-benzoic acid; 4- (Biphenyl-3-ylazo)-benzoic acid; 4- (4,4-Dimethyl-thiochroman-6-ylazo)-benzoic acid; 4- [2-Hydroxy-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen- 2-yl)-ethylamino]-benzoicacid;

4- [2-Hydroxy-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen- 2-yl)-ethylsulfanyl]-benzoic acid; 4-[2-Hydroxy-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen- 2-yl)-ethoxy]-benzoic acid; 4- [N'- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylmethy lene)- hydrazino]-benzoic acid; and 4- {N'- [Cyclopropyl-(1,1,2,3,3-pentamethyl-indan-5-yl)-methylene]- hydrazino}-benzoic acid.

A particular preferred class of retinoid compounds to be utilized to lower Lp (a) according to this invention include polyenoic acids and esters such as (ester) where aryl is an unsubstituted or substituted aromatic or cyclic radical such as phenyl, naphthyl, piperidyl, morpholinyl, or the like, and ester is preferably an alkyl group such as methyl, ethyl, isobutyl, or the like. Typical polyenoic retinoids include the following: 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid methyl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2- {2- [2- (2-hydroxy-ethoxy)-ethoxy]-ethoxy}-ethyl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2- {2- [2- (2-hydroxy-ethoxy)-ethoxy]-ethoxy}-ethyl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2- (2-oxo-pyrrolidin-1-yl)-ethyl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2- (2-oxo-pyrrolidin-1-yl)-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- {2- [2- (2-hydroxy-ethoxy)-ethoxy]-ethoxy}-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2-piperidin-1-yl-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2-morpholin-4-yl-ethyl ester;

9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2-piperidin-1-yl-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- (2, 5-dioxo-pyrrolidin-1-yl)-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- (2,6-dioxo-cyclohexyl)-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2-methanesulfonyl-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid methoxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid tert-butoxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid phenoxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2-acetoxy-phenoxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid styryloxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- (4-methoxy-phenyl)-vinyloxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- (benzoyl-carbonyl)-5-methoxy-phenoxymethoxycarbonyl- methylester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 1-phenoxycarbonyl-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 1-ethoxycarbonyloxy-ethyl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-ylester ; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-ylester ;

6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 4-dimethylamino-6-methyl-2- (2-octyl-hexadecyloxy)-tetrahydro-pyran-3-yl ester; 9- (4-Methoxy-2,5,6-trimethyl-cyclohex-1-enyl)-3,7-dimethyl-non a- 2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester; 9- (4-Methoxy-2,5,6-trimethyl-cyclohex-1-enyl)-3,7-dimethyl-non a- 2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester; and 9- (4-Methoxy-2,5,6-trimethyl-cyclohex-1-enyl)-3,7-dimethyl-non a- 2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester.

In addition to retinoic acids and esters, the method of this invention can be practiced with retinoid amides, for example, any of the foregoing compounds in an amide form, e. g., the general formula where R3 and R4 independently and hydrogen, C1 C6 alkyl, phenyl, or R2R2 substituted or disubstituted phenyl, or taken together with the nitrogen to which they are attached, R3 and R4 complete a ring which can have 1 or 2 heteroatoms, such as oxygen, sulfur, or nitrogen. Typical retinoids of this type include

Examples of specific retinoids having the above structures include the following: 4- [4- (2,6,6-Trimethyl-cyclohex-1-enyl)-but-3-en-1-ynyl]-benzamide ; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid amide; [6- (3-Adamantan-1-yl-4-methoxy-phenyl)-naphthalen-2-yl]-morphol in- 4-yl-methanone; N- (3, 5-Bis-trifluoromethyl-phenyl)-4- (5,5,8,8-tetramethyl-5,6,7,8- tetrahydro-naphthalene-2-carbonyl)-benzamide; N- (4-Hydroxy-phenyl)-4- [2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalen-2-yl)-vinyl]-benzamide; N- (3, 5-Bis-trifluoromethyl-phenyl)-4- (5,5,8,8-tetramethyl-5,6,7,8- tetrahydro-naphthalene-2-carbonyl)-benzamide; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-acetic acid; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-acetic acid methyl ester; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-4-methyl-pentanoic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-3-phenyl-propionic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-3- (4-hydroxy-phenyl)-propionic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-pentanedioic acid; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-acetic acid; 2- [3,7-Dimethyl-9- 6,8- tetraenoylamino]-propionic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-4-methyl-pentanoic acid; 2- 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-3-phenyl-propionic acid;

4- [3, 7-Dimethyl-9- (3,3,6,6-tetramethyl-cyclohex-1-enyl)-nona-2,4,6- trien-8-ynoylamino]-benzoic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoyl]-benzo [d] isothiazol-3-one; 4-[2- (8,8-Dimethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-propenyl]- N- (lH-tetrazol-5-yl)-benzamide; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-acetic acid; 4-Methyl-7- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- octa-2,4,6-trienoic acid ethylamide; {4- [4- (2-Hydroxy-ethyl)-piperazine-l-carbonyl]-phenyl}- (5,5,8,8- tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-methanone; 6- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carbon yl)- naphthalene-2-carboxylic acid; [2- (2-hydroxy-ethoxy)-ethyl]-amide; 6- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carbon yl)- naphthalene-2-carboxylic acid (4-hydroxy-phenyl)-amide; 4-Methylsulfanyl-2- { [6- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalene-2-carbonyl)-naphthalene-2-carbonyl]-amino}-butyr ic acid; 5- (4-Adamantan-2-ylidenemethyl-phenyl)-3-methyl-penta-2,4-dien oic acid (2-ethyl-hexyl)-amide; 2- [5- (4-Adamantan-2-ylidenemethyl-phenyl)-3-methyl-penta-2,4- dienoylamino]-4-methylsulfanyl-butyric acid ethyl ester; 4-[2- (1,3-Dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphth alen- <BR> <BR> <BR> <BR> 2-yl)-vinyl]-N- (2-hydroxy-ethyl)-benzamide;<BR> <BR> <BR> <BR> <BR> <BR> N-Butyl-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalene-2- carbonyl)-benzamide; N- (2-Hydroxy-ethyl)-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalene-2-carbonyl)-benzamide; and {2- [4- (2-Hydroxy-ethyl)-piperazine-1-carbonyl-carbonyl]-phenyl}- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-met hanone.

An especially preferred group of retinoids for lowering Lp (a) are adamantyl substituted benzamides which can be prepared by reacting a compound such as 3-adamantan-1-yl-4-methoxy-benzoyl chloride with a 4-aminobenzamide according to the following sequence

where R 1 and R2 can be organic radicals such as C 1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, and the like, or together with the nitrogen form a cyclic ring such as pyrrolidine or the like.

Typical amino benzamide starting materials include 4-Amino-N-tert-butyl-benzamide; 4-Amino-N-phenyl-benzamide; 4-Amino-N-benzyl-benzamide; 4-Amino-N- (2-hydroxy-ethyl)-benzamide; (4-Amino-phenyl)-pyrrolidin-1-yl-methanone; (4-Amino-phenyl)-piperidin-1-yl-methanone; and (4-Amino-phenyl)-morpholin-4-yl-methanone.

Typical retinoids prepared as described above include Benzamide, N- [4- [ [ (1, 1-dimethylethyl) amino] carbonyl] phenyl]- 4-methoxy-3- (tricyclo Benzamide, N- [4- [ (phenylamino) carbonyl] phenyl]-4-methoxy- 3- (tricyclo Benzamide, N- [4- [ [ (phenylmethyl) amino] carbonyl] phenyl]-4-methoxy- 3- (tricyclo dec-1-yl)-; Benzamide, N- [4- [ [ (2-hydroxyethyl) amino] carbonyl] phenyl]-4-methoxy- 3- (tricyclo [3.3.1.13 7] dec-1-yl)- ; 3-Adamantan-1-yl-4-methoxy-N- [4- (pyrrolidine-1-carbonyl-carbonyl)- phenyl]-benzamide; 3-Adamantan-1-yl-4-methoxy-N- [4- (piperidine-1-carbonyl-carbonyl)- phenyl]-benzamide; and 3-Adamantan-1-yl-4-methoxy-N- [4- (morpholine-4-carbonyl-carbonyl)- phenyl]-benzamide.

