TESTER, Mark, Alfred (29 Bolingbroke Grove, Toorak Gardens, South Australia 5065, AU)
ROY, Stuart, John (8/72 Queen Street, Norwood, South Australia 5067, AU)
TESTER, Mark, Alfred (29 Bolingbroke Grove, Toorak Gardens, South Australia 5065, AU)
| IHE CLAIMS UhFINlNG IHB INVEN TION ARE ΛS FOLLOWS: 1 Λ method for modulating the salinity tolerance of a plant cell, the method 1 om prising modulating the expression of a CI PKl 6 polypeptide in the plant cell. 2 The method ol claim 1 wherein the expression of the CIPklό polypeptide is modulated by modulating the expression of a ClPKIb nucleic acid in the plant cell 3 The method of ilaim 1 or 2 wherein expression or the CIPklό polypeptide and/or ClVKIh nucleic acid is upregulated in the plant cell and the salinity tolerance ot the plant cell is increased 4 The method ol claim 1 or 2 wherein expression of the C1PK16 polypeptide and/or t IPKIb nucleic add ^ downregulated m the plant t ell and the salinity tolerant e of the plant i ell is decreased 5. The method of any one of claims 1 to 3 wherein a ClPKIb nucleic acid is expressed in {he plant cell under the transcriptional control ot a constitutive transcriptional control sequence. 6 The method of claim 5 wherein the transcriptional control sequence comprises one or more repeats of a CaMV35S promoter 7. I he method of any one ol claims 1 to 6 wherein the plant cell is an angiospcrm plant t ell 8. lhe method ot any one of claims 1 to 7 wherein the plant cell is a monocotyledonous angiosperm plant cell 9 The method of any one ot tlairns 1 to S wherein the plant t ell is a cereal crop plant cell. 10. I he method ol any one of claims 1 U) Q wherein the plant cell is a rice cell 11. The method ot any one of claims i to 7 wherein the plant cell is a dicotyledonous angiosperm plant cell 12. A method for modulating the salinity tolerance of a multicellular structure comprising a plurality of plant cells, {he method comprising modulating {lie salinity tolerance ot one or more plant t ells in the multicellular structure ai cording to the method ot any one of claims 1 to 11 13. lhe method of claim 12 wherein expression of a ClPKl 6 polypeptide and/or CIPKIb nucleic acid is upregulated in {he one or more plant cells and the salinity tolerance of the multicellular structure is increased. 14. The method ot claim 12 wherein expression ot a CIPk 16 polypeptide and /or CIPK16 nucleic acid is downregulated in the one or more plant cells and the salinity tolerance of the multicellular structure is decreased. 15. The method of any one of claims 12 to 14 wherein the multic ellular structure comprises a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue 16. lhe method ot claim 13 wherein the plant is an angiosperm plant. 17. The method of claim 15 or 16 wherein the plant is a monocotyledonou? angiosperm plant. 18. lhe method of any one ot claims 15 to 17 wherein the plant is a cereal crop plant. 19 The method of any one ol claims 15 to 18 wherein the plant is a rice plant. 20 The method of claim 15 or 16 wherein ilie plant is a dicotyledonous angiosperm plant. 21 The method of any one of claims 15 to 20 wherein the multicellular structure comprises a plant or a part thereof and modulation of the salinity tolerance ol the plant or part lhereot is effected by modulating the expression of a Cl PKI 6 polypeptide and/or CIPKIo nucleotide sequence in at least one or more roof cells of the plant. 22. A genetically modified plant cell having modulated salinity tolerance relative to a wild type form of the plant cell, wherein the expression ol a CiPklό polypeptide and/or a CIPK16 nucleic acid is modulated in the plant cell 23. The cell of claim 22 wherein expression of the CI PKI 6 polypeptide and/or CIPKl 6 nucleic acid is υpregυlated in the plant cell and the salinity tolerance of the plant cell is increased 24. I he cell of claim 22 wherein expression of the CIPK.16 polypeptide and/or CIPKIb nucleic acid is downregulated m the plant cell and the salinity toll -ranee of the plant cell is decreased. 25 I he cell of claim 22 or 23 wherein a ClPKIb nucleic acid is expressed in the plant cell under the transcriptional control ot a constitutive transcriptional control sequence 26. The cell of claim 25 wherein the transcriptional control sequence comprises one or more repeats ol a CaMV i5S promoter 27. I he cell ot any one of claims 22 to 26 wherein the plant cell is an angiosperm plant i ell. 28. The cell of any one of claims 22 to 27 wherein [he plant cell is a monocotyL'donous angiosperm plant cell. 29. The cell of any one of claims 22 to 28 wherein the plant cell i« a cereal crop plant cell. 30. lhe ceil of any one of claims 22 to 29 wherein the plant ceil is a rice ceil. 31. The i ell of any one of claims 22 to 27 wherein the plant cell is a dicotyledonous angiosperm p] ant cell . 32. A multicellular structure having modulated salinity tolerance, wherein the multicellular structure comprises one or more plant cells according to any one of Jakns 22 to 3L The multicellular structure of claim 32 wherein expression of a ClFKI 6 polypeptide and/or ClPKw nucleic acid is upreguiated in the one or more plant ceils and the salinity tolerance of the multicellular structure is increased. 34. The multicellular structure of claim 32 wherein expression of a CIP polypeptide and/or CJPKl 6 nucleic acid is downregulated in the one or more plant cells and the salinity tolerance of the multicellular structure is decreased. 35. lhe multicellular structure of any one of claims 32 to 34 wherein the multicellular structure c omprises a whole plant,, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue. 36. The multicellular structure of claim 35 wherein the plant is an angiosperm plant. 37. The multicellular structure of claim 35 or 36 wherein the plant is a monocotyledonous angiosperm plant. 38. The multicellular structure of any one of claims 35 to 37 wherein the plant is a cereal crop plant. 39. The multicellular structure of any one of claims 35 to 38 wherein the plant is a rice plant. 40. The multicellular structure of claim 35 or 36 wherein the plant is a dicotyledonous angiosperm plant. 41. The multicellular structure of any one of claims 35 to 40 wherein the multicellular structure comprises a plant or a part thereof and modulation of the salinity tolerance of the plant or part thereof is effected by modulating the expression of a ClPKl 6 polypeptide and/or CIPKl 6 nucleotide sequence in at least one or more root cells of the plant. 42. A method for ascertaining or predicting the salinity tolerance of a plant cell, the method comprising determining the expression of a ClPKl 6 polypeptide and/or a CTPiCI 6 nucleic acid in the plant cell . 43. The method of claim 42 wherein relatively high expression of a C1PK16 polypeptide and/or ClPKl 6 nucleic acid in the plant cell is associated with increased salinity tolerance in the plant cell. 44. The method of claim 42 wherein relatively low expression of a ClPKI 6 polypeptide and/or CIPK16 nucleic acid in the plant cell is associated with decreased salinity tolerance in the plant cell. 45. The method of any one of claims 42 to 44 wherein the plant cell is an angiosperm plant cell. 46. I he method of any one of claims 42 to 45 wherein the plant cell is a monocolyledonous angiosperm plant cell 47. The method ot any one of claims 42 to 46 wherein the plant cell is a cereal crop plant cell. 48 The method of any one of claims 42 to 47 wherein the plant cell is a rice cell 49. The method ot any one of claims 42 to 45 wherein the plant cell is a dicotyledonous angiosperm plant cell. 50 Λ method for ascertaining or predicting the salinity tolerance of a multicellular struc ture- comprising a plant cell, the method c omprising ascertaining or predicting the salinity tolerance ot a plant cell in the multicellular struc ture according to the method of any one of claims 4°> to 4°. 51 The method of claim 50 wherein relatively high expression of a CIPK.16 polypeptide and/or ClP Klβ nucleic acid in the plant cell is associated with increased salinity tolerance in the multicellular <Mτuι ture. 52. lhe method ol claim 30 wherein relatively low expression of a C1FK16 polypeptide and/or CIF Kl 6 nucleic acid in the plant cell is associated with decreased salinity tolerance in the multicellular structure 5°i. The method of any one of claims ^O to ^2 wherein the multicellular structure comprises a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue. 54. The method of claim 53 wherein the plant is an angiosperm plant. 53. The method of claim 53 or 54 wherein the plant is a monocotyfedonous angiosperm plant. 56. The method of any one of claims 53 to 55 wherein the plant fc a cereal irop plant. 57. lhe method of any one of claims 53 to 56 wherein the plant is a rice plant. 58. The method of any one of iLiims 53 to 57 wherein the plant is a dicotyledonous angiosperm plant. 5C>. lhe method of any one of claims 53 to 3^ wherein the plant ceil comprises a root cell. |
PRIORITY CLAIM
This patent application claims priority to Australian provisional patent application 2008904596 filed 4 September 2008, the content of which is hereby incorporated by reference.
FIELD
The present invention is predicated, in part, on the identification of a gene involved in salinity tolerance in plants. As such, the present invention relates to methods for modulating salinity tolerance in plants. The present invention also provides plant cells and plants having modulated salinity tolerance. In further embodiments, the present invention also provides methods for determining the salinity tolerance of plant cells and plants.
BACKGROUND
Salinity is a major abiotic stress affecting crop plants in Australia, resulting in substantial loss of yield and millions of dollars of lost revenue. High levels of Na * in shoot tissue have adverse osmotic effects and reduce the amount of K * available for essential biological processes. Crucially, yield in cereals is commonly inversely proportional to the extent of shoot Na τ accumulation.
In order to combat this problem it would be desirable to understand how salt gets into a plant and how a plant deals with it once it is inside. Therefore, there is a need to identify the genes, resistant plant cultivars and cellular processes that are involved in salt tolerance with the goal of introducing these factors into commercially available crops. Reference to any prior art in this specification is not, and should not be taken as,, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country.
SUMMARY
The present invention is predicated, in part, on the use of recombinant inbred lines (RlLs) of Arabidopsis thaliana to identify quantitative trait loci (QTLs) linked to novel genes involved in Na' exclusion. A Bay-0 x Shahdara mapping population, produced from two parents with large geographical, ecological and genetic distances, has been used to identify a novel, significant QTL linked to Na h exclusion from the shoot, located on chromosome 2. Those RiLs with the Bay-0 genotype at the QTL have a twofold reduction in Na τ accumulation when compared to those with the Shahdara genotype. By creating 20 cleaved amplified polymorphic sequence (CAPS) markers to fine map the QTL a candidate gene of interest, CIPK16, was identified.
in a first aspect, the present invention provides a method for modulating the salinity tolerance of a plant cell, the method comprising modulating the expression of a CIPK16 poly peptide in the plant cell.
in some embodiments, the expression of the CiPKl 6 polypeptide is modulated by modulating the expression of a ClPKIb nucleic acid in the plant cell.
In some embodiments, expression of the CIPKl 6 polypeptide and/or CIPKl 6 nucleic acid is upregulated in the plant cell and the salinity tolerance of the plant cell is increased. In some embodiments expression of the CIPKl 6 polypeptide and/or CJPKl 6 nucleic acid is downregulated in the plant ceil and the salinity tolerance of the plant cell is decreased.
In a second aspect, the present invention provides a method for modulating the salinity tolerance of a multicellular structure comprising a plurality of plant cells, the method comprising modulating the salinity tolerance of one or more plant ceils in the multicellular structure according to the method of the first aspect of the invention,
In some embodiments, expression of a CI PKI 6 polypeptide and/or CIPK16 nucleic acid is upreguiated in the one or more plant cells and the salinity tolerance of the multicellular structure is increased. In some embodiments, expression of a CIPK16 polypeptide and/or CIPKlβ nucleic acid is downreguiated in the one or more plant cells and the salinity tolerance of the multicellular structure is decreased.
in some embodiments, the multicellular structure comprises a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue.
