SCIRRlO neurotrophic factor, its receptor and uses thereof

FIELD OF THE INVENTION

The present invention relates to a protein having a function of nerve protection and regeneration, its encoding gene, a receptor interacting with the protein, and their uses in preparation of neuronal damages recovery drug.

BACKGROUND

Nerve regeneration after spinal cord injury is a worldwide problem to be solved urgently. Recently, great progress has been achieved in molecular mechanism about recovery of spinal cord injury [ Bartholdi D, et al, Eur J Neuroscirr. 1997; 9(7): 1422- 1438. Nakamura M, et al, Exp Neurol. 2003; 184(l):313-325]. It is necessary to re-recognize spinal cord injury and take some ' pertinent measures. A lot of genes are involved during the course of recovery of spinal cord » injury and their interactions are complicated, so there are many unknown fields of molecular mechanism about recovery of spinal cord injury[ Profyris C, et al. Neurobiol Dis. 2004; 15(3), 415-436. Seitz A, et al J Neuroscirr Res. 2002; 67(3), 337-345. Beattie MS, et al. Prog. Brain Res. 2002; 137, 37-47]. Some scientists have tried to use NGF to recover spinal cords injuried recently, but effect is not good. At present, no report have disclosed any novel gene which can be used in regeneration after spinal cord injury.

Thyrotropin-Releasing Hormone Receptor 2(TRH-R2) is one of TRH Receptors, the second coupled receptor, belonging to G- protein-coupled receptors [ Sun Y,et al. Journal of Molecular Endocrinology 2003,30, 87-97. O'Dowd BF, et al. Molecular Endocrinology. 2000,14 183-193. Heuer H,et al. Acta Med Austriaca. 1999, 26(4): 119-22. TRH-R2 may play important roles in functional regulation of nervous system because TRH-R2 is expressed in the central nervous system. Studies demonstrate TRH-R2 is related to cognitive function in nervous system and the extremity motor function in spinal cord [Sun Y, et al. Journal of Molecular Endocrinology, 2003(3φ, 87-97. O'Dowd BF, et al. Molecular Endocrinology 2000, 14, 183-193. Heuer H, et al. Acta Med Austriaca. 1999. 26(4): 119-22]. It has never been reported that TRH-R2 is related with nerve protection and regeneration.

SUMMARY OF THE INVENTION

The object of the present invention is to provide a polypeptide having a function of nerve protection and regeneration and its encoding gene.

Another object of the present invention is to provide a receptor interacting with the polypeptide mentioned above, Thyrotropin-Releasing Hormone Receptor 2.

A further object of the present invention is to provide uses of SCIRRlO and its receptor in nerve injury and regeneration.

We have identified a number of novel spinal cord injury and regeneration related (SCIRR) genes in our efforts of seeking genes responsive to spinal cord injuries from DNA subtractive library.

SCIRRlO (GeneBank accession #AY623793, 2002 and 2004) is one of these genes that are highly up-regulated in injured spinal cord.

The present invention relates to a polypeptide having a function of nerve protection and regeneration, which is one selected from the group consisting of,

1) a polypeptide having the amino acid sequence of SEQ ID NO: 2 shown in the sequence listing;

2) a polypeptide which is obtained by substitution, deletion, and/or addition of one or more amino acids residues in the amino acid sequence of SEQ ID NO: 2, and which has the same activity as that of SEQ ID NO: 2.

The polypeptide of SEQ ID NO: 2 as shown in the sequence listing consists of 171 amino acids residues, there are a signal peptide and alpha helix transmembrane domain at N-terminal ends. SCIRRlO is supposed to be a secreted protein.

A nucleic acid molecule, encoding a protein having a function of nerve protection and regeneration, which is one selected from the group consisting of,

1) a nucleotide sequence as shown in SEQ ID NO: 1;

2) a nucleotide sequence having at least 90% homology with sequence of SEQ ID NO: 1, and having the same activity as that of SEQ ID NO: 1.

The nucleic acid molecule of SEQ ID NO: 1 as shown in the sequence listing consists of the open reading frame of SCIRRlO which is composed of 513bp, displayed in SEQ ID NO: 1.

SCIRRlO is exactly located in rat chromosome 13q27.

Expression vectors and cell lines containing the nucleic acid molecule of the present invention are within the scope of the present invention.

The protein is applied in neurotrophic drug or treating nerve injury drug, wherein said therapy

for nerve injury is through promoting injured nerve to regenerate.

The said nucleic acid molecule is used in preventive or therapeutic drug of neurodegenerative disorder diseases, wherein said neurodegenerative disorder diseases are senile dementia or parkinsonism.

The said protein is used in preventive or therapeutic drug or reagent of neurodegenerative disorder diseases, wherein said neurodegenerative disorder diseases are senile dementia or parkinsonism.

Thyrotropin-Releasing Hormone Receptor 2 interacting with the said protein is applied in nerve injury and regeneration medicine or therapeutic drug of neurodegenerative disorder diseases, wherein said neurodegenerative disorder diseases are senile dementia or parkinsonism. SCIRRlO may be an effective drug used for the treatment of neurodegenerative disorder diseases. According to molecular structure of SCIRRlO and its receptor TRH R2, there are several methods by which the therapeutic drugs can be obtained. One of which comprising following steps: a) establishing stable expression cell strain or constructing the virus vectors for gene therapy; b) designing corresponding polypeptide or compound; c) screening and designing ligand Combining with TRH R2. They are applied in treating nerve injury and neurodegenerative disorder diseases, wherein said neurodegenerative disorder diseases are senile dementia or parkinsonism.