The following specific retinoids are also useful in the method of this invention: 4- [3- (4-tert-Butyl-phenyl)-oxiranyl]-benzoic acid; 4- [3- (3-tert-Butyl-phenyl)-oxiranyl]-benzoic acid; 4- [3- (3,4-Diethyl-phenyl)-3-methyl-oxiranyl]-benzoic acid; 4- [3-Methyl-3- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- oxiranyl]-benzoic acid; 4-Benzoylamino-benzoic acid; 4- (3-tert-Butyl-benzoylamino)-benzoic acid; 4- (4-tert-Butyl-benzoylamino)-benzoic acid; 4- (3,5-Di-tert-butyl-benzoylamino)-benzoic acid; 4- (3,4-Diisopropyl-benzoylamino)-benzoic acid; 4- [ (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carbon yl)- amino]-benzoic acid; 4- [Methyl- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalene- 2-carbonyl)-amino]-benzoic acid; 4- [ (4,4-Dimethyl-chroman-7-carbonyl)-amino]-benzoic acid; 4- [ (5-Chloro-4,4-dimethyl-chroman-7-carbonyl)-amino]-benzoic acid; 4- [ (2,3-Dihydro-benzo [1,4] dioxine-6-carbonyl)-amino]-benzoic acid; 4- [ (3,3-Dimethyl-3,4-dihydro-2H-benzo [b] [1,4] dioxepine-7-carbonyl)- amino]-benzoic acid; 4- [ (5-Methyl-2,3,4,5-tetrahydro-benzo [b] thiepine-8-carbonyl)-amino]- benzoic acid; 4- [ (4,4-Dimethyl-thiochroman-7-carbonyl)-amino]-benzoic acid; 4-[(Thiochroman-6-carbonyl)-amino]-benzoic[(Thiochroman-6-ca rbonyl)-amino]-benzoic acid; 4- [ (2,3-Dihydro-benzo [1,4] dithiine-6-carbonyl)-amino]-benzoic acid; 4- [ (4,4-Dimethyl-1,1-dioxo-11>6_-thiochroman-7-carbonyl)-ami no]- benzoic acid; 4- 1-dioxo-11>6_-thiochroman-6-carbonyl)-amino]-benzoic acid; 4- [ (1,4,4-Trimethyl-1,2,3,4-tetrahydro-quinoline-7-carbonyl)-am ino]- benzoic acid;

4- [ ( 1-Decyl-4, 4-dimethyl-1,2,3,4-tetrahydro-quinoline-7-carbonyl)- amino]-benzoic acid; 4- (3-tert-Butyl-4-methoxy-benzoylamino)-benzoic acid; 4- (3-Adamantan-1-yl-4-hydroxy-benzoylamino)-benzoic acid; 4- (3-Adamantan-1-yl-4-methoxy-benzoylamino)-benzoic acid; 4- (3-Adamantan-1-yl-4-methoxy-benzoylamino)-2-hydroxy-benzoic acid; 4- (3-Adamantan-1-yl-4-hexyloxy-benzoylamino)-benzoic acid; 4- (3-Adamantan-1-yl-4-decyloxy-benzoylamino)-benzoic acid; 4- [3- (1, 1-Dimethyl-decyl)-4-methoxy-benzoylamino]-benzoic; acid; N-Phenyl-terephthalamic acid; N-m-Tolyl-terephthalamic acid; N- (3-Ethyl-phenyl)-terephthalamic acid; N- (3-Isopropyl-phenyl)-terephthalamic acid; N- (4-Isopropyl-phenyl)-terephthalamic acid; N- (3-tert-Butyl-phenyl)-terephthalamic acid; N- (4-tert-Butyl-phenyl)-terephthalamic acid; N- (3-Cyclohexyl-phenyl)-terephthalamic acid; N-Biphenyl-3-yl-terephthalamic acid; N- (3-Bromo-phenyl)-terephthalamic acid; N- (3-Dimethylamino-phenyl)-terephthalamic acid; N- (3-Trifluoromethyl-phenyl)-terephthalamic acid; N- (3,4-Diethyl-phenyl)-terephthalamic acid; N- (2-Isopropyl-phenyl)-terephthalamic acid; N- (2,4-Diisopropyl-phenyl)-terephthalamic acid; N- (2,5-Diisopropyl-phenyl)-terephthalamic acid; N- (2, 6-Diisopropyl-phenyl)-terephthalamic acid; N- (3,4-Diisopropyl-phenyl)-terephthalamic acid; N- (3,5-Diisopropyl-phenyl)-terephthalamic acid; N- (2,4-Di-tert-butyl-phenyl)-terephthalamic acid; N- (3,5-Di-tert-butyl-phenyl)-terephthalamic acid; N- (3, 4-Dichloro-phenyl)-terephthalamic acid; N- (5,6,7,8-Tetrahydro-naphthalen-1-yl)-terephthalamic acid;

N- (5,6,7,8-Tetrahydro-naphthalen-2-yl)-terephthalamic acid;<BR> <BR> <BR> <BR> <BR> <BR> N- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-1-yl)- terephthalamic acid; N- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- terephthalamic acid; N- (3,5,5,8,8-Pentamethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- terephthalamic acid; N-Methyl-N- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- terephthalamic acid; N-Isopropyl-N- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- terephthalamic acid; N- (3-Bromo-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2 -yl)- terephthalamic acid; N- (3-Amino-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2 -yl)- terephthalamic acid; N- (5,5,8,8-Tetramethyl-3-nitro-5,6,7,8-tetrahydro-naphthalen-2 -yl)- terephthalamic acid; N- (4,4-Dimethyl-chroman-6-yl)-terephthalamic acid; N- (4,4-Dimethyl-thiochroman-6-yl)-terephthalamic acid; Benzoic acid, 3,5-bis (l, l-dimethylethyl)-4-hydroxy-, carboxyphenyl ester; Benzoic acid, 4-ethyl-3- (tricyclo [3.3.1.13, dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-ethenyl-3- (tricyclo [3.3.1.13, dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1.13v7] dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo 4-carboxy- 3-methylphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1.1337] dec-1-yl)-, 4-carboxy- 2- (hydroxymethyl) phenyl ester; 4- (4-Adamantan-1-yl-3-methoxy-benzoyloxy)-isophthalic acid;

