CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application Serial No. 61/977,229, filed April 9, 2014, which is incorporated herein by reference in its entirety.

STATEMENT OF GOVERNMENTAL INTEREST

This invention was made with U.S. government support under grant no. NS38377. The U.S. government has certain rights in the invention.

FIELD OF THE INVENTION

The present invention relates to the field of neurodegenerative diseases. More specifically, the present invention provides methods and compositions useful for treating Parkinson's disease.

INCORPORATION -BY-REFERENCE OF MATERIAL SUBMITTED

ELECTRONICALLY

This application contains a sequence listing. It has been submitted electronically via EFS-Web as an ASCII text file entitled "PI 1516-05_ST25.txt." The sequence listing is 7,759 bytes in size, and was created on April 9, 2015. It is hereby incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

Following the identification of pathogenic LRRK2 mutations that lead to PD in 2004 (Paisan-Ruiz et al, 2004; Zimprich et al, 2004), LRRK2 mutations are now known to be the most common genetic cause of PD, accounting for up to 40% of familial cases in certain populations (Martin et al, 2011). LRRK2 mutations result in clinical and pathological features that closely resemble the more common sporadic PD, suggesting that understanding LRRK2-linked disease mechanisms may be a gateway to understanding sporadic PD.

Multiple lines of evidence indicate that LRRK2 kinase activity is key to PD development, particularly the findings that (i) the common G2019S mutation bestows increased kinase activity towards generic kinase substrates (Anand et al, 2009; Covy and Giasson, 2009; Greggio et al, 2006; Luzon-Toro et al., 2007; Smith et al, 2006; West et al, 2007) and (ii) LRRK2 toxicity is kinase-dependent (Deng et al, 2011; Greggio et al, 2006; Lee et al, 2010; MacLeod et al, 2006; Smith et al, 2006). To understand the link between LRRK2 kinase activity and PD development, it is imperative to identify authentic LRRK2 substrates that are linked to neurodegeneration in PD (Tsika and Moore, 2012). SUMMARY OF THE INVENTION

The present invention is based, at least in part, on the discovery that ribosomal protein sl5 (RPS15 or si 5) is an in vivo LRRK2 kinase substrate, phosphorylation of which is required for (i) Parkinson's disease-related phenotypes in G2019S LRRK2 transgenic Drosophila, (ii) G2019S LRRK2 neurotoxicity in human midbrain dopamine neurons and (iii) a toxicity-linked induction of protein synthesis resulting from G2019S LRRK2 expression in Drosophila and human neurons.

Accordingly, in one aspect, the present invention provides methods for identifying LRRK2 modulators. In one embodiment, a method for identifying a leucine-rich repeat serine/threonine-protein kinase 2 (LRRK2) modulator comprises the step of performing a kinase assay using LRRK2 and ribosomal protein S15 (RPS15) in vitro in the presence and absence of a test agent, wherein an agent that inhibits or reduces the phosphorylation of RPS15 by LRRK2 is identified as a LRRK2 modulator. In specific embodiments, the agent is a small molecule, an antibody, polypeptide, a polynucleotide, an aptamer, or an siRNA. In a specific embodiment, the LRRK2 modulator modulates a mutant form of LRRK2. In certain embodiments, the mutant LRRK2 is G2019S or I2020T. In a specific embodiment, the mutant LRRK2 is G2019S. In another aspect, the present invention provides methods for treating a LRRK2-mediated disease. In one embodiment, a method for treating a LRRK2- mediated disease comprises the step of administering to a patient an effective amount of a LRRK2 modulator. In a specific embodiment, the LRRK2-mediated disease is Parkinson's disease.

In another embodiment, a method for identifying a modulator of mutant LRRK2 comprises the step of performing a kinase assay using mutant LRRK2 and RPS15 in vitro in the presence and absence of a test agent, wherein an agent that inhibits or reduces the phosphorylation of RPS 15 by mutant LRRK2 is identified as a LRRK2 modulator. In certain embodiments, the agent is a small molecule, an antibody, polypeptide, a polynucleotide, an aptamer, or an siRNA. In some embodiments, the mutant LRRK2 is G2019S or I2020T. In a specific embodiment, the mutant LRRK2 is G019S. The present invention also provides a method for treating a LRRK2-mediated disease comprising the step of administering to a patient an effective amount of the LRRK2 modulator identified herein. In a specific embodiment, the LRRK2-mediated disease is Parkinson's disease.

The present invention also provides a method for identifying a modulator of mutant G2019S LRRK2 comprising the step of performing a kinase assay using mutant G2019S LRRK2 and RPS15 in vitro in the presence and absence of a test agent, wherein an agent that inhibits or reduces the phosphorylation of RPS15 by mutant G2019S LRRK2 is identified as a LRRK2 modulator. In certain embodiments, the agent is a small molecule, an antibody, polypeptide, a polynucleotide, an aptamer, or an siRNA.

The present invention also provides a method for reducing Parkinson's Disease- related neurotoxicity in a patient comprising the step of administering to the patient an effective amount of an agent that inhibits the phosphorylation of RPS15 by LRRK2. In a specific embodiment, the agent inhibits the phosphorylation of RPS15 at amino acid residue Thrl36.

In another embodiment, a method for treating mutant G2019S LRRK2-induced neurotoxicity in a patient comprises the step of administering to the patient an effective amount of an agent that inhibits phosphorylation of RPS15 by mutant G2019S LRRK2.

In another aspect, the present invention also provides an antibody that specifically binds RPS15 at Thrl36. In certain embodiments, the antibody is a polyclonal antibody. In more specific embodiments, the antibody specifically binds RPS at phosphorylated Thrl36. In particular embodiments, the antibody is designated as Phospho-T136 antibody. In more particular embodiments, the antibody can be used to monitor the phosphorylation status of RPS 15 in order to determine the effectiveness of LRRK2 inhibition in drug development. The antibody can be used in an in vitro or in vivo assay. For example, a potential drug candidate can be screened as described herein and the antibody used to assess the phosphorylation status of RPS 15. The antibody can be contacted with the substrate (e.g., with or without the presence of the drug candidate) under conditions that allow for specific binding of the antibody to antigen. A secondary antibody and detection scheme can be used. Such detection schemes are known to those of ordinary skill in the art.

Mutations in leucine-rich repeat kinase 2 (LRRK2) are a common cause of familial and sporadic Parkinson's disease (PD). Elevated LRRK2 kinase activity and

neurodegeneration are linked, but the phosphosubstrate that connects LRRK2 kinase activity to neurodegeneration is not known. Here, we show that ribosomal protein s 15 is a key pathogenic LRRK2 substrate in Drosophila and human neuron PD models. Phospho- deficient sl5 carrying a threonine 136 to alanine substitution rescues dopamine neuron degeneration and age-related locomotor deficits in G2019S LRRK2 transgenic Drosophila and substantially reduces G2019S LRRK2-mediated neurite loss and cell death in human dopamine and cortical neurons. Remarkably, pathogenic LRRK2 stimulates both cap- dependent and cap-independent mRNA translation, and induces a bulk increase in protein synthesis in Drosophila, which can be prevented by phospho-deficient T136A si 5. These results reveal a novel mechanism of PD pathogenesis linked to elevated LRRK2 kinase activity and aberrant protein synthesis in vivo.

BRIEF DESCRIPTION OF THE FIGURES FIG. 1. Identification of candidate LRRK2 substrates. FIG. 1A. Cartoon of LRRK2 TAP construct with C-terminal streptavidin binding peptide (SBP) and calmodulin binding peptide (CBP) tags and scheme for identifying LRRK2 -interacting phosphoproteins. FIG. IB. LRRK2 TAP co-purified proteins visualized by coomassie and silver stained

polyacrylamide gels. Control is empty vector. FIG. 1C. Phosphorimaging of LRRK2 complex purified by TAP demonstrating that it was kinase active. FIG. ID. IMAC enrichment of phosphoproteins from TAP eluate. FT is flow-through, Elu is eluate. FIG. IE. LRRK2 kinase substrates exhibiting significantly increased phosphorylation (γ- ³² Ρ-ΑΤΡ incorporation) by G2019S and I2020T LRRK2 compared to WT LRRK2 (individual one-way ANOVAs for effect of LRRK2 variant, pO.0001, Bonferroni's post-test, ** p<0.01, *** p<0.001, **** p<0.0001, n=3-7). Coomassie brilliant blue-stained gels are shown. FIG. IF. Endogenous LRRK2 levels in HEK293 cell whole lysates, nuclear (Nuc), mitochondrial (Mito) or ribosomal (Ribo) subcellular fractions. Endogenous LRRK2 is enriched in ribosomal fractions (ANOVA followed by Bonferroni's post-test, *** p < 0.001, n = 3). Data are mean ± SEM. See also FIG. 8 and Table 1 and Table 2.

FIG. 2. Phospho-deficient sl5 protects against LRRK2 toxicity. FIG. 2A. LRRK2 in vitro kinase assay. T136A (TA) sl5 reduces phosphorylation by wild type (WT), D 1994A (DA), G2019S (GS) and I2020T (IT) LRRK2 (two-way ANOVA, pO.0001 for effect of T136A mutation, n=3), and prevents the increase in sl5 phosphorylation via G2019S and I2020T LRRK2 (Bonferroni's post-test, *** p <0.001; ns, not significant). FIG. 2B. T136A (TA) sl5 blocks G2019S LRRK2 toxicity (neurite shortening and cell death) in rat cortical neurons (individual ANOVAs, Bonferroni's post-tests, * p<0.05, *** p<0.001, **** pO.0001, n =5). Arrows indicate neurons lacking neurites, a subset of which are TUNEL- positive (see inset magnifications) as indicated. The vast majority of GFP-positive neurons (-90%) co-labeled for LRRK2 and sl5 when co-transfected (not shown). FIG. 2C. Phospho- mimetic T136D (TD) sl5 mimics G2019S LRRK2 toxicity (individual ANOVAs, Bonferroni post-test, * p<0.05, ** p<0.01, *** pO.001, n =3). Scale bar, 25 μΜ. Data are mean ± SEM. See also FIG. 9.

FIG. 3. Phospho-deficient sl5 protects against G2019S LRRK2 toxicity in human dopamine and cortical neurons. G2019S LRRK2 toxicity (neurite shortening and cell death) in human midbrain dopamine neurons (FIG. 3A) (white arrows) and human cortical neurons (FIG. 3B) is phenocopied by phospho-mimetic T136D (TD) sl5 and rescued by phospho- mutant T136A (TA) sl5 but not wild type s 15. Individual ANOVAs, Bonferroni's post-test, * p<0.05, ** p<0.01, *** pO.001, n = 4). Scale bar, 25 μΜ. Data are mean ± SEM. See also FIG. 10.

FIG. 4. Phosphorylation of sl5 by pathogenic LRRK2 variants and block by LRRK2- ΓΝ-1. FIG. 4A. Kinetics of LRRK2 or G2019S LRRK2 initial enzyme velocity at various sl5 concentrations for derivation of the Michaelis-Menten constant, K _m . Data are mean ± SEM, n =3. Silver stained gels are shown. FIG. 4B. Phospho-s 15 levels following co- transfection of HEK293 cells with V5-sl5 and LRRK2. Densitometry revealed a significant effect of G2019S and I2020T LRRK2 variants on phospho-s 15 levels (ANOVA followed by Bonferroni post-test, * p<0.05, n =5). FIG. 4C. LRRK2-IN-1 blocked V5-s l5

phosphorylation by G2019S LRRK2 but not a drug-resistant variant, G2019S/A2016T LRRK2 in co-transfected HEK293 cells (ANOVA, Bonferroni's post-test, * p<0.05, ** p<0.01, n =3). FIG. 4D. Endogenous LRRK2 and s 15 in human cortical neurons exhibit punctate immunostaining, predominantly in the perinuclear region where they colocalize. Scale bars, 10 μΜ. FIG. 4E. Phospho-sl5 is increased in ribosomal fractions from G2019S LRRK2 human post-mortem brains (Student's t-test, ** p<0.01). Whole lysates were run separately (see FIG. 1 1) due to gel space constraints. Data are mean ± SEM. See also FIG. 11.

FIG. 5. Rescue of dopamine neuron degeneration and locomotor dysfunction in aged G2019S LRRK2 Drosophila by phospho-mutant sl5. FIG. 5A. Phospho-sl5 is reduced in dLRRK ^e0368 ° (dLRRK null) homozygotes compared to isogenic w ¹¹¹⁸ controls (Student's t- test, pO.001, n = 4 groups of 100 fly heads/genotype). L, whole lysates; R, ribosomal fractions (FIG. 5B), G2019S LRRK2 transgenic flies (Ddc-Gal4; UAS-G2019S-LRRK2) exhibit increased phospho-s 15 (ANOVA, Bonferroni's post-test, ** p<0.01; *** p <0.001; ns, not significant, n = 4 groups of 100 fly heads/genotype). L, whole lysates; R, ribosomal fractions. LRRK2 exhibits an additional high molecular weight band (likely SDS-insoluble LRRK2). FIG. 5C. Aged flies expressing G2019S LRRK2 exhibit a significant locomotor deficit in negative geotaxis assays, which is rescued by T136A (TA) s 15 expression

(ANOVA followed by Bonferroni's post-test, * p<0.05, ** p<0.01, n =30-40 flies).

Genotypes are Ddc-Gal4/+; +/+ (Control), UAS-sl5/+; +/+ (s l5), UAS-T136A si 5/+; +/+ (TA si 5), Ddc-Gal4/+; UAS-LRRK2/+ (LRRK2), Ddc-Gal4/+; UAS-G2019S-LRRK2/+ (G2019S), Ddc-Gal4/UAS-sl5; UAS-G2019S-LRRK2/+ (GS/sl5) and Ddc-Gal4/UAS-Tl 36A si 5; UAS-G2019S-LRRK2/+ (GS/TA si 5). FIG. 5D. Dopamine neuron loss in aged G2019S LRRK2 flies is rescued by T136A sl5 co-expression. Confocal projection images through the posterior fly brain show five major dopamine neuron clusters (PPM1, PPM2, PPM3, PPL1, PPL2). Scale bar, 60 μΜ. For quantitation, individual ANOVAs followed by Bonferroni's post-test, * p<0.05, ** p<0.01 *** pO.001, n =10 fly brains per genotype. Genotypes are as in (FIG. 5C). Data are mean ± SEM. See also FIG. 12.

FIG. 6. G2019S LRRK2 stimulates cap-dependent and cap-independent translation. FIG. 6A. Bicistronic reporter assay for assessing effects of LRRK2 on cap-dependent and cap-independent translation. FIG. 6B. G2019S LRRK2 stimulates cap-dependent (FLAG- GFP) and cap-independent (c-Myc-GFP) bicistronic reporter translation in human neuroblastoma (SH-SY5Y) cells (individual two-way ANOVAs, effect of LRRK2 dose, p < 0.0075, and genotype, p < 0.002, n =3), in a kinase-dependent manner vs. G2019S/D1994A (GS/DA) (Bonferroni's post-tests, * p<0.05, ** p<0.01, *** pO.001, **** pO.0001, n =3). FIG. 6C. V5-s l5 stimulates cap-dependent and cap-independent reporter translation which is reduced by T136A and potentiated by T136D mutations (individual two-way ANOVAs, effect of sl5 variant, p < 0.0073, effect of dose, p < 0.0099, n=3). FIG. 6D. G2019S LRRK2-stimulated cap-dependent (c.d.) and cap-independent (c.i.) reporter translation is attenuated by V5-T136A sl5 (individual ANOVAs, p < 0.0014, Bonferroni's post-test, * p <0.05, ** p<0.01, n =8) while bicistronic reporter mRNA was not significantly different (ANOVA, ns, n=8). FIG. 6E. In human cortical neurons, G2019S LRRK2 -stimulated reporter expression, toxicity and cell death are rescued by T136A sl5 co-expression

(individual ANOVA, Bonferroni's post-test, * p <0.05, *** p <0.001, n =4). Scale bar, 25 μΜ. Data are mean ± SEM. See also FIG. 13.

FIG. 7. Elevated protein synthesis in G2019S LRRK2 transgenic flies is blocked by

T136A sl5. FIG. 7A. De novo protein synthesis, measured by ³⁵ S-met/cys incorporation is significantly increased in protein precipitates from G2019S LRRK2 transgenic fly heads, which is blocked by T136A s 15 co-expression (* p <0.05, n = 5 groups of 50

heads/genotype). Genotypes are Da-Gal4 alone (Control), Da-Gal4; UAS-LRRK2 (WT), DaGaW UAS-G2019S/D1994A LRRK2 (GS/DA), Da-GaU; UAS-G2019S LRRK2 (G2019S), Da-Gal4/UAS-T136A si 5; UAS-G2019S LRRK2 (GS+TA si 5) (FIG. 7B), autoradiography from lysates reveals a widespread increase in ³⁵ S-met/cys-labeled protein abundance.

Ponceau staining for total protein. FIG. 7C. Fractions collected from fly head polysome profiles and used for RT-PCR of translating mRNA indicates a G2019S LRRK2 -mediated shift in tubulin and actin 5C to heavy polysome fractions, prevented by T136A sl5 (two-way ANOVA, Bonferroni's post-test, * p <0.05, ** p <0.01, *** p <0.001, n =3 groups of 100 fly heads/genotype). FIG. 7D. Confocal z-stack projection images and quantitation of dopamine neurons in Drosophila brains. Anisomycin (10 μΜ) treatment to food throughout adulthood rescued dopamine neuron loss in aged G2019S transgenic flies (individual ANOVAs, Bonferroni's post-test, * p<0.05, ** p<0.01, n =8-10 fly heads per genotype). FIG. 7E.

Anisomycin treatment prevented age-related locomotor deficits in G2019S flies (ANOVA, Bonferroni's post-test, * p<0.05, ** p<0.01, n =25 flies per genotype). Genotypes for FIG. 7D and FIG. 7E are as in FIG. 7A. Data are mean ± SEM. See also FIG. 14.

FIG. 8. Identification of LRRK2-interacting phosphoproteins and kinase substrates, related to FIG. 1. FIG. 8A. Cytoscape network analysis of LRRK2-interacting

phosphoproteins reveals four major functional groups as shown. Each group consists of nodes (molecular functions) connected to indicate functional relationships between nodes, and each group is headed by its statistically most represented function. Ungrouped nodes are white and not connected to other nodes. FIG. 8B. Scheme for screening LRRK2-interacting phosphoproteins in LRRK2 kinase assays. FIG. 8C. Autoradiograms, coomassie stained polyacrylamide gels and quantitation of LRRK2 substrate ³² P incorporation. Phosphorylation was decreased via D1994A (kinase-dead) and increased by G2019S or I2020T LRRK2 for some substrates as indicated (individual ANOVAs followed by Bonferroni's post-test, * p < 0.05, ** p < 0.01, *** p < 0.001, n = 3). Data are mean ± SEM.

FIG. 9. LRRK2 substrate phosphorylation sites and role in pathogenic LRRK2 toxicity, related to FIG. 2. Phospho-site spectra for FIG. 9A si 1 and FIG. 9B s l5 threonine phosphorylation sites (pT) identified following incubation with WT LRRK2 are shown. No phosphorylation sites were detected following D1994A LRRK2 incubation with either substrate (not shown). Sequence coverage by tandem mass spectrometry is indicated by underlined text and phosphorylation sites are indicated by arrows. FIG. 9C. A triple mutation of threonines 28, 46 and 54 (TM s i 1) eliminates LRRK2 phosphorylation. Effect of TM si 1 expression on G2019S LRRK2-induced toxicity (individual ANOVAs, Bonferroni's post-test *** pO.001, n =3). Scale bar, 25 μΜ. Data are mean ± SEM. FIG. 9D. Effects of T136A(TA) s 15 on I2020T or R1441C LRRK2 toxicity assessed in rat cortical neurons. Arrows indicate neurons lacking neurites, a subset of which are TUNEL-positive (see inset magnifications) as indicated. T136A sl5 protects against I2020T LRRK2 neurite toxicity and cell death (individual ANOVAs, Bonferroni post-test, * p<0.05, ** p<0.01, *** pO.001, n =3). Data are mean ± SEM.

