Assays for allosteric modulators of G-protein coupled receptors (GPCRs) .

The present invention relates to G protein-coupled receptors (GPCRs) and allosteric modulators thereof. More specifically, the invention relates to allosteric modulators of GPCRs that interact at an intracellular binding site, and methods for designing or identifying small molecule allosteric modulators.

BACKGROUND TO THE INVENTION

G protein-coupled receptors (GPCRs) from all species have been characterised based on sequence homologies (Kolakowski, L. F., 1994, Gcrdb-a G-protein-coupled receptor database, Recept. Channels 2, 1-7). These are defined as class A - Rhodopsin-like, Class B - Secretin-like, Class C - metabotropic glutamate/pheromone type receptors, Class D - fungal pheromone receptors, Class E - cAMP receptors (Dictyostelium), and finally the Frizzled/smoothened family members. Further information can be obtained from the G Protein-Coupled Receptor Data Base (http://www.gpcr.org/7tm/htmls/consortium.html).

Class A GPCRs are classed as rhodopsin-like GPCRs. They contain the following family members: Amine receptors (eg Muscarinic acetylcholine, Adrenoceptors, Dopamine receptors, Histamine and Serotonin receptors); Peptide receptors (eg angiotensin receptors,

Chemokine receptors, melanocortin receptors); Hormone protein receptors; Rhodopsin receptors; Olfactory receptors; Prostanoid receptors; Nucleotide like receptors;

Cannabinoid receptors; Platelet activating factor receptor; Gonadotrophin-releasing hormone receptors; Thyrotropin receptors; Melatonin receptors; Viral receptor;

Lysosphingolipid receptors; Leukotriene B4 receptor; Class A orphan GPCRs where no ligand has been identified.

The Chemokine receptors (and their ligands) are discussed in more detail below, as an example of GPCRs (in particular of Class A GPCRs).

Chemokines play an important role in immune and inflammatory responses in various diseases and disorders, including asthma and allergic diseases, as well as autoimmune pathologies such as rheumatoid arthritis and atherosclerosis. These small secreted molecules are a growing superfamily of 8-14 kDa proteins characterised by a conserved 5 cysteine motif. At the present time, the chemokine superfamily comprises three groups exhibiting characteristic structural motifs, the C-X-C, C-C and C-X ₃ -C families. The C-X- C and C-C families have sequence similarity and are distinguished from one another on the basis of a single amino acid insertion between the NH-proximal pair of cysteine residues. The C-X ₃ -C family is distinguished from the other two families on the basis of having a io triple amino acid insertion between the NH-proximal pair of cysteine residues.

The C-X-C chemokines include several potent chemoattractants and activators of neutrophils such as interleukin-8 (CXCL8 or IL-8) or CXCLl (Growth related oncogene- alpha or GROα) and neutrophil-activating peptide 2 (CXCL7 or NAP-2).

I ₅

The C-C chemokines include potent chemoattractants of monocytes and lymphocytes but not neutrophils. Examples include human monocyte chemotactic proteins 1-3 (MCP-I, MCP-2 and MCP-3), RANTES (Regulated on Activation, Normal T Expressed and Secreted), eotaxin and the macrophage inflammatory proteins lα and lβ (MIP- lα and 20 MlP-lβ).

The C-X ₃ -C chemokine (also known as fractalkine) is a potent chemoattractant and activator of microglia in the central nervous system (CNS) as well as of monocytes, T cells, NK cells and mast cells. 5

Studies have demonstrated that the actions of the chemokines are mediated by subfamilies of G protein-coupled receptors (GPCRs), among which are the receptors designated CCRl, CCR2 (including the two splice variants CCR2A and CCR2B), CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCRlO and CCRIl (for the C-C family); CXCRl, CXCR2, 0 CXCR3, CXCR4 and CXCR5 (for the C-X-C family) and CX ₃ CRl for the C-X ₃ -C family. These receptors represent good targets for drug development since agents which modulate

these receptors would be useful in the treatment of disorders and diseases such as those mentioned above.

The C-X-C chemokine IL-8 (CXCL8) is one of the most potent chemoattractants for 5 neutrophils and is produced by many cell types in response to inflammatory stimuli. IL-8 induces angiogenesis, mediates cytokine induced trans-endothelial neutrophil migration and triggers a variety of other effects associated with the inflammatory response. In vivo data indicates that IL-8 induces neutrophil infiltration to the site of inflammation thus causing tissue injury.

10

The effects of IL-8 are mediated through two receptors CXCRl and CXCR2. These receptors display distinct ligand specificities. CXCRl only binds IL-8 with high affinity; however, CXCR2 binds to other chemokines with high affinity such as NAP2 and GROα as well as IL-8.

I ₅

In ^' animal models of disease such as ARDS and acid induced lung injury anti-IL-8 antibodies have proved beneficial in reducing inflammatory tissue damage and improving survival. In light of this strong animal model in vivo data it has been proposed that inhibition of the action of CXC chemokine neutrophil attractants, such as IL-8, GROalpha 0 and NAP2 by inhibiting binding to their respective receptors, could prove to be beneficial in diseases such as rheumatoid arthritis, COPD, severe asthma, oncology, IBD (inflammatory bowel disease) and psoriasis.

A number of compounds have been described in the literature that can bind to GPCRs s including CXCRl and CXCR2 (see, for example, WO2000/035442, WO2001/025242 and

WO2004/052830). In general GPCR-inhibitory compounds are thought to interfere with binding of endogenous ligands at the extracellular receptor domain of the receptor. In vivo, the interaction with GPCR receptors by chemokines is a complex interaction and endogenous ligands are often produced in situ on demand. They might also be subject to 0 rapid and extensive break down, often already at the site of action. Both processes of production and degradation effectively cause transient receptor stimulation. By contrast, a synthetic compound intended to bind to a receptor is often designed to be metabolically

stable and may, therefore, lead to a more continuous stimulation or blockade of the receptor.

Recently, it has been recognized that a more controlled and selective "tuning" action on a receptor may be feasible through allosteric modulation and this is reviewed for example by

Soujin et al. (Drug Discovery Today, 9, 17, Sept 2004, p752-758). "Allosteric" refers to binding sites that are different from the primary substrate or ligand binding sites. Binding of modulators to the allosteric site results in conformational changes which influence receptor function. In such an interaction, the endogenous ligand remains such that the overall pharmacology resembles normal physiology more closely than with the use of synthetic ligands.

However, to date there has been no significant progress in determining the structural features required for allosteric modulation of GPCR activity. Therefore, there remains a need for such information in order to derive models for identifying compounds which can act as allosteric modulators.

STATEMENT OF INVENTION

This present invention relates to the identification of a binding site for small molecular weight compounds on the intracellular side of CXCR2, a G-protein coupled receptor. Compounds binding CXCR2 at this cytoplasmic site are able to allosterically modify the activity of agonists acting at an extracellular site. By alignment and homology modelling, the intracellular binding site is predicted to be present in GPCRs and, in particular, in all class A GPCRs.

The elucidation of this novel binding site facilitates the identification of specific and potent inhibitory small molecule compounds for therapeutic purposes.

Accordingly, the present invention relates to methods for identifying small molecule allosteric modulators of GPCRs.

For example, the present invention relates to assays for a candidate compound capable of allosterically modulating a GPCR, and to methods employing a homology model for the GPCR intracellular site to identify lead compounds.

Aspects of the invention are presented in the accompanying claims and are further described in the following paragraphs.

Any GPCR may be used in an assay or method according to the invention. The term "GPCR" thus includes any GPCR. In particular, the term "GPCR" includes Class A receptors (or rhodopsin-like receptors) as well as Class B and Class C receptors. Class A receptors include adenosine receptors and muscarinic receptors and peptide receptors (such as Chemokine receptors); Class B receptors include corticotropin-releasing factor I receptors and Class C receptors include metabotropic glutamate receptors and calcium- sensing receptors.

In particular, the term "GPCR" includes Chemokine receptors including the receptors designated CCRl (also referred to as CMKBRl, CMKRl, CKR-I, HM145, MIPIaR, SCYARl, CMKR-I), CCR2 (also referred to as CMKBR2, CKR2, CCR2A, CCR2B, CKR2A, CKR2B, MCP-I-R, CC-CKR-2, ccr2), CCR2A, CCR2B, CCR3 (also referred to as CKR3, CMKBR3, CC-CKR-3), CCR4 (also referred to as CKR4, K5-5, CMKBR4, ChemR13, CC-CKR-4, MGC88293, HGCN:14099, c-c ckr-4), CCR5 (also referred to as CMKBR5, CKR5, CD 195, CKR-5, CCCKR5, CC-CKR-5, ccr5), CCR6 (also referred to as BN-I, CKR6, DCR2, CKRL3, DRY-6, GPR29, CKR-L3, CMKBR6, GPRCY4, STRL22, GPR-CY4, CCR6, DRY6), CCR7 (also referred to as CMKBR7, EBIl, BLR2, CDwl97, EVIl, EBI 1), CCR8 (also referred to as CKRLl, CMKBR8, CY6, TERl, CKR- Ll, CMKBRL2, GPR-CY6, ChemRl, CKR8), CCR9 (also referred to as GPR28, GPR-9- 6, CMKBR9), CCRlO (also referred to as GPR2) and CCRI l (for the C-C family); CXCRl (also referred to as IL8RA, CMICARl, CD128, IL8R1, IL8RBA, CDwl28a, C-C CKR-I, C-C-CKR-I), CXCR2 (also referred to as IL8RB, IL8R2, CMKAR2, CDwl28b), CXCR3 (also referred to as GPR9, IPlO, MigR, CD183, Mig-R, CKR-L2, CMKAR3, IPlO-R), CXCR4 (also referred to as FB22, HM89, LAP3, LCRl, NPYR, WHIM, LESTR,

NPY3R, NPYRL, HSY3RR, NPYY3R, D2S201E), CXCR5 (also referred to as BLRl, CXCR5, MDRl 5) and CXCR6 (also referred to as BONZO, STRL33, TYMSTR, Bonzo) (for the C-X-C family) and CX ₃ CRl (also referred to as CX3CR1, GPR13, V28, CCRLl, CMKDRl, GPRV28, CMKBRLl, C3X1) for the C-X ₃ -C family and XCRl (also referred to as GPR5, CCXCRl, CXCl).

Preferred embodiments of any aspect of the invention include each of the following: i. an assay or method wherein the GPCR is a Class A receptor; ii. an assay or method wherein the GPCR is a Chemokine receptor iii. an assay or method wherein the GPCR is selected from the group consisting of CCRl, CCR2, CCR2A, CCR2B, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCRlO, CCRl 1, CXCRl, CXCR2, CXCR3, CXCR4, CXCR5 and CX ₃ CRl; iv. an assay or method wherein the GPCR is selected from the group consisting of

CCRl, CCR2, CX ₃ CRl, CCR4, CCR5 and CCR7 and a C-X-C family receptor; v. an assay or method wherein the GPCR is a C-X-C family receptor; vi. an assay or method wherein the GPCR is selected from the group consisting of

CXCRl and CXCR2; vii. an assay or method wherein the GPCR is CXCR2.

In a particularly preferred embodiment, the GPCR referred to in any aspect of the present invention is a Chemokine receptor and, preferably is selected from CCRl, CCR2, CX ₃ CRl, CCR4, CCR5, CCR7 and a C-X-C family receptor. Most preferably, the C-X-C family receptor is the CXCR2 receptor.

DETAILED DESCRIPTION

IDENTIFICATION OF THE INTRACELLULAR BINDING SITE AND GENERATION OF THE CXCR2 HOMOLOGY STRUCTURE

Two approaches have been utilised in obtaining structural information and to generate models for an allosteric intracellular binding site for GPCRs. These include (1) an analysis of structures derived from sequence homology with CXCR2 and bovine rhodopsin and (2) domain swap experiments, where the residues differing in the intracellular region of CXCR2 have been replaced with the corresponding residues of the CXCRl intracellular region as well as site-directed mutagenesis studies.

With reference to CXCR2, based on alignments with bovine rhodopsin, the intracellular region comprises four intracellular domains: domain 1 residues S67 to D94, domain 2 residues G133 to S173, domain 3 residues 1221 to F260 and domain 4 amino acids S307 to L360 (Figure IA). Because CXCR2 is a GPCR which has seven transmembrane spanning helices it has four regions which can be defined as intracellular. This can be seen schematically in Figure IB and 1C.

The present invention employs domain swap experiments and site-directed mutagenesis methods in conjunction with the homology modelling approach to identify amino acids within the intracellular region of GPCRs. Based on analysis of the sequence and residues in the intracellular region, it was possible to determine the specific residues involved in an allosteric intracellular binding site and to identify the interactions that could be exploited in the design of compounds which specifically bind the intracellular binding site for each GPCR and inhibit signalling from each receptor.

The residues involved in compound binding in a variety of CXCR and CCR molecules are compared in Figure 18, 19 and 20. As can be seen, one key amino acid is residue

Lysine320 (K320) of CXCR2. This residue is in the last intracellular domain in the C- terminal portion. Lysine320 (K320) is involved in mediating binding of CXCR2 inhibitors

from different series of small molecule antagonists. Compounds that interact with this binding site inhibit the binding of IL-8 to CXCR2 via an allosteric mechanism.

Other important amino acids are found in the other intracellular loops or the intracellular part of helices 2, 3, 6, 7 and 8. Such other residues include:

On the intracellular part of helix 2 residues S81, V82, T83, D84, Y86, L87, L90

On the intracellular part of helix 3 residues G133, L136, L137, 1140, D143, R144, A147 (particularly residues G133, L136, 1140, D143, R144, A147)

On intracellular loop 2 residue Q 157

On intracellular loop 3 residues Q245, K246

On the intracellular part of helix 6 residues A249, V252, 1253, V256, 1259

On the intracellular part of helix 7 residues L309, N310, P311, 1313, Y314, 1317, G318,

On helix 8 residues Q319, K320, F321

An alignment of CXCR2 with other receptors (Figure 19, and Figures 18 and 20) shows that corresponding residues, including those corresponding to K320 of CXCR2, are present in the other Chemokine receptors (for example CCR2b, CX ₃ CRl, CCR4, CCR5 and CCR7).

The intracellular allosteric compound-binding site may enable compounds of a similar series to have significant activity at more than one Chemokine receptor. Furthermore, this intracellular allosteric binding site may be critical for inhibition of GPCRs including Class A GPCRs by small molecule compounds for the treatment of human diseases such as inflammatory disorders, in particular, rheumatoid arthritis, COPD, severe asthma, oncology, IBD (inflammatory bowel disease) and psoriasis.

ASSAYS FOR INTRACELLULAR ALLOSTERIC MODULATORS

In a first aspect, the invention relates to an assay for a candidate compound capable of allosterically modulating a GPCR, said assay comprising the steps of: a) contacting said candidate compound with a GPCR or a mutant, variant, homologue, derivative or fragment thereof; and b) detecting whether said candidate compound forms associations with one or more amino acid residues corresponding to any one of amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, R144, A147, Q157, Q245, K246,

A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 or to any one of amino acid residues 301 to 360 of CXCR2.

In a preferred aspect, the invention relates to an assay for a candidate compound capable of allosterically modulating a GPCR, said assay comprising the steps of: a) contacting said candidate compound with a GPCR or a mutant, variant, homologue, derivative or fragment thereof; and b) detecting whether said candidate compound forms associations with one or more amino acid residues corresponding to any one of amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, 1140, D143, R144, A147, Q157, Q245, K246, A249,

V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 or to any one of amino acid residues 301 to 360 of CXCR2.

In another preferred aspect, the invention relates to an assay for a candidate compound capable of allosterically modulating a GPCR, said assay comprising the steps of:

(a) contacting said candidate compound with a GPCR or a mutant, variant, homologue, derivative or fragment thereof; and

(b) detecting whether said candidate compound forms associations with one or more amino acid residues corresponding to any one of amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, R144, A147, Q157, Q245,

K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 or to any one of amino acid residues 304 to 326 of CXCR2.

In a particularly preferred aspect, the invention relates to an assay for a candidate compound capable of allosterically modulating a GPCR, said assay comprising the steps of: (a) contacting said candidate compound with a GPCR or a mutant, variant, homologue, derivative or fragment thereof; and

(b) detecting whether said candidate compound forms associations with one or more amino acid residues corresponding to any one of amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 or to any one of amino acid residues 304 to 326 of CXCR2.

In a preferred embodiment, the GPCR in step a) is a fragment comprising amino acid residues corresponding to all or part of residues 304 to 326 and, preferably, residues 301 to 360 of CXCR2. Suitably said fragment may be linked to a molecule to facilitate expression and structural conformation or for detection of a binding reaction. For example, the fragment may be linked to form a GST-fusion protein. Other suitable detection molecules will be familiar to those skilled in the art.

Thus preferred embodiments of the first aspect of the invention include each of the following: i. an assay wherein the GPCR in step a) is a polypeptide comprising amino acid residues corresponding to all or part of residues 301 to 360 of CXCR2; ii. an assay wherein the GPCR in step a) is a polypeptide comprising amino acid residues corresponding to residues 301 to 360 of CXCR2; iii. an assay wherein the GPCR in step a) is a polypeptide comprising amino acid residues corresponding to all or part of residues 304 to 326 of CXCR2; iv. an assay wherein the GPCR in step a) is a polypeptide comprising amino acid residues corresponding to residues 304 to 326 of CXCR2.

In a preferred embodiment, step b) comprises detecting whether said candidate compound forms associations with amino acids selected from those corresponding to amino acids

S81, V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, Rl 44, A147, Q 157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321of CXCR2 and, in particular, K320 of CXCR2.

In a particularly preferred embodiment, step b) comprises detecting whether said candidate compound forms associations with amino acids selected from those corresponding to amino acids S81, V82, T83, D84, Y86, L87, L90, G133, L136, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321of CXCR2 and, in particular, K320 of CXCR2.

In other particularly preferred embodiments, step b) comprises detecting whether the candidate compound forms associations with one or more amino acid residues corresponding to any one of amino acid residues 301 to 360 of CXCR2 (and most particularly with one or more amino acid residues corresponding to any one of amino acid residues 304 to 326 of CXCR2).

"Amino acid residues corresponding to residues of CXCR2" may be determined by performing alignments of sequences from other GPCRs and, in particular, other Chemokine receptors. Methods for performing such alignments are described herein and are known in the art. For example, an alignment of sequences from Class A GPCRs is available at http://www.qpcr.orq/7tm/seq/001/001.html (GPCRDB, the G Protein-Coupled Receptor Data Base).

Suitably, "amino acid residues corresponding to residues of CXCR2" are defined by alignment with bovine rhodopsin as shown in Figure 19.

For example, the amino acid residues corresponding to amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 of CXCR2 or to amino acid residues 301 to 360 of CXCR2 are listed below for specified GPCRs:

Bovine rhodopsin: T70, P71, L72, N73, 175, L76, L79, A124, S127, L128, L131, E134, R135 V138, F148, A246, E247, V250, M253, V254, M257, A260, Y301, N302, P303, 1305, Y306, M309, N310, K311, Q312, F313 or amino acid residues 293 to 348.

CKRl: N67, M68, T69, S70, Y72, L73, L76, E120, F123, 1124, L127, D130, R131, A134, A144, K233, K234, A237, L240, 1241, 1244, 1247, V296, N297, P298, 1300, Y301, V304, G305, E306, R307, F308 or amino acid residues 288 to 355.

CKR2: C75, L76, T77,D78, Y80, L81, L84, G127, F130, 1131, L134, D137, R138, A141, A151, K237, R238, A241, V244, 1245, 1248, V251, 1300, N301, P302, 1304, Y305, V308, G309, E310, K311, F312 or amino acid residues 292 to 374.

CKR3: 167, M68, T69, N70, Y72, L73, L76, E120, F123, 1124, L127, D130, R131, A134, A144, K233, K234, A237, L240, 1241, 1244, V247, M296, N297, P298, 1300, Y301, V304, G305, E306, R307, F308 or amino acid residues 288 to 355.

CKR4: S72, M73, T74, D75, Y77, L78, L81, G124, F127, V128, M131, D134, R135, A138, A148, K236, K237, A240, M243, 1244, V247, L250, L299, N300, P301, 1303, Y304, L307, G308, E309, K310, F311 or amino acid residues 291 to 360.

CKR5: S63, M64, T65, D66, Y68, L69, L72, Gl 15, Fl 18, Il 19, L122, D125, R126, A129, A139, K229, R230, A233, L236, 1237, 1240, V243, 1292, N293, P294, 1296, Y297, V300, G301, E302, K303, F304 or amino acid residues 284 to 352.

CCR6: S79, M80, T81, D82, Y84, L85, M88, G132, L135, L136, 1139, D142, R143, Al 46, L 156, K248, R249, A252, V255, 1256, V259, V262, L311, N312, P313, L315, Y316, 1319, G320, Q321, K322, F323 or amino acid residues 303 to 374.

CCR7: T91. M92, T93, D94, Y96, L97, LlOO, G143, L146, L147, 1150, D153, R154, A157, H167, E257, R258, A261, V264, 1265, V268, V271, V321, N322, P323, L325, Y326, 1329, G330, V331, K332, F333 or amino acid residues 313 to 378.

CKR8: S68, 169, T70, D71, Y73, L74, L77, S120, F123, 1124, M127, D130, R131, A134, V144, N232, K233, A236, L239, V240, V243, A246, V295, N296, P297, 1299, Y300, V303, G304, E305, K306, F307 or amino acid residues 287 to 355.

CCR9: T69, M70, T71, D72, F74, L75, L78, C121, L124, 1125, 1128, D131, R132, A135, W145, S236, K237, A240, V243, T244, V247, V250, L300, N301, P302, L304, Y305, V308, G309, E310, R311, F312 or amino acid residues 292 to 357.

CCRlO: S75, P76, T77, S78, H80, L81, L84, G127, F130, L131, 1134, D137, R138, A141, R151, E231, R232, A235, V238, V239, L242, A245, L305, N306, P307, L309, Y310, L313, G314, L315, R316, F317 or amino acid residues 297 to 362.

CXCRl : S72, V73, T74, D75, Y77, L78, L81, G124, L127, L128, 1131, D134, R135, A138, Q148, Q236, K237, A240, V243, 1244, V247, 1250, L300, N301, P302, 1304, Y305, 1308, G309, Q310, N311, F312 or amino acid residues 292 to 350.

CXCR3: S86, S87, T88, D89, F91, L92, L95, G138, L141, L142, 1145, D148, R149, N152, R162, R249, R250, A253, L256, V257, V260, A263, L313, N314, P315, L317, Y318, V321, G322, V323, K324, F325, or amino acid residues 305 to 368.

CXCR4: S71, M72, T73, D74, Y76, R77, L80, S123, 1126, L127, 1130, D133, R134, A137, P147, Q233, K234, A237, T240, T241, L244, A247, L297, N298, P299, L301, Y302, L305, G306, A307, K308, F309 or amino acid residues 289 to 352.

CXCR5: S84, S85, T86, E87, F89, L90, L93, S136, L139, L140, 1143, D146, R147, A150, H160, Q253, R254, A257, V260, A261, V264, 1267, L317, N318, P319, L321, Y322, A325, G326, V327, K328, F329 or amino acid residues 309 to 372.

CXCR6: S64, L65, T66, D67, F69, L70, L73, Sl 16, Il 19, L120, 1123, D126, R127, V130, Q140, Q225, K226, S229, 1232, 1233, V236, V239, L283, N284, P285, L287, Y288, V291, S292, L293, K294, F295 and residues 275 to 342.

CX.CR1: S64, V65, T66, D67, Y69, L70, L73, Sl 16, Fl 19, 1120, 1123, D126, R127, A130, N140, K225, K226, A229, L232, 1233, V236, V239, L288, N289, P290, 1292, Y293, A296, G297, E298, K299, F300 or amino acid residues 280 to 355.

XCRl: S64, L65, T66, N67, F69, 170, L73, Sl 16, Fl 19, L120, M123, H126, R127, S130, V140, R219, R220, T223, L226, 1227, 1230, A233, F282, N283, P284, L286, Y287, V290, G291, V292, K293, F294, or amino acid residues 274 to 333.

In an assay according to the first aspect of the invention, detecting whether the candidate compound forms associations with one or more particular amino acid residues may be achieved by suitable methods known in the art. Such methods include, for example: disulfide trapping (for example, as described by Buck E and Wells JA, 2005, PNAS USA 102(8) :2719-24; or in Example 10); or photoaffmity labelling with proteomic characterisation (for example, as described by Murray et al, Nature Chemical Biology 2005, 1:371; or in Example 11 which describes a possible photoaffmity labelling assay involving cells expressing a whole GPCR).

In an assay according to the first aspect of the invention wherein the GPCR in step a) is a GPCR fragment consisting of a polypeptide comprising amino acid residues corresponding to all or part of residues 301 to 360 of CXCR2 (such as a polypeptide comprising amino acid residues corresponding to all or part of residues 304 to 326 of CXCR2), detection of any association between the fragment and the candidate compound can be achieved by a competitive binding assay. The methods of producing such an assay system with a

polypeptide and probe compound which are suitable for testing in such an assay are well known to those skilled in the art. To form an assay, generally both the polypeptide and probe compound assay components would be tagged or labelled in such a way to enable the detection of binding of one assay component to the other. Such methods may include systems such as SPA, FRET, etc. The ability of unlabelled candidate compounds to inhibit the interaction between polypeptide and probe can then be measured.

A second aspect of the invention relates to a competitive binding assay for a Candidate Compound X capable of allosterically modulating a GPCR which comprises the steps of : i) providing a GPCR polypeptide comprising amino acid residues corresponding to all or part of residues 301 to 360 of CXCR2; ii) contacting said polypeptide with a binding agent; iii) contacting said polypeptide with a Candidate Compound X; and iv) detecting displacement of the binding agent as an indication of the Candidate Compound X being capable of modulating said GPCR.

Preferred embodiments of the second aspect of the invention include each of the following: i. a competitive binding assay wherein the polypeptide comprises residues corresponding to residues 301 to 360 of CXCR2; ii. a competitive binding assay wherein the polypeptide comprises residues corresponding to residues 304 to 326 of CXCR2; iii. a competitive binding assay wherein the polypeptide comprises residues corresponding to residues 318 to 360 of CXCR2; iv. a competitive binding assay wherein the binding agent is a Candidate Compound Y identified by an assay according to the first aspect of the invention, or a pharmaceutically acceptable salt thereof; v. a competitive binding assay wherein the binding agent is selected from the group consisting of Compound A or a pharmaceutically acceptable salt thereof, Compound B or a pharmaceutically acceptable salt thereof, Compound C or a pharmaceutically acceptable salt thereof, and Compound F or a pharmaceutically acceptable salt thereof, wherein Compounds A, B, C and F are as defined herein (we have shown mat Compounds A, B, C and F bind at an intracellular allosteric site);

vi. a competitive binding assay wherein the binding agent is selected from the group consisting of Compound A or a pharmaceutically acceptable salt thereof, Compound B or a pharmaceutically acceptable salt thereof, and Compound C or a pharmaceutically acceptable salt thereof, wherein Compounds A, B and C are as defined herein; vii. a competitive binding assay wherein the binding agent is Compound C or a pharmaceutically acceptable salt thereof, wherein Compound C is as defined herein.

The polypeptide may be provided in any suitable way, as known in the art. Non-limiting examples are given below.

The polypeptide may be provided as an isolated or purified polypeptide in a suitable format for contacting with the binding agent and Candidate Compound X (for example: in a suitable solution; in a suitable plate; on a resin support; etc).

The polypeptide may be provided as an isolated or purified fusion protein, wherein the polypeptide is fused to a suitable carrier protein (for example, GST). The fusion protein is provided in a suitable format for contacting with the binding agent and Candidate Compound X (for example: in a suitable solution; in a suitable plate; on a resin support; etc). Suitably, a fusion protein (such as a GST-fusion protein) includes a polypeptide comprising residues corresponding to residues 301 to 360 of CXCR2, or to residues 304 to 326 of CXCR2, or to residues 318 to 360 of CXCR2. An example of a GST-fusion protein is described in Example 12 (GST fused to the last 43 amino acid residues of human CXCR2, that is residues G318 to L360).

The polypeptide (including a polypeptide provided as a fusion protein) may be expressed in a cell or cell membrane system. This involves providing a cell or cell membrane that is capable of expressing the polypeptide, contacting said cell or cell membrane with the binding agent, and incubating said cell or cell membrane with the Candidate Compound X. In a particular embodiment, the polypeptide (including a polypeptide provided as a fusion protein) may be fused to a target peptide, expressed in a cell and targeted to the cell membrane.

A preferred embodiment of the second aspect of the invention relates to the use of a compound selected from the compound series exemplified by Compounds A, B or C, as described herein, or a pharmaceutically acceptable salt thereof, in an assay for identifying candidate compounds capable of selectively modulating a GPCR. Suitably said selective modulation is through binding at an intracellular allosteric site as identified herein. Preferably, the competitive binding assay comprises the steps of : i) providing a cell or cell membrane that is capable of expressing a GPCR polypeptide comprising amino acid residues corresponding to all or part of residues 301 to 360 of

CXCR2; ii) contacting said cell or cell membrane with Compound C; iii) incubating said cell or cell membrane with a Candidate Compound X; and iv) detecting displacement of Compound C as an indication of a Candidate Compound X being capable of selectively modulating said GPCR.

Suitably said Compound C is detectably labelled and, preferably, radiolabeled (for example with tritium or ¹⁴ C).

In a preferred embodiment of the first or second aspects of the invention, the assay is a membrane assay. Suitable membrane assays are described herein.

In an alternative embodiment of any aspect of the invention, the assay is a whole cell assay. Suitable whole cell assays are described herein.

Advantageously, the compound binds to an intracellular binding site. By definition if a compound binds to an intracellular binding site of a GPCR it can not be competing at the same site with the endogenous ligand. This could be an advantage in that the degree of inhibition observed with the compound may not be influenced by the quantity of endogenous ligand on the extracellular surface.

Furthermore, CXCR2 and some other Chemokine receptors are "promiscuous" that is they have more than one ligand. In the case of CXCR2, for example, the ligands include IL8, NAP2 and GROalpha. Each ligand has a slightly different binding site on the extracellular

part of the receptor. By binding to a single intracellular allosteric site the compound is able to prevent the signalling by all ligands on that receptor.

As can be seen in the alignment with other GPCRs (Figure 19), the residues in the intracellular binding pocket tend to be more conserved than the residues on extracellular portions of the receptor which are involved in direct ligand binding. This could give the advantage that a small molecule inhibitor binding at a conserved intracellular site would be able to inhibit more than one Chemokine receptor such as one of CXCRl, CCRl, CCR2, CCR4, CCR5, CX ₃ CRl, CCR7 as well as CXCR2. Advantageously, binding to an intracellular site gives an alternative binding site to target in all GPCRs where targeting the retinal binding pocket has proved unsuccessful, for example where there is either lack of active chemical hits or where active compounds have unwanted activities against other proteins.

METHODS EMPLOYING A HOMOLOGY MODEL FOR THE GPCR INTRACELLULAR SITE

As used herein, the term "model" refers to a structural model such as a three dimensional (3D) structural model (or representation thereof) comprising a GPCR such as CXCR2. Preferably, the model comprising a GPCR such as CXCR2 is built from the co-ordinates of the bovine rhodopsin crystal structure. An example of the model for CXCR2 thus generated has the structure co-ordinates presented in Table 3. The homology model of the invention enables candidate compounds to be identified that bind spatially and preferentially to a GPCR such as CXCR2, particularly to the intracellular binding site of a GPCR such as CXCR2.