Benzoic acid, (tricyclo[3.3.1.13,7]dec-1-yl)-, 4-carboxy- 3-hydroxyphenyl ester; Benzoic acid, 2,4-dimethoxy-5- (tricyclo [3.3.1.13v7] dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-methoxy-3- (tricyclo [3.3.1.13v7] dec-1-yl)-, 4-carboxy- 2-methoxyphenyl ester; Benzoic acid, 4-methoxy-3-(tricyclo[3.3.1.13,7]dec-1-yl)-, 4-carboxy- 3-methoxyphenyl ester; Benzoic acid, 2-fluoro-4-methoxy-5- (tricyclo [3.3.1.13 7] dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4-methoxy-3-(tricyclo[3.3.1.13,7]dec-1-yl)-, 4-carboxy- 3-fluorophenyl ester; Benzoic acid, 4- (2-propenyloxy)-3-(tricyclo [3.3.1.13,7]dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4- (acetyloxy)-3-(tricyclo [3.3.1.13,7]dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4- (2-methoxy-2-oxoethoxy)-3- (tricyclo [3.3.1.13o7] dec- 1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4- [2- (phenylmethoxy)-2-oxoethoxy]- 3-(tricyclo[3.3.1.13,7]dec-1-yl)-, 4-carboxyphenyl ester; Benzoic acid, 4- (methylsulfonyl)-3- (tricyclo 4-carboxyphenyl ester; 4,4-Dimethyl-chroman-6-carboxylic acid 4-ethoxycarbonyl-phenyl ester; 2,2,4,4-Tetramethyl-chroman-6-carboxylic acid 4-ethoxycarbonyl-phenyl ester; 2,2,4,4,7-Pentamethyl-chroman-6-carboxylic acid 4-ethoxycarbonyl- phenyl ester; 4,4,7-Trimethyl-thiochroman-6-carboxylic acid 4-ethoxycarbonyl-phenyl ester; 2,2,4,4-Tetramethyl-thiochroman-6-carboxylic acid 4-ethoxycarbonyl- phenyl ester;

4- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene- 2-carbonylsulfanyl)-benzoic acid; 4- (3-Isopropyl-4-methoxy-benzoylsulfanyl)-benzoic acid; 4- (3-Isopropylsulfanyl-4-methyl-benzoylsulfanyl)-benzoic acid; 4- (3-Adamantan-1-yl-benzoylsulfanyl)-benzoic acid; 4- (5-Adamantan-1-yl-2-fluoro-4-methoxy-benzoylsulfanyl)-benzoi c acid; 4- (5-Adamantan-1-yl-4-methoxy-2-methyl-benzoylsulfanyl)-benzoi c acid; 4- (3-Adamantan-1-yl-4-allyloxy-benzoylsulfanyl)-benzoic acid; 4- (3-Adamantan-1-yl-4-methylsulfanyl-benzoylsulfanyl)-benzoic acid; 4- (3,5-Bis-trifluoromethyl-benzoylsulfanyl)-benzoic acid; 4- (4-tert-Butyl-benzylamino)-benzoic acid; 4- (3,5-Di-tert-butyl-4-hydroxy-benzylamino)-benzoic acid; 4- (4-tert-Butoxy-3-methoxy-benzylamino)-benzoic acid; 4- [4- (1-Methoxy-1-methyl-ethyl)-benzylamino]-benzoic acid; 4- [ (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylmethy l)- amino]-benzoic acid; 4- [ (3-Fluoro-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen- 2-ylmethyl)-amino]-benzoic acid; 4- [ (3-Methoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen - 2-ylmethyl)-amino]-benzoic acid; 4-[(1,3-Dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-nap hthalen- 2-ylmethyl)-amino]-benzoic acid; 4- [ ( 1-Butoxy-3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-naphthalen - 2-ylmethyl)-amino]-benzoic acid; 4- [ (5,5,8,8-Tetramethyl-5,8-dihydro-naphthalen-2-ylmethyl)-amin o]- benzoic acid; 4- [ (5,5,8,8-Tetramethyl-7-oxo-5,6,7,8-tetrahydro-naphthalen-2-y lmethyl)- amino]-benzoic acid; 4- [ (7-Hydroxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen - 2-ylmethyl)-amino]-benzoic acid; 4-[1- (7-Hydroxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen -2-yl)- ethylamino]-benzoic acid;

4- [Methyl- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylmethy l)- amino]-benzoicacid; 4- [Acetyl- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylmethy l)- amino]-benzoicacid; 4- [ (5-tert-Butyl-2-methyl-phenylamino)-methyl]-benzoic acid; 4- [ (3,5-Di-tert-butyl-phenylamino)-methyl]-benzoic acid; 4- [ (4-tert-Butyl-2, 6-dimethyl-phenylamino)-methyl]-benzoic acid; 4- [ (1, 1,2,3,3-Pentamethyl-indan-5-ylamino)-methyl]-benzoic acid; 4- [1- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylamino )- ethyl]-benzoicacid; 4- [ ( 1,4-Dichloro-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthal en- 2-ylamino)-methyl]-benzoic acid; 4- [ (1, 4-Dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthale n- 2-ylamino)-methyl]-benzoic acid; 4- { [Acetyl- (1,4-dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalen-2-yl)-amino]-methyl}-benzoic acid; 4- (4-tert-Butyl-phenoxymethyl)-benzoic acid; 4- (3-tert-Butyl-phenoxymethyl)-benzoic acid; 4- [4- (1, 1-Dimethyl-propyl)-phenoxymethyl]-benzoic acid; 4- (2-tert-Butyl-4-methyl-phenoxymethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenoxymethyl)-benzoic acid; 4- (2, 4-Di-tert-butyl-phenoxymethyl)-benzoic acid; 4- (2, 6-Di-tert-butyl-phenoxymethyl)-benzoic acid; 4- (2, 5-Di-tert-butyl-phenoxymethyl)-benzoic acid; <BR> <BR> <BR> <BR> 4- (3, 5-Di-tert-butyl-phenoxymethyl)-benzoic acid;<BR> <BR> <BR> <BR> <BR> <BR> <BR> 4- (2-sec-Butyl-4-tert-butyl-phenoxymethyl)-benzoic acid; 4- (2, 4-Di-tert-butyl-5-methyl-phenoxymethyl)-benzoic acid; 4- (2,4,6-Tri-tert-butyl-phenoxymethyl)-benzoicacid; <BR> <BR> <BR> <BR> 4- (3, 5-Di-tert-butyl-2-hydroxy-phenoxymethyl)-benzoic acid;<BR> <BR> <BR> <BR> <BR> <BR> <BR> 4- (5,5,8,8-Tetramethyl-3-nitro-5,6,7,8-tetrahydro-naphthalen- 2-yloxymethyl)-benzoicacid; 4- (1, 4-Dihydroxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthale n- 2-yloxymethyl)-benzoicacid;

4- (1,4-Diacetoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphth alen- 2-yloxymethyl)-benzoic acid; 4- (2,2,5,7,8-Pentamethyl-chroman-6-yloxymethyl)-benzoic acid; 4- [2- (2-Hydroxy-ethyl)-2,5,7,8-tetramethyl-chroman-6-yloxymethyl] - benzoic acid; 4- [2- (2-Acetoxy-ethyl)-2,5,7,8-tetramethyl-chroman-6-yloxymethyl] - benzoic acid; 4- (4-tert-Butyl-phenylsulfanylmethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid; 4- (4-tert-Butyl-2-methyl-phenylsulfanylmethyl)-benzoic acid; 4- (3,4-Diethyl-phenylazo)-benzoic acid; 4- (2-Isopropyl-phenylazo)-benzoic acid; 4- (3-Isopropyl-phenylazo)-benzoic acid; 4- (4-Isopropyl-phenylazo)-benzoic acid; 4- (2,4-Diisopropyl-phenylazo)-benzoic acid; 4- (2,6-Diisopropyl-phenylazo)-benzoic acid; 4- (3,4-Diisopropyl-phenylazo)-benzoic acid; 4- (3,5-Diisopropyl-phenylazo)-benzoic acid; 4- (3-tert-Butyl-phenylazo)-benzoic acid; 4- (3-Cyclohexyl-phenylazo)-benzoic acid; 4- (Biphenyl-3-ylazo)-benzoic acid; 4- (4,4-Dimethyl-thiochroman-6-ylazo)-benzoic acid; 4- [2-Hydroxy-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- ethylamino]-benzoic acid; 4- [2-Hydroxy-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- ethylsulfanyl]-benzoic acid; 4- [2-Hydroxy-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- ethoxy]-benzoic acid; 4- [N'- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylmethy lene)- hydrazino]-benzoic acid;