In a third aspect, the present invention provides a genetically modified plant cell having modulated salinity tolerance relative to a wild type form of the plant cell, wherein the expression of a CIPKlβ polypeptide and/or a CIPKl 6 nucleic acid is modulated in the plant cell.
In some embodiments, expression of the CI PKI 6 polypeptide and/or CIPKlβ nucleic acid is upreguiated in the plant cell and the salinity tolerance of the plant cell is increased. In some embodiments, expression of the CIPK16 polypeptide and/or CIPKlβ nucleic acid is downreguiated in the plant cell and the salinity tolerance of the plant cell is decreased.
In a fourth aspect, the present invention provides a multicellular structure having modulated salinity tolerance, wherein the multicellular structure comprises one or more plant cells according to the third aspect of the invention.
In some embodiments, expression of a CIPKlβ polypeptide and/or CIPKlβ nucleic acid is upreguiated in the one or more plant cells and the salinity tolerance of the multicellular structure is increased. In some embodiments, expression of a CIPKl 6 polypeptide and/or CJPKl 6 nucleic acid is downreguiated in the one or more plant cells and the salinity tolerance of the multicellular structure is decreased.
In some embodiments, the multicellular structure comprises a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue.
In a fifth aspect, the present invention provides a method for ascertaining or predicting the salinity tolerance of a plant cell, the method comprising determining the expression of a C1PK16 polypeptide and/or a C1PK16 nucleic acid in the plant cell.
In some embodiments, relatively high expression of a CIPKI 6 polypeptide and/or CIPKl 6 nucleic acid in the plant cell is associated with increased salinity tolerance in the plant cell. In some embodiments,, relatively low expression of a C1PK16 polypeptide and/or CIP Kl 6 nucleic acid in the plant cell is associated with decreased salinity tolerance in the plant cell.
In a sixth aspect, the present invention provides a method for ascertaining or predicting the salinity tolerance of a multicellular structure comprising a plant cell, the method comprising ascertaining or predicting the salinity tolerance of a plant cell in the multicellular structure according to the method of the fifth aspect of the invention.
In some embodiments, relatively high expression of a CIPK16 polypeptide and/or C1PK16 nucleic add in the plant cell is associated with increased salinity tolerance in the multicellular structure. In some embodiments, relatively low expression of a C1PK16 polypeptide and/or ClPKl 6 nucleic acid in the plant cell is associated with decreased salinity tolerance in the multicellular structure.
In some embodiments, the multicellular structure comprises a whole plant, plant tissue,, plant organ, plant part,, plant reproductive material or cultured plant tissue.
Nucleotide and amino acid sequences are referred to herein by a sequence identifier number (SEQ ID NO:), The SEQ ID NOs: correspond numerically to the sequence _ ς .
identifiers < 400 > 1 (SEQ ID NO :1), < 400 > 2 (SEQ ID NO : 2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided at the end of the specification.
TABLE 1 - Summary of Sequence Identifiers
DESCRIPTION OF EXEMPLARY EMBODIMENTS
It is to be understood that the following description is tor the purpose of describing particular embodiments only and is not intended to be limiting with respect to the above description.
In a first aspect, the present invention provides a method for modulating the salinity tolerance of a plant cell, the method comprising modulating the expression of a C1PK16 polypeptide in the plant cell.
The plant cells contemplated by the present invention may include any plant cell including angiosperm or gymnosperm higher plant cells as well as lower plant cells such as bryophy te, fern and horsetail cells.
In some embodiments, the plant cell may be a monocotyledonous angiosperm plant cell.
In some embodiments, the monocotyledonous plant cell may be a cereal crop plant cell. As used herein, the term "cereal crop plant" includes members of the Poaceae (grass family) that produce edible grain for human or animal food. Examples of Poaceae cereal crop plants which in no way limit the present invention include barley, wheat, rice, maize, millets, sorghum, rye, triticale, oats,, teff, wild rice, spelt and the like. However, the term cereal crop plant should also be understood to include a number of - "I -
non- Poaceae species thai also produce edible grain and are known as the pseudocereals, such as amaranth, buckwheat and quinoa.
In some embodiments, the plant cell may be a rit e plant cell. As referred to herein, "rice" includes several members of the genus Oyzc including the species Oryza ^airoa and Oiyza glάbcrπma. The term "rice" thus encompasses rice cultivars such as japonica or sinica varieties, indica varieties and javonica varieties, in some embodiments, the term "rice" refers to rice ot the species Oryza saliva.
In some embodiments, the plant cell may be a dicotyledonous angiosperm plant cell. Fxemplary dicots include, tor example, Aiabidopsis spp., Mcdkago spp., Nicotiana spp., soybean, canola, oil seed rape, sugar beet, mustard, sunflower, tomato, potato, saf flower, cassava, yams, sweet potato, other Brassicaceae such as Thdlungiella halύphϊϊa, among others.
As set out above, the present invention contemplates modulating the salinity tolerance of a plant cell.
The term "salinity" as used herein generally refers to the level of all salts in the growing environment of a plant. Thus, in some embodiments, the term "salinity tolerance" relates to the capacity of a plant cell or plant to survive and/or grow at a particular environmental salt concentration.
However, the most relevant salt for a majority of cropping systems is NaCl. Thus, in some embodiments, the term "salinity tolerance" refers to the capacity of a plant to survive and/or grow at a particular environmental sodium concentration. In some embodiments, salinity tolerance also refers to the ability of a plant to maintain a suitable sodium concentration in one or more tissues of the plant (eg. the shoots) at a particular environmental sodium concentration.
"Modulation" of salinity tolerance refers to an increase or decrease in the salinity - S -
tolerance of a plant cell or plant relative to an unmodified or wild type form of the cell.
An increase in salinity tolerance may include, for example: an increase (relative to an unmodified or wild type form of the plant) in the environmental salinity level at which a plant cell or plant may survive, grow or maintain a suitable shoot sodium concentration; an increase (relative to an unmodified or wild type form of the plant) in the biomass production, growth rate, seed yield or the like of a plant at a particular level of environmental salinity; and/or a decrease (relative to an unmodified or wild type form of the plant) in the rate or level of sodium accumulation in the plant or a particular part thereof (such as the shoots) at a particular environmental salinity level.
Conversely, a decrease in salinity tolerance may include, for example: a decrease (relative to an unmodified or wild type form of the plant) in the environmental salinity level at which a plant cell or plant may survive, grow or maintain a suitable shoot sodium concentration; a decrease (relative to an unmodified or wild type form of the plant) in the biomass production, growth rate, seed yield or the like of a plant at a particular level of environmental salinity; and/or an increase (relative to an unmodified or wild type form of the plant) in the rate or level of sodium accumulation in the plant or a particular part thereof (sudi as the shoots) at a particular environmental salinity level.
As set out above, the present invention contemplates modulating the salinity tolerance of a plant cell by modulating the expression of a ClPKI 6 polypeptide in the plant cell.
As referred to herein, a "C1PK16 polypeptide" includes the Arabidopsis thaliana polypeptide described under TAlR accession number At2g25090. The term "CI PKI 6 polypeptide" should also be understood extend to functional homologs of the polypeptide described under TAlR accession number At2g25090. ''Functional homologs" of a polypeptide described under TAlR accession number At2g25090 should be understood to include polypeptides which modulate the salinity tolerance of a plant. In some embodiments a functional homolog may comprise, for example, a polypeptide which has one or more amino acid insertions, deletions or substitutions relative to the polypeptide comprising the amino acid sequence set forth in At2g25090; a mutant form or allelic variant of the polypeptide comprising the amino acid sequence set forth in At2g25090; an ortholog of the polypeptide comprising the amino acid sequence set forth in At2g25090 in another plant species and the like.
In some embodiments, a functional homolog of a polypeptide comprising the amino acid sequence set forth in At2g25090 also comprises at least 40%, 42%, 44%, 46%, 48%, 50% ,. 52%, 54%, 56%, 58%, 60%, 62%, 64%, 66%, 68%, 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100% amino acid sequence identity to At2g25090.
When comparing amino acid sequences, the compared sequences should be compared over a comparison window of at least 100 amino acid residues, at least 200 amino acid residues, at least 300 amino acid residues, at least 400 amino acid residues or over the full length of SEQ ID NO: 2. The comparison window may comprise additions or deletions (ie. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschυl et al. (Nnd. .Acids Re?. 25: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19, 3 of Ausubei et ah (Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1998).
As a result of inconsistent nomenclature of genes and proteins within the ClPK family, it should be understood that orthologs of Arabidopsis thnliana CIPK16 (At2g25090) may be classified into different CIPK subfamilies. For example, homologs or orthologs of Arabidopsis thaliana C1PK16 (At2g25090) may include Arabidopsis tlialiana CIPK5 (At5gl0930), Arabidopsis thaliana C1PK25 (At5g25U0), Oryza satϊva CI PKI 6 (Q6ERS4), Populus trichocarpa CIPK20 (ABJ91235), Populus trichocarpa CIPK23 (ABJ91229) and Populus trichocarpa OPKb (ABJ91234).
As set out above, the present invention is predicated, in part, on modulating the expression of a CIPK16 polypeptide in a cell.
As referred to herein, modulation of the "expression" of a ClPKI 6 polypeptide includes modulating the level and/or activity of the polypeptide.
Modulation of the 'level" of the polypeptide should be understood to include an increase or decrease in the level or amount of a ClPKl 6 polypeptide in a cell or a particular part of a cell. Similarly, modulation of the "activity" of a CI PKI 6 polypeptide should be understood to include an increase or decrease in, for example, the total activity, specific activity, half-life and/or stability of a CIPK16 polypeptide in the cell.
By "Increasing" is intended,, for example, a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20 fold, 50-fold, 100-fold increase in the level of activity of a CJPKI 6 polypeptide in the cell. By "decreasing" is intended, for example, a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% reduction in the level or activity of a CIPK16 polypeptide in the cell.
"Modulating" should also be understood to include introducing a particular ClPKI 6 polypeptide into a cell which does not normally express the introduced polypeptide, or the substantially complete inhibition of a CIPK16 polypeptide activity in a ceil that normally expresses such a polypeptide.
In some embodiments, the expression of a C.1PK16 polypeptide is upregulated in the plant cell. "Upregulation" should be understood to include an increase in the level or activity of a CIPKl 6 in a cell and/or introducing a particular Cl PKI 6 polypeptide into a cell which does not normally express the introduced polypeptide.
In some embodiments, increasing or υpregulating the expression of a CIPK16 polypeptide in a cell effects an increase in the salinity tolerance of the cell.
In another embodiment, the expression of a CIPKl 6 polypeptide is downregulated in the plant cell. "Downregulation" should be understood to include a decrease in the level or activity of a CIPKl 6 in a cell and/or substantially complete inhibition of a particular CIPKl 6 polypeptide in a cell which normally expresses the CIPKI 6 polypeptide.
In some embodiments, decreasing or downregulating the expression of a C1PK16 polypeptide in a cell effects a decrease in the salinity tolerance of the cell.
The present invention contemplates any means by which the expression of a C1PK16 polypeptide in a cell may be modulated. This includes, for example, methods such as the application of agents which modulate CIPK16 polypeptide activity in a cell, including the application of agonists or antagonists; the application of agents which mimic CIPK16 polypeptide activity in a cell; modulating the expression of a nucleic acid which encodes a CIPK16 polypeptide in the cell; effecting the expression of an altered or mutated nucleic acid in a cell such that a CIPK16 polypeptide with increased or decreased specific activity, half-life and/or stability is expressed by the cell; or modulating the expression level,, pattern and/or targeting of a C1PK16 polypeptide in a cell for example via modification of a transcriptional control sequence and/or signal polypeptide associated with the ClPKl 6 polypeptide.
