Technical Field

The present invention relates to the area of tick disease, and more specifically to methods and products related to infections caused by Rickettsia, such as spotted fever. For example, the invention provides methods for efficient expression of peptides and proteins in host cells which are exogenous to the peptide or protein.

Background

Spotted fever Rickettsia (Helvetica) is a Gram-negative microorganism first discovered in 1979. Although R. Helvetica was initially thought to be harmless in humans and many animal species, case reports have since then suggested that it may be capable of causing a non-specific fever in humans. In 1999 and 2010, a case reports indicated that tick-borne R. Helvetica can also cause perimyocarditis and meningitis in humans.

Currently, diagnosis of Rickettsia (Helvetica) is rarely performed, inter alia as it often occurs as a combined infection with Borrelia. In fact, a Rickettsia (Helvetica) infection may be hidden by a concurrent Borrelia infection, making diagnosis difficult and treatment unsuccessful.

WO 2007/113009 (Institute Virion) relates to polynucleotides and polypeptides for the detection of Rickettsia Helvetica. More specifically, WO 2007/113009 describes polynucleotides encoding an OmpA polypeptide of Rickettsia Helvetica and antigenic fragments thereof and the respective polypeptides and antigenic fragments as well as to methods for detecting and/or monitoring the presence of Rickettsia Helvetica in a subject and respective kits.

WO 2007/123906 and US 2009/0022754 (Ching) relate to recombinant antigens for diagnosis and prevention of murine typhus. Such recombinant proteins may be used in detection and diagnostic assays. WO 2009/148627 (Ching) relate to recombinant antigens for diagnosis and prevention of spotted fever rickettsiae. Such recombinant proteins may be used in detection and diagnostic assays.

Hajem et al (Nedaa Hajem, Andrej Weintraub, Manfred Nimtz, Ute Romling and Carl Pahlsson in APMIS 117:253-262:”A study of the antigenicity of Rickettsia Helvetica proteins using two-dimensional gel electrophoresis”) investigated the protein profile of R. Helvetica and studied the antigenicity of its proteins in order to characterize the immunological response against R. Helvetica infection. Their results showed that in addition to PS 120 and OmpB antigenic R. Helvetica proteins, three other antigens exist: a 60kDa GroEL protein, a 10 kDa GroES protein and 35 kDa hypothetical protein. OmpB is described as a 160 kDa protein which has been proven to be involved in rickettsial entrance into cell upon infection.

Even though a number of potential Rickettsia Helvetica proteins have been identified, so far they have proved to be difficult to express recombinantly in standard systems such as E. coli. Thus, there is a need in this field for improved expression systems that enable the production of sufficient amounts of protein to be useful in the detection of Rickettsia Helvetica infections in humans and other mammals.

In the area of protein expression, research has turned to the very earliest stages namely to the genetic code to provide improved methods. As is well known in molecular biology, the genetic code is a universal template for protein translation.

All known organisms share the 'central dogma’: DNA is transcribed into mRNA that is translated into protein. During the discovery of the genetic code, Francis Crick hypothesized that translation required a mediator to aid mRNA-guided translation according to a number of specifics.

Amongst these specifics, in 1961, Francis Crick postulated that a triplet, a group of three bases, codes for one amino acid. He also proposed a degenerate code‘That is, in general, one particular amino-acid that can be coded by one of several triplets of bases.” Since then, several important findings have been made based on the function of the three bases encoding a specific amino acid.

For example, codons mutated in the wobble position are recognized by the same anticodon-tRNA as the native codon. These mutations, called synonymous mutations, preserve the protein sequence. From an evolutionary perspective, synonymous mutations are considered neutral, because they have no effect on the overall fitness of the individual carrying the mutation.

However synonymous mutations do change protein expression levels, although they don’t change the amino acid sequence. These mutations may also alter post- translational modifications, conformation, stability and function. This is why construct design for heterologous protein expression in synthetic biology is important. Codon optimization, for which you can use a codon optimization tool, has been used to introduce synonymous mutations that will favour efficient soluble functional protein expression.

In protein expression, the synonymous mutations described above may not actually be neutral because certain codons are translated more efficiently than others— creating codon bias. Furthermore, a synonymous mutation in a codon with a limited availability of corresponding tRNA anticodons could result in lower protein expression due to ribosome stalling. This can present a problem in synthetic biology applications. Many organisms display biased use of certain synonymous codons, and it is generally accepted that codon biases reflect a balance between mutational biases and natural selection for translational optimization.