As described herein, a homology model of a GPCR can be derived from comparison and modelling the crystal structure of a related GPCR such as rhodopsin. It will be recognised by those skilled in the art that a number of suitable homology models may be generated from any suitable starting structure. The present application describes one such homology model although the present invention also applies to other models sharing the same common defining features. Thus, as used herein, the term "model" is not limited to the

structural model having the structure co-ordinates presented in Table 3. The homology model to be used in methods of the invention may be any suitable structural model comprising a GPCR. The skilled person will be able to generate a range of suitable structural models.

Accordingly, in a third aspect of the invention, there is provided a method of screening for an allosteric modulator of a GPCR, wherein the method comprises using a structure having co-ordinates corresponding to those set out in Table 3 or to those co-ordinates of a similar model derived in a similar way.

Preferably said method comprises using the structure co-ordinates of Table 3.

Suitably, said method comprises the steps of:

(a) providing at least a portion of the structure co-ordinates of Table 3; (b) employing at least a portion of the structure co-ordinates of Table 3 to design or select or synthesise a putative allosteric modulator of a GPCR;

(c) contacting the putative allosteric modulator of a GPCR with a GPCR or a mutant, variant, homologue, derivative or fragment thereof; and

(d) determining whether said putative allosteric modulator of a GPCR modulates said GPCR.

In a preferred embodiment, at least a portion of the structure co-ordinates of Table 3 and/or the putative allosteric modulator of a GPCR and/or the substrate are provided on a machine-readable data storage medium comprising a data storage material encoded with machine readable data.

In another embodiment, the putative allosteric modulator of a GPCR is from a library of compounds. Preferably, the library is an in silico library. Suitable in silico libraries will be familiar to those skilled in the art, and include the Available Chemical Directory (MDL Inc), the Derwent World Drug Index (WDI), BioByteMasterFile, the National Cancer Institute database (NCI), and the Maybridge catalogue.

In another embodiment, the putative allosteric modulator of a GPCR is selected from a database, designed de novo or designed from a known GPCR modulator.

Suitably, the design or selection of the putative allosteric modulator of a GPCR is performed in conjunction with computer modelling.

In a preferred embodiment, the allosteric modulator of a GPCR inhibits GPCR activity.

Methods for monitoring GPCR activity will be familiar to those skilled in the art. "GPCR activity" includes GPCR signalling. In particular, and with reference to CXCR2, methods for determining activity include measuring cell calcium flux. Furthermore, the allosteric modulation of a GPCR can be determined by measuring the binding of the receptor ligand in the presence or absence of the candidate compound. In particular, the ability of a compound to allosterically modulate CXCR2 can be detected by measuring the binding of a CXCR2 ligand in the presence or absence of the candidate compound. Suitable CXCR2 ligands include IL- 8.

Suitably, the method in accordance with any embodiment of the third aspect of the invention provides an allosteric modulator of a GPCR which is useful in the prevention and/or treatment of a GPCR-related disorder, condition or disease in human and non- human animals.

In a preferred embodiment, where the GPCR is a Chemokine receptor the GPCR related disorder is an inflammatory disorder such as rheumatoid arthritis, COPD, severe asthma, oncology, IBD (inflammatory bowel disease) or psoriasis.

Another aspect of the invention relates to a computer for producing a three-dimensional representation of a GPCR wherein said computer comprises: a) a computer-readable data storage medium comprising a data storage material encoded with computer-readable data, wherein said data comprises the structure co-ordinates of

Table 3 or to those co-ordinates of a similar model derived in a similar way; b) a working memory for storing instructions for processing said computer-readable data;

c) a central-processing unit coupled to said working memory and to said computer- readable data storage medium for processing said computer-machine readable data into said three-dimensional representation; and d) a display coupled to said central-processing unit for displaying said three-dimensional representation.

Another aspect of the invention relates to a machine-readable data storage medium comprising a data storage material encoded with machine-readable data, wherein the data is defined by at least a portion of the structure co-ordinates of Table 3 or to those co- ordinates of a similar model derived in a similar way.

A further aspect of the invention relates to the use of the above-described computer or machine-readable data storage medium to predict the structure and/or function of potential allosteric modulators of a GPCR.

Another aspect relates to the use of at least a portion of the structure co-ordinates of Table 3 or a similar GPCR-specifϊc model based on the structure of bovine rhodopsin or any other suitable starting point to screen for allosteric modulators of a GPCR. Suitably, in a preferred embodiment of any aspect of the invention, said portion corresponds to the amino acids which define the intracellular region of said GPCR. With reference to CXCR2, based on alignments with bovine rhodopsin, the intracellular region suitably comprises four intracellular domains; domain 1 residues S67 to D94, domain 2 residues G133 to S173, domain 3 residues 1221 to F260 and domain 4 amino acids S307 to L360 (Figure IA).

In particular, the portion employed to design or select a putative allosteric modulator corresponds to the amino acids which define the intracellular region of the GPCR.

According to the third aspect of the invention, there is provided a method of designing or screening for an intracellular allosteric modulator of a GPCR comprising the steps of: a) providing at least a portion of the structure co-ordinates of the GPCR corresponding to those set out in Table 3;

b) employing at least a portion of the structure co-ordinates corresponding to those set out in Table 3 to design or select a putative allosteric modulator of the GPCR, wherein the portion employed corresponds to the amino acids which define the intracellular region of the GPCR; c) obtaining or synthesising the putative allosteric modulator of the GPCR; d) contacting the putative allosteric modulator of the GPCR with the GPCR or a mutant, variant, homologue, derivative or fragment thereof; and e) determining whether said putative allosteric modulator of the GPCR modulates said GPCR.

Preferably, the putative allosteric modulator interacts with any one or more amino acid residues corresponding to any one of amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 or to any one of amino acid residues 301 to 360 of CXCR2.

More preferably, the putative allosteric modulator interacts with any one or more amino acid residues corresponding to any one of amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 or to any one of amino acid residues 301 to 360 of CXCR2.

As a preferred embodiment, the putative allosteric modulator interacts with any one or more amino acid residues corresponding to any one of amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, or F321 of CXCR2, and most preferably with an amino acid residue corresponding to K320 of CXCR2.

As another preferred embodiment, the putative allosteric modulator interacts with any one or more amino acid residues corresponding to any one of amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, 1140, D143, R144, A147, Q157, Q245, K246,

A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, or F321 of CXCR2, and most preferably with an amino acid residue corresponding to K320 of CXCR2.

As another preferred embodiment, the putative allosteric modulator interacts with any one or more amino acid residues corresponding to any one of amino acid residues 301 to 360 of CXCR2, more preferably with any one or more amino acid residues corresponding to any one of amino acid residues 304 to 326 of CXCR2, and most preferably with an amino acid residue corresponding to K320 of CXCR2.

A further aspect relates to the use of at least a portion of the structure co-ordinates of Table 3 to solve the structure of the crystalline form of any other protein with significant amino acid sequence homology to an intracellular allosteric domain of a GPCR.

Preferably, the structure of the crystalline form of any other protein with significant amino acid sequence homology to an intracellular allosteric domain of a GPCR is solved using molecular replacement.

Yet another aspect of the invention relates to the use of at least a portion of the structure co-ordinates of Table 3 in molecular design techniques to design, select and synthesise modulators of a GPCR which bind to an intracellular allosteric domain.

Another aspect of the invention relates to the use of at least a portion of the structure coordinates of Table 3 to screen small molecule databases for chemical entities or compounds that modulate a GPCR.

Preferably, the modulator of a GPCR, chemical entity, substrate or compound selectively inhibits a GPCR.

GPCR MODULATORS

A further aspect of the invention relates to a GPCR modulator identified by the above- described methods, or a candidate compound identified by the above-described assays.

Preferably, the GPCR modulator or candidate compound of the invention inhibits GPCR activity.

More preferably, the GPCR modulator or candidate compound of the invention selectively inhibits a GPCR through an allosteric interaction in the intracellular domain of said GPCR. In particular, the GPCR modulator specifically binds the intracellular binding site identified herein and thus inhibits signalling from the receptor.

hi another preferred embodiment, the GPCR modulator or candidate compound of the invention comprises a functional group capable of forming an interaction such as a charged electrostatic interaction or hydrogen bond with the amino acid residue corresponding to K320 ofCXCR2.

hi one preferred embodiment, the GPCR modulator or candidate compound of the invention is capable of forming associations with one or more amino acid residues corresponding to: on the intracellular part of helix 2 residues S81, V82, T83, D84, Y86, L87, L90; on the intracellular part of helix 3 residues G133, L136, L137, 1140, D143, R144, A147 (particularly residues G133, L136, 1140, D143, R144, A147); on Intracellular loop 2 residue Q 157; on Intracellular loop 3 residues Q245, K246; on the intracellular part of helix 6 residues A249, V252, 1253, V256, 1259; on the intracellular part of helix 7 residues L309, N310, P311, 1313, Y314, 1317, G318, or on helix 8 residues Q319, K320, F321 of CXCR2 or the equivalent residues in all Chemokine receptors or Class A GPCRs, as determined by their alignment with the bovine rhodopsin structure (see Figure 19).

In a preferred embodiment, said GPCR modulator is capable of forming associations with one or more amino acid residues corresponding to amino acids 304 to 326 of CXCR2.

In another preferred embodiment, said GPCR modulator is capable of forming associations with one or more amino acid residues corresponding to amino acids 301 to 360 of CXCR2.

Suitably said GPCR modulator is capable of sterically interacting with said residues to induce an allosteric modulation of said GPCR.

In a preferred embodiment, the GPCR modulator or candidate compound of the invention is an allosteric modulator.

The present invention permits the use of molecular design techniques to design, select and synthesise chemical entities and compounds, including GPCR modulating compounds, capable of binding to an intracellular binding site of a GPCR, in whole or in part.

Suitably, molecular design can exploit the sequence and structural information of the active site by fragment based screening. The sequence information in conjunction with structural knowledge can be used either manually or computationally (using docking programs such as LUDI, GLIDE, DOCK, GOLD or FRED) to suggest small molecular weight fragments for NMR or high concentration screening. The same approach can also be used for reagent selection by a reagent-based or product-based approach for library synthesis and screening.

Other suitable approaches include Charlie (Tripos), which may be used to connect fragments together. De Novo approaches may include Sprout (Peter Johnston, Sheffield) or Rachel (Tripos).

Small molecule databases or candidate compounds may be screened for chemical entities or compounds that can bind in whole, or in part, to an intracellular binding site of a GPCR. Thus, in a preferred embodiment, the putative GPCR modulator is from a library of compounds or a database. In this screening, the quality of fit of such entities or compounds to the binding site may be judged by various methods - such as shape complementarity or estimated interaction energy (Meng, E. C. et al, J. Comp. Chem., 13, pp. 505-524 (1992)).

The structure co-ordinates of Table 3, or portions thereof, may also be useful in solving the structure of crystal forms of the intracellular binding site of homologous GPCRs. They

may also be used to solve the structure of GPCR mutants, GPCR variants, GPCR homologues, GPCR derivatives, GPCR fragments and GPCR complexes. Suitable GPCR homologues are described herein and include, in particular, the Chemokine receptors, for example, molecular replacement may be used.

In a preferred embodiment of the present invention, the GPCR crystal of unknown structure further comprises an entity bound to the GPCR protein or a portion thereof, for example, an entity that is an allosteric inhibitor of the GPCR.

The crystal structures of such complexes may be solved by molecular replacement or in combination with MAD (Multiwavelength Anomalous Dispersion) and/or MIRAS (Multiple Isomorphous Replacement with Anomalous Scattering) procedures - and compared with that of the wild-type GPCR. Potential sites for modification within the intracellular binding site of the enzyme may thus be identified. This information provides an additional tool for determining the most efficient binding interactions, for example, increased hydrophobic interactions, between a GPCR and a chemical entity or compound.

The structures and complexes of the GPCR may be refined using computer software - such as X-PLOR (Meth. Enzymol., vol. 114 & 115, H. W. Wyckoff et al., eds., Academic Press (1985)), MLPHARE (Collaborative computational project Number 4. The CCP4 Suite: Programs for Protein Crystallography (1994) Acta Crystallogr. D 50, 760-763) and SHARP [De La Fortelle, E. & Bricogne, G. Maximum-likelihood heavy-atom parameters refinement in the MIR and MAD methods (1997) Methods Enzymol. 276, 472-494). Preferably, the complexes are refined using the program CNS (Briinger et al. (1998) Acta Crystallogr. D 54, 905-921). During the final stages of refinement water molecules, ions and inhibitor molecules may be inserted in the structure. This information may thus be used to optimise known classes of GPCR modulators, e.g. GPCR inhibitors, and more importantly, to design and synthesise novel classes of GPCR allosteric modulators.

The overall figure of merit may be improved by iterative solvent flattening, phase combination and phase extension with the program SOLOMON [Abrahams, J. P. & Leslie,

A. G. W. Methods used in structure determination of bovine mitochondrial Fl ATPase. (1996) Acta Crystallogr. D 52, 110-119].

The structure co-ordinates of the homology model of the present invention may also facilitate the identification of related proteins or enzymes analogous to GPCR in function, structure or both, thereby further leading to novel therapeutic modes for treating or preventing GPCR related diseases.

The design of compounds that bind to or modulate a GPCR according to the present invention generally involves consideration of two factors. Firstly, the compound must be capable of physically and structurally associating with a GPCR. Non-covalent molecular interactions important in the association of a GPCR with its substrate may include electrostatic interactions, hydrogen bonding, van der Waals and hydrophobic interactions.

Secondly, the compound must be able to assume a conformation that allows it to associate with a GPCR. Although certain portions of the compound may not directly participate in the association with a GPCR, those portions may still influence the overall conformation of the molecule. This may have a significant impact on potency. Such conformational requirements include the overall three-dimensional structure and orientation of the chemical entity or compound in relation to all or a portion of a binding site of a GPCR, or the spacing between functional groups of a compound comprising several chemical entities that directly interact with a GPCR.

The potential modulating or binding effect of a chemical compound on a GPCR may be analysed prior to its actual synthesis and testing by the use of computer modelling techniques. If the theoretical structure of the given compound suggests insufficient interaction and association with a GPCR ₅ then synthesis and testing of the compound may be obviated. However, if computer modelling indicates a strong interaction, the molecule may be synthesised and tested for its ability to bind to a GPCR and modulate (eg. inhibit) using the fluorescent substrate assay of Thornberry et al. (2000) Methods Enzymol. 322, pp 100-110. In this manner, synthesis of inactive compounds may be avoided.

A modulating or other binding compound of a GPCR may be computationally evaluated and designed by means of a series of steps in which chemical entities or candidate compounds are screened and selected for their ability to associate with a GPCR.

A person skilled in the art may use one of several methods to screen chemical entities or candidate compounds for their ability to associate with a GPCR and more particularly with the intracellular binding sites of a GPCR. This process may begin by visual inspection of, for example, the active site on the computer screen based on the GPCR co-ordinates of the present invention. Selected chemical entities or candidate compounds may then be positioned in a variety of orientations, or docked, with the GPCR. Docking may be accomplished using software such as Quanta and Sybyl, followed by energy minimisation and molecular dynamics with standard molecular mechanics force fields - such as CHARMM and AMBER. Other suitable docking programs include GOLD, DOCK, GLIDE and FRED.

Specialised computer programs may also assist in the process of selecting chemical entities or candidate compounds. These include but are not limited to MCSS (Miranker and Karplus (1991) Proteins: Structure, Function and Genetics, 11, pp. 29-34); GRID (Goodford (1985) J. Med. Chem., 28, pp. 849-857) and AUTODOCK (Goodsell and Olsen (1990), Proteins: Structure. Function, and Genetics, 8, pp. 195-202.

Once suitable chemical entities or candidate compounds have been selected, they may be assembled into a single compound, such as a GPCR modulator. Assembly may proceed by visual inspection of the relationship of the chemical entities or candidate compounds in relation to the structure co-ordinates of a GPCR. This may be followed by manual model building using software - such as Quanta, Sybyl, O, HOOK or CAVEAT [Jones, T. A., Zou, J. Y., Cowan, S. W. & Kjeldgaard, M. Improved methods for building protein models in electron density maps and the location of errors in these models (1991) Acta Crystallogr. A 47, 110-119].

Refinement of the model may be carried out using the program CNS [Brϋnger, A. T. et al. Crystallography & NMR System: A new software suite for macromolecular structure determination. (1998) Acta Crystallogr. D 54, 905-921].

Various programs may be used by a skilled person to connect the individual chemical entities or candidate compounds, such as 3D Database systems (Martin (1992) J. Med. Chem., 35, pp. 2145-2154) and CAVEAT (Bartlett et al. (1989) Royal Chem. Soc. 78, pp. 182-196).

Rather than build a GPCR inhibitor one chemical entity at a time, modulating or other GPCR binding compounds may be designed as a whole or de novo using either an empty binding site or optionally including some portion(s) of a known inhibitor(s). Such compounds may be designed using programs that may include but are not limited to LEGEND (Nishibata and Itai (1991) Tetrahedron, 47, p. 8985) and LUDI (Bohm (1992) J Comp. Aid. Molec. Design, 6, pp. 61-78).

Other molecular modelling techniques may also be employed in accordance with this invention - such as those described by Cohen et al., J. Med. Chem., 33, pp. 883-894 (1990); Navia and Murcko (1992) Current Opinions in Structural Biology, 2, pp. 202-210 (1992).

Once a compound has been designed or selected by the above methods, the efficiency with which that compound may bind to a GPCR may be computationally evaluated. Specific computer software may be used to evaluate the efficiency of binding (eg. to evaluate compound deformation energy and electrostatic interaction), such as QUANTA/CHARMM (Accelrys Inc., USA) and Insight II/Discover (Biosym Technologies Inc., San Diego, Calif., USA). These programs may be implemented, for instance, using a suitable workstation. Other hardware systems and software packages will be known to those persons skilled in the art.

Once a GPCR-modulating compound has been selected or designed, as described above, substitutions may be made (eg. in atoms or side groups) to improve or modify the binding

properties. The substitutions may be conservative i.e. the replacement group may have approximately the same size, shape, hydrophobicity and charge as the original group. Such substituted chemical compounds may then be analysed for efficiency of binding to a GPCR by the same computer methods described above.

Candidate compounds and modulators of a GPCR etc., which are identified using the methods of the present invention, may be screened in assays. Screening can be, for example in vitro, in cell culture, and/or in vivo. Biological screening assays preferably centre on activity-based response models, binding assays (which measure how well a compound binds), and bacterial, yeast and animal cell lines (which measure the biological effect of a compound in a cell). Suitable assays are described herein. The assays can be automated for high capacity-high throughput screening (HTS) in which large numbers of compounds can be tested to identify compounds with the desired activity.

Current screening technologies are described in Handbook of Drug Screening, edited by Ramakrishna Seethala, Prabhavathi B. Fernandes. New York, NY, Marcel Dekker, (2001).

The conformation can be used to define a starting point for pharmacophore derivation, shape based database searching, CoMFA, Fieldscreen (Cresset, J. G. Vinter et al.) etc. The sequence information can be used in conjunction with the structure of the protein or a homologous protein and a homology model and the knowledge of the binding site residue locations to define pharmacophores for use for searching databases or for predicting activity using programs such as Catalyst (Accelrys), Unity (Tripos), Phase (Schrodinger).

DEFINITIONS

As herein, the term "modulating" or "modulates" refers to preventing, suppressing, inhibiting, alleviating, restorating, elevating, increasing or otherwise affecting GPCR activity. Suitably GPCR activity is GPCR signalling activity.

The term "allosteric modulator" may refer to a single entity or a combination of entities.

The allosteric modulator of a GPCR may be an antagonist or an agonist of said GPCR.

As used herein, the term "agonist" means any entity, which is capable of interacting (eg. binding) with a GPCR resulting in an increased or modified biological response. Suitably an agonist can be a protein ligand, peptide, chemokine, chemoattractant, lipid derivative or cytokine.

As used herein, the term "antagonist" means any entity, which is capable of interacting (eg. binding) with a GPCR resulting in a decreased biological response to the agonist.

Preferably, the allosteric GPCR modulators of the present invention are antagonists of GPCR and modulate the GPCR to reduce ligand binding and activation of the GPCR. In another embodiment, the allosteric GPCR modulators are activators and modulate the GPCR to increase activation of the GPCR.

The allosteric modulator of a GPCR may be an organic compound or other chemical. The allosteric modulator of a GPCR may be a compound, which is obtainable from or produced by any suitable source, whether natural or artificial. The allosteric modulator of a GPCR may be an amino acid molecule, a polypeptide, or a chemical derivative thereof, or a combination thereof. The allosteric modulator of a GPCR may even be a polynucleotide molecule, which may be a sense or an anti-sense molecule. The allosteric modulator of a GPCR may even be an antibody.

The allosteric modulator of a GPCR may be designed or obtained from a library of compounds, which may comprise peptides, as well as other compounds, such as small organic molecules.

By way of example, the allosteric modulator of a GPCR may be a natural substance, a biological macromolecule, or an extract made from biological materials such as bacteria, fungi, or animal (particularly mammalian) cells or tissues, an organic or an inorganic molecule, a synthetic agent, a semi-synthetic agent, a structural or functional mimetic, a

peptide, a peptidomimetic, a derivatised agent, a peptide cleaved from a whole protein, or a peptide synthesised synthetically (such as, by way of example, either using a peptide synthesiser or by recombinant techniques or combinations thereof, a recombinant agent, an antibody, a natural or a non-natural agent, a fusion protein or equivalent thereof and mutants, derivatives or combinations thereof).

Typically, the allosteric modulator of a GPCR will be an organic compound. Typically, the organic compounds will comprise two or more hydrocarbyl groups. Here, the term "hydrocarbyl group" means a group comprising at least C and H and may optionally comprise one or more other suitable substituents. Examples of such substituents may include halo-, alkoxy-, nitro-, an alkyl group, a cyclic group etc. In addition to the possibility of the substituents being a cyclic group, a combination of substituents may form a cyclic group. If the hydrocarbyl group comprises more than one C then those carbons need not necessarily be linked to each other. For example, at least two of the carbons may be linked via a suitable element or group. Thus, the hydrocarbyl group may contain hetero atoms. Suitable hetero atoms will be apparent to those skilled in the art and include, for instance, sulphur, nitrogen and oxygen. For some applications, preferably the allosteric modulator of a GPCR comprises at least one cyclic group. The cyclic group may be a polycyclic group, such as a non-fused polycyclic group. For some applications, the allosteric modulator of a GPCR comprises at least the one of said cyclic groups linked to another hydrocarbyl group.

The allosteric modulator of a GPCR may contain halo groups, for example, fluoro, chloro, bromo or iodo groups, or one or more of alkyl, alkoxy, alkenyl, alkylene and alkenylene groups, each of which may be branched or unbranched.

The allosteric modulator of a GPCR may be a structurally novel allosteric modulator of a GPCR, or may be an analogue of a known allosteric modulator of a GPCR.

Preferably, the allosteric modulators of a GPCR have improved properties over those GPCR modulators previously available, for example, fewer side effects.

The allosteric modulator of a GPCR may be a mimetic, or may be chemically modified.

The allosteric modulator of a GPCR may be capable of displaying other therapeutic properties.

The allosteric modulator of a GPCR may be used in combination with one or more other pharmaceutically active agents. If combinations of active agents are administered, then they may be administered simultaneously, separately or sequentially.

CANDIDATE COMPOUNDS

As used herein, the term "candidate compound" includes, but is not limited to, a compound which may be obtainable from or produced by any suitable source, whether natural or not.

The candidate compound may be designed or obtained from a library of compounds, which may comprise peptides, as well as other compounds, such as small organic molecules and particularly new lead compounds. By way of example, the candidate compound may be a natural substance, a biological macromolecule, or an extract made from biological materials - such as bacteria, fungi, or animal (particularly mammalian) cells or tissues, an organic or an inorganic molecule, a synthetic candidate compound, a semi-synthetic candidate compound, a structural or functional mimetic, a peptide, a peptidomimetic, a derivatised candidate compound, a peptide cleaved from a whole protein, or a peptide synthesised synthetically, for example, either using a peptide synthesiser or by recombinant techniques or combinations thereof, a recombinant candidate compound, a natural or a non-natural candidate compound, a fusion protein or equivalent thereof and mutants, derivatives or combinations thereof. The candidate compound may even be a compound that is a modulator of a GPCR, such as a known inhibitor of a GPCR, that has been modified in some way eg. by recombinant DNA techniques or chemical synthesis techniques.

Typically, the candidate compound will be prepared by recombinant DNA techniques and/or chemical synthesis techniques.

Once a candidate compound capable of allosteric interaction with a GPCR has been identified, further steps may be carried out to select and/or to modify the candidate compounds and/or to modify existing compounds, such that they are able to modulate the GPCR.

In one aspect, the modulator of a GPCR may act as a model (for example, a template) for the development of other compounds.

A further aspect relates to the use of candidate compounds or allosteric GPCR modulators identified by the assays and methods of the invention in one or more model systems, for example, in a biological model, a disease model, or a model for GPCR inhibition. Such models may be used for research purposes and for elucidating further details of the biological, physicochemical, pharmacological and/or pharmacokinetic activity of a particular candidate compound. By way of example, the candidate compounds or GPCR modulators of the present invention may be used in biological models or systems in which chemokine signalling is known to be of particular significance.

MIMETIC

As used herein, the term "mimetic" relates to any chemical which includes, but is not limited to, a peptide, polypeptide, antibody or other organic chemical which has the same qualitative activity or effect as a known compound. That is, the mimetic is a functional equivalent of a known compound.

CHEMICAL SYNTHESIS METHODS

Preferably, the modulator of GPCR of the present invention may be prepared by chemical synthesis techniques.

It will be apparent to those skilled in the art that sensitive functional groups may need to be protected and deprotected during synthesis of a compound of the invention. This may be achieved by conventional techniques, for example as described in "Protective Groups in Organic Synthesis" by T W Greene and P G M Wuts, John Wiley and Sons Inc. (1991), and by P.J.Kocienski, in "Protecting Groups", Georg Thieme Verlag (1994).

It is possible during some of the reactions that any stereocentres present could, under certain conditions, be racemised, for example if a base is used in a reaction with a substrate having an optical centre comprising a base-sensitive group. This is possible during e.g. a guanylation step. It should be possible to circumvent potential problems such as this by choice of reaction sequence, conditions, reagents, protection/deprotection regimes, etc. as is well-known in the art.

The compounds and salts may be separated and purified by conventional methods.

Separation of diastereomers may be achieved by conventional techniques, e.g. by fractional crystallisation, chromatography or H.P.L.C. of a stereoisomeric mixture of a compounds or suitable salts or derivatives thereof. An individual enantiomer of a compound may also be prepared from a corresponding optically pure intermediate or by resolution, such as by H.P.L.C. of the corresponding racemate using a suitable chiral support or by fractional crystallisation of the diastereomeric salts formed by reaction of the corresponding racemate with a suitably optically active acid or base.

GPCRs, allosteric modulators of a GPCR or variants, homologues, derivatives, fragments or mimetics thereof may be produced using chemical methods to synthesise the GPCR or the modulator of a GPCR in whole or in part. For example, a GPCR peptide or a modulator of a GPCR that is a peptide can be synthesised by solid phase techniques, cleaved from the resin, and purified by preparative high performance liquid chromatography (e.g., Creighton (1983) Proteins Structures And Molecular Principles, WH Freeman and Co, New York NY). The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure;

Creighton, supra).

Synthesis of peptides (or variants, homologues, derivatives, fragments or mimetics thereof) may be performed using various solid-phase techniques (Roberge JY et al (1995) Science 269: 202-204) and automated synthesis may be achieved, for example, using the ABI 43 1 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer. Additionally, the amino acid sequences comprising the modulator of a GPCR, may be altered during direct synthesis and/or combined using chemical methods with a sequence from other subunits, or any part thereof, to produce a variant modulator of a GPCR.

CHEMICAL MODIFICATION

In one embodiment, the modulator of a GPCR may be a chemically modified modulator of a GPCR. The chemical modification of a modulator of a GPCR may either enhance or reduce interactions between the modulator of a GPCR and the target, such as hydrogen bonding interactions, charge interactions, hydrophobic interactions, Van der Waals interactions or dipole interactions.

PROCESS

Another aspect of the invention relates to a process comprising the steps of:

(a) performing the method according to the invention, or an assay according to the invention;

(b) identifying one or more modulators of a GPCR; and

(c) preparing a quantity of said one or more GPCR modulators.

A further aspect of the invention relates to a process comprising the steps of:

(a) performing the method according to the invention, or an assay according to the invention;

(b) identifying one or more GPCR modulators; and (c) preparing a pharmaceutical composition comprising said one or more identified GPCR modulators.

A further aspect relates to a process comprising the steps of:

(a) performing the method according to the invention, or an assay according to the invention;

(b) identifying one or more GPCR modulators;

(c) modifying said one or more GPCR modulators; and

(d) optionally preparing a pharmaceutical composition comprising said one or more

GPCR modulators.

PHARMACEUTICAL COMPOSITIONS

Another aspect of the invention relates to a pharmaceutical composition comprising a GPCR modulator or candidate compound of the invention and a pharmaceutically acceptable carrier, diluent, excipient or adjuvant or any combination thereof. Even though the GPCR modulators or candidate compounds (including their pharmaceutically acceptable salts, esters and pharmaceutically acceptable solvates) can be administered alone, they will generally be administered in admixture with a pharmaceutical carrier, excipient or diluent, particularly for human therapy. The pharmaceutical compositions may be for human or animal usage in human and veterinary medicine.

Examples of such suitable excipients for the various different forms of pharmaceutical compositions described herein may be found in the "Handbook of Pharmaceutical Excipients, 2 ^nd Edition, (1994), Edited by A Wade and PJ Weller.

Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985).

Examples of suitable carriers include lactose, starch, glucose, methyl cellulose, magnesium stearate, mannitol, sorbitol and the like. Examples of suitable diluents include ethanol, glycerol and water.

The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as, or in addition to, the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).

Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flow lactose, beta-lactose, corn sweeteners, natural and synthetic gums, such as acacia, tragacanth or sodium alginate, carboxymethyl cellulose and polyethylene glycol.

Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like.

Preservatives, stabilizers, dyes and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used.

SALTS/ESTERS

The GPCR modulators or candidate compounds of the present invention can be present as salts or esters, in particular pharmaceutically acceptable salts or esters.

Pharmaceutically acceptable salts of the GPCR modulators or candidate compounds of the invention include suitable acid addition or base salts thereof. A review of suitable pharmaceutical salts may be found in Berge et al, J Pharm Sci, 66, 1-19 (1977). Salts are formed, for example with strong inorganic acids such as mineral acids, e.g. sulphuric acid, phosphoric acid or hydrohalic acids; with strong organic carboxylic acids, such as alkanecarboxylic acids of 1 to 4 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acids, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric

acid; with aminoacids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulfonic acids, such as (Cj-C ₄ )-alkyl- or aryl-sulfonic acids which are unsubstituted or substituted (for example, by a halogen) such as methane- or p-toluene sulfonic acid.