In some embodiments, the expression of the polypeptide is modulated by modulating the expression of a nucleic acid which encodes a CIPKl 6 polypeptide in the cell. As referred to herein, a nucleic add which encodes a ClPKl 6 polypeptide ("CIPK16 nucleic acid") refers to any nucleic acid which encodes a C1PK16 polypeptide as hereinbefore described.
The CIPKI 6 nucleic acids contemplated by the present invention may be derived from any source. For example, the CIPKlβ nucleic acids may be derived from an organism, such as a plant. Alternatively, the CIPKlβ nucleic acid may be a synthetic nucleic acid.
The CIPKlβ nucleic acids contemplated by the present invention may also comprise one or more non-translated regions such as 3' and 5' untranslated regions and/or introns.
The CIPKl 6 nucleic acids contemplated by the present invention may comprise, for example, mRNA sequences, cDNA sequences or genomic nucleotide sequences.
The term "modulating" with regard to the expression of a CIPK16 nucleic acid may include increasing or decreasing the transcription and/or translation of a CIPKlβ nucleic acid in a cell.
By "increasing" is intended, for example a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or greater increase in the transcription and/or translation of a CIPKlβ nucleic acid. By "decreasing" is intended, for example, a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% reduction in the transcription and/or translation of a CIPKlβ nucleic acid. Modulating also comprises introducing expression of a CIPKlβ nucleic acid not normally found in a particular cell; or the substantially complete inhibition (eg. knockout) of expression of a CIPKlβ nucleic acid in a cell that normally has such activity.
In some embodiments, the expression of a CIPKlβ nucleic add is upregulated in the plant cell. "Upregulation" should be understood to include an increase in the transcription arid/or translation of a C1PK16 nucleic acid in a cell and/or introducing transcription and/or translation of a particular CIPKlβ nucleic acid in a cell which does not normally express the introduced nucleic acid.
In some embodiments, the expression of a CIPK16 nucleic acid is downregulated in the plant cell. "Downregulation" should be understood to include a decrease in the transcription and/or translation of a CIPK16 nucleic acid in a ceil and/or substantially eliminating transcription and/or translation of a particular CIPKl 6 nucleic acid in a cell which does not normally expresses the ClPK 76 nucleic acid.
The present invention contemplates any means by which the expression of a CJPKl 6 nucleic acid may be modulated. Methods for modulating the expression of a CIPK16 nucleic acid include, for example: genetic modification of the cell to upregulate or downregulate endogenous CIPKlβ nucleic acid expression; genetic modification by transformation with a CIPKl 6 nucleic acid; genetic modification to increase the copy number of a CIPKlβ nucleic acid in the cell; administration of a nucleic acid molecule to the ceil which modulates expression of an endogenous CIPKlβ nucleic acid in the cell; and the like.
In some embodiments, the expression of a CIPKlβ nucleic acid is modulated by genetic modification of the cell. The term "genetically modified", as used herein, should be understood to include any genetic modification that effects an alteration in the expression of a CIPKlβ nucleic acid in the genetically modified cell relative to a non- genetically modified form of the cell. Exemplary types of genetic modification include: random mutagenesis such as transposon, chemical, LJV and phage mutagenesis together with selection of mutants which overexpress or underexpress an endogenous CIPKlβ nucleic acid; transient or stable introduction of one or more nucleic acid molecules into a cell which direct the expression and/or overexpression of CIPKlβ nucleic acid in the cell; modulation of an endogenous CIPK.16 polypeptide by site- directed mutagenesis of an endogenous CIPKlβ nucleic acid; introduction of one or more nucleic acid molecules which inhibit the expression of an endogenous CJPKl 6 nucleic acid in the cell, eg. a cosuppression construct, an RMAi construct or a miRNΛ construct; and the like.
In some embodiments the present invention iontemplates increasing the level of a CIPk 16 polypeptide in a cell, by introducing the expression of a CIPKIb nucleic acid into the cell, upregulating the expression of a ClPKIo nucleic acid in the cell and/or increasing the copy number of a ClPKIo nucleic acid in the cell.
Method" for transformation and expression of an introdiued nucleotide sequence in various cell types are well known in the art, and the present invention contemplates the use of any suitable method.
However, by way of example with regard to the transformation of plant cells, reference is made to Zhao et al. (MoI Breeding DOI 10.1007/si 1032-006-9005-6, 2006), Katsuhara et al. (Plant Cell Physiol 44(12): 1378-1383, 2003), Ohta el al. (FEBS l etter* 532: 279-282, 2002) and Wu et til. (Plant Science 169: 65-73, 2005). Further suitable methods for introduction of a nucleic acid molecule into plant cells include, tor example: Agrobacterium-mcdiciicd transformation, other baclerially-mediated transformation (see Broothaerts ft al, 2005, supra) micro projectile bombardment based translormation methods and direct DNA uptake based methods. Roa-Rυdrigue/ et al. (Agrobacteriurn mediated transformation of plants, 3 *a Fd. GAMBIA Intellectual Property Resource, Canberra, Australia, 2003) review a wide array of suitable Agrobacterium-mediated plant translormation methods tor a wide range of plant species. Micro projectile bombardment may also be used to transform plant tissue and methods for the transformation of plants particularly cereal plants, and such methods are reviewed by Casas ct αl (Plant Breeding Rev. 13: 235-264, 1995). Direct DXA uptake transformation protocols such as protoplast transformation and electroporation are described in detail in Galbraith et al. (eds.), Methods in Cell Biology Vol. 50, Academic Press, San Diego, 1995). In addition to the methods mentioned above, a range of other transformation protocols may also be used. These indude infiltration, electroporation of cell" and tissues, electroporation of embryos, microinjection, pollen-tube pathway, silicon carbide- and liposome mediated transformation. Methods such as these are reviewed by Rakoczy- Irojanowska (Cell. MoL Biol. Lett. 7: 849-858, 2002). A range ot other plant transformation methods may also be evident to those of skill in the art.
In further embodiments the present invention also provides methods for down- regulating expression of a CIPK16 nucleic acid in a cell. For example, with the identification of ClP K16 nucleic acid sequences, the present invention also facilitates methods such as knockout, knockdown or downregυlation of a ClPKIb nucleic acid in a cell using methods including, for example: insertional mutagenesis including knockout or knockdown of a nucleic acid in a cell by homologous recombination with a knockout construct (for an example of targeted gene disruption see lerada et al., Nat. BiotechnoL 20: 1030-1034, 2002); post -transcriptional gene silencing (PIGb) or RNAi of a nucleic acid in a cell (for review of PTGS and RXAi «ee Sharp, Genes Deυ. 15(5): 455-4^0, 2001; and I lannon, Nature 418: 244-51 , 2002); transformation of a cell with an antisense construct directed against a nucleic acid (for examples of antisense suppression see van der Krol el al, Nature 333: 8t>6-869; van der Krol et al., Biolechniqiifs b: 958-967; and van der Krol et al., Gen. Genet. 220: 204- 212); transformation of a tell with a c o-suppression construct directed against a nucleic acid (for an example of co-suppression see van der Krol el al., Plant Cell 2(4): 291-299); translormation ot a cell with a construct encoding a double stranded RNA directed against a nucleic acid (for an example of dsRXΛ mediated gene silencing see Waterhousp et al, Proc. hail. Acad. Sd. US 4 95: 13159-13964, 1998); transformation of a cell with a construct encoding an siRXA or hairpin R\ A directed against a nucleic acid (for an example of siRNΛ or hairpin RNA mediated gene silencing see Lu et al, Nud. Adds Res. 32(21): el71; 2004); and insertion of a miRXA target sequence ^u eh that it is in operable connection with a nucleic acid (for an example of miRNA mediated gene silencing see Brown et al., BlOGd 110(13): 4144-4152, 2007).
The present invention also facilitates the downregulation of a C1PK16 nucleic acid in a cell via the use of synthetic oligonucleotides, for example, siRNAs or rniRNAs directed against a CIPKT 6 nucleic acid (for examples of synthetic siRNA mediated silencing see Caplen et al.,. Proc. Natl. Acad. Sd. USA 98: 9742-9747, 2001; Elbashir et al., Genes Dcv. 15: 188-200,, 2001; Elbashir el al, Nature 411: 494-498, 2001; Elbashir ct a!... FAdBO /. 20: 6877- 6888,. 2001; and Elbashir et al, Methods 26: 199-213, 2002).
In addition to the examples above, the introduced nucleic acid may also comprise a nucleotide sequence which is not directly related to a CIPKT 6 nucleic acid but, nonetheless, may directly or indirectly modulate the expression of a ClPKIb nucleic acid in a cell. Examples include nucleic acid molecules that encode transcription factors or other proteins which promote or suppress the expression of an endogenous ClPKl 6 nucleic acid molecule in a cell; and other noτvtranslated RNAs which directly or indirectly promote or suppress endogenous CIPKl 6 polypeptide expression and the like.
In order to effect expression of an introduced nucleic acid in a cell, where appropriate, the introduced nucleic acid may be operably connected to one or more transcriptional control sequences and/or promoters.
The term '' " transcriptional control sequence" should be understood to include any nucleic acid sequence which effects the transcription of an operably connected nucleic add. A transcriptional control sequence may include, for example, a leader, polyadenylation sequence, promoter, enhancer or upstream activating sequence, and transcription terminator. Typically, a transcriptional control sequence at least includes a promoter. The term "promoter" as used herein, describes any nucleic acid which confers, activates or enhances expression of a nucleic acid molecule in a cell.
In some embodiments, at least one transcriptional control sequence is operably connected to a ClPKIb nucleic acid. For the purposes of the present specification, a transcriptional control sequence is regarded as "operably connected" to a given gene or other nucleotide sequence when the transcriptional control sequence is able to promote, inhibit or otherwise modulate the transcription of the gene or other nucleotide sequence.
A promoter may regulate the expression of an operably connected nucleotide sequence constitutively, or differentially, with respect to the cell, tissue, organ or developmental stage at which expression occurs, in response to external stimuli such as physiological stresses, pathogens, or metal ions, amongst others, or in response to one or more transcriptional activators. As such, the promoter used in accordance with the methods of the present invention may include, for example, a constitutive promoter,, an inducible promoter, a tissue-specific promoter or an activatablc promoter.
Plant constitutive promoters typically direct expression in nearly all tissues of a plant and are largely independent of environmental and developmental factors. Examples of constitutive promoters that may be used in accordance with the present invention include plant viral derived promoters such as the Cauliflower Mosaic Virus 35S and 19S (CaMV 35S and CaMV 19S) promoters; bacterial plant pathogen derived promoters such as opine promoters derived from Agrobacterium spp., eg. the Agrobactenum- derived nopaline synthase (nβs) promoter; and plant-derived promoters such as the rubisco small subunit gene (rbcS) promoter,, the plant ubiquitin promoter (Pubi) and the rice actin promoter (Pact).
In some embodiments, a constitutive transcriptional control sequence may be used. In some embodiments, the constitutive transcriptional control sequence comprises one or more repeats of a CaIVlV 35S promoter. In some embodiments the transcriptional control sequence comprises two repeats of the CaMV 35S promoter.
