AND USES THEREOF

Cross-Reference to Related Applications

This international application claims benefit of priority under 37 C.F.R. §1.1 19(e) of provisional application U.S. Serial No. 62/135,224, filed March 19, 2015, the entirety of which is hereby incorporated by reference.

Federal Funding Legend

This invention was made with government support under Grant Number CA108846 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

Field of the Invention

The present invention relates to RUNX2 transcription factor inhibitors and their uses in cancer treatment. More specifically, the invention relates to derivatives and analogs of the RUNX2 transcription factor inhibitor compound 1 and their uses in treating breast cancer.

Description of the Related Art

Breast cancer is a heterogeneous disease and despite advances in treatment, it remains the second leading cause of cancer-related deaths among women. Luminal breast cancer has the highest rates of relapse, often localizes to the bone, and accounts for 50% of all metastatic-related breast cancer deaths in spite of the primary tumor being highly responsive to treatment. Given their high rate of relapse, it is clear current treatment modalities are insufficient to completely eradicate these heterogeneous tumors.

The HER2-targeted agent trastuzumab is the only FDA-approved for use in patients whose tumors are clinically defined as HER2 amplified. Early clinical trials have shown a 50% reduction in recurrence rates in patients with luminal breast cancer treated with combination trastuzumab/chemotherapy over patients treated with chemotherapy alone. Ductal carcinomas in situ (DCIS) also express HER2 prior to a transition to an invasive phenotype, suggesting there may be clinical benefit to treating early disease with HER2- targeted agents even in the absence of HER2 amplification.

RUNX2, an osteoblast transcription factor, is expressed in developing breast epithelial cells and is enriched in the mammary stem cell population responsible for terminal end bud differentiation. RUNX2 is expressed in early stage ER+ breast cancer above normal levels found in the breast epithelia. In basal-type breast cancer cell lines RUNX2 promotes an osteomimetic phenotype and metastasis to the bone through transcriptional activation of osteopontin, MMPs, and VEGF. The RUNX2 binding partners, YAP and TAZ are WW domain-containing transcriptional coactivators that promote cell transformation, osteogenesis, or stem cell self-renewal.

TAZ is a nuclear effector of the Hippo tumor suppressor pathway that has been implicated in promoting breast cancer progression. RUNX2 was recently shown to be upregulated in a subpopulation of luminal A MCF7 cells that share molecular characteristics with a more invasive breast cancer phenotype, including genes associated with stem cell renewal, and enhanced tumorsphere-forming capacity. Disruption of cell:cell contacts (Hippo pathway inactivation) results in reduced phosphorylation of TAZ leading to nuclear translocation and interaction with transcription factors that regulate expression of cell proliferation and anti-apoptotic genes. TAZ is upregulated in 20% of breast cancer patients and is expressed in many breast cancer cell lines where it has been shown to increase migration, invasion, tumorigenesis, drug resistance, and to promote an EMT. TAZ and RUNX2 have both been independently implicated in mediating metastasis to the bone but a cooperative role in breast cancer has not been reported.

Although an epithelial-mesenchymal transition (EMT) in breast cancer is characterized by downregulation of E-Cadherin, it is becoming increasingly clear that cells may also disseminate from the primary tumor without undergoing an EMT or downregulating E-Cadherin expression. An alternative pathway involving secretion of an oncogenic E- Cadherin ectodomain (sE-Cad; 80kDa) was reported to mediate migration, invasion, and proliferation while maintaining epithelial morphology. sE-Cad functions in an autocrine and paracrine manner to activate survival and metastatic programs by interacting with ErbB receptors. In addition, sE-Cad binds full length E-Cadherin resulting in the destabilization of adherens junctions. sE-Cad has been proposed as a functional metastatic biomarker in many cancers including, but not limited to, breast cancer. RUNX2 expression in luminal breast cancer cells results in nuclear TAZ localization and expression of sE-Cad. TGF enhances the RUNX2-mediated expression of sE-Cad and upregulation of HER2 in MCF7 cells. RUNX2 associated with TAZ immune complexes and knockdown of TAZ inhibited RUNX2 and HER2 mediated tumorsphere formation. Thus, there is a recognized need in the art for inhibitors of RUNX2 as cancer therapeutics. The prior art is deficient in RUNX2 inhibitors or derivatives or analogs thereof and cancer treatments via these inhibitors. The present invention provides this longstanding need and desire in the art.

SUMMARY OF THE INVENTION

The present invention is directed to a compound having the chemical structure:

The R† and R ₂ substituents independently are H, CI, F, Br, CH ₃ , CF ₃ , SH, -NKC!^alkyl^, NHCCO^.salkyl, or -NHC(0)C ₅ - ₇ cycloalkyl, the R ₃ substituent is H or d _-3 alkyl and the R

substituents is ; or a pharmaceutically acceptable salt thereof.

The present invention is directed to a related compound having the chemical structure:

The present invention also is directed to a pharmaceutical composition comprising any of the compounds described herein and a pharmaceutically acceptable carrier.

The present invention is directed further to a method for treating a cancer in a subject. The method comprises administering to the subject a dose of one or more of the compounds described herein effective to inhibit a RUNX2 activity, thereby treating the cancer. The present invention is directed to a related method further comprising the step of administering one or more other cancer drugs. The present invention is directed further still to a method for treating a metastatic cancer in a subject. The method comprises administering to the subject a dose of one or more of the compounds described herein effective to inhibit a RUNX2 activity, thereby treating the metastatic cancer. The present invention is directed to a related method further comprising the step of administering one or more other cancer drugs.

The present invention is directed to a related method for inhibiting metastasis of a cancer in a subject. The method comprises contacting cells comprising the cancer with one or more compounds of claim 1 effective to decrease migration of the cancer cells away from the cancer, thereby inhibiting metastasis of the cancer. The present invention is directed to a related method further comprising the step of administering one or more other cancer drugs.

The present invention is directed further still to a method for inhibiting RUNX2 activity in a cancer cell. The method comprises contacting the cancer cell with one or more of the compounds described herein.

The present invention is directed further still to a method for inhibiting RUNX2 protein expression in a breast cancer cell. The method comprises contacting the breast cancer cell with one or more of the compounds described herein.

Other and further aspects, features, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of the invention. These embodiments are given for the purpose of disclosure.

BRIEF DESCRIPTION OF THE DRAWINGS

So that the matter in which the above-recited features, advantages and objects of the invention, as well as others which will become clear, are attained and can be understood in detail, more particular descriptions of the invention briefly summarized above may be had by reference to certain embodiments thereof which are illustrated in the appended drawings. These drawings form a part of the specification. It is to be noted, however, that the appended drawings illustrate preferred embodiments of the invention and therefore are not to be considered limiting in their scope.

FIGS. 1A-1 K depict the structures of compound 1 and analog compounds 2-11 and their percent similarity to compound 1.

FIG. 2 shows that inactivation of the Hippo tumor suppressor pathway by RUNX2 promotes a tumorigenic phenotype in luminal breast cancer cells. Several therapeutic targets are indicated that inhibit the tumorigenic phenotype described herein (tumorsphere formation), including Herceptin/Lapatinib targeting of HER2, DECMA-1 targeting of sE-Cad, and compound 1 targeting of RUNX2. FIGS. 3A-3C depict RUNX2 expression in luminal breast cancers and anchorage independent growth. Upregulation of RUNX2 correlates with poor overall survival in patients with Luminal breast. Cancer Genome Atlas (TCGA) results shown represent protein expression and are based upon data generated by the TCGA Research Network. Kaplan- Meier curves indicate % patients surviving (overall survival) as a function of months after diagnosis for patients with high RUNX2 protein expression (>2 SD) and patients with lower levels of RUNX2 protein (<2 SD). FIG. 3A shows that low RUNX2 expression was significantly associated with longer median survival of 80 months compared to 1 17.5 months for high RUNX2 expression (p = 0.016). FIG. 3B shows that RUNX2 promotes attachment and invasion of MCF7 RUNX2-expressing breast cancer cells. Adhesion of MCF7 cells to tissue culture plates coated with fibronectin, extracellular matrix (ECM), or to a monolayer of EC was measured 120min after adding tumor cells. Cell numbers indicate cells/field at high magnification (40X). Representative photographs depict MCF7 cell spreading on fibronectin, ECM, or endothelial cells monolayer 16hr after adhesion. Arrows indicate areas where MCF7 tumor cells have invaded through the endothelial cell monolayer and attached to the underlying matrix. FIG. 3C shows that RUNX2 promotes tumorsphere formation. MCF7 RUNX2 Tet.OFF cells were resuspended in basal media for 7 days supplemented with (gray bars) or without (black bars) 2ng/ml_ TGF in ultra-low attachment plates. Tumorsphere diameter was calculated from photographic images. The number of colonies measured is indicated in each bar graph and designated by "n". Statistical analysis (Student's t-test or ANOVA) was used to determine significance between RUNX2 positive or RUNX2 negative treatment groups. Representative photos of colonies are shown.