FIG. 10. Characterization of ES cell-derived human cortical and midbrain dopamine neurons and Phospho-T 136 antibody validation, related to FIG. 3. FIG. 10A. Human dopamine neurons are immunopositive for tyrosine hydroxylase (TH), the midbrain marker FOXA2 and neuronal marker TUJ1 at 32 d of differentiation. FIG. 10B. Human cortical neurons are immunopositive for MAP2, cortical neuron layer markers as indicated and synaptophysin at 60 d of differentiation. Scale bar, 25 μΜ except synaptophysin, 5 μΜ. FIG. IOC. T136 phospho-sl5 is significantly increased by G2019S LRRK2 expression in human cortical neurons (ANOVA followed by Bonferroni's post-test, * p<0.05, n =3). FIG. 10D. ELISA showing T136 Phospho-sl5 primary antibody dilution curve for binding to T136 Phospho-s 15 or sl5 oligopeptide. FIG. 10E. Dot blot showing binding of T 136 Phospho-s 15 antibody to T136 Phospho-sl5 or sl5 oligopeptide. FIG. 10F. In vitro LRRK2 kinase assay and immunoblot showing specific antibody binding to T 136 Phospho-s 15 following LRRK2-mediated sl5 phosphorylation. FIG. 10G. s 15 knock-down (yellow arrowheads) partially rescues G2019S LRRK2 toxicity (neurite shortening and cell death) in human cortical neurons (individual ANOVAs, Bonferroni's post-test, * p<0.05, ** p<0.01, *** p<0.001). Scale bar, 25 μΜ. LRRK2 levels are not affected by s l5 knock-down. FIG. 10H. LRRK2 toxicity in rat cortical neurons mediated by low (125 pM plasmid) or high (0.4 nM plasmid) levels of LRRK2. Scale bar, 20 μΜ. Quantitation of the data revealed that increasing wild-type LRRK2 expression increases neuronal injury and cell death (ANOVA, Bonferroni's post-test, ** p<0.01, *** p<0.001, n =3). The vast majority of GFP-positive neurons (-90%) co-labeled for LRRK2 when co-transfected (not shown). FIG. 101. P-s l5 levels in rat neuron ribosomal fractions following LRRK2 overexpression (* p<0.05, ** p<0.01, n =3). Data are mean ± SEM.

FIG. 1 1. Block of s 15 phosphorylation block by LRRK2 kinase inhibitors, related to FIG. 4. FIG. 11 A. The LRRK2 kinase inhibitor LRRK2-TN-1 inhibited autophosphorylation of recombinant LRRK2 and LRRK2-mediated sl5 phosphorylation. IC5 ₀ values derived from the dose-response curve are indicated. n=3. FIG. 1 IB. The LRRK2 kinase inhibitor CZC-25146 blocked recombinant LRRK2-mediated sl5 phosphorylation and inhibited V5- sl5 phosphorylation via G2019S LRRK2 in co-transfected HEK293 cells (ANOVA, Bonferroni's post-test, * p<0.05, n =3). FIG. 11C. Colocalization controls for LRRK2 and sl5 interaction show absence of spectral cross-talk between red and green channels for confocal microscopy conditions used. Overexpressed G2019S LRRK2 and s 15 exhibit perinuclear colocalization. Scale bars, 10 μΜ. Scale bars, 10 μΜ. FIG. 1 ID.

Immunoprecipitated V5-sl5 (N-terminal tag) co-immunoprecipitated full-length FLAG tagged LRRK2 and its WD40 domain. Data are representative of three independent experiments. FIG. HE. Co-immunoprecipitation of endogenous LRRK2 and s 15 from human HEK293 cells. Results are representative of three independent experiments. FIG. 1 IF. LRRK2 expression in post-mortem brain whole lysates. FIG. 11 G. Perinuclear colocalization of endogenous s 15 and dLRRK in Drosophila S2 cells. Scale bars, 10 μΜ. Data are mean ± SEM.

FIG. 12. sl5 expression and dopamine neuron viability in transgenic Drosophila,

Related to Figure 5. FIG. 12A. Immunoblot confirmation of UAS-sl5 and UAS-T136A si 5 expression via da-Gal4 in male fly heads. Similar expression levels were observed in females. FIG. 12B. No effect of sl5 or T136A sl5 co-expression on G2019S LRRK2 expression via Ddc-Gal4. FIG. 12C. No significant effect of G2019S LRRK2, sl5 or T136A sl5 expression via Ddc-Gal4 on dopamine neurons in the major posterior clusters (PPM 1/2, PPM3, PPL1, PPL2) or anterior PAL cluster in 3 week-old flies (individual ANOVAs for each dopamine neuron cluster visualized by TH immunostaining). Scale bar, 60 μΜ. FIG. 12D. Negative geotaxis in 2-week-old LRRK2 and sl5 transgenic flies. FIG. 12E. No significant effect of sl5 or T136A sl5 expression alone on negative geotaxis ability or (FIG. 12F) dopamine neurons numbers. Data are mean ± SEM.

FIG. 13. Bicistronic reporter expression in human cortical neurons and neuroblastoma cells, related to FIG. 6. FIG. 13 A. Reporter mRNA levels at the maximum amount of LRRK2 and sl5 plasmid transfected in SH-SY5Y cells in FIGS. 6B and 6C. There were no significant effects of LRRK2 or sl5 variant expression on reporter mRNA levels (individual ANOVAs, n =3). FIG. 13B. sl5 knock-down via shRNA in human SH-SY5Y cells attenuates G2019S LRRK2-induced bicistronic reporter expression whereas expressing non- targeting shRNA to mouse sl5 did not (individual ANOVAs, Bonferroni's post-test, * p<0.05, ** p<0.01, *** p<0.001). FIG. 13C. No effect of dicer silencing and no modulation of G2019S LRRK2 effect by hAgo2 overexpression on cap-dependent and cap-independent reporter translation in SH-SY5Y cells. Scr is scrambled control siRNA. FIG. 13D. 4E-BP1 overexpression did not block G2019S LRRK2-induced cap-dependent (c.d.) or cap- independent (c.i.) translation. FIG. 13E. 4E-BP 1 phosphorylation was unaffected by G2019S LRRK2 expression in SH-SY5Y cells. FIG. 13F. Phospho-4EBP 1 (Thr 37/46) is not increased in G2019S transgenic fly heads. FIG. 13G. Reduced eIF4E expression in

0V235 0 ^ f

Drosophila by two independent mutant alleles, 4E and 4E . FIG. 13H. Locomotor deficits seen in aged (5 weeks) G2019S transgenic flies are not significantly affected by reduced 4E expression. FIG. 131. Loss of dopamine neurons observed in aged G2019S transgenic flies is not affected by reduced 4E expression. FIG. 13 J. Neuronal toxicity and cell death were significantly higher in reporter-positive neurons compared to surrounding reporter-negative neurons (MAP2 positive). Individual two-way ANOVAs, *** p < 0.001, **** p < 0.0001, n = 4. Scale bar, 25 μΜ. Data are mean ± SEM.

FIG. 14. Ribosomal run-off following harringtonine treatment is unaffected by G2019S LRRK2, related to FIG. 7. FIG. 14A. Schematic of harringtonine and

cycloheximide treatment. FIG. 14B. Polysome profiles generated at indicated time points following harringtonine treatment of SH-SY5Y cells demonstrate progressive ribosomal runoff. FIG. 14C. No significant difference of ribosomal run-off, quantified as polysome area under curve (AUC) at each time point between cells transfected with vector,

G2019S/D1994A LRRK2 or G2019S LRRK2 (two-way ANOVA, Bonferroni's post-test, n =3) (FIG. 14D), no significant difference in ribosomal run-off, measured by increase in 35S- met/cys incorporation following harringtonine treatment (two-way ANOVA, Bonferroni's post-test, n =3). FIG. 14E. Anisomycin treatment had no effect on LRRK2 expression (Student's t-test, ns, n=3). FIG. 14F. Anisomycin treatment had no effect on P-s l5 levels in fly head whole lysates (Lys) or ribosomal fractions (Ribo). Genotypes for FIG. 14E and FIG. 14F are Da-Gal4/+; +/+ (Control) and Da-Gal4/+ ; G2019S-LRRK2/+ (G2019S). FIG. 14G. Anisomycin treatment reduced the elevated protein synthesis in G2019S transgenic flies (ANOVA, Bonferroni's post-test, * p<0.05, n =3). Data are mean ± SEM.

DETAILED DESCRIPTION OF THE INVENTION

It is understood that the present invention is not limited to the particular methods and components, etc., described herein, as these may vary. It is also to be understood that the terminology used herein is used for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include the plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a "protein" is a reference to one or more proteins, and includes equivalents thereof known to those skilled in the art and so forth. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Specific methods, devices, and materials are described, although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.

All publications cited herein are hereby incorporated by reference including all journal articles, books, manuals, published patent applications, and issued patents. In addition, the meaning of certain terms and phrases employed in the specification, examples, and appended claims are provided. The definitions are not meant to be limiting in nature and serve to provide a clearer understanding of certain aspects of the present invention.

LRRK2 is a large multidomain protein with several protein-protein interaction domains and a catalytic core containing GTPase, COR (C-terminal of ROC) and kinase domains where most PD-linked mutations are found. It is likely that its physiologic and pathophysiologic functions are mediated through protein-protein interactions and/or phosphorylation of LRRK2 substrates (Cookson, 2010). A number of candidate LRRK2 substrates have been identified. LRRK2 kinase activity is part of an endophilin A

phosphorylation cycle that promotes efficient synaptic vesicle endocytosis at the

neuromuscular junction (Matta et al, 2012). Phosphorylation of ezrin/radixin/moesin by LRRK2 promotes the rearrangement of the actin cytoskeleton in neuronal morphogenesis (Parisiadou et al, 2009). LRRK2 phosphorylation of eukaryotic initiation factor 4E (eIF4E)- binding protein (4E-BP) has been suggested to couple increased LRRK2 kinase activity to aberrant translation of a small number of mRNAs through 4E-BP-dependent perturbation of microRNA activity (Gehrke et al, 2010; Imai et al, 2008). However, while this study raises the possibility that LRRK2 may affect translation at some level, a mechanistic link involving phospho-4E-BP is lacking as there was no direct demonstration that LRRK2 phosphorylation of 4E-BP mediates altered translation of these mRNAs. Moreover, recent studies suggest that 4E-BP may not be an important in vivo LRRK2 substrate (Kumar et al, 2010; Trancikova et al, 2012) raising additional doubt on the role of 4E-BP as a kinase substrate important in LRRK2 toxicity. Thus, how elevated LRRK2 kinase activity is coupled to aberrant mRNA translation and neurodegeneration in PD remains to be clarified.

In order to understand the connection between LRRK2 kinase activity and neurotoxicity, candidate LRRK2 substrates were identified through LRRK2 tandem affinity purification and in vitro kinase screening of LRRK2-interacting phosphoproteins. We find that ribosomal proteins are major LRRK2 interactors and LRRK2 kinase targets, and that LRRK2 is markedly enriched in the ribosomal subcellular fraction. Blocking phosphorylation of the small ribosomal subunit protein sl5 rescues LRRK2 neurotoxicity in human dopamine neurons and Drosophila PD models. We demonstrate that pathogenic LRRK2 induces an increase in bulk protein synthesis in flies, which is blocked by phospho- deficient si 5. Moreover, the global protein synthesis inhibitor anisomycin rescues the locomotor deficits and dopamine neuron loss in aged G2019S LRRK2 transgenic Drosophila. Our findings identify s 15 as a key pathogenic LRRK2 substrate that links elevated LRRK2 kinase activity to Parkinson's disease pathogenesis via altered translation.

I. Definitions

As used herein, the term "modulate" indicates the ability to control or influence directly or indirectly, and by way of non-limiting examples, can alternatively mean inhibit or stimulate, agonize or antagonize, hinder or promote, and strengthen or weaken. Thus, the term "LRRK2 modulator" refers to an agent that modulates LRRK2. In certain

embodiments, the modulator modulates mutant LRRK2 including, but not limited to, R1441C, G2091 S and/or I2020T LRRK2. In particular embodiments, a LRRK2 modulator refers to an agent that modulates the phosphorylation of RPS 15 by LRRK2, specifically, mutant LRRK2. Modulators may be organic or inorganic, small to large molecular weight individual compounds, mixtures and combinatorial libraries of inhibitors, agonists, antagonists, and biopolymers such as peptides, nucleic acids, or oligonucleotides. A modulator may be a natural product or a naturally-occurring small molecule organic compound. In particular, a modulator may be a carbohydrate; monosaccharide;

oligosaccharide; polysaccharide; amino acid; peptide; oligopeptide; polypeptide; protein; receptor; nucleic acid; nucleoside; nucleotide; oligonucleotide; polynucleotide including DNA and DNA fragments, RNA and RNA fragments and the like; lipid; retinoid; steroid; glycopeptides; glycoprotein; proteoglycan and the like; and synthetic analogues or derivatives thereof, including peptidomimetics, small molecule organic compounds and the like, and mixtures thereof. A modulator identified according to the invention is preferably useful in the treatment of a disease disclosed herein.

As used herein, an "antagonist" is a type of modulator and the term refers to an agent that binds a target (e.g., a protein) and can inhibit a one or more functions of the target. For example, an antagonist of a protein can bind the protein and inhibit the binding of a natural or cognate ligand to the protein and/or inhibit signal transduction mediated through the protein. An "agonist" is a type of modulator and refers to an agent that binds a target and can activate one or more functions of the target. For example, an agonist of a protein can bind the protein and activate the protein in the absence of its natural or cognate ligand.

As used herein, the term "antibody" is used in reference to any immunoglobulin molecule that reacts with a specific antigen. It is intended that the term encompass any immunoglobulin (e.g., IgG, IgM, IgA, IgE, IgD, etc.) obtained from any source (e.g., humans, rodents, non-human primates, caprines, bovines, equines, ovines, etc.). Specific

types/examples of antibodies include polyclonal, monoclonal, humanized, chimeric, human, or otherwise-human-suitable antibodies. "Antibodies" also includes any fragment or derivative of any of the herein described antibodies. In other embodiments, antibodies may be raised against LRRK2 and used as LRRK2 modulators. In more specific embodiments, an antibody modulator modules that phosphorylation of RPS15 by LRRK2. In more particular embodiments, LRRK2 is mutant LRRK2.

The terms "specifically binds to," "specific for," and related grammatical variants refer to that binding which occurs between such paired species as antibody/antigen, enzyme/substrate, receptor/agonist, and lectin/carbohydrate which may be mediated by covalent or non-covalent interactions or a combination of covalent and non-covalent interactions. When the interaction of the two species produces a non-covalently bound complex, the binding which occurs is typically electrostatic, hydrogen-bonding, or the result of lipophilic interactions. Accordingly, "specific binding" occurs between a paired species where there is interaction between the two which produces a bound complex having the characteristics of an antibody/antigen or enzyme/substrate interaction. In particular, the specific binding is characterized by the binding of one member of a pair to a particular species and to no other species within the family of compounds to which the corresponding member of the binding member belongs. Thus, for example, an antibody typically binds to a single epitope and to no other epitope within the family of proteins. In some embodiments, specific binding between an antigen and an antibody will have a binding affinity of at least 10 ^~6 M. In other embodiments, the antigen and antibody will bind with affinities of at least 10 ^~7 M, 10 ^~8 M to 10 ^~9 M, 10 ^"10 M, 10 ¹¹ M, or 10 ^~12 M.

Optional" or "optionally" means that the subsequently described event or

circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

The terms "subject" and "patient" are used interchangeably herein, and are intended to include organisms, e.g., eukaryotes, which are suffering from or afflicted with a disease, disorder or condition associated with LRRK2. Examples of subjects or patients include mammals, e.g., humans, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. In one aspect, the subject is a mammal such as a primate or a human. In certain embodiments, the subject or patient is a human, e.g., a human suffering from, at risk of suffering from, or potentially capable of suffering from Parkinson's disease and other diseases of the nervous system (e.g., a LRRK2 -related disease, disorder or condition).

As used herein, the term "effective," means adequate to accomplish a desired, expected, or intended result. More particularly, a "therapeutically effective amount" as provided herein refers to an amount of a LRRK2 modulator of the present invention, either alone or in combination with another therapeutic agent, necessary to provide the desired therapeutic effect, e.g., an amount that is effective to prevent, alleviate, or ameliorate symptoms of disease or prolong the survival of the subject being treated. In a specific embodiment, the term "therapeutically effective amount" as provided herein refers to an amount of a LRRK2 modulator, necessary to provide the desired therapeutic effect, e.g., an amount that is effective to prevent, alleviate, or ameliorate symptoms of disease or prolong the survival of the subject being treated. As would be appreciated by one of ordinary skill in the art, the exact amount required will vary from subject to subject, depending on age, general condition of the subject, the severity of the condition being treated, the particular compound and/or composition administered, and the like. An appropriate "therapeutically effective amount" in any individual case can be determined by one of ordinary skill in the art by reference to the pertinent texts and literature and/or by using routine experimentation.

As used herein, the terms "treatment," "treating," and the like, refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse affect attributable to the disease. "Treatment," as used herein, covers any treatment of a disease in a subject, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, e.g., causing regression of the disease, e.g., to completely or partially remove symptoms of the disease.

The terms "LRRK2 -related disease, disorder or condition" or "LRRK2-mediated disease, disorder or condition," and the like mean diseases, disorders or conditions associated with aberrant LRRK2 signaling, including but not limited to neurodegenerative diseases such as Parkinson's disease. In specific embodiments, a LRRK2 -related disease refers to a disease mediated by the phosphorylation of RPS15 by mutant LRRK2.

II. RPS15 and LRRK2 Polynucleotides, Polypeptides and Expression Thereof

In particular embodiments, RPS15 and/or LRRK2 are human. In other embodiments,

RPS15 and/or LRRK2 and is non-human (e.g., primate, rodent, canine, or feline). There are a variety of sequences that are disclosed on GenBank, at www.pubmed.gov, and these sequences and others herein are incorporated by reference in their entireties as are individual subsequences or fragments contained therein. As used herein, RPS15 refers to ribosomal protein S 15, in particular, human RPS15. For example, the nucleotide and amino acid sequences of the human RPS15 can be found at GenBank Accession Nos. BC141832 and AAI41833, respectively, respectively, and are incorporated herein by reference. LRRK2 refers to leucine-rich repeat serine/threonine-protein kinase 2, in particular, human LRRK2. For example, the nucleotide and amino acid sequences of the human LRRk2 can be found at Gene ID No. 120982 and Accession No. NP_940980, respectively, and are incorporated herein by reference. Thus provided are the nucleotide sequences of RPS15 and LRRK2 as well as nucleotide sequences at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more, identical to the nucleotide sequence of the aforementioned GenBank Accession Numbers. Also provided are amino acid sequences of RPS15 and LRRK2 as well as amino acid sequence at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or more, identical to the sequences of the aforementioned GenBank Accession Numbers.

As with all peptides, polypeptides, and proteins, including fragments thereof, it is understood that additional modifications in the amino acid sequence of the RPS15 and/or LRRK2 polypeptides can occur that do not alter the nature or function of the peptides, polypeptides, or proteins. Such modifications include conservative amino acids substitutions.

The polypeptides described herein can be further modified and varied so long as the desired function is maintained. It is understood that one way to define any known modifications and derivatives or those that might arise, of the disclosed genes and proteins herein is through defining the modifications and derivatives in terms of identity to specific known sequences. Specifically disclosed are polypeptides which have at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, and 99 percent identity to RPS15 and variants provided herein. Those of skill in the art readily understand how to determine the identity of two polypeptides. For example, the identity can be calculated after aligning the two sequences so that the identity is at its highest level.