"Inducible" promoters include, but are not limited to, chemically inducible promoters and physically inducible promoters. Chemically inducible promoters include promoters which have activity that is regulated by chemical compounds such as alcohols, antibiotics, steroids, metal ions or other compounds. Examples of chemically inducible promoters include: alcohol regulated promoters (eg. see European Patent 637 339); tetracycline regulated promoters (eg. see US Patent 5,851,796 and US Patent 5,464,758); steroid responsive promoters such as glucocorticoid receptor promoters (eg. see US Patent 5,512,483), estrogen receptor promoters (eg. see European Patent Application 1 232 273),. ecdysone receptor promoters (eg. see US Patent 6,379,945) and the like; metal- responsive promoters such as metallothionein promoters (eg. see US Patent 4,940,661, US Patent 4,579,821 and US 4,601,978); and pathogenesis related promoters such as chitinase or lysozyme promoters (eg. see US Patent 5,654,414) or PR protein promoters (eg. see US Patent 5,689,044, US Patent 5,789,214, Australian Patent 708850, US Patent 6,429,362).
In some embodiments, a salt or sodium inducible promoter may be used. Examples of such promoters include the AtGRP9 promoter (Chen et al., Journal of Plant Research 120: 337-343, 2007; accession number At2g05440) and the VHAc3 promoter (accession number At4g38920).
An inducible promoter may also be a physically regulated promoter which is regulated by non-chemical environmental factors such as temperature (both heat and cold), light and the like. Examples of physically regulated promoters include heat shock promoters
(eg. see US Patent 5,447858, Australian Patent 732872, Canadian Patent Application
1324097); cold inducible promoters (eg. see US Patent 6,.479,.26O, US Patent 6,184,443 and US Patent 5,847,102); light inducible promoters (eg. see US Patent 5,750,385 and Canadian Patent 132 1563); light repressible promoters (eg. see New Zealand Patent
508103 and US Patent 5,639,952).
''Tissue specific promoters" include promoters which are preferentially or specifically expressed in one or more specific cells, tissues or organs in an organism and/or one or more developmental stages of the organism. It should be understood that a tissue specific promoter also be constitutive or inducible. Examples of plant tissue specific promoters include: root specific promoters such as those described in US Patent Application 2001047525; fruit specific promoters including ovary specific and receptacle tissue specific promoters such as those described in European Patent 316 441, US Patent 5,753,475 and European Patent Application 973 922; and seed specific promoters such as those described in Australian Patent 612326 and European Patent application 0 781 849 and Australian Patent 746032.
In some embodiments, a promoter which preferentially or specifically directs expression in a root, or one or more parts thereof, may be used. Examples of root- specific or preferential promoters that may be used include the promoter of the root stelar gene AtGRPΘ (At2g05440) as described by Chen ct al. (J. Plant Res. 120: 337-343,, 2007) and the root cortex promoter from tobacco as described in US patent 5,837,876.
The promoter may also be a promoter that is activaf able by one or more transcriptional activators, referred to herein as an "activatable promoter". For example, the activatable promoter may comprise a minimal promoter operably connected to an Upstream Activating Sequence (UAS), which comprises, inter alia, a DNA binding site for one or more transcriptional activators.
As referred to herein the term "minimal promoter" should be understood to include any promoter that incorporates at least an RNA polymerase binding site and, optionally a TATA box and transcription initiation site and/or one or more CAAT boxes. In some embodiments wherein the cell is a plant cell, the minimal promoter may be derived from the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter. The CaMV 35S derived minimal promoter may comprise, for example, a sequence that substantially corresponds to positions -90 to +1 (the transcription initiation site) of the CaMV 35S promoter (also referred to as a -90 CaMV 35S minimal promoter), -60 to +1 of the CaMV 35S promoter (also referred to as a -60 CaMV 35S minimal promoter) or - 45 to +1 of the CaMV 35S promoter (also referred to as a -45 CaMV 35S minimal promoter). As set out above, the activatabfe promoter may comprise a minimal promoter fused to an Lpstream Activating Sequence (U Ab) The UAS may be any sequence that can bind a transcriptional activator to activate the minimal promoter. Fλpmplarγ transcriptional activators include, tor example yeast derived transcription activators such as Ga 14, Pdrl, Gαi4 and Acel, the viral derived transcription activator, VP16; Hapl (Hach et al, ] Biol Chem 278: 248-254, 2000), Gall (Hoe ei al, Gene 213(2): 319-328, 1998), E2F (Aibani et al, J Biol them 275 19258-19267, 2000), HΛND2 (Dai and Cserjesi, J Biol Chan 277 12&04-12612, 2002); \RF-1 and EWG (Her/ig et <ιL, ] Cell Sd 113: 4263-4273, 2000): P/C AF (Itoh el al, Nυd Adds Res 28 4291 - 4298, 2000), Maf Λ (Kataoka et al. J Biol Chem 277: 49903-499 iθ, 2002); human activating transcription factor 4 (I iang and Hai, / Biol Chem 272: 24088 - 24095, l c «7), BdIO (Liu ei al, Binchem Biυphys Res Comm 320(1): 1-6, 2004): CREB-H (ϋmori et al, Nud Acids Res 29: 2154 - 2162, 2001); ARRl and ARR2 (Sakai et al. Plant j 24(6): 703-71 1, 2000): Fos (Szurs and Bienz, Proc Natl Acad v/ USA 97: 5351-5356, 2000); HSF4 (Tanabe et al, ] Biol Chem 274: 27845 - 27S56, 19 Q 9) ; VtAMLl (VVu ct al, Nat Genet 26: 484-489, 2000)
In some embodiments, the UAS comprises a nucleotide sequence that is able U) bind to at least the D\A-binding domain of the GΛL4 transcriptional activator.
An example ot an activatabJe promoter includes the enhancer trap system for Arabidopsis and rice as described by Johnson ei al (Plant j 41 779-789, 2005) and Møiler ct al {Plant Cell 21: 2163-2178, 2009).
In some embodiments, the expression ot the CIPK16 nucleic aaά is placed under the transcriptional control of a CJPkI 6 transcriptional control sequence derived from a sodium tolerant plant.
A "CIPKl 6 transcriptional control sequence" refers to a transcriptional control sequence or promoter which, in it« native state, exerts transcriptional control over a CffK76 nucleic acid. The term "derived from", as used herein, refers to a source or origin for the transcriptional control sequence or promoter. For example, a transcriptional control sequence "derived from a CIPK16 nucleic acid" refers to a transcriptional control sequence which, in its native state, exerts at least some transcriptional control over a CIPKKD nucleic acid. The term derived from should also be understood to refer to the source of the sequence information for a transcriptional control sequence and not be limited to the source of a nucleic acid itself. Thus, a transcriptional control sequence derived from a ClPKl 6 nucleic acid need not necessarily be directly isolated from the gene. For example, a synthetic nucleic acid having a sequence that is determined with reference to a transcriptional control sequence which, in its native state, exerts at least some transcriptional control over a C1PK16 nucleic acid should be considered derived from a ClPKl 6 nucleic acid.
As set out above, the CIP 'K16 transcriptional control sequence may be derived from a sodium tolerant plant, in some embodiments the term "sodium tolerant plant" may include any plant which exhibits a higher degree of sodium tolerance than the plant into which the transcriptional control sequence is being introduced. In further embodiments, the term sodium tolerant plant refers to particular cultivars or ecotypes within a plant species that exhibit a higher degree of sodium tolerance than at least one other eultivar or ecotype within the plant species.
In some embodiments, the term "sodium tolerant plant" may include a halophyte, As referred to herein, a "halophyte" should be understood to include a plant which can tolerate total dissolved solids in irrigation water of at least 5 g/1, at least 10 g/1, at least
15 g/1, at least 20g/l, at least 25g/l, at least 30g/l, at least 40g/1, at least 50 g/1 or at least 60 g/I-
In some embodiments, the CIPK16 nucleic acid is placed is under the transcriptional control of a transcriptional control sequence comprising the nucleotide sequence set forth in SEQ ID NO: 1 or a functionally active fragment or variant thereof. SEQ ID NQ: 1 is the nucleotide sequence of the CIPK16 promoter from Arabldβpsϊs ihaϊϊana ceo type Bay-0. As described later, this Amhidoγsis thaliana ecotype exhibits increased salinity tolerance relative to Arάbidopsis thaliana ecotype Shahdara.
''Functionally active fragments" of SEQ ID NO: 1 include fragments of a transcriptional control sequence which direct expression of an operably connected nucleotide sequence in a substantially identical pattern to SEQ ID NO: 1 in at least one plant type. In some embodiments, the fragment comprises at least 200 nt,. at least 500 nt, at least 1000 nt or at least 1500 nt from the nucleotide sequence set forth in SEQ ID NO: 1.
"Functionally active variants" of the transcriptional control sequence of the invention include orthologs, mutants, synthetic variants, analogs and the like of SEQ ID NO: 1 which direct expression of an operably connected nucleotide sequence in a substantially identical pattern to SEQ ID NO: 1 in at least one plant type. The term "variant" should be considered to specifically include, for example, orthologoυs transcriptional control sequences from other organisms; mutants of the transcriptional control sequence; variants of the transcriptional control sequence wherein one or more of the nucleotides within the sequence has been substituted, added or deleted; and analogs that contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine.
In some embodiments, the functionally active fragment or variant comprises at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 82% . , at least 85%, at least 87%, at least 90%, at least 92% . , at least 95%, at least 96%, at least 97%, at least 98% or at least 99% nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 1.
When comparing nucleic acid sequences to calculate a percentage identity, the compared nucleotide sequences should be compared over a comparison window of at least 500 nucleotide residues, at least 1000 nucleotide residues, at least 1500 nucleotide residues or over the full length of SEQ ID NO: 1. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms sudi the BLAST family of programs as, for example, disclosed by Altschul et al. (1997, supra). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubcl et al. (1998, supra).
In some embodiments, the functionally active fragment or variant comprises a nucleic acid molecule which hybridises to a nucleic acid molecule defining a transcriptional control sequence of the present invention under stringent conditions. In some embodiments, the functionally active fragment or variant comprises a nucleic acid molecule which hybridises to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO: 1 under stringent conditions.
As used herein, "stringent" hybridisation conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to S.3 and the temperature is at least 30 0 C. Stringent conditions may also be achieved with the addition of destabilising agents such as formamide. In some embodiments, stringent hybridisation conditions may be low stringency conditions, medium stringency conditions or high stringency conditions. Exemplary low stringency conditions include hybridisation with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in W to 2xSSC (20xSSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridisation in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.3x to IxSSC at 55 to 60°C. Exemplary high stringency conditions include hybridisation in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.KSSC at 60 to 65°C Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridisation is generally less than 24 hours, usually 4 to 12 hours
Specificity of hybridisation is also a function of post -hybridisation washes, with the i ritu al factors being the ionic strength and temperature of the final wash solution. For DNA-DXA hybrids, the Tm can be approximated from the equation of VIeinkoth and Wahl (Anal. BioJiun. 138 267-284, 1^84), i.e. fm -^13 0 C +16.6 (log M) K) 41 (% GQ-0.61 (% torm)-300/ L, where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DN A, % form is the percentage ol tormamide in the hybridisation solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pi I) at which 50% of a complementary target sequence hybridises to a perfectly matched probe T- is reduced by about 1°C for each 1% ot mismatching, thus, I ^, hybridisation, and/or wash conditions can be adjusted to hybridise to sequences of dilferent degrees of lomplementaritv- For example sequences with > Q 0% identity can be hybridised by decreasing the T- by about iO°C. Generally, stringent ionditions are selected to be about 5 C lower than the thermal melting point (T-) for the specific sequence and its complement at a defined ionic strength and pH. However, high stringency conditions can utilise a hybridisation and/or wash at, tor example, 1, 2, 3, or 4°C lower than the thermal melting point (I™); medium stringency conditions can utilise a hybridisation and/or wash at, for example 6, 7, 8, 9, or 10 r C lower than the thermal melting point (Tm); low stringency conditions can utilise a hybridisation and /or wash at, for example, 11, 12, 13, 14, 13, or 20 0 C lower than the thermal melting point (I }. L sing the equation, hybridisation and wash compositions, and desired T , those of ordinary skill will understand that variations in the stringency of hybridisation and/or wash solutions are inherently described. If the desired degree of mismatching result" in a T- of less than 4^ C C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridisation of nucleic acids is found in lijssen (Laboratory Fechniques in Biochemistry and Aϊolerulat Biology HyIv idisation with Nucleic Add Probes, Pt 1, Chapter 2, Elsevier, New \ork 1993), Ausubel et ah, eds. (Current Protocols in Molecular Biology Chapter 2, Greene Publishing and WiJey-Tntersαence, New York, 19°5) and Sambrook et al (Molecular Cloning: A Laboratory Manual, 2 nd ed., Cold Spring Harbor Laboratory Press, Plainview, NY, 1989).