Gene and protein related in the invention can be prepared by common method in this field. Some conclusions are drawn on the basis of a large number of experiments, a) SCIRRlO is closely related to spinal cord injury and regeneration; b) The expression levels of SCIRRlO mRNA and protein are temporally elevated in injured spinal cord, c) The interaction between SCIRRlO and TRH-R2 is confirmed by corresponding experiment; d) SCIRRlO interacting with TRH R2 can induce activation of the PLC and MAPK-Erk signaling pathways, e) It is more powerful to promote the outgrowth of nerve fibre from cultured embryonic rat cortex tissue blocks in media supplemented with SCIRRlO than fifty times of NGF or from cultured spinal cords tissues in media supplemented with SCIRRlO than the same dosage of BDNF. f) SCIRRlO is a novel Neurotrophic Factor that exerts its activity through TRH R2 in vivo and in vitro. It can obviously promote regeneration of sciatic nerves transected completely, g) TRH synthesized has no effect on neural regeneration.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig.l illustrates a electrophoretic map of the SCIRRlO gene by PCR.

Fig.2 illustrates a electrophoretic map of the pET-32a-SCIRR10 after digestion with EcoRI and

SaIII.

Fig.3 illustrates a SDS-PAGE map of His-tagged N-terminal SCIRRlO.

Fig.4 illustrates a electrophoretic map of Dig labeled SCIRRlO RNA probes.

Fig.5 illustrates four drawings about expression of SCIRR 10 mRNA in different tissues.

A. RT-PCR amplification of SCIRR 10 mRNA in multiple rat tissues

B. Expression of SCIRR 10 mRNA in rat cerebrum

C. Expression of SCIRR 10 mRNA in rat cerebrum magnification

D. Expression of SCIRR 10 mRNA in spinal cord gray matter neurons

Fig.6 illustrates drawings about expression of SCIRR 10 mRNA and protein in injuried spinal cord.

A and B. Expression of SCIRR 10 mRNA in injuried spinal cord

C and D. Expression of SCIRR 10 protein in injuried spinal cord

Fig.7 illustrates drawings of capture and identification of interaction protein of SCIRRl O-His-tag fusion protein.

A. a protein electrophoresis map stained with coomassie brilliant blue in pull down assays. Lane 1. protein marker; Lane 2. the elution of purified SCIRRl O-His-tag flowing; Lane 3. protein in spinal cord tissue; Lane 4,5,6. the elution at different phase; Lane 7,8. the elution of Negative control. The arrow represents the interaction protein with SCIRRlO.

B. a peptide mass fingerprint obtained by MALDI-TOF-MS.

Fig.8 illustrates drawings of interaction between receptor TRH R2 and SCIRRlO

A. Interaction protcols between the receptor TRH R2 and agent, SCIRRlO

B . SCIRR 10 binding TRH receptor 2

Fig.9 illustrates a hybridization map (A) of ERK 1/2 and their phosphorylated form detected by Western blotting with specific antibodies and a bar graph (B) of the Ratio of the phosphorylated ERK1/2 and ERKl /2.

Fig.10 illustrates a Histogram of radio-activity of different group at different time by Scintillation Counter.

Fig.11 illustrates a hybridization map of the Effect of SCIRRlO on the expression of GAP 43. Fig.12 illustrates a micro-graph of the effect of recombinant SCIRRlO on the sprouting and growing of neurites of rat spinal cord tissue blocks in vitro. These tissue blocks were cultured on the following medium, a. DMEM; b. DMEM+SCIRR10; c. DMEM+SCIRR10+PTX; d. DMEM+TRH; e. DMEM+TRH+PTX; f. DMEM+BDNF 1(0.000296 nM); g. DMEM+BDNF2(0.0296 nM).

Fig.13 illustrates a bar graph of the average numbers and lengths of neurites from the cultured rat spinal cord tissue blocks on different medium.

Fig.14 illustrates a bar graph of the average numbers and lengths of neurites from the cultured rat cortex tissue blocks on different medium.

Fig.15 illustrates a hybridization map of expression of SCIRRlO in COS 7 cell transfected with

SCIRRIO-pcONA TM 3.1/myc-His (-) A by Western Blot.

Fig.16 illustrates a micro-graph of the nerve fibers labeled with NF- 160 antibody in sciatic nerves at different segments apart from linked sites.

Fig.17 illustrates a bar graph of the numbers of NF- 160 positive fiber in the sciatics nerves at different segments apart from linked sites.

DETAILED DISCLOSURE OF THE INVENTION

The present invention is further explained by the drawings and the following examples. But the scope of the invention is not limited to these drawings and examples. If experimental conditions or steps are not described in examples, Molecular Cloning (A Laboratory Manual, 2nd editon) or the procedure of specification in kit is referred.

Example 1 Discovery of a novel gene, named as SCIRRlO

An in vitro spinal cord primary neuron injury model was replicated in rat. 4.5 days after injury and regeneration of spinal cord primary neurons, the differentially expressed genes were cloned by improved subtractive hybridization to construct DNA subtractive library. Randomly picked 110 clones from this library were detected by restriction enzyme digestion and sequencing methods, suggesting that these clones represented 51 ESTs. The further experiment rejecting false positive clones and repeat sequence by Reverse Dot Blot was conducted. Finally, 31 differential display ESTs were obtained, including 24 known genes and 7 novel genes. A part of genes have been included in GeneBank. SCIRRlO (GeneBank accession #AY623793, 2002 and 2004) is one of these genes that are highly up-regulated in injured spinal cord. The same gene was also identified by another group of people at the same time and renamed as Neudesin and was detected that it had influence on cell differentiation.