4-{N'-[Cyclopropyl-(1, 1,{N'-[Cyclopropyl-(1, 1, 2,3,3-pentamethyl-indan-5-yl)-methylene]- hydrazino}-benzoic acid; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2- {2- [2- (2-hydroxy-ethoxy)-ethoxy]-ethoxy}-ethyl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2- {2- [2- (2-hydroxy-ethoxy)-ethoxy]-ethoxy}-ethyl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2- (2-oxo-pyrrolidin-1-yl)-ethyl ester; 6-trimethyl-cyclohex-l-enyl)-nona-2,4,6,8-tetraenoic acid 2- (2-oxo-pyrrolidin-1-yl)-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- {2- [2- (2-hydroxy-ethoxy)-ethoxy]-ethoxy}-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2-piperidin-1-yl-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 -- etraenoic acid 2-morpholin-4-yl-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2-piperidin-1-yl-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- (2, 5-dioxo-pyrrolidin-1-yl)-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- (2,6-dioxo-cyclohexyl)-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2-methanesulfonyl-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid methoxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid tert-butoxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid phenoxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2-acetoxy-phenoxycarbonylmethyl ester;

9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid styryloxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- (4-methoxy-phenyl)-vinyloxycarbonylmethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 2- (benzoyl-carbonyl)-5-methoxy-phenoxymethoxycarbonyl- methyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 - tetraenoic acid 1-phenoxycarbonyl-ethyl ester; 9- (4-Methoxy-2,3,6-trimethyl-phenyl)-3,7-dimethyl-nona-2,4,6,8 -- tetraenoic acid 1-ethoxycarbonyloxy-ethyl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid 4-dimethylamino-6-methyl-2- (2-octyl-hexadecyloxy)-tetrahydro-pyran-3-yl ester; 9- (4-Methoxy-2,5,6-trimethyl-cyclohex-1-enyl)-3,7-dimethyl-non a- 2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester; 9- (4-Methoxy-2,5,6-trimethyl-cyclohex-l-enyl)-3,7-dimethyl-non a- 2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester; 9- (4-Methoxy-2,5,6-trimethyl-cyclohex-l-enyl)-3,7-dimethyl-non a- 2,4,6,8-tetraenoic acid 2-butoxy-4-dimethylamino-6-methyl-tetrahydro-pyran-3-yl ester; 4- [4- (2,6,6-Trimethyl-cyclohex-1-enyl)-but-3-en-1-ynyl]-benzamide ; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8-tetraenoic acid amide;

[6- (3-Adamantan-l-yl-4-methoxy-phenyl)-naphthalen-2-y !]-morpholin- 4-yl-methanone; N- (3, 5-Bis-trifluoromethyl-phenyl)-4- (5,5,8,8-tetramethyl-5,6,7,8- tetrahydro-naphthalene-2-carbonyl)-benzamide; N- (4-Hydroxy-phenyl)-4- [2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalen-2-yl)-vinyl]-benzamide; N- (3, 5-Bis-trifluoromethyl-phenyl)-4- (5,5,8,8-tetramethyl-5,6,7,8- tetrahydro-naphthalene-2-carbonyl)-benzamide; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-acetic acid; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-acetic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-4-methyl-pentanoic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-3-phenyl-propionic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-3- (4-hydroxy-phenyl)-propionic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-pentanedioic acid; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-acetic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-propionic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-4-methyl-pentanoic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-3-phenyl-propionic acid; 4- [3,7-Dimethyl-9- (3,3,6,6-tetramethyl-cyclohex-1-enyl)-nona-2,4,6-trien- 8-ynoylamino]-benzoic acid; 2- [3, 7-Dimethyl-9- (2,6,6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoyl]-benzo [d] isothiazol-3-one;

4- [2- (8,8-Dimethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-propenyl]- N- (1 H- tetrazol-5-yl)-benzamide; 6-trimethyl-cyclohex-1-enyl)-nona-2,4,6,8- tetraenoylamino]-acetic acid; 4-Methyl-7- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-oct a- 2,4,6-trienoic acid ethylamide; {4- [4- (2-Hydroxy-ethyl)-piperazine-l-carbonyl]-phenyl}- (5,5,8,8- tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-methanone; 6- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carbon yl)- naphthalene-2-carboxylic acid [2- (2-hydroxy-ethoxy)-ethyl]-amide; 6- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carbon yl)- naphthalene-2-carboxylic acid (4-hydroxy-phenyl)-amide; 4-Methylsulfanyl-2- { [6- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalene-2-carbonyl)-naphthalene-2-carbonyl]-amino}-butyr ic acid; 5- (4-Adamantan-2-ylidenemethyl-phenyl)-3-methyl-penta-2,4-dien oic acid (2-ethyl-hexyl)-amide; 2- [5- (4-Adamantan-2-ylidenemethyl-phenyl)-3-methyl-penta-2,4- dienoylamino]-4-methylsulfanyl-butyric acid ethyl ester; 4- [2- (1,3-Dimethoxy-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphth alen- <BR> <BR> <BR> <BR> 2-yl)-vinyl]-N- (2-hydroxy-ethyl)-benzamide;<BR> <BR> <BR> <BR> <BR> N-Butyl-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalene- 2-carbonyl)-benzamide; N- (2-Hydroxy-ethyl)-2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro- naphthalene-2-carbonyl)-benzamide; {2- [4- (2-Hydroxy-ethyl)-piperazine-1-carbonyl-carbonyl]-phenyl}- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-met hanone; 3-Adamantan-1-yl-4-methoxy-benzoyl chloride; 4-Amino-N-tert-butyl-benzamide; 4-Amino-N-phenyl-benzamide; 4-Amino-N-benzyl-benzamide; 4-Amino-N- (2-hydroxy-ethyl)-benzamide; (4-Amino-phenyl)-pyrrolidin-1-yl-methanone; (4-Amino-phenyl)-piperidin-1-yl-methanone;

(4-Amino-phenyl)-morpholin-4-yl-methanone; Benzamide, N- [4- [ [ (1,1-dimethylethyl) amino] carbonyl] phenyl]- 4-methoxy-3- (tricyclo [3.3.1.13 7] dec-1-yl)- ; Benzamide, N- [4- [ (phenylamino) carbonyl] phenyl]-4-methoxy- 3-(tricyclo[3.3.1.13,7]dec-1-yl)-; Benzamide, N- [4- [ [ (phenylmethyl) amino] carbonyl] phenyl]-4-methoxy- 3- (tricyclo[3.3.1.13 7] dec-1-yl)-; Benzamide, N- [4- [ [ (2-hydroxyethyl) amino] carbonyl] phenyl]-4-methoxy- 3- (tricyclo [3.3.1.13 7] dec-1-yl)- ; 3-Adamantan-1-yl-4-methoxy-N- [4- (pyrrolidine-1-carbonyl-carbonyl)- phenyl]-benzamide; 3-Adamantan-1-yl-4-methoxy-N- [4- (piperidine-1-carbonyl-carbonyl)- phenyl]-benzamide; 3-Adamantan-1-yl-4-methoxy-N- [4- (morpholine-4-carbonyl-carbonyl)- phenyl]-benzamide; 1,1,3,3-Tetramethyl-5- ( 1-methyl-2-phenyl-vinyl)-indan; 6- (1-Methyl-2-phenyl-vinyl)-1,2,3,4-tetrahydro-naphthalene; 6- (1-Methyl-2-phenyl-vinyl)-1,2,3,4-tetrahydro-naphthalene; 1,1-Dimethyl-6- (1-methyl-2-phenyl-vinyl)-1, 2,3,4-tetrahydro-naphthalene; 3,4-tetrahydro- naphthalene; 3,4-tetrahydro- naphthalene; 1,1,4,4-Tetramethyl-6- (1-methyl-2-phenyl-vinyl)-7-octyl-1, 2,3,4- tetrahydro-naphthalene; 3,4- tetrahydro-n aphthalene; 6-Chloro-1,1,4,4-tetramethyl-7- (1-methyl-2-phenyl-vinyl)-1,2,3,4- tetrahydro-naphthalene; 3,4-tetrahydro- naphthalene;