FIGS. 4A-4C show that RUNX2-targeting compound 1 inhibits RUNX2-positive MCF7 tumorsphere formation in suspension. FIG. 4A shows that compound 1 (left) was identified from a computer-assisted drug design screen and validated in DNA binding assays to inhibit RUNX2 binding to its cognate DNA-binding domain It exhibits an IC50 = 10nM in D-ELISA DNA binding assays. A best-fit model (right) predicts interaction with the tail, wing, and other adjacent residues of the Runx2 DNA-binding (Runt) domain. In FIG. 4B MCF7 RUNX2 Tet.OFF cells were cultured in suspension for 12 days with (gray bar) or without (black bar) 50μΜ compound 1. Representative photos of colonies are shown. FIG. 4C shows that compound 1 inhibits RUNX2 expression. MCF7 Tet.OFF RUNX2 cells were grown with (RUNX2 -) or without (RUNX2 +) doxycycline and treated with 50μΜ compound 1. To ensure that RUNX2 protein inhibition was not cell-type specific a low RUNX2- expressing luminal BC cell, T47D, was transfected with either an empty vector (ctrl) or a FLAG.RUNX2-expressing vector and treated with 50μΜ compound 1 for 48hr. Nuclear proteins were collected and resolved by SDS-PAGE. RUNX2 protein quantification was normalized to β-actin and fold-changes relative to untreated cultures are indicated below each lane.

FIGS. 5A-5C illustrate RUNX2 expression in luminal breast cancer. FIG. 5A shows endogenous RUNX2 expression in MCF7Parental, T47D, and HCC1428 BC cells. Nuclear protein fractions were obtained using the High/Low salt extraction method detailed in FIG. 4A. Cells were grown in full media (DMEM for MCF7 parental; RPMI for T47D and HCC1428) and then fractionated. Proteins were resolved by SDS-PAGE and RUNX2 protein bands were visualized using a RUNX2 specific antibody (Cell Signaling) to detect endogenous RUNX2 and FLAG-tagged RUNX2. FIG. 5B shows that RUNX2 does not promote an EMT. MCF7 cells expressing ectopic RUNX2 or Hs578t cells expressing endogenous RUNX2 were grown for 3 days in + or - Doxycycline media or in full media, respectively. Cells were starved overnight in minimal DMEM supplemented with 2% FBS and 1 mM glucose and treated with 2ng/ml_ TGF or left untreated for 48hr. Nuclear/Cytoplasmic extracts were obtained using a High/Low salt protocol and proteins were resolved by SDS-PAGE. Immunoblots were probed with antibodies for E-Cadherin (120kDa; 80kDa), N-Cadherin (135kDa), ER-66kDa), Vimentin (57kDa), RUNX2 (60kDa MCF7; 55kDa Hs578t), or β-actin (Sigma-Aldrich). FIG. 5C shows that YAP expression and localization are not affected by RUNX2 in MCF7 cells. MCF7 Tet.OFF cells cultured in the presence (doxycycline+, RUNX2 negative) or absence (doxycycline-, RUNX2 positive) of doxycycline were analyzed for changes in YAP localization using specific antibodies. YAP was detected in both cytoplasmic and nuclear fractions of both RUNX2 positive and negative cells.

FIGS. 6A-6E illustrate that TAZ cooperates with RUNX2 to promote tumorsphere formation. FIG. 6A shows that higher levels of nuclear TAZ are found in RUNX2 positive cells. MCF7 Tet.OFF cells were grown in the presence (RUNX2-) or absence (RUNX2+) of doxycycline for 3 days and starved 16hr in minimal DMEM supplemented with 1 mM glucose and 2% FBS (t=0). Cells were then treated for 48hr with 2ng/ml_ TGF with or without EGTA (500μΜ or 1 mM). Cytoplasmic and nuclear extracts were resolved by SDS- PAGE and immunoblots were probed with antibodies for YAP/TAZ (50kDa), FLAG (RUNX2, 60kDa), and β-Actin (42kDa). Cytoplasmic and nuclear TAZ (50kDa) protein bands were normalized to β-Actin, quantified using Image-J, and graphed as fold-change relative to RUNX2 negative cells. FIG. 6B shows that RUNX2 and TAZ associated in the same immune complex. Cells were either cultured in Full Media (DMEM, 10%FBS) or starved in minimal DMEM media supplemented with 1 mM glucose and 2% FBS for 16hr. Nuclear lysates (400μg) were immunoprecipitated (IP) using YAP/TAZ antibody, resolved by SDS- PAGE, and immunoblots were probed for RUNX2 and TAZ. To visualize TAZ expression a conformation-specific Rabbit IgG was used. Rabbit IgG and beads alone were used as controls. Inputs are nuclear lysates. FIG. 6C shows TAZ knockdown in MCF7 Tet.OFF RUNX2 cells. MCF7 Tet.OFF RUNX2 cells were treated with siRNA targeting three different regions of the TAZ mRNA or scrambled siRNA control. Protein levels of TAZ (50kDa) were assayed 96 hr post-transfection. FIG. 6D shows that knockdown of TAZ protein inhibits tumorsphere formation. MCF7 Tet.OFF RUNX2 cells were transfected with TAZ siRNA or scrambled control and 24hr post transfection cells were scraped from dishes and resuspended in basal media supplemented with 2 ng/mL TGF in ultra-low attachment plates. After growth for 12 days, wells were photographed and tumorsphere sizes were measured from photographic images. Statistical analysis was performed using Student's t- test or ANOVA to determine significance between RUNX2 treatment groups. Representative photos of colonies are shown. FIG. 6E shows inhibition of TAZ nuclear localization in RUNX2 positive MCF7 and HCC1428 cells treated with compound 1. MCF7 Tet.OFF RUNX2 cells were grown with (RUNX2-) or without (RUNX2+) doxycycline and treated for 24, 48, or 72hr with 50μΜ compound 1 drug. Nuclear proteins were collected using the High/Low salt extraction method and resolved by SDS-PAGE. Proteins were visualized using antibodies against YAP/TAZ (50kDa) and β-actin (42kDa). TAZ protein bands were quantified using Image-J and normalized to β-actin. Fold changes relative to untreated cultures are indicated. TAZ nuclear protein levels were unaffected in compound 1- treated RUNX2 negative cells (MCF7 +doxycycline; 72hr).

FIGS. 7A-7E show RUNX2 expression is associated with production of soluble E- Cadherin (sE-Cad) and tumorsphere formation. FIG. 7A shows that RUNX2 increases the production of sE-Cad associated with the cell surface in response to TGF . MCF7 Tet.OFF cells were grown in the presence (RUNX2 -) or absence (RUNX2+) of doxycycline for 3 days and starved 16hr in minimal DMEM supplemented with 1 mM glucose and 2% FBS (t=0). Cells were then treated for 48 hr with 2 ng/mL TGF with or without EGTA (500 μΜ or 1 mM). Cytoplasmic and nuclear fractions were obtained and resolved by SDS-PAGE. Immunoblots were probed with antibodies for E-Cadherin (120kDa = full length; 80kDa = sE- Cad), FLAG (RUNX2; 60kDa), and β-Actin (42kDa). FIG. 7B shows that RUNX2 positive MCF7 cells secrete higher levels of sE-Cad. Conditioned media from MCF7 Tet.OFF cells were collected following a 16 hr starvation in minimal DMEM supplemented with 1 mM glucose and 2% FBS (t=0) or after treatment with 2ng/mL TGF for 48hr. Conditioned media were centrifuged to remove cellular debris, and immunoprecipitated using 0^g of E- Cadherin antibody. Proteins were eluted from beads and separated by SDS-PAGE followed by Western blot with antibodies to detect full-length (120kDa) and ectodomain (80kDa) sE- Cad. FIG. 7C shows sE-Cad-mediated tumorsphere formation in RUNX2-expressing MCF7 cells. MCF7 cells were cultured in suspension in basal media supplemented with 2ng/ml_ TGF with or without (TGFp untreated Ctrl and IgG isotype control) an E-Cadherin specific antibody, DECMA-1. After 10 days, wells were photographed and tumorsphere sizes were measured from photographic images. Statistical analysis was performed using Student's t- test or ANOVA. FIG. 7D shows that treatment with compound 1 inhibits sE-Cad production. MCF7 Tet.OFF cells were and treated for 24, 48, or 72hr with 50μΜ compound 1. Cytoplasmic fractions were obtained using the High/Low salt extraction method and proteins were resolved by SDS-PAGE. Proteins were visualized using antibodies against E-Cadherin (Full length = 120kDa; sE-Cad = 80kDa) and β-actin (42kDa). SDS-PAGE was performed in triplicate and results were quantified. FIG. 7E shows the effect of TAZ knockdown on sE- Cad production. TAZ siRNA#1 (FIG. 5C) was used to reduce TAZ levels and the expression of E-Cadherin (120kDa and 80kDa), TAZ (cytoplasmic or nuclear) and RUNX2 (FLAG) was determined by Western blot. Quantitation represents results from 3 separate gels.