Another way of calculating identity can be performed by published algorithms.

Optimal alignment of sequences for comparison may be conducted by the local identity algorithm of Smith and Waterman, Adv. Appl. Math 2:482 (1981), by the identity alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by inspection.

The same types of identity can be obtained for nucleic acids by, for example, the algorithms disclosed in Zuker, Science 244:48-52 (1989), Jaeger et al, Proc. Natl. Acad. Sci. USA 86:7706-7710 (1989), Jaeger et al., Methods Enzymol. 183:281-306 (1989), which are herein incorporated by reference for at least material related to nucleic acid alignment. It is understood that any of the methods typically can be used and that in certain instances the results of these various methods may differ, but the skilled artisan understands if identity is found with at least one of these methods, the sequences would be said to have the stated identity and to be disclosed herein.

Protein modifications include amino acid sequence modifications. Modifications in amino acid sequence may arise naturally as allelic variations (e.g., due to genetic

polymorphism) or may be produced by human intervention (e.g., by mutagenesis of cloned DNA sequences), such as induced point, deletion, insertion, and substitution mutants. These modifications can result in changes in the amino acid sequence, provide silent mutations, modify a restriction site, or provide other specific mutations. Post-translational modifications can include variations in the type or amount of carbohydrate moieties of the protein core or any fragment or derivative thereof. Amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional, or deletional modifications.

Insertions include amino and/or terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues.

Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from two to six residues are deleted at any one site within the protein molecule. Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Deletions or insertions preferably are made in adjacent pairs, i.e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional modifications are those in which at least one residue has been removed and a different residue inserted in its place.

Modifications, including the specific amino acid substitutions, are made by known methods. By way of example, modifications are made by site-specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the modification, and thereafter expressing the DNA in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example Ml 3 primer mutagenesis and PCR mutagenesis.

Nucleic acids that encode the polypeptide sequences, variants, and fragments thereof are disclosed. These sequences include all degenerate sequences related to a specific protein sequence, i.e., all nucleic acids having a sequence that encodes one particular protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences. Thus, while each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequences.

Isolated nucleic acid molecules can be produced by standard techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain an isolated nucleic acid containing a nucleotide sequence described herein. Various PCR methods are described, for example, in PCR Primer: A Laboratory Manual, Dieffenbach and Dveksler, eds., Cold Spring Harbor Laboratory Press, 1995. Various PCR strategies also are available by which the site-specific nucleotide sequence modifications described herein can be introduced into a template nucleic acid. Optionally, isolated nucleic acids are chemically synthesized, either as a single nucleic acid molecule (e.g., using automated DNA synthesis in the 3' to 5' direction using phosphoramidite technology) or as a series of oligonucleotides. For example, one or more pairs of long oligonucleotides (e.g., >100 nucleotides) can be synthesized that contain the desired sequence, with each pair containing a short segment of complementarity (e.g., about 15 nucleotides) such that a duplex is formed when the oligonucleotide pair is annealed. DNA polymerase is used to extend the oligonucleotides, resulting in a single, double-stranded nucleic acid molecule per oligonucleotide pair, which then can be ligated into a vector. Isolated nucleic acids disclosed herein also can be obtained by mutagenesis of, e.g., a naturally occurring DNA.

Nucleic acids that encode the polypeptide sequences, variants, and fragments thereof can be cloned into a vector for delivery into the cell. There are a number of compositions and methods which can be used to deliver nucleic acids to cells, either in vitro or in vivo via, for example, expression vectors. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based delivery systems. Such methods are well known and readily adaptable for use with the compositions and methods described herein.

As used herein, plasmid or viral vectors transport the disclosed nucleic acids into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered. Viral vectors are, for example, Adenovirus, Adeno-associated virus, Herpes virus, Vaccinia virus, Polio virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviral vectors, in general, are described by Verma, I. M., Retroviral vectors for gene transfer, in

Microbiology- 1985, American Society for Microbiology, Washington, pp. 229-232 (1985), which is incorporated by reference herein for the vectors and methods of making them. The construction of replication-defective adenoviruses has been described (Berkner et al, J.

Virology 61 : 1213-20 (1987); Massie et al, Mol. Cell. Biol. 6:2872-83 (1986); Haj-Ahmad et al, J. Virology 57:267-74 (1986); Davidson et al, J. Virology 61 : 1226-39 (1987); Zhang et al, BioTechniques 15:868-72 (1993)). The benefit of the use of these viruses as vectors is that they are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell, but are unable to form new infectious viral particles. Recombinant adenoviruses have been shown to achieve high efficiency after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites. Other useful systems include, for example, replicating and host- restricted non-replicating vaccinia virus vectors.

Also provided are expression vectors comprising the disclosed nucleic acids, wherein the nucleic acids are operably linked to an expression control sequence. Suitable vector backbones include, for example, those routinely used in the art such as plasmids, viruses, artificial chromosomes, BACs, YACs, or PACs. Suitable expression vectors include, without limitation, plasmids and viral vectors derived from, for example, bacteriophage, baculoviruses, and retroviruses. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, Wis.), Clontech (Palo Alto, Calif), Stratagene (La Jolla, Calif), and Invitrogen/Life Technologies (Carlsbad, Calif). Vectors typically contain one or more regulatory regions. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5' and 3 ' untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, and introns.

Particular promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g., beta actin promoter or EF1 promoter, or from hybrid or chimeric promoters (e.g., cytomegalovirus promoter fused to the beta actin promoter). The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication. The immediate early promoter of the human cytomegalovirus is conveniently obtained as a Hindlll E restriction fragment. Of course, promoters from the host cell or related species also are useful herein.

Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5 ' or 3 ' to the transcription unit.

Furthermore, enhancers can be within an intron as well as within the coding sequence itself. They are usually between 10 and 300 base pairs in length, and they function in cis.

Enhancers usually function to increase transcription from nearby promoters. Enhancers can also contain response elements that mediate the regulation of transcription. While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression. Examples of enhancers include the SV40 enhancer on the late side of the replication origin, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

Optionally, the promoter and/or enhancer region can act as a constitutive promoter and/or enhancer to maximize expression of the region of the transcription unit to be transcribed. In certain constructs the promoter and/or enhancer region be active in all eukaryotic cell types, even if it is only expressed in a particular type of cell at a particular time. A particular promoter of this type is the CMV promoter. Other promoters include SV40 promoters, cytomegalovirus (plus a linked intron sequence), beta-actin, elongation factor- 1 (EF-1) and retroviral vector LTR. Optionally the promoter and/or enhancer region can be inducible (e.g., chemically or physically regulated). A chemically regulated promoter and/or enhancer can, for example, be regulated by the presence of alcohol, tetracycline, a steroid, or a metal. A physically regulated promoter and/or enhancer can, for example, be regulated by environmental factors, such as temperature and light.

The vectors also can include, for example, origins of replication, scaffold attachment regions (SARs), and/or markers. A marker gene can confer a selectable phenotype, e.g., antibiotic resistance, on a cell. This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed. Examples of marker genes include the E. coli lacZ gene, which encodes B galactosidase, green fluorescent protein (GFP), and luciferase. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hygromycin, blasticidin, and puromycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure.

In certain embodiments, RPS15 and/or LRRK2 is/are linked to an expression tag. An expression vector can include a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as glutathione S-transferase (GST), polyhistidine (His), myc, hemagglutinin (HA), V5, IgG, T7, or FLAG™ tag (Kodak, New Haven, Conn.) sequences typically are expressed as a fusion with the encoded polypeptide. For example, RPS15 can be linked to the IgG tag. Such tags can be inserted anywhere within the polypeptide, including at either the carboxyl or amino terminus. Optionally the expression tag can be a fluorescent protein tag. Fluorescent proteins can, for example, include such proteins as green fluorescent protein (GFP), red fluorescent protein (RFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and blue fluorescent protein (BFP). Fluorescent proteins can be inserted anywhere within the polypeptide, but are most preferably inserted at either the carboxyl or amino terminus.

III. LRRK2 Modulators

The present invention provides LRRK2 modulators. In certain embodiments, a LRRK2 modulator modulates the interaction between LRRK2 and RPS 15. More specifically, a LRRK2 modulator inhibits the phosphorylation of RPS 15 by LRRK2. In particular embodiments, the modulator inhibits phosphorylation of RPS by mutant LRRK2 which can include R1441C, G2019S, and I2020T. The present invention contemplates that the modulator can bind LRRK2 (wildtype and/or mutant) or RPS15 to modulate

phosphorylation of RPS 15 by LRRK2.

In certain embodiments, the LRRK2 modulator is selected from the group consisting of a small molecule, a polypeptide, a nucleic acid molecule, a peptidomimetic, or a combination thereof. In a specific embodiment, the agent can be a polypeptide. The polypeptide can also comprise an antibody. In another embodiment, the agent can be a nucleic acid molecule. The nucleic acid molecule can, for example, be an RPS15 and/or LRRK2 inhibitory nucleic acid molecule. The RPS15 and/or LRRK2 inhibitory nucleic acid molecule can comprise a short interfering RNA (siRNA) molecule, a microRNA (miRNA) molecule, or an antisense molecule.

As used herein, a RPS15 and/or LRRK2 inhibitory nucleic acid sequence can be a siRNA sequence or a miRNA sequence. A 21-25 nucleotide siRNA or miRNA sequence can, for example, be produced from an expression vector by transcription of a short-hairpin RNA (shRNA) sequence, a 60-80 nucleotide precursor sequence, which is processed by the cellular RNAi machinery to produce either an siRNA or miRNA sequence. Alternatively, a 21-25 nucleotide siRNA or miRNA sequence can, for example, be synthesized chemically.

Chemical synthesis of siRNA or miRNA sequences is commercially available from such corporations as Dharmacon, Inc. (Lafayette, Colo.), Qiagen (Valencia, Calif), and Ambion, Inc. (Austin, Tex.). An siRNA sequence preferably binds a unique sequence within the RPS15 or LRRK2 mRNA with exact complementarity and results in the degradation of the RPS15 or LRRK2 mRNA molecule. An siRNA sequence can bind anywhere within the mRNA molecule. An miRNA sequence preferably binds a unique sequence within the RPS15 or LRRK2 mRNA with exact or less than exact complementarity and results in the translational repression of the RPS 15 or LRRK2 mRNA molecule. An miRNA sequence can bind anywhere within the mRNA molecule, but preferably binds within the 3'UTR of the mRNA molecule. Methods of delivering siRNA or miRNA molecules are known in the art. See, e.g., Oh and Park, Adv. Drug Deliv. Rev. 61(10):850-62 (2009); Gondi and Rao, J. Cell. Physiol. 220(2):285-91 (2009); and Whitehead et al, Nat. Rev. Drug Discov. 8(2)129-38 (2009).

As used herein, a RPS15 and/or LRRK2 inhibitory nucleic acid sequence can be an antisense nucleic acid sequence. Antisense nucleic acid sequences can, for example, be transcribed from an expression vector to produce an RNA which is complementary to at least a unique portion of the RPS15 or LRRK2 mRNA and/or the endogenous gene which encodes RPS15 or LRRK2. Hybridization of an antisense nucleic acid molecule under specific cellular conditions results in inhibition of RPS15 or LRRK2 protein expression by inhibiting transcription and/or translation.

The term antibody is used herein in a broad sense and includes both polyclonal and monoclonal antibodies. The term can also refer to a human antibody and/or a humanized antibody. Examples of techniques for human monoclonal antibody production include those described by Cole et al. (Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985)) and by Boerner et al. (J. Immunol. 147(l):86-95 (1991)). Human antibodies (and fragments thereof) can also be produced using phage display libraries (Hoogenboom et al, J. Mol. Biol. 227:381 (1991); Marks et al., J. Mol. Biol. 222:581 (1991)). The disclosed human antibodies can also be obtained from transgenic animals. For example, transgenic mutant mice that are capable of producing a full repertoire of human antibodies, in response to immunization, have been described (see, e.g., Jakobovits et al, Proc. Natl. Acad. Sci. USA 90:2551-5 (1993); Jakobovits et al, Nature 362:255-8 (1993); Bruggermann et al, Year in Immunol. 7:33 (1993)).

In certain embodiments, the LRRK2 modulator is an antibody. The antibody can bind wildtype LRRK2 and/or mutant LRRK2 including, but not limited to R1441C, G2019S and/or I2020T. A LRRK2 modulator can bind any or all of the foregoing. In some embodiments, the LRRK2 antibody modulator binds RPS 15 and prevents its phosphorylation by LRRK2 (wildtype and/or mutant).

In other embodiments, a LRRK2 modulator is a small molecule. The term "small molecule organic compounds" refers to organic compounds generally having a molecular weight less than about 5000, 4000, 3000, 2000, 1000, 800, 600, 500, 250 or 100 Daltons, preferably less than about 500 Daltons. A small molecule organic compound may be prepared by synthetic organic techniques, such as by combinatorial chemistry techniques, or it may be a naturally-occurring small molecule organic compound.

Examples of LRRK2 modulators are aminopyrimidine derivatives, pyrazole aminopyrimidine derivatives, 2-phenylaminopyrimidine derivatives, 2-(benzyloxy) benzamides, the cancer drug sunitinib, the small molecule inhibitor HG-10-102, zinc finger nuclease, 4-(substituted amino)-7H-pyrrolo[2,3-d] pyrimidines, triazolopyridazine compounds, and pyrazolopyridines. Further examples of LRRK2 modulators can be found in U.S. Patent Nos. 8,791, 130; 8,796,296; 8,802,674; 8,815,882; 8,354,420; and Patent Application Nos. 13/687,411 ; 13/687,421; 14/129,099; 13/820, 184; 13/327,322; 13/928,696; 14/348, 138; 13/875,751; 13/697,878; PCT/US 13/064, 183; and PCT/US 14/018,895; which are incorporated herein by reference. Compound libraries may be screened for LRRK2 modulators. A compound library is a mixture or collection of one or more putative modulators generated or obtained in any manner. Any type of molecule that is capable of interacting, binding or has affinity for LRRK2 may be present in the compound library. For example, compound libraries screened using this invention may contain naturally-occurring molecules, such as carbohydrates, monosaccharides, oligosaccharides, polysaccharides, amino acids, peptides, oligopeptides, polypeptides, proteins, receptors, nucleic acids, nucleosides, nucleotides, oligonucleotides, polynucleotides, including DNA and DNA fragments, RNA and RNA fragments and the like, lipids, retinoids, steroids, glycopeptides, glycoproteins, proteoglycans and the like; or analogs or derivatives of naturally-occurring molecules, such as peptidomimetics and the like; and non-naturally occurring molecules, such as "small molecule" organic compounds generated, for example, using combinatorial chemistry techniques; and mixtures thereof.

A library typically contains more than one putative modulator or member, i.e., a plurality of members or putative modulators. In certain embodiments, a compound library may comprise less than about 50,000, 25,000, 20,000, 15,000, 10000, 5000, 1000, 500 or 100 putative modulators, in particular from about 5 to about 100, 5 to about 200, 5 to about 300, 5 to about 400, 5 to about 500, 10 to about 100, 10 to about 200, 10 to about 300, 10 to about 400, 10 to about 500, 10 to about 1000, 20 to about 100, 20 to about 200, 20 to about 300, 20 to about 400, 20 to about 500, 20 to about 1000, 50 to about 100, 50 to about 200, 50 to about 300, 50 to about 400, 50 to about 500, 50 to about 1000, 100 to about 200, 100 to about 300, 100 to about 400, 100 to about 500, 100 to about 1000, 200 to about 300, 200 to about 400, 200 to about 500, 200 to about 1000, 300 to about 500, 300 to about 1000, 300 to 2000, 300 to 3000, 300 to 5000, 300 to 6000, 300 to 10,000, 500 to about 1000, 500 to about 2000, 500 to about 3000, 500 to about 5000, 500 to about 6000, or 500 to about 10,000 putative modulators. In particular embodiments, a compound library may comprise less than about 50,000, 25,000, 20,000, 15,000, 10,000, 5,000, 1000, or 500 putative modulators.

A compound library may be prepared or obtained by any means including, but not limited to, combinatorial chemistry techniques, fermentation methods, plant and cellular extraction procedures and the like. A library may be obtained from synthetic or from natural sources such as for example, microbial, plant, marine, viral and animal materials. Methods for making libraries are well-known in the art. See, for example, E. R. Felder, Chimia 1994, 48, 512-541 ; Gallop et al, J. Med. Chem. 1994, 37, 1233-1251; R. A. Houghten, Trends Genet. 1993, 9, 235-239; Houghten et al, Nature 1991, 354, 84-86; Lam et al, Nature 1991, 354, 82-84; Carell et al, Chem. Biol. 1995, 3, 171-183; Madden et al, Perspectives in Drug Discovery and Design 2, 269-282; Cwirla et al, Biochemistry 1990, 87, 6378-6382; Brenner et al, Proc. Natl. Acad. Sci. USA 1992, 89, 5381-5383; Gordon et al, J. Med. Chem. 1994, 37, 1385-1401 ; Lebl et al, Biopolymers 1995, 37 177-198; and references cited therein. Compound libraries may also be obtained from commercial sources including, for example, from Maybridge, ChemNavigator.com, Timtec Corporation, ChemBridge Corporation, A- Syntese-Biotech ApS, Akos-SC, G & J Research Chemicals Ltd., Life Chemicals, Interchim S.A., and Spectrum Info. Ltd.

IV. Methods of Using LRRK2 Modulators

The LRRK2 modulators described herein have in vitro and in vivo diagnostic and therapeutic utilities. For example, these molecules can be administered to cells in culture, e.g., in vitro or in vivo, or in a subject, e.g., in vivo, to treat, prevent or diagnose LRRK2- mediated diseases, disorders or conditions. LRRK2 modulators are particularly suitable for treating human patients suffering from "LRRK2 signaling-related disorders," meaning those diseases and conditions associated with aberrant LRRK2 signaling. Aberrant upregulation of LRRK2 signaling is associated with neurodegenerative diseases like Parkinson's disease, which conditions would be particularly amendable to treatment by the administration of antagonizing LRRK2 modulators. Conversely, aberrant downregulation of LRRK2 signaling would be particularly amendable to treatment by the administration of agonizing LRP modulators.

In certain embodiments, the LRRK2 antagonizing modulators of the present invention are capable of inhibiting the phosphorylation of RPS 15 by LRRK2. By way of example, a cell can be contacted with an antagonizing LRRK2 modulator (e.g., a LRRK2 modulator including an antigen binding portion of an antibody that specifically binds to LRRK2), thereby preventing LRRK2 pathway signal transduction through phosphorylation of RPS 15.

In one embodiment, the modulators of the invention can be used to detect levels of

LRRK2. This can be achieved, for example, by contacting a sample (such as an in vitro sample) and a control sample with the LRRK2 modulator under conditions that allow for the formation of a complex between the modulator and LRRK2. Any complexes formed between the molecule and LRRK2 are detected and compared in the sample and the control. For example, standard detection methods, well known in the art, such as ELISA and flow cytometric assays, can be performed using the compositions of the invention.

Accordingly, in one aspect, the invention further provides methods for detecting the presence of LRRK2 (e.g., hLRRK2) in a sample, or measuring the amount of LRRK2, comprising contacting the sample, and a control sample, with a LRRK2 modulator (e.g., an antibody) of the invention, under conditions that allow for formation of a complex between the antibody or portion thereof and LRRK2. The formation of a complex is then detected, wherein a difference in complex formation between the sample compared to the control sample is indicative of the presence of LRRK2 in the sample.