Esters are formed either using organic acids or alcohols/hydroxides, depending on the functional group being esterified. Organic acids include carboxylic acids, such as alkanecarboxylic acids of 1 to 12 carbon atoms which are unsubstituted or substituted (e.g., by halogen), such as acetic acid; with saturated or unsaturated dicarboxylic acid, for example oxalic, malonic, succinic, maleic, fumaric, phthalic or tetraphthalic; with hydroxycarboxylic acids, for example ascorbic, glycolic, lactic, malic, tartaric or citric acid; with aminoacids, for example aspartic or glutamic acid; with benzoic acid; or with organic sulfonic acids, such as (d-C ₄ )-alkyl- or aryl-sulfonic acids which are unsubstituted or substituted (for example, by a halogen) such as methane- or p-toluene sulfonic acid. Suitable hydroxides include inorganic hydroxides, such as sodium hydroxide, potassium hydroxide, calcium hydroxide, aluminium hydroxide. Alcohols include alkanealcohols of 1-12 carbon atoms which may be unsubstituted or substituted, e.g. by a halogen).

In a preferred embodiment, the allosteric modulators identified in accordance with the present invention are rendered cell permeable. For example, modulators may be designed to be cell permeable as a result of their combined physicochemical properties including number of hydrogen bond donors, logD, logP molecular weight etc. In addition, modulators may be carried in by another agent such as a virus capsule or administered in lipid micelles.

ENANTIOMERS/TAUTOMERS

In all aspects of the present invention previously discussed, the invention includes, where appropriate all enantiomers and tautomers of the GPCR modulators or candidate compounds of the invention. The man skilled in the art will recognise compounds that possess optical properties (one or more chiral carbon atoms) or tautomeric characteristics. The corresponding enantiomers and/or tautomers may be isolated/prepared by methods known in the art.

STEREO AND GEOMETRIC ISOMERS

Some of the GPCR modulators or candidate compounds of the invention may exist as stereoisomers and/or geometric isomers, e.g. they may possess one or more asymmetric and/or geometric centres and so may exist in two or more stereoisomeric and/or geometric forms. The present invention contemplates the use of all the individual stereoisomers and geometric isomers of those agents, and mixtures thereof. The terms used in the claims encompass these forms, provided said forms retain the appropriate functional activity (though not necessarily to the same degree).

The present invention also includes all suitable isotopic variations of the GPCR modulators or candidate compounds, or pharmaceutically acceptable salts thereof. An isotopic variation of a GPCR modulator or candidate compound of the present invention or a pharmaceutically acceptable salt thereof is defined as one in which at least one atom is replaced by an atom having the same atomic number but an atomic mass different from the atomic mass usually found in nature. Examples of isotopes that can be incorporated into the agent and pharmaceutically acceptable salts thereof include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulphur, fluorine and chlorine such as ² H, ³ H, ¹³ C, ¹⁴ C, ¹⁵ N, ¹⁷ O, ¹⁸ 0, ³¹ P, ³² P, ³⁵ S, ¹⁸ F and ³⁶ Cl, respectively. Certain isotopic variations of the agent and pharmaceutically acceptable salts thereof, for example, those in which a radioactive isotope such as ³ H or ¹⁴ C is incorporated, are useful in drug and/or substrate tissue distribution studies. Tritiated, i.e., ³ H, and carbon-14, i.e., ¹⁴ C, isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with isotopes such as deuterium, i.e., ² H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements and hence may be preferred in some circumstances. Isotopic variations of the GPCR modulators or candidate compounds of the present invention can generally be prepared by conventional procedures using appropriate isotopic variations of suitable reagents.

SOLVATES

The present invention also includes solvate forms of the GPCR modulators or candidate compounds. The terms used in the claims encompass these forms.

POLYMORPHS

The invention furthermore relates to GPCR modulators or candidate compounds of the present invention in their various crystalline forms, polymorphic forms and (an)hydrous forms. It is well established within the pharmaceutical industry that chemical compounds may be isolated in any of such forms by slightly varying the method of purification and or isolation form the solvents used in the synthetic preparation of such compounds.

PRODRUGS

The invention further includes GPCR modulators or candidate compounds of the present invention in prodrug form. Such prodrugs are generally compounds of the invention wherein one or more appropriate groups have been modified such that the modification may be reversed upon administration to a human or mammalian subject. Such reversion is usually performed by an enzyme naturally present in such subject, though it is possible for a second agent to be administered together with such a prodrug in order to perform the reversion in vivo. Examples of such modifications include ester (for example, any of those described above), wherein the reversion may be carried out be an esterase etc. Other such systems will be well known to those skilled in the art.

Examples of ester compounds which act as prodrugs are described herein. Suitable modifications render the compound cell permeable.

THERAPEUTIC USE

Allosteric modulators of GPCRs including Chemokine receptors identified in accordance with the invention have activity as pharmaceuticals, in particular as modulators of

Chemokine receptors, and may be used in the treatment (therapeutic or prophylactic) of conditions/diseases in human and non-human animals which are exacerbated or caused by excessive or unregulated production of chemokines. Examples of such conditions/diseases include:

(1) (the respiratory tract) obstructive airways diseases including chronic obstructive pulmonary disease (COPD); asthma, such as bronchial, allergic, intrinsic, extrinsic and dust asthma, particularly chronic or inveterate asthma (e.g. late asthma and airways hyper- responsiveness); bronchitis; acute, allergic, atrophic rhinitis and chronic rhinitis including rhinitis caseosa, hypertrophic rhinitis, rhinitis purulenta, rhinitis sicca and rhinitis medicamentosa; membranous rhinitis including croupous, fibrinous and pseudomembranous rhinitis and scrofoulous rhinitis; seasonal rhinitis including rhinitis nervosa (hay fever) and vasomotor rhinitis, idiopathic pulmonary fibrosis (IPF); sarcoidosis, farmer's lung and related diseases, fibroid lung and idiopathic interstitial pneumonia;

(2) (bone and joints) rheumatoid arthritis, seronegative spondyloarthropathies (including ankylosing spondylitis, psoriatic arthritis and Reiter's disease), Behcet's disease, Siogren's syndrome and systemic sclerosis, gout, osteoporosis and osteoarthritis.

(3) (skin) psoriasis, atopical dermatitis, contact dermatitis and other eczmatous dermitides, seborrhoetic dermatitis, Lichen planus, Pemphigus, bullous Pemphigus, Epidermolysis bullosa, urticaria, angiodermas, vasculitides, erythemas, cutaneous eosinophilias, uveitis, Alopecia areata and vernal conjunctivitis;

(4) (gastrointestinal tract) Coeliac disease, proctitis, eosinopilic gastro-enteritis, mastocytosis, Crohn's disease, ulcerative colitis, food-related allergies which have effects remote from the gut, e.g., migraine, rhinitis and eczema;

(5) (other tissues and systemic disease) multiple sclerosis, atherosclerosis, Acquired Immunodeficiency Syndrome (AIDS), lupus erythematosus, systemic lupus, erythematosus, Hashimoto's thyroiditis, myasthenia gravis, type I diabetes, nephrotic

syndrome, eosinophilia fascitis, hyper IgE syndrome, lepromatous leprosy, sezary syndrome and idiopathic thrombocytopenia pupura; post-operative adhesions, and sepsis.

(6) (allograft rejection) acute and chronic following, for example, transplantation of kidney, heart, liver, lung, bone marrow, skin and cornea; and chronic graft versus host disease;

(7) Cancers, especially non-small cell lung cancer (NSCLC), malignant melanoma, prostate cancer and squamous sarcoma, and tumour metastasis;

(8) Diseases in which angiogenesis is associated with raised CXCR2 chemokine levels (e.g. NSCLC, diabetic retinopathy).

(9) Cystic fibrosis, stroke, re-perfusion injury in the heart, brain, peripheral limbs and other organs.

(10) Burn wounds & chronic skin ulcers

(11) Reproductive Diseases (e.g. Disorders of ovulation, menstruation and implantation, Pre-term labour, Endometriosis)

Thus, compounds identified in accordance with the invention, or pharmaceutically- acceptable salts or solvates thereof, are for use in therapy.

Preferably the compounds identified in accordance with the invention are used to treat diseases in which the Chemokine receptor belongs to the CXC Chemokine receptor subfamily, more preferably the target Chemokine receptor is the CXCR2 receptor.

Particular conditions which can be treated with the compounds of the invention are rheumatoid arthritis, psoriasis, diseases in which angiogenesis is associated with raised CXCR2 chemokine levels, IBD and COPD. It is preferred that the compounds of the invention are used to treat rheumatoid arthritis and COPD.

In the context of the present specification, the term "therapy" also includes "prophylaxis" unless there are specific indications to the contrary. The terms "therapeutic" and "therapeutically" should be construed accordingly.

A further aspect of the invention therefore relates to a method of treating a GPCR related disorder, said method comprising administering to a subject in need thereof a compound identified in accordance with the invention.

A further aspect of the invention relates to the use of a GPCR modulator or candidate compound according to the invention in the preparation of a medicament for treating a GPCR-related disorder.

As used herein the phrase "preparation of a medicament" includes the use of the compound directly as the medicament in addition to its use in a screening programme for further therapeutic agents or in any stage of the manufacture of such a medicament.

In one preferred embodiment, the compound of the invention is administered orally.

Yet another aspect relates to a method of selectively inhibiting a GPCR in a cell comprising contacting said cell with an amount of a compound identified in accordance with the invention, such that a GPCR is selectively inhibited in said cell.

ADMINISTRATION The pharmaceutical compositions of the present invention may be adapted for oral, rectal, vaginal, parenteral, intramuscular, intraperitoneal, intraarterial, intrathecal, intrabronchial, subcutaneous, intradermal, intravenous, nasal, buccal or sublingual routes of administration.

For oral administration, particular use is made of compressed tablets, pills, tablets, gellules, drops, and capsules. Preferably, these compositions contain from 1 to 250 mg and more preferably from 10-100 mg, of active ingredient per dose.

Other forms of administration comprise solutions or emulsions which may be injected intravenously, intraarterially, intrathecally, subcutaneously, intradermally, intraperitoneally or intramuscularly, and which are prepared from sterile or sterilisable solutions. The pharmaceutical compositions of the present invention may also be in form of suppositories, pessaries, suspensions, emulsions, lotions, ointments, creams, gels, sprays, solutions or dusting powders.

An alternative means of transdermal administration is by use of a skin patch. For example, the active ingredient can be incorporated into a cream consisting of an aqueous emulsion of polyethylene glycols or liquid paraffin. The active ingredient can also be incorporated, at a concentration of between 1 and 10% by weight, into an ointment consisting of a white wax or white soft paraffin base together with such stabilisers and preservatives as may be required,

Injectable forms may contain between 10 - 1000 mg, preferably between 10 - 250 mg, of active ingredient per dose.

Compositions may be formulated in unit dosage form, i.e., in the form of discrete portions containing a unit dose, or a multiple or sub-unit of a unit dose.

DOSAGE

A person of ordinary skill in the art can easily determine an appropriate dose of one of the instant compositions to administer to a subject without undue experimentation. Typically, a physician will determine the actual dosage which will be most suitable for an individual patient and it will depend on a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the individual undergoing therapy. The dosages disclosed herein are exemplary of the average case.

There can of course be individual instances where higher or lower dosage ranges are merited, and such are within the scope of this invention.

Depending upon the need, the agent may be administered at a dose of from 0.01 to 30 mg/kg body weight, such as from 0.1 to 10 mg/kg, more preferably from 0.1 to 1 mg/kg body weight.

In an exemplary embodiment, one or more doses of 10 to 150 mg/day will be administered to the patient for the treatment of malignancy.

GPCR FRAGMENT

Another aspect of the invention relates to a fragment of GPCR, or a homologue, mutant, or derivative thereof, comprising a ligand binding domain, said ligand binding domain being defined by the amino acid residue structural coordinates corresponding to the following amino acids in CXCR2: S81, V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 (particularly S81, V82, T83, D84, Y86, L87, L90, G133, L136, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321), or by amino acid residues 301 to 360 of CXCR2 (particularly residues 304 to 326 of CXCR2).

As used herein, the term "allosteric intracellular binding site" means the intracellular region of a GPCR which is responsible for an allosteric modification when a compound is bound. The term "allosteric intracellular binding site" also includes a homologue of the allosteric intracellular binding site, or a portion thereof.

As used herein, the term "portion thereof means the structural co-ordinates corresponding to a sufficient number of amino acid residues of the intracellular binding site of the GPCR sequence (or homologue thereof) that are capable of interacting with a candidate compound capable of binding to the allosteric intracellular binding site and eliciting an allosteric modulation of the GPCR.

In one preferred embodiment, the fragment of a GPCR corresponding to the allosteric intracellular binding site, or a homologue, mutant or derivative thereof, corresponds to a portion of the structure co-ordinates of Table 3. In particular, said site corresponds to amino acids 304 to 326 of CXCR2.

Another aspect of the invention relates to the use of the above-described fragment of a GPCR, or a homologue, mutant, or derivative thereof, in an assay for identifying candidate compounds capable of modulating a GPCR.

For use in the assays of the present invention, GPCR proteins or fragments thereof may be produced by a host recombinant cell may be secreted or may be contained intracellularly depending on the nucleotide sequence and/or the vector used.

As will be understood by those skilled in the art, expression vectors containing a GPCR encoding nucleotide sequence or a mutant, variant, homologue, derivative or fragment thereof, may be designed with signal sequences which direct secretion of the GPCR coding sequences through a particular prokaryotic or eukaryotic cell membrane.

The GPCR encoding sequence may be fused (eg. ligated) to nucleotide sequences encoding a polypeptide domain which will facilitate purification of soluble proteins (Kroll DJ et al (1993) DNA Cell Biol 12:441-53). Preferably, the polypeptide domain, which facilitates purification of soluble proteins, is fused in frame with the GPCR encoding sequence. Such purification facilitating domains include, but are not limited to, metal chelating peptides - such as histidine-tryptophan modules that allow purification on immobilised metals (Porath J (1992) Protein Expr Purif 3, 263-281), protein A domains that allow purification on immobilised immunoglobulin, and the domain utilised in the FLAGS extension/affinity purification system (Immunex Corp, Seattle, WA). The inclusion of a cleavable linker sequence such as Factor XA or enterokinase (Invitrogen, San Diego, CA) between the purification domain and GPCR is useful to facilitate purification.

NUCLEOTIDE SEQUENCES

As used herein, the term "nucleotide sequence" refers to nucleotide sequences, oligonucleotide sequences, polynucleotide sequences and variants, homologues, fragments and derivatives thereof (such as portions thereof) which comprise the nucleotide sequences encoding GPCR.

The nucleotide sequence may be DNA or RNA of genomic or synthetic or recombinant origin, which may be double-stranded or single-stranded whether representing the sense or antisense strand or combinations thereof.

Preferably, the term nucleotide sequence is prepared by use of recombinant DNA techniques (e.g. recombinant DNA). The nucleotide sequences may include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that the nucleotide sequences described herein may be modified by any method available in the art.

It will be understood by a skilled person that numerous different nucleotide sequences can encode the same protein as a result of the degeneracy of the genetic code. In addition, it is to be understood that skilled persons may, using routine techniques, make nucleotide substitutions that do not substantially affect the activity encoded by the nucleotide sequence of the present invention to reflect the codon usage of any particular host organism in which the target is to be expressed. Thus, the terms "variant", "homologue" or "derivative" in relation to nucleotide sequences include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acids from or to the sequence providing the resultant nucleotide sequence encodes a functional protein according to the present invention (or even a modulator of a GPCR according to the present invention if said modulator comprises a nucleotide sequence or an amino acid sequence).

AMINO ACID SEQUENCES

As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and/or the term "protein". In some instances, the term "amino acid sequence" is synonymous with the term "peptide".

The amino acid sequence may be isolated from a suitable source, or it may be made synthetically or it may be prepared by use of recombinant DNA techniques.

VARIANTS/HOMOLOGUES/DERIVATIVES/FRAGMENTS

The GPCR described herein is intended to include any polypeptide, which has the activity of the naturally occurring GPCR and includes all vertebrate and mammalian forms. Such terms also include polypeptides that differ from naturally occurring forms of the GPCR by having amino acid deletions, substitutions, and additions, but which retain the activity of the GPCR.

The term "variant" is used to mean a naturally occurring polypeptide or nucleotide sequences which differs from a wild-type or a native sequence.

The term "fragment" indicates that a polypeptide or nucleotide sequence comprises a fraction of a wild-type or a native sequence. It may comprise one or more large contiguous sections of sequence or a plurality of small sections. The sequence may also comprise other elements of sequence, for example, it may be a fusion protein with another protein. Preferably the sequence comprises at least 50%, more preferably at least 65%, more preferably at least 80%, most preferably at least 90% of the wild-type sequence.

The present invention also encompasses the use of variants, homologues and derivatives of nucleotide and amino acid sequences. Here, the term "homologue" means an entity having a certain homology with amino acid sequences or nucleotide sequences. Here, the term "homology" can be equated with "identity".

In the present context, an homologous sequence is taken to include an amino acid sequence which may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the subject sequence. Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), it is preferred to express homology in terms of sequence identity.

An homologous sequence is taken to include a nucleotide sequence which may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the subject sequence.

Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.

% homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.

Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to try to maximise local homology.

However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting higher relatedness between the two compared sequences - will achieve a higher score than one with many gaps. "Affϊne gap costs" are

typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of

Wisconsin, U.S.A.; Devereux et ah, 1984, Nucleic Acids Research 12:387). Examples of other software than can perform sequence comparisons include, but are not limited to, the

BLAST package (see Ausubel et al, 1999 ibid - Chapter 18), FASTA (Atschul et al, 1990, J. MoI. Biol, 403-410) and the GENEWORKS suite of comparison tools. Both

BLAST and FASTA are available for offline and online searching (see Ausubel et al,

1999 ibid, pages 7-58 to 7-60). However, for some applications, it is preferred to use the

GCG Bestfit program. A new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequence (see FEMS Microbiol Lett 1999 174(2): 247- 50; FEMS Microbiol Lett 1999 177(1): 187-8). Another alternative is to align manually, using known alignment motifs.

Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.

Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

The sequences may also have deletions, insertions or substitutions of amino acid residues, which produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as the secondary binding activity of the substance is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

Conservative substitutions may be made, for example according to the table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

Homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue, with an alternative residue) may occur i.e. like-for-like substitution such as basic for basic, acidic for acidic, polar for polar etc. Nonhomologous substitution may also occur i.e. from one class of residue to another or

alternatively involving the inclusion of unnatural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.

Replacements may also be made by unnatural amino acids include; alpha* and alpha- disubstituted* amino acids, N-alkyl amino acids*, lactic acid*, halide derivatives of natural amino acids such as trifluorotyrosine*, p-Cl-phenylalanine*, p-Br-phenylalanine*, p-I- phenylalanine*, L-allyl-glycine*, β-alanine*, L-α-amino butyric acid*, L-γ-amino butyric acid*, L-α-amino isobutyric acid*, L-ε-amino caproic acid*, 7-amino heptanoic acid*, L- methionine sulfone , L-norleucine*, L-norvaline*, p-nitro-L-phenylalanine*, L- hydroxyproline*, L-thioproline*, methyl derivatives of phenylalanine (Phe) such as 4- methyl-Phe*, pentamethyl-Phe*, L-Phe (4-amino) ^# , L-Tyr (methyl)*, L-Phe (4- isopropyl)*, L-Tic (l,2,3,4-tetrahydroisoquinoline-3-carboxyl acid)*, L-diaminopropionic acid ^# and L-Phe (4-benzyl)*. The notation * has been utilised for the purpose of the discussion above (relating to homologous or non-homologous substitution), to indicate the hydrophobic nature of the derivative whereas # has been utilised to indicate the hydrophilic nature of the derivative, #* indicates amphipathic characteristics.

The term "derivative" or "derivatised" as used herein includes chemical modification of an entity, such as candidate compound or a GPCR modulator. Illustrative of such chemical modifications would be replacement of hydrogen by a halo group, an alkyl group, an acyl group or an amino group.

Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or β- alanine residues. A further form of variation, involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the art. For the avoidance of doubt, "the peptoid form" is used to refer to variant amino acid residues wherein the α-carbon substituent group is on the residue's nitrogen atom rather than the α- carbon. Processes for preparing peptides in the peptoid form are known in the art, for

example Simon RJ et a!., PNAS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.

MUTANT As used herein, the term "mutant" refers to a GPCR comprising one or more changes in the wild-type GPCR sequence.

The term "mutant" is not limited to amino acid substitutions of the amino acid residues in a GPCR, but also includes deletions or insertions of nucleotides which may result in changes in the amino acid residues in the amino acid sequence of a GPCR.

The present invention also enables the solving of the crystal structure of GPCR mutants. More particularly, by virtue of the present invention, the location of the active site of the intracellular binding site of a GPCR based on the structural coordinates of Table 3 permits the identification of desirable sites for mutation. For example, one or more mutations may be directed to a particular site - such as the active site - or combination of sites of a GPCR. Similarly, only a location on, at or near the enzyme surface may be replaced, resulting in an altered surface charge of one or more charge units, as compared to the wild-type enzyme. Alternatively, an amino acid residue in a GPCR may be chosen for replacement based on its hydrophilic or hydrophobic characteristics.

Such mutants may be characterised by any one of several different properties as compared with the wild-type GPCR. For example, such mutants may have altered surface charge of one or more charge units, or have an increased stability to subunit dissociation, or an altered substrate specificity in comparison with, or a higher specific activity than, the wild- type GPCR.

The mutants may be prepared in a number of ways that are known by a person skilled in the art. For example, mutations may be introduced by means of oligonucleotide-directed mutagenesis or other conventional methods. Alternatively, mutants of a GPCR may be generated by site-specific replacement of a particular amino acid with an unnaturally

occurring amino acid. This may be achieved by growing a host organism capable of expressing either the wild-type or mutant polypeptide on a growth medium depleted of one or more natural amino acids but enriched in one or more corresponding unnaturally occurring amino acids.

5

HOST CELLS

As used herein, the term "host cell" refers to any cell that comprises nucleotide sequences that are of use in the present invention, for example, nucleotide sequences encoding GPCR.

io Host cells may be transformed or transfected with a nucleotide sequence contained in a vector e.g. a cloning vector. Preferably, said nucleotide sequence is carried in a vector for the replication and/or expression of the nucleotide sequence. The cells will be chosen to be compatible with the said vector and may for example be prokaryotic (for example bacterial), fungal, yeast or plant cells.

I ₅

The gram-negative bacterium E. coli is widely used as a host for cloning nucleotide sequences. This organism is also widely used for heterologous nucleotide sequence expression. However, large amounts of heterologous protein tend to accumulate inside the cell. Subsequent purification of the desired protein from the bulk of E. coli intracellular 0 proteins can sometimes be difficult.

In contrast to E. coli, bacteria from the genus Bacillus are very suitable as heterologous hosts because of their capability to secrete proteins into the culture medium. Other bacteria suitable as hosts are those from the genera Streptomyces and Pseudomonas. ₅

Depending on the nature of the polynucleotide and/or the desirability for further processing of the expressed protein, eukaryotic hosts including yeasts or other fungi may be preferred. In general, yeast cells are preferred over fungal cells because yeast cells are easier to manipulate. However, some proteins are either poorly secreted from the yeast cell, or in 0 some cases are not processed properly (e.g. hyperglycosylation in yeast). In these instances, a different fungal host organism should be selected.

Examples of expression hosts are fungi - such as Aspergillus species (such as those described in EP-A-0184438 and EP-A-0284603) and Trichoderma species; bacteria - such as Bacillus species (such as those described in EP-A-0134048 and EP-A-0253455), Streptomyces species and Pseudomonas species; yeasts - such as Kluyveromyces species (such as those described in EP-A-0096430 and EP-A-0301670) and Saccharomyces species; and mammalian cells — such as CHO-Kl cells.

The use of host cells may provide for post-translational modifications as may be needed to confer optimal biological activity on recombinant expression products of the present invention.

Aspects of the present invention also relate to host cells comprising the GPCR constructs of the present invention. The GPCR constructs may comprise a nucleotide sequence for replication and expression of the sequence. The cells will be chosen to be compatible with the vector and may for example be prokaryotic (for example bacterial), fungal, yeast or plant cells.

In a preferred embodiment, the host cells are mammalian cells, such as CHO-Kl cells or HEK293 cells.

VECTOR

Aspects of the present invention relate to a vector comprising a nucleotide sequence, such as a nucleotide sequence encoding a GPCR or a modulator of a GPCR, administered to a subject.

Preferably, the GPCR or the modulator of a GPCR is prepared and/or delivered using a genetic vector.

As it is well known in the art, a vector is a tool that allows or facilitates the transfer of an entity from one environment to another. In accordance with the present invention, and by

way of example, some vectors used in recombinant DNA techniques allow entities, such as a segment of DNA (such as a heterologous DNA segment, such as a heterologous cDNA segment), to be transferred into a host and/or a target cell for the purpose of replicating the vectors comprising nucleotide sequences and/or expressing the proteins encoded by the nucleotide sequences. Examples of vectors used in recombinant DNA techniques include, but are not limited to, plasmids, chromosomes, artificial chromosomes or viruses.

The term "vector" includes expression vectors and/or transformation vectors.

The term "expression vector" means a construct capable of in vivo or in vitro/ex vivo expression.

The term "transformation vector" means a construct capable of being transferred from one species to another.

REGULATORY SEQUENCES

In some applications, nucleotide sequences are operably linked to a regulatory sequence which is capable of providing for the expression of the nucleotide sequence, such as by a chosen host cell. By way of example, a vector comprising the GPCR nucleotide sequence is operably linked to such a regulatory sequence i.e. the vector is an expression vector.

The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

The term "regulatory sequences" includes promoters and enhancers and other expression regulation signals.

The term "promoter" is used in the normal sense of the art, e.g. an RNA polymerase binding site.

Enhanced expression of a nucleotide sequence, for example, a nucleotide sequence encoding a GPCR, may also be achieved by the selection of heterologous regulatory regions, e.g. promoter, secretion leader and terminator regions, which serve to increase expression and, if desired, secretion levels of the protein of interest from the chosen expression host and/or to provide for the inducible control of the expression of a GPCR. In eukaryotes, polyadenylation sequences may be operably connected to the GPCR nucleotide sequence.

Preferably, the GPCR nucleotide sequence is operably linked to at least a promoter.

Aside from the promoter native to the gene encoding the GPCR nucleotide sequence, other promoters may be used to direct expression of the GPCR polypeptide. The promoter may be selected for its efficiency in directing the expression of the GPCR nucleotide sequence in the desired expression host.

In another embodiment, a constitutive promoter may be selected to direct the expression of the GPCR nucleotide sequence. Such an expression construct may provide additional advantages since it circumvents the need to culture the expression hosts on a medium containing an inducing substrate.

Hybrid promoters may also be used to improve inducible regulation of the expression construct.

The promoter can additionally include features to ensure or to increase expression in a suitable host. For example, the features can be conserved regions such as a Pribnow Box or a TATA box. The promoter may even contain other sequences to affect (such as to maintain, enhance, decrease) the levels of expression of the GPCR nucleotide sequence. For example, suitable other sequences include the Shl-intron or an ADH intron. Other sequences include inducible elements - such as temperature, chemical, light or stress inducible elements. Also, suitable elements to enhance transcription or translation may be present.

EXPRESSION VECTOR

Preferably, nucleotide sequences, such as nucleotide sequences encoding a GPCR or modulators of a GPCR, are inserted into a vector that is operably linked to a control sequence that is capable of providing for the expression of the coding sequence by the host cell.

Nucleotide sequences produced by a host recombinant cell may be secreted or may be contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors can be designed with signal sequences, which direct secretion of the nucleotide sequence through a particular prokaryotic or eukaryotic cell membrane.

Preferably, the expression vectors are stably expressed in wild type HEK293 cells expressing promiscuous Gqi5 on a stably integrated expression vector. Suitable expression vectors include pIRESneo2 (BD Biosciences Clontech) and/or pGENiresneo.

FUSION PROTEINS

A GPCR or a modulator of a GPCR may be expressed as a fusion protein to aid extraction and purification and/or delivery of the modulator of a GPCR or the GPCR protein to an individual and/or to facilitate the development of a screen for modulators of a GPCR. Examples of fusion protein partners include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA binding and/or transcriptional activation domains) and β-galactosidase.

It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences. Preferably, the fusion protein will not hinder the activity of the protein of interest.

The fusion protein may comprise an antigen or an antigenic determinant fused to the substance of the present invention. In this embodiment, the fusion protein may be a non- naturally occurring fusion protein comprising a substance, which may act as an adjuvant in

the sense of providing a generalised stimulation of the immune system. The antigen or antigenic determinant may be attached to either the amino or carboxy terminus of the substance.

ORGANISM

The term "organism" in relation to the present invention includes any organism that could comprise GPCR and/or modulators of a GPCR. Examples of organisms may include mammals, fungi, yeast or plants.

Preferably, the organism is a mammal. More preferably, the organism is a human.

TRANSFORMATION

As indicated earlier, the host organism can be a prokaryotic or a eukaryotic organism. Examples of suitable prokaryotic hosts include E. coli and Bacillus subtilis. Teachings on the transformation of prokaryotic hosts are well documented in the art, for example see Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor Laboratory Press) and Ausubel et al, Current Protocols in Molecular Biology (1995), John Wiley & Sons, Inc. Examples of suitable eukaryotic hosts include mammalian cells.

If a prokaryotic host is used then the nucleotide sequence, such as the GPCR nucleotide sequence, may need to be suitably modified before transformation - such as by removal of introns.

Thus, the present invention also relates to the transformation of a host cell with a nucleotide sequence, such as GPCR or a modulator of a GPCR. Host cells transformed with the nucleotide sequence may be cultured under conditions suitable for the expression and recovery of the encoded protein from cell culture. The protein produced by a recombinant cell may be secreted or may be contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing coding sequences can be designed with signal sequences

which direct secretion of the coding sequences through a particular prokaryotic or eukaryotic cell membrane. Other recombinant constructions may join the coding sequence to nucleotide sequence encoding a polypeptide domain, which will facilitate purification of soluble proteins (Kroll DJ et a! (1993) DNA Cell Biol 12:441-53) e.g. 6-His or Glutathione-S-transferase.

TRANSFECTION

Vectors comprising for example, the GPCR nucleotide sequence, may be introduced into host cells, for example, mammalian cells, using a variety of methods.

Typical transfection methods include electroporation, DNA biolistics, lipid-mediated transfection, compacted DNA-mediated transfection, liposomes, immunoliposomes, lipofectin, cationic agent-mediated, cationic facial amphiphiles (CFAs) (Nature Biotech. (1996) 14, 556), multivalent cations such as spermine, cationic lipids or polylysine, 1, 2,- bis (oleoyloxy)-3-(trimethylammonio) propane (DOTAP)-cholesterol complexes (Wolff and Trubetskoy 1998 Nature Biotechnology 16: 421) and combinations thereof.

Uptake of nucleic acid constructs by mammalian cells is enhanced by several known transfection techniques for example those including the use of transfection agents. Examples of these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants (for example lipofectam™ and transfectam™). Typically, nucleic acid constructs are mixed with the transfection agent to produce a composition.

Such methods are described in many standard laboratory manuals - such as Sambrook et al, Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.

The present invention is further described by way of example, and with reference to the following Figures wherein:

FIGURES

Figure IA shows an alignment of human CXCRl and CXCR2. 1111 etc represent equivalent amino acids in bovine rhodopsin in alpha helix 1 etc. Boxed areas represent binding portions. Dashed lines represent amino acids in membrane spanning regions.

Figure IB shows a schematic representation of the structure of CXCR2.

Figure 1C shows a schematic view of the intracellular face of a GPCR. The intracellular binding site is represented by an ellipse.

Figure 2 shows inhibition of [ ¹²⁵ I] IL8 binding in a CXCR2 membrane binding assay.

Figure 3 shows Potency Correlation for a range of compounds displacing [ ¹²⁵ I] IL-8 and [ ³ H] Compound C.