FIGS. 8A-8C demonstrate HER2 expression in RUNX2 positive cells that express elevated sE-Cad levels sensitizes cells to HER2-targeted drugs. FIG. 8A shows that TGF treated RUNX2 positive MCF7 cells express HER2. MCF7 Tet.OFF cells were grown in the presence (RUNX2 -) or absence (RUNX2+) of doxycycline for 3 days and starved for 16hr in minimal DMEM supplemented with 1 mM glucose and 2% FBS (t=0). Cells were then treated for 48hr with 2ng/ml_ TGF with or without EGTA (500μΜ or 1 mM). Cytoplasmic and nuclear fractions resolved by SDS-PAGE and immunoblots were probed with antibodies for HER2 (180kDa), FLAG (RUNX2; 60kDa), or β-Actin (42kDa). FIG. 8B shows that TGF cells expressing RUNX2 are sensitive to Herceptin. MCF7 RUNX2 Tet.OFF cells were cultured in suspension in basal media for 10 days supplemented with 2ng/mL TGF with or without (IgG isotype control) 10μg mL Herceptin (replenished every 2-3 days). Representative photos of colonies are shown. FIG. 8C shows that TGF RUNX2 positive cells are sensitive to Lapatinib treatment. MCF7 RUNX2 Tet.OFF cells were cultured in suspension for 15 days in 2ng/mL TGF with or without (DMSO control) 1 μΜ lapatinib. Representative photos of colonies are shown.

FIGS. 9A-9B demonstrate that Hippo signaling is regulated by both oncogenic soluble E-Cadherin and RUNX2 targeting compound 1. In FIG. 9A HCC1428 luminal BC cells that express E-Cadherin were treated with recombinant soluble E-Cadherin (rsE-Cad) for 24hr and total cell extracts were analyzed for phosphorylation of the Lats1/2 tumor suppressors. Phospho.Lats1/2 and total Lats1/2 levels declined with rsE-Cad treatment consistent with TAZ translocation to the nucleus, where it acts as an oncogene with RUNX2. FIG. 9B shows that RUNX2 targeting with compound 1 increases pLatsl and total Lats1/2. MCF7 cells expressing RUNX2 (Tet.OFF) were treated with compound 1 drug for 24 hours and total cell extracts were analyzed for phosphp.Lats1/2, total Lats1/2, and RUNX2 expression.

FIGS. 10A-10B demonstrate that RUNX2 inhibits PDH activity, which increases in response to RUNX2-targeting compound 1 drug treatment. In FIG. 10A PDH enzymatic activity was determined in doxycycline-responsive MCF7-tet-off (left) and Hs578t-Control or RUNX2 KD cells (right) or non-targeting control siRNA (NTC = RUNX2+) versus RUNX2 KD (55.5 cells = RUNX2 KD) using an antibody-specific microtiter plate assay. Results are expressed as the change in Absorbance at 450nm per minute per mg protein (AmOD ₄ 5o/min/mg) (*p < 0.05). In FIG. 10B PDH activity was determined in MDA-MB-468 (left) and MCF7 (right) BC cell lines with or without compound 1 treatment (50μΜ) for the indicated time period.

FIGS. 11A-11 B demonstrate that PDH activity increases in response to RUNX2- targeting compound 1 drug treatment. PDH activity (AOD/min/mg protein) was determined as in FIGS. 10A-10B. In FIG. 11A MDA-231 or BT-474 breast cancer cells were treated with 50μΜ compound 1 for 3hr or 1-3 days. FIG. 11 B shows controls T47D-Vector control or T47D-RUNX2-clone #10 overexpressing cells; MCF7-Vector Control or RUNX2-clone #2 overexpressing cells treated with 50μΜ compound 1 for 1 day (.

FIGS. 12A-12D demonstrate that RUNX2 and compound 1 regulates PDH complex. FIG. 12A shows that RUNX2 increases PDHEI phosphorylation (Ser293), but decreases PDP1 level. In contrast, RUNX2 KD decreases PDHEI a phosphorylation but increases PDP1 . Immunoblot analyses were performed using antibodies indicated in T47D-RUNX2 and -Empty cells (left) and in Hs578t cells (middle). Parental, non-transfectant; 54.5, a negative clone for RUNX2 KD; Control, non-targeting control; RUNX2 KD, a positive control for RUNX2 KD. In FIG. 12B MDA-MB-231 , MDA-MB-468 and MCF7 cells were treated with compound 1 (50 μΜ) for indicated time period and the expression of PDP1 , p-PDHE1 and total PDHEI a were determined. FIG. 12C shows that compound 1 inhibits RUNX2 phosphorylation and levels of RUNX2 cofactor, CBFB. FIG. 12D shows that compound 1 inhibits CBFB levels in MDA-231 cells.

FIGS. 13A-13B demonstrate that Complex I Activity measures the ability of NADH Dehydrogenase to transfer electrons to the electron transport chain in mitochondria (AOD/min/mg protein). In FIG. 13A MDA-231 , MDA-468, MCF7, and BT-474 breast cancer cells were treated with compound 1 (50 μΜ) for 1-3 days. Complex I activity increased in MDA-468 and MCF7 cells. In FIG. 13B T47D-Vector control or T47D-RUNX2-clone #10 overexpressing cells; MCF7-Vector Control or RUNX2-clone #2 overexpressing cells were treated with 50μΜ compound 1 for 1 day. FIGS. 14A-14B demonstrate that ROS levels in breast cancer cells treated with anti- RUNX2 compound 1. In FIG. 14A MDA-231 , MDA-468, MCF7 and BT474 breast cancer cells were treated with compound 1 (0 - 100 μΜ) for 6-18 hours and ROS production in response to H202 treatment (2mM) was measured with luciferase-based luminometer assay. In FIG. 14B T47D-Vector control or T47D-RUNX2-clone #10 overexpressing cells; MCF7-Vector Control or RUNX2-clone #2 overexpressing cells were treated with 50μΜ compound 1 for 6 hours.

FIGS. 15A-15C demonstrate compound 1 inhibits spontaneous breast cancer tumor development in mice. FIG. 15A illustrates expression of RUNX2 with age in MMTV/PyMT transgenic mice. Relative to normal mammary gland (control mice), FIG. 15B illustrates tumor incidence (palpable tumors) after starting treatment with compound 1. Control mice were treated with vehicle (DMSO). All mice developed multiple tumors. Treatment with compound 1 (1-20mg/kg) delayed tumor incidence. FIG. 15C is a box/whisker plot showing median tumor weights with min/max values. Significant differences in tumor weight were found for mice treated with 5mg/kg or 20mg/kg compound 1 (p=0.022; p=0.021 ). Representative tumors are shown below the plot.

FIGS. 16A-16C illustrate an angiogenic and metastic potential assay. FIG. 16A shows a confluent monolayer of MCF7 tumor cells is wounded with a pipette tip and a "plug" of Huvec within matrigel is solidified opposite the wounded monolayer. In FIG. 16B cells are incubated at 37C for various periods of time and the distance that tumor cells have migrated from the wound front is measured with Olympus Q-Pro software. Significant increases in cancer cell migration (*p < 0.05) upon RUNX2 induction and significant inhibition by compound Itreatment (**p < 0.01) are observed. FIG. 16C shows representative results from each treatment group. Shown for comparison is the lack of migration in the absence of Huvec cells (-Dox NO Huvec). DMEM, Dulbecco's modified Eagles Media; EBM, endothelial basal media + growth factors + FBS + TGFB; -Dox, removal of doxycycline for 3 days prior to the assay induces the expression of RUNX2; +Dox, treatment with doxycycline represses RUNX2 expression; compound 1 , RUNX2 targeting transcriptional inhibitor. DETAILED DESCRIPTION OF THE INVENTION

As used herein, the term "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." Some embodiments of the invention may consist of or consist essentially of one or more elements, method steps, and/or methods of the invention. It is contemplated that any method described herein can be implemented with respect to any other method described herein.