Also within the scope of the invention are kits comprising the compositions of the invention and instructions for use. In one embodiment, the kit comprises an anti-LRRK2 antibody. The antibody can bind wild type LRRK2 and/or mutant LRRK2 including R1441C, G2019S and/or I2020T. The kit can further contain a least one additional reagent, or one or more additional antibodies (e.g., an antibody having a complementary activity which binds to an epitope on the target antigen distinct from the first antibody). Kits typically include a label indicating the intended use of the contents of the kit. The term label includes any writing, or recorded material supplied on or with the kit, or which otherwise accompanies the kit. The kit can further comprise an antibody that specifically binds RPS15 at Thrl36. In certain embodiments, the antibody is a polyclonal antibody. In more specific embodiments, the antibody specifically binds RPS at phosphorylated Thrl36. In particular embodiments, the antibody is designated as Phospho-T136 antibody.

VI. Pharmaceutical Compositions and Administration

Accordingly, a pharmaceutical composition of the present invention may comprise an effective amount of a LRRK2 modulator. As used herein, the term "effective," means adequate to accomplish a desired, expected, or intended result. More particularly, an

"effective amount" or a "therapeutically effective amount" is used interchangeably and refers to an amount of a LRRK2 modulator, perhaps in further combination with yet another therapeutic agent, necessary to provide the desired "treatment" (defined herein) or therapeutic effect, e.g., an amount that is effective to prevent, alleviate, treat or ameliorate symptoms of a disease or prolong the survival of the subject being treated. In particular embodiments, the pharmaceutical compositions of the present invention are administered in a therapeutically effective amount to treat patients suffering from a LRRK2 -mediated disease, disorder or condition. As would be appreciated by one of ordinary skill in the art, the exact low dose amount required will vary from subject to subject, depending on age, general condition of the subject, the severity of the condition being treated, the particular compound and/or composition administered, and the like. An appropriate "therapeutically effective amount" in any individual case can be determined by one of ordinary skill in the art by reference to the pertinent texts and literature and/or by using routine experimentation. The pharmaceutical compositions of the present invention are in biologically compatible form suitable for administration in vivo for subjects. The pharmaceutical compositions can further comprise a pharmaceutically acceptable carrier. The term

"pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly, in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a LRRK2 modulator is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, including but not limited to peanut oil, soybean oil, mineral oil, sesame oil and the like. Water may be a carrier when the pharmaceutical composition is administered orally. Saline and aqueous dextrose may be carriers when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions may be employed as liquid carriers for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried slim milk, glycerol, propylene, glycol, water, ethanol and the like. The pharmaceutical composition may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

The pharmaceutical compositions of the present invention can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation may include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. In a specific embodiment, a pharmaceutical composition comprises an effective amount of a LRRK2 modulator together with a suitable amount of a pharmaceutically acceptable carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.

The pharmaceutical compositions of the present invention may be administered by any particular route of administration including, but not limited to oral, parenteral, subcutaneous, intramuscular, intravenous, intrarticular, intrabronchial, intraabdominal, intracapsular, intracartilaginous, intracavitary, intracelial, intracelebellar,

intracerebroventricular, intracolic, intracervical, intragastric, intrahepatic, intramyocardial, intraosteal, intraosseous, intrapelvic, intrapericardiac, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal, intrasynovial, intrathoracic, intrauterine, intravesical, bolus, vaginal, rectal, buccal, sublingual, intranasal, iontophoretic means, or transdermal means. Most suitable routes are oral administration or injection. In certain embodiments, subcutaneous injection is preferred.

In general, the pharmaceutical compositions comprising a LRRK2 modulator may be used alone or in concert with other therapeutic agents at appropriate dosages defined by routine testing in order to obtain optimal efficacy while minimizing any potential toxicity. The dosage regimen utilizing a pharmaceutical composition of the present invention may be selected in accordance with a variety of factors including type, species, age, weight, sex, medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular pharmaceutical composition employed. A physician of ordinary skill can readily determine and prescribe the effective amount of the pharmaceutical composition (and potentially other agents including therapeutic agents) required to prevent, counter, or arrest the progress of the condition.

Optimal precision in achieving concentrations of the therapeutic regimen (e.g., pharmaceutical compositions comprising a LRRK2 modulator, optionally in combination with another therapeutic agent) within the range that yields maximum efficacy with minimal toxicity may require a regimen based on the kinetics of the pharmaceutical composition's availability to one or more target sites. Distribution, equilibrium, and elimination of a pharmaceutical composition may be considered when determining the optimal concentration for a treatment regimen. The dosages of a pharmaceutical composition disclosed herein may be adjusted when combined to achieve desired effects. On the other hand, dosages of the pharmaceutical compositions and various therapeutic agents may be independently optimized and combined to achieve a synergistic result wherein the pathology is reduced more than it would be if either was used alone.

In particular, toxicity and therapeutic efficacy of a pharmaceutical composition disclosed herein may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LDso (the dose lethal to 50% of the population) and the ED ₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index and it may be expressed as the ratio LD5 ₀ /ED5 ₀ . Pharmaceutical compositions exhibiting large therapeutic indices are preferred except when cytotoxicity of the composition is the activity or therapeutic outcome that is desired. Although pharmaceutical compositions that exhibit toxic side effects may be used, a delivery system can target such compositions to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. Generally, the pharmaceutical compositions of the present invention may be administered in a manner that maximizes efficacy and minimizes toxicity.

Data obtained from cell culture assays and animal studies may be used in formulating a range of dosages for use in humans. The dosages of such compositions lie preferably within a range of circulating concentrations that include the ED5 ₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any composition used in the methods of the invention, the therapeutically effective dose may be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC5 ₀ (the concentration of the test composition that achieves a half- maximal inhibition of symptoms) as determined in cell culture. Such information may be used to accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

Moreover, the dosage administration of the compositions of the present invention may be optimized using a pharmacokinetic/pharmacodynamic modeling system. For example, one or more dosage regimens may be chosen and a pharmacokinetic/pharmacodynamic model may be used to determine the pharmacokinetic/pharmacodynamic profile of one or more dosage regimens. Next, one of the dosage regimens for administration may be selected which achieves the desired pharmacokinetic/pharmacodynamic response based on the particular pharmacokinetic/pharmacodynamic profile. See WO 00/67776, which is entirely expressly incorporated herein by reference.

More specifically, the pharmaceutical compositions may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three, or four times daily. In the case of oral administration, the daily dosage of the compositions may be varied over a wide range from about 0.1 ng to about 1,000 mg per patient, per day. The range may more particularly be from about 0.001 ng/kg to 10 mg/kg of body weight per day, about 0.1-100 μg, about 1.0-50 μg or about 1.0-20 mg per day for adults (at about 60 kg).

The daily dosage of the pharmaceutical compositions may be varied over a wide range from about 0.1 ng to about 1000 mg per adult human per day. For oral administration, the compositions may be provided in the form of tablets containing from about 0.1 ng to about 1000 mg of the composition or 0.1, 0.2, 0.5, 1.0, 2.0, 5.0, 10.0, 15.0, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, or 1000 milligrams of the composition for the symptomatic adjustment of the dosage to the patient to be treated. An effective amount of the pharmaceutical composition is ordinarily supplied at a dosage level of from about 0.1 ng/kg to about 20 mg/kg of body weight per day. In one embodiment, the range is from about 0.2 ng/kg to about 10 mg/kg of body weight per day. In another embodiment, the range is from about 0.5 ng/kg to about 10 mg/kg of body weight per day. The pharmaceutical compositions may be administered on a regimen of about 1 to about 10 times per day.

In the case of injections, it is usually convenient to give by an intravenous route in an amount of about 0.000^g-30 mg, about 0.01 μg-20 mg or about 0.01-10 mg per day to adults (at about 60 kg). In the case of other animals, the dose calculated for 60 kg may be administered as well.

Doses of a pharmaceutical composition of the present invention can optionally include 0.0001 μg to 1,000 mg/kg/administration, or 0.001 μg to 100.0 mg/kg/administration, from 0.01 μg to 10 mg/kg/administration, from 0.1 μg to 10 mg/kg/administration, including, but not limited to, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53,54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and/or 100-500 mg/kg/administration or any range, value or fraction thereof, or to achieve a serum concentration of 0.1, 0.5, 0.9, 1.0, 1.1, 1.2,

I.5, 1.9, 2.0, 2.5, 2.9, 3.0, 3.5, 3.9, 4.0, 4.5, 4.9, 5.0, 5.5, 5.9, 6.0, 6.5, 6.9, 7.0, 7.5, 7.9, 8.0, 8.5, 8.9, 9.0, 9.5, 9.9, 10, 10.5, 10.9, 1 1, 1 1.5, 11.9, 20, 12.5, 12.9, 13.0, 13.5, 13.9, 14.0,

14.5, 4.9, 5.0, 5.5, 5.9, 6.0, 6.5, 6.9, 7.0, 7.5, 7.9, 8.0, 8.5, 8.9, 9.0, 9.5, 9.9, 10, 10.5, 10.9, 11,

I I .5, 1 1.9, 12, 12.5, 12.9, 13.0, 13.5, 13.9, 14, 14.5, 15, 15.5, 15.9, 16, 16.5, 16.9, 17, 17.5, 17.9, 18, 18.5, 18.9, 19, 19.5, 19.9, 20, 20.5, 20.9, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 96, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, and/or 5000 μg/ml serum concentration per single or multiple administration or any range, value or fraction thereof.

As a non-limiting example, treatment of subjects can be provided as a one-time or periodic dosage of a composition of the present invention 0.1 ng to 100 mg/kg such as 0.0001, 0.001, 0.01, 0.1 0.5, 0.9, 1.0, 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 45, 50, 60, 70, 80, 90 or 100 mg/kg, per day, on at least one of day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, or alternatively or additionally, at least one of week 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, or 52, or alternatively or additionally, at least one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20 years, or any combination thereof, using single, infusion or repeated doses.

Specifically, the pharmaceutical compositions of the present invention may be administered at least once a week over the course of several weeks. In one embodiment, the pharmaceutical compositions are administered at least once a week over several weeks to several months. In another embodiment, the pharmaceutical compositions are administered once a week over four to eight weeks. In yet another embodiment, the pharmaceutical compositions are administered once a week over four weeks.

More specifically, the pharmaceutical compositions may be administered at least once a day for about 2 days, at least once a day for about 3 days, at least once a day for about 4 days, at least once a day for about 5 days, at least once a day for about 6 days, at least once a day for about 7 days, at least once a day for about 8 days, at least once a day for about 9 days, at least once a day for about 10 days, at least once a day for about 11 days, at least once a day for about 12 days, at least once a day for about 13 days, at least once a day for about 14 days, at least once a day for about 15 days, at least once a day for about 16 days, at least once a day for about 17 days, at least once a day for about 18 days, at least once a day for about 19 days, at least once a day for about 20 days, at least once a day for about 21 days, at least once a day for about 22 days, at least once a day for about 23 days, at least once a day for about 24 days, at least once a day for about 25 days, at least once a day for about 26 days, at least once a day for about 27 days, at least once a day for about 28 days, at least once a day for about 29 days, at least once a day for about 30 days, or at least once a day for about 31 days.

Alternatively, the pharmaceutical compositions may be administered about once every day, about once every 2 days, about once every 3 days, about once every 4 days, about once every 5 days, about once every 6 days, about once every 7 days, about once every 8 days, about once every 9 days, about once every 10 days, about once every 1 1 days, about once every 12 days, about once every 13 days, about once every 14 days, about once every 15 days, about once every 16 days, about once every 17 days, about once every 18 days, about once every 19 days, about once every 20 days, about once every 21 days, about once every 22 days, about once every 23 days, about once every 24 days, about once every 25 days, about once every 26 days, about once every 27 days, about once every 28 days, about once every 29 days, about once every 30 days, or about once every 31 days.

The pharmaceutical compositions of the present invention may alternatively be administered about once every week, about once every 2 weeks, about once every 3 weeks, about once every 4 weeks, about once every 5 weeks, about once every 6 weeks, about once every 7 weeks, about once every 8 weeks, about once every 9 weeks, about once every 10 weeks, about once every 11 weeks, about once every 12 weeks, about once every 13 weeks, about once every 14 weeks, about once every 15 weeks, about once every 16 weeks, about once every 17 weeks, about once every 18 weeks, about once every 19 weeks, about once every 20 weeks.

Alternatively, the pharmaceutical compositions of the present invention may be administered about once every month, about once every 2 months, about once every 3 months, about once every 4 months, about once every 5 months, about once every 6 months, about once every 7 months, about once every 8 months, about once every 9 months, about once every 10 months, about once every 1 1 months, or about once every 12 months.

Alternatively, the pharmaceutical compositions may be administered at least once a week for about 2 weeks, at least once a week for about 3 weeks, at least once a week for about 4 weeks, at least once a week for about 5 weeks, at least once a week for about 6 weeks, at least once a week for about 7 weeks, at least once a week for about 8 weeks, at least once a week for about 9 weeks, at least once a week for about 10 weeks, at least once a week for about 1 1 weeks, at least once a week for about 12 weeks, at least once a week for about 13 weeks, at least once a week for about 14 weeks, at least once a week for about 15 weeks, at least once a week for about 16 weeks, at least once a week for about 17 weeks, at least once a week for about 18 weeks, at least once a week for about 19 weeks, or at least once a week for about 20 weeks.

Alternatively the pharmaceutical compositions may be administered at least once a week for about 1 month, at least once a week for about 2 months, at least once a week for about 3 months, at least once a week for about 4 months, at least once a week for about 5 months, at least once a week for about 6 months, at least once a week for about 7 months, at least once a week for about 8 months, at least once a week for about 9 months, at least once a week for about 10 months, at least once a week for about 1 1 months, or at least once a week for about 12 months.

It would be readily apparent to one of ordinary skill in the art that the pharmaceutical compositions of the present invention (e.g., a LRRK2 inhibitor) can be combined with one or more therapeutic agents. In particular, the compositions of the present invention and other therapeutic agents can be administered simultaneously or sequentially by the same or different routes of administration. The determination of the identity and amount of therapeutic agent(s) for use in the methods of the present invention can be readily made by ordinarily skilled medical practitioners using standard techniques known in the art.

In specific embodiments, a LRRK2 inhibitor of the present invention can be administered in combination with an effective amount of a therapeutic agent that treats Parkinson's disease. For example, Levodopa (L-dopa) is used as a form of symptomatic treatment. L-dopa is transformed into dopamine in the dopaminergic neurons by L-aromatic amino acid decarboxylase. However, only 1-5% of L-dopa enters the dopaminergic neurons. The remaining L-dopa is often metabolized to dopamine elsewhere, causing a wide variety of side effects. Due to feedback inhibition, L-dopa results in a reduction in the endogenous formation of L-dopa, and so eventually becomes counterproductive. Carbidopa and benserazide are dopadecarboxylase inhibitors. They help to prevent the metabolism of L- dopa before it reaches the dopaminergic neurons and are generally given as combination preparations of carbidopa/levodopa (co-careldopa) and benserazide/levodopa (co-beneldopa). Duodopa is a combination of levodopa and carbidopa.

Other Parkinson's disease agents include the dopamine agonists bromocriptine, pergolide, pramipexole, ropinirole, cabergoline, apomorphine, and lisuride. Dopamine agonists can be useful for patients experiencing on-off fluctuations and dyskinesias as a result of high doses of L-dopa. MAO-B inhibitors (first, second, or later generation MAO-B inhibitors) reduce the symptoms associated with Parkinson's disease by inhibiting the breakdown of dopamine secreted by the dopaminergic neurons. An exemplary MAO-B inhibitor is Rasagiline [N-propargyl-l(R)-aminoindan], a second-generation propargylamine pharmacophore that selectively and irreversibly inhibits brain MAO-B.

Other agents including noradrenergic drugs such as norepinephrine ; kinase inhibitors such as p38 mitogen-activated protein kinase inhibitors, and mixed lineage kinase inhibitors, (for example CEP-1347); mitochondrial modulators such as Enzyme co-QlO; calcium channel blockers such as isradipine; and compounds that prevent/reverse/disaggregate, halt aggregation of alpha-synuclein may be useful in preventing, reversing, or treating early premotor/prodromal Parkinson's disease or Parkinson' s-like disease.

Furthermore, therapeutic agents that can be administered in combination therapy with one or more LRRK2 inhibitors include, but are not limited to, anti-inflammatory, anti-viral, anti-fungal, anti-mycobacterial, antibiotic, amoebicidal, trichomonocidal, analgesic, antineoplastic, anti-hypertensives, anti-microbial and/or steroid drugs, to treat Parkinson's disease. In some embodiments, patients are treated with a LRRK2 inhibitor in combination with one or more of the following; β-lactam antibiotics, tetracyclines, chloramphenicol, neomycin, gramicidin, bacitracin, sulfonamides, nitrofurazone, nalidixic acid, cortisone, hydrocortisone, betamethasone, dexamethasone, fluocortolone, prednisolone, triamcinolone, indomethacin, sulindac, acyclovir, amantadine, rimantadine, recombinant soluble CD4 (rsCD4), anti-receptor antibodies (e.g., for rhinoviruses), nevirapine, cidofovir (Vistide™), trisodium phosphonoformate (Foscarnet™), famcyclovir, pencyclovir, valacyclovir, nucleic acid/replication inhibitors, interferon, zidovudine (AZT, Retrovir™), didanosine

(dideoxyinosine, ddl, Videx™), stavudine (d4T, Zerit™), zalcitabine (dideoxycytosine, ddC, Hivid™), nevirapine (Viramune™), lamivudine (Epivir™, 3TC), pro tease inhibitors, saquinavir (Invirase™, Fortovase™), ritonavir ( orvir™), nelfinavir (Viracept™), efavirenz (Sustiva™), abacavir (Ziagent™), amprenavir (Agenerase™) indinavir (Crixivan™), ganciclovir, AzDU, delavirdine (Kescriptor™), kaletra, trizivir, rifampin, clathiromycin, erythropoietin, colony stimulating factors (G-CSF and GM-CSF), non-nucleoside reverse transcriptase inhibitors, nucleoside inhibitors, adriamycin, fluorouracil, methotrexate, asparagyinase and combinations foregoing.

In another aspect, the LRRK2 inhibitors of the present invention may be combined with other therapeutic agents including, but not limited to, immunomodulatory agents, antiinflammatory agents (e.g., adrenocorticoids, corticosteroids (e.g., beclomethasone, budesonide, flunisolide, fluticasone, triamcinolone, methlyprednisolone, prednisolone, prednisone, hydrocortisone), glucocorticoids, steroids, non-steriodal anti-inflammatory drugs (e.g., aspirin, ibuprofen, diclofenac, and COX -2 inhibitors), and leukotreine antagonists (e.g., montelukast, methyl xanthines, zafirlukast, and zileuton), 2-agonists (e.g., albuterol, biterol, fenoterol, isoetharie, metaproterenol, pirbuterol, salbutamol, terbutalin formoterol, salmeterol, and salbutamol terbutaline), anticholinergic agents (e.g., ipratropium bromide and oxitropium bromide), sulphas alazine, penicillamine, dapsone, antihistamines, anti-malarial agents (e.g., hydroxychloroquine), other anti-viral agents, and antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, erythomycin, penicillin, mithramycin, and anthramycin (AMC)).

In various embodiments, a RPS 15 or LRRK2 inhibitor of the present invention in combination with a second therapeutic agent may be administered less than 5 minutes apart, less than 30 minutes apart, 1 hour apart, at about 1 hour apart, at about 1 to about 2 hours apart, at about 2 hours to about 3 hours apart, at about 3 hours to about 4 hours apart, at about 4 hours to about 5 hours apart, at about 5 hours to about 6 hours apart, at about 6 hours to about 7 hours apart, at about 7 hours to about 8 hours apart, at about 8 hours to about 9 hours apart, at about 9 hours to about 10 hours apart, at about 10 hours to about 11 hours apart, at about 11 hours to about 12 hours apart, at about 12 hours to 18 hours apart, 18 hours to 24 hours apart, 24 hours to 36 hours apart, 36 hours to 48 hours apart, 48 hours to 52 hours apart, 52 hours to 60 hours apart, 60 hours to 72 hours apart, 72 hours to 84 hours apart, 84 hours to 96 hours apart, or 96 hours to 120 hours part. In particular embodiments, two or more therapies are administered within the same patent visit.