Sharp et a! (in Sharp PM, Li WFI. (1987):”The codon Adaptation Index a measure of directional synonymous codon usage bias, and its potential applications”. Nucleic Acids Res. 15(3): 1281—95) defined the most common measurement for codon usage, namely the Codon Adaptation Index (CAD This index examines the codon usage (resulting from codon bias) in highly expressed genes from a species and assesses the codons that are preferentially used in that reference set.

in the laboratory, investigators often want to express proteins across species (e.g., human proteins in E. coli cells). One might think that the genetic code permits expression of any open reading frame (ORE) in an organism, which is partially right. However, the presence of rare codons in the transgenic mRNA can result in

suboptimal ribosome use and depletion, which ultimately reduces the levels of heterologous protein expression.

Traditional approaches in protein expression and synthetic biology involve mutating transgene codons to those that are preferentially used by the host species (i.e., reduce codon bias), but such changes may increase the risk of amino acid starvation as well as altering the equilibrium of tRNA pools. Also, for a whole protein, manual codon optimization for expression in two species is very demanding, and for optimal expression in three or four species this is an almost impossible task.

Today, newer strategies for the optimization of heterologous protein expression take into account many factors, such as global nucleotide content, local mR A folding, codon bias, a codon ramp or codon correlations.

Summary of the Invention

The present inventors have shown that codon optimization may be applied to the nucleotides encoding Rickettsia protein to improve its expression in an exogenous host cell such as E. coli.

Thus, one aspect of the invention is a polynucleotide comprising a DNA sequence encoding a Rickettsia protein or a fragment thereof, which DNA sequence comprises codons optimized for expression in a host to which it is exogenous. The polynucleotide may comprise or consist of the sequence of SEQ ID NO: 14. Another aspect of the invention is a protein obtained by expression of a polynucleotide according to any one of the preceding claims, such as protein comprising or consisting of the sequence of SEQ ID NO: 15. The protein is advantageously expressed in E.coli.

An additional aspect of the invention is a method of detecting and/or monitoring an immunological response against a Rickettsia protein in a biological sample, which method comprises the steps of

a) Providing a solid support having immobilized at least one protein according to the invention;

b) Adding a buffer including a blocking agent to the support;

c) Adding a biological sample including an unknown amount of antibodies

directed to a Rickettsia protein;

d) Incubating the solid support with enzyme-linked secondary antibodies directed to the immobilized protein-antibody complex to allow complexing between enzyme-linked secondary antibodies and immobilized protein-antibody complex;

e) Adding a buffer including an enzymatic substrate; and

f) Measuring the enzyme activity; wherein one or more wash steps are performed subsequent to any one of steps c), d) and e).

An additional aspect of the invention is a kit for detecting and/or monitoring an immunological response against a Rickettsia protein in a sample, which kit comprises, in separate compartments (i) a solid support having immobilized at least one protein according to the invention; (ii) an enzyme buffer; and (iii) a buffer comprising a substrate for said enzyme; optionally with a blocking solution and/or one or more wash solutions. The kit may e.g. be a kit for lateral flow immunochromatographic detection of the response against Rickettsia protein(s) in a sample.

A further aspect of the invention is a method for diagnosing exposure to a Rickettsia Helvetica in a patient, which method comprises the steps of a) Providing a solid support having immobilized at least one protein according to the invention;

b) Adding a buffer including a blocking agent to the support;

c) Adding a sample of blood serum from the patient including an unknown

amount of Rickettsia Helvetica antibodies;

d) Incubating the solid support with enzyme-linked secondary antibodies directed to the immobilized protein-antibody complex to allow complexing between enzyme-linked secondary antibodies and immobilized protein-antibody complex;

e) Adding a buffer including an enzymatic substrate to the support; and

f) Measuring a signal obtained as substrate is consumed by the enzyme linked to the antibodies; wherein one or more wash steps are performed subsequent to any one of steps c), d) and e).

Further details, embodiments and advantages of the present invention will appear from the dependent claims as well as the specification below.