The transcriptional control sequence may also include a terminator. The term "terminator" refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are S'-non-translated DNA sequences generally containing a polyadenylation signal, which facilitate the addition of polyadenylatc sequences to the 3'-end of a primary transcript. As with promoter sequences,, the terminator may be any terminator sequence which is operable in the cells, tissues or organs in which it is intended to be used. Examples of suitable terminator sequences which may be useful in plant cells include: the nopaline synthase (nos) terminator, the CaMV 35S terminator, the octopine synthase (ocs) terminator,, potato proteinase inhibitor gene (pin) terminators, such as the pinil and pinJϊl terminators and the like.
In a second aspect, the present invention provides a method for modulating the salinity tolerance of a multicellular structure comprising a plurality of plant cells, the method comprising modulating the salinity tolerance of one or more plant cells in the multicellular structure according to the method of the first aspect of the invention,
In some embodiments expression of a CIPK16 polypeptide and/or CIPKI 6 nucleic acid is upreguiated in the one or more plant cells and the salinity tolerance of the multicellular structure is increased.
In some embodiments expression of a CI PKI 6 polypeptide and/or CIP Kl 6 nucleic acid is downregulated in the one or more plant cells and the salinity tolerance of the multicellular structure is decreased.
As referred to herein, a "multicellular structure" includes any aggregation of one or more plant cells as hereinbefore described. As such, a multicellular structure specifically encompasses tissues, organs, whole organisms and parts thereof. - 2b -
Furthermore, a multicellular structure should also be understood to encompass multicellular aggregations of cultured cells such as colonies, plant calli, liquid or suspension cultures and the like.
In light of the above, the term "'multicellular structure" should be understood to include a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue (eg. callus or suspension culture).
The plants contemplated by the second aspeit of the present invention may include any plant including angiosperm or gyrnnosperm higher plants as well as lower plants such as bryophytes, ferns and horsetails.
In some embodiments, the plant cell may be a monocofyledonous angiosperm plant. In some embodiments the monυcotyledonous plant may be a cereal crop plant as hereinbefore described. In some embodiments, the plant may be a rice plant as hereinbefore described,
In some embodiments, the plant may be a dicotyledonous angiosperm plant as hereinbelore described.
In some embodiments wherein the multicellular structure comprises a plant or a part thereot, modulation ot the salinity tolerance of the plant may be effected by modulating the expression of a ClPkI 6 polypeptide in at least one or more roof cells ol the plant.
In a third aspect, the present invention provides a genetically modified plant cell having modulated salinity tolerance relative to a wild type form ot the plant ceil, wherein the expression of a ClPKIb polypeptide and/or a CIPKKD nucleic acid is modulated in the plant cell.
As referred to herein, a "genetically modified cell" comprises a cell that is genetically modified with respect io the wild type of the cell. As such, a genetically modified cell may be a cell which has itself been genetically modified and/or the progeny ot such a cell.
The plant cell of the present invention may include a plant cell as hereinbefore described. For example, in some embodiments, the plant cell may be any of an angiosperm, gymnosperm or bryophyte cell In some embodiments, the cell may be a monocolyledonous angiosperm plant cell, a cereal crop plant cell or a rice cell. In some embodiments the cell may be a dicotyledonous angiosperm plant cell.
As set out above, the expression of a CIPK16 polypeptide and/or a ClPKIb nucleic acid is modulated in the plant cell. Modulation of a ClPKl 6 polypeptide and/or a ClPKw nucleic acid may be as described with respect to the first aspect of the invention. In some embodiments, the plant cell ot the third aspect of the invention may be produced act ordmg to the method of the first aspect of the invention.
In a fourth aspect, the present invention provides a multicellular structure having modulated salinity tolerance, wherein the multicellular structure comprises one or more plant cells according U) the third aspect of the invention
The multicellular structure may be any multicellular structure as hereinbefore described. In some embodiments of the invention the salinity tolerance of the multicellular structure as a whole (eg. a plant) may be modulated relative to a wild type lorm of the multicellular structure as a result of including one or more cells having modulated salinity toll -ranee. In some embodiments, the present invention provides a plant having increased salinity tolerance relative to a wild type form of the plant
In a fifth aspect, the present invention provides a method for ascertaining or predicting the salinity tolerance of a plant i ell the method comprising determining the expression of a CIPKl 6 polypeptide and/or a CJPKIb nucleic acid in the plant cell As described above, the expression of a ClPKl 6 polypeptide arid/or CIP Kl β nucleic acid in a plant cell is correlated with the level of salinity tolerance in the plant cell. Thus, relatively high expression of a CIPK16 polypeptide and/or ClPK 76 nucleic acid in the plant cell is associated with increased salinity tolerance in the plant cell and low expression of a ClPKl 6 polypeptide and/or C1PK16 nucleic acid in the plant cell is associated with decreased salinity tolerance in the plant cell.
Methods for determining the level and/or pattern of expression of a nucleic acid or polypeptide are known in the art. Exemplary methods of the detection of RNA expression include methods such as quantitative or semi -quantitative reverse- transcriptase PCR (eg. see Burton el al., Plant Physiology 134: 224-236, 2004), in-situ hybridization (eg. see Linnestad et al., Plant Physiology 118: 1169-1180, 1998); northern blotting (eg. see Mizuno et al, Plant Physiology 132: 1989- 1997, 2003); and the like. Exemplary methods for the expression of a polypeptide include Western blotting (eg. see Fido et al, Methods MoI Biol. 49: 423-37, 1995); ELlSA (eg. see Gendloff et ul., Plant
Molecular Biology 14: 575-583); immunomicroscopy (eg. see Asghar et al., Protσplasma
177: 87-94, 1994) and the like. In another embodiment, the expression of a CIPKlβ nucleic acid sequence may be determined by determining the number of ClPKl 6 nucleic acids present in the genomic DNA of one or more cells of the organism.
The plant cells contemplated in the fifth aspect of the invention may include any plant cells as hereinbefore described.
In a sixth aspect, the present invention provides a method for ascertaining or predicting the salinity tolerance of a multicellular structure comprising a plant cell, the method comprising ascertaining or predicting the salinity tolerance of a plant cell in the multicellular structure according to the method of any one of the fifth aspect of the invention.
In some embodiments, the expression of a CIPKI 6 polypeptide and/or CIPKlβ nucleic acid in a plant cell of the multicellular structure is correlated with the level of salinity tolerance in a multicellular structure comprising the plant cell. Thus, relatively high expression of a C1PK16 polypeptide and/or ClPKIb nucleic acid in the plant cell is associated with increased salinity tolerance in the multicellular structure and relatively low expression of a CtPKl 6 polypeptide and/or CIPKl 6 nucleic acid in the plant ceil is associated with decreased salinity tolerance in the multicellular structure.
The multicellular structures contemplated in the sixth aspect of the invention may inilude any multicellular structures, including plants or parts thereof,, as hereinbefore described.
The cells used for determining the expression of a C1PK16 polypeptide and/or a CIPKIb nucleic acid may be any suitable plant cell. In some embodiments, the cells may comprise a root cell. In some embodiments, the cells may comprise a leaf cell.
In further embodiments, the method of the sixth aspect of the invention may be used to ascertain the salinity sensitivity or tolerance of an organism and then select individual organisms on the basis of the ascertained level of salinity sensitivity or tolerance. I 1 Or example, in the case of plants, plants having increased salinity tolerance may be selec ted for planting in saline soil" or may be selected for breeding programs to produce salinity tolerant eultivars of the plant.
Finally, reference is made to standard textbooks of molecular biology that contain methods lor carrying out basic techniques encompassed by the present invention, including DNA restriction and ligation for the generation of the various genetic constructs described herein. See, for example, Maniatis ci d. r MokcuUi Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, New York, 1982) and Sambrook ct nl, (2000, supra).
Embodiments of the present invention are further desc ribed by the following non- limiting examples: BRlEF DESCRIPTION OF THE FIGURES
Figure I shows the quantitative trait locus linked to Na 4 leaf exclusion on chromosome 2 as plotted on a LR scale. 420 lines of a Bay-0 x Shahdara mapping population were grown for 6 weeks in soil and supplied with 2 mM at 2,3,4,5 and 6 weeks. Depending on germination and survival between 1 and 8 replicates were made for each line. The black line shows the likelihood ratio statistic and the long dashed line the additive effect. The short dashed lines indicate levels of significance of, from bottom to top,. suggestive, significant and extremely significant.
Figure 2 shows Na' concentrations, as determined by flame photometry, in lines of the Bay-0 x Shahdara mapping population with either the Bay-0 or Shahdara genotype at the marker MSAT2.41 which lies under the QTL peak. Results are the mean ± s.e.m. (n = 228 for Bay-0 genotypes and n= 133 for Shahdara genotypes).
Figure 3 shows a Genevestigator heatmap output for the expression profile of AtCIPKl 6 in different tissues of Arabidopsis. White and pale blue colours indicate no or low gene expression, darker colours indicate high expression. The number of arrays mined for each tissue are listed.
Figure 4 shows a partial Genevestigator dot plot output for the increase in the expression of AtCIPKl 6 in different experimental conditions. Arrows indicate salt and osmotic stress experiments. The number of arrays mined for each tissue are listed (experimental /control) .
Figure 5 shows the level of gene expression of A(CIPKIo in the shoots of three Arabidopsis eco types grown for 5 weeks in hydroponics and then exposed to 5 days of either 0 or 50 mM NaCl. Results are the mean ± s.e.m. (n = 3)
Figure 6 shows the level of gene expression of AtCJPKl 6 in the roots of three - λi -
Arabidopsis eco types grown for 5 weeks in hydroponics and then exposed to 5 days of either 0 or 50 mM NaCl. Results are the mean ± s.e.πi. (n = 3)
Figure 7 shows the level of gene expression of AtClPkI 6 in the roofs of three Arabidopsis ecotypes grown for 5 weeks in hydroponics and then exposed to 5 days of either 0 or 100 mM NaCl. Results are the mean ± s.e.m. (n = ■ 3).
Figure S shows the expression of the AtClPKl 6 lransgene in Ti Arabidopsis plants. RNA was extracted from the shoot of plants growing in soil and cDNA produced. A PCR was used to confirm the presence of the AiCIPKl 6 and Ac tin- genes.
Figure c > shows Na h concentrations, as determined by flame photometry, on average plants from Lines 11, 33 and wild type (VVT) CoI-O plants. Results shown are the mean ± S.E. of S - 16 biological replicates. Y-axis indicates μmol of Na' / g fresh weight.
Figure 10 shows the expression of native AiCJPKl 6 and AtCIPKIb transgene in the roots of 5 week old Arabidopsis plants grown in 100 mM NaCi for 10 days. Results are the mean ± S.E. of 8 ■ 16 biological replicates. Y-axis indicates relative gene expression, wherein expression level in wild type = 1.