In certain embodiments, a RPS15 or LRRK2 inhibitor of the present invention and one or more other therapies are cyclically administered. Cycling therapy involves the administration of a first therapy (e.g., a RPS15 inhibitor) for a period of time, followed by the administration of a second therapy (e.g. a second RPS15 inhibitor, a LRRK2 inhibitor or another therapeutic agent) for a period of time, optionally, followed by the administration of a third therapy for a period of time and so forth, and repeating this sequential administration, e.g., the cycle, in order to reduce the development of resistance to one of the therapies, to avoid or reduce the side effects of one of the therapies, and/or to improve the efficacy of the therapies. In certain embodiments, the administration of the combination therapy of the present invention may be repeated and the administrations may be separated by at least 1 day, 2 days, 3 days, 5 days, 10 days, 15 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months.

Without further elaboration, it is believed that one skilled in the art, using the preceding description, can utilize the present invention to the fullest extent. The following examples are illustrative only, and not limiting of the remainder of the disclosure in any way whatsoever.

EXAMPLES

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices, and/or methods described and claimed herein are made and evaluated, and are intended to be purely illustrative and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for herein. Unless indicated otherwise, parts are parts by weight, temperature is in degrees Celsius or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component

concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.

Materials and Methods

LRRK2 tandem affinity purification: LRRK2 -interacting phosphoproteins were identified using tandem affinity purification of TAP tagged LRRK2 from HEK293 cells, IMAC phosphoprotein enrichment and mass spectrometry in series. The method is more fully described below.

LRRK2 in vitro kinase assays: Recombinant LRRK2 (aa 970-2527) and recombinant GST-tagged substrate candidates were incubated in kinase assay buffer containing γ-Ρ ³² -ΑΤΡ for phosphorimaging-based visualization of protein phosphorylation following separation of the reaction mixture by SDS-PAGE. See the paragraphs below for full details.

LRRK2 in vitro toxicity assays: Toxicity (loss of neurites and appearance of TU EL- positive nuclei) in rodent and human neurons overexpressing LRRK2, substrate and GFP for neurite tracing in a 10: 10: 1 ratio was assessed using previously described methods 48 h following plasmid transfection (Lee et al, 2010; Li et al, 2010; Ramsden et al, 201 1 ; Xiong et al, 2010). The vast majority of GFP positive neurons (-90%) also co-labeled for overexpressed LRRK2 and substrate indicating that the effects of LRRK2 and sl5/sl 1 overexpression could be assessed in these neurons, as previously described (Lee et al, 2010). See the paragraphs below for more details.

Generation of si 5 and T136A si 5 transgenic lines: Human sl5 and T136A sl5 constructs were generated by subcloning full-length cDNA into pUAST between EcoRl and Xbal restriction sites. After sequence verification, constructs were microinjected into w ¹¹¹⁸ fly embryos. Transgenic UAS-sl5 and UAS-T136A si 5 expression were confirmed by western blot on fly heads following expression driven via daughterless-Gal4 (FIG. 12A). Details on additional fly lines used are provided in the paragraphs below.

Phospho-sl5 assessment in cells and Drosophila: A polyclonal antibody to phospho- Thr 136 was generated and validated as described in the paragraphs below. In cells, phosphorylation of overexpressed sl5 was assessed from whole lysates extracted using 1% NP-40 lysis buffer and separated by SDS-PAGE for immunoblotting. In homogenized heads of LRRK2 transgenic or dLRRK-null flies, phosphorylation of endogenous s 15 was assessed in ribosomal fractions that were isolated essentially as described before (Belin et al, 2010) with the addition of phosphatase inhibitors to the extraction buffer. Drosophila dopamine neuron immunohistochemistry and locomotor function:

Dopamine neuron immunohistochemistry and negative geotaxis assessment of locomotor function were performed as described in the paragraphs below.

De novo protein synthesis and mRNA polysome profiling in Drosophila: For protein synthesis measurement, ³⁵ S-methionine/cysteine (100 μθί/ιηΐ) incorporation into flies fed with labeled food for 24h was assessed by liquid scintillation counting and expressed relative to total protein amount. Polysomes were isolated from fly heads via sucrose gradient centrifugation and fractionated for RNA extraction, cDNA synthesis and real-time PCR measurement of genes relative to a spike-in luciferase synthetic RNA added prior to RNA extraction as previously described (Trancikova et al, 2012). See the paragraphs below for full details.

Statistical analyses: All statistical analyses, including Student's t-tests, ANOVA and associated Bonferroni's post-tests were performed using GraphPad Prism software.

LRRK2 tandem affinity purification. A fusion protein consisting of full-length LRRK2 with a C-terminal Streptavidin binding peptide and calmodulin binding peptide tag (TAP LRRK2) was generated and transfected into HEK293 cells. 48 h following transfection, LRRK2 was purified from cells using the InterPlay mammalian tandem affinity purification (TAP) kit (Agilent) following the manufacturer's instructions. The TAP eluate was enriched for phosphoprotein using an immobilized metal affinity chromatography (IMAC) column. A fraction of the IMAC column eluate was subjected to an in vitro kinase assay with γ- ³² Ρ-ΑΤΡ followed by SDS-PAGE and immunoblotting to confirm the purification of kinase-active LRRK2. Phosphorimaging revealed abundant incorporation of ³² P in a protein confirmed to be LRRK2 by immunoblotting, as well as ³² P incorporation in numerous co-purified proteins. The co-purification of numerous phospho-proteins by this method was also supported by phosphostaining a portion of the IMAC column eluate. All remaining eluate was resolved by SDS-PAGE. The gel was fixed and stained with coomassie brilliant blue revealing candidate LRRK2-interacting proteins with a wide range of molecular weights. The entire loaded lane was excised from the gel and divided into even sized gel fragments. All fragments were analyzed by mass spectrometry in order to identify candidate LRRK2 interacting proteins.

Cytoscape analysis o fLRRK2 interacting proteins . LRRK2 -interacting proteins were filtered to control for non-specific binding. Interacting proteins identified using TAP -tags for Botch and GADD45B were subtracted from the mass spectrometry data set for LRRK2. The remaining set of LRRK2 -interacting proteins was analyzed using the ClueGo Cytoscape plugin with molecular function gene ontology annotation. Functional groups consist of nodes (molecular functions) connected to reflect functional relationships between nodes. Each functional group is annotated in colored type according to the statistically most enriched molecular function for that group. Ungrouped functional nodes are white and not connected to other nodes.

Generation of GST tagged candidate LRRK2 substrates. Entry clone cDNA for each of the LRRK2 -interacting proteins identified by tandem affinity purification was sub-cloned into an N-terminal GST-tagged bacterial expression vector (pDEST 15, Invitrogen) via Gateway cloning and expressed in E.coli for affinity purification of GST tagged protein. Starter cultures for each expression clone were generated from single colonies grown overnight at 37 C, and a 200 μϊ _^ aliquot was transferred to 3 ml LB broth and cultured at 37 C. Protein expression was induced using 0.15 mM IPTG once bacterial cultures had reached an O.D. of 0.6 a.u. At this time point, cultures were incubated at 30 C for 3 h, pelleted by centrifugation (3,000 x g for 10 minutes) and then lysed in chilled lysis buffer (BugBuster, 1 mg/ml lysozyme, protease inhibitor cocktail and benzonase nuclease) on ice for 30 minutes. Lysates were centrifuged at 16,000 x g for 20 minutes at 4 C, and the supernatant was incubated with glutathione sepharose beads (GE healthcare) resuspended in PBS overnight at 4 C with end-over-end rotation. The beads were separated from lysate by centrifugation and were washed three times in chilled PBS, followed by elution of bound protein in elution buffer (50 mM HEPES (pH 8), 150 mM NaCl and 30 mM glutathione). Eluted proteins were stored in 15% glycerol at -20 C until use.

LRRK2 in vitro kinase assays. LRRK2 kinase assays were performed with purified recombinant GST-tagged LRRK2 (aa 970-2527) or its variants D1994A, G2019S and I2020T (Invitrogen) along with purified recombinant GST-tagged substrate candidate generated as described above. Proteins were incubated in a kinase assay buffer (20 mM HEPES pH 7.5, 5 mM EGTA, 20 mM β-glycerophosphate, 20 mM MgCl ₂ , 10 μΜ ATP and 0.5 μθί of γ- ³² Ρ- ATP at a combined volume of 30 μϊ _^ . The reaction mixture was incubated at 30 C for 30 minutes, or as indicated. Reactions were quenched by the addition of SDS-sample loading buffer, heated to 70 C for 10 minutes and then loaded onto 8% polyacrylamide gels for SDS- PAGE. Following electrophoresis, gels were fixed (50% methanol, 10% acetic acid), stained in coomassie brilliant blue, heat-sealed in hybridization bags and exposed to a phosphorimaging screen overnight at room temperature for assessing radioactive P incorporation. GST alone was not phosphorylated (not shown).

LRRK2 enzyme kinetics. LRRK2 kinase assays with recombinant LRRK2 and sl5 were performed as described above, except reactions were incubated for 5 minutes at 30 C in order to measure initial enzyme velocity. To determine an appropriate time point for assessing initial enzyme velocity, time-course LRRK2 kinase assays were performed for a range of sl5 concentrations to monitor the progress curve for LRRK2 -catalyzed sl5 phosphorylation. After 5 minutes, product formation was detectable by autoradiography at all substrate concentrations tested, and estimation of product formation over time indicated that non-phosphorylated substrate concentration was still within 10% of its starting value.

Additionally, measurements of s 15 and LRRK2 stability under assay conditions indicated that both enzyme and substrate were stable over this time period, and hence this was a suitable period for measuring initial enzyme velocity. Estimates of Michaelis-Menten kinetic parameters K _m and V _max for s 15 were derived from measurements of initial LRRK2 reaction velocity at varying sl5 concentrations using non-linear regression (GraphPad Prism).

Identification of phosphorylation sites by tandem mass spectrometry. In vitro kinase assays were performed using either wild type or D1994A (kinase dead) recombinant LRRK2 plus recombinant substrate, and protein mixture were resolved by SDS-PAGE. The protein bands corresponding to GST-sl 1, GST-sl5 or GST-s27 were excised and subjected to in-gel trypsin digestion. The resulting tryptic peptides were desalted on an in-house trap column

(75 μιη inner diameter, 2 cm long) packed with C-18 materials (Magic C18AQ, 5 μιη, 100 A) and separated on an in-house analytical column (75 μιη inner diameter, 15 cm long) packed with the same packing materials. Separated peptides were analyzed on either an LTQ- Orbitrap Elite ETD mass spectrometer or an LTQ-Orbitrap XL ETD mass spectrometer. The acquired mass spectra data were searched against a human RefSeq protein database using both SEQUEST and MASCOT algorithms. The searching criteria were set as following; maximal 2 missed cleavage allowed; 10 ppm mass tolerance for precursor ions; 0.5 Da or 0.05 Da mass tolerance for fragment ions for data from an LTQ-Orbitrap XL ETD mass spectrometer or an LTQ-Orbitrap Elite ETD mass spectrometer, respectively; oxidation at methionine, deamidation at asparagine or glutamine, or phosphorylation at serine, threonine, or tyrosine as variable modifications; carbamidomethylation at cysteine as a fixed modification. The probability of phosphorylation sites was calculated by the PhosphoRS algorithm. All tandem mass spectra obtained were manually validated. No phosphorylation sites were detected on substrates incubated with D 1994A LRRK2. The sequence coverage for substrates phosphorylated by WT LRRK2 was calculated by dividing the number of amino acid residues encompasses within identified peptides by the total number of amino acid residues in a corresponding protein.

Phospho-sl 5 polyclonal antibody generation. The s 15 phospho-peptide

RPGIGA(p)THSSRFIPLKC (SEQ ID NO:23) was conjugated to KLH and injected into rabbits for polyclonal antibody generation. Phospho-sl 5 antibody was purified from crude sera by passing it over a sulfo-link immobilized peptide column containing sl5 phospho- peptide. The eluate was then passed over a sulfo-link immobilized peptide containing non- phosphorylated sl5 peptide. The flow-through from this step was subsequently passed over a second phospho-peptide column to obtain purified phospho-antibody.

Enzyme-linked immunosorbent assay for phospho-sl 5 antibody validation. 50 iL of 500 μg/mL sl5 oligopeptide or 500 μg/mL T136 Phospho-sl5 oligopeptide immunogen were added to separate 96-well plates and incubated on an orbital shaker overnight at 4 C. All subsequent incubation and detection steps were performed at room temperature. Plates were washed twice in PBS and blocked in a 5% non-fat milk solution in PBS on a shaker for 90 minutes. The plates were washed twice in PBS (5 minutes per wash). T136 Phospho-sl5 antibody dilutions in TBS-T with 2.5% non-fat milk were added and incubated for 1 h on a shaker. The plates were washed three times in TBS-T (5 minutes per wash) and anti-rabbit secondary antibody dilutions in TBS-T with 2.5% non-fat milk were added. Secondary antibody was incubated for lh on a shaker and plates were washed three times in TBS-T (15 minutes per wash). 100 μΐ., of 3,3,5,5-tetramethylbenzidine (TMB) was added to each well. OD (650 nm) was read after 5 minutes incubation.

Dot blot for phospho-sl 5 antibody validation. Using gel-loading tips, 10 ng of T136 Phospho-s l 5 oligopeptide immunogen or non-phosphorylated sl5 oligopeptide were spotted on pieces of nitrocellulose membrane. Spots were allowed to dry and the membranes were cut into strips, marked for orientation. All subsequent incubation and detection steps were carried out at room temperature. Membrane strips were blocked in 5% milk in TBS-T for 30 minutes on a shaker, washed in TBS-T, then incubated in T 136 Phospho-sl 5 antibody at the dilutions indicated for lh. Membranes were washed three times in TBS-T (5 minutes per wash) on a shaker. HCL-conjugated anti-rabbit antibody (diluted 1 : 1000 in 2.5%

milk/TBST) was added and incubated on a shaker for 1 h. Membranes were washed three times in TBS-T (15 minutes per wash) on a shaker and antibody detection was performed with enhanced chemiluminescent substrate. LRRK2 toxicity assays. Rat neurons: Neuronal toxicity was assessed using previously described methods (Lee et al, 2010; Li et al, 2010; Ramsden et al., 2011 ; Xiong et al, 2010). Primary cortical neuronal cultures were prepared from gestational day 15 fetal rats as previously described. The cortex was dissected, incubated for 15 minutes in 0.027% trypsin, and then transferred to modified Eagle's medium (MEM)/ 10% horse serum/10% fetal bovine serum/2 mM glutamine followed by trituration. Dissociated cells were plated at a density of 3-4 x 10 ⁵ cells per well in polyornithine-coated plates. After 4 days, the cells were treated with 10 μg of 5-fluoro-2'-deoxyuridine to prevent proliferation of non-neuronal cells. Cells were maintained in MEM/5% horse serum/2 mM glutamine in an 8% C02 incubator. The medium was changed twice weekly. At DIV 10-12, neurons were switched to Opti-MEM reduced serum medium and transfected with plasmid DNA. Myc LRRK2 (or vector), sl5/sl 1 (or vector) and GFP for tracing neurites at a 10: 10: 1 ratio were mixed with

Lipofectamine 2000 at a 1 :3 ratio in Opti-MEM. 4 h after transfection, the medium was replaced with original conditioned medium containing serum. 48 h after transfection, neurons were fixed, permeabilized and immunostained. The vast majority of GFP -positive neurons (-90%) also co-labeled for overexpressed LRRK2 and s l5/sl 1 indicating that the effects of LRRK2 and s 15/s 11 could be assessed in these neurons, as previously described (Xiong et al, 2010). Neurons were subject to TUNEL and DAPI staining following manufacturer's protocols and visualized using a Zeiss Axiocam fluorescent microscope with Axiovision 6.0 software. Viable neurons were defined as having at least one smooth extension (neurite) twice the length of the cell body. The percentage of GFP-positive injured neurons in each experimental group relative to all GFP-positive neurons was calculated. The percentage of GFP-positive neurons exhibiting TUNEL-positive nuclei was also determined. At least 100 neurons were counted per group per independent experiment.

Human neurons: Mature human cortical and dopamine neurons were derived from the

HI embryonic stem cell line using methods described elsewhere (Kriks et al, 201 1 ; Pasca et al, 2011 ; Yahata et al., 201 1) and validated by immunostaining. Human cortical neurons derived from embryonic stem cells by targeted differentiation for 60 d were immunopositive for the neuronal marker MAP2 and synaptic marker synaptophysin. Neurons were immunopositive for cortical layer-specific markers (TBRl (layers I, V and VI), BRN2 (layers II-IV), SATB2 (layers II-IV, V), and CTIP2 (layer V and VI)). Midbrain dopamine neurons were identified by co-labeling of tyrosine hydroxylase (TH) and the midbrain marker FOXA2 as well as the neuronal marker TUJ1 at day 32 of differentiation. LRRK2 toxicity was assessed in human cortical or dopamine neurons at these time points as described for rat cortical neurons. The use of viral vectors such as the HSV amplicon for gene overexpression was precluded by the known induction of interferon response caused by these vectors, which may significantly affect translation via protein kinase R activation (Shayakhmetov et al, 2010; Suzuki et al., 2007, 2008). For human dopamine neurons, neuronal injury and TUNEL phenotypes were assessed on TH-positive neurons.

Bicistronic reporter assay. A bicistronic reporter (pCMV-BICEP 4, Sigma) which expresses a single transcript with two eGFP open reading frames separated by a CMV IRES, was used to determine the relative effects of LRRK2, si 5, sl5 knock-down, hAgo2 and dicer on cap-dependent and cap-independent translation via expression of ORF1 (FLAG-eGFP) and ORF2 (c-Myc-eGFP), respectively.

SH-SY5Y neuroblastoma cells. This bicistronic vector was co-transfected into SH- SY5Y cells with LRRK2 and N-terminal tagged V5-s l5 variants, 4E-BP or hAgo2 at a ratio of 1 :4:4 using X-tremeGENE HP transfection reagent. 36 h after transfection, cells were harvested in chilled PBS, and lysed in extraction buffer (1% NP-40, 50 mM Tris-HCl, 150 mM NaCl, 5 mM EGTA, protease inhibitor cocktail). Equal protein amounts were resolved by SDS-PAGE. Following transfer, membranes were probed with antibodies to detect FLAG, myc, V5, LRRK2 and actin. Relative amounts of eGFP mRNA were determined by reverse transcriptase qPCR using SYBR green dye and the AAC _t method, with the geometric mean of GAPDH, β-actin, a-tubulin and β-2-microglobulin transcripts used as a loading control. For dicer knock-down, 150 nM dicer smart-pool siRNAs were transfected into cells at low confluency, resulting in 80-90% dicer silencing by 48h and concomitant reduction in miRNA levels at this time point (not shown). 48h after initial transfection, a second transfection consisting of bicistronic reporter with or without LRRK2 was performed.

Human cortical neurons. Neurons were transfected with bicistronic vector in addition to LRRK2 and/or s 15 variants using Lipofectamine 2000 in Opti-MEM medium. After 4 h, the medium with transfection complex was replaced with original conditioned medium. 36 h following transfection, neurons were fixed, permeabilized and subject to

immunocytochemistry with antibodies to detect eGFP, LRRK2, MAP2, as well as assaying for TUNEL positive cells. The percentage of GFP-positive cells in each treatment group was determined using a cell counting tool in ImageJ on at least 500 cells per group for each independent experiment. A translation-linked neuronal injury index, which describes the amount of neurons exhibiting reporter translation and neurite shortening was derived as follows: % neuronal injury x % reporter-positive neurons x 100%. A translation-linked cell death index was similarly derived as follows: % TU EL-positive nuclei x % reporter- positive neurons x 100%. LRRK2 toxicity was assessed in reporter (eGFP)-positive, MAP2- positive neurons and reporter-negative, MAP2-positive neurons using the methods described above.