Detailed description of the Invention

The present invention is based on the use of codon optimization to increase the expression of Rickettsia protein. As discussed in the section Background above, cloning of Rickettsia proteins has proved to be very difficult. The difficulties seem to increase the more the host system differs in nucleotide composition from the Rickettsia itself. For example, if a Rickettsia protein, which is known to have extremely low guanine/cytosine (G/C) ratios, is expressed in a bacterial host such as E.coli even a correctly constructed expression system will show very low or no production at all, as is also shown in the Experimental part below.

In an attempt to provide a more efficient expression of Rickettsia protein, the present inventors have found that by performing a codon optimization, following methods which are known as such, a substantial increase in expression of Rickettsia protein could surprisingly be obtained while the Rickettsia protein’s specific amino acid sequences and protein folding were maintained. Such large amounts of correctly expressed protein have enabled the development of new tools and methods for detection of infection caused by Rickettsia, all of which are included in the present invention. Thus, the invention may be regarded as a method of improving expression of Rickettsia protein by codon optimisation, wherein an encoding polypeptide is obtained the base content of which has been optimized toward a content which more closely resembles that of the intended host cell, which is exogenous to the unoptimized sequence.

More specifically, the present invention based their research on a targeted optimization of some of the triplets encoding a 50 kDa OmpB protein from Rickettsia Helvetica.

As will be described in more detail in the experimental part below, the optimized nucleic acid sequence was successfully expressed in the most commonly used host, i.e. E. coli.

In a first aspect, the present invention relates to a polynucleotide comprising a DNA sequence encoding a Rickettsia protein, or a functional fragment thereof, which DNA sequence comprises codons optimized for expression in a host to which it is

exogenous.

The synthetic polynucleotide according to the invention will advantageously comprise a complete open reading frame (ORF) for a Rickettsia protein.

A specific polynucleotide according to the invention comprises the DNA sequence of SEQ ID NO: 14, or fragments thereof wherein an ORF has been maintained.

Since the polynucleotide according to the invention has been modified as compared to the native i.e. original sequence, it may be denoted a“synthetic” polynucleotide.

The present invention also relates to the use of one or more of the nucleotide fragments presented by SEQ ID NO: 1-13 in a method for preparing Rickettsia nucleotides which are specifically suited to be expressed in a host to which the unoptimized sequence is exogenous.

The invention also includes to protein obtainable by expression of the synthetic polynucleotide according to the invention. The protein may be expressed in any suitable bacterial host having similar G/C content as E.coli, or in E.coli. The protein may be a surface protein.

The invention includes a method of producing a protein fragment of OmpB from Rickettsia Helvetica, which method includes inserting the synthetic polynucleotide according to the invention, e.g. as illustrated by SEQ ID NO: 14, in a bacterial vector and expressing a 50 kDa protein in cell culture. Thus, a protein according to the invention may be comprised or be consisted of the amino acid sequence of SEQ ID NO: 15.

The invention also includes an expression cassette for producing a Rickettsia Helvetica protein fragment, which cassette includes the polynucleotide according to the invention, e.g. as illustrated by SEQ ID NO: 14, together with elements for histidine tag.

Thus, the availability of a readily produced recombinant 50 kDa OmpB protein has allowed the development of methods for the detection, quantitation and/or monitoring of Rickettsia Helvetica infection in biological samples.

The invention also relates to kits and assays for such detection, quantitation and/or monitoring of Rickettsia Helvetica infection in biological samples.

Consequently, one aspect of the present invention is a method of detecting and/or monitoring an immunological response against Rickettsia Helvetica in a biological sample, which method comprises the steps of a) Providing a solid support having immobilized at least one protein according to the invention;

b) Adding a buffer including a blocking agent to the support;

c) Adding a biological sample including an unknown amount of antibodies directed to a Rickettsia protein;

d) Incubating the solid support with enzyme-linked secondary antibodies directed to the immobilized protein-antibody complex to allow complexing between enzyme- linked secondary antibodies and immobilized protein-antibody complex;

e) Adding a buffer including an enzymatic substrate; and

f) Measuring the enzyme activity; wherein one or more wash steps are performed subsequent to any one of steps c), d) and e).

The solid support provided in step a) may be a passively coated nitrocellulose membrane or a plastic surface, such as MultiSorb or any other commercially available format. Such a coated surface will have been provided with suitable ligands or binding groups for the user to attach a protein of choice. The solid support may be any suitable format, such as a multi well plate.