Figure Ii shows the expression of native AiCJPKl 6 and AtCIPKIb transgene in the shoots of 5 week old Arabidopsis plants grown in 100 mM NaCl for 10 days. Results are the mean ± S.E. of 8 ■ 16 biological replicates. Y-axis indicates relative gene expression, wherein expression level in wild type = 1.
Figure 12 shows total shoot biomass in T: segregating Arabidopsis plants from Line 11 and 33 as well as wild type (WT) CoI-O plants after 5 weeks growth in hydroponics, followed by the addition of either 0 or 100 mM NaCl for 10 days. Results are the mean ± S.E. of S - 16 biological replicates. V axis shows fresh weight shoot biomass (g). For each treatment, the left bar indicates fresh weight shoot biomass at OmM NaCl, while the right bar is at 10OmM NaCi. - T? -
Figure 13 shows a scatter plot of the results of flame photometry (to determine shoot Na" accumulation) and semi -quantitative RT-PCR (to estimate levels of AtCIPKl 6 gene expression) in the Arabidopsis amiRNA lines,, relative to that of the wild type controls (dot with error bars).
Figure 14 shows Na 1 concentrations, as determined by flame photometry, in individual T2 segregating Arabidopsis plants from Lines 111, 132, 222 and 2122 grown in hydroponics for 5 weeks before the addition of 100 mM NaCl for 10 days. Sample 2122C was lost in the extraction. Y-axis indicates μmoJ of Na * / g fresh weight.
Figure 15 shows the results of semi-quantitative RT-PCR for AtClPKlβ in individual Arabidopsis plants expressing either the amiRNA CIPKl 6-1 (plants from Line 111 or 132) or amiRNA AtCIPK16-2 (Lines 222 or 2122) when grown in hydroponics for 5 weeks before the addition of 100 mM NaCl for 10 days. Results for wild type (VVT) CoI- 0 plants are the mean ± S.E. of 3 biological replicates. Y-axis indicates relative gene expression, wherein expression level in wild type = 1.
Figure 16 shows two rice transformants (16-1 and 16-2) (left panel). The right panel shows that both AiClPKl 6 and the hygromycin resistance gene could be defected in both 16-1 and 16-2.
Figure 17 shows the fourth leaf biomass of segregating T: 35S::AtClPK16 rice plants from Lines 16_1 and 16_2 grown in hydroponics for 2 weeks before the addition of 75 mM NaCl for 5 days. Y-axis shows the 4 ih leaf dry weight biomass in g.
Figure 18 shows a comparison of shoot sodium concentration (upper) and AtClPKlβ expression (lower) in segregating T2 35S::AtClPK16 rice plants from Lines 16 1 and 16__2 grown in hydroponics for 2 weeks before the addition of 75 mM NaCl for 5 clays. Y-axis on upper panel indicates μmol NaVg dry weight. Y-axis on lower panel indicates relative gene expression, wherein expression level in wild type = 1. - λ°> -
EXAMPLE 1 Growth and phcnotyping of Bay-0 ' Shahdara mapping population
Phenotypirig for Na * exclusion was performed on 420 recombinant inbred lines (RlLs) of a Bay-0 x Shalulara Arabidopsis thaliana mapping population obtained from the European Arabidopsis Stock Centre (Nottingham, Uk), Plants were germinated on an artificial soil mix composed of 3.6L Coira, 3.6L perlite and 0.25L sand and supplied with 300 ml of nutrient solution (2 mM Ca(NOs), 15 mM KNOs, 0.5 mM MgS(X 0.5 mM NaHzPOi, 15 mM NHtNO ' ., 2.5 μM NaFeEDTA, 200 μM HJBOJ, 0.2 μM Na_Moθ4, 0.2 μM NiCb, 1 μM ZnSO<, 2 μM MnCb, 2 μM CuSO4 and 0.2 μM CoCb). After one week, and for the next 5 weeks, the plants were supplied once a week with 300 ml of nutrient solution containing 2 mM NaCl. An additional 300 ml of water was supplied once a week if required with excess water removed after 24 h.
After 6 weeks of growth, the last fully expanded leaf was removed and its fresh weight obtained. The leaf was digested in overnight 1 % nitric acid at S5°C in a hoiblock (Thermoline Scientific, Northgate, Australia). Once cooled, samples were diluted as necessary before the N a" and k" concentrations in the tissue were determined by flame photometry (Model 420, Sherwood Scientific, Cambridge, UK).
EXAMPLE 2 QTL mapping
Genotype data for 38 microsatellite markers of all 420 lines was obtained from http://dbsgap.versailles.inra.fr/vnat/Documentation/33/DOC.h tml. These data, in addition to the phenotypic data was entered into the mapping programme MapManager QTX (http://www.mapmanager.org/). Interval mapping, with 1000 permutations, was performed for shoot Na" and Kr concentrations as well as shoot NaVK' ratios. LXAMPLE 3 DN Λ extraction from RlLs
DKA W(F extracted from RILs with recombination occurring between the flanking markers ot the QTL. l eaf tissue was trozen in liquid nitrogen and then ground to powder using a mortar and pestle. 400 μi of Edwards buffer (200 mM fπs HCl (pH 7.3), 250 mM XaCl, 25 mM HDTA and 0.5% SDS) was added to the ground plant material and the sample left at room temperature (RT) for 1 hr. I he extract was spun at 10,000 g tor 1 rnin and 300 μl of supernatant added to 300 μl ot iso-propanυl. Samples were left for 2 min at RT and then spun at 10,000 ? for ^ mins. The supernatant was removed and the pellet resuspended overnight at 4 C in 200 μl TF buffer. The samples were centrifuged at 10,000 g for 3 mms before 130 μl of suspension was added to 15 μl of 3 M NaΛc and 115 μl of iso-propanol. Samples were left at room temperature tor 10 min before being spun at 10,000 g for 5 mm. The supernatant wa« removed and the DNA pellet washed twice with 70% ethanol betore left to air dry. The DNA was resuspended in 100 μl TF buffer.
EXAMPLE 4 l'ine mapping of QTL
To fine map the QTI , 20 cleaved amplified polymorphic site (CAPS) markers were designed to recognise the difference between Bay-0 and Shahdara DNA in the QTL interval Each CAPS marker was designed to amplify a region of genomic DNA between 500- 1000 bases long which had within it a restriction site tor a specific restriction en/yme on one parent's DMA but not the other. Polymerase chain reaction (PCR) using specific CAPS marker primers and Platinum Tat] (Invitrogen, Carlsbad, CA, USA) was carried out on all D\A and the PCR product digested for 3 hrs with the required restriction enzyme. Genotypes of the mapping lines for the new CAPS markers were visualised on a 2% agarose gel. - λS -
EXAMPLE 5 Mining of online mlcroarray data
Genevestigator version 3 (https:/7www.genevestigator.ethz.eh/gv/index.jsp) was used to mine 3110 Arabidopsis Affymetrix ATHl: 22k microarrays for the expression profile of AtClPK1 ' 6 (At2g25090) in different plant tissues and under different experimental conditions.
EXAMPLE 6 Q-PCR hydroponics
Seeds of Arabidσpsis lhaliana ecotypes Columbia (Col),, Wassilewskija (Ws) and Landsberg crccta (Ler) were obtained from the European Arabidopsis Stock Centre (Nottingham,. UK). Individual seeds were germinated in 1.5 ml microfuge tubes on top of 0.8% bactoagar supplemented with half strength Arabidopsis nutrient media (Arteca and Arteca, Physiologies Phmtarum 108: 188-193, 2000). After 2 d vernalisation at 4°C the tubes were transferred to a growth room with a 10 h light / 14 h dark photoperiod, an irradiance of 70 μmoLnτ : .s 4 , and a constant temperature of 2PC. When the plant's roots had grown two-thirds of the distance through the agar the bottom of the microfuge tubes were removed allowing the roots to emerge. Upon emergence of the root from the tube they were transferred to a continually aerated hydroponics setup containing full strength nutrient solution. The pH of the hydroponic solution was monitored and maintained at pH 5.7, Salt stress was applied 5 weeks after germination by the addition of 50 or 100 mM NaCl and calcium activity, as calculated using Visual Minteq V 2.3 (US Environmental Protection Agency; USA), was maintained in the nutrient solution by additional CaCI: if required. Whole roots and shoots were harvested after 5 d of salt treatment and immediately frozen in liquid nitrogen. EXAMPLE 7 Expression analysis of CIPKl 6 in hydroponically grown plants
Total RNA was extracted from frozen root and shoot samples using TRIzol reagent (mvitrogen, Carlsbad, CA, USA), following the protocol described previously (Chomczynski, BioTechniques 15: 532-537, 1993). Genomic DNA contamination was removed using Ambion's DNA-free (Promega, Madison, VVl, USA) and 200 ng of total RNA was used to synthesis cDNA using Superscript 111 (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR (Q-PC]R) was performed on the cDNA for the gene /MCJPKl 6 (At2g25090) using a RG6000 Rotor-Gene Real Time Thermal Cycler (Corbett Research, Sydney, Australia) according to the method of Burton el al. {Plant Physiol. 134: 224-236, 2004). Cydophilin (At2g36130), Tubulin alpha 2 chain (TUA2, AtIgSOOlO) and glyceraldehyde 3-phosphatc dehydrogenase A (GAPA, At3g26650) were used as control genes to normalise the results. The results presented are the average ± s.e.m. for three biological replicates. For primer sequences see table 2 below.
TABLE 2 - Primers used for Q-PCR experiments
EXAMPLE 8 Novel QTL detected on chromosome 2
Shoot Na J and K' accumulation was collected from 6 week old Arabidopsis RILs that had been watered with 2 mM NaQ at 2, 3, 4, 5 and 6 weeks. For each line that germinated the number of replicates was between 1 and 8 depending on plant survival. The phenotypic data along with the RiL genotypic data downloaded from the web was entered into MapManager and used for QTL mapping. Using interval mapping, an extremely significant QTL explaining 24% of the total phenotypic variation with a likelihood ratio (LR) of 100.9 was found at the microsateilite marker MSAT2.41 between the flanking markers MSAT2.36 and MSAT2.7 on chromosome 2 (see Figure 1 and Table 3 below). When the RILs are separated by genotype between those with a Bay-0 or Shahdara allele at MSAT2.41 it can be found that there is approximately a two-fold difference in Na * accumulation between the lines. Those RlLs with a Bay-0 allele at MSAT2.41 have a mean Na 4 shoot concentration of 6.9 ± 0.25 μmoles Na" g 4 FW, n = 228, while those with a Shahdara allele have 14.7 ± 0.74 μmoles Na gr'FW, n = 133, results are the mean ± standard error of the mean (s.e.m.) (Figure 2).
TABLE 3 ■ • Interval mapping results calculated from Na τ exclusion phenotype and RIL genotype data. Columns show microsateilite marker position, likelihood score of DNA region's effect on Na' exclusion phenotype, % total phenotypic variation explained by region and the additive effect.
- λQ -
FXAMPI E 9 Fine mapping of Ql L
Between the flanking markers MSAT2.36 and MSAT2.7 lhere were approximately 1200 gi-np" with no obvious candidate gene involved in Ma transport, ^u eh as AtSOSl, AfNIIXl, AtIIKTl;! or At AVPl . In order to narrow the interval to a smaller number of genes, 20 CAPS markers were designed and used to genotype the RlLs with recombination between the two tlanking markers Fine mapping narrowed the interval of the QfL to between the genes At2g24970 and At2g2^355, a region containing 41 genes (see Table 4, below). Within this region is a candidate gene of interest AtClPKl 6 (Al2g25090) which encodes a Calcineurin B -like interacting protein kinase and belongs to the same family υt genes as AK1PK24 (At5g354I0), also known as AtSO^Z.