Phospho-sl5 in human cortical neurons. Phosphorylation of endogenous sl5 at T136 following LRRK2 overexpression was measured in human cortical neurons (derived and characterized as described above). Cultures were transduced with an HSV amplicon vector previously described (Lee et al, 2010) containing untagged LRRK2, D 1994A LRRK2, G2019S LRRK2 or GFP. 48 h after transduction, neurons were harvested by gentle scraping in chilled PBS, briefly centrifuged and resuspended in lysis buffer (1% NP-40, 50 mM Tris- HC1, 150 mM NaCl, 5 mM EGTA, 20 mM protease inhibitor cocktail, β-glycerophosphate, 10 mM sodium fluoride, 1% serine/threonine phosphatase inhibitor cocktail (Sigma)).

Samples were incubated on ice for 30 minutes, centrifuged at 18, 000 x g, and supernatants were subject to SDS-PAGE followed by immunoblotting for endogenous T136 Phospho-s l5, total s 15 , LRRK2 and actin.

LRRK2 and si 5 coiocaiization in human cortical neurons or Drosophila S2 cells. Human cortical neurons derived as described above or Drosophila S2 cells were fixed in 4% paraformaldehyde, washed three times in PBS, blocked in 10% donkey serum/0.3% triton-X- 100 and immunostained for endogenous sl5 (Abeam or Sigma) and LRRK2 ( euroMab) or endogenous dLRRK (gift from Bingwei Lu) overnight at 4 C followed by three 5 minute washes in PBS then incubation in alexa-fluor 488 and alexa-fluor 568. Neurons were visualized using confocal microscopy. Assessment of G2019S LRRK2 coiocaiization was carried out as above, 2d after LRRK2 transfection using Lipofectamine 2000 as before.

LRRK2 and si 5 co-immunoprecipitation. Protein G-antibody complexes (Dynabead protein G) were prepared and incubated overnight at 4°C. The following day, HEK293FT cells were lysed in cell lysis buffer (lOmL Tris-HCl pH 7.5, 150mL NaCl, 5mM EGTA, 1% Nonidet P-40 (vv) and Complete Protease Inhibitor Mixture). Co-immunoprecipitation was performed by incubating lysates with the respective Dynabead-protein G-antibody complexes overnight at 4°C, either LRRK2 (Cell Signaling) or sl5 (Sigma). The immunocomplexes were washed with wash buffer (PBS and Complete Protease Inhibitor Mixture) for four times and protein was eluted by adding sample loading buffer and heating to 70°C for 10 min.

Drosophila stock and husbandry. All flies were reared and aged at 25°C/60% relative humidity under a 12 h light-dark cycle on standard cornmeal medium. Human sl5 and T136A s l5 constructs were generated by subcloning full-length cDNA into pUAST between EcoRl and Xbal restriction sites. After sequence verification, constructs were microinjected into w ¹¹¹⁸ fly embryos. Transgenic UAS-sl5 and UAS-T136A sl5 expression were confirmed by western blot on fly heads following expression driven via daughterless- Gal4 (FIG. 12A). Transgenic human LRRK2 (WT and G2019S) lines previously characterized (Liu et al, 2008) were generously provided by Wanli Smith. All other lines were obtained from the Bloomington Drosophila stock center.

Phospho-sl5 in Drosophila or human post-mortem brain. Whole Drosophila heads from control or LRRK2 transgenic flies were lysed in extraction buffer and ribosomal fractions were isolated essentially as described before (Belin et al., 2010) with the addition of phosphatase inhibitors to the extraction buffer. Ribosomal fractions were washed twice in 1 ml of chilled water before resuspension in buffer C. Total protein concentrations were determined using the Lowry assay. 40 μg of total protein for lysates and ribosomal fractions were loaded onto polyacrylamide gels, separated by SDS-PAGE and immunoblotted. For human brain samples, whole lysates were run on separate gels due to the limited number of lanes per mini-gel.

Drosophila dopamine neuron immunohistochemistry . Brains were harvested, fixed and permeabilized at 7 weeks of age and immunohistochemistry for tyrosine hydroxylase expressing neurons was performed following methods previously described (Wu and Luo, 2006). Confocal z-stacks were acquired at 1 μιη slice intervals and projection images through the anterior portion of the brain for the PAL (protocerebral anterior lateral) cluster and posterior brain for the PPM1/2 (protocerebral posterior medial 1/2), PPM3, PPL1 (protocerebral posterior lateral 1) and PPL2 clusters were derived and used for dopamine neuron counts.

Drosophila negative geotaxis. Cohorts of 75 female flies back-crossed to an isogenic w ¹¹¹⁸ background for six generations were collected under brief anesthesia and transferred to fresh food vials to recover. After 24 h, flies were transferred to empty vials, allowed 1 min to rest and then tapped to the bottom of the vial to initiate climbing. The position of each fly was captured in a digital image 4 s after initiation using a fixed camera. A second group of flies collected at the same time were aged for 6 weeks (or as indicated) and tested using the same protocol. Automated image analysis was performed on digital images using the particle analysis tool on Scion Image to derive x-y co-ordinates for each fly thus providing the height climbed, as described before (Gargano et al, 2005). Young and aged flies were tested at the same time of the day. 35S-methionine/cysteine labeling in Drosophila. 35S-methionine/cysteine (100 μθί/ηιΐ) was added to standard food medium during cooling. The following day, flies were transferred to labeled food for 24h, and then heads were collected on dry ice and

homogenized by pestle and mortar in 1% NP-40 extraction buffer on ice. Protein was precipitated by the addition of methanol and heparin (lysate:heparin(100mg/ml):methanol volume ratio of 150: 1.5:600), centrifuged at 14,000 x g for 2 minutes, and supernatant was removed and the pellet air dried. Protein pellet was resuspended in 8M urea/150 mM Tris, pH 8.5 and incorporation relative to total protein amount was measured by scintillation counting following assay of protein concentration by BCA assay.

Anisomycin treatment in Drosophila. Anisomycin (or DMSO vehicle) was added to standard food medium at a final concentration of 10 μΜ anisomycin/0.1%DMSO. Flies were transferred to fresh food containing anisomycin/vehicle at 3-4 d intervals and aged for assessment of dopamine neuron viability and negative geotaxis performance, as described above.

mRNA polysome profiling by RT-PCR. Fly heads were homogenized in polysome lysis buffer (10 mM Tris-HCl/150 mM NaCl/5 mM MgCl ₂ /0.5 mM DTT/100 μϋ

cycloheximide/EDTA-free protease inhibitor cocktail/40U/ml Superase-in) and following clearing of the homogenate by centrifugation at 2,000 x g for 10 minutes, 1% NP-40 was added to the supernatant and incubated on ice for 10 minutes. The lysate was cleared by centrifugation at 16,000 x g for 10 mins at 4°C, lysate was then layered onto a 10-60% sucrose gradient, centrifuged in a SW-41Ti rotor at 40,000 rpm for 2 hours at 4°C, and sampled using a Biocomp gradient station connected to a Gilson fraction collector with constant monitoring of optical density at 254 nm. 1 ml fractions were collected and spiked with 20 ng of polyA synthetic luciferase RNA to control for variations in downstream processing as previously described (Thoreen et al, 2012). Total RNA was extracted from each fraction using Trizol LS (Life Technologies) and precipitated with isopropanol following the manufacturer's protocol. cDNA was derived using Superscript III first-strand kit for RT-PCR using random hexamer primers and following the manufacturer's protocol. Transcript levels were measured by quantitative PCR using SYBR green master mix (Applied Biosystems) and primers for actin 5C, tubulin or luciferase. Actin 5C and tubulin levels in each fraction were normalized to luciferase and the percentage of translated mRNA in each fraction was calculated relative to the total RNA in all monosome and polysome fractions combined. Assessment of ribosomal runoff. SH-SY5Y cells were transfected with LRRK2 and the following day, passaged to a new culture vessel at -40% confluency to allow exponential growth. 24h after passaging, cells were treated with harringtonine (2 μg/ml) to freeze initiating ribosomes and allow runoff of elongating ribosomes. Total ribosomal translocation was blocked by adding cycloheximide (100 μg/ml) at fixed time intervals following harringtonine, and polysome profiles were generated by sedimentation of cell lysates made using polysome lysis buffer on 10-60% sucrose gradients. In a parallel experiment, transfected cells were pulse labeled with ³⁵ S-methionine/cysteine (50 μΟϊΛνεΙΙ) then immediately treated with harringtonine and cycloheximide together or harringtonine followed by cycloheximide at fixed time intervals. Cells were lysed and increase in ³⁵ S- methionine/cysteine incorporation was measured and compared between groups as an indicator of relative ribosomal elongation rates.

LRRK2 subcellular fraction studies. HEK293 cells were fractionated using a centrifugation protocol described elsewhere (Belin et al, 2010) to derive nuclear, mitochondrial and ribosomal fractions. Protein concentrations for lysates and fractions were determined using the Lowry assay. 40 μg of total protein for lysates and fractions were resolved by SDS-PAGE. Membranes were blotted for LRRK2 and nuclear, mitochondrial and ribosomal fraction markers.

Real time PCR primer sequences, d.m. actin 5C (fwd 5'- GTGAAATCGTCCGTGACATC-3 ' (SEQ ID NO:7); rev 5'-

GGCAGCTCGTAGGACTTCTC-3 ' (SEQ ID NO:8)). d.m. a-tubulin (fwd 5'- CACTTCCAATAAAAACTCAATATGCGTGA (SEQ ID NO: 9); rev 5'- ACAGTGGGTTCCAGATCCAC-3 ' (SEQ ID NO: 10)). luciferase (fwd 5'- TGGAGAGCAACTGCATAAGG-3 ' (SEQ ID NO: 11); rev 5'- CGTTTCATAGCTTCTGCCAA-3 ' (SEQ ID NO: 12)). eGFP (fwd 5'- ACGTAAACGGCCACAAGTTC-3 ' (SEQ ID NO: 13); rev 5'- AAGTCGTGCTGCTTCATGTG-3 ' (SEQ ID NO: 14)). h.s. GAPDH (fwd 5'- AAACCCATCACCATCTTCCAG-3 ' (SEQ ID NO: 15); rev 5'- AGGGGCCATCCACAGTCTTCT-3 ' (SEQ ID NO: 16)). h.s. a-tubulin (fwd 5'- CGCCCAACCTACACTAACCT-3' (SEQ ID NO: 17); rev 5'-

ATTCAGGGCTCCATCAAATC-3' (SEQ ID NO: 18)). h.s. β-2-microglobulin (fwd 5'- GACTTTGTCACAGCCCAAGA-3' (SEQ ID NO: 19); rev 5'- CAAGCAAGCAGAATTTGGAA-3 ' (SEQ ID NO:20)). h.s. β-actin (fwd 5'- AGCCTCGCCTTTGCCGA-3 ' (SEQ ID NO:21); rev 5 '-GCGCGGCGATATCATCATC-3 ' (SEQ ID NO:22)).

Results

Identifying candidate LRRK2 kinase substrates. LRRK2-interacting phosphoproteins were identified by tandem affinity purification (TAP) of LRRK2 from HEK293 cells. A LRRK2 TAP tag was generated by fusing a streptavidin binding peptide and a calmodulin binding peptide to the C-terminus of LRRK2. TAP -tagged LRRK2 complex retains kinase activity (FIG. 1A-C). LRRK2-interacting phosphoproteins were enriched by immobilized metal affinity chromatography (IMAC) (FIG. ID) and then separated via SDS-PAGE. The gel was divided into multiple even-sized pieces and protein bands were identified by mass spectrometry. To control for non-specific binding, proteins identified by TAP of two unrelated proteins, Botch and GADD45B were subtracted from the mass spectrometry data set for LRRK2, leaving 161 interacting proteins (Table 1). A Cytoscape network analysis reveals that the major LRRK2 interacting proteins identified by this approach are functionally categorized into four major groups; structural constituents of the ribosome, proteins involved in transporter activity, nucleotide binding and cation binding (FIG. 8A). To determine which of these interacting proteins are direct LRRK2 substrates, GST-fusion proteins were generated by Gateway cloning and screened via an in vitro LRRK2 kinase assay to assess phosphorylation in the presence of wild type LRRK2, kinase-dead LRRK2 (D1994A), and two disease-causing variants with kinase domain mutations, G2019S LRRK2 and I2020T LRRK2 (FIG. 8B). Approximately 60% of all GST-fusion proteins were amenable to purification (Table 1). 1 1 proteins are phosphorylated by wild type, G2019S and I2020T LRRK2, but not by kinase-dead D1994A LRRK2. 10 candidate substrates are ribosomal proteins and the other protein is lactate dehydrogenase B (LDHB) (FIGS. IE and 8C).

Consistent with our finding that LRRK2 interacts with and phosphorylates ribosomal proteins, endogenous LRRK2 is highly enriched in the ribosomal subcellular fraction suggesting that LRRK2 might play an important role in ribosomal function and mRNA translation (FIG. IF). Similar levels of enrichment are observed for overexpressed wild type, D1994A and G2019S LRRK2 (data not shown), suggesting that the physical association of LRRK2 with ribosomes is not kinase-dependent. To further determine the scope of LRRK2 actions at the ribosome, all known ribosomal proteins belonging to the human 40S and 60S subunits amenable to purification were subjected to in vitro LRRK2 kinase assays (Table 2). A total of 19 ribosomal proteins are phosphorylated by LRRK2 (Table 2). Three substrates belonging to the 40S ribosomal subunit, si 1, sl5 and s27, exhibit significantly increased phosphorylation by the pathogenic mutants G2019S and I2020T LRRK2 (FIG. IE). We reasoned that substrates exhibiting elevated phosphorylation with pathogenic LRRK2 variants might be involved in LRRK2 toxicity. To identify phosphorylation sites on these 3 ribosomal proteins, tandem mass spectrometry analysis was performed following LRRK2 phosphorylation in vitro (FIG. 9A-B). LRRK2 phosphorylates threonine 136 of s 15 and threonines 28, 46 and 54 of s 1 1 (FIG. 9A-B). We are unable to detect phosphorylation of s27 by LRRK2 via mass spectrometry (data not shown).

sl5 is a pathogenic LRRK2 substrate in human dopamine neurons. A substitution of threonine 136 to alanine in s 15 significantly reduces wild type, G2019S and I2020T LRRK2 phosphorylation of sl5 (FIG. 2A). A triple mutation of threonines 28, 46 and 54 to alanines in si 1 eliminates phosphorylation of si 1 by wild type, G2019S and I2020T LRRK2 (FIG. 9C). To ascertain whether s 15 or s i 1 phosphorylation are required for LRRK2 toxicity, the effects of T136A sl5 and triple mutant (T28A, T46A, T54A) si 1 were examined. G2019S LRRK2 has been repeatedly shown to cause kinase-dependent neuronal toxicity characterized by neurite loss and cell death in rodent and human neurons (Greggio et al, 2006; Lee et al, 2010; Ramsden et al, 201 1; Smith et al, 2006; West et al, 2007). Phospho-deficient T136A sl5 is markedly protective against G2019S LRRK2 toxicity (neurite loss and cell death) whereas triple mutant si 1 failed to influence LRRK2 toxicity in rat cortical neurons (FIGS. 2B and 9C). Overexpression of sl5 is modestly toxic to rat cortical neurons but

overexpression of T136A s 15, s i 1 or triple mutant s i 1 are not (FIG. 2B and 9C). T136A sl5 is additionally protective against the kinase domain mutant I2020T LRRK2, but not the pathogenic ROC domain mutant R1441C LRRK2 (FIG. 9D). Coexpression of wild type s 15 did not substantially influence toxicity for any of the LRRK2 variants tested. To further explore the role of s 15 phosphorylation in LRRK2 toxicity, the effect of phosphomimetic T136D sl5 was examined. T136D s 15 alone is sufficient to induce neuronal toxicity and when expressed together with G2019S LRRK2, did not exacerbate LRRK2 toxicity (FIG. 2C) consistent with G2019S LRRK2 toxicity being mediated via sl5 phosphorylation. To extend our investigation and probe the role of sl5 in human neurotoxicity caused by G2019S LRRK2, human midbrain dopamine neurons and cortical neurons were derived from human embryonic stem cells and characterized (FIGS. 10A and B). G2019S LRRK2 causes neurotoxicity in human midbrain dopamine neurons (FIG. 3A) and in human cortical neurons (FIG. 3B), where it results in significantly elevated endogenous phospho-T136 sl5 levels (FIG. IOC), observed using a validated phospho-specific antibody to phospho-T136 (FIG. 10D-F). LRRK2 toxicity in both human dopamine and cortical neurons is significantly attenuated by T136A sl5 but not wild type sl5. Phospho-mimetic T136D sl5 is toxic to both types of neurons (FIGS. 3 A and B). Partial knock-down (-50%) of sl5 in human cortical neurons partially rescues neuronal toxicity caused by G2019S LRRK2, similar to that observed for T136A sl5 (FIG. 10G), while expression of G2019S LRRK2 is not affected (FIG. 10G). Finally, increasing wild-type LRRK2 overexpression leads to a modest increase in sl5 phosphorylation and neuronal toxicity, but not to the extent observed via G2019S LRRK2 (FIG. 10H and I). Taken together, these data reveal that s 15 is a pathogenic LRRK2 substrate for LRRK2 mutations within the kinase domain of LRRK2 and that LRRK2 and s 15 act in the same cell death pathway.

s 15 is an authentic LRRK2 substrate in vivo. Since phosphorylation of s 15 by

LRRK2 was found to be required for LRRK2 neurotoxicity, the interaction and

phosphorylation of s 15 by LRRK2 was further investigated. Recombinant s 15 is

phosphorylated by wild type LRRK2 with a K _m of 1.5 μΜ and by G2019S LRRK2 with a K _m of 0.7 μΜ, suggesting a stronger substrate affinity between s 15 and G2019S LRRK2 compared to that with wild type LRRK2 (FIG. 4A). G2019S and I2020T LRRK2 both increase phospho-sl5 levels in cells whereas overexpression of the ROC domain mutants R1441C or R1441G do not (FIG. 4B). These phosphorylation results are consistent with the ability of the T136A sl5 mutant to rescue G2019S and I2020T LRRK2 neurotoxicity but not R1441C neurotoxicity (see FIGS. 2 and 9). LRRK2-IN-1 and CZC-25146, two potent LRRK2 kinase inhibitors with non-overlapping off-target kinase inhibition (Deng et al, 2011 ; Ramsden et al, 201 1) block G2019S LRRK2 phosphorylation of s 15 both in kinase assays in vitro and in cell culture (FIGS. 4C, 1 1A and B). The G2019S/A2016T LRRK2 variant is resistant to LRRK2-IN-1 kinase inhibition, and phosphorylation of s 15 by this LRRK2 variant is unaffected by LRRK2-TN-1 treatment (FIG. 4C), further supporting that reduced sl5 phosphorylation is caused specifically by LRRK2 kinase inhibition. Endogenous LRRK2 and s 15 both exhibit punctate immunostaining with partial perinuclear co- localization in human cortical neurons (FIGS. 4D and 1 1C), which is also found for overexpressed G2019S LRRK2 and sl5 (FIG. 11C). Endogenous sl5 and LRRK2 co- immunoprecipitate and s 15 interacts with the WD40 protein interaction domain of LRRK2 (FIG. 1 ID). Post-mortem cortex from human G2019S carriers exhibit increased s 15 phosphorylation in ribosomal fractions (FIG. 4E). LRRK2 expression was not significantly different in G2019S carrier ribosomal fractions or whole lysates compared to control patient brain samples (FIGS. 4E and 1 IF). Finally, ribosomal fractions from dLRRK (Drosophila LRRK2 homolog) null fly heads exhibit significantly reduced sl5 phosphorylation (FIG. 5 A) whereas phospho-sl5 is significantly increased in head ribosomal fractions from G2019S transgenic flies but not kinase-dead G2019S/D1994A LRRK2 flies (FIG. 5B). As in human cells, endogenous sl5 and dLRRK exhibit partial colocalization around the nucleus of Drosophila S2 cells (FIG. 11G). These data collectively demonstrate that sl5 is an authentic and direct in vivo LRRK2 kinase substrate.