Figure 4 shows compound activity in a membrane binding assay versus compound activity in a whole cell calcium flux assay.

Figure 5 shows a schematic diagram of constructs CXCRl (l-290)-CXCR2(301-360) (CXCRl/2), and CXCR2( 1-30O)-CXCR 1(291-350) (CXCR2/1).

Figure 6 shows GROalpha- and IL-8-induced calcium release for wild type CXCRl and CXCR1(1-29O)-CXCR2 (301 to 360) tail swap measured in FLIPR assay.

Figure 7 shows GROalpha- and IL-8-induced calcium release for wild type CXCR2 and CXCR2(l-300)-CXCRl(291-350) tail swap measured in FLIPR assay.

Figure 8 shows IL-8-induced calcium release for wild type CXCRl and CXCR1(1-29O> CXCR2(301-360) tail swap in the presence and absence of 3OnM Compound A.

Figure 9 shows IL-8-induced calcium release for wild type CXCR2 and CXCR2(l-300)- CXCRl (291-350) tail swap in the presence and absence of 30 nM Compound A.

Figure 10 shows a schematic diagram of the constructs CXCRl(I -316)/CXCR2(327-360) (CXCRl/2short), and CXCR2(l-326)/CXCRl(317-350) (CXCR2/1 short).

Figure 11 shows IL-8-induced calcium release for CXCRl/2short and CXCR2/lshort in the presence and absence of Compound A and Compound B.

Figure 12 shows a schematic diagram of CXCRl and CXCR2 mutants: CXCRl N311K/F316L, CXCR2 K320N/L325F, CXCRl F316L, CXCR2 K320N and CXCRl N311K.

Figure 13 shows IL-8-induced calcium release for CXCRl N311K/F316L and CXCR2 K320N/L325 in the presence of Compound A and Compound B.

Figure 14 shows IL-8-induced calcium release for CXCRl F316L in the presence of Compound A and Compound B.

Figure 15 shows IL-8-induced calcium release for CXCRl N31 IK and CXCR2 K320N in the presence of Compound A and Compound B.

Figure 16 shows an alignment of amino acids in first shell of intracellular binding site from a variety of GPCRs.

Figure 17 shows principal components analysis of the intracellular binding site residues based upon e-state key descriptors (1 ^st and 2 ^nd components). The targets currently known to have intracellular binding sites are highlighted as stars.

Figure 18 shows an alignment of the C-terminal amino acids in several Chemokine receptors (7777777 indicates the helix which the equivalent amino acid in bovine rhodopsin resides). Lys 320 and its equivalents are circled.

Figure 19 shows an alignment of Chemokine receptors indicating residues which form the intracellular binding site.

Figure 20 shows CXCRl, CXCR2, CCR4 and CCR2b alignment generated using CLUSTALW. Residues highlighted by shading indicate amino acids which form part of the compound binding pocket.

Figure 21 shows results of a radioligand binding assay using [ ³ H]Compound A with GST- CXCR2 fusion protein and wild type GST.

EXAMPLES

General Methods

The methods described here may employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biolog}>, ch. 9, 13, and 16, John Wiley & Sons, New York, N. Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons J. M. Polak and James O'D.

McGee, 1990, In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, IrI Press; D. M. J. Lilley and J. E. Dahlberg, 1992, Methods ofEnzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; Using Antibodies : A Laboratory Manual : Portable Protocol NO. I by Edward Harlow, David Lane, Ed Harlow (1999, Cold Spring Harbor Laboratory Press, ISBN 0-87969-544-7); Antibodies : A Laboratory Manual by Ed Harlow (Editor), David Lane (Editor) (1988, Cold Spring Harbor Laboratory Press, ISBN 0-87969-314-2), 1855. Handbook of Drug Screening, edited by Ramakrishna Seethala, Prabhavathi B. Fernandes (2001, New York, NY, Marcel Dekker, ISBN 0-8247-0562-9); and Lab Ref: A Handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench, Edited Jane Roskams and Linda Rodgers, 2002, Cold Spring Harbor Laboratory, ISBN 0-87969-630-3. Each of these general texts is herein incorporated by reference.

Methods and materials

The following compounds are used in the following Examples. Compounds A and C are exemplified in WO2001025242 and Compound B in WO2000035442.

Compound A

Compound C

EXAMPLE 1

CXCR2 allosteric antagonist compounds such as Compound A displace IL-8 in a membrane binding assay

Method for binding assay

Preparation of Membranes

The cDNA encoding the human Chemokine receptor CXCR2 was cloned into pIRESneo2 using standard methods as described in Sambrook et al, (1989) and confirmed by sequencing.

Adherent HEK293 cells were maintained as monolayer cultures in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS and 2mM L-glutamine (All from Sigma). HEK 293 cells were transfected with CXCR2 receptor using the lipofection reagent Fugene 6 (Roche). HEK 293 cells were seeded at 4x10 ⁵ cells per well in a 6 well plate (Costar) and grown to reach 70% confluency for transfection. Fugene 6 lipofection reagent and plasmid DNA (lμg) was mixed at a ratio of 6:1 in a final volume of 500μl PBS and incubated for 15 minutes at room temperature before addition to HEK 293 cells in culture media (drop wise). Cells were then incubated over night at 37°C with an

atmosphere of 5% CO ₂ /95% air. Stable transfectants expressing CXCR2 were selected for and maintained by addition of Geneticin G418 at lmg/ml (Invitrogen). Stable HEK- CXCR2 transfectants were grown to approximately 80% confluence in 10-layer cell factories in DMEM medium containing 10% (v/v) foetal calf serum and glutamine (2 mM) in a humidified incubator at 37°C, 5% CO ₂ . Cells were harvested from the flask using Accutase at 37°C for 3 to 5 minutes.

Cells were resuspended on ice in 60 mL hypotonic buffer at a density of 2x10 ⁷ cells/mL.

Membranes were prepared on ice by homogenisaton using a polytron tissue homogenizer set at 22000 rpm. The membrane preparation was purified by sucrose gradient centrifugation. In each of 4 centrifuge tubes 15 mL of cell membranes was layered onto 10 mL 41% (w/v) sucrose solution and the tubes centrifuged at 140000 g for 1 hour at 4 ⁰ C.

The membrane fraction was harvested at the interface, diluted 4-fold with HEPES-buffered

Tyrode's solution and centrifuged at 100000 g for 20 minutes at 4 ⁰ C. The membrane pellet was re-suspended at 1x10 ^s cell equivalents/mL in HEPES-buffered Tyrode's solution and subsequently stored in aliquots at -8O ⁰ C.

AU buffers used for membrane preparation and storage were made in the presence of protease inhibitors.

Assay Protocol Radioligand Binding assay

Prior to use in an experiment, aliquots of membranes at 1x10 ⁸ cell equivalents/mL were defrosted at room temperature and diluted in HEPES-buffered salt solution.

To each well in a 96-well polypropylene plate was added [ ¹²⁵ I]IL-8 (10 μL, to a final concentration of 0.06 nM, pre-diluted to 0.6 nM in HEPES-buffered salt solution from a 9.6 nM stock) and either vehicle (10 μL, 10% (v/v) DMSO in HEPES-buffered salt solution: for determination of total binding (BO)), Compound A (10 μL, 10 μM solution in 10% (v/v) DMSO HEPES-buffered salt solution: for determination of non-specific binding (NSB)) or the appropriate solution of the different compounds or IL-8 to be tested (10 μL, 10% (v/v) DMSO in HEPES-buffered salt solution) were added to the wells of a 96-well multiscreen-filter plate (pre-wet with HEPES-buffered salt solution). Membranes (80 μL

of 1x10 ⁶ cell equivalents/mL) were then added, giving a total incubation volume of 100 μL per well. The plates were incubated for 2 hours at room temperature.

Following incubation, the plate containing the assay mixture was filter-washed with 200 μL cold HEPES-buffered salt solution using a Millipore vacuum manifold. The filtration plate was allowed to air dry then either the individual filters were punched out into polypropylene test tubes and the radioactivity measured by direct gamma counting using a

Cobra II Gamma counter (Packard BioScience) for 1 minute per sample or alternatively, the whole filtration plate was placed in a carrier plate and 50 μL of MicroScint-0 added to each well. 96-well plate scintillation counting was performed using a TopCount instrument (Packard BioScience) for 1 minute per sample well.

Figure 2 shows that the presence of Compound C is able to inhibit the binding of [ ¹²⁵ I]-TL- 8 in a CXCR2 membrane binding assay as described in example 1 and also non-radioactive IL-8 is also able to inhibit the binding of [ ¹²⁵ I]-IL-8.

Method for [ ³ H]-Compound C binding assay

To each well in a 96-well polypropylene plate was added [ ³ H] Compound C (10 μL, to a final concentration of 20 nM, from a working solution of 200 nM in HEPES-buffered salt solution) and either vehicle (10 μL, 10% (v/v) DMSO in HEPES-buffered salt solution: for determination of total binding (BO)), Compound A (10 μL, 10 μM solution in 10% (v/v) DMSO HEPES-buffered salt solution: for determination of non-specific binding (NSB)) or the appropriate solution of the different compounds or IL-8 to be tested (10 μL, 10% (v/v) DMSO in HEPES-buffered salt solution) were added to the wells of a 96-well polypropylene plate. Membranes (80 μL of 3x10 ⁶ cell equivalents/mL) were then added, giving a total incubation volume of 100 μL per well. The plates were incubated for 2 hours at room temperature

Following incubation, the plate containing the assay mixture was transferred to GF-B plates and filter-washed with cold HEPES-buffered salt solution using a Tomtec harvester.

The filtration plate was allowed to air dry then 20μl of MicroScint-0 added to each well.

96-well plate scintillation counting was performed using a TopCount instrument (Packard BioScience) for 1 minute per sample well.

As Compound C can bind to CXCR2, the ability of other compounds to bind in the same site can be described by displacement of a radio-labelled Compound C. For many compounds which bind in the same site as Compound C, this displacement correlates with inhibition of IL-8 agonist binding (Figure 3).

EXAMPLE 2

In this example, the method for membrane binding assay was used as in Example 1.

Method for HEK FLIPR assay Intracellular Calcium Measurements

HEK cells, transfected with the human recombinant CXCR2 receptor, were grown to approximately 80% confluence in 225 cm ² flasks in DMEM-Glutamax medium containing, non-essential amino acids, 10% (v/v) FCS in a humidified incubator at 37°C, 5% CO ₂ . Cells were harvested from the flask using 1Ox trypsin at 37°C for 1 to 2 minutes.

HEK 293 transfectants were seeded at 5x10 ⁴ cells per well in 96 well poly-D lysine coated black with clear bottom plates (Becton Dickinson) and cultured for 16h at 37 ⁰ C with an atmosphere of 5% CO ₂ /95% air to form confluent monolayers. The following day cells were loaded with 5μM Flura 3AM diluted in tyrodes solution (137mM NaCl, 1OmM

HEPES, 0.44ImM KH ₂ PO ₄ , 2.67mM KCl, 1.8mM CaCL ₂ , ImM MgCl ₂ ) with 6.25mM probenecid at pH7.4, lOOμl per well and incubated at 37°C with an atmosphere of 5% CO ₂ /95% air for Ih. After which the loading media was removed and the cells washed twice with PBS/HEPES solution (lOOμl per well) then overlayed with 50μl assay buffer

(tyrodes buffer without probenecid). 50μl inhibitor compound or 50μl 0.2% (v/v) DMSO carrier diluted in assay buffer was then added per well and incubated for 30 minutes at room temperature before the addition of 50μl 3mM Carbachol per well. Calcium flux responses were measured using a Fluorometric Imaging Plate Reader (Molecular Devices) for 3 minutes before the addition of either IL-8 (50μl, IxIO ^"7 - 3xlO ^'n M final

concentration) or GROalpha. All points were reproduced in triplicate on each plate. Fluorescence readings were taken every 2 seconds for a total run time of 6 minutes.

Figure 4 shows that across a series of compounds similar to Compounds A and C there is a tendency to show reduced potency in a whole cell functional assay as measured by the increase in intracellular calcium concentration using a FLIPR assay compared to a CXCR2 membrane binding assay. One interpretation of these data are that to be active in the whole cell calcium flux assay the compounds need to penetrate the membrane and therefore have a drop in potency when compared to the binding assay. If this is so then the compounds may be acting on an intracellular site.

EXAMPLE 3 The activity of Compounds A (30 nM) and B (100 nM) can be switched from being active against CXCR2 and inactive against CXCRl to inactive against CXCR2 and active against CXCRl, by exchanging the last 60 amino acid residues in the C-terminal tail of CXCR2 (residues 301 to 360) with the last 60 amino acids of CXCRl (residues 291-350). These last sixty residues are part of transmembrane domain 7 and the cytoplasmic C-terminal tail which is known to be involved in downstream signaling (Ben-Baruch et al. Journal of Biological Chemistry (1995) 9121).

Methods

The cDNAs encoding the human Chemokine receptors CXCRl and CXCR2 were cloned into pIRESneo2 using standard methods as described in Sambrook et al, (1989) and confirmed by sequencing. Using these plasmids as a template CXCRl and CXCR2 Chimeras, CXCRl (amino acids l-290)/CXCR2 (amino acids 301 to 360) and CXCR2 (amino acids l-300)/CXCRl (amino acids 291-350) were generated by ligating Xcm I restriction fragments of CXCRl and CXCR2 (where the last 60 amino acids of the carboxy terminus from each receptor are swapped). Briefly 3μg CXCRl/pIRESneo2 and 3μg CXCR2/pIRESneo2 were digested with the restriction enzymes Xcm I and Not I then separated on a 1% agarose gel. Restriction enzyme digests resulted in the presence of two

DNA fragments per plasmid. The larger fragment encoding the plasmid pIRESneo2 and either CXCRl (amino acids 1-290) or CXCR2 (amino acids 1-300) and the smaller DNA fragment encoding the last 60 amino acids of each receptor CXCRl (amino acids 291-350) or CXCR2 (amino acids 301 to 360). DNA fractions were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen) following manufacturer's instructions. The DNA fractions encoding the plasmid DNA and either CXCRl (amino acids 1-290) or CXCR2 (amino acids 1-300) were dephosphorylated using calf intestinal alkaline phosphatase (Invitrogen). CXCRl and CXCR2 chimeras were generated by ligating pIRESneo2 CXCRl (amino acids 1-290) DNA with the DNA encoding CXCR2 (amino acids 300-360) and pIRESneo2 CXCR2 (amino acids 1-300) DNA with the DNA encoding CXCRl (amino acids 291-350) using T4 DNA ligase (New England Biolabs) at 16°C overnight. DNA ligations were transformed into competent TOP 10 E. coli (Invitrogen) and positive colonies were screened and confirmed by DNA sequencing. A schematic diagram of the constructs generated is shown in Figure 5.

Adherent HΕK 293 cells were maintained as monolayer cultures in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS and 2mM L-glutamine (All from Sigma). HEK 293 cells were transfected with CXCRl and CXCR2 receptor chimeras and mutant plasmids using the lipofection reagent Fugene 6 (Roche). HEK 293 cells were seeded at 4x10 ⁵ cells per well in a 6 well plate (Costar) and grown to reach 70% confluency for transfection. Fugene 6 lipofection reagent and plasmid DNA (lμg) was mixed at a ratio of 6:1 in a final volume of 500μl PBS and incubated for 15 minutes at room temperature before addition to HEK 293 cells in culture media (drop wise). Cells were then incubated over night at 37°C with an atmosphere of 5% CO ₂ /95% air. Stable transfectants expressing CXCRl and CXCR2 mutants and chimeras were selected for and maintained by addition of Geneticin G418 at lmg/ml (Invitrogen). Transfected cell populations were then screened for responses to IL-8 and GRO-α by measuring intracellular calcium flux using the method as described in Example 2.

Initially, experiments were performed to check that the chimeras still had correct functional responses to their ligands. Figures 6 and 7 show that both CXCRl/2 and CXCR2/1 chimeras responded correctly to their respective ligand despite having the C-

terminal residues of the opposing receptor. These data confirm that of Denise Merz et al. presented at ACR, ("The Phosphate Transporter Pit-1 is Upregulated in Osteoarthritic Cartilage and Promotes Chondrocyte Hypertrophy" Category: 06 Cartilage biology and pathogenesis of osteoarthritis Presentation Number: 1076 and that of Ahjuja et al. (Journal of Biological Chemistry 271 :225-232 (1996)).

Secondly, the ability of Compound A (at 3OnM) to inhibit the calcium flux induced by the chimeric proteins in HEK cells was tested. The results are shown in Figures 8 and 9.

Very similar data to that obtained with 3OnM Compound A were obtained using Compound B at 10OnM (not shown). These data suggest that a particular amino acid or amino acids found in the last 56 (not 60 as the first 4 of these are identical in CXCR2 and CXCRl) amino acids of CXCR2 are at least in part responsible for compound binding as the capability of the chimeric receptors to be inhibited by compounds is changed but their ability to signal in the presence of IL-8 ligand remains unaltered.

EXAMPLE 4

Using similar methods to Example 3 it was shown that compound activity is not affected by exchanging the last 35 amino acid residues in the C-terminal tail of CXCRl and CXCR2.

Methods

To generate CXCRl and CXCR2 chimeras CXCRl (amino acids 1-316)/CXCR2 (amino acids 327-360) (CXCR l/2short) and CXCR2 (amino acids l-326)/CXCRl (amino acids 317- 350) (CXCR2/1 short), AfIII restriction enzymes sites were introduced into the DNA sequences of both receptors by mutagenesis using the QuikChange XL Site Directed Mutagenesis Kit (Stratagene) following manufacturer's directions. Mutagenesis primers are detailed in Table 1 (CXCRl AfIF, CXCRl AfIR, CXCR2 AfIF and CXCR2 AFlR).

TABLE 1

CXCR1/CXCR2 MUTAGENESIS PRIMERS

Mutagenesis Primer Sequence 5'- 3'

CXCRl AfIF CCATGGATTCCTTAAGATCCTGGCTATG CXCRl AfIR CATAGCCAGGATCTTAAGGAATCCATGG CXCR2 AfIF GCCATGGACTCCTTAAGATTCTAGCTATAC CXCR2 AfIR GTATAGCTAGAATCTTAAGGAGTCCATGGC CXCR1 N311K F CTTCATCGGCCAAAAGTTTCGCCATGGATTC CXCR1 N311K R GAATCCATGGCGAAACTTTTGGCCGATGAAG CXCRl F316L F CAAAATTTTCGCCATGGACTCCTCAAGATCCTGG CXCRl F316L R CCAGGATCTTGAGGAGTCCATGGCGAAAATTTTG CXCR2 K320N F CCTTCATTGGCCAGAATTTTCGCCATGGACTC CXCR2 K320N R GAGTCCATGGCGAAAATTCTGGCCAATGAAGG CXCRl N311K/F316L F CATCGGCCAAAAGTTTCGCCATGGACTCCTCAAGATC CXCRl N311K/F316L R GATCTTGAGGAGTCCATGGCGAAACTTTTGGCCGATG CXCR2 K320N/L325F F CTTCATTGGCCAGAATTTTCGCCATGGATTCCTCAAGATT( CXCR2 K320N/L325F R GAATCTTGAGGAATCCATGGCGAAAATTCTGGCCAATGAJ

The human Chemokine receptors CXCRl and CXCR2 cloned into pIRESneo2 were used as a template for these reactions. Positive colonies were screened and confirmed by DNA sequencing. Using the AfIII mutated plasmids as a template CXCRl and CXCR2 Chimera's CXCRl (amino acids 1-316)/CXCR2 (amino acids 327-360) and CXCR2 (amino acids l-326)/CXCRl (amino acids 317-350) were generated by ligating AfIII restriction fragments of CXCRl and CXCR2 (where the last 34 amino acids of the carboxy terminus from each receptor are swapped). Briefly lμg CXCRl/pIRESneo2 AfI II mutant DNA and lμg CXCR2/pIRESneo2 AfIII mutant DNA were digested with the restriction enzymes AfIII and Notl then separated on a 1% agarose gel. Restriction enzyme digests resulted in the presence of two DNA fragments per plasmid. The larger fragment encoding the plasmid pIRESneo2 and either CXCRl (amino acids 1-316) or CXCR2 (amino acids 1- 326) and the smaller DNA fragment encoding the last 34 amino acids of each receptor

CXCRl (amino acids 317-350) or CXCR2 (amino acids 327-360). DNA fractions were excised from the gel and purified using QIAquick Gel Extraction kit (Qiagen) following manufacturer's instructions. The DNA fractions encoding the plasmid DNA and either CXCRl (amino acids 1-316) or CXCR2 (amino acids 1-326) were dephosphorylated using calf intestinal alkaline phosphatase (Invitrogen). The CXCRl and CXCR2 chimeras were therefore generated by ligating pIRESneo2 CXCRl large fragment (encoding amino acids 1-316) with CXCR2 small fragment (encoding amino acids 327-360) and pIRESneo2 CXCR2 large fragment (amino acids 1-326) with CXCRl small fragment (amino acids 317-350) using T4 DNA ligase (New England Biolabs) at 16°C overnight. DNA ligations were transformed into competent TOP 10 E. coli (Invitrogen) and positive colonies were screened and confirmed by DNA sequencing. A schematic diagram of the constructs generated is shown in Figure 10.

These two new constructs were transfected into HEK 293 cells as described in Example 3. The ability of the chimeric constructs to signal to IL-8 and GROalpha (data not shown) was unchanged and, when tested in the presence of Compound A and B at 3OnM and 10OnM respectively, the compounds did not inhibit the CXCRl/2short but did inhibit the CXCR2/lshort (Figure 11).

The data in Figure 11 coupled with information in Example 3 indicates that residues required for Compound A and B binding, and compounds in similar series, are located between amino acids 304 to 326 in CXCR2. The majority of this region lies within the intracellular part of the receptor (Figure 1).

EXAMPLE 5

The activity of Compounds A (10 nM and 30 nM) and B (100 nM) can be switched from being active against CXCR2 and inactive against CXCRl to inactive against CXCR2 and active against CXCRl by exchanging the single amino acid residue lysine320 in CXCR2 and the equivalent asparagine residue in CXCRl (asn310).

Cloning CXCRl and CXCR2 receptor mutants: CXCRl N311K. CXCRl F316L. CXCR2 K32QN. CXCRl N311K/F316L and CXCR2 K320N/L325F

Using CXCRl pIRESneo2 and CXCR2 pIRESneo2 plasmids as a templates, DNA primers with single or double base mismatches (Table 1) were designed to generate the following receptor mutants CXCRl N311K, CXCRl F316L, CXCR2 K320N, CXCRl N311K/F316L and CXCR2 K320N/L325F using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene) following manufacturer's directions. Positive colonies were screened and confirmed by DNA sequencing.

A schematic diagram of these new constructs is shown in Figure 12.

The constructs were transfected into HEK cells as above (Example 5) and selected in media containing G418. Their response to the ligand IL-8 was tested using the whole cell calcium flux assays in the presence and absence of Compounds A and B. Figures 13, 14 and 15 show the effect of the compounds on the ability of the ligand to cause a change in intracellular calcium concentrations.

Figure 13 shows that substituting both the asn at position 311 and the phe at position 316 in CXCRl with a lysine and leucine respectively causes an increase in the ability of the compounds to inhibit the mutant receptor. The equivalent substitution of amino acids in CXCR2 causes a decrease in the ability of the compounds to inhibit the mutant CXCR2 receptor.

Figure 14 shows that when only phe316 in CXCRl is mutated to leucine there is no effect on agonist potency or antagonist pharmacology. However when only the asn at position

311 in CXCRl is mutated to a lysine (Figure 15) there is a dramatic increase in antagonist potency in the mutant receptor and a similar decrease in antagonist potency on the equivalent CXCR2 K320N mutant. These data suggest that the antagonists exemplified by

Compound A and Compound B require lysine 320 in order to functionally antagonise CXCR2. Because wild type CXCRl does not have this residue the compounds are inactive at the concentration tested against CXCRl. A sequence alignment of the CXCR2 coding sequence with other GPCRs and bovine rhodopsin was generated using ClustalW and it

was shown that the equivalent residue to K320 in CXCR2 is also a lysine in several Chemokine receptors including, CCR2, CX ₃ CRl, CCR4, CCR5 and CCR7 (Figure 18).

EXAMPLE 6

Using assays similar to those in Example 1 and Example 2 it was shown that Compound A and Compound F are active at the concentration tested against a number of Chemokine receptors. These include CCRl, CXCR2, CXCRl, CCR2, CX ₃ CRl, CCR4, CCR5 and CCR7 (Table 2). As Compound A binds to an intracellular allosteric binding site of CXCR2, and Compound F is a very closely related compound from the same series, it indicates that a similar novel intracellular binding site as described for CXCR2 exists in a variety of related Chemokine receptors and can be used to inhibit them via an allosteric interaction. Changes in activity against different receptors is likely to be caused by small differences in receptor sequence or to changes in a second shell of residues around the binding site which affects the precise position and orientation of the amino acids in the first shell.

Compound F

TABLE 2

EXAMPLE 7

1) CXCR2 Model Generation

A sequence alignment of the CXCR2 coding sequence with other GPCRs and bovine rhodopsin was generated using ClustalW with default settings and then modified to reflect known trans-membrane defining motifs. This alignment along with the structure of bovine rhodopsin (119h.pdb) were used as input to Modeller version 5, run through the insightll 2000 interface with default settings. A total of 20 models were produced. Of these, for the initial analysis, the structure with the lowest penalty function was used. Hydrogens and charges were subsequently added in Sybyl version 6.9 and siteID was used to visualise the binding site cavities. The resulting model was then used as the structure for subsequent dockings using GOLD version 2.12 and for selecting residues for mutagenesis.

TABLE 3 lists the PDB coordinate file of CXCR2 homology model

The intracellular domain portion of CXCR2, based on alignments with bovine rhodopsin comprises amino acid residues S67 to D94, residues G133 to S173, residues 1221 to F260 and residues S307 to L360. The intracellular allosteric binding site contains one or more of amino acids S81, V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, R144,

A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321of CXCR2 and their equivalent residues based on alignment with bovine rhodopsin as seen in Figure 19.

EXAMPLE 8

Docking of ligands into the intracellular binding site using GOLD. The native protein homology model structure may be further refined by first manually docking an active compound into the site and rearranging a minimal number of side chains to accommodate the ligand and to match known SAR and mutagenesis. The protein co-ordinates may then be refined, such as by minimisation, if necessary. Once prepared, a set of ligands — built using CORTNA, or another suitable 3D coordinate generation program - would be docked in using the program GOLD. This is an automated procedure, but several parameters may be optimised to reproduce known SAR in the dockings. Once the docking protocol is established and is demonstrated to successfully dock in known ligands in a manner consistent with known SAR, novel compounds with unknown affinity for the target protein can then be docked in. Top ranking compounds can then be selected for purchase, synthesis, used as reagents in library synthesis and/or testing. The top ranking compounds could also be scored using an external scoring routine - e.g. CSCORE to further refine the selection. The above protocol would be very similar for other docking routines, such as GLIDE.

EXAMPLE 9

Design of compounds using sequence analysis and ID and 2D information.

Figure 16 shows the sequence alignment of the first shell of residues surrounding the proposed binding site identified in CXCR2 and applied to other GPCRs. There is considerable conservation of sequence. A PCA plot of the properties of the residues is shown in Figure 17. The targets with known intracellular binding sites as described in

Example 6 are highlighted as stars. The position of the targets with known intracellular binding sites relative to other Chemokine receptors, and the sequence similarity suggests that it is likely that other Chemokine receptors and GPCRs will also have similar sites.

Differences in SAR between Chemokine receptors may be due either to small differences in sequence or to changes in a second shell of residues around the binding site which affects the precise position and orientation of the amino acids in the first shell. Descriptors of the amino acids and the type of functional groups that individual amino acid types associate with, can be used in the absence of structural information to suggest chemical scaffolds, reagents or chemistries for library synthesis and/or to suggest compounds for purchase/synthesis.

EXAMPLE 10 Disulfide trapping: a method to detect whether a candidate compound forms associations with one or more amino particular acid residues

Disulfide trapping is a method that was used by Buck E and Wells JA (2005, PNAS USA 102(8):2719-24) to localize small-molecule agonists and antagonists for the C5a receptor, a GPCR. The method may be used in an assay according to the first aspect of the present invention.

Disulfide trapping may be used to identify candidate compounds that bind to one or more particular amino acid residues of the intracellular allosteric site of a GPCR, wherein the particular amino acids are those corresponding to any one of amino acid residues S81,

V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 of CXCR2, or to any one of amino acid residues 301 to 360 of CXCR2 (including to any one of amino acid residues 304 to 326 of CXCR2).

Firstly GPCR mutants (or variants, homologues, derivatives or fragments thereof) are specifically engineered, where one or more of the particular amino acid residues is converted to a cysteine. Binding studies are then performed on cells or membranes isolated from cells transfected with the mutant, using a library of thiol-containing small molecules or cysteine-containing peptide receptors under reducing conditions, allowing the

formation of disulfide bonds. This methodology allows for the identification of weak- binding ligands (candidate compounds) that are associated specifically with the particular amino acid residue(s) of interest.

EXAMPLE 11

Photoaffinity labelling: a method to detect whether a candidate compound forms associations with one or more amino particular acid residues

The method of photoaffinity labelling and proteomic characterisation was described in Murray et al (Nature Chemical Biology 2005, 1 :371). The method may be used in an assay according to the first aspect of the present invention, by identifying the residues directly involved in candidate compound binding.

Photoaffinity labelling and proteomic characterisation may be used to identify candidate compounds that bind to one or more particular amino acid residues of the intracellular allosteric site of a GPCR, wherein the particular amino acids are those corresponding to any one of amino acid residues S81, V82, T83, D84, Y86, L87, L90, G133, L136, L137, 1140, D143, R144, A147, Q157, Q245, K246, A249, V252, 1253, V256, 1259, L309, N310, P311, 1313, Y314, 1317, G318, Q319, K320, F321 of CXCR2, or to any one of amino acid residues 301 to 360 of CXCR2 (including to any one of amino acid residues 304 to 326 of CXCR2).

One example uses Compound A (which we have shown to interact with the intracellular site of CXCR2) or compounds from the same chemical series. The compound is labelled with a radio- and photoaffinity label (probe compound). The precise position of the radiolabel and photoaffinity label in the new compound is determined by the SAR of the compound series, the physico-chemical properties of the compound series and the route of synthesis of the compound as determined by one skilled in the art. This new photoaffinity

compound is then used to probe membranes of cells expressing the GPCR of interest and should be able to bind covalently upon photoaffinity labelling to amino acid residues which make up the compound binding site. The specificity of photoaffmity compound binding is determined by carrying out the experiment in increasing concentrations of cold compound (eg Compound A) which binds to the same site and so competes off the probe compound before affinity labelling at increasing concentrations of cold compound.

Once the specific binding of the probe compound has been identified, cell membranes containing the target GPCR are photoaffmity labelled with the probe compound. The membranes are then treated with a suitable detergent (eg. digitonin) to extract the proteins and the extracted protein is resolved by poryacrylamide gel electrophoresis to check that the protein is labelled.

To identify the position where the protein is labelled, the solubilised, photoaffmity labelled protein and control-untreated protein are proteolytically cleaved with agents well known in the art such as trypsin and cyanogen bromide to release peptides with known cleavage sites. Due to their cleavage site sequence, the mass and properties of these peptides can be predicted from the primary amino-acid sequence of the target GPCR protein.