Example2 Amplification of SCIRRlO and Construction of expression vectors

1. A nucleic acid molecule encoding SCIRRlO protein obtained by PCR

Total RNA was extracted from transected (adjacent to the transected site) rat spinal cord using the SV Total RNA Isolation System from Promega. First strand cDNA was synthesized using 2μg of the RNA and the Superscript II RNaseH Reverse Transcriptase from Invitrogen. PCR was carried out using 2 μl of the first strand cDNA and the following Scirrl O-specific primers, which were designed containing two restriction sites, EcoRI and SaIII.

Sense: 5'-AGA|GAATTC] ATGGCGCGCCCCGCGCCCTG -3' ( SEQ ID No:3 )

EcoRI

Anti-sense: 5'-GAGjGTCGAg TTAGAACTCGTCCTTTATGTCAA-3' ( SEQ ID No:4 )

SaIII PCR Condition: 9 4 ^° C 3min

72 ^° C lmin

72 ^" C 3min

PCR products were separated by 1% agarose gel (Fig.l).

Fig.l shows that a nucleic acid molecule encoding SCIRRlO protein, including an open reading frame of 513bp, is obtained. 2. Construction of expression vectors

(1). The bacterial expression vector pET-32a-SCIRR10 was generated by inserting a SCIRRlO cDNA fragment encoding SCIRRlO protein (nucleotide 1-513) into pET-32a. The main process was as follows: a. The PCR products in example 2 were ligated to pET32a, which the ratio between the former and the latter is 3: 1, after double digestion with EcoRI and SaIII and purification. The ligation products were then transformed into competent Escherichia coli cells Rosetta GAMI B by standard techniques (CaCl ₂ method ). b. These positive clones were picked out and shaken overnight at 37 ^° C . The plasmids were extracted and identified by digestion with EcoRI and SaIII and Sequencing.

The result showed that 8 recombinant clones with SCIRRlO were generated (Fig.2).

(2)The eukaryotic expression plasmid-SCIRRIO-pcDNA™ 3.1/Myc-His (-) A was generated by inserting a SCIRRlO cDNA fragment (nucleotide 1-513) encoding SCIRRlO protein to the cloning site up-stream of the Myc-His tags in pcDNA™ 3.1/Myc-His (Invitrogen). The main process was as follows: a. The PCR products in example 2 and pcDNA™ 3.1/Myc-His were ligated, which the ratio

between the former and the latter is 3:1, after double digestion with EcoR I and HindIII and purification. The ligation products were then transformed into E.coli DH5α by standard techniques (CaCl ₂ method ). b.These positive clones were picked out and shaken overnight at 37°C. The plasmids were extracted and identified by digestion with EcoRI and HindIII and Sequencing.

(3) Plasmids expressing SCIRRIO-GFP and TRH-R2-RED fusion proteins were constructed by inserting PCR fragments, which were generated by using SCIRRlO or TRH-R2 cDNA templates and the corresponding primers, into pEGFP-Nl and pDsRed-Nl vectors (Clontech Laboratories,

Inc., Palo Alto, CA, USA), respectively. The SCIRRIO-GFP and TRH-R2-RED fusion proteins thus generated were both tagged at the carboxyl terminus, with the green fluorescent protein

(GFP) and the red fluorescent protein (RED), respectively.

SCIRRlO specific primers:

Sense: 5'-TCTGGTCTCACTGCCAAGGA-S' (corresponding to nucleotide 340-359 of the

SCIRRlO cDNA); (SEQ ID No:5)

Anti-sense: 5'-TTAGAACTCGTCCTTTATG-S' (corresponding to nucleotide 498-516 of the

SCIRRlO cDNA); (SEQ ID No:6)

TRH-R2 specific primers:

Sense: 5'-TATGCTAGCGATGGATGGCCCCAGTAATGT-S ' (corresponding to nucleotide 1-20 of the TRH-R2 cDNA, with a Nhel site underlined) (SEQ ID No:7)

Anti-sense: 5'-GCAGAATTCGCATCTTCTCAGTTCCTTCTG-S' (corresponding to nucleotide 1037-1056 of the TRH-R2 cDNA, with an EcoRI site underlined) (SEQ ID No:8)

Example3 Expression and purification of recombinant SCIRRlO protein

1. Expression and purification of His-tagged N-terminal SCIRRlO a. The cells transformed with pET-32a-SCIRR10 were cultured and shaken overnight at 37 ^° C in

LB including resistance to amp, kan, tet and chl. b.50μl bacterial liquid was added to 5ml LB and continuously cultured at 20°C. When OD ₆₀ O was from 0.6 to 0.8, His-tagged N-terminal SCIRRlO was expressed with induction of 0.1 mM IPTG for 15h. After collected, these cells were washed by IxPBS (pH7.4, 0.0 IM) and disrupted by

Ultrasonic Wave. c. Supernatants were purified using a HiTrap FF column with a Ni-NTA agarose (Amersham Pharmacia). d. The purified recombinant His-tagged N-terminal SCIRRlO protein was confirmed by

SDS-PAGE.

SDS-PAGE analysis showed that His-tagged N-terminal SCIRRlO with molecular weight

36.6kD was expressed with induction of 0.1 mM IPTG at 20 °C for 15h (Fig.3).

2. Expression and purification of His-tagged C-terminal SCIRRlO a. With 5%CO ₂ condition, COS7 cells were cultured in DMEM containing 5% fetal bovine serum, 10% horse serum, 2mM Glutamine at 37 ^" C. The passage COS7 cells were seeded in 35mm plate at IxIO ⁵ per plate and cultivated for 24h until cell density is 80-90%. b. The eukaryotic expression plasmid-SCIRRIO-pcDNA™ 3.1/Myc-His (-) A was transfected into the said cos7 cells with Lipofectamine 2000 reagent (Invitrogen), which transfection was conducted with the guide of reagent specification. 6 hours later, these cells were cultured in Serum-free medium with Neural basal for 24h. c. After supernatants was collected, expression level of the recombinant protein was detected by Western Blot, which antibody was anti-myc. d. The His-tagged C-terminal SCIRRlO protein was purified from the transfected COS 7 cells and the collected cell media using affinity columns (GE Healthcare Company, HisTrap™ FF 17-5319-01). e. And then concentration of the purified protein was measured by BCA method. It was 0.5mg/ml.