Phospho-deficient s!5 blocks neurodegeneration in G2019S LRRK2 transgenic Drosophila. To determine whether sl5 phosphorylation underlies LRRK2-dependent neurodegeneration and PD-related phenotypes in vivo, we used the robust and efficient Drosophila LRRK2 transgenic model in which flies expressing human G2019S LRRK2 rapidly exhibit aging-related dopaminergic neurodegeneration and locomotor deficits linked to increased LRRK2 kinase activity (Liu et al, 2008). Dopamine neuron degeneration and locomotor dysfunction observed in aged G2019S LRRK2 transgenic Drosophila are completely rescued by co-expression of T136A sl5 whereas wild type sl5 is not protective (FIGS. 5C and D and 12A). Neither sl5 nor T136A sl5 co-expression affects G2019S LRRK2 levels (FIG. 12B). There were no effects of LRRK2, s l5 or T136A s l5

overexpression observed in young flies in these assays, consistent with previous reports for LRRK2 transgenic flies at this age (Liu et al, 2008) (FIGS. 12C and D). Also, neither sl5 nor T136A sl5 expression alone significantly affects negative geotaxis or dopamine neuron survival in aged flies, although there was a slight reduction in climbing ability with sl5 overexpression (FIGS. 12E and F). s 15 is an integral ribosomal protein and knocking-down sl5 by RNAi is lethal in Drosophila, via whole-body or targeted neuronal expression (data not shown).

LRRK2 stimulates cap-dependent and cap-independent translation. The role of s 15 in LRRK2 toxicity raises the possibility that pathogenic LRRK2 might modulate the activity of ribosomes to impact protein synthesis in an sl5-dependent manner. Although little is known about the role of sl5 in translation, it is located on the surface of the 40S ribosomal subunit and its C-terminal tail (where T136 lies) is highly conserved among eukaryotes and may extend into the ribosomal decoding site during mRNA translation (Khairulina et al, 2010; Pisarev et al, 2006). mRNA translation can occur by both cap-dependent and cap- independent mechanisms of ribosome binding. To simultaneously probe the effects of

LRRK2 on cap-dependent and cap-independent translation, a bicistronic reporter composed of a FLAG readout to monitor cap-dependent translation followed by an IRES site with a c- Myc readout to monitor cap-independent translation from the same transcript was utilized (FIG. 6A). G2019S LRRK2 dose-dependently increases both cap-dependent and cap- independent reporter translation in a kinase-dependent manner (FIG. 6B), while reporter mRNA levels are not significantly affected by LRRK2 expression (FIG. 13 A). Wild type sl5 stimulates both cap-dependent and cap-independent reporter translation in a dose-dependent manner (FIG. 6C). Importantly, these effects are augmented by the phosphomimetic T136D mutation and subtly decreased by T136A si 5, without significant changes in reporter transcript levels (FIG. 6C and 13 A). To determine whether s 15 phosphorylation mediates the effects of LRRK2 on translation, cap-dependent and cap-independent reporter translation induced by G2019S LRRK2 was monitored in the presence of wild type sl5 or T136A sl5. Wild type sl5 modestly enhances the stimulation of translation by G2019S LRRK2, whereas T136A sl5 blocked stimulation of both cap-dependent and cap-independent translation by G2019S LRRK2 (FIG. 6D). Reporter mRNA levels are not significantly different between the groups (FIG. 6D). Partial knock-down of s 15 similarly attenuates cap-dependent and cap- independent reporter translation (FIG. 13B) further supporting the link between sl5 and LRRK2 effects on translation. LRRK2 was previously reported to phosphorylate human 4E- BP1 and it was suggested that phospho-4E-BP 1 affects the expression of certain genes by repressing miRNA activity (Gehrke et al, 2010). As expected, knock-down of dicer led to reduced miRNA levels (data not shown) but failed to stimulate bicistronic reporter expression (FIG. 13C) suggesting that G2019S LRRK2 does not promote reporter translation by impairing the miRNA pathway. Similarly, overexpressing hAgo2, which was proposed to be functionally impeded by phospho-4E-BP binding, did not attenuate cap-dependent or cap- independent reporter expression (FIG. 13D). Since phosphorylation of 4E-BP blocks its ability to bind to and repress eIF4E, it is possible that elevated levels of eIF4E could stimulate translation upon an increase in phospo-4E-BP (Imai et al, 2008). However, while 4E-BP overexpression was previously reported to rescue loss of dopamine neurons observed in flies expressing pathogenic dLRRK variants (Imai et al, 2008), it did not reduce G2019S LRRK2 -mediated reporter expression in cells (FIG. 13D). Moreover, we did not detect an increase in phospho-4E-BP 1 levels following G2019S LRRK2 expression in cells (FIG. 13E) or G2019S LRRK2 transgenic fly heads (FIG. 13F), consistent with other subsequent studies (Kumar et al, 2010; Trancikova et al, 2012) that failed to find an increase in 4E-BP 1 phosphorylation in mammalian cells expressing pathogenic LRRK2 variants or LRRK2 transgenic mouse brain. Additionally, an increase in 4E-BP phosphorylation would not account for an increase in cap-independent translation since neither eIF4E nor 4E-BP1 are known to be involved in this mode of translation. Finally, partial loss of eIF4E expression did not block neurodegenerative phenotypes (age-related loss of dopamine neurons and locomotor deficits) observed in aged G2019S transgenic flies (FIGS. 13G-I). Collectively, these results suggest that miRNA pathway impairment or elevated free eIF4E levels via 4E- BP1 phosphorylation does not play a major role in LRRK2-induced translation.

Reporter expression in human ES cell-derived cortical neurons is stimulated in G2019S LRRK2-expressing neurons and this is blocked by T136A s 15 coexpression (FIG. 6E). If the stimulatory effect of G2019S LRRK2 on translation underlies its neuronal toxicity, then it might be expected that reporter-positive neurons would exhibit

disproportionately high levels of toxicity. Indices of translation-linked neuronal injury and translation-linked cell death in reporter-positive neurons indicate that cell injury and death are coupled to increases in translation (FIG. 6E). G2019S LRRK2 stimulates reporter translation and increases both toxicity indices by almost 3 -fold compared to kinase-dead

G2019S/D1994A LRRK2 in human cortical neurons (FIG. 6E). This effect is blocked by T136A sl5 coexpression. Comparison of reporter-positive neurons with neighboring reporter-negative neurons reveals 5-fold higher levels of neurite toxicity in reporter-positive neurons, and a similar difference in levels of cell death under all conditions, further suggesting a link between translation stimulation and LRRK2 toxicity (FIG. 13J). Taken together, these results suggest that phosphorylation of sl5 on T136 by LRRK2 mediates enhanced cap-dependent and cap-independent reporter translation and that a stimulatory effect of LRRK2 on mRNA translation contributes to LRRK2 toxicity.

G2019S LRRK2 increases bulk translation in Drosophila. From our in vitro reporter assays, we hypothesized that pathogenic LRRK2 may cause a bulk shift in translation that, as shown in other neurodevelopmental and neurodegenerative diseases, can impair neuronal function. Consistent with our in vitro observations, ³⁵ S-Methionine/Cysteine pulse labeling of newly synthesized protein was significantly increased in G2019S LRRK2 transgenic Drosophila heads (FIG. 7A), suggesting an increase in protein synthesis rates by LRRK2. In accordance with its ability to block LRRK2 toxicity, T136A sl5 co-expression abolishes this increase (FIG. 7A). SDS-PAGE analysis of lysates indicates a bulk increase in many proteins across a large range of molecular weights by G2019S LRRK2 (FIG. 7B). Assessment of housekeeping gene mRNAs undergoing translation in monosome and polysome fractions from fly heads reveals that G2019S LRRK2 expression leads to an enrichment of mRNAs in heavy polysome fractions, an effect which is attenuated by T136A sl5 (FIG. 7C). This increase in density of ribosomes associated with mRNA indicates that LRRK2 stimulates mRNA translation and that an increased rate of protein synthesis underlies the augmented protein levels observed via ³⁵ S-methionine/cysteine labeling. Increased ribosomal density typically indicates an increase in translation initiation, but could theoretically signal a slower rate of ribosomal elongation or release upon termination. Reduced elongation/termination rates are not consistent with an increase in protein production, however, and G2019S LRRK2 did not affect rates of ribosomal runoff following treatment of cells with harringtonine, a drug which prevents translocation of ribosomes engaged in initiation but not elongation (FIG. 14A-D). Hence, these data are consistent with an effect of LRRK2 on initiation, the rate- limiting step in translation. To independently test whether a bulk increase in protein synthesis underlies G2019S LRRK2 toxicity, flies were treated with the global protein synthesis inhibitor anisomycin and chronic low-dose anisomycin treatment throughout adulthood rescued locomotor deficits and dopamine neuron loss in aged G2019S LRRK2 transgenic Drosophila, whereas no effects of the drug were seen in control flies (FIG. 7D and E). Anisomycin treatment did not affect LRRK2 expression levels (FIG. 14E) or sl5 phosphorylation (FIG. 14F) but did reduce the increase in translation observed in G2019S LRRK2 transgenic flies (FIG. 14G). The rescue effect of anisomycin supports our conclusion that elevated bulk protein synthesis underlies G2019S LRRK2 toxicity.

Discussion

The major finding from this study is the identification, via a screen for LRRK2 kinase substrates, of sl5 as a novel in vivo LRRK2 substrate that underlies PD-related phenotypes in Drosophila and directly links LRRK2 toxicity to altered mRNA translation. Screening for LRRK2 -interacting proteins revealed numerous ribosomal proteins and led to the discovery that LRRK2 is enriched in the ribosomal subcellular fraction. Further screening of all ribosomal proteins as candidate LRRK2 substrates revealed that sl5 is a strong LRRK2 substrate, which although not identified in the original screen, interacts directly with LRRK2 in co-immunoprecipitation studies. In vitro phosphorylation assays indicate that wild type LRRK2 phosphorylates a number of ribosomal proteins, of which sl5 phosphorylation transduces LRRK2 -related toxicity and regulation of cap-dependent and cap-independent translation, s 15 fulfills several criteria as a substrate for LRRK2 including enhanced phosphorylation in LRRK2 transgenic Drosophila brain and human brain expressing the common G2019S mutation, and in HEK293 cells expressing G2019S LRRK2, where it is blocked by two specific and unrelated LRRK2 kinase inhibitors. Moreover, s 15

phosphorylation is significantly reduced in flies null for the Drosophila LRRK2 homolog, dLRRK. sl5 phosphorylation is central to G2019S LRRK2 toxicity since T136A sl5 blocks G2019S LRRK2 toxicity in human dopamine neurons and additionally blocks

neurodegeneration, locomotor deficits and elevated protein synthesis observed in a Drosophila in vivo PD model. While wild type sl5 co-expression appears to provide a minor protective effect in rat cortical neuron cultures overexpressing G2019S LRRK2 (FIG. 2B), it was not protective in other neuronal culture experiments or in G2019S LRRK2 transgenic flies, in contrast to T136A s 15 co-expression, which produces a clear and significant protective effect in all neuronal culture experiments and Drosophila neurodegenerative phenotypes examined. It is possible that the small protective effect seen in rat cortical neurons may be related to a minor competitive effect of extra cytosolic s 15 that might reduce phosphorylation of s 15 by LRRK2 directly at the ribosome in this context. Informatively, wild type LRRK2 overexpression in Drosophila causes a slight increase in s 15

phosphorylation and, as observed in previous studies (Liu et al, 2008), leads to a modest effect on locomotion and dopamine neuron viability, which are more pronounced, with G2019S LRRK2 expression. This supports a well-established link between LRRK2 kinase activity and neurotoxicity and suggests that wild type LRRK2 overexpression could in theory result in pathology if expressed at high enough levels. Consistent with this, elevated wild- type LRRK2 overexpression in neuronal cultures results in slightly increased s 15 phosphorylation and neuronal toxicity, but not to the extent observed with G2019S LRRK2 expression, suggesting, as previously reported, that additional mechanisms may differentially regulate the kinase activities of wild type and mutant forms of LRRK2 in vivo, effectively dampening the kinase activity of wild type LRRK2 (Sen et al, 2009; Webber et al, 2011). While we observe an increase in P-sl5 and rescue effect of T136A s 15 for the kinase domain mutants G2019S and I2020T LRRK2, R1441C LRRK2 does not show similar phenotypes, suggesting that alternative pathogenic mechanisms leading to PD may result from this mutation, possibly involving other pathogenic substrates or perhaps even kinase-independent pathways. Future detailed studies are necessary to understand the consequences of ROC domain mutations on LRRK2 function and neurotoxicity.

Studies in Drosophila models of LRRK2 toxicity suggest that LRRK2 mutants with increased kinase activity can stimulate 4E-BP1 phosphorylation and expression of transcription factors e2fl and dp through unclear mechanisms possibly involving elevated levels of free eIF4E or perturbed miRNA function (Gehrke et al, 2010; Imai et al., 2008; Tain et al, 2009). Evidence showing that 4E-BP is a direct LRRK2 substrate or that 4E-BP has a role in miRNA function is lacking, however, and importantly there has been no demonstration that LRRK2-mediated phosphorylation of 4E-BP directly mediates altered translation of the few mRNAs mentioned. Subsequent studies have failed to detect an increase in P-4E-BP in cells or mouse brain following increased LRRK2 kinase activity (Kumar et al, 2010; Trancikova et al, 2012). Our data from in vitro reporter assays and Drosophila suggest that G2019S LRRK2 actually promotes an increase in bulk translation, and provide a mechanism by which G2019S LRRK2 directly stimulates cap-dependent and cap-independent translation at the ribosomal level through phosphorylation of si 5. Our results also indicate that pathogenic LRRK2 does not cause a systematic effect on either mode of translation via 4E-BP phosphorylation or disruption of the miRNA pathway. Thus, the observation that overexpression of 4E-BP or reduction in dLRRK levels can be protective in Drosophila models of ΡΓΝΚ1 and Parkin pathology may be accounted for by a potential for modulated 4E-BP expression to dampen aberrant protein production as opposed to direct interference with LRRK2 substrate phosphorylation-mediated signaling (Tain et al, 2009). Consistent with this notion are our observations that the global protein synthesis inhibitor anisomycin rescues the locomotor deficits and dopamine neuron loss in aged G2019S LRRK2 transgenic Drosophila. Further studies investigating a possible role of altered translation following other genetic mutations linked to PD are warranted by this finding.

Defects in translational regulation underlie a number of inherited diseases. These diseases exhibit a high degree of heterogeneity despite the fact that protein synthesis is a fundamental process of all cells (Scheper et al., 2007). In the nervous system, excessive protein synthesis has long been implicated in the development of Fragile X syndrome (reviewed in (Bhakar et al, 2012)). More recently, systematically altered translation has been identified as a fundamental mechanism driving prion disease neurodegeneration

(Moreno et al, 2012) and perturbed RNA metabolism through mutations in RNA binding proteins such as TAR DNA binding protein-43 (TDP-43) and fused in sarcoma/translocated in sarcoma (FUS/TLS) has been implicated in the pathogenesis of amyotrophic lateral sclerosis and frontotemporal dementia (Lagier-Tourenne et al, 2012; Polymenidou et al, 2011 ; Tollervey et al, 201 1). Thus, loss of translational control is emerging as an important mediator of diverse neurologic diseases. A molecular understanding of how aberrant protein synthesis leads to neurodegeneration in these diseases will be an important future priority.

In summary, these findings support a role for dysregulated translation in the pathogenesis of PD. Consistent with this notion is the recent observation that mutations in the translation initiation factor eIF4Gl cause autosomal dominant PD (Chartier-Harlin et al, 201 1; Nuytemans et al, 2013). Whether mutations in LRRK2 and eIF4Gl converge on common or overlapping pathogenic outputs are under detailed investigation. As mentioned above, elevated or impaired translation has been identified as a causative factor in numerous neurological diseases and emphasizes the importance of protein homeostasis in neuronal function. Thus, further understanding the role of translation in the degenerative process of PD will provide new targets for disease modification in PD.

Table 1. LRRK2-Interacting Proteins

NP 006000.2 tubulinalpha- 1 Achain Y

NP 001000.2 40SribosomalproteinS5 Y

NP 659409.2 L-lactatedehydrogenaseA-like6A Y

NP 056046.1 nuclearporecomplexproteinNup 160 Y

NP 002943.2 40SribosomalproteinS2 Y

NP 003507.1 histoneH2Atype2-A Y

NP 060058.1 WDrepeat-containingprotein5 Y

NP 004238.3 116kDaU5smallnuclearribonucleoproteincomponentisoforma Y

NP 004059.2 AP-2complexsubunitmuisoforma N

NP 000993.1 60 SacidicribosomalproteinPO N

NP 000969.1 60SribosomalproteinL23 N

NP 036601.2 pre-mRNA-processingfactor6 N

NP 002287.2 lamin-Breceptor Y

NP 036558.3 splicingfactor3 B subunit3 N

NP 659412.3 schlafenfamilymember5 Y

NP 003964.3 60 SribosomalproteinL 14 Y

NP 001013.1 40SribosomalproteinS19 Y

NP 000999.1 40SribosomalproteinS4,Yisoforml Y

NP 001395.1 elongationfactor 1 -gamma Y

NP 000537.3 cellulartumorantigenp53iso forma Y

NP 060422.4 pentatricopeptiderepeat-containingprotem3,mitochondrialprecu rsor Y

NP 073591.2 sideroflexin-1 N

NP 004387.1 probableATP-dependentRNAhelicaseDDX5 Y

NP 115700.1 cancer -relatednucleoside-triphosphatase Y

NP_006627.2 bifunctionalmethylenetetrahydrofolatedehydrogenase/cyclohydr olase,mitoch Y ondrialprecursor

NP 000975.2 60SribosomalproteinL23a Y

BAD96826.1 RibosomalproteinS5variant Y

NP 059118.2 calmodulin-likeprotein5 Y

NP 056417.2 torsin- 1 A-interactingprotein 1 Y

NP_008921.1 wiskott-Aldrichsyndromeproteinfamilymember2isoforml Y

NP 000653.3 arylamineN-acetyltransferase 1 iso forma N

NP 036339.1 heterogeneousnuclearribonucleoproteinH3isoforma N

NP 004591.2 60kDaSS-A/Roribonucleoproteinisoform2 N

NP 004511.2 kinesin-likeprotein IF2Aisoforml N

NP 002618.1 6 -pho spho fructokinasetypeCiso form 1 N

NP 002645.3 pyruvatekinaseisozymesMl/M2iso forma N

NP 057479.2 3 -hydroxy acyl-Co Adehydratase3 N

NP 001143.2 ADP/ATPtranslocase2 Y

NP 001001935.1 ATPsynthasesubunitalpha,mitochondrialiso forme Y

NP 036355.2 unconventionalmyosin-Ibisoform2 Y

NP 001087.2 ATP-citratesynthaseisoforml N

NP 056485.2 sentrin-specificprotease3 N

NP 002799.3 26Sproteasomenon-ATPaseregulatorysubunit2 Y

NP 002432.1 mutSproteinhomolog5iso forme Y

NP 055486.2 ubiquitin-proteinligaseE3 C N

NP 078974.1 mitochondrialglutamatecarrier 1 Y

NP 057376.2 heatshockprotein75kDa,mitochondrialprecursor N

NP 002379.2 DNAreplicationlicensingfactorMCM3 N

NP_003578.2 putativepre-mRNA-splicingfactorATP- Y dependentRNAhelicaseDHX 16isoform 1