In step a) the solid support is contacted with a recombinant protein produced by expression of a nucleic acid sequence which has been codon optimized in according with the present invention. Thus, the solid support may be contacted by a recombinant protein obtained by expression of the nucleic acid as defined by SEQ ID NO: 14 in a suitable host, advantageously an E. coli host. The recombinant protein used in the present invention may be defined by the amino acid sequence of SEQ ID NO: 15, and is a 50 kDa protein originating from the Rickettsia Helvetica OmpB protein.

Thus, the herein illustrate recombinant protein has been designed to include a His tag at the end of its sequence, as six histidine amino acids is well known to work efficiently in simple identification using chelating ligands, such as Ni. As the skilled person will appreciate, other tags may be included in the expressed protein without deviating from the inventive concept as described herein. In step b), the blocking buffer may be any suitable buffer comprising a commonly known blocking agent capable of blocking any sites available on the solid support which are still available after step c). The blocking buffer may for example be one of bovine serum albumin (BSA) or casein. Depending on the nature of the Rickettsia protein as well as the specific assay, other blocking buffers may be envisaged, such as serum from chicken, rabbit or humans.

In step c), the immobilized recombinant protein will operate as the antigen of an immunological assay. Thus, when the solid support including the immobilized protein is contacted with a sample to be analysed, antibodies against the immobilised

Rickettsia protein such as Rickettsia Helvetica protein will specifically bind to the support.

In step d), a sample to be processed is combined with a solution comprising enzyme to link enzyme to any antibodies present in the sample. Enzymes useful to this end are commercially available from any one of the large suppliers of immunological assays and kits, such as Thermo Scientific. Methods for successful linking of enzyme to antibodies are commonly used technologies, and available through the kit suppliers.

The sample may be any biological fluid, and is advantageously blood or serum.

Advantageously, a washing step is performed after step c) to remove the remains of the sample as well as other antibodies and proteins.

In step e) the enzymatic substrate added is obtained as discussed above from commercial sources providing assays and kits for ELISA and other immunological assays.

In step f) a signal is detected which is proportional to the amount of substrate consumed by the enzyme linked to the antibodies. Methods and means for such signal detection are well known, and will as the skilled person will appreciate be dependent on which enzyme system is used. Advantageously, the enzyme activity is measured by optical means, such as by colorimetric or fluorescence measurement.

As discussed above, the recombinant protein used in the present method may have been expressed in an E. coli system.

A third aspect of the present invention is a kit for detecting and/or monitoring an immunological response against Rickettsia such as Rickettsia Helvetica in a sample, which kit comprises (i) a solid support having immobilized a recombinant protein according to the invention; an enzyme solution; and a solution comprising a substrate for said enzyme; as well as optionally a blocking solution and/or one or more wash solutions.

Alternatively, the kit according to the invention is designed for lateral flow

immunochromatographic detection of the response against one or more Rickettsia proteins in a sample, which kit comprises a test strip comprising at least one patch having immobilized at least one protein according to the invention. In an example, the lateral flow kit is a strip comprising one, two or more patches each of which has immobilised a different Rickettsia protein. Thus, this kit will enable simple testing of a patient not only to check if the patient has been exposed to Rickettsia, but also to learn which Rickettsia species. Consequently, improved therapy may be supplied to patients suffering from tick bites.

Thus, the present invention may also be regarded as a Rickettsia Helvetica assay.

Another aspect of the invention is a method for diagnosing exposure to a Rickettsia Helvetica in a patient, which method comprises the steps of

a) Providing a solid support having immobilized at least one protein according to the invention;

b) Adding a buffer including a blocking agent to the support; c) Adding a sample of blood serum from the patient including an unknown amount of Rickettsia Helvetica antibodies;

d) Incubating the solid support with enzyme-linked secondary antibodies directed to the immobilized protein-antibody complex to allow complexing between enzyme-linked secondary antibodies and immobilized protein-antibody complex;

e) Adding a buffer including an enzymatic substrate to the support; and measuring a signal obtained as substrate is consumed by the enzyme linked to the antibodies; wherein one or more wash steps are performed subsequent to any one of steps c), d) and e).

The details for this method are as discussed above in relation to the other aspects of the invention.