The purified recombinant His-tagged C-terminal SCIRRlO protein was confirmed by Western Blot(Fig.l5), using a SCIRRlO specific antiserum and used for further study on signal transduction and functional investigation to promote neurite growth from cortex and spinal cord blocks.

Western Blot was conducted according to following procedure.

Tissues of normal or transected (adjacent to the transected site) rat spinal cord or cultured cells were lysed with lysis buffer I (2OmM HEPES, pH 7.2, 1% Triton X-100, 1% deoxycholate, 0.1% SDS, 15OmM NaCl, lOug/ml leupeptin, lOug/ml aprotinin, and ImM phenylmethylsulfonyl fluoride).The lysates were separated with 10% SDS-polyacrylamide gel and blotted onto polyvinylidene difluoride (PVDF) membranes using semidry blotting apparatus (Bio-Rad). The blots were first blocked with washing buffer (2OmM Tris, 15OmM NaCl, 0.05% Tween-20, pH 7.6) containing 5% skimmed milk at 4°C overnight and incubated with the polyclonal anti-SCIRRlO antibody or a monoclonal antibody against p-Erkl/2 (at a 1 :500 dilution) at room temperature (RT) for 1 hr. They were then washed in washing buffer three times every 10 min and then incubated with horseradish peroxidase (HRP) labeled secondary goat anti-mouse antibody at room temperature for 1 hr. Following, the blots were washed three more times with

washing buffer and visualized using an enhanced chemiluminescence Western Blotting detection kit (Vigorous).

Example 4 Distribution of SCIRRlO mRNA in multiple rat tissues

1. RT-PCR

Total RNA was extracted from (adjacent to the transected site) adult rat different tissues, such as Cerebrum, Cerebellum, Brain stem, Spinal Cord, Skeletal Muscle, Heart, Liver, Spleen, Pancreas, Thymus, Kidney, Stomach, Lung, Colon, Small Intestine and Testis, using the SV Total RNA Isolation System from Promega. First strand cDNA was synthesized using 2μg of the RNA and the Superscript II RNaseH Reverse Transcriptase from Invitrogen. PCR was carried out using 2 μl of the first strand cDNA and Scirrl 0-specifϊc primers. G Iy ceraldehyde-3 -phosphate dehydrogenase (GAPDH) was taken as internal reference standard in every sample. StorriO-specific primers and GAPDH-specific primers were as follows: primers:

Sense: 5'-TCTGGTCTCACTGCCAAGGA-S' (SEQ ID NO:5) Anti-sense: 5'-CCTCTGCTTGTTCCGTGGG-S' (SEQ ID NO:9) GλPDH-specific primers:

Sense: 5'-TCCCTCAAGATTGTCAGCAA-S' (SEQ ID NO: 10) Anti-sense: 5'-AGATCCACAACGGATACATT-S' (SEQ ID NO: 11) PCR products were separated by 1% agarose gel. (Fig.5-A).

The result indicated that expression of SCIRRlO mRNA was widely in adult rat tissues, such as cerebrum, cerebellum, brain stem, spinal cord, skeletal muscle, heart, liver, spleen, kidney, stomach, lung, small and large intestine. But SCIRRlO mRNA was highly expressed in central nervous system, skeletal muscle, kidney and lung among these tissues. Besides, its expression level was relatively high in male rat Testis.

2. Tissue In Situ Hybridization

(1) RNA probes were designed according to specific sequence of SCIRRlO from 199bp to 357bp in SEQ ID NO. I.

RNA probes were prepared according to following procedure.

The specific sequence was amplified from SCIRRlO PCR products in example 2 by PCR and using the following SWrriø-specific primers, which were designed containing two restriction sites, EcoRI and Hind III.

Sense: TACAAGCTT GTGAAGGGAGTGGTGTTCGA (SEQ ID No: 12)

EcoR I

Anti-sense: CTG GAATTC CTTGGCAGTGAGACCAGAAAT (SEQ ID No: 13)

Hind III

The PCR products were ligated to pSPT18 and pSPT19 repectively, after they were digested with EcoR I and HindIIIand purified using QIAquick Gel Extraction Kit. The ligation products were then transformed into E.coli DH5α by standard techniques (CaCl ₂ method). These positive clones were picked out. The plasmids were extracted and identified by digestion and Sequencing. RNA sense and anti-sense probes were transcripted from pSPT18 recombinant plasmids digested with EcoR I and pSPT19 recombinant plasmids digested with Hind III repectively as templates.Transcription and labelling of RNA probes were completed using Dig RNA Labeling Kit (SP6/T7).

Dig labeled products were separated by 1.5% agarose gel (Fig.4). (2) Hybridization

In Situ Hybridization of Tissue section was conducted by conventional method in this field, which related tissues were rat cerebrum and intact spinal cord, hybridizing temperature was 55 ⁰ C and the hybridized signals were detected with NBT/BCIP. The result was observed using a scanning electron microscope.