1,1,4,4-Tetramethyl-6- (1-methyl-2-phenyl-vinyl)-1, 2,3,4-tetrahydro- naphthalen-2-ol; 1,1,4,4,6-Pentamethyl-7- (l-methyl-2-phenyl-vinyl)-1, 2,3,4-tetrahydro- naphthalen-2-ol; 1,1,3,3-Tetramethyl-5- (l-methyl-2-phenyl-vinyl)-indan-2-one; 1,4,4-Trimethyl-7- (1-methyl-2-phenyl-vinyl)-1, 2,3,4-tetrahydro-quinoline; 1,4,4-Trimethyl-6- ( 1-methyl-2-phenyl-vinyl)-1,2,3,4-tetrahydro-quinoline; 4,4-Dimethyl-7- ( 1-methyl-2-phenyl-vinyl)-chroman; 4,4-Dimethyl-6-(1-methyl-2-phenyl-vinyl)-chroman; 4,4-Dimethyl-7-(1-methyl-2-phenyl-vinyl)-thiochroman; 4,4-Dimethyl-6- ( 1-methyl-2-phenyl-vinyl)-thiochroman; 4,4-Dimethyl-7- ( 1-methyl-2-phenyl-vinyl)-thiochroman 1,1-dioxide; 4,4-Dimethyl-6- ( 1-methyl-2-phenyl-vinyl)-thiochroman 1,1-dioxide; 2,2-Dimethyl-5- (l-methyl-2-phenyl-vinyl)-benzo [l, 3] dithiole; 7,7-Dimethyl-2- (1-methyl-2-phenyl-vinyl)-7, 8-dihydro-6H-5,9-dithia- benzocycloheptene; 1,1,3,3-Tetramethyl-indan-5-carboxylic acid phenylamide; 7,8-tetrahydro-naphthalene-2-carboxylic acid phenylamide; 5,5,7,7,9,9-Hexamethyl-6,7,8,9-tetrahydro-5H-benzocyclohepte ne- 2-carboxylic acid phenylamide; <BR> <BR> <BR> <BR> N- (1,1,3,3-Tetramethyl-indan-5-yl)-benzamide;<BR> <BR> <BR> <BR> <BR> <BR> <BR> N- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-ben zamide; 3-Adamantan-1-yl-4-methoxy-benzoic acid phenyl ester; 3-Adamantan-1-yl-4-methoxy-thiobenzoic acid S-phenyl ester; 4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-pro penyl]- phenol; Acetic acid 4- [2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- propenyl]-phenyl ester; 1- (2- {4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- <BR> <BR> <BR> propenyl]-phenoxy}-ethyl)-piperidine;<BR> <BR> <BR> <BR> <BR> <BR> 4- (2- {4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-< ;BR> <BR> <BR> <BR> <BR> <BR> <BR> propenyl]-phenoxy}-ethyl)-morpholine;

4- (2- {4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-< ;BR> <BR> <BR> <BR> <BR> <BR> propenyl]-phenoxy}-ethyl)-thiomorpholine 1,1-dioxide;<BR> <BR> <BR> <BR> <BR> <BR> <BR> 4- [2- (3-Chloro-5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen- 2-yl)- propenyl]-phenol; 4-[2-(6-Methoxy-1, 1,[2-(6-Methoxy-1, 1, 3,3-tetramethyl-indan-5-yl)-propenyl]-phenol; 5- [2- (4-Hydroxy-phenyl)-l-methyl-vinyl]-1,1,3,3-tetramethyl-indan - 2-one; 5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carboxy lic acid (4-hydroxy-phenyl)-amide; 7,7-Dimethyl-6,7,8,9-tetrahydro-5H-benzocycloheptene-2-carbo xylic acid (4-hydroxy-phenyl)-amide; 3-Ethyl-7,7-dimethyl-6,7,8,9-tetrahydro-5H-benzocycloheptene - 2-carboxylic acid (4-hydroxy-phenyl)-amide; 4-Hydroxy-N- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- benzamide; 3-Adamantan-1-yl-4-methoxy-benzoic acid 4-hydroxy-phenyl ester; 3-Adamantan-1-yl-4-methoxy-thiobenzoic acid S- (4-hydroxy-phenyl) ester; 5- [2-Methyl-4- (2,6,6-trimethyl-cyclohex-1-enyl)-buta-1,3-dienyl]-1 H- tetrazole ; 5- {4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- propenyl]-phenyl}-1 H-tetrazole; <BR> <BR> <BR> <BR> 5- [4- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-ylethyn yl)-<BR> <BR> <BR> <BR> <BR> <BR> phenyl]-IH-tetrazole; Methyl- {4- [2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- propenyl]-phenyl}-phosphinic acid ethyl ester; Phenyl- {4- [2- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- propenyl]-phenyl}-phosphinic acid ethyl ester; {4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-pro penyl]- phenyl}-phosphonic acid dimethyl ester; {4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-pro penyl]- phenyl}-phosphonic acid diethyl ester;

{4- [2- (5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)-pro penyl]- phenyl}-phosphonic acid dibutyl ester; {4-[2-(1, 1,2,3,3-Pentamethyl-indan-5-yl)-propenyl]-phenyl}-phosphonic acid diethyl ester; 6- (2-Biphenyl-4-yl-1-methyl-vinyl)-1,1,4,4-tetramethyl-1,2,3,4 -tetrahydro- naphthalene; 6- [2-(2-Fluoro-phenyl)-1-methyl-vinyl]-1,1,4,4-tetramethyl-1,2 ,3,4- tetrahydro-naphthalene; 6- [2- (2-Fluoro-phenyl)-1-methyl-vinyl]-1,1,4,4-tetramethyl-1,2,3, 4- tetrahydro-naphthalene; 6- [2- (4-Chloro-phenyl)-1-methyl-vinyl]-1, 1, 4, 4-tetramethyl-1,2,3,4- tetrahydro-naphthalene; 6-[2-(2-Bromo-phenyl)-1-methyl-vinyl]-1,[2-(2-Bromo-phenyl)- 1-methyl-vinyl]-1, 3,4- tetrahydro-naphthalene; 6- [2- (3-Bromo-phenyl)- 1-methyl-vinyl]-1,1,4,4-tetramethyl-1,2,3,4- tetrahydro-naphthalene; 6- [2- (4-Iodo-phenyl)-1-methyl-vinyl]-1, 1,4,4-tetramethyl-1,2,3,4- tetrahydro-naphthalene; 1,1,4,4-Tetramethyl-6- [ 1-methyl-2- (4-nitro-phenyl)-vinyl]-1,2,3,4- tetrahydro-naphthalene; 3-Tetramethyl-indan-5-carboxylic acid (4-fluoro-phenyl)-amide; 5,5,8,8-Tetramethyl-5,6,7,8-tetrahydro-naphthalene-2-carboxy lic acid (4-fluoro-phenyl)-amide; 9,9-Dimethyl-6,7,8,9-tetrahydro-5H-benzocycloheptene-2-carbo xylic acid (4-fluoro-phenyl)-amide; 7,7-Dimethyl-6,7,8,9-tetrahydro-5H-benzocycloheptene-2-carbo xylic acid (4-fluoro-phenyl)-amide; <BR> <BR> <BR> <BR> 4-Fluoro-N- (1, 1,3,3-tetramethyl-indan-5-yl)-benzamide;<BR> <BR> <BR> <BR> <BR> <BR> <BR> 4-Fluoro-N- (5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-naphthalen-2-yl)- benzamide; <BR> <BR> <BR> N> 1_, N> 1_-Dimethyl-N>2_- {4-[2-(5,5,8,8-tetramethyl-5,6,7,8-<BR> <BR> <BR> <BR> <BR> <BR> tetrahydro-naphthalen-2-yl)-propenyl]-phenyl}-ethane-1,2-dia mine;

Methyl- (2-morpholin-4-yl-ethyl)- {4- [2- (5,5,8,8-tetramethyl-5,6,7,8- tetrahydro-naphthalen-2-yl)-propenyl]-phenyl}-amine; 6- {2- [4- (2-Methoxy-ethylsulfanyl)-phenyl]-1-methyl-vinyl}-1,1,4,4- tetramethyl-1,2,3,4-tetrahydro-naphthalene; and <BR> <BR> <BR> 1,1,4,4-Tetramethyl-6- { 1-methyl-2- [4- (2-methylsulfanyl-ethylsulfanyl)-<BR> <BR> <BR> phenyl]-vinyl}-1,2,3,4-tetrahydronaphthalene.