EXPERIMENTAL

The present examples are provided for illustrative purposes only, and should not be construed as limiting the application as defined by the appended claims. All references provided below and elsewhere in the present application are hereby included herein by reference.

Codon Optimization - General Considerations

As a prerequisite, all three parts of the central dogma need to perform well so that transcript on, mRNA stability, and translation are efficient and in harmony with the codon pool. For ultimate efficiency in these parts, it was necessary to consider a number of factors:

a) Parameters for Transcriptional Efficacy:

» Avoid high GC content and CpG~methylated sequences, cryptic splicing sites and negative CpG islands

« Employ codon-optimized cDNAs with optimal TATA boxes and termination

signals to maximize the likelihood of high yield protein expression Be sure to include a termination signal in your cDN A. b) Considerations for Translational Efficiency:

Codon usage is a key determining factor for efficient protein expression, but in bacteria and arehaea the Shine Dalgamo (SD) sequence also plays a pivotal role. This sequence is important in both translation initiation and efficiency, arid mRNA sequences with SD homology negatively impact protein translation because the SD homologous region competes with the bona fide SD sequence for binding to the 16S rRNA. ⁴ The available algorithms optimize mRNA sequences to avoid SD homology.

The free energy of 5" mRNA ends also lias a significant impact on corresponding protein levels. This was elegantly shown by expressing 154 GFP mutants in E. coli, where hairpins engineered into the 5’ mRNA end reduced GFP expression by up to 250-fold, compared to an optimal codon-optimized construct. The 5’ stable free mRNA energy accounted for more than half of the cases of reduced GFP protein expression, which is IQ-fold more than any of the other parameters measured in that study. ³ Codon optimization ensures that the 5’ mRNA end is unlikely to form stable hairpins, thus facilitating optimal mRNA loading and protei translation.

The AU-rich elements (AREs) found in the 3’ untranslated region of the mRNA affect mRNA stability. These elements serve as binding sites for proteins and mieroRNAs (miRNAs) that promote mRNA degradatio and, thereby, decrease protein levels. In that same vein, premature poly- A sites and internal ribosomal binding sites also decrease protein levels by aberrant processing of the mRNA and decreased translation e) Considerations for Protein Folding:

Optimization of protei folding is necessary so that the newly synthesized protein is chaperoned to its correct secondary and tertiary structures. Apart from the transcriptional and translational tools outlined above, the codon context can be optimized as well as the interaction between codon and anticodon to ensure faithful protein refolding. Example 1 ~ Codon Optimization according to the invention

As appears from above, the present invention is based on a targeted optimization of almost all the triplets encoding a 50 kDa OmpB protein from Rickettsia Helvetica.

This was done by splitting up the desired fragment and adding restriction sites in both ends of an approximately 100 base-pair primers. As cloning vector, plasmid pBR322 was used, where an Ndel site are located which code for the starting codon methionine then follow the optimized sequence for the protein sequence with codons for expression in E. coli. Since it is necessary for the Ndel enzyme to have some base-pair before the cutting site two Adenine and four Guanine are added at the 5 'end, this also works as the Shine-Dalgamo fragment as a ribosome binding site. The 3 'end of this synthetic oligonucleotide have a cutting site for the restriction enzyme BpulO.

A total of 13 fragments were synthesized in accordance with the above, and cloned together to form the following completed fragments:

Fragment 1.

CAGGAGGTAAAACATATGACCAGCGCAGACAATACCGGTATCGTCAAATT

CGTTAACGCAGATCTGATTACGGTTACGGTTCAAAAGCAGGCGGGTGTCGT

TGAC

Fragment 2.

GCCCTGAAGCAGATTACCGTTAGCGGTAGCGGCAACGTGGTTATCAACCA

GACCGGTAACGCGGCCAATCCGGGCGTGGTCACGGATACCATTGCGTTCG

CCGACGCGAGCCTG

Fragment 3.

GGTACCAGCCTGTTTTTGCCGAGCGGCCTGCCGTTTAATGACGCCGGTAAC

ACCATCCCGTTGACTATCAAGTCTACGGTGGGTAACGGCCCAGAAGGTGA

CTTCAA

Fragment 4. GTTCCGCGCGT C ATCGT GAGCGGC ATT GATTCCGT C ATTGCGGAT GGCC AG GT GATCGGT GACC AAGAT A AC ATT ATCGGTCT GGGTCT GGGTTCCGAC AAC GGTATCATTGT

Fragment 5.