NP 005122.2 THOcomplexsubunit 1 N

NP 037377.1 vacuolarproteinsorting-associatedprotein4A Y

NP 001914.3 DNAdamage-bindingprotein 1 Y

NP 055191.2 cytoplasmicFMRl-interactingprotein2 N

NP 003312.3 elongationfactorTu,mitochondrialprecursor N

NP 000179.2 hexokinase - 1 iso formH I N NP 005038.1 26Sproteasomenon-ATPaseregulatorysubunit5 N

NP 055078.1 ATP-dependentzincmetalloproteaseYME 1 L lisoform3 N

P01834.1 immunoglobulinkappaconstant N

NP 112483.1 ribosomalbiogenesisproteinLAS 1 Lisoform 1 N

NP 001347.3 ATP -dependentRNAhelic aseDDX3 Xiso form 1 Y

NP 036205.1 T-complexproteinl subunitepsilon Y

NP 001952.1 elongationfactor2 N

NP 001016.1 40SribosomalproteinS23 Y

NP 009194.2 coatomersubunitepsilonisoforma Y

NP 002931.2 ATP-bindingcassettesub-familyEmemberl Y

NP 006271.1 translocon-associatedproteinsubunitdeltaisoform2precursor Y

NP 001531.1 heatshockproteinbeta- 1 Y

NP 064555.2 nicalinprecursor Y

NP 203693.3 unconventionalmyosin-Icisoformc Y

NP 006406.1 serinepalmitoyltransferaseliso forma Y

NP 064632.2 chaperoneactivityofbc 1 complex-like,mitochondrial Y

NP 066406.1 histoneH2Btype 1 -B Y

NP 006787.2 AFG3 -likeprotein2 N

NP 839943.2 rasGTPase-activating-likeproteinIQGAP3 Y

NP 001672.1 sarcoplasmic/endoplasmicreticulumcalciumATPase2isoforma N

NP 060533.2 lymphoid-specifichelicase N

NP 072090.1 aldehydedehydrogenasefamily8memberAlisoforml Y

NP 057318.2 long-chain-fatty-acid— Co Aligase 1 N

NP 001008938.1 Cytoskeletonassociatedprotein5 N

NP 004893.1 RNA-bindingprotein39isoformb N

NP 006293.2 mannosyl-oligosaccharideglucosidaseisoforml N

NP 055768.3 exosomecomplexexonucleaseRRP44isoforma N

NP 002262.3 importin-5 N

NP 061846.2 dolichol-phosphatemannosyltransferasesubunit3isoforml Y

NP 000242.1 DNAmismatchrepairproteinMsh2isoforml N

NP 002682.2 DNApolymerasedeltacatalyticsubunit Y

NP 005726.1 beta-centractin Y

NP 149124.3 2 ^, ,3'-cyclic-nucleotide3'-phosphodiesterase Y

NP 001213.2 calcium/calmodidin-dependentproteinkinasetypeIIsubunitgammai soform4 N

NP 005975.1 tricarboxylatetransportprotein,mitochondrialisoformaprecurso r N

NP 001142.2 ADP/ATPtranslocase 1 N

NP 065761.1 leucine-richrepeat-containingprotein47 N

NP 000967.1 60 SribosomalproteinL 12 N

NP 002797.3 26 Sproteaseregulatorysubunit 10B Y

NP 065134.1 nuclearporecomplexproteinNup 107 N

NP 003655.3 AP-3 complexsubunitbeta- 1 N

NP 056414.1 phosphoacetylglucosaminemutaseisoform2 N

NP 060700.2 nuclearporecomplexproteinNup 133 N

NP 001005526.1 splicingfactor3Bsubunitlisoform2 N

NP 002625.1 prohibitin N

NP 008838.2 pyrroline-5-carboxylatereductasel,mitochondrialisoforml Y

NP 071757.4 MMS 19nucleotideexcisionrepairproteinhomolog N

NP 000997.1 40SribosomalproteinS3a N

NP 000958.1 60SribosomalproteinL3isoforma N

NP 001004060.1 nodalmodulator2isoform lprecursor N

NP 005210.3 proteindiaphanoushomolog 1 isoform 1 N

NP 003908.1 AP- 1 complexsubunitgamma-like2 N

NP 002853.2 glycogenphosphorylase,brainform N

NP 004199.1 apoptosis-inducingfactorl,mitochondrialisoformlPrecursor Y

P01876.2 Igalpha- 1 chainCregion Y

NP 001509.3 generaltranscriptionfactorII-Iisoform4 N

NP 036265.3 coatomersubunitgamma-2 N

NP 003922.1 wiskott-Aldrichsyndromeproteinfamilymemberl N NP 055423 cytoplasmicFMRl-interactingproteinliso forma N

Table 2. Ribosomal Protein Purification

79 proteins total, 46 in 60S and 33 in 40S

ribosomal protein LI 7 (RPL17) Y ribosomal protein L22 (RPL22) Y ribosomal protein S28 (RPS28) Y ribosomal protein L5 (RPL5) Y ribosomal protein L22 (RPL22) Y ribosomal protein L32 (RPL32) Y ribosomal protein L5 (RPL5) Y ribosomal protein S2 (RPS2) Y ribosomal protein L32 (RPL32) Y ribosomal protein S3 (RPS3) Y ribosomal protein S2 (RPS2) Y ribosomal protein S3 a (S3 a) Y ribosomal protein S3 (RPS3) Y ribosomal protein S4 Y ribosomal protein S3 a (S3 a) Y ribosomal protein s8 Y ribosomal protein S4 y isoform 1 Y ribosomal protein S5 (RPS5) Y ribosomal protein s8 Y ribosomal protein S7 (RPS7) Y ribosomal protein S5 (RPS5) Y ribosomal protein S14 (S14) Y ribosomal protein S5 variant Y ribosomal protein S15 (RPS15 Y ribosomal protein S7 (RPS7) Y ribosomal protein S16 (RPS16) Y ribosomal protein S14 (S14) Y ribosomal protein S19 (RPS19) Y ribosomal protein S15 (RPS15 Y ribosomal protein S20 (RPS20) Y ribosomal protein S16 (RPS16) Y ribosomal protein S23 (RPS23) Y ribosomal protein S19 (RPS19) Y ribosomal protein S27 (RPS27) Y ribosomal protein S20 (RPS20) Y ribosomal protein L3 (RPL3) Y ribosomal protein S23 (RPS23) Y ribosomal protein L9 (RPL9) Y ribosomal protein S27 (RPS27) Y ribosomal protein LlOa (RPLlOa) Y ribosomal protein pO Y ribosomal protein LI 1 (RPLl 1) Y ribosomal protein L3 (RPL3) Y ribosomal protein L12 (RPLl 2) Y ribosomal protein L9 (RPL9) Y ribosomal protein LI 3 (RPLl 3) Y ribosomal protein LlOa (RPLlOa) Y ribosomal protein L14 (RPL14) Y ribosomal protein LI 1 (RPLl 1) Y ribosomal protein L23 (RPL23) Y ribosomal protein L12 (RPL12) Y ribosomal protein L23a (RPL23a) Y ribosomal protein L12 variant Y ribosomal protein L24 (RPL24) Y ribosomal protein L13 (RPL13) Y ribosomal protein S30 (RPS30) N ribosomal protein L14 (RPL14) Y ribosomal protein L28 (RPL8) N ribosomal protein L23 (RPL23) Y ribosomal protein L2 (RPL2) N ribosomal protein L23a (RPL23a) Y ribosomal protein L40 (RPL40) N ribosomal protein L24 (RPL24) Y Ribosomal protein, large, PI (RPLPl) N ribosomal protein L27 (RPL27) Y ribosomal protein L27 (RPL27) Y

Ribosomal protein, large, P2 (RPLP2) N

References

1. Anand, V.S., Reichling, L.J., Lipinski, K., Stochaj, W., Duan, W., Kelleher, K., Pungaliya, P., Brown, EX., Reinhart, P.H., Somberg, R., et al. (2009). Investigation of leucine-rich repeat kinase 2 : enzymological properties and novel assays. FEBS J 276, 466- 478.

2. Belin, S., Hacot, S., Daudignon, L., Therizols, G., Pourpe, S., Mertani, H.C., Rosa-Calatrava, M., and Diaz, J.J. (2010). Purification of ribosomes from human cell lines. Curr Protoc Cell Biol Chapter 3, Unit 3 40.

3. Bhakar, A.L., Dolen, G., and Bear, M.F. (2012). The pathophysiology of fragile X (and what it teaches us about synapses). Annu Rev Neurosci 35, 417-443.

4. Chartier-Harlin, M.C., Dachsel, J.C., Vilarino-Guell, C, Lincoln, S.J., Lepretre, F., Hulihan, M.M., Kachergus, J., Milnerwood, A.J., Tapia, L., Song, M.S., et al. (201 1). Translation initiator EIF4G1 mutations in familial Parkinson disease. Am J Hum Genet 89, 398-406.

5. Cookson, M.R. (2010). The role of leucine-rich repeat kinase 2 (LRRK2) in Parkinson's disease. Nat Rev Neurosci 11, 791-797 ^' .

6. Covy, J.P., and Giasson, B.I. (2009). Identification of compounds that inhibit the kinase activity of leucine-rich repeat kinase 2. Biochem Biophys Res Commun 378, 473- 477.

7. Deng, X., Dzamko, N., Prescott, A., Davies, P., Liu, Q., Yang, Q., Lee, J.D., Patricelli, M.P., Nomanbhoy, T.K., Alessi, D.R., et al. (201 1). Characterization of a selective inhibitor of the Parkinson's disease kinase LRRK2. Nat Chem Biol 7, 203-205.

8. Deng, X., Dzamko, N., Prescott, A., Davies, P., Liu, Q., Yang, Q., Lee, J.D., Patricelli, M.P., Nomanbhoy, T.K., Alessi, D.R., et al. (201 1). Characterization of a selective inhibitor of the Parkinson's disease kinase LRRK2. Nature chemical biology 7, 203-205.

9. Gehrke, S., Imai, Y., Sokol, N., and Lu, B. (2010). Pathogenic LRRK2 negatively regulates microRNA-mediated translational repression. Nature 466, 637-641.

10. Greggio, E., Jain, S., Kingsbury, A., Bandopadhyay, R., Lewis, P.,

Kaganovich, A., van der Brug, M.P., Beilina, A., Blackinton, J., Thomas, K.J., et al. (2006). Kinase activity is required for the toxic effects of mutant LRRK2/dardarin. Neurobiol Dis 23, 329-341.

11. Imai, Y., Gehrke, S., Wang, H.Q., Takahashi, R., Hasegawa, K., Oota, E., and

Lu, B. (2008). Phosphorylation of 4E-BP by LRRK2 affects the maintenance of

dopaminergic neurons in Drosophila. EMBO J 27, 2432-2443.

12. Khairulina, J., Graifer, D., Bulygin, K., Ven'yaminova, A., Frolova, L., and Karpova, G. (2010). Eukaryote-specific motif of ribosomal protein S 15 neighbors A site codon during elongation and termination of translation. Biochimie 92, 820-825.

13. Kumar, A., Greggio, E., Beilina, A., Kaganovich, A., Chan, D., Taymans, J.M., Wolozin, B., and Cookson, M.R. (2010). The Parkinson's disease associated LRRK2 exhibits weaker in vitro phosphorylation of 4E-BP compared to autophosphorylation. PLoS One 5, e8730.

14. Lagier-Tourenne, C, Polymenidou, M., Hutt, K.R., Vu, A.Q., Baughn, M.,

Huelga, S.C., Clutario, K.M., Ling, S.C., Liang, T.Y., Mazur, C, et al. (2012). Divergent roles of ALS-linked proteins FUS/TLS and TDP-43 intersect in processing long pre-mRNAs. Nat Neurosci 15, 1488-1497. 15. Lee, B.D., Shin, J.H., VanKampen, J., Petrucelli, L., West, A.B., Ko, H.S., Lee, Y.I., Maguire-Zeiss, K.A., Bowers, W.J., Federoff, H.J., et al. (2010). Inhibitors of leucine-rich repeat kinase-2 protect against models of Parkinson's disease. Nat Med 16, 998- 1000.

16. Li, X., Moore, D.J., Xiong, Y., Dawson, T.M., and Dawson, V.L. (2010).

Reevaluation of phosphorylation sites in the Parkinson disease-associated leucine-rich repeat kinase 2. J Biol Chem 285, 29569-29576.

17. Liu, Z., Wang, X., Yu, Y., Li, X., Wang, T., Jiang, FL, Ren, Q., Jiao, Y., Sawa, A., Moran, T., et al. (2008). A Drosophila model for LRRK2-linked parkinsonism. Proc Natl Acad Sci U S A 105, 2693-2698.

18. Luzon-Toro, B., Rubio de la Torre, E., Delgado, A., Perez-Tur, J., and Hilfiker, S. (2007). Mechanistic insight into the dominant mode of the Parkinson's disease- associated G2019S LRRK2 mutation. Hum Mol Genet 16, 2031-2039.

19. MacLeod, D., Dowman, J., Hammond, R., Leete, T., Inoue, K., and

Abeliovich, A. (2006). The familial Parkinsonism gene LRRK2 regulates neurite process morphology. Neuron 52, 587-593.

20. Martin, I., Dawson, V.L., and Dawson, T.M. (2011). Recent advances in the genetics of Parkinson's disease. Annu Rev Genomics Hum Genet 12, 301-325.

21. Matta, S., Van Kolen, K., da Cunha, R., van den Bogaart, G., Mandemakers, W., Miskiewicz, K., De Bock, P.J., Morais, V.A., Vilain, S., Haddad, D., et al. (2012).

LRRK2 controls an EndoA phosphorylation cycle in synaptic endocytosis. Neuron 75, 1008- 1021.

22. Moreno, J.A., Radford, H., Peretti, D., Steinert, J.R., Verity, N., Martin, M.G., Halliday, M., Morgan, J., Dinsdale, D., Ortori, C.A., et al. (2012). Sustained trans lational repression by eIF2alpha-P mediates prion neurodegeneration. Nature 485, 507-51 1.

23. Nuytemans, K., Bademci, G., Inchausti, V., Dressen, A., Kinnamon, D.D., Mehta, A., Wang, L., Zuchner, S., Beecham, G.W., Martin, E.R., et al. (2013). Whole exome sequencing of rare variants in EIF4G1 and VPS35 in Parkinson disease. Neurology 80, 982- 989.

24. Paisan-Ruiz, C, Jain, S., Evans, E.W., Gilks, W.P., Simon, J., van der Brug,

M., Lopez de Munain, A., Aparicio, S., Gil, A.M., Khan, N., et al. (2004). Cloning of the gene containing mutations that cause PARK8-linked Parkinson's disease. Neuron 44, 595- 600. 25. Parisiadou, L., Xie, C, Cho, H.J., Lin, X., Gu, X.L., Long, C.X., Lobbestael, E., Baekelandt, V., Taymans, J.M., Sun, L., et al. (2009). Phosphorylation of

ezrin/radixin/moesin proteins by LRRK2 promotes the rearrangement of actin cytoskeleton in neuronal morphogenesis. J eurosci 29, 13971-13980.

26. Pisarev, A.V., Kolupaeva, V.G., Pisareva, V.P., Merrick, W.C., Hellen, C.U., and Pestova, T.V. (2006). Specific functional interactions of nucleotides at key -3 and +4 positions flanking the initiation codon with components of the mammalian 48S translation initiation complex. Genes Dev 20, 624-636.

27. Polymenidou, M., Lagier-Tourenne, C, Hutt, K.R., Huelga, S.C., Moran, J., Liang, T.Y., Ling, S.C., Sun, E., Wancewicz, E., Mazur, C, et al. (201 1). Long pre-mRNA depletion and RNA missplicing contribute to neuronal vulnerability from loss of TDP-43. Nat Neurosci 14, 459-468.

28. Ramsden, N., Perrin, J., Ren, Z., Lee, B.D., Zinn, N., Dawson, V.L., Tarn, D., Bova, M., Lang, M., Drewes, G., et al. (201 1). Chemoproteomics-based design of potent LRRK2-selective lead compounds that attenuate Parkinson's disease-related toxicity in human neurons. ACS Chem Biol 6, 1021-1028.

29. Scheper, G.C., van der Knaap, M.S., and Proud, C.G. (2007). Translation matters: protein synthesis defects in inherited disease. Nat Rev Genet 8, 71 1-723.

30. Smith, W.W., Pei, Z., Jiang, H., Dawson, V.L., Dawson, T.M., and Ross, C.A. (2006). Kinase activity of mutant LRRK2 mediates neuronal toxicity. Nat Neurosci 9, 1231-

1233.

31. Sen, S., Webber, P.J., and West, A.B. (2009). Dependence of leucine-rich repeat kinase 2 (LRRK2) kinase activity on dimerization. J Biol Chem 284, 36346-36356.

32. Smith, W.W., Pei, Z., Jiang, H., Dawson, V.L., Dawson, T.M., and Ross, C.A. (2006). Kinase activity of mutant LRRK2 mediates neuronal toxicity. Nature neuroscience 9,

1231-1233.

33. Tain, L.S., Mortiboys, H., Tao, R.N., Ziviani, E., Bandmann, O., and

Whitworth, A.J. (2009). Rapamycin activation of 4E-BP prevents parkinsonian dopaminergic neuron loss. Nat Neurosci 12, 1 129-1 135.

34. Thoreen, C.C., Chantranupong, L., Keys, H.R., Wang, T., Gray, N.S., and

Sabatini, D.M. (2012). A unifying model for mTORCl -mediated regulation of mRNA translation. Nature 485, 109-113.

35. Tollervey, J.R., Curk, T., Rogelj, B., Briese, M., Cereda, M., Kayikci, M., Konig, J., Hortobagyi, T., Nishimura, A.L., Zupunski, V., et al. (2011). Characterizing the RNA targets and position-dependent splicing regulation by TDP-43. Nat Neurosci 14, 452- 458.

36. Trancikova, A., Mamais, A., Webber, P. J., Stafa, K., Tsika, E., Glauser, L., West, A.B., Bandopadhyay, R., and Moore, D.J. (2012). Phosphorylation of 4E-BP1 in the mammalian brain is not altered by LRRK2 expression or pathogenic mutations. PLoS One 7, e47784.

37. Tsika, E., and Moore, D.J. (2012). Mechanisms of LRRK2-mediated neurodegeneration. Curr Neurol Neurosci Rep 12, 251-260.

38. Webber, P.J., Smith, A.D., Sen, S., Renfrow, M.B., Mobley, J.A., and West, A.B. (2011). Autophosphorylation in the leucine-rich repeat kinase 2 (LRRK2) GTPase domain modifies kinase and GTP-binding activities. J Mol Biol 412, 94-1 10.

39. West, A.B., Moore, D.J., Choi, C, Andrabi, S.A., Li, X., Dikeman, D., Biskup, S., Zhang, Z., Lim, K.L., Dawson, V.L., et al. (2007). Parkinson's disease-associated mutations in LRRK2 link enhanced GTP-binding and kinase activities to neuronal toxicity. Hum Mol Genet id, 223-232.

40. Xiong, Y., Coombes, C.E., Kilaru, A., Li, X., Gitler, A.D., Bowers, W.J., Dawson, V.L., Dawson, T.M., and Moore, D.J. (2010). GTPase activity plays a key role in the pathobiology of LRRK2. PLoS Genet 6, el000902.

41. Zimprich, A., Biskup, S., Leitner, P., Lichtner, P., Farrer, M., Lincoln, S., Kachergus, J., Hulihan, M., Uitti, R.J., Calne, D.B., et al. (2004). Mutations in LRRK2 cause autosomal-dominant parkinsonism with pleomorphic pathology. Neuron 44, 601-607.