The glitazones are a family of antidiabetic agents characterized as being thiazolidinediones or related analogs. They are described in Current Pharmaceutical Design, 1996; 2: 85-101. Typical glitazones have the formula where n is 1,2, or 3, Y and Z independently are O or NH; and E is a cyclic or bicyclic aromatic or non-aromatic ring, optionally containing a heteroatom selected from oxygen or nitrogen.

Preferred glitazones have the formula wherein: R I and R2 independently are hydrogen or Cl-C5 alkyl; R3 is hydrogen, a Cl-C6 aliphatic acyl group, an alicyclic acyl group, an aromatic acyl group, a heterocyclic acyl group, an araliphatic acyl group, a (Cl-C6 alkoxy) carbonyl group, or an aralkyloxycarbonyl group; R4 and R5 independently are hydrogen, C 1-C5 alkyl, C I-C5 alkoxy, or R4 and R5 together are C1-C4 alkylenedioxy; W is-CH2-, >CO, or CHOR6, where R6 is any one of the atoms or groups defined for R3 and may be the same as or different from R3; n, Y, and Z are as defined above, and pharmaceutically acceptable salts thereof.

An especially preferred glitazone is troglitazone having the formula

Other glitazones that can be employed in this invention are described in United States Patent Numbers 5,457,109 and 5,478,852, which are incorporated herein by reference. Other specific glitazones which are preferred include ciglitazone, pioglitazone, englitazone, TA 174, which has the formula and BRL 49653 (rosiglitazone), which has the formula Additionally preferred glitazones include: 5- (4- [2- [ 1- (4-2'-Pyridylphenyl) ethylideneaminooxy] ethoxy] benzyl]- thiazolidine-2,4-dione; 5- (4- [5-Methoxy-3-methylimidazo [5,4-b] pyridin-2-yl- methoxy) benzyl] thiazolidine-2,4-dione, or its hydrochloride; 5- [4- (6-Methoxy-1-methylbenzimidazol-2-yl-methoxy) benzyl]- thiazolidine-2,4-dione; 5- [4- (l-Methylbenzimidazol-2-ylmethoxy) benzyl] thiazolidine-2,4-dione; and

5- [4- (5-Hydroxy-1,4,6,7-tetramethylbenzimidazol-2-ylmethoxy) benzyl]- thiazolidine-2,4-dione.

The combinations of this invention will be used to inhibit cell proliferation, and thus to treat diseases which result from cell proliferation, including cancer, restenosis, and atherosclerosis. Cancers to be treated according to this invention include breast cancer, leukemias, ovarian, colon, pancreatic, melanoma, and lymphnomas.

For use in the method of this invention, the retinoids preferably are combined with one or more pharmaceutically acceptable diluents, carriers, excipients, or the like, for convenient oral, parenteral, and topical administration to animals, preferably humans. The retinoids are ideally suited to formulation for oral administration in the form of tablets, capsules, dispersible powders, granules, suspensions, elixirs, buccal seals, and the like. The formulations typically will contain from about 1 % to about 90% by weight of active retinoid, and more commonly from about 5% to about 60% by weight.

Oral formulations can contain, for suspensions, from about 0.05% to about 5% by weight of a suspending agent, such as talc or the like, and syrups will contain from about 10% to about 50% by weight of a sugar such as dextrose.

Tablets may contain normal amounts of binders, stabilizers, and common diluents such as corn starch and sugars. Parenteral formulations, for instance, solutions for IV injection, will be made by dissolving or suspending the retinoid in a solvent such as isotonic saline or 5% glucose in sterile water.

The dose of retinoid to be administered is that amount which is effective, in combination with a glitazone, for reducing or inhibiting cell proliferation.

The effective dosage of active ingredient employed may vary depending on the particular compound employed, the mode of administration, and the severity of the condition being treated. However, in general, satisfactory results are obtained when the retinoids are administered at a daily dosage of from about 0.5 to about 500 mg/kg of animal body weight, preferably given in divided doses two to four times a day, or in sustained-release form. For most large mammals, such as humans, the total daily dosage is form about 1 to 100 mg, preferably from about 2 to 80 mg. Dosage forms suitable for internal use comprise from about 0.5 to 500 mg of the active compound in intimate admixture with a solid or liquid

pharmaceutically acceptable carrier. This dosage regimen may be adjusted to provide the optimal therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

The glitazones will likewise be formulated in their normal clinical dosage forms which are employed in treating non-insulin dependent diabetes mellitus, and impaired glucose tolerance. For example, troglitazone is routinely used at doses of about 200 to about 800 mg per day orally. Rosiglitazone will be used at about 2 to about 20 mg per day, typically about 5 to 8 mg. Pioglitazone generally will be administered orally at doses from about 5 to about 100 mg per day, more typically at about 10 to about 50 mg per day.

Both the retinoids and the glitazones may be administered orally as well as by intravenous, intramuscular, or subcutaneous routes. Solid carriers include starch, lactose, dicalcium phosphate, microcrystalline cellulose, sucrose, and kaolin, while liquid carriers include sterile water, polyethylene glycols, nonionic surfactants, and edible oils such as corn, peanut, and sesame oils, as are appropriate to the nature of the active ingredient and the particular form of administration desired. Adjuvants customarily employed in the preparation of pharmaceutical compositions may be advantageously included, such as flavoring agents, coloring agents, preserving agents, and antioxidants, for example, vitamin E, ascorbic acid, BHT, and BHA.

The preferred pharmaceutical compositions from the stand point of ease of preparation and administration are solid compositions, particularly tablets and hard-filled or liquid-filled capsules. Oral administration of the compounds is preferred. The retinoids and glitazones can be administered separately, for example as separate tablets, or they can be formulated together in a fixed dosage combination.

These active compounds may also be administered parenterally or intraperitoneally. Solutions or suspensions of these active compounds as a free base or pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils.

Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacterial and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e. g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.

The compounds may also be encapsulated in liposomes to allow an intravenous administration of the drug. The liposomes suitable for use in the invention are lipid vesicles and may include plurilamellar lipid vesicles, small sonicated multimellar vesicles, reverse phase evaporation vesicles, large multilamellular vesicles, and the like, wherein the lipid vesicles are formed by one or more phospholipids such as phosphotidylcholine, phosphatidylglycerol, sphingomyelin, phospholactic acid, and the like. In addition, the liposomes may also comprise a sterol component such as cholesterol.

Some typical formulations which can be administered to humans are as follows: Tablet Formulation 4- [2- (3, 4-di-n-butylphenyl)-propenyl]-benzoic acid (250 mg) is blended to uniformity with 100 mg of corn starch and 50 mg of lactose. The mixture is compressed into a tablet. Such tablets are administered orally at the rate of one to three times a day.