GTCAACGCGACCACGCTGTATGCGGGTATCGGCACCGTCAATGACAACCA

AGGCACGGTTACCCTGTCGGGCGGTGTCCCTAACACTCCGGGTACCATTTA

CTCCCTGGGT

Fragment 6.

ATTGGCAACGGTACCCCGAAGCTGAAACAGGTAACCTTTACGACGAATTA C AAT AATCT GGGC AGC ATT ATT GC AACC AACGCC ACC ATC AAT GAT GGTTT GACGGTG

Fragment 7.

ACCACGGGTGGCATTGCGGGTAAAGATTTCGACGGCAAGATCACCCTGGG T AGCGC A AACGGC AAC AGC AACGT C ATCTTT GTCGAT GGC ACC AAC AGC A CCGCGACCTCT

Fragment 8.

AT GGT GGCCACT GCTAAAGCGAATAAT GGTACCGTTACGTATCT GGGTTCG GCGGCAGT GGGC AAC ATT GGTTCTAGCAAT GCGTTGGT GGCAAGCGT GAA ATTCACC

Fragment 9.

GGTCCGGC AGGC AGCCT GGAGAAACT GC AGGGC AAT ATCT ACTCT ACGGC AACCAACTTTGGTAACGTCAACTTGAATGTTGCGGGTAGCAACATCATCCT GGGTGGTGAT

Fragment 10. ACGACT GCGATTAAT GGTAATATCAATCTGGTTACTAAC ACTCT GACCTT C

GAGAGCGGCACGAGCACGTGGGGCTCCAACACGAGCCTGAGCACGACCCT

GACCGTG

Fragment 11.

AGCAATGGCAATATTGGCCACATCGTTATTGCTGAGGGTGCCCAAGTCAAC

GTGACCACCATCGGCACGACCACCATTAATGTGCAGGATAATGCAAGCGC

GAATTTCAGC

Fragment 12.

GGTACCAAGTACTATACCCTGATTGAAGGTGGTGCTCGTTTTAACGGTACG

CTGCGTGATCCGAATTTTGCTGTGACCGGCAGCAATCGTTTCGTTAACTAC

GGTCTGATT

Fragment 13.

CGT GCGGCGAACC AAGACT AT GTT GT C ACGCGC ACC AAT GACGCGGCT A A T GTT GT GACC AACGAC AT CGC AAACGGTCCGC AT CAT C ACC ACC AT C ACT A ACTCGAG

These fragments, the sequences of which are presented in the appended sequence listing as SEQ ID NOs: 1-13, were used to obtain the optimized nucleotide having the sequence of SEQ ID NO: 14 which may be used to express the polypeptide having the sequence of SEQ ID NO: 15.

Example 2 - Cloning of native R.helvetica peptide

2a) Amplification of fragment for cloning 1 sample Primers OmpB Bam Rew 0.5 mΐ (1 mM)

OmpB Nde Forw 0.5 mΐ (1 mM)

R. helvetica DNA 1 mΐ (2.5 ng/mΐ)

Water 23 mΐ (PCR grade)

PCR supermix (Invitrogen) 25 mΐ

Amplification: 94°C 5 min-(94°C 30 sec-55°C 30 sec-72°C 1.5 min)x35-72 °C 10 min- 4°C.

The amplified product was tested by electrophoresis in 1.4% agarose in Tris-Borate EDTA buffer.

2b) Digestion of cloning vector:

Cloning vector pET 3a (kindly received from Gote Swedberg IMBIM Uppsala University).

The vector was cultured in 500 ml Lauria Broth media (Accumedia) with 100 pg/ml Ampicillin (Sigma) at 37°C in an orbital shaker for 18 h. The cells were harvested by centrifugation and plasmid DNA was isolated with NucleoBond Midi Prep (AH diagnostics) according to the manufacturer’s recommendation, 100 mΐ eluate gave 220 ng/mΐ DNA.