As used herein, the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or."

As used herein, "comprise" and its variations, such as "comprises" and "comprising," will be understood to imply the inclusion of a stated item, element or step or group of items, elements or steps but not the exclusion of any other item, element or step or group of items, elements or steps unless the context requires otherwise. Similarly, "another" or "other" may mean at least a second or more of the same or different claim element or components thereof.

As used herein, the term "about" refers to a numeric value, including, for example, whole numbers, fractions, and percentages, whether or not explicitly indicated. The term "about" generally refers to a range of numerical values (e.g., +/- 5-10% of the recited value) that one of ordinary skill in the art would consider equivalent to the recited value (e.g., having the same function or result). In some instances, the term "about" may include numerical values that are rounded to the nearest significant figure.

As used herein, the terms "compound", "inhibitory compound" and "inhibitor" refer to a chemical entity effective to inhibit an activity of RUNX2 in a cancer cell such as, but not limited to, inhibiting RUNX2 protein, inhibiting RUNX2 over expression or inhibiting RUNX2 gene.

As used herein, the term "contacting" refers to any suitable method of bringing a compound or a composition into contact with a cell. For in vivo applications, any known method of administration is suitable as described herein.

As used herein, the term "subject" refers to any human or non-human recipient of the compounds or pharmaceutical compositions thereof described herein.

In one embodiment of the present invention there is provided a compound having the chemical structure:

where and R ₂ inde endently are H, CI, F, Br, CH ₃ , CF ₃ , SH, -NCC^alkyl);*, -

NHCCC C^alkyl, or -NHC(0)C ₅ - ₇ cycloalkyl; R ₃ is H or d _-3 alkyl; and R ₄ is ; or a pharmaceutically acceptable salt thereof.

In one aspect of this embodiment R ₃ may be NH. In another aspect and R ₂ Ri

and R ₂ independently may be H, CI, Br, or -NHC(0)CH ₃ , R ₃ is NH and R ₄ is

In yet another aspect and R ₂ independently may be H, -

NHC(0)CH ₃ , -NHC(0)cyclohexane, or -N(CH ₃ ) ₂ , R ₃ may be NH and R ₄ may be . Particularly, compounds of this embodiment are those depicted in FIGS. 1A-1 K.

In another embodiment of the present invention there is provided a compound having the chemical structure:

or a pharmaceutically acceptable salt thereof.

In a related embodiment the present invention provides a pharmaceutical composition comprising the compound as described supra and a pharmaceutically acceptable carrier.

In yet another embodiment of the present invention there is provided a method for treating a cancer in a subject, comprising administering to the subject a dose of one or more compounds as described supra effective to inhibit a RUNX2 activity, thereby treating the cancer. Further to this embodiment the method comprises administering one or more other cancer drugs. Non-limiting examples of cancer drugs are Herceptin, Lapatinib, or DECMA1 antibody. In both embodiments the cancer may be breast cancer, osteosarcoma, ovarian cancer, prostate cancer, melanoma, Ewing sarcoma, pancreatic cancer, thyroid cancer, leukemia, head/neck cancer, colorectal cancer, liver cancer, lung, pituitary cancer, gliomas, esophageal cancer, or multiple myeloma. Alternatively, the cancer may be a metastatic cancer.

In a related embodiment the present invention provides a method for treating breast cancer in a subject comprising administering to the subject a dose of one or more compounds as described supra effective to inhibit RUNX2, thereby treating the cancer. A further embodiment comprises administering one or more other cancer drugs as described supra. In these embodiments the breast cancer may comprise metastases thereof.

In yet another embodiment of the present invention there is provided a method for treating a metastatic cancer in a subject, comprising administering to the subject a dose of one or more compounds of claim 1 effective to inhibit a RUNX2 activity, thereby treating the metastatic cancer. A further embodiment comprises administering one or more other cancer drugs as described supra. In both embodiments the metastatic cancer may originate from a breast cancer, a lung cancer, a melanoma, a colorectal cancer, a prostate cancer, or a pancreatic cancer.

In a related embodiment the present invention provides a method for inhibiting metastasis of a cancer in a subject, comprising contacting cells comprising the cancer with one or more compounds of claim 1 effective to decrease migration of the cancer cells away from the cancer, thereby inhibiting metastasis of the cancer. A further embodiment comprises administering one or more other cancer drugs as described supra. In both embodiments the cancer cell may comprise a breast cancer, an osteosarcoma, an ovarian cancer, a prostate cancer, a melanoma, a Ewing sarcoma, a pancreatic cancer, a thyroid cancer, a leukemia, a head/neck cancer, a colorectal cancer, a liver cancer, a lung, a pituitary cancer, a gliomas, an esophageal cancer, or a multiple myeloma.

In yet another embodiment of the present invention there is provided a method for inhibiting RUNX2 activity in a cancer cell, comprising contacting the cancer cell with one or more of the compounds as described supra. In this embodiment the cancer cells may comprise a breast cancer, an osteosarcoma, an ovarian cancer, a prostate cancer, a melanoma, a Ewing sarcoma, a pancreatic cancer, a thyroid cancer, a leukemia, a head/neck cancer, a colorectal cancer, a liver cancer, a lung, a pituitary cancer, a gliomas, an esophageal cancer, or a multiple myeloma.

In yet another embodiment of the present invention there is provided a method for increasing survival of a subject with breast cancer, comprising administering to a subject having a breast cancer overexpressing RUNX2 protein a dose of one or more compounds as described supra effective to inhibit RUNX2 protein expression, thereby increasing the subject's survival. A further embodiment comprises administering one or more other cancer drugs as described supra. The cancer drugs and cancers are as described supra.

In a related embodiment the present invention provides a method for inhibiting RUNX2 protein expression in a breast cancer cell comprising contacting the breast cancer cell with one or more of the compounds as described supra.

Provided herein are compounds or inhibitory compounds effective to inhibit RUNX2 activity in a cancer. The compounds ma have the general chemical structure of:

or may be a suitable pharmacologically effective salt thereof. Generally, R^ R ₂ and R ₃ substituents may comprise independently, hydrogen, a halogen, a haloalkyl, a short chain alkyl, an alkylamide, a cycloalkylamide or an alkylamine. In non-limiting examples the alkyl moiety is a such as a Ci _-3 alkyl chain and the cycloalkyl moiety is a such as a C ₅ . ₇ ring. The R ₄ substituent is a bridged cycloalkenyl ring for example, but not limited to, a cyclohexene ring with a small alkyl bridge, such as a methylene bridge. Optionally, the bridge may be substituted with a small cycloalkyl ring, such as a cyclopropane ring. The compounds of the present invention encompass homologs, bioisosteres and/or positional isomers of the general chemical structure.

For example, the inhibitory compound may be (3-(N-(3,4-dichlorophenyl)carbamoyl)- 5-norbornene-2-carboxylic a mical structure of:

This compound may be utilized as a lead compound to screen for chemically-related analogs, such as, but not limited to, analogs with a high homology. Screening methods for drug analogs are well-known in the art. Particularly, compound 1 of the present invention is depicted in FIG. 1 A and analog compounds 2-11 are depicted in FIGS. 1 B-1 K.

Also provided are pharmaceutical compositions of the RUNX2 inhibitory compounds. As is known and standard in the art, the inhibitory compounds are formulated with, although not limited to, a pharmacologically acceptable carrier, diluent or excipient. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of an pharmaceutical composition that contains an inhibitory compound and/or additional drug will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference.

These carriers include any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, gels (e.g., gelatin), dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art. Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.

The inhibitory compounds described herein and other RUNX2 inhibitors may be administered orally or parenterally. An oral composition may comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, and combinations thereof. A composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.; or combinations thereof the foregoing. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both.

For parenteral administration, in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof.

The inhibitory compounds and compositions described herein may be used to treat one or more types of cancers. These RUNX2 inhibitory compounds, compositions and methods have one or more benefits over existing treatments. While many of the working examples are described for the treatment of breast cancer, such as luminal breast cancer, a person having ordinary skill in the art would readily understand that the teachings provided herein can be used to treat other types of cancer including but not limited to osteosarcoma, breast, ovarian, prostate, melanoma, Ewing sarcoma, pancreatic, thyroid, leukemia, head/neck, colorectal, liver, lung, pituitary, gliomas, esophageal, and multiple myeloma. Moreover, these inhibitory compounds and compositions may be used to target and treat metastases or metastatic cancers, such as, but not limited to, metastases originating from breast cancer, lung cancer, melanoma, colorectal cancer, prostate cancer, and pancreatic cancer or other. As such, these inhibitory compounds and compositions inhibit or decrease metastasis or the incidence of metastasis by decreasing migration of cancer cells from the cancer.