Fixed Combination Tablet Troglitazone (400 mg) and 9-cis-retinoic acid (50 mg) are blended with N-vinylpyrrolidone polymer and extruded at 180°C through a twin-screw extender to provide an extrudate which is compressed into a tablet.

Fixed Combination Tablet Rosiglitazone (8 mg) and 13-cis-retinol (80 mg) are blended with 200 mg of corn starch and pressed into a tablet.

Preparation of Oral Suspension Ingredient Amount 4,4-dimethyl-7- (1-methyl-2-phenylvinyl) chroman 500 mg Pioglitazone 35 mg Sorbitol solution (70% NF) 40 mL Sodium benzoate 150 mg Saccharin 10 mg Red dye 10 mg Cherry flavor 50 mg Distilled water qs OD 100 mL The sorbitol solution is added to 40 mL of distilled water and the retinoid and glitazone are suspended thereon. The saccharin, sodium benzoate, flavor, and dye are added and dissolved. The volume is adjusted to 100 mL with distilled water. Each milliliter of syrup contains 2 mg of retinoid and 0.35 mg of pioglitazone.

Suppositories A mixture of 300 mg of 4- (2,4-diisopropylbenzoyl) benzoic acid, 200 mg of troglitazone, and 500 mg of theobroma oil is stirred at 60°C to uniformity. The mixture is cooled and allowed to harden in a tapered mold to provide a 1-g suppository.

Parenteral Solution In a solution of 700 mL of propylene glycol and 200 mL of sterile water is suspended 20.0 g of retinoic acid and 5.0 g of rosiglitazone. The pH is adjusted to pH 6.5 with dilute sodium hydroxide, and the volume is made up to 1000 mL with water for injection. The formulation is sterilized, filled into 5.0-mL ampoules each containing 2.0 mL, and sealed under nitrogen.

Preferred formulations are those incorporating any of the preferred retinoids and glitazones to be utilized to inhibit cell proliferation and thus to treat cancer, restenosis and atherosclerosis, and similar vascular smooth muscle cell proliferations. Specifically preferred are all trans isomers of retinoic acid, retinal, and retinol. Also preferred are the 9-cis isomers of retinoic acid, retinal, and retinol, as well as the 13-cis isomers of retinoic acid, retinal, and retinol. Certain retinoid esters also are preferred, for example, 6-trimethyl- cyclohex-l-enyl)-nona-2,4,6,8-tetraenoic acid, methyl ester.

When the retinoid and glitazone are formulated together, the compositions will contain about one to about 1000 parts by weight of retinoid, and about 1000 to about one part by weight glitazone. For example, a typical composition of 9-cis-RA and troglitazone will contain about 12 mg of 9-cis-RA and about 500 mg of troglitazone. Such combination will be administered to an adult patient about once each day to achieve a synergistic control of cell proliferation.

The compositions may contain common excipients and carriers such as starch, sucrose, talc, gelatin, methylcellulose, and magnesium stearate. The compositions will normally be made for oral administration, for instance as tablets or capsules, but also may be in the form of aqueous suspensions or solutions, suppositories, slow release forms, for example employing an osmotic pump, skin patch, or the like.

The ability of the retinoid-glitazone combinations to inhibit cell proliferation and thereby treat cancer has been established in experimental protocols. The following examples illustrate the surprising biological effects of the combinations.

EXAMPLE 1 PPARs exist heterodimerized to retinoid X receptor (RXR) on a gene's promoter peroxisome proliferator responsive element (PPRE). The consensus PPRE corresponds to a hexanucleotide direct repeat sequence separated by one nucleotide. The RXR ligand, 9-cis-RA, a natural derivative of vitamin A, cannot only activate signaling pathways through PPAR-RXR heterodimer, but also can mediate transactivation through LXR-RXR heterodimers and RXR-RXR homodimers. Clinically, retinoic acid derivatives have been widely used to supplement cancer treatment with variable outcomes. Indeed, utility of retinoids as cancer treatment has been suggested nearly 100 years ago. Perhaps, variation in the ability of retinoids to suppress tumors may be dependent on PPARy expression and the presence of natural ligands to PPARy. Therefore, it would be of interest to determine whether PPAR and RXR ligands might cooperate to suppress cell proliferation.

In the current study, RA treatment of human THP-1 monocytic leukemia cells induces expression of PPARyl RNA and protein. Under these conditions, RA caused a concentration dependent suppression of cell growth. At the lower concentrations, where RA was marginally effective in suppressing cell growth, the simultaneous treatment of the cells with BRL 49653 completely blocked cell proliferation. Treatment with BRL 49653 alone was ineffective. These results demonstrate RA induces expression of PPARyl, and in the presence of their ligands, PPARyl and RXR cooperate to suppress cell growth. This interaction establishes the combinations are useful for growth suppression in other proliferative conditions (e. g., cancer, restenosis) when PPARy is not highly expressed.

MATERIALS AND METHODS Cell Culture and Differentiation. Human THP-1 cells were obtained from the American type Culture Collection (Rockville, MD). Cells were cultured in RPMI 1640 medium (GIBCO BRL) containing 10% fetal bovine serum, 0.05 mM 2-mercaptoethanol (GIBCO BRL). For RA treatment and macrophage

differentiation, cells were switched to differentiation medium (DM) containing 1 % Nutridoma-Hu (Boehringer Mannheim), 0.05 mM 2-mercaptoethanol in RPMI 16140 medium with the addition of either RA or PMA in dimethylsulfoxide (DMSO) (0.2% of final volume).

Rnase Protection Assays. Total cellular RNA was isolated from THP-1 cells using Trizol reagents (GIBCO BRL). The cDNA probe for the human PPARywas prepared by reverse transcription-polymerase chain reaction with primers generated from published sequences. The sequences of 5'-and 3'-oligonucleotides used were GACTGCAAGGACATGAGCGA (nucleotides 111-134) and CGGTTGGTGAAGAGCAGATA (nucleotides 251-274), respectively. Thus, a partial cDNA containing nucleotides 111-274 of hPPARy2 was subcloned into the pCRII vector (Invitrogen). A labeled antisense riboprobe was synthesized using a Maxiscript in vitro transcription kit (Ambion). RNase protection assays were done with an Ambion RPA II RNase protection assay kit.

Western Blot Analysis. To detect the PPARy protein, nuclear extracts were isolated as described by Andrews et al. for western blot analysis, Nucleic Acids Res., 1991; 19: 2499. Protein concentrations were measured using Bio-Rad Protein Assay Reagent (Bio-Rad Laboratories, CA) following the manufacturer's suggested procedure. Protein was separated on a 6% Tris-Glycine gel (Novex).

After electrophoresis, gels were transferred to nitrocellulose membranes and blocked overnight in PBST with 10% non-fat dry milk (Bio-Rad Laboratories, CA) at 4°C. Protein was detected using ECL western blotting analysis system (Amersham) following the manufacturer's suggested procedure. The primary antibody for PPARy was a polyclonal antibody generated with the PPARy C-terminal as epitope.

Flow Cytometry Cell Cycle Analysis. THP-1 cells treated with RA for 1 day were harvested and fixed with ice-cold 70% ethanol. The cells were then stained with a propidium iodide solution (100 FM in Dulbecco's-PBS w Ca2+, Mg2+, with 36U RNase A) and subjected to flow cytometry analysis on FACScan

(Becton Dickinson) following the manufacturer's suggested procedure. Data were analyzed using ModFit software (Verity Software House, Inc.).