The result demonstrated ScirrlO mRNA-positive neurons were widely distributed in the cerebral cortex of adult rat brain, especially in cingulate cortex, piriform cortex. The magnificent figure of the frame is in Fig.5-B. A: AON anterior olfactory nucleus, MoBgr main olfactory bulb granule cell layer, MoBmi main olfactory bulb mitral layer, SEZ subependymal zone; B: PIR piriform area, GU gustatory area, Aid agranular insular area, Mop primary somatomotor area, Mos secondary somatomotor areas, AcAd anterior cingulated area; C: OT olfactory tubercle, SSc supplemental somato area: D: PSCH, suprachiasmatic preopticnucleus, SO, supraoptic nucleus, VLP, ventrolateral preoptic nucleus, AVP, anteroventral preoptic nucleus, SO, supraoptic nucleus; E, RH, rhomboid nucleus, PVHpml, paraventrecular hyprothalamic nucleus posterior magnocellular part; F, PERI, perihinal area, ECT, ectorhinal area, TEa, temporal association areas, AUD, auditory area, BLAP, basolateral amygdalar nucleus posterior, DGcr, dentate gyrus crest; G, PAG, periagueductal gray; I, ICd, inferior colliculus dorsal, LDTg, laterodorsal tegmental nucleus.

SCIRRlO mRNA-positive neurons were widely distributed in the cerebral cortex of adult cerebellum. The magnificent figure of the frame is in Fig.5-C. A, PSV, principal sensory nucleus of the trigeminal, SOC, superior olivery complex; B, LC, locus ceruleus; C, FL, flocculus, VCOa, ventral cochlear nucleus anterior part, SGt, supragenual nucleus; D, LRNm, lateral reticular nucleus magnocellular part, DMX, dorsal motor nucleus vagus nerve, 10, inferior olivary complex; E, CU, cuneate.

Sections obtained from intact rat spinal cord (fig.5-D) were hybridized with a ScirrlO antisense riboprobe. The area of the box in panel A is enlarged and shown in panel B where the large motor neurons in the ninth layer are shown deeply stained.

Meanwhile, Comparative distribution of SCIRRlO mRNA and TRH R2 mRNA in CNS was recorded according to the result of above Tissue In Situ Hybridization (Table 1).

Table 1 Comparative distribution of SCIRRlO mRNA and TRH R2 mRNA in CNS

Region Ditribu TRH-R Region Ditributi TRH- tive 2 ve R2 density density of of

SCIRR SCIRRl

10 0 mRNA mRNA in CNS in CNS

Cortex — — Amygdala

Rhinal cortex — — Amygdaloid nuclei ++++ +

Piriform cortex -H- + Septal region

Frontoparietal cortex ++++ + Stria terminalis ++ +

Primary visual ++++ + Medial septal nucleus +++ — cortex

Primary olfactory ++++ + Lateral septal nucleus +++ — cortex

Anterior cingulate ++++ + Septohippocampal +++ — area nucleus

Posterior cingulate ++++ + Nucleus of the ++ + area diagonal band

Retrosplenium +++ + Corpus striatum

Striate areas ++ + Caudate putamen ++ —

Subiculum ++ + Globus pallidus +++ +

Thalamus Nucleus accumbens — —

Paraventricular ++++ + Midbrain and hindbrain nucleus

Centromedial + Superior colliculus + nucleus

Anteroventral +++ + Inferior colliculus + nucleus

Ventroposterior + Periaqueductal gray ++ + nucleus

Posterior medial Mesencephalic + nucleus reticular N

Laterodorsal nucleus + Ventral tegmental area +

Lateroposterior + Pontine gray + nucleus

Ventromedial + Pontine reticular + nucleus nucleus

Medial + Central/rostral linear + habenularnucleus raphe N

Medial reuniens + + Periolivary nucleus nucleus

Medial/lateral + Nucleus sagulum + geniculate N Subthalamic area Parabrachial nucleus +

Subthalamic nucleus + Motor trigeminal ++ nucleus

Hypothalamus Facial nucleus ++

Anterior ++++ + Hypoglossal nucleus ++ hypothalamic area

Lateral hypothalamic Dorsal motor nucleus ++ area of vagus

Posterior Spinal cord No hypothalamic area data

Medial preoptic area + White mater ±

Lateral preoptic area Gray I ++++ Dorsomedial Gray II hypothalamic N

Paraventricular +++++ + Gray III +++ nucleus

Periventricular + — Gray IV ++ nucleus

Suprachiasmatic + — Gray V ++ nucleus

Mammillary nucleus + + Gray VI Hippocampus Gray VII

Dentate gyrus Gray VIII -H-++

Amnion's horn ++ Gray IX ++++ Gray X +++

Example5 Expression of SCIRRlO mRNA and protein in injured spinal cord

Expression of SCIRRlO mRNA and protein in normal and injured adult rat spinal cords was measured by RT-PCR and Western blot.

Rat spinal cords were transected and the total proteins and mRNAs were extracted from the injured spinal cords adjacent to the transected sites.

1. Semi-quantitative RT-PCR

RNAs were extracted from normal or transected (adjacent to the transected site) rat spinal cord using the SV Total RNA Isolation System from Promega. First strand cDNA was synthesized using 2 μg of the RNA and the Superscript II RNaseH Reverse Transcriptase from Invitrogen. Semi-quantitative PCR was carried out using 2 μl of the first strand cDNA and the Scirrl O-specific primers. PCR products were separated by 1% agarose gel and quantified by ImageMaster TotalLab vl.l. The level of Scirrl 0 mRNA expressed in each sample was normalized by that of glyceraldehyde-3 -phosphate dehydrogenase (GAPDH).

Scirrl O-specific primers and GAPDH-specific primers were as follows: Primers specific to SCIRRlO,

Sense: 5'-TCTGGTCTCACTGCCAAGGA-S' (corresponding to nucleotide 340-359 of the

SCIRRlO cDNA), ( SEQ ID No:5 )

Anti-sense: 5'-TTAGAACTCGTCCTTTATG-S' (corresponding to nucleotide 498-516 of the

SCIRRlO cO^ A) (SEQ ID No:6)

Primers specific to GAPDH,

Sense: 5'-TCCCTCAAGATTGTCAGCAA-S' ( SEQ ID No:10)

Anti-sense: 5' -AGATCC AC AACGGATAC ATT-3 ' ( SEQ ID No: 11 )

2. Western Blot

Western Blot was conducted by the method of example 3, which materials were respectively drawed at 1st, 3th, 5th day after spinal cord injured.