The inhibitory compounds and compositions described herein may be administered independently or in combination with one or more known drugs, such as cancer drugs or anti-cancer agents. Examples of cancer drugs are Herceptin, Lapatinib, and DECMA1 antibody. A non-limiting dosage range for compound 1 for example is about 1 mg/kg and 20 mg/kg.

Generally, it is known in the art that a dosage amount or therapeutically effective amount of an inhibitory compound and/or other known drug or pharmaceutical compositions of the present invention administered to a human or animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of cancer being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.

The following example(s) are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. EXAMPLE 1

Methods and materials

Cell culture

The MCF7 breast cancer cell line with inducible RUNX2 expression (ER+ MCF7) was prepared using the BD™ Tet-Off System (BD Biosciences). RUNX2- MCF7 cells are ER+ and express wild type p53, PTEN, c-myc, and ras, but do not express p16. MCF7 cells containing tTA (Tetracycline-controlled transactivator) regulatory vector (G418 resistant) were purchased from Clontech (Mountain View, CA), infected with retroviral vectors expressing RUNX2, and selected with 20C^g/ml hygromycin B. Cells were frozen within three passages and maintained in DM EM (Corning) containing 10% Tet-Approved FBS (Clontech) and the antibiotics G418 (100μg ml; Sigma), hygromycin B (200μg ml; Roche), and doxycycline (2pg/ml; Sigma) to repress RUNX2 expression (+Dox). To express RUNX2, cells were grown in the same media but in the absence of doxycycline (-Dox) for 72 hours to achieve maximal RUNX2 protein levels. T47D and HCC1428 luminal breast cancer cells were obtained from ATCC (Manassas, VA) and were a gift from Dr. Stuart Martin (University of Maryland). They were maintained in RPMI (Corning) containing 10% FBS (Gemini; #100-106) with 1 % Pen/Strep (Gemini; #400-109). T47D luminal breast cancer cells was also supplemented with 0.2Units/ml_ bovine insulin (Sigma; #10516). To validate EMT markers, the triple negative Hs578t cells were obtained from ATCC (Manassas, VA) and maintained in DMEM (Corning) supplemented with 5% FBS (Gemini) and 1 % Pen/Strep (Gemini).

Suspension culture - tumorsphere formation

MCF7 Tet.OFF cells were grown in the presence (+Dox, RUNX2 negative) or absence (-Dox, RUNX2 positive) of doxycycline for 3 days. Cells were then scraped and counted. 60,000 cells were plated in each well of a 6-well ultra-low attachment plate (Corning; 3471) in Promocell Basal Medium (Promocell; c-2221 1) complete with Supplement Mix (Promocell; c-39216). Cells were then treated with or without 2 ng/mL TGF (R&D Systems; 240-B-002). After growth for 10-15 days, wells were photographed and tumorsphere diameters were measured from photographic images (mm). Colony diameters were calculated using the formula: (L+W)/2. Representative photographs were obtained at 4X magnification. Other treatments included: 50 μΜ compound 1 (ChemBridge Corporation; 5221975), 20 μg/mL DECMA-1 (Sigma-Aldrich; U3254), 10 μg/mL Herceptin (replenished every 2-3 days; the University of Maryland Marlene and Stuart Greenebaum Cancer Center), and 1 μΜ Lapatinib (kind gift from Dr. Anne Hamburger at the University of Maryland Baltimore). For TAZ siRNA knockdown experiments, TAZ siRNA was transfected (as below) into MCF7 Tet.OFF cells and 24hr later cells were scraped and placed into suspension as described above.

Western blot and antibody protocols

MCF7 cells were grown to subconfluence in the presence or absence of doxycycline for 72hr in full media as described above. Cells were then treated in minimal DMEM (Sigma, D5030) containing 0.1 %BSA, 1 % L-glutamine, 2% Tet-Approved FBS, and 1 mM glucose for 16 hours followed by treatment with 2ng/ml_ TGF (R&D Systems, 240-B-002) for 48 hours in the presence or absence of EGTA to examine sE-Cad expression levels, TAZ localization, and HER2 expression levels. Cells were washed with PBS and scraped from plates. Cytoplasmic and nuclear lysates were obtained using the Low/High Salt extraction method [50]. Cytoplasmic extracts were obtained by resuspending cells in NP40 containing Hypotonic Buffer (10mM HEPES pH 7.4, 1.5mM MgCI ₂ , 10mM KCI, 0.5% NP40) followed by a 30 min incubation on ice and centrifiugation. Nuclear extracts were obtained by resuspending the nuclear pellet in an equal volume of low salt buffer (10mM HEPES, 25% glycerol, 1 .5mM MgCI ₂ , 20mM KCI, 0.2mM EDTA) followed by high salt buffer (10mM HEPES, 25% glycerol, 1.5mM MgCI ₂ , 800mM KCI, 0.2mM EDTA) followed by vortexing, 30 min incubation on ice, another vortex, and centrifugation. Samples were resolved on 4-12% Bis-Tris polyacrylamide gradient gels (Invitrogen) and transferred to PVDF membranes (Millipore). Membranes were probed with antibodies listed below followed by development with enhanced ECL (Millipore). Proteins were visualized using antibodies recognizing: E- Cadherin (Abeam, HECD-1 , ab1416), YAP/TAZ (Cell Signaling, D24E4, #8418), FLAG antibody (from Dr. Chen-Yong Lin at Georgetown University, Washington DC), RUNX2 (Cell Signaling, D1 L7F, #12556), HER2 (Santa Cruz, C-18, sc-284), ER-a (Santa Cruz, G-20, sc- 544), N-Cadherin (Abeam, ab18203), Vimentin (Santa Cruz, V9, sc-6260), Histone H2A (Cell Signaling, #2578), β-actin (Sigma/Aldrich), GAPDH (Cell Signaling, 14C10, #21 18), and YAP (Novus Biologicals). Protein levels were normalized to actin and quantified using NIH Image-J software. Immunoprecipitation/Co-immunoprecipitation assay (IP/Co-IP)

Conditioned media was collected from MCF7 cells cultured in the presence (RUNX2 negative) or absence (RUNX2 positive) of doxycycline in minimal DMEM (Sigma, D5030) containing 0.1 %BSA, 1 % L-glutamine, 2% Tet-Approved FBS, and 1 mM glucose for 16 hours followed by treatment with 2ng/mL TGF (R&D Systems, 240-B-002) for 48 hours. Conditioned Media was carefully removed from cells and remaining cellular debris was pelleted briefly by centrifugation. Conditioned Media protein levels were estimated using the Bradford assay. 200μ9 of protein was suspended in 200μΙ_ Co-IP buffer (50mM Tris pH 7.5, 150mM NaCI, 1 mM EDTA, 1 mM EGTA, 1 % Triton X-100, 0.5% NP-40) and precleared in 20μΙ_ of a 50% slurry of Protein G-Sepharose (GE Healthcare, 17-0618-01 ) for 30 minutes. Precleared supernatants were then incubated overnight with 0^g of E-Cadherin antibody (Abeam, HECD-1 , ab1416). Protein G-Sepharose was added for 1 hour and the precipitated complexes were washed with Co-IP buffer. Proteins were eluted from the beads using 0.1 M Glycine buffer (pH 2.5), treated with 1X SDS loading buffer containing β-mercaptoethanol, and heated at 97°C for 10min. Samples were resolved on a 4-12% Bis-Tris polyacrylamide gel (Invitrogen) and transferred to PVDF membranes (Millipore). Immunoblots were probed for E-Cadherin (Abeam, HECD-1 , ab1416) followed by development with enhanced ECL (Millipore).