IABLH 4 - lhe number ol candidate genes remaining in the QIL interval, along with a brief description ol eadi gene ΛiCWKlβ is shown in bold.
EXAMPLE 10
Searches using Genevesligator revealed thai ΛtClPklβ is primarily expressed in root tissue and in younger plants, such as seedlings (see Figure 3), Very little gene expression is found in the shoot. A number υf environmental stimuli were found tυ increase the expression of AtCIPKIb in the root, including salinity and osmotic stress (see Figure 4).
EXAMPLE 11
Three cultivars of Arabidopsis Col, Ler and VVs were grown hydroporϋcaJly for five weeks before being exposed to 0, 30 or 100 mM NaCl for 5 days. While no significant expression of A(CWKIv could be deiecied in the shooi of any ecotype, under either control or salt stressed conditions (see Figure 5), there was a significant up-regulation of gene expression in the roots of all ecotypes under both 50 and 100 mM NaCl salt stress (see Figures 6 and 7, respectively). Depending on ecotype and NaCl concentration, there was a 1.5 to 3,1 - fold increase in AtCIPKlO expression.
EXAMPLE 12 DNA and RNA extractions and cDNA synthesis from wild type and transgenic
ΔT-gMdQpM& ..f lidjicg_plan.tg
Genomic DNA was extracted from young leaves of Arabidopsi? thaliami using the methodology of Edwards ct al. (Nucleic Adds Res 19: 1349, 1991), Briefly, plant shoot or root tissue was snap frozen in liquid nitrogen and ground to a fine powder using a mortar and pestle. To the powder, 400 μl of Edwards buffer (200 mM Iris pH 8, 25 mM EDTA, 250 mM NaCl and 0.5% SDS), was added and the samples left at room temperature for 1 hr. The samples were centrifuged at 13,000 g for 2 mins and the supernatant removed. DNA was precipitated by the addition of 300 μl of 100% isopropanoL followed by incubation of the samples at room temperature for 2 mins, before centrifugation at 13,000 g for 5 mins. DNA pellets were washed with 70% ethanol and allowed to air dry before being resuspended in 100 μl of TE buffer.
Total RNA was extracted using TRizol reagent (Invitrogen, Carlsbad, CA, USA), following the protocol described by Chomczynski {Biotechniques 15: 532-537, 1993), Genomic DNA contamination was removed using ONA-free (Anibion, Madison, WI, USA) and 2 μg of total RNA was used to synthesis cDNA using Superscript III (Invitrogen).
EXAMPLE 13
Over- expression of ,4 t ClP Kl 6 in Arabidopsis and rice
Using primers AtCIPKl 6 Whole gene Forward (ATCGAAGAATCAAACCCTAGTAGTACTGTC; SEQ ID NO: 10) and AiCIPKU Whole gene Reverse (TTGGAATTGGATGTGCGAGG; SEQ ID NO: II ), the gene of AtC !PKl 6 (2069 nucleotides) was cloned from Arabidopsis genomic DNA into a pCR8 Gateway enabled entry vector. Restriction digestion and sequencing of the plasmid was used to confirm the orientation of the gene in the vector and to ensure there were no errors in the coding sequence of the cloned gene.
For Arabidopsis transformation the gene was then transferred into a pTOOL2 destination vector, using a Gateway reaction, and transformed into Agrabacteήum tumefaάens, strain AGLl.
Eor rice transformation, the gene was transferred into a pMDC32 destination vector using a Gateway reaction, and transformed into A. tutncfaciens, strain AGLL Both of these vectors used a double CaMV35S promoter to drive the expression of the transgene.
EXAMPLE 14 amiRNA knockdowns
Unlike most Arabidopsis genes, there are no commercially available T-DNA insertion knockout mutants available for AiCIPKl 6. Earlier experimentation in the laboratory investigated whether a GABl-Kat (Max Planck Institute for Plant Breeding Research, Koeln, Germany) T-DNA insertion 140 bp 5' of the start ATG of AtdPKlβ disrupted the gene's expression. It was found, however, that the T-DNA did not affect the expression of the gene, suggesting plants deficient in AtCIPKlβ expression were lethal or did not grow well. Gene knockdown mutants, using an artificial micro RNA construct (amiRNA), were therefore created to investigate the effect of reduced AiCIPKW expression on shoot Na 1 accumulation. Using WMD 2 - Web MicroRNA Designer (http://wmd2.weigelworld.org/cgi-bin/mirnatools.pl), two 21 nucleotide sequences of AtCIPKl 6 were identified to which two independent amiRNA constructs could be designed which would reduce the expression of the gene. These constructs were designated amiRNA AtCIPK16-l (TTTTCGTCGATAAACGGCAAG; SEQ ID NO: 12) and amiRNA AtCIPKl 6-2 (TTATTCCCT.AAAACCTCCGGC; SEQ ID NO: 13), Primers (see Table 5) containing the necessary sequences to generate 21 bp amiRNAs were incorporated into the amiRNA vector MIR319a and the whole amiRNA constructs were cloned into pCR8, following the protocol at http://wmd2.weigelworld.org/cgi- bin/mirnaiools.pl?page=7. After sequencing, to check for any sequence errors and to determine the correct orientation of the sequence, a Gateway LR was performed to transfer the two amiRNA constructs into pTOOL2 vectors which would use a CaMV35S promoter to drive the expression of the amiRNA.
TABLE 5 - Primer sequences used to incorporate an amiRNA sequence into vector
EXAMPLE 15
Arabidopsis CoI-O ecotype was transformed via the floral dip method (Clough and Bent, Plant / 16: 735-743, 1998), using Agrobacterium tumcfaciens, strain AGLl, with the pTOOL2 vectors containing either the 35S over-expression or amiRNA construct. Seeds were collected from transformed plants and germinated on an artificial soil medium (3.6 L perliie- medium grade, 3.6 L coira and 0.2ϋ L river sand) and sprayed with 100 nig L 4 BASIA (AgrEvo, DQsseldorf, Germany) to identify putative Ti transformants. Transformants were transferred to soil, watered weekly with 300 mi of nutrient solution (2 mM Ca(NO 3 ), 15 rnM KNO 3 , 0.5 mM MgSO 4 , 0.5 mM NaHrPO 4 , 15 niM NH4NO3, 2.5 μM NaFeEDTA, 200 μM H?BO«, 0.2 μM Na 2 MoO^ 0.2 μM NiCb, 1 μM ZnSO 4 , 2 μM MnCb, 2 μM CuSO 4 and 0.2 μM C0CI2) and grown to flowering to collect Ti seed. DNA and RNA were extracted from Ti plants to determine the presence and expression of the transgcnc and the number of inserts determined by restriction digests and southern blots.
EXAMPLE 16 Determination of presence and activity of transgene
PCR reactions to determine the presence and activity of the AtCIPK ' 16 transgene or the ami RNA constructs were performed on DNA and cDNIA obtained from the transgenic plants. Reactions were performed using Platinum Taq (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol using the primers listed in Table 6, below:
TABLE 6 - Primer sequences used to confirm presence of transgene in transformant Arabidopsis and rice plants.
EXAMPLE 17
Genomic DNA (10 μg) was digested tor 5 h at 37°C with 400 U H/ndlll. Digested DNA was separated on 1% (w/v) agarose gels and DNA fragments were transferred to a nylon membrane using the method of Southern (Journal of Molecular Biology 98: 503,. 1975). The nylon membrane was neutralised in a solution of 2 * SSC. Membranes were blotted dry and dried under vacuum at 80 0 C prior to probing, Prehybridisation of the membranes was conducted in a 6 x SSC, 1 * Dcnhardt's 111 solution (2% w/v BSA, 2% w/v Ficoll 400 and 2% PVP), 1% (w/v) SDS and 2.5 mg denatured salmon sperm DNA for a minimum of 4 h at 65°C. Hybridisation mixture (10 ml) containing 3 * SSC, 1 * Denhardt's 111 solution, 1% (w/v) SDS and 2.5 mg denatured salmon sperm DNA was used to replace the discarded prehybridisation mixture. DNA probes were radiolabeled with [α- 32 P]~dCTP, using a Megaprime DNA labelling kit according to the manufacturer's directions (Amersham, UK). The probe was hybridised for 16 h at 65°C. The membranes were washed sequentially for 20 min at 65 C C in 2 x SSC containing 0.1% (w/v) SDS, with 1 x SSC/0.1% (w/v) SDS and with 0.5 * SSC/0.1% (w/v) SDS. Membranes were blotted dry, sealed in plastic and RX X-ray film was exposed to the membrane at -80 0 C for 24-48 h, using an intensifying screen.
EXAMPLE 18
Seeds from CoI-O or segregating T2 plants containing either a construct to over-express or knockdown the activity of AtCIPKl 6 were surface sterilised, by soaking in 70% ethanol for two minutes followed by 3-4 rinses in sterile mi Ui -Q water, before individual seeds were planted in 1.5 ml microfuge tubes filled with half strength Arabidopsis nutrient solution (Arteca and Arteca, Physiol Plantarum 108: 188-193, 2000) and 0,8 % Bactoagar. The seeds were vernalised for 2 d at 4°C and then transferred to a growth room with a 10 h light / 14 h dark photoperiod, an irradiance of 150 μmol m 2 s ' 1 , and a constant temperature of 21°C. The bottom 0.5-0,7 cm of the microfuge tubes were removed after emergence of the cotyledon and the roots of the seedling had grown approximately two-thirds of the way down the length of the tube. Upon emergence of the root from the agar, the plants were transferred to a constantly aerated hydroponics tank containing full strength Arabidopsis nutrient solution. The pH of the hydroponic solution was monitored and maintained at pH 5.7. Salt stress was applied 5 weeks after germination by the addition of 100 mM NaQ in 12 hourly increments of 25 mM. Calcium activity in the growth medium was maintained at 0.3 mM at each salt application by addition of the correct amount of calcium . , as calculated using Visual Minteq Version 2.3 (US Environmental Protection Agency, USA).
Plants were harvested after 10 days of salt treatment. Whole shoots of control and salt treated plants were excised and fresh weights recorded. The last fully expanded leaf was removed, weighed and digested in 1% nitric acid overnight at 85°C in a Hot Block
(Environmental Express,, Mt Pleasant,, South Carolina, USA). Na 1 and K * concentrations in this leaf" were measured using a model 420 flame photometer (Sherwood Scientific,
Cambridge, UK). For the transgenic plants containing either the 35S over-expression or ami RNA constructs, the remainder of the shoot and root material was frozen in liquid nitrogen for DNA and RNA extractions to confirm presence and activity of the transgene.
EXAMPLE 19 Semi-£uantjtatlγe_PCR
Semi-quantitative PCR for AtClPKIb was performed on cDNA obtained from both Arabidopsis and rice plants growing in hydroponics. Platinum Taq (Invitrogen, Carlsbad, CA, USA) was used following the manufacturer's protocol and using the primers listed in Table 6. BriefTy, approximately 2 μg of cDNA was added to 1 x PlalTaq PCR buffer, 1.5 mM MgCl∑, 0.2 mM dNTPs, 0.2 μM Forward primer, 0.2 μM reverse primer and 1 U of PlatinurnTfltj, Amplification conditions were initial denaturing tor 2 mins at 94°C, followed by 28 cycles υf 30 sec 94°C, 30 sec 50 0 C and 1 min 72°C. The control genes AtACTZ and OsGAP were used for Arabidopsis and rice respectively. Samples were run on agarose gels containing SyberSafe for visualisation of DNA and a photograph taken of the gel images. The imaging programme. Scion Image (Scion Coporaiion, Maryland, USA), was used to determine the intensity of all PCR product bands observed from the gel, as well as the background signal from the gel itself. The background intensity between each gel was first removed and the signal intensity for each control gene from every sample was standardised. The expression of AtCJPKl 6 for each sample was adjusted accordingly, using the factor necessary to standardise that sample's control gene expression, allowing the comparison between different samples.