Expression of SCIRRlO mRNA (Fig.6-A) and protein (Fig.6-C) in normal and injured adult rat spinal cord, was measured by RT-PCR and Western blot. The first column of each penal referred to samples collected from control (uninjured) animals. GAPDH was used as the internal control. The expression levels of mRNA of SCIRRlO were elevated at first day after spinal cord injured, then increased gradually, and arrived the highest level at 5th day post-injury, and little decreased since that (Fig.6-B). The SCIRRlO protein also increased gradually in first three days after spinal cord injured (Fig.6-D).

Example 6 Screening and Identification of a protein interacting with SCIRRlO.

His-tagged N-terminal SCIRRlO expressed in E.coli was incubated with cobalt chelate (ProFound pull-down PolyHis Protein-Protein Interaction Kit; Pierce) immobilized on resin at 4 ^° C for 2 hrs. Transected rat spinal cords were isolated 72 hrs. After the injury, homogenated in another kind of lysis buffer II (1OmM Tris-HCl [pH 7.8], 15OmM NaCl, 1% Nonidet P-40) containing protease inhibitor cocktail (Roche), sonicated, and centrifuged at 20,000 xg for 1 hr. The resin with captured His-tagged N-terminal SCIRRlO was washed and incubated with the lysates at 4 "C for 4 hrs. After 3X washes with washing buffer (ProFound pull-down PolyHis Protein-Protein Interaction Kit; Pierce), the proteins bound to the resin were eluted with elution buffer (washing buffer with 29OmM imidazole). The elution was separated by SDS-PAGE. The proteins were visualized by commas blue staining. The identity of the protein pulled-down by SCIRRlO was determined by MALDI-TOF mass spectrometry (MS) analysis. A 35~45 kD protein was pulled-down from the lysates of transected rat spinal cord by using His-tagged N-terminal SCIRRlO protein coupled affinity resin (Fig.7-A). MALDI-TOF MS analysis of trypsinized fragments of the protein predicted sequence matches between the major fragments of the protein with TRH-R2, a G-protein coupled receptor for TRH (Fig.7-B). Transient expression of SCIRRIO-GFP and TRH-R2-RED fusions were achieved by transfecting the SCIRRIO-GFP and TRH-R2-RED plasmids into COS 7 cells using Lipofectamine 2000 reagent (Invitrogen) following the manufacturer's instruction. SCIRRIO-GFP and TRH-R2-pDsRed fusions protein were respectively expressed in COS 7 cells using the expression plasmids described in example 2. 16 hrs after transfection, the supernatants of the cultured COS 7 cells transfected with SCIRRIO-GFP were harvested. The COS 7 cells transfected with TRH-R2- pDsRed were incubated with or without 10 μM of synthesized Thyrotropin-releasing hormone (TRH) for 5 min, and then with the SCIRRIO-GFP supernatant for 4 hrs. After incubation, the cells were washed, fixed with 4% paraformaldehyde, and mounted with cover slips. The cells were then analyzed and photographed under a laser scanning confocal microscope (Bio-Rad Radiance 2100).

After the supernatant of these COS 7 cell transfected with SCIRRIO-GFP were collected and added into those COS 7 cells transfected with TRHR2-RED, continuing to culture for another 4 hours. The process was showed in Fig.8-A.

COS 7 cell was transfected with SCIRRIO-GFP plasmid and TRHR2-RED plasmid respectively (Fig.8-B). TRHR2 with RFP could be detected in the rim of the COS 7 cell (al and bl).

SCIRRlO with GFP could also exist around the COS 7 cell transfected with TRHR2-Ds-Red (a2). That two kinds of color labels can be easy emerged, demonstrating that the interaction between the SCIRRlO and TRHR2 in vitro (a3). However, after pre-treating the COS 7 cells transfected with TRHR2-RED plasmid with synthesized TRH at high concentration (lOuM/ml), the prepared supernatant containing SCIRRIO-GFP was then added into the cultured COS 7 cells transfected with TRHR2-RED for another 2-4 hours. Only shadow GFP labeled (hollow arrow) was seen around the red fluorescence cells (b2). GFP labeled cell was contrasted with the shadow labeled cell (b2 and b3). Bars in al and bl equal 20μm

Example7 Confirm of signal transduction of SCIRRlO on TRH receptor 2

1. Cultured primary neurons from rat cortex were staged in serum free media for 3 hours. The staged cells were treated with or without 250 ng/ml of Pertussis toxin (Sigma) at 37 ⁰ C for 2 hrs, and then with or without 1 ng (0.0000525 nM) of recombinant His-tagged C-terminal SCIRRlO fusion protein or 72.4μg (200 nM) of synthesized TRH for 10 min. The cells were washed three times with ice cold PBS and lysed in TNE buffer (10 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 50 mM NaF, 2 mM Na3VO4,10 μg/ml aprotinin, 10 μg/ml leupeptin, and 2 μg/ml pepstatin). Levels of phosphorelated extracellular signal-regulated kinase 1/2 (ERKl/2) in the cells were determined by Western Blot using antibodies specific to phospho-ERKl/2 (anti-phospho-Thr202/Tyr204 ERkl/2, working dilution 1 :500, Cell Signaling #9101) and ERKl/2 (working dilution 1:500, Cell Signaling* 9102).