To test for RUNX2 and TAZ protein interaction, nuclear lysates were obtained using NucBuster (Novagen) from MCF7 cells grown in full media or cultured in the presence (RUNX2 negative) or absence (RUNX2 positive) of doxycycline in minimal DMEM (Sigma, D5030) containing 0.1 %BSA, 1 % L-glutamine, 2% Tet-Approved FBS, and 1 mM glucose and 2ng/ml_ TGF for 4 and 24 hours. Briefly, 400μg of protein was resuspended in Co-IP buffer to a final volume of 200μΙ_. Lysates were precleared with 35μΙ_ of a 50% slurry of Protein G-Sepharose (GE Healthcare) for 1 hr. Precleared nuclear lysates were then incubated with 4μΙ_ of YAP/TAZ antibody (Cell Signaling) overnight. Protein G-Sepharose was added for 1 hour and the precipitated complexes were washed with Co-IP buffer. Proteins were eluted from the beads using 0.1 M Glycine buffer (pH 2.5), treated with 1X SDS loading buffer containing β-mercaptoethanol, and heated at 97°C for 10min. Samples were resolved on a 4-12% Bis-Tris polyacrylamide gel (Invitrogen) and transferred to PVDF membranes (Millipore). Immunoblots were probed for RUNX2 (Cell Signaling, D1 L7F, #12556), and YAP/TAZ (Cell Signaling, D24E4, #8418) followed by development with enhanced ECL (Millipore). To visualize the TAZ protein band a conformation specific rabbit secondary antibody was used (Cell Signaling, L27A9, #5127). Rabbit IgG and beads alone were used as Co-IP controls. siRNA mediated knockdown of TAZ

TAZ knockdown was performed in MCF7 Tet.OFF cells using Custom 23mer desalted siRNA oligonucleotides from Sigma and a Universal Scrambled Negative Control siRNA Duplex from Origene (Catalog No. SR30004): TAZ siRNA #1 : GACA UGAGAUCCAUCACUAUU (SEQ ID NO: 1 ), TAZ siRNA #2: GGACAAACACCCAU GAACAUU (SEQ ID NO: 2) and TAZ siRNA #3: AAGCCUAGCUCGUGGCGGAUU (SEQ ID NO: 3). Briefly, MCF7 Tet.OFF cells were grown in the absence or presence of doxycycline for 3 days and then transfected with corresponding siRNA's using Lipofectamine-2000 (Life Technologies). RIPA extracts were obtained 48hr post transfection and total protein was analyzed by Western blot (see above) and probed for TAZ protein expression. Protein levels were normalized to actin and quantified using NIH Image-J software.

To assay for sE-Cad levels, MCF7 Tet.OFF cells were grown in the absence or presence of doxycycline for 3 days and then transfected with TAZ siRNA #1 using Lipofectamine-2000. Cells were trypsinized, replated 24 hours later, and allowed to reattach. After 72 hours, nuclear and cytoplasmic extracts were obtained using the High/Low salt extraction method described above and analyzed for sE-Cad, TAZ, and RUNX2. Protein levels were normalized to actin and quantified using NIH Image-J software.

Drug treatments with compound 1

The compound 1 (MF = C15H1 ₃ CI2NO ₃ ) has a molecular weight of 326.175, a high LogP value of 3.25 (logarithm of its partition coefficient between n-octanol and water, a measure of the compound's hydrophilicity with low hydrophilicity = high LogP), a low LogSW of -4.35 (measure of aqueous solubility), three rotatable bonds, a hydrogen bonding donor/acceptor ratio of 2/3 (Hdon/Hacc), a polar surface area of 66.4 (tPSA; indicative of good cell membrane permeability), and an IC50 of 10nM in D-ELISA DNA binding assays. MCF7 Tet.OFF cells were pretreated in the absence or presence of doxycycline for 3 days. RUNX2 transiently transfected T47D or HCC1428 breast cancer cells were grown in media that was then replaced with full media (as listed in cell culture section) and treated with or without 50 μΜ compound 1 . Cells were allowed to grow for 24, 48, and 72 hours. Nuclear and cytoplasmic extracts were obtained using High/Low salt extraction method and protein levels analyzed by Western blot (see above).

Attachment and Invasion Assay

Tissue culture plates were coated with Fibronectin (^g/ml), extracellular matrix (ECM; from endothelial cells cultured to confluence and treated with 5mM EDTA to remove cells), or with confluent endothelial cells (human bone marrow endothelial cells). MCF7. Tet.OFF cells (RUNX2 negative and RUNX2 positive cultured in the presence (+Dox, RUNX2 negative) or absence (-Dox, RUNX2 positive) of doxycycline for 3 days) were added to the indicated plates for 120min in D5030W media (Sigma) containing 0.1 %FBS, 5mM glucose, and 2ng/ml TGF . The number of cells/field attached to Fibronectin, ECM, or endothelial monolayer was counted from 3-4 fields/well. TCGA RUNX2 protein analysis

The Cancer Genome Atlas (TCGA) data was obtained from the online cbioportal (cbioportal.org/public-portal). The results shown represent protein expression and are based upon data generated by the TCGA Research Network (cancergenome.nih.gov). Briefly, cellular proteins were extracted and denatured in SDS sample buffer. After serial dilution of each sample, cell lysates were arrayed on nitrocellulose-coated slides and probed with specific RUNX2 and HRP-coupled antibodies to detect a signal by DAB colorimetric reaction. Spot densities were determined by MiroVigene, ( automatic spot finding and background subtraction) and protein concentrations were determined by super curve fitting and normalized for protein loading.

EXAMPLE 2

RUNX2 inhibitor compounds

3D analogs of the lead compound 1 (inhibitor of RUNX2 DNA binding, IC50 10nM) were identified using the drug screen, Chembridge.com (FIGS. 1A-1 K). All drugs are small compounds (300-400 molecular weight), with high hydrophobicity (LogP > 2.0), low solubility in water (LogSW < 0), high flexibility (2-3 rotatable bonds), capable of hydrogen bonding (2- 3 donor acceptor pairs; Hdon, Hacc), and low polar surface area (tPSA) for membrane permeability.

EXAMPLE 3

RUNX2 inactivates the Hippo tumor suppressor pathway in luminal breast cancer

The Hippo tumor suppressor pathway is active in the context of stable E-Cadherin interactions that promote epithelial cell:cell polarity. Under these conditions, E-Cadherin signaling maintains TAZ localization to 14-3-3 complexes in the cytosol and eventual ubiquitination and degradation. Upon induction of oncogenic events, which include sE-Cad production and cooperation with HER2 receptors, the Hippo pathway is inactivated and in this context TGF signaling promotes TAZ translocation to the nucleus where it can interact with transcription factors, such as RUNX2, which are responsible for activation of genes that promote cell invasion, survival, and tumorsphere formation.

RUNX2 expression supported a TGF -driven oncogenic signaling pathway that involves TAZ-mediated activation of tumorsphere formation, the production of soluble E- cadherin (sE-Cad), and cooperation with HER2, which was increased in RUNX2 expressing cells. The data indicate that E-Cad stabilizes HER2 and sensitizes breast cancer cells to HER2 targeted drugs and that luminal breast cancer cells expressing RUNX2 rely on HER2 signaling to potentiate their tumorigenic phenotype. The effects on tumorsphere formation are consistent with known roles for RUNX2 and TAZ in tumor-initiating functions. These results have identified several therapeutic targets that converge on RUNX2:TAZ transcriptional regulation in breast cancer cells. The combined signaling pathways may be responsible for a transcriptional program that mediates breast cancer tumorsphere formation and anchorage-independent growth (FIG. 2).

EXAMPLE 4

RUNX2 expression in luminal BCs and targeted therapeutic approaches

RUNX2 protein levels were examined in patients diagnosed with early stage luminal breast cancer (FIG. 3A). RUNX2 protein expression was associated with poor prognosis after diagnosis (overall survival; p = 0.016) in those patients with high RUNX2 protein expression (>2 SD; median survival 80 months) compared to patients with lower levels of RUNX2 protein (<2 SD; median survival 1 17.5 months). To define models of luminal breast cancer, several cell lines were examined for RUNX2 expression. Variable levels of endogenous RUNX2 protein were detectable in luminal MCF7, HCC1428, and T47D breast cancer cells (FIG. 5A).

To examine its oncogenic function, RUNX2 was expressed in the luminal breast cancer cell line, MCF7, under the control of a Tet.OFF promoter (FIG. 5A). RUNX2 expression increased attachment to extracellular matrix and fibronectin, and invasion through an endothelial cell monolayer (FIG. 3B). Culture of breast cancer cells in suspension as a model of anchorage-independent growth defines a transformed breast cancer cell phenotype (tumorspheres). Inducible RUNX2 expression in MCF7 cells resulted in tumorspheres that were significantly larger (3.6-fold;p <0.001) than MCF7 cells in which RUNX2 expression was repressed, especially in the presence of TGF (FIG. 3C).

To validate that tumorsphere growth was RUNX2 dependent, an inhibitor of

RUNX2:DNA binding (FIG. 4A), compound 1 , designed to interact with the RUNX2 DNA- binding pocket was used to treat MCF7 cells in suspension. Compound 1 significantly decreased the diameter of RUNX2 positive MCF7 tumorspheres (17.21 ±5.28 to 4.83±1.87; p<0.001 ), an almost 4-fold inhibition relative to vehicle-treated cells (FIG. 4B). RUNX2 negative cells were unaffected (6.98±2.89 to 6.37±1 .78; p=0.209). Therefore, RUNX2 is necessary for luminal breast cancer cell tumorsphere formation.