The peptides are fractionated on the basis of size, charge and hydrophobiciry using techniques well known in the art in order to separate them. The fractions containing radiolabel are likely to contain a peptide which has the photoaffinity compound covalently attached to it.

Any individual peptide isolated with the photoaffinity label covalently attached will be larger in molecular mass then the equivalent peptide from membranes which have not been photoaffinity labelled.

As the sequence of the target GPCR is known, any peptide which is found to be larger molecular mass in photo-affinity membranes compared to peptides released from untreated

membranes contains specific amino acid residues which are adjacent to, or form part of the compound binding site in the nascent molecule.

EXAMPLE 12

Radio-ligand binding to GST-CXCR2 C terminal tail

An expression construct which encodes for S. Japonicum glutathione-S-transferase (GST) fused to the last 43 amino acids of human CXCR2 (residues G318 to L360) was generated by standard molecular biological techniques.

The predicted sequence of the GST-CXCR2-C-tail fusion protein is shown below (CXCR2 sequence is underlined, GST sequence is not underlined).

MSPILGYWKI KGLVQPTRLL LEYLEEKYEE HLYERDEGDK WRNKKFΞLGL EFPNLPYYID

GDVKLTQSMA IIRYIADKHN MLGGCPKΞRA EISMLΞGAVL DIRYGVSRIA YSKDFETLKV

DFLSKLPEML KMFEDRLCHK TYLNGDHVTH PDFMLYDALD WLYMDPMCL DAFPKLVCFK

KRIEAIPQID KYLKSSKYIA WPLQGWQATF GGGDHPPKGS LVPRGSGOKF RHGLLKILAI

HGLISKDSLP KDSRPSFVGS SSGHTSTTL

The protein was expressed in E. coli and the resulting fusion protein was purified from the cell extract via chromatography using a 5ml GSTrap column (Amersham) which binds GST containing proteins, and eluted using 1OmM reduced glutathione in the elution buffer. At the same time GST without a CXCR2 C-terminal tail was also expressed and purified as a control. Both proteins had the excess 1OmM glutathione removed using a XK26/10 desalting column (Amersham).

The purified proteins were used in a radioligand binding assay.

Radio-ligand binding assay

To each well in a 96-well polypropylene plate was added [ ³ H]Compound A (20 μL, to a final concentration of 20 nM, from a working solution of 5OmM Phosphate-buffered salt solution) and either vehicle (20 μL, 10% (v/v) DMSO in Phosphate-buffered salt solution: for determination of total binding (BO)), or Compound A (20 μL, ImM solution in 10% (v/v) DMSO phosphate-buffered salt solution: for determination of non-specific binding (NSB)) were added to the wells of a 96-well polypropylene plate. Protein solutions (50 μL dilutions starting at 1.28mg/ml) of either GST-CXCR2 fusion or wild type GST were then added, giving a total incubation volume of 200 μL per well. The plates were incubated for 2 hours at room temperature.

A GF-B filter plate was set up containing 50μl of lmg/ml gelatine in PBS in each well, which was then filtered through the plate and discarded. lOOμl filter mix (160mg/ml charcoal (dextran coated) in PBS containing lmg/ml gelatine) was then filtered through the plate and then 150μl assay mix was then filtered through the prepared filter plate (The charcoal catches the excess un-bound compound). After filtering, lOOμl filtrate was transferred to a lumaplate and dried down in a 5O ⁰ C oven overnight and then counted on the TopCount instrument (Packard BioScience)

Figure 21 shows results of the radioligand binding assay using [ ³ H]Compound A with GST-CXCR2 fusion protein and wild type GST. The data in Figure 21 is the average of three separate experiments. As can be seen as expected on diluting the GST-CXCR2 protein less radio-labelled compound can bind. Using the wild type GST control protein there is minimal compound binding. On the addition of excess cold compound there is a decrease in radiolabeled binding to the GST-CXCR2 fusion protein but no effect with the wild type GST.

EXAMPLE 13

Alternative method to express the C-terminal portion of a G-protein coupled receptor to generate protein that is membrane bound or extracted from a cell lysate using a detergent

5

The C-terminal domain and transmembrane helix 7 domain of GPCRs is expressed by a method described in Carillo et al. Molecular Pharmacology 66 1123-1137 (2004). This paper describes expression of various mutant transmembrane domains of the αlb- adrenoceptor in HEK293 cells. The paper exemplifies a TM7 construct that contains the io N-terminal 44 amino acids of the αlb-adrenoceptor fused to the TM7 helix and the C- terminal tail of the same receptor. The N-terminal 44 amino acids are necessary for targeting expression of the protein to the membrane. In the paper, this mutant construct was shown to express in HEK293 cells after transient transfection and the mutant protein was extracted from the cell using a detergent-containing buffer.

I ₅

Similar mutant proteins derived from the sequence of other GPCRs could be suitable proteins to test in compound binding. Alternatively the membrane fraction from these cells expressing the mutant proteins could be used to measure compound binding to the C- terminal portion of the protein expressed in the membranes. 0