The result of Western Blot demonstrated Both His-tagged C-terminal SCIRRlO and TRH induced MAP kinases (Erkl/2) activation in cultured primary neurons. When the cultured primary neurons were pre-treated with PTX or UO 126, SCIRRlO and TRH induced MAP kinase phosphorylation was abolished (Fig.9-A). Their proportionality was showed in Fig.9-B.

2. Another Signal Transduction Pathways through TRHR2 was phospholipase C (PLC) Pathway. The Cultured primary neurons from rat cortex were staged in DMEM with myo-[ ³ H] inositol (2 μCi/ml) for 24 hours and then were treated by 10 mM of LiCl for 30 min. The staged cells were treated with or without lOμM of Pertussis toxin or U73122 (Sigma) at 37 ⁰ C for 2 hrs, and then with or without 1 ng (0.0000525 nM) of recombinant His-tagged C-terminal SCIRRlO fusion protein or 72.4μg (200 nM) of synthesized TRH for different time, 0, 5, 10, 30 and 60 min. SCIRRlO and TRH activity was measured by counting ³ H radio-activity with Scintillation Counter (wallac 1450 MicroBeta TriLux, Perkin Elmer). The data was analyzed by T test. The result showed that SCI RRlO could also induced the activation of phospholipase C signal

pathway (PO.05) like TRH. The activation of phospholipase C by SCIRRlO or TRH was inhibited by PTX or U73122, a phospholipase C inhibitor (Table 2, Fig.10) .

Table 2 radio-activity of different group at different time by Scintillation Counter

SCIRRlO and TRH also induced the activation of phospholipase C in cultured primary neurons, and the activation of phospholipase C by SCIRRlO or TRH was also inhibited by pre-incubation of the neurons with either PTX or U73122, a phospholipase C inhibitor.

Example 8 Effect of SCIRRlO on the expression of GAP 43

Rat primary neurons were isolated from cerebra cortexes of newborn rats (2 to 4 days old).The cortexes were dissected out, cut into ~1 mm blocks with scissors, and incubated in DMEM medium containing 0.25% trypsin for 30 min at 37°C. The digested tissue blocks were rinsed three times with DMEM containing 10% of fetal bovine serum (FBS), blown gently in the same media with a Pasture pipette, and centrifuged at 500 g for 5 min at room temperature. The isolated cells were suspended in DMEM containing 10% FBS at a density of 5><10 ⁵ cells/ml. 2 ml of the cell suspension was seeded either in 35 mm of poly-L-lysine-coated tissue culture dishes or on poly-L-lysine-coated cover slips placed in 35 mm tissue culture dishes. Eighteen hours later, cells in two replicate dishes (or cover slips) were immunofluorescently stained with a monoclonal antibody against nestin and the number of nestin positive cells was determined under microscope. The media in the remaining dishes were replaced with serum-free DMEM containing 10 nM of arabinosylcytosine (arc-c). The cells were further cultivated for 96 hours to eliminate proliferating cells. Following incubation, the cells were rinsed three times with fresh media to remove the arc-c. The purity of the enriched neuronal cultures or the percentage of neurons in these cultures was determined by microscopic cell counting, or the labeled cells were counted by flow cytometric analysis. Replicates of cultures were also stained with the antibody

against nestin to determine the number of remaining neural stem cells or progenitors.In these experiments, over 99.84% of the cells were found positive to both PI and MAP2 or Pl and ShcC staining. As no nestin expressing cells were detected from these enriched neuronal cultures. SCIRRlO was then added into the remaining of the enriched neuronal at concentration of lng/ml to continuously cultured for different times. Western blot protocols against GAP43 were put in practice as above.

Trace amounts of SCIRRlO up-regulated the expression of GAP43, neuron growth-associated protein 43, in primary neurons (Fig.11).

Example 9 Effect of SCIRRlO protein on promoting neurite outgrowth from cortex and spinal cord tissue blocks in vitro

The spinal cords of the new born rats and cerebrum cortexes of rat embryos were dissected, cut into small blocks (~0.8 mm ³ ), and transferred into polylysine coated 6-well tissue culture plates with DMEM. They were treated with or without 250 ng/ml of pertussis toxin (Sigma) at 37 ⁰ C for 2 hr. The spinal cord tissue blocks were then treated in DMEM with or without 2 ng (0.000105 nM) of recombinant His-tagged C-terminal SCIRRlO fusion protein, 72.4 μg (200 nM) of synthesized TRH, or 2 ng (0.000167 nM) or 200 ng (0.0167 nM) of BDNF at 37 ⁰ C for 16 hr. The cortex tissue blocks were treated in DMEM with or without 28.8 ng (0.0012 nM) of recombinant His-tagged C-terminal SCIRRlO fusion protein, 72.4 μg (200 nM) of synthesized TRH, or 21 μg (0.078 nM) of NGF for 12 hr. The numbers and lengths of the neuritis growing from the tissue blocks were determined under microscope. E ach experiment was repeated for 3 times. Data were statistically analyzed and expressed as the means ± S.E.M. Differences between groups were considered significant if P < 0.05. Statistics analysis of the data showed that trace amount of SCIRRlO could obviously enhance survival of primary cortical neurons for cortex (Table 4, Fig.12, Fig.l4)and spinal cord tissue blocks(Table 3, Fig.12, Fig.13 ) in vitro ; Regeneration capacity of neuritis from cortex tissue blocks cultured in media supplemented with 0.2ng of SCIRRlO far exceeded media supplemented with 20ng of NGF. In addition, the activity of SCIRRlO for enhancing regeneration of neuritis from spinal cord tissue blocks was far more than the activity of the same dosage of BDNF and could be inhibited by PTX. However, few process was observed from the tissue blocks treated with TRH.