RUNX2 protein stability is regulated by phosphorylation, which promotes DNA binding. To determine whether targeting RUNX2 DNA binding altered the levels of RUNX2 MCF7 or T47D cells overexpressing RUNX2 were treated with the compound 1 DNA-binding inhibitor. Compound 1 reduced RUNX2 protein levels in both MCF7 and T47D cells (FIG. 4C). In MCF7 cells, RUNX2 protein levels were reduced about 8-fold after 24hr treatment (reduction of 90%) and greater than 95% after 48hr. In T47D cells, RUNX2 protein levels were reduced about 2-fold after 48hr confirming that targeting RUNX2 DNA binding can alter RUNX2 levels in vivo. EXAMPLE 5

Role of RUNX2 cofactor TAZ in anchorage independent growth

The Hippo signaling effectors, TAZ and YAP, are important RUNX2 transcriptional cofactors that interacts with the RUNX2 C-terminal domain. YAP expression in MCF7 cells was low and levels in response to RUNX2 expression did not change in these cells (FIG. 5B). However, TAZ nuclear levels were higher upon induction of RUNX2 expression compared to cells with low RUNX2 expression (FIG. 6A, lanes 7 and 9). Disruption of cell:cell contacts with EGTA resulted in additional increases in TAZ nuclear levels (lanes 1 1 and 12) with a concomitant decrease in cytosolic TAZ (lanes 5 and 6). Immunoprecipitation of TAZ showed that RUNX2 and TAZ were associated within the same immune complex only in RUNX2 positive MCF7 cells treated with TGFB (FIG. 6B). To determine if RUNX2 and TAZ cooperativity was necessary for tumorsphere formation, MCF7 cells expressing inducible RUNX2 were transfected with scrambled siRNA or three specific siRNAs targeting TAZ. TAZ knockdown to levels 70-80% (siRNAI ), 50-70% (siRNA2) or 30% (siRNA3) of control (scrambled siRNA) was observed in cells expressing low (doxycycline +) or high (doxycycline -) RUNX2 (FIG. 6C). Tumorsphere formation of RUNX2 positive cells was inhibited by all three specific siRNAs about 3-fold compared to untreated or scrambled siRNA over 12 days (FIG. 6D). Although significant (p=0.001 and p=0.006), TAZ siRNA#1 (4.85±2.1 1 ) and siRNA#2 (5.16±1.91 ) knockdown produced a modest decrease in tumorsphere size compared to controls in RUNX2 negative cells (6.97±2.89 for TGF treated and 7.18±2.98 for scrambled). TAZ siRNA#3 had no significant effect in these cells. However, TAZ siRNA #1 , 2, and 3 (4.43±1.47, 5.35±2.42, and 6.05±3.12 respectively) inhibited tumorsphere formation 2.5 to 4-fold in the RUNX2 positive MCF7 cells compared to controls (17.21 ±5.28 and 13.97±3.81 for TGFp and scrambled controls respectively). Interestingly, a 30% reduction in TAZ protein levels (FIG. 6C) was sufficient to significantly decrease tumorsphere formation by 65% in RUNX2 positive cells (p<0.001) while having no effect in RUNX2 negative cells. Further, breast cancer cell targeting with the RUNX2- selective compound 1 lowered TAZ nuclear levels within 24hr in RUNX2 positive cells (FIG. 6E; doxycycline -). However, compound 1 treatment of RUNX2 negative cells (doxycycline +) had no affect on nuclear TAZ levels over 72hr. Similarly, in HCC1428 breast cancer cells expressing endogenous RUNX2, treatment with compound 1 led to an 80% reduction in nuclear TAZ levels compared to vehicle-treated controls (FIG. 6E). EXAMPLE 6

Production of oncogenic E-Cadherin ectodomain (sE-CacQ is dependent on RUNX2 and TAZ The EMT can be regulated by RUNX2 in some breast cancer cells. However, in luminal breast cancer cells, RUNX2 did not promote the loss of E-Cadherin, the downregulation of ER or the expression of N-Cadherin and Vimentin, which are indicative of an EMT progression (FIG. 7C). Instead, RUNX2 was associated with a 129% increase in oncogenic E-Cadherin fragment, sE-Cadherin (sE-Cad; 80kDa) consisting of the E-Cadherin ectodomain (FIG. 7A). RUNX2 positive cells expressed 2.5-fold more sE-Cad in response to TGF treatment (48hr), compared to RUNX2 negative MCF7 cells (FIG. 7A, boxes 1 and 2). sE-Cad protein levels were reduced after treatment with the Ca ⁺² chelator EGTA suggesting that sE-Cad was associated with the cell surface. sE-Cad is an established biomarker for metastatic prostate cancer and has been found in the conditioned media of DU145 prostate cancer cells where it promotes tumorigenesis and mediates invasion. Conditioned media from MCF7 cells expressing RUNX2 contained 2.3-fold higher levels of sE-Cad ectodomain compared to RUNX2 negative cells (FIG. 7B). In contrast to RUNX2 positive cells, after 48hr treatment with TGF there was a 30% reduction in sE-Cad secreted into the conditioned media by RUNX2 negative cells. Baseline levels of sE-Cad released by the MCF7 Tet.OFF cells were similar in RUNX2 positive and RUNX2 negative cells at t=0. E-Cadherin and sE- Cad are neutralized using the ectodomain-specific E-Cadherin antibody, DECMA-1. Tumorsphere size was significantly inhibited in RUNX2 positive cells treated with DECMA-1 over 10 days (7.85±3.1 1 ; p<0.001 ) compared to TGF and IgG controls (13.06±5.16 and 14.88±4.14 respectively) indicating RUNX2 positive cells rely on sE-Cad for tumorsphere formation (FIG. 7C). However, DECMA-1 promoted larger tumorsphere formation in RUNX2 negative cells, perhaps through its ability to prevent E-Cadherin-dependent growth suppression, thus increasing cell proliferation. The RUNX2-selective compound 1 increased sE-Cad production 3.5-fold within the first 24hr of treatment, but sE-Cad levels declined by almost 20-fold by 72hr in RUNX2 positive cells (FIG. 7D). Baseline levels of sE-Cad were significantly higher in RUNX2 positive cells prior to treatment with compound 1 (p=0.02). A 2-fold decrease in sE-Cad production in RUNX2 negative cells (doxycycline +) (FIG. 7D) may be due to compound 1 inhibition of endogenous RUNX2 or of low amounts of RUNX2 produced by the Tet.OFF system even in the presence of doxycycline. Further, siRNA- targeted knockdown of the RUNX2 cofactor TAZ resulted in a 50% reduction in sE-Cad ectodomain expression without affecting RUNX2 levels (FIG. 7E). In summary, MCF7 cells naturally produce sE-Cad, its levels can be modulated by the expression of RUNX2 and TAZ, and expression of sE-Cad ectodomain mediates tumorsphere formation in RUNX2- expressing luminal breast cancer cells. EXAMPLE 7

Therapeutic targeting of sE-Cad/HER2 signaling in RUNX2-expressing luminal BC cells

The ErbB2/HER2 receptor family member is expressed in a subset of luminal breast cancer cells in the absence of gene amplification and HER2 is one of the main targets of sE- Cad. HER2 interacts with sE-Cad to promote ligand-independent cell signaling in triple negative breast cancer cells, but its role in luminal breast cancers (in the absence of gene amplification) is undefined. After 48hr treatment with TGF , RUNX2 positive MCF7 cells expressed 2-fold higher HER2 levels than RUNX2-negative cells (FIG. 8A, boxes 1 & 2) suggesting that RUNX2-mediated production of secreted sE-Cad (FIG. 7A) may stabilize HER2. Inhibition of sE-Cad levels at the cell surface with EGTA treatment (E-Cadherin destabilization to remove sE-Cad bound at the cell surface; FIG. 7A) correlated with a decrease in HER2 to levels observed in RUNX2 negative cells (FIG. 8A, box 3).