EXAMPLE 20 Rice transformation
Rice seeds were transformed using a modified methodology of Toki et ai ' . (Plant j.47: 969-976, 2006). Wild type Nipponbare rice seeds were dehusked and washed for 1 min with 70% ethanol. The seeds were sterilised for 30 mins in 30% White King bleach, then rinsed ten times with sterile miliiQ water. The seeds were transferred onto plates containing NoD media (Toki et ah, 2006, supra) and grown in the dark at 28°C for 5-8 day to induce germination. A. tumefaciens transformed with the pMDC32 plasmid containing the AtCIPKIo gene was suspended in AAM media (Toki et al., 2006, supra) and adjusted to an optical density at 600 nm of 0.1 , The germinated rice seedlings were dipped into the A. tumefaciens containing AAM media for 2 min before being incubated on 2N6-AS media (Toki ei at., 2006, supra) in the dark at 25°C for 3 days. After three days the seeds were rinsed once with sterile water for 1 min and then twice with sterile water containing the antibiotics 400 mg L/ 1 Cefotaxime and 100 mg L 1 Vancornycϊne.
Washed seeds were transferred onto N6D-seiective media (Table 7), containing 400 mg L/ 1 Cefotaxime, 100 mg L Λ Vancomycine and 150 mg ϊ_/ ! Ceneiacine, and grown in the dark al 28°C for 3 weeks. Transformed calli were grown for 1 week on PRN media (Table 7) at 2S°C in the dark, 3 days on RN media (Table 7) at 28°C in the dark and on RN media at 28°C in the light, until the first shoot appeared. The newly formed shoot was separated from the remaining callus and placed on P media (Table 7) in the light at 2S°C until big enough to transfer to soil. The primary transformants were then grown to seed in a growth room with the following conditions: 2S°C / 25°C day / night, 80 % / 60% day / night humidity and 600μmol mV light, with a light dark cycle of 12 hrs light/ 12 hrs night.
TABLE 7 - Rice culture media
EXAMPLE 21 Rice salt stress assays
35S::AtLIPKlβ and wild type Nipponbare rice seeds were germinated for 5 days on moist filter paper at 28°C / 25°C day / night,, 80 % / 60% day / night humidity and 600μmol nτ 2 s "! light, with a light dark cycle of 12hrs light/ 12 hrs night. Seedlings were removed from the filter paper and placed in 1.5 ml microfuge tubes which had their bottoms removed to allow the roots to emerge from the tube. Each microfuge tube was placed carefully into a support above a 10 1 tank filled with ACPFG rice nutrient solution (5mM NH-iNCh, 5.0 KNOs, 2 mM Ca(NOa)-, 2.0 tnM MgSCu, 0.1 πiM KH2PO4, 0.5 mM Na 3 SiOb, 50 μM NaFe ( ui,EDTA, 10 μM H3BO3, 5 μM MnCb 7 5 μM ZnSO 4 , 0.5 μM CuSO4 and 0.1 μM Na-MoO?) allowing the seedlings root access to the media. Seedlings were grown for two weeks in 28°C / 25°C day / night, 80 % / 60% day / night humidity and 600μmol nτ 2 s 4 light, with a light dark cycle of 12hrs light/ 12 hrs night, with the nutrient solution replaced every 5 days. 19 days after germination, half of the seedlings were transferred into nutrient solution containing 75 mM NaCl, supplemented with 0.24 mM CaCh. So as not to shock the plants, salt application was made in three 12 hr applications of 25 mM NaCl and 0.8 mM CaCl:. The plants were allowed to grow for a further 2 weeks before being harvested. The 4 th fully expanded leaf was removed from each plant, its fresh weight recorded and then incubated at 65°C for 48 hrs to obtain dried tissue for dry weight measurements. Once weight measurements were obtained the tissue was digested for in 1% nitric acid for 6 hrs at 85°C. Na τ and IC measurements for each leaf were determined by flame photometry. In addition to the 4 ih leaf, the remaining shoot material from each plant was frozen in liquid nitrogen and RNA extracted to determine the expression levels of AtCIPKlό in transgenic and wild type rice. RNA extract, DNA removal, reverse transcription and PCR were carried out as previously described.
EXAMPLE 22
Constitutive over-expression of AtClPKlβ in Arabidopsis decreases the amount of shoot Na' and increases salt tolerance
Arabidopsis, eeotype CoI-O,. was transformed with a 35S::ΛiClPK " iβ construct designed for the constitutive expression of the AtCJPKI 6 gene, DNA was extracted from T; transgenic Arabidopsis plants transformed with 35S::AtCJPK16 and a Southern blot used to determine the insert number of the transgene. A probe designed to recognise the double CaMV35S promoter driving the expression of the AtCJPKl 6 transgene was used to probe the DNA. Plant lines 11 and 33, which were used in subsequent experiments, contained two insertions of the transgene.
To confirm the expression of the AtClPKlβ transgene in the Ti plants, RNA was extracted from the shoot of plants growing in soil and cDNA produced. PCR was used to confirm the presence of the AtCJPKlθ and Actinl genes. Shoot material was used as it has been previously shown that wild type CoI-O has little to no expression of AiCIPKl 6 in the shoot under control conditions. As shown in Figure 8, Lane 1.1 shows the expression of AtClPKlβ in the shoot of Line 11, lane 3.3 shows the expression of the gene in Line 33, The negative lane contains cDNA extracted from wild type CoI-O plants and shows that while the control gene AtACTl can be amplified from these samples no expression of AtCJPKIb could be observed.
Segregating T: plants from Lines 11 and 33 were grown in hydroponics for 5 weeks before the addition of 100 πiM NaCl for 10 days. As shown in figure 9, flame photometry determined that, on average, plants from both Lines 11 and 33 have 25% less shoot Na" than wild type (VVT) CoI-O plants. These observations, however, still contain null segregates, which do not over-express the gene. Within this population - S-d -
there were identified a number of individual plants with 30% to 50% the shoot Na * accumulation and high AtClPK 16 expression.
RNA was extracted from the roots of 5 week old plants grown in 100 mM NaC"! for 10 days and the expression levels of the native AtCIPKl 6 and AtCJPKl 6 transgene were determined. As shown in Figure 10, on average, there was 3 to 4 fold higher expression of AtClPKIb in the roots of the segregating overexpressing T2 plants of Line 11 and 33 compared to wild type (VVT) CoI-O.
RNA was also extracted from the shoots of 5 week old plants grown in 100 mM NaCl for 10 days and the expression levels of the native AtClPKl 6 and transgene were determined. As shown in Figure 11, on average, there was 10 to 25 fold higher expression of AtCIPKIo in the shoots of the segregating T2 plants of Line 11 and 33 compared to wild type (WT) Col-0. This higher relative expression observed in the shoot compared to roots (Figure 10) is due to the low shoot expression of AtClPKl 6 in wild type Col-0.
Total shoot biomass was determined in T2 segregating plants from Line 11 and 33 as well as wild type (WT) CoI-O plants after 5 weeks growth in hydroponics, followed by the addition of either 0 or 100 mM NaCl for 10 days. As shown in Figure 12, while wild type shoot fresh weight was decreased by 50% after 10 days growth in 100 mM NaCl, plants from Line 11 showed no shoot biomass reduction. Although T2 segregating plants from line 33 showed similar reductions in shoot biomass to wild type plants, there were individuals with similar biomass to those observed in Line 11.
EXAMPLE 23
Reduction in the expression level of AtClPKlβ, using amlRNA, results in an increase in the shoot Na' concentration
Arabidopsis, ecotype Col-0,. was transformed with two separate amiRNA constructs designed to knockdown the expression of the native AtClPKIb gene. DNA was extracied from Ti transgenic Arabidopsis plants transformed with amiRNA AtClPKlό constructs and a Southern blot used to determine the insert number of the transgene. A probe designed to recognise the double CaMV35$ promoter driving the expression of the amiRNA construct was used to probe the DNA. Plant lines 11 1 and 132, were found to contain the amiRNA CIPKI 6-1 constructs, while plant lines 222 and 2122, were found to contain the amiRNA C1PK16-2 constructs. Progeny from these four lines were used in subsequent experiments. These plants contained one to five insertions of the amiRNA construct.
individual T: segregating plants from Lines 1 11, 132, 222 and 2122 were grown in hydroponics for 5 weeks before the addition of 100 mM NaCl for 10 days. Flame photometry was used to determine shoot Na h accumulation and semi-quantitative RT- PCR used to estimate levels of AtCIPKlβ gene expression in the amiRNA lines, relative to that of the wild type controls (shown as dot with error bars in Figure 13). As shown in Figure 13, a trend WΆS observed that those amiRNA plants with low root AtCIPKl 6 expression showed increased shoot Na L accumulation.
Individual T2 segregating plants trom Lines 111, 132, 222 and 2122 were grown in hydroponics for 5 weeks before the addition of 100 mM NaCl for 10 days. As shown in Figure 14, flame photometry identified a trend for the arniRNA-expressing plants to have higher shoot Na' than wild type plants.
Individual T2 segregating plants trom Lines 111, 132, 222 and 2122 were grown in hydroponics for 5 weeks before the addition of 100 mM NaCl for 10 clays. Semi- quantitative RT-PCR determined expression levels of AtClPKl ό in individual plants expressing either the amiRNA CIPKl 6-1 (plants from Line 111 or 132) or amiRNA AtCIPkl6-2 (Lines 222 or 2122). As shown in Figure 15, many plants showed reduced expression of AtCIPklό expression in the root and this was related to the amount of Na τ observed in the shoot. EXAMPLE 24 Over expression of AtClPKIb in Rice
Rice callus was transformed with a 35S:: AiClPKl 6 vector designed to express AtClPKl 6 in rice. As shown in Figure 16, the left panel shows two transformarits (16 1 and 16_2), while the right panel shows that both AtCIPKlβ and the hygromycin resistance gene
(used to select transgenic callus from non- transformed callus) could be detected in both
16-1 and 16-2. The expression of neither gene could be detected in wild type (WT)
Nipponbare rice. The expression of the control gene GAP could be detected in all plants.
Segregating T2 35S::AtCIPK16 rice plants from Lines 16 1 and 16 2 were grown in hydroponics for 2 weeks before the addition of 75 mM NaCl for 5 days. The fourth leal" of every plant was removed and its dry weight recorded before the concentration of leaf Na" could be determined. As shown in Figure 17, there were multiple individual plants with significantly higher leaf biomass when compared to wild type (WT) Nipponbare plants.
Segregating T2 35S::AtClPK16 rice plants from Lines 16 1 and lό_J2 were grown in hydroponics for 2 weeks before the addition of 75 mM NaCl for 5 days. As shown in
Figure 18, plants from both lines with detectable levels of AtCIPKlG expression have significantly lower shoot Na h than wild type (VVT) Nipponbare plants (11= for VVT plants). T: plants from lines 16 1 and lό_J2 which did not show expression of the transgene had similar or higher shoot Na τ to wild type plants. Only 4 individual plants did not fit this pattern. Promisingly, plants 16_1_4, 16__1__5, 16__i__6 and 16_2_6 have high expression levels of AiCIPKl 6 and extremely low shoot Na H .
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to, or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features.
Also, if must be noted that, as used herein, the singular forms "a", "an" and "the" include plural aspects unless the context already dictates otherwise.
Throughout tills specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.