TABLE 3

HEADER CXCR2 IMOD

COMPND CXCR2 IMOD

REMARK GENERATED BY SYBYL (TRIPOS, INC. ) 15-DEC-04 IMOD

SEQRES 1 356 MET GLU ASP PHE ASN MET GLU SER ASP SER PHE GLU IMOD

SEQRES 2 356 PHE TRP LYS GLY GLU ASP LEU SER ASN TYR SER TYR IMOD

SEQRES 3 356 SER THR LEU PRO PRO PHE LEU LEU ASP ALA ALA PRO IMOD

SEQRES 4 356 GLU PRO GLU SER LEU GLU ILE ASN LYS TYR PHE VAL IMOD

SEQRES 5 356 ILE ILE TYR ALA LEU VAL PHE LEU LEU SER LEU LEU IMOD

SEQRES 6 356 ASN SER LEU VAL MET LEU VAL ILE LEU TYR SER ARG IMOD

SEQRES 7 356 GLY ARG SER VAL THR ASP VAL TYR LEU LEU ASN LEU IMOD

SEQRES 8 356 LEU ALA ASP LEU LEU PHE ALA LEU THR LEU PRO ILE IMOD

SEQRES 9 356 ALA ALA SER LYS VAL ASN GLY TRP ILE PHE GLY THR IMOD

SEQRES 10 356 LEU CYS LYS VAL VAL SER LEU LEU LYS GLU VAL ASN IMOD

SEQRES 11 356 TYR SER GLY ILE LEU LEU LEU ALA CYS ILE SER VAL IMOD

SEQRES 12 356 ARG TYR LEU ALA ILE VAL HIS ALA THR ARG THR LEU IMOD

SEQRES 13 356 GLN LYS ARG TYR LEU VAL LYS PHE ILE CYS LEU SER IMOD

SEQRES 14 356 TRP GLY LEU SER LEU LEU LEU ALA LEU PRO VAL LEU IMOD

SEQRES 15 356 PHE ARG ARG THR VAL TYR SER SER ASN VAL SER PRO IMOD

SEQRES 16 356 CYS TYR GLU ASP MET GLY ASN ASN THR ALA ASN TRP IMOD

SEQRES 17 356 MET LEU LEU ARG ILE LEU PRO GLN SER PHE GLY PHE IMOD

SEQRES 18 356 VAL PRO LEU LEU ILE MET LEU PHE CYS TYR GLY PHE IMOD

SEQRES 19 356 LEU ARG THR LEU PHE LYS ALA HIS MET GLY GLN LYS IMOD

SEQRES 20 356 ARG ALA MET ARG VAL ILE PHE ALA VAL VAL LEU ILE IMOD

SEQRES 21 356 LEU LEU CYS TRP LEU PRO TYR ASN LEU VAL LEU LEU IMOD

SEQRES 22 356 ASP THR LEU MET ARG THR GLN VAL ILE GLN GLU THR IMOD

SEQRES 23 356 GLU ARG ARG ASN HIS ILE ASP ARG ALA LEU ASP ALA IMOD

SEQRES 24 356 GLU ILE LEU GLY ILE LEU HIS SER CYS LEU ASN PRO IMOD

SEQRES 25 356 ILE TYR ALA PHE ILE GLY GLN LYS PHE ARG HIS GLY IMOD

SEQRES 26 356 LEU LYS ILE LEU ALA ILE HIS GLY LEU ILE SER LYS IMOD

SEQRES 27 356 SER LEU PRO LYS ASP SER ARG PRO SER PHE VAL GLY IMOD

SEQRES 28 356 SER SER GLY HIS THR IMOD

ATOM 1 N MET 1 -9. 842 -43 .057 -21 .943 1.00 0 .00 IMOD

ATOM 2 CA MET 1 -10. 643 -43 .934 -22 .828 1.00 0 .00 IMOD

ATOM 3 C MET 1 -10. 288 -43 .657 -24 .246 1.00 0 .00 IMOD

ATOM 4 O MET 1 -9. 142 -43 .337 -24 .558 1.00 0 .00 IMOD

ATOM 5 CB MET 1 -12. 146 -43 .668 -22 .639 1.00 0 .00 IMOD

ATOM 6 CG MET 1 -12. 645 -44 .019 -21 .235 1.00 0 .00 IMOD

ATOM 7 SD MET 1 -14. 389 -43 .621 -20 .905 1.00 0 .00 IMOD

ATOM 8 CE MET 1 -14. 273 -43 .898 -19 .113 1.00 0 .00 IMOD

ATOM 9 N GLU 2 -11. 271 -43 .782 -25 .155 1.00 0 .00 IMOD

ATOM 10 CA GLU 2 -10. 962 -43 .520 -26 .526 1.00 0 .00 IMOD

ATOM 11 C GLU 2 -10. 605 -42 .075 -26 .611 1.00 0 .00 IMOD

ATOM 12 O GLU 2 -11. 382 -41 .212 -26 .211 1.00 0 .00 IMOD

ATOM 13 CB GLU 2 -12. 155 -43 .762 -27 .468 1.00 0 .00 IMOD

ATOM 14 CG GLU 2 -12. 552 -45 .235 -27 .579 1.00 0 .00 IMOD

ATOM 15 CD GLU 2 -13. 868 -45 .305 -28 .337 1.00 0 .00 IMOD

ATOM 16 OEl GLU 2 -14. 597 -44 .278 -28 .348 1.00 0 .00 IMOD

ATOM 17 OE2 GLU 2 -14. 164 -46 .387 -28 .912 1.00 0 .00 IMOD

ATOM 18 N ASP 3 -9. 398 -41 .776 -27 .123 1.00 0 .00 IMOD

ATOM 19 CA ASP 3 -9. 002 -40 .406 -27 .252 1.00 0 .00 IMOD

ATOM 20 C ASP 3 -9. 849 -39 .767 -28 .299 1.00 0 .00 IMOD

ATOM 21 O ASP 3 -10. 264 -38 .619 -28 .156 1.00 0 .00 IMOD

ATOM 22 CB ASP 3 -7. 528 -40 .221 -27 .660 1.00 0 .00 IMOD

ATOM 23 CG ASP 3 -6. 674 -40 .544 -26 .445 1.00 0 .00 IMOD

ATOM 24 ODl ASP 3 -7. 247 -40 .598 -25 .324 1.00 0 .00 IMOD

ATOM 25 OD2 ASP 3 -5. 441 -40 .735 -26 .613 1.00 0 .00 IMOD

ATOM 26 N PHE 4 -10. 153 -40 .506 -29 .382 1.00 0 .00 IMOD

ATOM 27 CA PHE 4 -10. 887 -39 .884 -30 .442 1.00 0 .00 IMOD

ATOM 28 C PHE 4 -12. 309 -40 .326 -30 .368 1.00 0 .00 IMOD

ATOM 29 O PHE 4 -12. 608 -41 .469 -30 .027 1.00 0 .00 IMOD

ATOM 30 CB PHE 4 -10.392 -40.262 -31.848 .00 0.00 IMOD

ATOM 31 CG PHE 4 -8.961 -39.868 -31.958 .00 0.00 IMOD

ATOM 32 CDl PHE 4 -8.608 -38.602 -32.365 .00 0.00 IMOD

ATOM 33 CD2 PHE 4 -7.973 -40.772 -31.641 .00 0.00 IMOD

ATOM 34 CEl PHE 4 -7.283 -38.251 -32.463 .00 0.00 IMOD

ATOM 35 CE2 PHE 4 -6.647 -40.423 -31.741 .00 0.00 IMOD

ATOM 36 CZ PHE 4 -6.301 -39.160 -32.152 .00 0.00 IMOD

ATOM 37 N ASN 5 -13.231 -39.396 -30.678 .00 0.00 IMOD

ATOM 38 CA ASN 5 -14.620 -39.728 -30.705 .00 0.00 IMOD

ATOM 39 C ASN 5 -15.072 -39.472 -32.104 .00 0.00 IMOD

ATOM 40 O ASN 5 -14.488 -38.654 -32.814 .00 0.00 IMOD

ATOM 41 CB ASN 5 -15.489 -38.889 -29.749 .00 0.00 IMOD

ATOM 42 CG ASN -15.381 -37.431 -30.165 .00 0.00 IMOD

ATOM 43 ODl ASN 5 -14.289 -36.869 -30.232 .00 0.00 IMOD

ATOM 44 ND2 ASN 5 -16.548 -36.798 -30.461 .00 0.00 IMOD

ATOM 45 N MET 6 -16.117 -40.194 -32.547 .00 0.00 IMOD

ATOM 46 CA MET 6 -16.578 -40.036 -33.893 .00 0.00 IMOD

ATOM 47 C MET 6 -17.253 -38.706 -33.983 .00 0.00 IMOD

ATOM 48 O MET 6 -17.801 -38.215 -32.998 .00 0.00 IMOD

ATOM 49 CB MET 6 -17.574 -41.124 -34.322 .00 0.00 IMOD

ATOM 50 CG MET 6 -17.720 -41.251 -35.838 .00 0.00 IMOD

ATOM 51 SD MET 6 -18.787 -42.625 -36.355 .00 0.00 IMOD

ATOM 52 CE MET 6 -17.805 -43.885 -35.489 .00 0.00 IMOD

ATOM 53 N GLU 7 -17.204 -38.072 -35.173 .00 0.00 IMOD

ATOM 54 CA GLU 7 -17.796 -36.775 -35.317 .00 0.00 IMOD

ATOM 55 C GLU 7 -18.499 -36.693 -36.628 1.00 0.00 IMOD

ATOM 56 O GLU 7 -18.278 -37.500 -37.530 .00 0.00 IMOD

ATOM 57 CB GLU 7 -16.773 -35.628 -35.350 .00 0.00 IMOD

ATOM 58 CG GLU 7 -16.151 -35.297 -33.995 .00 0.00 IMOD

ATOM 59 CD GLU 7 -17.125 -34.371 -33.279 .00 0.00 IMOD

ATOM 60 OEl GLU 7 -18.102 -33.925 -33.939 .00 0.00 IMOD

ATOM 61 OE2 GLU 7 -16.904 -34.089 -32.071 .00 0.00 IMOD

ATOM 62 N SER 8 -19.401 -35.699 -36.733 .00 0.00 IMOD

ATOM 63 CA SER 8 -20.056 -35.382 -37.963 .00 0.00 IMOD

ATOM 64 C SER 8 -19.536 -34.021 -38.278 .00 0.00 IMOD

ATOM 65 O SER 8 -19.465 -33.164 -37.397 .00 0.00 IMOD

ATOM 66 CB SER 8 -21.587 -35.291 -37.839 .00 0.00 IMOD

ATOM 67 OG SER 8 -22.128 -36.568 -37.535 .00 0.00 IMOD

ATOM 68 N ASP 9 -19.132 -33.777 -39.537 .00 0.00 IMOD

ATOM 69 CA ASP 9 -18.545 -32.498 -39.800 .00 0.00 IMOD

ATOM 70 C ASP 9 -19.607 -31.455 -39.844 .00 0.00 IMOD

ATOM 71 O ASP 9 -20.756 -31.717 -40.196 .00 0.00 IMOD

ATOM 72 CB ASP 9 -17.704 -32.445 -41.085 .00 0.00 IMOD

ATOM 73 CG ASP 9 -16.392 -33.148 -40.759 .00 0.00 IMOD

ATOM 74 ODl ASP 9 -16.038 -33.187 -39.550 .00 0.00 IMOD

ATOM 75 OD2 ASP 9 -15.725 -33.652 -41.701 .00 0.00 IMOD

ATOM 76 N SER 10 -19.227 -30.222 -39.459 .00 0.00 IMOD

ATOM 77 CA SER 10 -20.168 -29.147 -39.434 .00 0.00 ^■ 1MOD

ATOM 78 C SER 10 -19.571 -28.018 -40.203 .00 0.00 IMOD

ATOM 79 O SER 10 -18.386 -28.025 -40.529 .00 0.00 IMOD

ATOM 80 CB SER 10 -20.455 -28.611 -38.020 .00 0.00 IMOD

ATOM 81 OG SER 10 -21.380 -27.537 -38.083 .00 0.00 IMOD

ATOM 82 N PHE 11 -20.417 -27.030 -40.544 .00 0.00 IMOD

ATOM 83 CA PHE 11 -19.974 -25.875 -41.263 .00 0.00 IMOD

ATOM 84 C PHE 11 -19.509 -24.884 -40.249 .00 0.00 IMOD

ATOM 85 O PHE 11 -19.874 -24.964 -39.077 ,00 0.00 IMOD

ATOM 86 CB PHE 11 -21.081 -25.238 -42.120 .00 0.00 IMOD

ATOM 87 CG PHE 11 -20.515 -24.047 -42.813 .00 0.00 IMOD

ATOM 88 CDl PHE 11 -19.634 -24.191 -43.861 ,00 0.00 IMOD

ATOM 89 CD2 PHE 11 -20.883 -22.781 -42.423 00 0.00 IMOD

ATOM 90 CEl PHE 11 -19.119 -23.086 -44.497 00 0.00 IMOD

ATOM 91 CE2 PHE 11 -20.374 -21.672 -43.054 00 0.00 IMOD

ATOM 92 CZ PHE 11 -19.487 -21.823 -44.093 .00 0.00 IMOD

ATOM 93 N GLU 12 -18.665 -23.925 -40.677 00 0.00 IMOD

ATOM 94 CA GLU 12 -18.155 -22.966 -39.744 1.00 0.00 IMOD

ATOM 95 C GLU 12 -17.464 -23.726 -38.667 00 0.00 IMOD

ATOM 96 O GLU 12 -17.613 -23.413 -37.486 00 0.00 IMOD

ATOM 97 CB GLU 12 -19.254 -22.151 -39.042 00 0.00 IMOD

ATOM 98 CG GLU 12 -20.045 -21.214 -39.953 00 0.00 IMOD

ATOM 99 CD GLU 12 -21.107 -20.562 -39.080 00 0.00 IMOD

ATOM 100 OEl GLU 12 -22.096 -21.265 -38.735 1.00 0.00 IMOD

ATOM 101 OE2 GLU 12 -20.938 -19.366 -38.727 .00 0.00 IMOD

ATOM 102 N ASP 13 -16.691 -24.757 -39.050 .00 0.00 IMOD

ATOM 103 CA ASP 13 -16.015 -25.514 -38.044 .00 0.00 IMOD

ATOM 104 C ASP 13 -15.137 -24.574 -37.300 .00 0.00 IMOD

ATOM 105 O ASP 13 -14.316 -23.870 -37.882 .00 0.00 IMOD

ATOM 106 CB ASP 13 -15.119 -26.635 -38.592 .00 0.00 IMOD

ATOM 107 CG ASP 13 -16.019 -27.787 -38.997 .00 0.00 IMOD

ATOM 108 ODl ASP 13 -17.089 -27.944 -38.352 .00 0.00 IMOD

ATOM 109 OD2 ASP 13 -15.651 -28.526 -39.950 .00 0.00 IMOD

ATOM 110 N PHE 14 -15.294 -24.561 -35.965 .00 0.00 IMOD

ATOM 111 CA PHE 14 -14.545 -23.677 -35.131 .00 0.00 IMOD

ATOM 112 C PHE 14 -13.885 -24.437 -34.033 .00 0.00 IMOD

ATOM 113 O PHE 14 -12.660 -24.520 -33.975 .00 0.00 IMOD

ATOM 114 CB PHE 14 -15.400 -22.587 -34.462 .00 0.00 IMOD

ATOM ^• 115 CG PHE 14 -14.666 -22.189 -33.222 .00 0.00 IMOD

ATOM 116 CDl PHE 14 -13.452 -21.544 -33.259 .00 0.00 IMOD

ATOM 117 CD2 PHE 14 -15.226 -22.470 -31.997 .00 0.00 IMOD

ATOM 118 CEl PHE 14 -12.811 -21.210 -32.087 .00 0.00 IMOD

ATOM 119 CE2 PHE 14 -14.592 -22.134 -30.825 .00 0.00 IMOD

ATOM 120 CZ PHE 14 -13.377 -21.501 -30.871 .00 0.00 IMOD

ATOM 121 N TRP 15 -14.693 -25.006 -33.121 .00 0.00 IMOD

ATOM 122 CA TRP 15 -14.135 -25.619 -31.955 .00 0.00 IMOD

ATOM 123 C TRP 15 -14.356 -27.090 -32.035 .00 0.00 IMOD

ATOM 124 O TRP 15 -15.142 -27.586 -32.842 .00 0.00 IMOD

ATOM 125 CB TRP 15 -14.881 -25.236 -30.663 1.00 0.00 IMOD

ATOM 126 CG TRP 15 -16.291 -25.799 -30.650 00 0.00 IMOD

ATOM 127 CDl TRP 15 -17.114 -26.072 -31.706 00 0.00 IMOD

ATOM 128 CD2 TRP 15 -16.996 -26.230 -29.476 00 0.00 IMOD

ATOM 129 NEl TRP 15 -18.271 -26.668 -31.264 00 0.00 IMOD

ATOM 130 CE2 TRP 15 -18.218 -26.767 -29.893 00 0.00 IMOD

ATOM 131 CE3 TRP 15 -16.657 -26.194 -28.155 00 0.00 IMOD

ATOM 132 CZ2 TRP 15 -19.113 -27.275 -28.997 00 0.00 IMOD

ATOM 133 CZ3 TRP 15 -17.564 -26.700 -27.249 00 0.00 IMOD

ATOM 134 CH2 TRP 15 -18.768 -27.230 -27.664 00 0.00 IMOD

ATOM 135 N LYS 16 -13.610 -27.846 -31.213 00 0.00 IMOD

ATOM 136 CA LYS 16 -13.939 -29.230 -31.100 00 0.00 IMOD

ATOM 137 C LYS 16 -14.389 -29.410 -29.694 00 0.00 IMOD

ATOM 138 O LYS 16 -13.607 -29.289 -28.752 00 0.00 IMOD

ATOM 139 CB LYS 16 -12.807 -30.240 -31.353 00 0.00 IMOD

ATOM 140 CG LYS 16 -13.328 -31.674 -31.196 00 0.00 IMOD

ATOM 141 CD LYS 16 -12.463 -32.766 -31.825 1.00 0.00 IMOD

ATOM 142 CE LYS 16 -13.100 -34.155 -31.715 00 0.00 IMOD

ATOM 143 NZ LYS 16 -12.261 -35.164 -32.398 00 0.00 IMOD

ATOM 144 N GLY 17 -15.694 -29.675 -29.515 00 0.00 IMOD

ATOM 145 CA GLY 17 -16.183 -29.841 -28.185 00 0.00 IMOD

ATOM 146 C GLY 17 -15.779 -31.192 -27.717 00 0.00 IMOD

ATOM 147 O GLY 17 -15.648 -32.126 -28.507 00 0.00 IMOD

ATOM 148 N GLU 18 -15.558 -31.320 -26.399 00 0.00 IMOD

ATOM 149 CA GLU 18 -15.280 -32.606 -25.841 00 0.00 IMOD

ATOM 150 C GLU 18 -15.954 -32.617 -24.519 00 0.00 IMOD

ATOM 151 O GLU 18 -16.345 -31.568 -24.009 00 0.00 IMOD

ATOM 152 CB GLU 18 -13.799 -32.973 -25.662 00 0.00 IMOD

ATOM 153 CG GLU 18 -13.645 -34.446 -25.274 00 0.00 IMOD

ATOM 154 CD GLU 18 -12.268 -34.928 -25.702 00 0.00 IMOD

ATOM 155 OEl GLU 18 -11.792 -34.490 -26.782 00 0.00 IMOD

ATOM 156 OE2 GLU 18 -11.684 -35.762 -24.962 00 0.00 IMOD

ATOM 157 N ASP 19 -16.152 -33.809 -23.938 00 0.00 IMOD

ATOM 158 CA ASP 19 -16.838 -33.824 -22.686 00 0.00 IMOD

ATOM 159 C ASP 19 -16.008 -33.044 -21.714 1.00 0.00 IMOD

ATOM 160 O ASP 19 -16.512 -32.166 -21.016 .00 0.00 IMOD

ATOM 161 CB ASP 19 -17.001 -35.244 -22.118 .00 0.00 IMOD

ATOM 162 CG ASP 19 -18.116 -35.197 -21.082 .00 0.00 IMOD

ATOM 163 ODl ASP 19 -19.195 -34.629 -21.407 .00 0.00 IMOD

ATOM 164 OD2 ASP 19 -17.904 -35.708 -19.952 .00 0.00 IMOD

ATOM 165 N LEU 20 -14.698 -33.356 -21.657 .00 0.00 IMOD

ATOM 166 CA LEU 20 -13.808 -32.711 -20.734 .00 0.00 IMOD

ATOM 167 C LEU 20 -13.541 -31.277 -21.089 .00 0.00 IMOD

ATOM 168 O LEU 20 -13.569 -30.417 -20.209 .00 0.00 IMOD

ATOM 169 CB LEU 20 -12.447 -33.407 -20.608 .00 0.00 IMOD

ATOM 170 CG LEU 20 -11.514 -32.707 -19.602 .00 0.00 IMOD

ATOM 171 CDl LEU 20 -12.106 -32.727 -18.185 .00 0.00 IMOD

ATOM 172 CD2 LEU 20 -10.098 -33.296 -19.658 .00 0.00 IMOD

ATOM 173 N SER 21 -13.275 -30.957 -22.373 .00 0.00 IMOD

ATOM 174 CA SER 21 -12.924 -29.591 -22.656 .00 0.00 IMOD

ATOM 175 C SER 21 -13.378 -29.230 -24.032 .00 0.00 IMOD

ATOM 176 O SER 21 -14.122 -29.984 -24.655 .00 0.00 IMOD

ATOM 111 CB SER 21 -11.412 -29.306 -22.583 .00 0.00 IMOD

ATOM 178 OG SER 21 -10.950 -29.447 -21.246 .00 0.00 IMOD

ATOM 179 N ASN 22 -13.033 -28.008 -24.502 .00 0.00 IMOD

ATOM 180 CA ASN 22 -13.305 -27.733 -25.877 .00 0.00 IMOD

ATOM 181 C ASN 22 -12.134 -26.974 -26.412 .00 0.00 IMOD

ATOM 182 O ASN 22 -11.751 -25.922 -25.903 .00 0.00 IMOD

ATOM 183 CB ASN 22 -14.606 -26.961 -26.189 .00 0.00 IMOD

ATOM 184 CG ASN 22 -14.444 -25.485 -25.899 .00 0.00 IMOD

ATOM 185 ODl ASN 22 -14.068 -24.744 -26.804 .00 0.00 IMOD

ATOM 186 ND2 ASN 22 -14.710 -25.056 -24.635 .00 0.00 IMOD

ATOM 187 N TYR 23 -11.516 -27.514 -27.472 .00 0.00 IMOD

ATOM 188 CA TYR 23 -10.364 -26.866 -28.012 .00 0.00 IMOD

ATOM 189 C TYR 23 -10.897 -25.865 -28.976 1.00 0.00 IMOD

ATOM 190 O TYR 23 -11.878 -26.121 -29.668 00 0.00 IMOD

ATOM 191 CB TYR 23 -9.425 -27.787 -28.802 00 0.00 IMOD

ATOM 192 CG TYR 23 -8.126 -27.069 -28.938 00 0.00 IMOD

ATOM 193 CDl TYR 23 -7.878 -26.227 -29.996 1.00 0.00 IMOD

ATOM 194 CD2 TYR 23 -7.152 -27.234 -27.981 00 0.00 IMOD

ATOM 195 CEl TYR 23 -6.675 -25.567 -30.110 00 0.00 IMOD

ATOM 196 CE2 TYR 23 -5.947 -26.578 -28.085 00 0.00 IMOD

ATOM 197 CZ TYR 23 -5.705 -25.744 -29.152 00 0.00 IMOD

ATOM 198 OH TYR 23 -4.469 -25.069 -29.262 00 0.00 IMOD

ATOM 199 N SER 24 -10.287 -24.671 -28.988 00 0.00 IMOD

ATOM 200 CA SER 24 -10.666 -23.597 -29.853 00 0.00 IMOD

ATOM 201 C SER 24 -10.091 -23.834 -31.212 00 0.00 IMOD

ATOM 202 O SER 24 -9.694 -22.878 -31.875 00 0.00 IMOD

ATOM 203 CB SER 24 -10.142 -22.233 -29.370 00 0.00 IMOD

ATOM 204 OG SER 24 -10.711 -21.921 -28.108 00 0.00 IMOD

ATOM 205 N TYR 25 -9.927 -25.106 -31.628 00 0.00 IMOD

ATOM 206 CA TYR 25 -9.391 -25.330 -32.939 00 0.00 IMOD

ATOM 207 C TYR 25 -10.291 -26.285 -33.651 00 0.00 IMOD

ATOM 208 O TYR 25 -10.887 -27.175 -33.044 00 0.00 IMOD

ATOM 209 CB TYR 25 -7.964 -25.912 -32.921 00 0.00 IMOD

ATOM 210 CG TYR 25 -7.443 -25.883 -34.313 00 0.00 IMOD

ATOM 211 CDl TYR 25 -7.117 -24.683 -34.902 00 0.00 IMOD

ATOM 212 CD2 TYR 25 -7.254 -27.045 -35.022 00 0.00 IMOD

ATOM 213 CEl TYR 25 -6.634 -24.639 -36.187 00 0.00 IMOD

ATOM 214 CE2 TYR 25 -6.770 -27.010 -36.309 00 0.00 IMOD

ATOM 215 CZ TYR 25 -6.461 -25.805 -36.893 00 0.00 IMOD

ATOM 216 OH TYR 25 -5.964 -25.759 -38.214 00 0.00 IMOD

ATOM 217 N SER 26 -10.441 -26.105 -34.977 00 0.00 IMOD

ATOM 218 CA SER 26 -11.305 -26.988 -35.702 00 0.00 IMOD

ATOM 219 C SER 26 -10.510 -28.205 -36.032 00 0.00 IMOD

ATOM 220 O SER 26 -9.348 -28.121 -36.422 00 0.00 IMOD

ATOM 221 CB SER 26 -11.770 -26.401 -37.038 00 0.00 IMOD

ATOM 222 OG SER 26 -12.342 -25.123 -36.816 00 0.00 IMOD

ATOM 223 N SER 27 -11.115 -29.394 -35.906 00 0.00 IMOD

ATOM 224 CA SER 27 -10.317 -30.534 -36.240 1.00 0.00 IMOD

ATOM 225 C SER 27 -10.724 -30.965 -37.601 00 0.00 IMOD

ATOM 226 O SER 27 -11.413 -31.973 -37.760 00 0.00 IMOD

ATOM 227 CB SER 27 -10.544 -31.732 -35.298 00 0.00 IMOD

ATOM 228 OG SER 27 -9.729 -32.832 -35.679 00 0.00 IMOD

ATOM 229 N THR 28 -10.294 -30.212 -38.634 00 0.00 IMOD

ATOM 230 CA THR 28 -10.708 -30.659 -39.917 00 0.00 IMOD

ATOM 231 C THR 28 -10.093 -31.997 -40.156 00 0.00 IMOD

ATOM 232 O THR 28 -10.824 -32.964 -40.367 00 0.00 IMOD

ATOM 233 CB THR 28 -10.360 -29.717 -41.047 00 0.00 IMOD

ATOM 234 OGl THR 28 -10.827 -30.246 -42.281 00 0.00 IMOD

ATOM 235 CG2 THR 28 -8.841 -29.459 -41.099 00 0.00 IMOD

ATOM 236 N LEU 29 -8.742 -32.112 -40.169 00 0.00 IMOD

ATOM 237 CA LEU 29 -8.311 -33.461 -40.361 00 0.00 IMOD

ATOM 238 C LEU 29 -8.527 -34.258 -39.084 00 0.00 IMOD

ATOM 239 O LEU 29 -9.652 -34.353 -38.613 00 0.00 IMOD

ATOM 240 CB LEU 29 -6.856 -33.465 -40.882 00 0.00 IMOD

ATOM 241 CG LEU 29 -6.712 -32.967 -42.331 00 0.00 IMOD

ATOM 242 CDl LEU 29 -5.246- -33.000 -42.797 00 0.00 IMOD

ATOM 243 CD2 LEU 29 -7.658 -33.736 -43.266 00 0.00 IMOD

ATOM 244 N PRO 30 -7.530 ^■ 34.826 -38.444 00 0.00 IMOD

ATOM 245 CA PRO 30 -7.739 •35.255 -37.084 1.00 0.00 IMOD

ATOM 246 C PRO 30 -6.957 -34.410 -36.137 00 0.00 IMOD

ATOM 247 O PRO 30 -6.862 ^■ 34.865 -35.001 00 0.00 IMOD

ATOM 248 CB PRO 30 -7.316 ^■ 36.720 -36.983 00 0.00 IMOD

ATOM 249 CG PRO 30 -6.308 -36.885 -38.116 00 0.00 IMOD

ATOM 250 CD PRO 30 -6.819 -35.891 -39.161 00 0.00 IMOD

ATOM 251 N PRO 31 -6.397 ^■ 33.282 -36.511 00 0.00 IMOD

ATOM 252 CA PRO 31 -5.378 -32.657 -35.704 00 0.00 IMOD

ATOM 253 C PRO 31 -5.704 -32.518 -34.252 00 0.00 IMOD

ATOM 254 O PRO 31 -4.822 ■32.775 -33.435 00 0.00 IMOD

ATOM 255 CB PRO 31 -5.154 ^■ 31.279 -36.316 1.00 0.00 IMOD

ATOM 256 CG PRO 31 -6.550 -30.921 -36.845 00 0.00 IMOD

ATOM 257 CD PRO 31 -7.144 ^■ 32.276 -37.257 00 0.00 IMOD

ATOM 258 N PHE 32 -6.949 ^■ 32.152 -33.908 00 0.00 IMOD

ATOM 259 CA PHE 32 -7.288 •31.905 -32.537 00 0.00 IMOD

ATOM 260 C PHE 32 -7.129 ^■ 33.130 -31.706 00 0.00 IMOD

ATOM 261 O PHE 32 -7.411 •34.248 -32.133 00 0.00 IMOD

ATOM 262 CB PHE 32 -8.715 ^■ 31.363 -32.335 00 0.00 IMOD

ATOM 263 CG PHE 32 -9.002 ^■ 31.444 -30.876 00 0.00 IMOD

ATOM 264 CDl PHE 32 -8.454 ^■ 30.548 -29.988 00 0.00 IMOD

ATOM 265 CD2 PHE 32 -9.834 ^• 32.432 -30.405 00 0.00 IMOD

ATOM 266 CEl PHE 32 -8.734 •30.645 -28.645 00 0.00 IMOD

ATOM 267 CE2 PHE 32 -10.117 •32.531 -29.065 1.00 0.00 IMOD

ATOM 268 CZ PHE 32 -9.566 ■31.636 -28.180 .00 0.00 IMOD

ATOM 269 N LEU 33 -6.625 ^■ 32.917 -30.473 .00 0.00 IMOD

ATOM 270 CA LEU 33 -6.420 •33.977 -29.535 .00 0.00 IMOD

ATOM 271 C LEU 33 -6.690 ■33.425 -28.167 .00 0.00 IMOD

ATOM 272 O LEU 33 -6.540 •32.228 -27.933 .00 0.00 IMOD

ATOM 273 CB LEU 33 -4.980 ■34.472 -29.551 .00 0.00 IMOD

ATOM 274 CG LEU 33 -4.543 ^■ 35.064 -30.899 .00 0.00 IMOD

ATOM 275 CDl LEU 33 -3.096 •35.572 -30.831 .00 0.00 IMOD

ATOM 276 CD2 LEU 33 -5.530 ^■ 36.134 -31.389 .00 0.00 IMOD

ATOM 277 N LEU 34 -7. .066 •34.298 -27.208 .00 0.00 IMOD

ATOM 278 CA LEU 34 .439 ■33.836 -25.900 .00 0.00 IMOD

ATOM 279 C LEU 34 -6.253 •33.220 -25.234 .00 0.00 IMOD

ATOM 280 O LEU 34 -5.132 ^■ 33.717 -25.321 .00 0.00 IMOD

ATOM 281 CB LEU 34 -7.978 •34.956 -24.990 .00 0.00 IMOD

ATOM 282 CG LEU 34 -8.392 •34.477 -23.585 .00 0.00 IMOD

ATOM 283 CDl LEU 34 -9.572 ^• 33.493 -23.651 .00 0.00 IMOD

ATOM 284 CD2 LEU 34 -8.662 35.666 -22.651 .00 0.00 IMOD

ATOM 285 N ASP 35 -6.496 ■32.099 -24.534 ,00 0.00 IMOD

ATOM 286 CA ASP 35 -5.476 31.350 -23.864 .00 0.00 IMOD

ATOM 287 C ASP 35 -4.894 32.227 -22.811 .00 0.00 IMOD

ATOM 288 O ASP 35 -3.727 32.089 -22.446 .00 0.00 IMOD

ATOM 289 CB ASP 35 -6.038 - 30.123 -23.133 1.00 0.00 IMOD

ATOM 290 CG ASP 35 6 . 596 -29.166 -24.172 ,00 0.00 IMOD

ATOM 291 ODl ASP 35 ^• 5 . 945 -28.994 -25.239 .00 0.00 IMOD

ATOM 292 OD2 ASP 35 ^■ 7 . 685 -28.593 -23.912 .00 0.00 IMOD

ATOM 293 N ALA 36 ^■ 5 . 726 -33.103 -22.225 .00 0.00 IMOD

ATOM 294 CA ALA 36 ^• 5 .230 -33.957 -21.192 .00 0.00 IMOD

ATOM 295 C ALA 36 ^• 4 .214 -34.938 -21.715 .00 0.00 IMOD

ATOM 296 O ALA 36 189 -35.153 -21.072 .00 0.00 IMOD

ATOM 297 CB ALA 36 ^■ 6 .350 -34.785 -20.535 .00 0.00 IMOD

ATOM 298 N ALA 37 ^• 4 . 502 -35.662 -22.821 .00 0.00 IMOD

IQ ATOM 299 CA ALA 37 ^■ 3 . 511 -36.620 -23.247 .00 0.00 IMOD

ATOM 300 C ALA 37 2 . 352 -36.120 -24.091 .00 0.00 IMOD

ATOM 301 O ALA 37 -1 203 -36.331 -23.705 .00 0.00 IMOD

ATOM 302 CB ALA 37 4.124 -37.900 -23.863 .00 0.00 IMOD

ATOM 303 N PRO 38 2.564 -35.467 -25.223 .00 0.00 IMOD

I ₅ ATOM 304 CA PRO 38 1.395 -35.121 -26.009 .00 0.00 IMOD

ATOM 305 C PRO 38 -1 030 -33.672 -26.011 .00 0.00 IMOD

ATOM 306 O PRO 38 ^■ 1 . 765 -32.854 -25.463 .00 0.00 IMOD

ATOM 307 CB PRO 38 1 . 621 -35.674 -27.413 ,00 0.00 IMOD

ATOM 308 CG PRO 38 ^■ 3 . 142 -35.725 -27.527 .00 0.00 IMOD

2Q ATOM 309 CD PRO 38 3 . 616 -35.969 -26.096 .00 0.00 IMOD

ATOM 310 N CYS 39 0 . 095 -33.343 -26.678 ,00 0.00 ^• 1MOD

ATOM 311 CA CYS 39 0 . 563 -31.997 -26.793 1.00 0.00 IMOD

ATOM 312 C CYS 39 0 . 359 -31.278 -27.731 .00 0.00 IMOD

ATOM 313 O CYS 39 0 . 988 -31.882 -28.597 .00 0.00 IMOD

2S ATOM 314 CB CYS 39 1 . 978 -31.913 -27.393 .00 0.00 IMOD

ATOM 315 SG CYS 39 3 . 186 -32.913 -26.472 .00 0.00 IMOD

ATOM 316 N GLU 40 0 . 454 -29.944 -27.543 .00 0.00 IMOD

ATOM 317 CA GLU 40 1 . 151 -28.881 -28.234 .00 0.00 IMOD

ATOM 318 C GLU 40 0 . 404 -28.301 -29.418 .00 0.00 IMOD

30 ATOM 319 O GLU 40 0 . 748 -27.172 -29.762 .00 0.00 IMOD

ATOM 320 CB GLU 40 -1 562 -27.698 -27.336 .00 0.00 IMOD

ATOM 321 CG GLU 40 ^• 2 . 862 -27.935 -26.558 .00 0.00 IMOD

ATOM 322 CD GLU 40 •2 .550 -28.583 -25.221 .00 0.00 IMOD

ATOM 323 OEl GLU 40 ^■ 1 . 896 -27.905 -24.384 .00 0.00 IMOD

3 ₅ ATOM 324 OE2 GLU 40 -2 968 -29.751 -25.010 .00 0.00 IMOD

ATOM 325 N PRO 41 0 . 623 -28.904 -29.994 .00 0.00 IMOD

ATOM 326 CA PRO 41 1 .511 -28.258 -30.934 .00 0.00 IMOD

ATOM 327 C PRO 41 0 . 825 -27.710 -32.151 .00 0.00 IMOD

ATOM 328 O PRO 41 1 .528 -27.248 -33.046 .00 0.00 IMOD 0 ATOM 329 CB PRO 41 2 . 463 -29.350 -31.394 .00 0.00 IMOD

ATOM 330 CG PRO 41 1 .528 -30.561 -31.492 .00 0.00 IMOD

ATOM 331 CD PRO 41 0 .477 -30.293 -30.406 .00 0.00 IMOD

ATOM 332 N GLU 42 0 .507 -27.797 -32.259 .00 0.00 IMOD

ATOM 333 CA GLU 42 -1 158 -27.234 -33.397 .00 0.00 IMOD 5 ATOM 334 C GLU 42 0.750 -25.780 -33.471 .00 0.00 IMOD

ATOM 335 O GLU 42 0.721 -25.239 -34.573 .00 0.00 IMOD

ATOM 336 CB GLU 42 2 . 693 -27.328 -33.315 .00 0.00 IMOD

ATOM 337 CG GLU 42 3. 310 -26.514 -32.181 .00 0.00 IMOD

ATOM 338 CD GLU 42 3 .513 -25.100 -32.701 .00 0.00 IMOD 0 ATOM 339 OEl GLU 42 -4 225 -24.949 -33.729 .00 0.00 IMOD

ATOM 340 OE2 GLU 42 -2.952 -24.156 -32.088 .00 0.00 IMOD

ATOM 341 N SER 43 -0.495 -25.096 -32.317 .00 0.00 IMOD

ATOM 342 CA SER 43 0.058 -23.755 -32.312 .00 0.00 IMOD

ATOM 343 C SER 43 1.553 -23.903 -32.351 .00 0.00 IMOD 5 ATOM 344 O SER 43 2.083 -24.983 -32.116 .00 0.00 IMOD

ATOM 345 CB SER 43 -0.273 -22.943 -31.052 .00 0.00 IMOD

ATOM 346 OG SER 43 0.301 -21.649 -31.156 ,00 0.00 IMOD

ATOM 347 N LEU 44 2.299 -22.815 -32.616 ,00 0.00 IMOD

ATOM 348 CA LEU 44 3.723 -22.966 -32.740 00 0.00 IMOD 0 ATOM 349 C LEU 44 4.290 -23.412 -31.428 ,00 0.00 IMOD

ATOM 350 O LEU 44 3.829 -23.010 -30.361 00 0.00 IMOD

ATOM 351 CB LEU 44 4.447 -21.679 -33.164 00 0.00 IMOD

ATOM 352 CG LEU 44 4.043 -21.191 -34.566 00 0.00 IMOD

ATOM 353 CDl LEU 44 4.880 -19.974 -34.994 00 0.00 IMOD 5 ATOM 354 CD2 LEU 44 4.087 -22.333 -35.594 1.00 0.00 IMOD

ATOM 355 N GLU 45 5.311 - 24.290 -31.499 .00 0.00 IMOD

ATOM 356 CA GLU 45 5.958 ^■ 24.855 -30.348 .00 0.00 IMOD

ATOM 357 C GLU 45 6.688 •23.782 -29.610 .00 0.00 IMOD

ATOM 358 O GLU 45 6.741 ^• 23.784 -28.381 .00 0.00 IMOD

ATOM 359 CB GLU 45 6.986 ^• 25.945 -30.705 .00 0.00 IMOD

ATOM 360 CG GLU 45 7.651 ^■ 26.570 -29.476 ,00 0.00 IMOD