To test for functional HER2, the effect of HER2-targeted agents on tumorsphere formation was determined. The Herceptin monoclonal antibody binds the extracellular domain of HER2 and promotes receptor internalization and degradation, prevents homo/heterodimerization, and mediates antibody-dependent cellular cytotoxicity. Herceptin inhibited tumorsphere formation in RUNX2 positive MCF7 cells by 2-fold (1 1 .91 ±4.65 to 5.76±2.83; p<0.001), without affecting tumorsphere formation in RUNX2 negative cells (6.25±2.68 to 7.2±3.27; p=0.145) (FIG. 8B). Isotype-matched IgG had no significant impact on tumorsphere size. Lapatinib is a small molecule receptor tyrosine kinase inhibitor that is able to cross lipid bilayers and bind the intracellular kinase domain of HER2 to inhibit receptor activation. RUNX2 positive cells were very sensitive to lapatinib treatment, with tumorsphere size reduced by 2.5-fold relative to vehicle control over 15 days (13.48±4.87 to 5.68±1 .78; p<0.001) (FIG. 8C). Lapatinib had no effect on the tumorsphere formation capacity of RUNX2 negative cells (6.99±1 .67 to 6.08±2.38). These results are consistent with a cooperative function for HER2 and sE.Cad in promoting a tumorigenic phenotype in luminal breast cancer cells expressing RUNX2.

EXAMPLE 8

Hippo tumor suppressor pathway activated by compound 1 in luminal breast cancer cells

It was demonstrated that RUNX2 inactivates and RUNX2 inhibitors (compound 1) activate the tumor suppressor pathway Hippo signaling (FIGS. 9A-9B) in HCC1428 luminal breast cancer cells. Treatment with recombinant soluble E-Cadherin showed a decline in phosphorylation of the Lats1/2 tumor suppressors (FIG. 9A). Compound 1 treatment demonstrated an increase in phosphorylation of the tumor suppressors (FIG. 9B) which is consistent with activation of Hippo signaling and TAZ translocation to the cytosol. EXAMPLE 9

RUNX2 oncogenic function reversed and mitochondrial enzyme activity restored by compound 1

Compound 1 increases pyruvate dehydrogenase activity (PDH)

It was shown in an antibody-specific microtiter plate assay that there is an increase in

PDH activity in RUNX2 knockdown cells (FIG. 10A). It is shown in two breast cancer cell lines, MDA-MB-468 and MCF7, that compound 1 increases PDH activity. Compound 1 is a metabolic targeting agent because it increases PDH enzymatic activity (FIG. 10B) consistent with RUNX2 inhibition. As confirmation it was shown that overexpressing RUNX2 in MCF7 cells inhibits PDH activity but compound l increases PDH activity in same cells (FIG. 1 1A- 1 1 B). Furthermore using either luminal or TNBC cells it was demonstrated that compound 1 inhibits RUNX2 transcriptional activity and increases PDH activity (FIGS. 12A-12D).

Compound 1 increases Complex I activity

Complex I is a rate-limiting step in oxidative phosphorylation. It was demonstrated that compound 1 increased Complex I activity in MDA-468 and MCF7 cells (FIG. 13A) compared to controls (FIG. 13B).

Compound 1 increases mitochondrial reactive oxygen species (ROS) production

The ability of mitochondria to produce reactive oxygen species is a measure of increased electron flow through the electron transport chain. It was demonstrated that MDA- 231 , MDA-468, MCF7 and BT474 breast cancer cells treated with compound 1 showed an increase in mitochondrial ROS production (FIG. 14A) compared to control (FIG. 14B). EXAMPLE 10

Targeting RUNX2 in vivo with compound 1 inhibits spontaneous breast cancer development Runx2 expression increases with age in PyMT-induced breast cancer in MMTV/PyMT transgenic mice (FIG. 15A). While all mice, treated and control, developed tumors, the incidence of palpable tumors was delayed in mice treated with compound 1 (FIG. 15B) with significant differences in tumor weight and volume (data not shown) between mice treated with 5mg/kg or 20mg/kg compound 1 and control mice (DMSO only) (FIG. 15C). The results demonstrate that RUNX2 is an important determinant of breast cancer tumorigenesis. EXAMPLE 11

Cancer cell migration inhibited by compound 1

Compound 1 is shown to inhibit tumor cell migration in an angiogenic metastatic potential (AMP) assay (FIG. 16A). Cancer cells migrate a significantly shorter distance from the wound front upon treatment with compound 1 than in the control upon RUNX2 induction (FIGS. 16B-16C). This AMP assay can screen for other anti-RUNX2 targeted analogs and derivatives of compound 1 , such as to inhibit breast cancer metastatic activity.

The following references were cited herein.

1. Eroles et al., Cancer Treat Rev 2012; 38:698-707.

2. Cadoo et al., Q J Nucl Med Mol Imaging 2013; 57:312-321 .

3. Siegel et al., 2013. CA Cancer J Clin 2013; 63: 1 1 -30.

4. Foley et al., Semin Cell Dev Biol 2010; 21 :951-960.

5. Ganapathy et al., Clin Exp Metastasis 2012; 29: 493-509.

6. Ithimakin et al., Cancer Res 2013; 73: 1635-1646.

7. Ferrari et al., J Cell Physiol 2013; 228: 1 137-1 142.

8. McDonald et al., Dis Model Mech 2014.

9. Das et al., Eur J Cancer 2009; 45:2239-2248.

10. Onodera et al., Cancer Sci 2010; 101 :2670-2675.

1 1 . Barnes et al., Cancer Res 2004; 64:4506-4513.

12. Pratap e/ a/., Mol Cell Biol 2005; 25:8581 -8591 .

13. Pratap et al., Cancer Metastasis Rev 2006; 25:589-600.

14. Yagi et al., Embo J 1999; 18:2551-2562.

15. Cui et al., Mol Cell Biol 2003; 23:1004-1013.

16. Vitolo et al., Cancer Biol Ther 2007; 6:856-863.

17. Varelas et al., Nat Cell Biol 2008; 10:837-848.

18. Cordenonsi et al., Cell 201 1 ; 147:759-772.

19. Hiemer et al., J Biol Chem 2014; Mar 27.

20. Kim J et al., Proc Natl Acad Sci U S A 2012; 109:6124-6129.

21 . Liu et al., Int J Biochem Mol Biol 201 1 ; 2:247-256.

22. Chan et al., Cancer Res 2008; 68:2592-2598.

23. Lei et al., Mol Cell Biol 2008; 28:2426-2436.

24. Matteucci et al., Eur J Cancer 2013; 49:231-244.

25. Lee et al., J Cell Biol 2006; 172:973-981 .

26. Thiery et al., Cell 2009; 139:871-890.

27. Valastyan et al., Cell 201 1 ; 147: 275-292. 28. Hollestelle et ai., Breast Cancer Res Treat 2013; 138: 47-57.

29. David et ai, Cancer Res 2012; 72:2917-2923.

30. Grabowska et ai, Front Biosci (Landmark Ed) 2012; 17: 1948-1964.

31. Chunthapong et ai, J Cell Biochem 2004; 91 649-661.

32. Inge et ai., Exp Cell Res 201 1 ; 317:838-848.

33. Kuefer e/ a/., Clin Cancer Res 2003; 9:6447-6452.

34. Najy et ai, J Biol Chem 2008; 283:18393-18401.

35. Brouxhon et ai, Clin Cancer Res 2013; 19:3234-3246.

36. Brouxhon et ai., Mol Carcinog 2013.

37. Hofmann et ai., Clin Biochem 2013; 46: 1585-1589.

38. Kuefer et ai., Br J Cancer 2005; 92:2018-2023.

39. Turner et al., Semin Cancer Biol 2012; 22:374-378.

40. Underwood et ai., J Vis Exp 2013; Issue 78.

41. Qiao et ai., J Biol Chem 2006; 281 :71 18-7128.

42. Rajgopal et ai., J Cell Biochem 2007; 100:1509-1517.

43. Chimge et ai., Breast Cancer Res 201 1 ; 13:R127.

44. St. Croix et ai., J Cell Biol 1998; 142:557-571.

45. Nahta et ai., Nat Clin Pract Oncol 2006; 3:269-280.

46. Berman et ai., Cancer Prev Res (Phila) 2010; 3:579-587.

47. Chimge et al., Clin Cancer Res 2012; 18:901-91 1 .

48. Chimge et ai., Oncogene 2013; 32:2121-2130.

49. Yeh et ai., Curr Opin Oncol 2013; 25:652-658.

50. Underwood et ai., J Bone Min Res 2012; 27:913-925.

51. Frangou et ai., Oncotarget 2014; 5: 2166-12176.

52. Onder et al., Cancer Res 2008; 68:3645-3654.

In the foregoing specification the invention has been described with reference to specific embodiments thereof. It will, however, be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the invention. The specification and drawings are, accordingly, to be regarded in an illustrative rather than a restrictive sense.