Restriction enzyme digestion:

Buffer: All Phor One (Amer sham/Pharmacia)

Enzyme Nde 1 (Invitrogen)/Lot K9102FA

Enzyme Bam HI (MBI)/Lot KR4221

Four reactions were set up:

1: 2 mΐ DNA + 2 mΐ Buffer + 1 mΐ Nde 1 +15 mΐ dH ₂ 0

2: 2 mΐ DNA + 2 mΐ Buffer + 1 mΐ Bam HI + 15 mΐ dH ₂ 0

3: 2 mΐ DNA + 2 mΐ Buffer + 1 mΐ Bam HI + 1 mΐ Ndel +14 mΐ dH ₂ 0

4: 2 mΐ DNA + 18 mΐ dH ₂ 0 (Control for DNAse activity) All reactions were incubated 2h in 37°C water bath. Digestion was tested by electrophoresis in 1.4% agarose in Tris-Borate_EDTA buffer.

2c) Purification of digested fragments and vector:

After digestion, the reactions were extracted once with pH7.0 buffered

Phenol/Chloroform and once with Chloroform/isoamyl alcohol. After extraction, the water phases were precipitated with iso-propanol and the DNA recovered by centrifugation for 10 min. at 13000 g. The pellet was dissolved in 25 ul dfbO and purity and concentration determined by 260/280 nm spectroscopy in NanoDrop, resulting in 64.9 ng/mΐ for Nde 1/Bam HI cut PCR fragment and 49.8 ng/mΐ for double digested pET3a vector.

2d) Ligation of vector and fragment:

Ligase and lOx Ligase buffer (New England Biolab)

1. The following reactions were set up in a microcentrifuge tube on ice.

Neg control Reaction 1 Reaction 2 5x Ligase buffer 4 mΐ 4 mΐ 4 mΐ

Ligase enzyme lUnit/ul 1 mΐ 1 mΐ 1 mΐ

Ndel/Bam HI fragment 64.9 ng/mΐ - 1 mΐ 0.5 mΐ

Nde 1/Bam HI vector 49.8 ng/mΐ 1 mΐ 1 mΐ 0.5 mΐ dH ₂ 0 14.5 mΐ 13 mΐ 14 mΐ

2. The reaction were gently mix the reaction by pipetting up and down and

microfuged

3. Reactions were incubated at 16°C overnight

4. And heat inactivate at 65°C for 10 minutes

5. Chill on ice and transform 1-5 mΐ of the reaction into 50 mΐ E.coli BL 21 cells 6. E. coli were made competent by standard methods (Maniatis et al CSH laboratory)

7. The cells were held on ice for 10 minutes and heat shocked 42°C 30 sec.

8. 250 ul SOC medium was added and incubation on shake 37°C 1.5h

9. 10 and 200 ul were spread on 2 LB plates with 100 pg/ML Ampicillin

10. After overnight incubation 37°C 18 colonies were grown in 5 ml LB+ Ampicillin

11. The cells were pelleted and plasmids isolated by Qiagen plasmid Mini kit.

12. The plasmids were cut with BamHl and the size determined by Electrophoresis where the vector was found to be 4500 bp and the vector + insert 6000bp, as expected

2d) Expression of cloned protein

This procedure was performed both with the cloned native protein and with the codon optimized synthetic vector.

1. Two tubes of competent E.coli BL21 cells were thawed on ice, 10 ng plasmid was added to each and the tubes were incubated on ice 30 min.

2. The tubes were heat shocked for 30 sec at 42°C, 250 mΐ SOC medium was added and the tubes were incubated for 30 min. with shake at 37°C.

3. 10 mΐ of each was spread on LB agar with Ampicillin, the rest was added to 10 ml LB-broth with 100 mg/1 Ampicillin and incubated with shake overnight.

4. Day 2. 400 ml new LB-broth were infected with the overnight cultures and the cultures were grown to log-phase (approximately 3h).

5. 1ml from tubes at 37°C was place in labelled 1.5ml tubes. Spin at max, 30sec, RT, and remove supernatant. Pellets were freezed at -20 until needed. THIS IS THE UNINDUCED CONTROL.

6 The cultures were induced with ImM IPTG (Isopropyl b-D-l- thiogalactopyranoside } 7. After 3-4hrs, transfer 1ml from induced sample to labelled 1.5ml tubes and spin at max, 30sec, RT, and remove supernatant. Freeze pellets at -20 until needed. THIS IS THE INDUCED SAMPLE.

8. Sample preparation for SDS-PAGE: Add lOOul of IX loading buffer (see solutions below) with 1% BME to uninduced and induced samples.