ATOM 361 CD GLU 45 8.394 ^■ 27.828 -29.909 ,00 0.00 IMOD

ATOM 362 OEl GLU 45 9.308 ^■ 21.111 -30.767 .00 0.00 IMOD

ATOM 363 OE2 GLU 45 8.053 ^• 28.921 -29.379 .00 0.00 IMOD

ATOM 364 N ILE 46 7.264 •22.826 -30.358 .00 0.00 IMOD

ATOM 365 CA ILE 46 8.061 ^■ 21.786 -29.781 1.00 0.00 IMOD

ATOM 366 C ILE 46 7.193 ^■ 21.022 -28.840 00 0.00 IMOD

ATOM 367 O ILE 46 7.612 ^■ 20.663 -27.741 00 0.00 IMOD

ATOM 368 CB ILE 46 8.537 •20.806 -30.814 00 0.00 IMOD

ATOM 369 CGl ILE 46 9.271 ^■ 21.532 -31.958 00 0.00 IMOD

ATOM 370 CG2 ILE 46 9.405 ^■ 19.758 -30.099 00 0.00 IMOD

ATOM 371 CDl ILE 46 10.513 ^■ 22.307 -31.521 00 0.00 IMOD

ATOM 372 N ASN 47 5..936 •20.775 -29.249 00 0.00 IMOD

ATOM 373 CA ASN 47 5..021 •19.996 -28.471 00 0.00 IMOD

ATOM 374 C ASN 47 4..861 ^• 20.661 -27.143 00 0.00 IMOD

ATOM 375 O ASN 47 4..798 ^■ 19.997 -26.110 00 0.00 IMOD

ATOM 376 CB ASN 47 3.633 ^■ 19.913 -29.127 00 0.00 IMOD

ATOM 377 CG ASN 47 2.834 - 18.825 -28.425 00 0.00 IMOD

ATOM 378 ODl ASN 47 3.073 - 18.519 -27.258 00 0.00 IMOD

ATOM 379 ND2 ASN 47 1.857 -18.223 -29.152 00 0.00 IMOD

ATOM 380 N LYS 48 4.796 -22.003 -27.136 00 0.00 IMOD

ATOM 381 CA LYS 48 4.673 -22.706 -25.895 00 0.00 IMOD

ATOM 382 C LYS 48 5.898 -22.377 -25.103 00 0.00 IMOD

ATOM 383 O LYS 48 5.831 -22.129 -23.906 00 0.00 IMOD

ATOM 384 CB LYS 48 4.644 -24.233 -26.068 00 0.00 IMOD

ATOM 385 CG LYS 48 3.365 -24.769 -26.710 00 0.00 IMOD

ATOM 386 CD LYS 48 .495 -26.210 -27.207 00 0.00 IMOD

ATOM 387 CE LYS 48 .060 -26.314 -28.624 00 0.00 IMOD

ATOM 388 NZ LYS 48 .119 -25.692 -29.583 00 0.00 IMOD

ATOM 389 N TYR 49 .058 -22.298 -25.772 00 0.00 IMOD

ATOM 390 CA TYR 49 8.291 -22.030 -25.093 00 0.00 IMOD

ATOM 391 C TYR 49 8.151 -20.737 -24.364 00 0.00 IMOD

ATOM 392 O TYR 49 8.632 -20.603 -23.241 00 0.00 IMOD

ATOM 393 CB TYR 49 9.486 -21.887 -26.055 1.00 0.00 IMOD

ATOM 394 CG TYR 49 10.683 -21.394 -25.305 00 0.00 IMOD

ATOM 395 CDl TYR 49 11.426 -22.231 -24.502 00 0.00 IMOD

ATOM 396 CD2 TYR 49 11.077 -20.079 -25.427 00 0.00 IMOD

ATOM 397 CEl TYR 49 12.534 -21.761 -23.828 00 0.00 IMOD

ATOM 398 CE2 TYR 49 12.181 -19.605 -24.756 00 0.00 IMOD

ATOM 399 CZ TYR 49 12.913 -20.445 -23.954 00 0.00 IMOD

ATOM 400 OH TYR 49 14.046 -19.951 -23.270 00 0.00 IMOD

ATOM 401 N PHE 50 7.482 -19.746 -24.975 00 0.00 IMOD

ATOM 402 CA PHE 50 7.349 -18.484 -24.313 00 0.00 IMOD

ATOM 403 C PHE 50 6.626 -18.674 -23.021 00 0.00 IMOD

ATOM 404 O PHE 50 7.014 -18.098 -22.006 00 0.00 IMOD

ATOM 405 CB PHE 50 6.571 -17.425 -25.109 00 0.00 IMOD

ATOM 406 CG PHE 50 7.474 ■16.860 -26.149 00 0.00 IMOD

ATOM 407 CDl PHE 50 7.608 ■17.462 -27.378 00 0.00 IMOD

ATOM 408 CD2 PHE 50 8.187 •15.713 -25.883 00 0.00 IMOD

ATOM 409 CEl PHE 50 8.444 -16.922 -28.327 00 0.00 IMOD

ATOM 410 CE2 PHE 50 9.025 ■15.170 -26.827 00 0.00 IMOD

ATOM 411 CZ PHE 50 9.152 ■15.777 -28.053 00 0.00 IMOD

ATOM 412 N VAL 51 5.554 ■19.488 -23.002 00 0.00 IMOD

ATOM 413 CA VAL 51 .834 ■19.570 -21.767 00 0.00 IMOD

ATOM 414 C VAL 51 .706 ■20.134 -20.685 00 0.00 IMOD

ATOM 415 O VAL 51 .668 •19.641 -19.563 00 0.00 IMOD

ATOM 416 CB VAL 51 .520 •20.303 -21.835 00 0.00 IMOD

ATOM 417 CGl VAL 51 2.597 •19.540 -22.802 00 0.00 IMOD

ATOM 418 CG2 VAL 51 3.738 ■21.771 -22.204 00 0.00 IMOD

ATOM 419 N VAL 52 6.556 •21.131 -20.991 1.00 0.00 IMOD

ATOM 420 CA VAL 52 7 .395 -21.778 -20.011 00 0.00 IMOD

ATOM 421 C VAL 52 8 .161 -20.724 -19.287 00 0.00 IMOD

ATOM 422 O VAL 52 8 . 089 -20.587 -18.066 00 0.00 IMOD

ATOM 423 CB VAL 52 8 .555 -22.473 -20.668 00 0.00 IMOD

ATOM 424 CGl VAL 52 9 .287 -23.314 -19.615 00 0.00 IMOD

ATOM 425 CG2 VAL 52 8 . 167 -23.102 -22.015 00 0.00 IMOD

ATOM 426 N ILE 53 8 . 914 -19.935 -20.068 00 0.00 IMOD

ATOM 427 CA ILE 53 9.770 -18.940 -19.508 00 0.00 IMOD

ATOM 428 C ILE 53 8 . 932 -17.915 -18.837 00 0.00 IMOD

ATOM 429 O ILE 53 9.295 -17.409 -17.778 00 0.00 IMOD

ATOM 430 CB ILE 53 10.649 -18.248 -20.509 1.00 0.00 IMOD

ATOM 431 CGl ILE 53 11 .733 -17.443 -19.773 00 0.00 IMOD

ATOM 432 CG2 ILE 53 9. 768 -17.396 -21.437 00 0.00 IMOD

ATOM 433 CDl ILE 53 12 .717 -18.317 -18.996 00 0.00 IMOD

ATOM 434 N ILE 54 7.780 -17.570 -19.437 00 0.00 IMOD

ATOM 435 CA ILE 54 7 . 005 -16.534 -18.826 00 0.00 IMOD

ATOM 436 C ILE 54 6.593 -16.983 -17.459 00 0.00 IMOD

ATOM 437 O ILE 54 6.766 -16.249 -16.487 00 0.00 IMOD

ATOM 438 CB ILE 54 5.744 -16.207 -19.577 00 0.00 IMOD

ATOM 439 CGl ILE 54 6. 068 -15.648 -20.973 00 0.00 IMOD

ATOM 440 CG2 ILE 54 4 . 911 -15.255 -18.700 00 0.00 IMOD

ATOM 441 CDl ILE 54 4 . 848 -15.569 -21.890 00 0.00 IMOD

ATOM 442 N TYR 55 6 .053 -18.213 -17.342 00 0.00 IMOD

ATOM 443 CA TYR 55 5. 597 -18.696 -16.070 00 0.00 IMOD

ATOM 444 C TYR 55 6. 767 -18.874 -15.168 00 0.00 IMOD

ATOM 445 O TYR 55 6. 691 -18.576 -13.978 1.00 0.00 IMOD

ATOM 446 CB TYR 55 4 .835 -20.035 -16.123 00 0.00 IMOD

ATOM 447 CG TYR 55 3 . 667 -19.795 -17.015 00 0.00 IMOD

ATOM 448 CDl TYR 55 2 . 710 -18.855 -16.707 00 0.00 IMOD

ATOM 449 CD2 TYR 55 3 .517 -20.545 -18.155 00 0.00 IMOD

ATOM 450 CEl TYR 55 1 . 651 -18.650 -17.559 00 0.00 IMOD

ATOM 451 CE2 TYR 55 2 . 461 -20.341 -19.006 00 0.00 IMOD

ATOM 452 CZ TYR 55 1 .521 -19.388 -18.711 00 0.00 IMOD

ATOM 453 OH TYR 55 0 . 436 -19.175 -19.587 00 0.00 IMOD

ATOM 454 N ALA 56 7 .894 -19.364 -15.704 00 0.00 IMOD

ATOM 455 CA ALA 56 9. 026 -19.593 -14.860 1.00 0.00 IMOD

ATOM 456 C ALA 56 9 .403 -18.282 -14.242 00 0.00 IMOD

ATOM 457 O ALA 56 9. 740 -18.215 -13.061 00 0.00 IMOD

ATOM 458 CB ALA 56 10.248 -20.112 -15.634 00 0.00 IMOD

ATOM 459 N LEU 57 9 .348 -17.195 -15.032 00 0.00 IMOD

ATOM 460 CA LEU 57 9.707 -15.901 -14.529 00 0.00 IMOD

ATOM 461 C LEU 57 8 . 750 -15.492 -13.453 00 0.00 IMOD

ATOM 462 O LEU 57 9.164 -15.032 -12.390 00 0.00 IMOD

ATOM 463 CB LEU 57 9. 635 -14.797 -15.597 00 0.00 IMOD

ATOM 464 CG LEU 57 10. 628 -14.970 -16.758 00 0.00 IMOD

ATOM 465 CDl LEU 57 10.524 -13.792 -17.738 00 0.00 IMOD

ATOM 466 CD2 LEU 57 12.060 -15.202 -16.250 00 0.00 IMOD

ATOM 467 N VAL 58 7 . 436 -15.668 -13.693 00 0.00 IMOD

ATOM 468 CA VAL 58 6.483 -15.191 -12.735 00 0.00 IMOD

ATOM 469 C VAL 58 6. 666 -15.923 -11.453 00 0.00 IMOD

ATOM 470 O VAL 58 6.596 -15.329 -10.379 00 0.00 IMOD

ATOM 471 CB VAL 58 5.042 -15.337 -13.147 00 0.00 IMOD

ATOM 472 CGl VAL 58 4 . 806 -14.492 -14.408 00 0.00 IMOD

ATOM 473 CG2 VAL 58 4 . 696 -16.825 -13.301 00 0.00 IMOD

ATOM 474 N PHE 59 6. 911 -17.240 -11.530 00 0.00 IMOD

ATOM 475 CA PHE 59 7 .049 -18.006 -10.333 00 0.00 IMOD

ATOM 476 C PHE 59 8.247 -17.519 -9.589 00 0.00 IMOD

ATOM 477 O PHE 59 8 .214 -17.353 -8.372 00 0.00 IMOD

ATOM 478 CB PHE 59 7.226 -19.508 -10.596 00 0.00 IMOD

ATOM 479 CG PHE 59 7 .288 -20.152 -9.259 00 0.00 IMOD

ATOM 480 CDl PHE 59 6.133 -20.459 -8.581 00 0.00 IMOD

ATOM 481 CD2 PHE 59 8. 496 -20.426 -8.668 00 0.00 IMOD

ATOM 482 CEl PHE 59 6. 185 -21.050 -7.340 00 0.00 IMOD

ATOM 483 CE2 PHE 59 8.555 -21.018 -7.429 00 0.00 IMOD

ATOM 484 CZ PHE 59 7.397 -21.333 -6.762 1.00 0.00 IMOD

ATOM 485 N LEU 60 9.344 -17.253 -10.314 00 0.00 IMOD

ATOM 486 CA LEU 60 10.557 -16.872 -9.659 00 0.00 IMOD

ATOM 487 C LEU 60 10.312 -15.604 -8.903 00 0.00 IMOD

ATOM 488 O LEU 60 10.650 -15.512 -7.725 00 0.00 IMOD

ATOM 489 CB LEU 60 11.685 -16.605 -10.680 00 0.00 IMOD

ATOM 490 CG LEU 60 13.092 -16.370 -10.093 00 0.00 IMOD

ATOM 491 CDl LEU 60 13.185 -15.086 -9.250 00 0.00 IMOD

ATOM 492 CD2 LEU 60 13.582 -17.619 -9.346 00 0.00 IMOD

ATOM 493 N LEU 61 9.720 -14.591 -9.570 00 0.00 IMOD

ATOM 494 CA LEU 61 9.531 -13.302 -8.963 00 0.00 IMOD

ATOM 495 C LEU 61 8.488 -13.309 -7.887 00 0.00 IMOD

ATOM 496 O LEU 61 8.705 -12.765 -6.806 00 0.00 IMOD

ATOM 497 CB LEU 61 9.165 -12.198 -9.977 00 0.00 IMOD

ATOM 498 CG LEU 61 8.992 -10.785 -9.371 00 0.00 IMOD

ATOM 499 CDl LEU 61 7.655 -10.592 -8.634 00 0.00 IMOD

ATOM 500 CD2 LEU 61 10.201 -10.436 -8.491 00 0.00 IMOD

ATOM 501 N SER 62 7.329 -13.938 -8.156 00 0.00 IMOD

ATOM 502 CA SER 62 6.193 -13.888 -7.278 00 0.00 IMOD

ATOM 503 C SER 62 6.510 -14.510 -5.957 00 0.00 IMOD

ATOM 504 O SER 62 6.066 -14.021 -4.920 1.00 0.00 IMOD

ATOM 505 CB SER 62 4.993 -14.642 -7.876 00 0.00 IMOD

ATOM 506 OG SER 62 3.878 -14.591 -7.000 00 0.00 IMOD

ATOM 507 N LEU 63 7.286 -15.606 -5.949 00 0.00 IMOD

ATOM 508 CA LEU 63 7.521 -16.284 -4.705 00 0.00 IMOD

ATOM 509 C LEU 63 8.266 -15.376 -3.772 00 0.00 IMOD

ATOM 510 O LEU 63 7.859 -15.194 -2.626 1.00 0.00 IMOD

ATOM 511 CB LEU 63 8.343 -17.579 -4.900 00 0.00 IMOD

ATOM 512 CG LEU 63 8.455 -18.534 -3.682 00 0.00 IMOD

ATOM 513 CDl LEU 63 9.294 -19.768 -4.051 00 0.00 IMOD

ATOM 514 CD2 LEU 63 9.002 -17.863 -2.410 00 0.00 IMOD

ATOM 515 N LEU 64 9.360 -14.754 -4.246 00 0.00 IMOD

ATOM 516 CA LEU 64 10.184 -13.965 -3.374 00 0.00 IMOD

ATOM 517 C LEU 64 9.431 -12.790 -2.848 00 0.00 IMOD

ATOM 518 O LEU 64 9.409 -12.543 -1.641 00 0.00 IMOD

ATOM 519 CB LEU 64 11.418 -13.389 -4.086 00 0.00 IMOD

ATOM 520 CG LEU 64 12.248 -12.453 -3.189 00 0.00 IMOD

ATOM 521 CDl LEU 64 12.901 -13.212 -2.024 00 0.00 IMOD

ATOM 522 CD2 LEU 64 13.245 -11.634 -4.020 00 0.00 IMOD

ATOM 523 N GLY 65 8.767 -12.042 -3.743 00 0.00 IMOD

ATOM 524 CA GLY 65 8.143 -10.827 -3.317 00 0.00 IMOD

ATOM 525 C GLY 65 7.084 -11.138 -2.316 00 0.00 IMOD

ATOM 526 O GLY 65 6.967 -10.463 -1.295 00 0.00 IMOD

ATOM 527 N ASN 66 6.267 -12.167 -2.594 00 0.00 IMOD

ATOM 528 CA ASN 66 5.197 -12.518 -1.707 00 0.00 IMOD

ATOM 529 C ASN 66 5.731 -13.090 -0.432 00 0.00 IMOD

ATOM 530 O ASN 66 5.234 -12.792 0.651 00 0.00 IMOD

ATOM 531 CB ASN 66 4.234 -13.545 -2.321 00 0.00 IMOD

ATOM 532 CG ASN 66 3.442 -12.812 -3.394 00 0.00 IMOD

ATOM 533 ODl ASN 66 2.833 -11.778 -3.127 00 0.00 IMOD

ATOM 534 ND2 ASN 66 3.462 -13.347 -4.642 00 0.00 IMOD

ATOM 535 N SER 67 6.755 -13.951 -0.522 00 0.00 IMOD

ATOM 536 CA SER 67 7.250 -14.549 0.680 00 0.00 IMOD

ATOM 537 C SER 67 7.899 -13.503 1.526 00 0.00 IMOD

ATOM 538 O SER 67 7.725 -13.476 2.742 00 0.00 IMOD

ATOM 539 CB SER 67 8.246 -15.691 0.416 00 0.00 IMOD

ATOM 540 OG SER 67 9.342 -15.235 -0.360 00 0.00 IMOD

ATOM 541 N LEU 68 8.653 -12.587 0.899 00 0.00 IMOD

ATOM 542 CA LEU 68 9.351 -11.588 1.646 00 0.00 IMOD

ATOM 543 C LEU 68 8.334 -10.752 2.351 00 0.00 IMOD

ATOM 544 O LEU 68 8.482 -10.454 3.534 00 0.00 IMOD

ATOM 545 CB LEU 68 10.181 -10.679 0.725 00 0.00 IMOD

ATOM 546 CG LEU 68 11.013 -9.600 1.439 00 0.00 IMOD

ATOM 547 CDl LEU 68 12.037 -10.220 2.405 00 0.00 IMOD

ATOM 548 CD2 LEU 68 11.682 -8.674 0.408 00 0.00 IMOD

ATOM 549 N VAL 69 7.245 -10.372 1.655 1.00 0.00 IMOD

ATOM 550 CA VAL 69 6.288 -9.528 2.308 00 0.00 IMOD

ATOM 551 C VAL 69 5.723 •10.251 3.488 00 0.00 IMOD

ATOM 552 O VAL 69 5.572 -9.668 4.558 00 0.00 IMOD

ATOM 553 CB VAL 69 5.149 -9.040 1.446 00 0.00 IMOD

ATOM 554 CGl VAL 69 5.722 -8.138 0.349 00 0.00 IMOD

ATOM 555 CG2 VAL 69 4.340 - ^• 10.217 0.897 00 0.00 IMOD

ATOM 556 N MET 70 5.409 ^■ 11.552 3.340 00 0.00 IMOD

ATOM 557 CA MET 70 4.845 ^■ 12.283 4.439 00 0.00 IMOD

ATOM 558 C MET 70 5.820 ^■ 12.303 5.572 00 0.00 IMOD

ATOM 559 O MET 70 5.451 ^■ 12.056 6.718 00 0.00 IMOD

ATOM 560 CB MET 70 4.579 ^• 13.764 4.108 00 0.00 IMOD

ATOM 561 CG MET 70 4.290 ^■ 14.603 5.358 00 0.00 IMOD

ATOM 562 SD MET 70 4.258 ^■ 16.402 5.092 00 0.00 IMOD

ATOM 563 CE MET 70 2.465 ^• 16.499 4.837 00 0.00 IMOD

ATOM 564 N LEU 71 7.104 ^■ 12.587 5.282 00 0.00 IMOD

ATOM 565 CA LEU 71 8.040 ^• 12.676 6.363 00 0.00 IMOD

ATOM 566 C LEU 71 8.177 ^• 11.370 7.056 00 0.00 IMOD

ATOM 567 O LEU 71 8.191 ^■ 11.319 8.284 00 0.00 IMOD

ATOM 568 CB LEU 71 9.471 ^■ 13.076 5.979 00 0.00 IMOD

ATOM 569 CG LEU 71 9.683 ^■ 14.583 5.792 00 0.00 IMOD

ATOM 570 CDl LEU 71 9.004 ^■ 15.121 4.524 00 0.00 IMOD

ATOM 571 CD2 LEU 71 11.174 ^■ 14.920 5.893 00 0.00 IMOD

ATOM 572 N VAL 72 8.270 ^• 10.272 6.289 00 0.00 IMOD

ATOM 573 CA VAL 72 8.518 -9.009 6.920 00 0.00 IMOD

ATOM 574 C VAL 72 7.396 -E 713 7.859 00 0.00 IMOD

ATOM 575 O VAL 72 7.626 - -i8.259 8.979 00 0.00 IMOD

ATOM 576 CB VAL 72 8.611 -7.843 .963 00 0.00 IMOD

ATOM 577 CGl VAL 72 9.780 -8.084 .011 00 0.00 IMOD

ATOM 578 CG2 VAL 72 7.276 -7.640 .232 00 0.00 IMOD

ATOM 579 N ILE 73 6.147 -8.987 .435 00 0.00 IMOD

ATOM 580 CA ILE 73 5.031 -8.623 8.253 00 0.00 IMOD

ATOM 581 C ILE 73 5.103 -9.371 9.549 00 0.00 IMOD

ATOM 582 O ILE 73 4.866 -8.791 10.608 00 0.00 IMOD

ATOM 583 CB ILE 73 3.691 -8.848 7.593 00 0.00 IMOD

ATOM 584 CGl ILE 73 3.389 -10.334 7.336 00 0.00 IMOD

ATOM 585 CG2 ILE 73 3.668 -7.989 6.316 00 0.00 IMOD

ATOM 586 CDl ILE 73 2.822 -11.079 8.545 00 0.00 IMOD

ATOM 587 N LEU 74 5.439 -10.676 9.499 00 0.00 IMOD

ATOM 588 CA LEU 74 5.498 -11.484 10.685 00 0.00 IMOD

ATOM 589 C LEU 74 6.581 -10.994 11.595 00 0.00 IMOD

ATOM 590 O LEU 74 6.357 -10.800 12.789 00 0.00 IMOD

ATOM 591 CB LEU 74 5.826 -12.957 10.377 00 0.00 IMOD

ATOM 592 CG LEU 74 6.054 -13.803 11.646 00 0.00 IMOD

ATOM 593 CDl LEU 74 4.771 -13.916 12.482 00 0.00 IMOD

ATOM 594 CD2 LEU 74 6.691 -15.164 11.318 00 0.00 IMOD

ATOM 595 N TYR 75 7.780 -10.737 11.045 00 0.00 IMOD

ATOM 596 CA TYR 75 8.890 -10.372 11.877 00 0.00 IMOD

ATOM 597 C TYR 75 8.599 -9.121 12.630 00 0.00 IMOD

ATOM 598 O TYR 75 8.849 -9.050 13.832 00 0.00 IMOD

ATOM 599 CB TYR 75 10.202 -10.127 11.107 1.00 0.00 IMOD

ATOM 600 CG TYR 75 10.897 -11.421 10.853 00 0.00 IMOD

ATOM 601 CDl TYR 75 10.491 -12.286 9.865 00 0.00 IMOD

ATOM 602 CD2 TYR 75 11.991 -11.757 11.620 1.00 0.00 IMOD

ATOM 603 CEl TYR 75 11.166 -13.469 9.658 00 0.00 IMOD

ATOM 604 CE2 TYR 75 12.670 -12.934 11.417 00 0.00 IMOD

ATOM 605 CZ TYR 75 12.257 -13.795 10.430 00 0.00 IMOD

ATOM 606 OH TYR 75 12.947 -15.008 10.211 00 0.00 IMOD

ATOM 607 N SER 76 8.049 -8.093 11.967 00 0.00 IMOD

ATOM 608 CA SER 76 7.858 -6.890 12.723 00 0.00 IMOD

ATOM 609 C SER 76 6.503 -6.964 13.340 ^' 00 0.00 IMOD

ATOM 610 O SER 76 5.487 -6.916 12.652 00 0.00 IMOD

ATOM 611 CB SER 76 7.899 -5.616 11.865 00 0.00 IMOD

ATOM 612 OG SER 76 9.175 -5.484 11.254 00 0.00 IMOD

ATOM 613 N ARG 77 6.467 -7.040 14.681 00 0.00 IMOD

ATOM 614 CA ARG 77 5.261 -7.204 15.440 1.00 0.00 IMOD

ATOM 615 C ARG 77 4.373 -6.006 15.312 00 0.00 IMOD

ATOM 616 O ARG 77 3.150 -6.129 15.352 00 0.00 IMOD

ATOM 617 CB ARG 77 5.528 -7.458 16.932 00 0.00 IMOD

ATOM 618 CG ARG 77 6.138 -8.837 17.188 00 0.00 IMOD

ATOM 619 CD ARG 77 7.538 -9.011 16.595 00 0.00 IMOD

ATOM 620 NE ARG 77 8.500 -8.446 17.582 00 0.00 IMOD

ATOM 621 CZ ARG 77 8.959 -9.238 18.593 00 0.00 IMOD

ATOM 622 NHl ARG 77 8.578 -10.548 18.648 00 0.00 IMOD-

ATOM 623 NH2 ARG 77 9.795 -8.724 19.540 00 0.00 IMOD

10 ATOM 624 N VAL 78 4.963 -4.811 15.168 1.00 0.00 IMOD

ATOM 625 CA VAL 78 4.210 -3.593 15.130 00 0.00 IMOD

ATOM 626 C VAL 78 3.271 -3.572 13.965 00 0.00 IMOD

ATOM 627 O VAL 78 2.160 -3.064 14.104 00 0.00 IMOD

ATOM 628 CB VAL 78 5.080 -2.375 15.015 1.00 0.00 IMOD

I ₅ ATOM 629 CGl VAL 78 4.177 -1.133 14.912 00 0.00 IMOD

ATOM 630 CG2 VAL 78 6.051 -2.342 16.207 00 0.00 IMOD

ATOM 631 N GLY 79 3.687 -4.087 12.786 00 0.00 IMOD

ATOM 632 CA GLY 79 2.854 -3.992 11.613 00 0.00 IMOD

ATOM 633 C GLY 79 1.605 -4.801 11.784 00 0.00 IMOD

20 ATOM 634 O GLY 79 1.526 -5.942 11.329 00 0.00 IMOD

ATOM 635 N ARG 80 0.562 -4.201 12.395 1.00 0.00 IMOD

ATOM 636 CA ARG 80 0.662 -4.919 12.566 00 0.00 IMOD

ATOM 637 C ARG 80 -1 780 -3.992 12.213 00 0.00 IMOD

ATOM 638 O ARG 80 2.799 -3.947 12.903 00 0.00 IMOD

2S ATOM 639 CB ARG 80 0.912 -5.343 14.024 00 0.00 IMOD

ATOM 640 CG ARG 80 0.174 -6.255 14.596 00 0.00 IMOD

ATOM 641 CD ARG 80 0.567 -7.398 13.661 1.00 0.00 IMOD

ATOM 642 NE ARG 80 1.571 -8.235 14.375 .00 0.00 IMOD

ATOM 643 CZ ARG 80 2.566 -8.860 13.679 .00 0.00 IMOD

30 ATOM 644 NHl ARG 80 2.692 -8.658 12.336 .00 0.00 IMOD

ATOM 645 NH2 ARG 80 3.436 -9.684 14.330 ,00 0.00 IMOD

ATOM 646 N SER 81 -1 633 -3.234 11.114 1.00 0.00 IMOD

ATOM 647 CA SER 81 •2.706 -2.375 10.721 00 0.00 IMOD

ATOM 648 C SER 81 ^■ 3.642 -3.242 9.965 00 0.00 IMOD

3 ₅ ATOM 649 O SER 81 ^• 3.316 -4.378 9.629 00 0.00 IMOD

ATOM 650 CB SER 81 •2.297 -1.232 9.777 00 0.00 IMOD

ATOM 651 OG SER 81 ^■ 3.443 -0.481 9.402 00 0.00 IMOD

ATOM 652 N VAL 82 854 -2.729 9.704 00 0.00 IMOD

ATOM 653 CA VAL 82 784 -3.492 8.938 00 0.00 IMOD

40 ATOM 654 C VAL 82 168 -3.664 7.587 00 0.00 IMOD

ATOM 655 O VAL 82 256 -4.723 6.973 00 0.00 IMOD

ATOM 656 CB VAL 82 089 -2.779 8.768 00 0.00 IMOD

ATOM 657 CGl VAL 82 983 -3.624 7.854 00 0.00 IMOD

ATOM 658 CG2 VAL 82 694 -2.518 10.157 00 0.00 IMOD S ATOM 659 N THR 83 4.519 -2.604 7.078 00 0.00 IMOD

ATOM 660 CA THR 83 3.917 -2.683 5.779 00 0.00 IMOD

ATOM 661 C THR 83 2.797 -3.670 5.816 00 0.00 IMOD

ATOM 662 O THR 83 -2 612 -4.454 4.888 00 0.00 IMOD

ATOM 663 CB THR 83 ^• 3.361 -1.366 5.306 00 0.00 IMOD so ATOM 664 OGl THR 83 ^■ 2.885 -1.483 3.973 00 0.00 IMOD

ATOM 665 CG2 THR 83 ^• 2.223 -0.923 6.241 00 0.00 IMOD

ATOM 666 N ASP 84 ^• 2.022 -3.661 6.913 00 0.00 IMOD

ATOM 667 CA ASP 84 0.897 -4.540 7.022 00 0.00 IMOD

ATOM 668 C ASP 84 -1 419 -5.938 6.987 00 0.00 IMOD ₅ ATOM 669 O ASP 84 ^■ 0.811 -6.824 6.387 00 0.00 IMOD

ATOM 670 CB ASP 84 0.144 -4.362 8.353 00 0.00 IMOD

ATOM 671 CG ASP 84 0.436 -2.954 8.390 00 0.00 IMOD

ATOM 672 ODl ASP 84 0.257 -2.211 7.389 00 0.00 IMOD

ATOM 673 OD2 ASP 84 070 -2.603 9.421 00 0.00 IMOD 0 ATOM 674 N VAL 85 569 -6.178 7.644 00 0.00 IMOD

ATOM 675 CA VAL 85 075 -7.517 7.693 00 0.00 IMOD

ATOM 676 C VAL 85 506 -7.955 6.333 00 0.00 IMOD

ATOM 677 O VAL 85 -3.252 -9.094 5.947 00 0.00 IMOD

ATOM 678 CB VAL 85 -4.204 -7.709 8.639 00 0.00 IMOD ₅ ATOM 679 CGl VAL 85 -3.746 -7.082 9.963 1.00 0.00 IMOD

ATOM 680 CG2 VAL 85 -5.519 -7.218 8.021 00 0.00 IMOD

ATOM 681 N TYR 86 -4.161 -7.067 5.558 00 0.00 IMOD

ATOM 682 CA TYR 86 -4.599 -7.496 4.260 00 0.00 IMOD

ATOM 683 C TYR 86 -3.451 -7.893 3.406 00 0.00 IMOD

ATOM 684 O TYR 86 -3.527 -8.913 2.723 00 0.00 IMOD

ATOM 685 CB TYR 86 -5.433 -6.496 3.445 00 0.00 IMOD

ATOM 686 CG TYR 86 -6.836 -6.893 3.698 00 0.00 IMOD

ATOM 687 CDl TYR 86 -7.231 -8.117 3.217 00 0.00 IMOD

ATOM 688 CD2 TYR 86 -7.740 -6.091 4.349 00 0.00 IMOD

ATOM 689 CEl TYR 86 -8.509 -8.569 3.402 00 0.00 IMOD

ATOM 690 CE2 TYR 86 -9.024 -6.545 4.532 00 0.00 IMOD

ATOM 691 CZ TYR 86 -9.404 -7.779 4.062 00 0.00 IMOD

ATOM 692 OH TYR 86 -10.710 -8.256 4.247 00 0.00 IMOD

ATOM 693 N LEU 87 -2.358 -7.117 3.430 00 0.00 IMOD

ATOM 694 CA LEU 87 -1.242 -7.393 2.569 00 0.00 IMOD

ATOM 695 C LEU 87 -0.740 -8.752 2.922 00 0.00 IMOD

ATOM 696 O LEU 87 -0.325 -9.516 2.053 00 0.00 IMOD

ATOM 697 CB LEU 87 -0.054 -6.420 2.783 00 0.00 IMOD

ATOM 698 CG LEU 87 1.173 -6.536 1.832 00 0.00 IMOD

ATOM 699 CDl LEU 87 1.881 -7.896 1.887 00 0.00 IMOD

ATOM 700 CD2 LEU 87 0.843 -6.111 0.400 00 0.00 IMOD

ATOM 701 N LEU 88 -0.761 -9.091 4.222 00 0.00 IMOD

ATOM 702 CA LEU 88 -0.257 -10.373 4.610 00 0.00 IMOD

ATOM 703 C LEU 88 -1.084 -11.399 3.916 00 0.00 IMOD

ATOM 704 O LEU 88 -0.561 -12.388 3.401 00 0.00 IMOD

ATOM 705 CB LEU 88 -0.371 -10.623 6.123 00 0.00 IMOD

ATOM 706 CG LEU 88 0.064 -12.037 6.546 00 0.00 IMOD

ATOM 707 CDl LEU 88 1.533 -12.309 6.188 00 0.00 IMOD

ATOM 708 CD2 LEU 88 -0.243 -12.287 8.031 00 0.00 IMOD

ATOM 709 N ASN 89 -2.408 -11.163 3.873 00 0.00 IMOD

ATOM 710 CA ASN 89 -3.337 -12.075 3.277 00 0.00 IMOD

ATOM 711 C ASN 89 -3.012 -12.226 1.823 1.00 0.00 IMOD

ATOM 712 O ASN 89 -2.914 -13.343 1.319 00 0.00 IMOD

ATOM 713 CB ASN 89 -4.785 -11.569 3.376 00 0.00 IMOD

ATOM 714 CG ASN 89 -5.721 -12.699 2.981 00 0.00 IMOD

ATOM 715 ODl ASN 89 -5.313 -13.682 2.367 00 0.00 IMOD

ATOM 716 ND2 ASN 89 -7.024 -12.550 3.339 1.00 0.00 IMOD

ATOM 717 N LEU 90 -2.792 -11.101 1.116 00 0.00 IMOD

ATOM 718 CA LEU 90 -2.511 -11.181 -0.291 00 0.00 IMOD

ATOM 719 C LEU 90 -1.267 -11.986 -0.476 00 0.00 IMOD

ATOM 720 O LEU 90 -1.182 -12.826 -1.371 00 0.00 IMOD

ATOM 721 CB LEU 90 -2.117 -9.847 -0.962 00 0.00 IMOD

ATOM 722 CG LEU 90 -3.177 -8.754 -1.186 00 0.00 IMOD

ATOM 723 CDl LEU 90 -4.327 -9.248 -2.080 1.00 0.00 IMOD

ATOM 724 CD2 LEU 90 -3.579 -8.068 0.122 .00 0.00 IMOD

ATOM 725 N ALA 91 -0.261 -11.745 0.383 .00 0.00 IMOD

ATOM 726 CA ALA 91 1.014 -12.369 0.198 .00 0.00 IMOD

ATOM 727 C ALA 91 0.841 -13.849 0.254 .00 0.00 IMOD

ATOM 728 O ALA 91 1.433 -14.573 -0.544 .00 0.00 IMOD

ATOM 729 CB ALA 91 2.025 -11.997 1.294 .00 0.00 IMOD

ATOM 730 N LEU 92 0.036 -14.340 1.211 .00 0.00 IMOD

ATOM 731 CA LEU 92 -0.150 -15.755 1.349 .00 0.00 IMOD

ATOM 732 C LEU 92 -0.885 -16.282 0.151 .00 0.00 IMOD

ATOM 733 O LEU 92 -0.487 -17.287 -0.435 .00 0.00 IMOD

ATOM 734 CB LEU 92 -0.945 -16.093 2.630 .00 0.00 IMOD

ATOM 735 CG LEU 92 -1.167 -17.587 2.971 .00 0.00 IMOD

ATOM 736 CDl LEU 92 -1.827 -17.713 4.354 .00 0.00 IMOD

ATOM 737 CD2 LEU 92 -1.979 -18.354 1.911 .00 0.00 IMOD

ATOM 738 N ALA 93 -1.963 -15.592 -0.268 .00 0.00 IMOD

ATOM 739 CA ALA 93 -2.782 -16.068 -1.346 ,00 0.00 IMOD

ATOM 740 C ALA 93 -1.920 -16.164 -2.556 .00 0.00 IMOD

ATOM 741 O ALA 93 -2.011 -17.114 -3.331 ,00 0.00 IMOD

ATOM 742 CB ALA 93 -3.939 -15.108 -1 680 ,00 0.00 IMOD

ATOM 743 N ASP 94 -1.037 -15.170 ^• 2.727 .00 0.00 IMOD

ATOM 744 CA ASP 94 -0.173 -15.106 ^■ 3.862 1.00 0.00 IMOD

ATOM 745 C ASP 94 0.703 -16.313 -3.851 .00 0.00 IMOD

ATOM 746 O ASP 94 0. 963 -16.911 -4.893 .00 0.00 IMOD

ATOM 747 CB ASP 94 0 .714 -13.852 -3.840 .00 0.00 IMOD

ATOM 748 CG ASP 94 -0 .198 -12.645 -4.025 .00 0.00 IMOD

ATOM 749 ODl ASP 94 -1 .410 -12.858 -4.303 .00 0.00 IMOD

ATOM 750 OD2 ASP 94 0.306 -11.497 -3.897 .00 0.00 IMOD

ATOM 751 N LEU 95 1 .165 -16.721 -2.658 .00 0.00 IMOD

ATOM 752 CA LEU 95 2.027 -17.861 -2.577 .00 0.00 IMOD

ATOM 753 C LEU 95 1 .251 -19.039 -3.069 .00 0.00 IMOD

ATOM 754 O LEU 95 1.807 -19.945 -3.688 .00 0.00 IMOD

ATOM 755 CB LEU 95 2.519 -18.145 -1.150 .00 0.00 IMOD

ATOM 756 CG LEU 95 3.390 -17.004 -0.588 .00 0.00 IMOD

ATOM 757 CDl LEU 95 3 .876 -17.313 0.835 .00 0.00 IMOD

ATOM 758 CD2 LEU 95 4 .545 -16.652 -1.540 .00 0.00 IMOD

ATOM 759 N LEU 96 -0.067 -19.054 -2.792 .00 0.00 IMOD

ATOM 760 CA LEU 96 -0 . 900 -20.134 -3.230 .00 0.00 IMOD

ATOM 761 C LEU 96 -0 . 888 -20.142 -4.732 .00 0.00 IMOD

ATOM 762 O LEU 96 -0.771 -21.200 -5.348 .00 0.00 IMOD

ATOM 763 CB LEU 96 -2 .369 -19.977 -2.801 .00 0.00 IMOD

ATOM 764 CG LEU 96 -2 .582 -19.890 -1.278 .00 0.00 IMOD

ATOM 765 CDl LEU 96 -4 .078 -19.820 -0.933 ,00 0.00 IMOD

ATOM 766 CD2 LEU 96 -1 .849 -21.017 -0.533 .00 0.00 IMOD

ATOM 767 N PHE 97 -0. 976 -18.950 -5.364 .00 0.00 IMOD

ATOM 768 CA PHE 97 -1 006 -18.876 -6.807 .00 0.00 IMOD

ATOM 769 C PHE 97 0.238 -19.523 -7.287 1.00 0.00 IMOD

ATOM 770 O PHE 97 0.227 -20.345 -8.198 00 0.00 IMOD

ATOM 771 CB PHE 97 0.700 -17.503 -7.455 00 0.00 IMOD

ATOM 772 CG PHE • 97 -1 632 -16.331 -7.434 00 0.00 IMOD

ATOM 773 CDl PHE 97 1.657 -15.455 -6.377 00 0.00 IMOD

ATOM 774 CD2 PHE 97 2.432 -16.061 -8.523 00 0.00 IMOD

ATOM 775 CEl PHE 97 -2 476 -14.349 -6.382 00 0.00 IMOD