CD14 and CD15 Immunocytometry Analysis. THP-1 cells were treated for one day with DMSO vehicle or RA, and then harvested and incubated with 10% heat- inactivated human serum (Sigma) to block cell membrane Fc receptors. After first staining with either oc-CD 14 (Ancell) or a mouse isotype antibody control (IgG2a), or a-CD 15 (Ancell) or a mouse isotype antibody control (IgM). Cells were then treated with a propidium iodide solution and subjected to FACScan (Becton Dickinson) immunocytometry analysis. The FACScan histogram data were analyzed by CellQuest software (Becton Dickinson).

RESULTS In the course of studying the regulation of PPARy expression in human THP-1 monocytes, various stimulators were used, including the 9-cis-RA. It was found that growth suppression was induced in the THP-1 cells treated with RA alone. When cells were treated with DMSO vehicle alone, cell number increased nearly two-fold after 2 days in culture. Retinoic acid caused a concentration dependent suppression of cell growth, with near complete growth arrest at the highest concentration (500 nM) (Figure 1). At 500 nM RA, RNase protection analysis revealed PPARyl was upregulated in the RA-treated cells (Figure 2A).

THP-1 cells treated with various concentration of RA demonstrated PPARy1 expression increased in a concentration dependent fashion (Figure 2B, top panel).

The nuclear PPARyl protein level (Figure 2B, bottom panel) paralleled the induction of PPARyl message (Figure 2B, top panel).

To determine whether growth arrest was dependent on ligand interaction with PPARyl, cells were grown in the presence of BRL 49653 alone (Figure 3A) or in combination with a low concentration of RA (Figure 3B). BRL 49653 at 1 RM (Figure 3A) had only a modest effect of decreasing cell growth by 16% after 2 days. At 10 p. M, BRL 49653 cell proliferation was inhibited by 55% after 2 days. At 5 nM RA alone (Figure 3B), cell growth was inhibited by 49% after

2 days. However, the simultaneous treatment of cells with both 5 nM RA plus 1 RM or 10 RM BRL 49653 caused a 64% and 100% inhibition in cell growth, respectively (Figure 3B). Flow cytometry analysis was used to determine the combined effect of RA and BRL 49653 on the percentage of THP-1 cells in G1 phase (Figure 3C). In the absence of RA or BRL 49653,34.9 3.6% of cells were in G1 phase. Treatment with 1 tM BRL 49653 alone showed no change in number of cells in G1 (34.5 + 3.5% of cells), while 10 RM BRL 49653 increased the number of cells to 41.7 5.2% in G1. Treatment with 0.5,5, or 500 nM RA progressively increased the G1 cell populations to 36.1 3.9%, 40.3 2.7%, and 42.7 2.6%, respectively. Compared to either compound alone, the combination of RA plus BRL 49653 further increased the number of cells in G1, reaching a maximal level (53.6 3.6%) at 5 nM RA plus 10 uM BRL 49653 (Figure 3C). At this combined concentration, cell proliferation is completely inhibited (Figure 3B).

To determine whether RA's effects on growth suppression were associated with effects on differentiation, the THP-1 cell surface antigens CD 14 and CD 15 were determined by immunocytometry analysis following treatment with 500 nM RA (Figure 4A). No difference in the cell surface expression of either of these antigens could be detected. The effects of RA on differentiation of THP-1 monocytes to macrophages were also assessed by determination of adhesion to a plastic surface, characteristic of differentiation induced by phorbal esters. To determine cell adhesion, the number of remaining suspended cells was measured after 1 day in culture (Figure 4B). No difference in the number of suspended cells was observed after 500 nM RA treatment. PMA-induced differentiation decreased the number of suspended cells by 80%. The effect of RA plus PMA treatment on cells adhesion was similar to that of PMA alone. Overall, these two control experiments show that RA-induced growth arrest does not induce differentiation.

To determine if nuclear hormone receptor induction by RA is specific to undifferentiated cells (e. g., the THP-1 monocytes, Figure 2A), we compared PPARyl levels to that of a differentiated THP-1 derived macrophages. In the undifferentiated THP-1 cells, PPARyl was induced by RA (Figure 5A), as previously shown (Figure2A). In PMA differentiated THP-1 cells, significant

levels of PPARyl were observed, although cells were not treated with RA. RA addition during induction of differentiation did not further increase the basal level of PPARyl. PPARyl levels were also not changed in cells treated with RA following PMA induced differentiation (Figure 5B). These data indicate that undifferentiated cells are sensitive to PPARyl induction by RA, while differentiated cells of the same lineage are not.

DISCUSSION The foregoing experiments establish that the induction of PPARyl plays an important role in RA mediated growth suppression. RA treatment suppressed cell growth and enriched the G 1 cell population. In that RA is a ligand of RXR, which can heterodimerize with other nuclear hormone receptor partners (e. g., PPARoc, PPARß, PPAR), the data indicate a potential effect of the ligand might be to induce regulation of these partners.

In the undifferentiated monocyte, PPARyl is expressed at low levels; however, when RA is present, the receptor RNA and protein are markedly induced (Figure 2). The PPARyl induction was RA concentration dependent and inversely related to cell growth suppression. At high levels of RA, growth suppression was complete; however, at low concentration of RA, cell growth was only partially impeded unless exogenous ligand (BRL 49653) to PPARyl was included in the growth media. These data establish that appropriate ligation of RXR/PPARyl may be an efficient means to completely block the proliferation of undifferentiated tumor cells. Cell cycle analysis confirmed treatment with both ligands significantly increased the proportion of cells in Gl phase when cell growth was arrested.

It should be noted that the treatments with high levels of RA or the combination of a low concentration of RA plus a PPARy ligand blocked proliferation without inducing differentiation to macrophages. These findings contrast those in which PPARy overexpression cause fibroblast differentiation into adipocytes. Human liposarcoma cells naturally express RXR and high levels of

PPARy can be forced into terminal differentiation when treated with pioglitazone alone. Unlike the liposarcoma cell studies where PPARy is highly expressed, the monocytic tumor cells used in the current study express minute amounts of PPARy, and RA can be utilized to induce expression. It should also be noted that the combination therapy (RXR ligand plus a glitazone) caused the differentiation of the liposarcoma, as reported by Tontonoz et al., Proc. Natl Acad. Sci. USA 1997; 94: 237-241, while in the foregoing study, treatment blocked monocyte proliferation without induction of differentiation.

Growth suppression in tumor cells induced by the activation of PPARy thus provides new therapeutic targets on human diseases associated with uncontrolled cell growth. It has been shown that the PPARy ligand can cause growth suppression in the tumor cells with PPARy highly expressed. The effects of PPARy ligands on quelling tumor growth may be dependent upon the endogenous level of PPARy expression. Indeed, if abundantly expressed, monotherapy with PPARy ligand alone may be sufficient to block further tumor growth by induction of differentiation. However, tumors not expressing PPARy may be resilient to PPARy ligand monotherapy unless the receptor is induced. In the THP-1 cell model used above, proliferation was blocked without differentiation; however, other tumor types deficient in PPARy, when subject to this dual therapeutic approach, may instead force growth suppression by differentiation. Although not tested in the current study, induction of PPARy may have application in other forms of cellular proliferation. Perhaps, induction of PPARy plus glitazone therapy prior to and following angioplasty, vessel transplant, or endarectomy will reduce the proliferative responses induced as a consequence of these procedures. The combinations of this invention can thus be used in these cell proliferation diseases.

The above data establish a new interaction between the retinoic acid signaling pathway an the PPAR pathway. This new interaction may have provided new therapeutic targets on the human diseases which are associated with uncontrolled cell growth. As for PPARy function in macrophage differentiation, the data demonstrated PPARy is upregulated during PMA treatment (induced

differentiation) in the absence of RA. Therefore, the induction of PPARy itself in the monocyte is not sufficient to cause differentiation. Since PPAR^y was also upregulated upon the PMA-induced macrophage differentiation, it shows that PPARy plays an important role in the regulation of the macrophage function, especially with respect to uptake of lipoproteins.