Vortex for lOsec to lmin or until there are no clumps of bacteria. Boil 3- 5min, spin at max, 30sec, RT, and load 5-25m1 (usually lOul) depending on 10% PAGE gel (for determination of amount, size and antigenicity of protein.)

9. The grown bacteria were harvested by centrifugation and the pelleted bacteria frozen until purification. e) Purification of fusion protein:

1. 2 batches of pelleted bacteria of approximately 100 mg were lysed in 8 ml 6M Guanidine-HCl buffer with 10 mM Imidazole for lysis of the bacteria.

2. After incubation on shake for 10 min, the preparation was sonicated 3x 5 sec.

3. Centrifugation 3000 g 15 minutes. Pellet 1 and Supernatant 2 (saved for downstream analysis)

4. Ni-NTA-Resin (Thermo-Scientific) is saturated with two column volumes of 5mg/ml NiCl. Wash buffers are phosphate buffers with 8M urea, 4 different pH is used, (binding buffer pH 7.5, wash buffer 1 and 2 (buffer 1 pH 6.0), (buffer 2 pH5.3) as elution buffer with pH 4.0. The pH must be adjusted the same day they should be used.

5. A small column is packed with 3 ml Ni-saturated resin and washed twice in dHiO, and two volume binding buffer.

6. The lysed supernatant from step 3 is incubated with the resin on shake for 20 minutes. The resin is centrifuged and the supernatant collected (unbound protein).

7. 2x wash in Wash buffer 1 (both supernatant collected) 8. 2x wash in Wash buffer 2 (both supernatant collected)

9. The column is opened and eluted with 5 ml Elution buffer pH 4.0 and 1 ml fractions are collected.

10.20 mΐ from all collected fractions are precipitated with trichloroacetic acid, pelleted and dissolved in SDS sample buffer for electrophoresis. The fractions are electrophoresed 1,5 h at 175V , the gel is stained with

Coomassie brilliant blue. The eluted fraction containing the protein are pooled together and dialyzed against 10 mM Tris-HCl pH 8.0 with 0.1% triton X-100 over night.

11. Protein purity is again tested by electrophoresis and the amount is checked by commercial Bradford Protein Determination Kit (Bio Rad)

Example 3 - Codon optimization and results

Below we describe a method for optimizing a nucleotide encoding a predetermined amino acid sequence. The present nucleotide is optimized for maximal recombinant expression in a host cell. The method comprises the steps of

a) Genererating a plurality of nucleotide candidates encoding the

predetermined amino acid sequence;

b) Using a statistic algorithm, obtaining scores for sequences which scoring system is based on a plurality of properties and/or parameters affecting the protein expression in the host cell, wherein the plurality of sequence properties and/or parameters are selected from the group consisting of protein/time and exactness of thecandidates of step a);

c) Determining nucleotide sequence candidate(s) capable of optimised i.e. increased expression of protein in a host cell;

d) Estimation of the scoring of protein expression resulting from nucleotides having different codons encoding the same amino acid.

Example:

E. Coli (triplette/ 1000) Rickettsia (triplette/ 1000) Phenylalanine UUU (101/1000) UUU (106/1000) - about the same UUC (77/1000) UUC (21/1000) - i.e. about 3x more in E. Coli

Leucine UUA (78/1000) UUA (157/1000) - half in E Coli

UUG (61/1000) UUG (23/1000) - about double in E. Coli CUU (61/1000) CUU (71/1000) - about the same

CUC (54/1000) CUC (7/1000) - about 7x more in E. Coli CUA (27/1000) CUA (51/1000) - half in E. Coli

CUG (240/1000) CUG (15/1000) - about 15x more in E. Coli

Thus, if e.g. the triplette UUA of Rickettsia is replaced with CUG i E. Coli, the rate of protein expression will increase. Consequently, for each triplette exchange, it is possible to calculate an average score corresponding to the change in rate for each amino acid. Based on an average of the possible triplettes for each amino acid, the change in rate may be calculated.

For example, Phenylalanine x 3, Leucine x 10, Methionine x 0, Valine x 7 increased rate etc.

Following this principle, the cumulated total effect of the codon optimization performed according to the invention on all of the herein selected sequence (OmpB) results in expression which in total is 1,6 x 10 ¹³ times the value for the non-optimized sequence.