Table 3 The Effect of SCIRRlO on the numbers and lengths of the neuritis from spinal cord tissue blocks in rats different stimuli number average number of average length of nerve fibers nerve fibers(μm)

DMEM 28 51.888±46.294 ^a 218.142±145.619 ^a

DMEM+SCIRR10 20 115.900± 119.903" 362.800±293.536 ^b

DMEM+SCIRRl 0+PTX 13 45.571±28.838 ^a 240.429±133.487 ^a

DMEM+TRH 40 52.250±47.045 ^a 271.160±252.610 ^a

DMEM+TRH+PTX 11 48.363±38.390 ^a 204.000±131.608 ^a

DMEM+BDNF1 30 65.566±43.165 ^a 361.400±496.321 ^b

DMEM+BDNF2 9 152.555±76.779 ^b 486.222±356.659 ^C

Table 4 The Effect of SCIRRlO on the numbers and lengths of the nerve fibers from cortex tissue blocks in rats different stimuli number average number of average length of nerve fibers nerve fibers(μm)

DMEM 8 48.125±37.813 ^a 41.955±28.152 ^a

DMEM +SCIRR10 8 259.875±219.996" 143.877±86.104"

DMEM+SCIRRl 0+PTX 14 28.285±22.543 ^a 34.920±21.757 ^a

DMEM +TRH 9 90.888±32.982 ^a 85.395±40.265 ^c

DMEM+ TRH+PTX 9 53.111±23.213 ^a 69.164±28.367 ^C

DMEM+ NGF 8 87.000±40.496 ^a 88.377±52.145 ^C

DMEM+ NGF+ PTX 9 91.444±42.945 ^a 102.838±32.951 ^d

ExamplelO Effect of SCIRRlO on promoting regeneration of transected sciatic nerve in rats

Sciatic nerves of 12 adult Wistar rats were transected completely and then linked by connecting the epineurium of the two separated terminals of each. COS 7 cells (2 X 10 ⁴ /injection) transfected with either SCIRRl 0-pcDNA™ 3.1/myc-His (-) A which were described in example 3(Fig.l5) or pcDNA™ 3.1/myc-His were injected into the intumescentia lumbalis of the spinal cords. Six days later, the rats were perfused with 4% paraformaldehyde via aorta ascendens, the intumescentia lumbalis of the spinal cords and the sciatic nerves were isolated. Frozen sections at 40 μm were prepared from the isolated tissues. Regenerating nerve fibers in the transected and then linked sciatic nerves and the injected COS 7 cells were labeled with antibodies specific to

NF 160 or myc, respectively and visualized by ABC-DAB protocol. The numbers of the regenerative nerve fibers (NF-160-immunoreactive positive) in the linked sciatic nerves at different segments, 4 mm, 6 mm, 8 mm, 10 mm, 12 mm, 14mm and 16mm apart from the linked sites, were determined. Data were expressed as the means ± S.E.M and evaluated by unpaired Student's t test of SAS software.

The result showed that adjacent to the surgical site (within 4 mm away but down stream from the surgical site), substantial numbers of NF- 160 positive nerve fibers were observed in animals treated with either COS 7 cells or cells expressing the SCIRRlO fusion protein. Further down stream from the surgical site, the number of the fibers detected within the nerve started to decrease. The further away from the surgical site, the less nerve fiber was observed. The difference observed between animals treated with different cells is that the number of nerve fibers detected in the animals treated with COS 7 cells decreased much faster when moved along the nerves toward their extremity end than that in the animals treated with cells expressing SCIRRlO fusion protein (p<0.005 or 0.0001 ) . The average numbers (S.E.M) of NF-160 positive fibers detected in different segments of the sciatic nerves (related to the surgical site) in animals treated with COS 7 cells or cells expressing the SCIRRlO fusion protein were shown in Fig.17. At positions 12mm down stream from the surgical site, no NF-160 positive fibers of sciatic nerves in animals treated with COS 7 cells were found. However, at position 16mm down stream from the surgical site, NF-160 positive fibers of sciatic nerves in animals treated with cells expressing the SCIRRlO fusion protein were still observed (Fig.16). The result explained that SCIRRlO in vivo also played an important role in neuronal regeneration.

Reference

Bartholdi D, Schwab ME. Expression of pro-inflammatory cytokine and chemokine mRNA upon experimental spinal cord injury in mouse: an in situ hybridization study. Eur J Neuroscirr. 1997;

9(7): 1422-1438.

Nakamura M, Houghtling RA, MacArthur L, et al. Differences in cytokine gene expression profile between acute and secondary injury in adult rat spinal cord. Exp Neurol. 2003;

184(l):313-325.

Profyris C, Cheema SS, Zang D, et al. Degenerative and regenerative mechanisms governing spinal cord injury. Neurobiol Dis. 2004; 15(3), 415-436.

Seitz A, Aglow E, Heber-Katz E. Recovery from spinal cord injury: a new transection model in the C57B1/6 mouse. J Neuroscirr Res. 2002; 67(3), 337-345.

Beattie MS, Hermann GE., Rogers RC. et al. Cell death in models of spinal cord injury. Prog.

Brain Res. 2002; 137, 37^7.

O'Dowd BF, Lee DK, Huang W, et al. Gershengorn MC & George SR (2000) TRH-R2 exhibits similar binding and acute signaling but distinct regulation and anatomic distribution compared with TRH Rl. Molecular Endocrinology 14 183-193.

Heuer H, Schafer MK, Bauer K ( 1999) Thyrotropin-releasing hormone (TRH), a signal peptide of the central nervous system. Acta Med Austriaca. 26(4): 119-22

Sun Y, Lu X and M C Gershengorn G (2003) protein-coupled receptor signaling in neuroendocrine system, Thyrotropin-releasing hormone receptors-similarities and differences.

Journal of Molecular Endocrinology 30, 87-97.