ATOM 776 CE2 PHE 97 ^■ 3 .255 -14.958 -8.536 00 0.00 IMOD

ATOM 111 CZ PHE 97 ^■ 3 . 281 -14.093 -7.466 00 0.00 IMOD

ATOM 778 N ALA 98 1 . 357 -19.161 -6.647 .00 0.00 IMOD

ATOM 779 CA ALA 98 2 . 647 -19.573 -7.096 .00 0.00 IMOD

ATOM 780 C ALA 98 2 . 651 -21.054 -7.152 00 0.00 IMOD

ATOM 781 O ALA 98 3 .418 -21.612 -7.921 00 0.00 IMOD

ATOM 782 CB ALA 98 3 .790 -19.130 -6.165 00 0.00 IMOD

ATOM 783 N LEU 99 1 .862 -21.716 -6.284 00 0.00 IMOD

ATOM 784 CA LEU 99 1 .706 -23.148 -6.258 00 0.00 IMOD

ATOM 785 C LEU 99 1 .032 -23.634 -7.517 00 0.00 IMOD

ATOM 786 O LEU 99 1.439 -24.633 -8.109 00 0.00 IMOD

ATOM 787 CB LEU 99 0 . 845 -23.571 -5.049 00 0.00 IMOD

ATOM 788 CG LEU 99 0 .580 -25.082 -4.878 00 0.00 IMOD

ATOM 789 CDl LEU 99 -0 . 405 -25.640 -5.922 00 0.00 IMOD

ATOM 790 CD2 LEU 99 1 . 900 -25.862 -4.820 00 0.00 IMOD

ATOM 791 N THR 100 -0 . 032 -22.934 -7.958 00 0.00 IMOD

ATOM 792 CA THR 100 -0 .811 -23.308 -9.109 00 0.00 IMOD

ATOM 793 C THR 100 0 . 083 -23.196 -10.296 00 0.00 IMOD

ATOM 794 O THR 100 -0 . 101 -23.860 -11.312 00 0.00 IMOD

ATOM 795 CB THR 100 -1 . 983 -22.401 -9.358 00 0.00 IMOD

ATOM 796 OGl THR 100 -2 . 923 -23.062 -10.179 00 0.00 IMOD

ATOM 797 CG2 THR 100 -1 .519 -21.148 -10.119 00 0.00 IMOD

ATOM 798 N LEU 101 .078 -22.308 -10.170 00 0.00 IMOD

ATOM 799 CA LEU 101 . 991 -21.970 -11.217 00 0.00 IMOD

ATOM 800 C LEU 101 2 . 744 -23.183 -11.694 00 0.00 IMOD

ATOM 801 O LEU 101 968 -23.269 -12.898 00 0.00 IMOD

ATOM 802 CB LEU 101 011 -20.905 -10.754 00 0.00 IMOD

ATOM 803 CG LEU 101 967 -20.357 -11.838 00 0.00 IMOD

ATOM 804 CDl LEU 101 001 -21.396 -12.294 00 0.00 IMOD

ATOM 805 CD2 LEU 101 3.191 -19.740 -13.011 00 0.00 IMOD

ATOM 806 N PRO 102 3.189 -24.119 -10.892 00 0.00 IMOD

ATOM 807 CA PRO 102 3.928 -25.202 -11.472 00 0.00 IMOD

ATOM 808 C PRO 102 3.150 -26.081 -12.377 00 0.00 IMOD

ATOM 809 O PRO 102 3.740 -26.608 -13.312 1.00 0.00 IMOD

ATOM 810 CB PRO 102 .618 25.931 -10.325 .00 0.00 IMOD

ATOM 811 CG PRO 102 .846 24.809 -9.304 .00 0.00 IMOD

ATOM 812 CD PRO 102 .696 23.825 -9.572 .00 0.00 IMOD

ATOM 813 N ILE 103 .851 26.297 -12.124 .00 0.00 IMOD

ATOM 814 CA ILE 103 .141 27".090 -13.076 .00 0.00 IMOD

ATOM 815 C ILE 103 .060 26.316 -14.345 .00 0.00 IMOD

ATOM 816 O ILE 103 1.177 26.875 -15.435 .00 0.00 IMOD

ATOM 817 CB ILE 103 -0.217 27.551 -12.626 .00 0.00 IMOD

ATOM 818 CGl ILE 103 -0.997 28.105 -13.832 .00 0.00 IMOD

ATOM 819 CG2 ILE 103 -0.894 26.430 -11.830 .00 0.00 IMOD

ATOM 820 CDl ILE 103 -0.304 29.277 -14.523 .00 0.00 IMOD

ATOM 821 N TRP 104 0.854 24.995 -14.224 .00 0.00 IMOD

ATOM 822 CA TRP 104 0.720 24.148 -15.369 .00 0.00 IMOD

ATOM 823 C TRP 104 2.019 24.162 -16.116 .00 0.00 IMOD

ATOM 824 O TRP 104 2.054 24.249 -17.341 .00 0.00 IMOD

ATOM 825 CB TRP 104 0.381 22.705 -14.960 .00 0.00 IMOD

ATOM 826 CG TRP 104 -0.147 21.842 -16.077 .00 0.00 IMOD

ATOM 827 CDl TRP 104 0.024 21.940 -17.427 .00 0.00 IMOD

ATOM 828 CD2 TRP 104 -1.036 - 20.734 -15.860 .00 0.00 IMOD

ATOM 829 NEl TRP 104 -0.714 -: 20.967 -18.063 1.00 0.00 IMOD

ATOM 830 CE2 TRP 104 -1.370 ^• 20.218 -17.110 1.00 0.00 IMOD

ATOM 831 CE3 TRP 104 -1.544 ^■ 20.200 -14.710 1.00 0.00 IMOD

ATOM 832 CZ2 TRP 104 -2.220 ^• 19.154 -17.231 1. 00 0.00 IMOD

ATOM 833 CZ3 TRP 104 -2.392 ^■ 19.122 -14.834 1.00 0.00 IMOD

ATOM 834 CH2 TRP 104 -2.726 ^• 18.610 -16.070 1.00 0.00 IMOD

ATOM 835 N ALA 105 3.137 ^■ 24.049 -15.379 1.00 0.00 IMOD

ATOM 836 CA ALA 105 4.438 ^• 24.064 -15.979 1.00 0.00 IMOD

ATOM 837 C ALA 105 4.697 ^• 25.413 -16.563 1 00 0.00 IMOD

ATOM 838 O ALA 105 5.162 ^■ 25.527 -17.689 00 0.00 IMOD

ATOM 839 CB ALA 105 5.559 ^• 23.784 -14.966 00 0.00 IMOD

ATOM 840 N ALA 106 4.384 ^• 26.487 -15.824 00 0.00 IMOD

ATOM 841 CA ALA 106 4.670 ^■ 27.813 -16.286 00 0.00 IMOD

ATOM 842 C ALA 106 3.887 ^• 28.053 -17.527 00 0.00 IMOD

ATOM 843 O ALA 106 4.378 ^■ 28.636 -18.493 00 0.00 IMOD

ATOM 844 CB ALA 106 4.261 ^• 28.900 -15.277 00 0.00 IMOD

ATOM 845 N SER 107 2.629 ^■ 27.590 -17.530 00 0.00 IMOD

ATOM 846 CA SER 107 1.781 ^• 27.829 -18.655 00 0.00 IMOD

ATOM 847 C SER 107 2.322 ^■ 27.127 -19.855 00 0.00 IMOD

ATOM 848 O SER 107 2.253 ^■ 27.648 -20.966 00 0.00 IMOD

ATOM 849 CB SER 107 0.350 27.316 -18.440 00 0.00 IMOD

ATOM 850 OG SER 107 0.344 •25.901 -18.341 .00 0.00 IMOD

ATOM 851 N LYS 108 2.954 ^■ 25.960 -19.642 .00 0.00 IMOD

ATOM 852 CA LYS 108 3.361 ^• 25.093 -20.710 .00 0.00 IMOD

ATOM 853 C LYS 108 4.217 25.867 -21.647 .00 0.00 IMOD

ATOM 854 O LYS 108 4.291 ^■ 25.558 -22.837 .00 0.00 IMOD

ATOM 855 CB LYS 108 4.273 23.931 -20.285 .00 0.00 IMOD

ATOM 856 CG LYS 108 5.743 ^■ 24.110 -20.712 .00 0.00 IMOD

ATOM 857 CD LYS 108 6.644 25.054 -19.898 .00 0.00 IMOD

ATOM 858 CE LYS 108 7.833 25.671 -20.641 .00 0.00 IMOD

ATOM 859 NZ LYS 108 8.835 26.182 -19.674 .00 0.00 IMOD

ATOM 860 N VAL 109 911 26.884 -21.117 .00 0.00 IMOD

ATOM 861 CA VAL 109 830 27.634 -21.909 .00 0.00 IMOD

ATOM 862 C VAL 109 089 28.173 -23.083 .00 0.00 IMOD

ATOM 863 O VAL 109 547 28.033 -24.214 .00 0.00 IMOD

ATOM 864 CB VAL 109 369 28.845 -21.200 .00 0.00 IMOD

ATOM 865 CGl VAL 109 335 29.585 -22.145 .00 0.00 IMOD

ATOM 866 CG2 VAL 109 000 28.415 -19.869 .00 0.00 IMOD

ATOM 867 N ASN 110 3.921 28.806 -22.854 .00 0.00 IMOD

ATOM 868 CA ASN 110 3.243 - 29.378 -23.979 .00 0.00 IMOD

ATOM 869 C ASN 110 1.776 - 29,529 -23.717 .00 0.00 IMOD

ATOM 870 O ASN 110 0.950 - 28.883 -24.362 .00 0.00 IMOD

ATOM 871 CB ASN 110 .780 30.764 -24.367 .00 0.00 IMOD

ATOM 872 CG ASN 110 .043 30.559 -25.192 00 0.00 IMOD

ATOM 873 ODl ASN 110 .030 29.846 -26.194 00 0.00 IMOD

ATOM 874 ND2 ASN 110 6.168 - 31.190 -24.764 1.00 0.00 IMOD

ATOM 875 N GLY 111 1.400 -30.428 -22.787 00 0.00 IMOD

ATOM 876 CA GLY 111 -0.003 -30.680 -22.619 00 0.00 IMOD

ATOM 877 C GLY 111 -0.363 -30.681 -21.178 00 0.00 IMOD

ATOM 878 O GLY 111 0.484 -30.561 -20.295 00 0.00 IMOD

ATOM 879 N TRP 112 -1.674 -30.826 -20.920 00 0.00 IMOD

ATOM 880 CA TRP 112 -2.163 -30.806 -19.585 00 0.00 IMOD

ATOM 881 C TRP 112 -1.917 -32.191 -19.090 00 0.00 IMOD

ATOM 882 O TRP 112 -2.828 -33.010 -18.969 00 0.00 IMOD

ATOM 883 CB TRP 112 -3.661 -30.537 -19.576 00 0.00 IMOD

ATOM 884 CG TRP 112 -4.014 -29.895 -18.294 00 0.00 IMOD

ATOM 885 CDl TRP 112 -4.245 -30.451 -17.086 00 0.00 IMOD

ATOM 886 CD2 TRP 112 -4.126 -28.477 -18.128 00 0.00 IMOD

ATOM 887 NEl TRP 112 -4.468 -29.469 -16.171 00 0.00 IMOD

ATOM 888 CE2 TRP 112 -4.409 -28.248 -16.788 00 0.00 IMOD

ATOM 889 CE3 TRP 112 -3.977 -27.455 -19.013 00 0.00 IMOD

ATOM 890 CZ2 TRP 112 -4.555 -26.984 -16.295 00 0.00 IMOD

ATOM 891 CZ3 TRP 112 -4.161 -26.185 -18.522 00 0.00 IMOD

ATOM 892 CH2 TRP 112 -4.441 -25.949 -17.192 00 0.00 IMOD

ATOM 893 N ILE 113 -0.647 -32.452 -18.743 00 0.00 IMOD

ATOM 894 CA ILE 113 -0.196 -33.779 -18.466 00 0.00 IMOD

ATOM 895 C ILE 113 -0.905 -34.408 -17.319 00 0.00 IMOD

ATOM 896 O ILE 113 -1.280 -35.576 -17.407 00 0.00 IMOD

ATOM 897 CB ILE 113 1.284 -33.856 -18.213 00 0.00 IMOD

ATOM 898 CGl ILE 113 1.727 -35.323 -18.076 00 0.00 IMOD

ATOM 899 CG2 ILE 113 1.624 -32.972 -17.005 00 0.00 IMOD

ATOM 900 CDl ILE 113 3.244 -35.511 -18.116 00 0.00 IMOD

ATOM 901 N PHE 114 -1.123 -33.702 -16.199 00 0.00 IMOD

ATOM 902 CA PHE 114 -1.715 -34.508 -15.179 00 0.00 IMOD

ATOM 903 C PHE 114 -3.196 -34.351 -15.147 00 0.00 IMOD

ATOM 904 O PHE 114 -3.788 -34.123 -14.093 00 0.00 IMOD

ATOM 905 CB PHE 114 -1.153 -34.230 -13.784 00 0.00 IMOD

ATOM 906 CG PHE 114 0.237 -34.760 -13.768 00 0.00 IMOD

ATOM 907 CDl PHE 114 1.293 -34.037 -14.275 00 0.00 IMOD

ATOM 908 CD2 PHE 114 0.482 -36.000 -13.236 00 0.00 IMOD

ATOM 909 CEl PHE 114 2.570 -34.550 -14.253 00 0.00 IMOD

ATOM 910 CE2 PHE 114 1.755 -36.517 -13.211 00 0.00 IMOD

ATOM 911 CZ PHE 114 2.804 -35.795 -13.721 00 0.00 IMOD

ATOM 912 N GLY 115 -3.837 -34.507 -16.316 00 0.00 IMOD

ATOM 913 CA GLY 115 -5.264 -34.563 -16.398 00 0.00 IMOD

ATOM 914 C GLY 115 -5.906 -33.373 -15.769 00 0.00 IMOD

ATOM 915 O GLY 115 -5.274 -32.369 -15.455 00 0.00 IMOD

ATOM 916 N THR 116 -7.217 -33.529 -15.519 00 0.00 IMOD

ATOM 917 CA THR 116 -8.105 -32.530 -15.007 00 0.00 IMOD

ATOM 918 C THR 116 -7.664 -32.085 -13.651 00 0.00 IMOD

ATOM 919 O THR 116 -7.856 -30.925 -13.299 00 0.00 IMOD

ATOM 920 CB THR 116 -9.509 -33.044 -14.880 00 0.00 IMOD

ATOM 921 OGl THR 116 -10.395 -31.989 -14.539 00 0.00 IMOD

ATOM 922 CG2 THR 116 -9.528 -34.138 -13.799 00 0.00 IMOD

ATOM 923 N PHE 117 -7.075 -32.982 -12.841 00 0.00 IMOD

ATOM 924 CA PHE 117 -6.721 -32.585 -11.506 00 0.00 IMOD

ATOM 925 C PHE 117 -5.787 -31.419 -11.573 00 0.00 IMOD

ATOM 926 O PHE 117 -5.984 -30.413 -10.894 00 0.00 IMOD

ATOM 927 CB PHE 117 -6.009 -33.690 -10.710 00 0.00 IMOD

ATOM 928 CG PHE 111 -5.758 -33.143 -9.347 00 0.00 IMOD

ATOM 929 CDl PHE 117 -6.727 -33.221 -8.373 00 0.00 IMOD

ATOM 930 CD2 PHE 117 -4.553 -32.551 -9.042 00 0.00 IMOD

ATOM 931 CEl PHE 117 -6.497 -32.715 -7.115 00 0.00 IMOD

ATOM 932 CE2 PHE 117 -4.318 -32.045 -7.784 00 0.00 IMOD

ATOM 933 CZ PHE 117 -5.292 -32.127 -6.818 00 0.00 IMOD

ATOM 934 N LEU 118 -4.744 -31.504 -12.409 00 0.00 IMOD

ATOM 935 CA LEU 118 -3.864 -30.383 -12.495 00 0.00 IMOD

ATOM 936 C LEU 118 -4.608 -29.241 -13.090 00 0.00 IMOD

ATOM 937 O LEU 118 -4.236 -28.083 -12.912 00 0.00 IMOD

ATOM 938 CB LEU 118 -2.530 -30.683 -13.185 00 0.00 IMOD

ATOM 939 CG LEU 118 -1.593 -31.372 -12.176 1.00 0.00 IMOD

ATOM 940 CDl LEU 118 -2.239 32.626 -11.574 .00 0.00 IMOD

ATOM 941 CD2 LEU 118 -0.210 31.636 -12.771 .00 0.00 IMOD

ATOM 942 N CYS 119 -5.665 29.542 -13.855 .00 0.00 IMOD

ATOM 943 CA CYS 119 -6.449 28.506 -14.460 .00 0.00 IMOD

ATOM 944 C CYS 119 -7.105 27.751 -13.346 .00 0.00 IMOD

ATOM 945 O CYS 119 -7.105 26.521 -13.325 .00 0.00 IMOD

ATOM 946 CB CYS 119 -7..494 29.122 -15.407 .00 0.00 IMOD

ATOM 947 SG CYS 119 .602 28.013 -16.337 .00 0.00 IMOD

ATOM 948 N LYS 120 -7, .668 28.488 -12.369 .00 0.00 IMOD

ATOM 949 CA LYS 120 -8.305 27.890 -11.235 .00 0.00 IMOD

ATOM 950 C LYS 120 -7.281 27.180 -10.412 .00 0.00 IMOD

ATOM 951 O LYS 120 -7.551 26.111 -9.874 .00 0.00 IMOD

ATOM 952 CB LYS 120 -9.027 28.901 -10.328 .00 0.00 IMOD

ATOM 953 CG LYS 120 -10.408 29.306 -10.849 .00 0.00 IMOD

ATOM 954 CD LYS 120 -10.375 30.091 -12.161 .00 0.00 IMOD

ATOM 955 CE LYS 120 -11.760 30.312 -12.773 .00 0.00 IMOD

ATOM 956 NZ LYS 120 -12.284 29.034 -13.305 .00 0.00 IMOD

ATOM 957 N VAL 121 -6.075 27.757 -10.258 .00 0.00 IMOD

ATOM 958 CA VAL 121 -5.119 27.068 -9.443 1.00 0.00 IMOD

ATOM 959 C VAL 121 -4.780 25.774 -10.107 00 0.00 IMOD

ATOM 960 O VAL 121 -4.755 24.728 -9.464 00 0.00 IMOD

ATOM 961 CB VAL 121 -3.850 27.845 -9.178 00 0.00 IMOD

ATOM 962 CGl VAL 121 -3.032 27.997 -10.465 00 0.00 IMOD

ATOM 963 CG2 VAL 121 -3. .068 27.119 -8.072 00 0.00 IMOD

ATOM 964 N VAL 122 -4, .533 25.804 -11.430 00 0.00 IMOD

ATOM 965 CA VAL 122 -4.163 24.601 -12.118 00 0.00 IMOD

ATOM 966 C VAL 122 -5.275 23.606 -12.019 00 0.00 IMOD

ATOM 967 O VAL 122 -5.067 - 22.456 -11.640 00 0.00 IMOD

ATOM 968 CB VAL 122 -3.996 ^• 24.797 -13.597 00 0.00 IMOD

ATOM 969 CGl VAL 122 -3.692 ^• 23.429 -14.234 00 0.00 IMOD

ATOM 970 CG2 VAL 122 -2.937 ^■ 25.869 -13.870 00 0.00 IMOD

ATOM 971 N SER 123 -6.499 ^■ 24.033 -12.380 00 0.00 IMOD

ATOM 972 CA SER 123 -7.593 ^■ 23.115 -12.447 00 0.00 IMOD

ATOM 973 C SER 123 -8.025 ^■ 22.653 -11.095 00 0.00 IMOD

ATOM 974 O SER 123 -8.267 ^• 21.465 -10.900 00 0.00 IMOD

ATOM 975 CB SER 123 -8.832 ^■ 23.688 -13.133 00 0.00 IMOD

ATOM 976 OG SER 123 -9.873 ^■ 22.724 -13.156 00 0.00 IMOD

ATOM 977 N LEU 124 -8.139 ^■ 23.581 -10.128 00 0.00 IMOD

ATOM 978 CA LEU 124 -8.658 ^• 23.265 -8.826 00 0.00 IMOD

ATOM 979 C LEU 124 -7.792 ^■ 22.280 -8.114 00 0.00 IMOD

ATOM 980 O LEU 124 -8.288 ^■ 21.302 -7.559 00 0.00 IMOD

ATOM 981 CB LEU 124 -8.764 ^■ 24.497 -7.909 00 0.00 IMOD

ATOM 982 CG LEU 124 -9.299 ^• 24.177 -6.499 00 0.00 IMOD

ATOM 983 CDl LEU 124 -10.743 ^■ 23.656 -6.552 00 0.00 IMOD

ATOM 984 CD2 LEU 124 -9.139 ^■ 25.376 -5.550 00 0.00 IMOD

ATOM 985 N LEU 125 -6.468 22.501 -8.120 00 0.00 IMOD

ATOM 986 CA LEU 125 -5.595 ^• 21.639 -7.376 00 0.00 IMOD

ATOM 987 C LEU 125 -5.648 20.249 -7.917 00 0.00 IMOD

ATOM 988 O LEU 125 -5.544 ^■ 19.285 -7.161 00 0.00 IMOD

ATOM 989 CB LEU 125 -4.129 22.108 -7.357 00 0.00 IMOD

ATOM 990 CG LEU 125 -3.885 23.300 -6.409 00 0.00 IMOD

ATOM 991 CDl LEU 125 -4.034 22.873 -4.941 00 0.00 IMOD

ATOM 992 CD2 LEU 125 -4.797 24.490 -6.737 00 0.00 IMOD

ATOM 993 N LYS 126 -5.767 20.098 -9.242 00 0.00 IMOD

ATOM 994 CA LYS 126 -5.787 18.779 -9.802 00 0.00 IMOD

ATOM 995 C LYS 126 -7.017 18.056 -9.343 00 0.00 IMOD

ATOM 996 O LYS 126 -6.952 16.899 -8.932 00 0.00 IMOD

ATOM 997 CB LYS 126 -5.839 18.814 -11.339 00 0.00 IMOD

ATOM 998 CG LYS 126 -5.853 17.442 -12.018 00 0.00 IMOD

ATOM 999 CD LYS 126 -5.784 17.540 -13.543 00 0.00 IMOD

ATOM 1000 CE LYS 126 -5.664 16.192 -14.255 00 0.00 IMOD

ATOM 1001 NZ LYS 126 -4.238 15.878 -14.495 00 0.00 IMOD

ATOM 1002 N GLU 127 -8.181 18.730 -9.406 00 0.00 IMOD

ATOM 1003 CA GLU 127 -9.405 18.066 -9.076 00 0.00 IMOD

ATOM 1004 C GLU 127 -9.402 17.666 -7.645 1.00 0.00 IMOD

ATOM 1005 O GLU 127 -9.709 -16.522 -7.318 00 0.00 IMOD

ATOM 1006 CB GLU 127 -10.648 -18.922 -9.371 00 0.00 IMOD

ATOM 1007 CG GLU 127 -10.851 -19.118 -10.877 00 0.00 IMOD

ATOM 1008 CD GLU 127 -12.013 -20.069 -11.120 00 0.00 IMOD

ATOM 1009 OEl GLU 127 -12.554 -20.633 -10.132 00 0.00 IMOD

ATOM 1010 OE2 GLU 127 -12.374 -20.239 -12.315 00 0.00 IMOD

ATOM 1011 N VAL 128 -8.987 -18.583 -6.755 00 0.00 IMOD

ATOM 1012 CA VAL 128 -9.015 -18.285 -5.356 00 0.00 IMOD

ATOM 1013 C VAL 128 -8.169 -17.088 -5.127 00 0.00 IMOD

ATOM 1014 O VAL 128 -8.501 -16.210 -4.335 00 0.00 IMOD

ATOM 1015 CB VAL 128 -8.493 -19.394 -4.486 00 0.00 IMOD

ATOM 1016 CGl VAL 128 -9.472 -20.570 -4.548 00 0.00 IMOD

ATOM 1017 CG2 VAL 128 -7.078 -19.767 -4.943 00 0.00 IMOD

ATOM 1018 N ASN 129 -7.034 -17.028 -5.826 00 0.00 IMOD

ATOM 1019 CA ASN 129 -6.131 -15.949 -5.628 00 0.00 IMOD

ATOM 1020 C ASN 129 -6.715 -14.649 -6.117 00 0.00 IMOD

ATOM 1021 O ASN 129 -6.539 -13.615 -5.472 00 0.00 IMOD

ATOM 1022 CB ASN 129 -4.784 -16.281 -6.267 00 0.00 IMOD

ATOM 1023 CG ASN 129 -4.218 -17.424 -5.441 00 0.00 IMOD

ATOM 1024 ODl ASN 129 -3.539 -18.319 -5.938 00 0.00 IMOD

ATOM 1025 ND2 ASN 129 -4.535 -17.402 -4.119 00 0.00 IMOD

ATOM 1026 N PHE 130 -7.410 -14.631 -7.275 1.00 0.00 IMOD

ATOM 1027 CA PHE 130 -7.908 -13.356 -7.712 .00 0.00 IMOD

ATOM 1028 C PHE 130 -9.091 -12.922 -6.897 .00 0.00 IMOD

ATOM - 1029 O PHE 130 -9.232 -11.732 -6.614 .00 0.00 IMOD

ATOM 1030 CB PHE 130 -8.218 -13.224 -9.217 .00 0.00 IMOD

ATOM 1031 CG PHE 130 -9.487 -13.875 -9.639 .00 0.00 IMOD

ATOM 1032 CDl PHE 130 -9.582 -15.226 -9.856 .00 0.00 IMOD

ATOM 1033 CD2 PHE 130 -10.596 -13.094 -9.858 .00 0.00 IMOD

ATOM 1034 CEl PHE 130 -10.774 -15.772 -10.272 .00 0.00 IMOD

ATOM 1035 CE2 PHE 130 -11.787 -13.639 -10.270 .00 0.00 IMOD

ATOM 1036 CZ PHE 130 -11.879 -14.990 -10.476 .00 0.00 IMOD

ATOM 1037 N TYR 131 -9.982 -13.862 -6.506 .00 0.00 IMOD

ATOM 1038 CA TYR 131 -11.154 -13.488 -5.756 .00 0.00 IMOD

ATOM 1039 C TYR 131 -10.719 -12.922 -4.446 .00 0.00 IMOD

ATOM 1040 O TYR 131 -11.273 -11.936 -3.964 .00 0.00 IMOD

ATOM 1041 CB TYR 131 -12.121 -14.637 -5.380 .00 0.00 IMOD

ATOM 1042 CG TYR 131 -12.704 -15.302 -6.582 .00 0.00 IMOD

ATOM 1043 CDl TYR 131 -13.547 -14.624 -7.427 .00 0.00 IMOD

ATOM 1044 CD2 TYR 131 -12.397 -16.607 -6.876 .00 0.00 IMOD

ATOM 1045 CEl TYR 131 -14.076 -15.244 -8.535 .00 0.00 IMOD

ATOM 1046 CE2 TYR 131 -12.920 -17.236 -7.981 .00 0.00 IMOD

ATOM 1047 CZ TYR 131 -13.770 -16.553 -8.815 .00 0.00 IMOD

ATOM 1048 OH TYR 131 -14.314 -17.190 -9.951 .00 0.00 IMOD

ATOM 1049 N SER 132 -9.708 -13.543 -3.820 .00 0.00 IMOD

ATOM 1050 CA SER 132 -9.286 -13.073 -2.537 .00 0.00 IMOD

ATOM 1051 C SER 132 -8.869 -11.652 -2.683 .00 0.00 IMOD

ATOM 1052 O SER 132 -9.137 -10.830 -1.811 .00 0.00 IMOD

ATOM 1053 CB SER 132 -8.122 -13.899 -1.966 .00 0.00 IMOD

ATOM 1054 OG SER 132 -7.042 -13.945 -2.887 ,00 0.00 IMOD

ATOM 1055 N GLY 133 -8.217 -11.325 -3.810 .00 0.00 IMOD

ATOM 1056 CA GLY 133 -7.778 -9.985 -4.035 .00 0.00 IMOD

ATOM 1057 C GLY 133 -8.972 -9.095 -4.162 .00 0.00 IMOD

ATOM 1058 O GLY 133 -8.978 -7.979 -3.644 .00 0.00 IMOD

ATOM 1059 N ILE 134 -10.020 -9.555 -4.877 ,00 0.00 IMOD

ATOM 1060 CA ILE 134 -11.133 -8.674 -5.072 .00 0.00 IMOD

ATOM 1061 C ILE 134 -11.764 -8.412 -3.743 .00 0.00 IMOD

ATOM 1062 O ILE 134 -12.099 -7.279 -3.406 .00 0.00 IMOD

ATOM 1063 CB ILE 134 -12.226 -9.199 -5.982 ,00 0.00 IMOD

ATOM 1064 CGl ILE 134 -13.011 -10.371 -5.378 ,00 0.00 IMOD

ATOM 1065 CG2 ILE 134 -11.561 -9.603 -7.301 00 0.00 IMOD

ATOM 1066 CDl ILE 134 -14.351 -10.620 -6.059 00 0.00 IMOD

ATOM 1067 N LEU 135 -11.933 -9.480 -2.953 00 0.00 IMOD

ATOM 1068 CA LEU 135 -12.615 -9.429 -1.700 ,00 0.00 IMOD

ATOM 1069 C LEU 135 -11.834 -8.587 -0.755 1.00 0.00 IMOD

ATOM 1070 O LEU 135 -12.406 -7.848 0.045 .00 0.00 IMOD

ATOM 1071 CB LEU 135 -12.749 -10.826 1.094 .00 0.00 IMOD

ATOM 1072 CG LEU 135 -13.411 -11.787 2.089 1.00 0.00 IMOD

ATOM 1073 CDl LEU 135 -13.681 -13.157 1.461 00 0.00 IMOD

ATOM 1074 CD2 LEU 135 -14.644 -11.143 2.734 00 0.00 IMOD

ATOM 1075 N LEU 136 -10.495 -8.684 0.800 00 0.00 IMOD

ATOM 1076 CA LEU 136 -9.728 -7.918 0.140 00 0.00 IMOD

ATOM 1077 C LEU 136 -9.991 -6.481 0.161 00 0.00 IMOD

ATOM 1078 O LEU 136 -10.121 -5.653 0.738 00 0.00 IMOD

ATOM 1079 CB LEU 136 -8.197 -8.082 0.020 00 0.00 IMOD

ATOM 1080 CG LEU 136 -7.647 -9.522 0.058 00 0.00 IMOD

ATOM 1081 CDl LEU 136 -6.132 -9.534 0.215 00 0.00 IMOD

ATOM 1082 CD2 LEU 136 -8.303 -10.405 1.115 00 0.00 IMOD

ATOM 1083 N LEU 137 -10.095 -6.157 1.462 00 0.00 IMOD

ATOM 1084 CA LEU 137 -10.269 -4.802 1.884 00 0.00 IMOD

ATOM 1085 C LEU 137 -11.515 -4.267 1.268 00 0.00 IMOD

ATOM 1086 O LEU 137 -11.579 -3.098 -0.897 00 0.00 IMOD

ATOM 1087 CB LEU 137 -10.415 -4.671 -3.408 00 0.00 IMOD

ATOM 1088 CG LEU 137 -10.608 -3.220 -3.885 00 0.00 IMOD

ATOM 1089 CDl LEU 137 -9.381 -2.358 -3.551 00 0.00 IMOD

ATOM 1090 CD2 LEU 137 -10.994 -3.168 -5.373 00 0.00 IMOD

ATOM 1091 N ALA 138 -12.561 -5.100 -1.166 00 0.00 IMOD

ATOM 1092 CA ALA 138 -13.777 -4.608 -0.593 00 0.00 IMOD

ATOM 1093 C ALA 138 -13.548 -4.240 0.844 1.00 0.00 IMOD

ATOM 1094 O ALA 138 -13.982 -3.186 1.304 00 0.00 IMOD

ATOM 1095 CB ALA 138 -14.925 -5.633 -0.633 00 0.00 IMOD

ATOM 1096 N CYS 139 -12.852 -5.095 1.609 00 0.00 IMOD

ATOM 1097 CA CYS 139 -12.691 -4.773 2.996 00 0.00 IMOD

ATOM 1098 C CYS 139 -11.817 -3.572 3.160 1.00 0.00 IMOD

ATOM 1099 O CYS 139 -12.044 -2.743 4.037 00 0.00 IMOD

ATOM 1100 CB CYS 139 -12.167 -5.938 3.836 00 0.00 IMOD

ATOM 1101 SG CYS 139 -13.412 -7.264 3.918 00 0.00 IMOD

ATOM 1102 N ILE 140 -10.784 -3.429 2.316 00 0.00 IMOD

ATOM 1103 CA ILE 140 -9.936 -2.281 2.439 00 0.00 IMOD

ATOM 1104 C ILE 140 -10.764 -1.075 2.142 00 0.00 IMOD

ATOM 1105 O ILE 140 -10.592 -0.026 2.760 00 0.00 IMOD

ATOM 1106 CB ILE 140 -8.748 -2.307 1.518 00 0.00 IMOD

ATOM 1107 CGl ILE 140 -7.696 -1.280 1.968 00 0.00 IMOD

ATOM 1108 CG2 ILE 140 -9.235 -2.081 0.081 00 0.00 IMOD

ATOM 1109 CDl ILE 140 -6.331 -1.473 1.304 00 0.00 IMOD

ATOM 1110 N SER 141 -11.693 -1.192 1.174 00 0.00 IMOD

ATOM 1111 CA SER 141 -12.469 -0.041 0.831 00 0.00 IMOD

ATOM 1112 C SER 141 -13.208 0.410 2.052 00 0.00 IMOD

ATOM 1113 O SER 141 -13.350 1.612 2.265 00 0.00 IMOD

ATOM 1114 CB SER 141 -13.497 -0.269 -0.292 00 0.00 IMOD

ATOM 1115 OG SER 141 -14.636 -0.960 0.195 00 0.00 IMOD

ATOM 1116 N VAL 142 -13.731 -0.528 2.871 00 0.00 IMOD

ATOM 1117 CA VAL 142 -14.427 -0.114 4.059 00 0.00 IMOD

ATOM 1118 C VAL 142 -13.483 0.399 5.109 00 0.00 IMOD

ATOM 1119 O VAL 142 -13.754 1.420 5.739 1.00 0.00 IMOD

ATOM 1120 CB VAL 142 -15.321 -1.163 4.674 00 0.00 IMOD

ATOM 1121 CGl VAL 142 -16.402 -1.525 3.643 00 0.00 IMOD

ATOM 1122 CG2 VAL 142 -14.497 -2.357 5.176 00 0.00 IMOD

ATOM 1123 N ASP 143 -12.335 -0.278 5.324 00 0.00 IMOD

ATOM 1124 CA ASP 143 -11.464 0.146 6.385 00 0.00 IMOD

ATOM 1125 C ASP 143 -11.019 1.532 6.082 00 0.00 IMOD

ATOM 1126 O ASP 143 -10.795 2.332 6.988 00 0.00 IMOD

ATOM 1127 CB ASP 143 -10.223 -0.750 6.620 00 0.00 IMOD

ATOM 1128 CG ASP 143 -9.220 -0.713 5.469 00 0.00 IMOD

ATOM 1129 ODl ASP 143 -8.718 0.388 5.119 00 0.00 IMOD

ATOM 1130 OD2 ASP 143 -8.922 -1.816 4.941 00 0.00 IMOD

ATOM 1131 N ARG 144 -10.857 1.843 4.787 00 0.00 IMOD

ATOM 1132 CA ARG 144 -10.448 3.149 4.376 00 0.00 IMOD

ATOM 1133 C ARG 144 -11.546 4.113 4.689 00 0.00 IMOD

ATOM 1134 O ARG 144 -11.291 5.253 5.070 1.00 0.00 IMOD

ATOM 1135 CB ARG 144 -10.176 3.247 2.864 00 0.00 IMOD

ATOM 1136 CG ARG 144 -8.813 2.694 2.435 00 0.00 IMOD

ATOM 1137 CD ARG 144 -7.667 3.711 2.489 00 0.00 IMOD

ATOM 1138 NE ARG 144 -6.880 3.434 3.725 00 0.00 IMOD

ATOM 1139 CZ ARG 144 -6.878 4.313 4.771 00 0.00 IMOD

ATOM 1140 NHl ARG 144 -7.566 5.486 4.678 00 0.00 IMOD

ATOM 1141 NH2 ARG 144 -6.170 4.018 5.901 00 0.00 IMOD

ATOM 1142 N TYR 145 -12.807 3.673 4.521 00 0.00 IMOD

ATOM 1143 CA TYR 145 -13.930 4.551 4.677 00 0.00 IMOD

ATOM 1144 C TYR 145 -13.973 5.060 6.081 00 0.00 IMOD

ATOM 1145 O TYR 145 -14.183 6.249 6.311 00 0.00 IMOD

ATOM 1146 CB TYR 145 -15.269 3.850 4.387 00 0.00 IMOD

ATOM 1147 CG TYR 145 -16.363 4.867 4.422 00 0.00 IMOD

ATOM 1148 CDl TYR 145 -16.592 5.685 3.340 00 0.00 IMOD

ATOM 1149 CD2 TYR 145 -17.168 4.994 5.530 00 0.00 IMOD

ATOM 1150 CEl TYR 145 -17.604 6.616 3.368 00 0.00 IMOD

ATOM 1151 CE2 TYR 145 -18.182 5.923 5.565 00 0.00 IMOD

ATOM 1152 CZ TYR 145 -18.402 6.734 4.479 00 0.00 IMOD

ATOM 1153 OH TYR 145 -19.440 7.690 4.498 00 0.00 IMOD

ATOM 1154 N LEU 146 -13.760 4.168 7.061 00 0.00 IMOD

ATOM 1155 CA LEU 146 -13.871 4.547 8.437 00 0.00 IMOD

ATOM 1156 C LEU 146 -12.831 5.569 8.792 00 0.00 IMOD

ATOM 1157 O LEU 146 -13.116 6.511 9.527 00 0.00 IMOD

ATOM 1158 CB LEU 146 -13.703 3.348 9.383 00 0.00 IMOD

ATOM 1159 CG LEU 146 -14.691 2.214 9.055 00 0.00 IMOD

ATOM 1160 CDl LEU 146 -14.737 1.159 10.170 00 0.00 IMOD

ATOM 1161 CD2 LEU 146 -16.070 2.771 8.679 00 0.00 IMOD

ATOM 1162 N ALA 147 -11.584 5.394 8.312 00 0.00 IMOD

ATOM 1163 CA ALA 147 -10.534 6.304 8.691 00 0.00 IMOD

ATOM 1164 C ALA 147 -10.720 7.697 8.162 00 0.00 IMOD

ATOM 1165 O ALA 147 -10.619 8.668 8.909 00 0.00 IMOD

ATOM 1166 CB ALA 147 -9.150 5.834 8.210 00 0.00 IMOD

ATOM 1167 N ILE 148 -10.944 7.861 6.846 00 0.00 IMOD

ATOM 1168 CA ILE 148 -11.069 9.200 6.350 1.00 0.00 IMOD

ATOM 1169 C ILE 148 -12.399 9.801 6.657 .00 0.00 IMOD

ATOM 1170 O ILE 148 -12.482 10.923 7.152 .00 0.00 IMOD

ATOM 1171 CB ILE 148 -10.809 9.320 4.879 .00 0.00 IMOD

ATOM 1172 CGl ILE 148 -10.764 10.813 4.532 .00 0.00 IMOD

ATOM 1173 CG2 ILE 148 -11.859 8.504 4.100 00 0.00 IMOD

ATOM 1174 CDl ILE 148 -9.730 11.568 5.369 .00 0.00 IMOD

ATOM 1175 N VAL 149 -13.477 9.055 6.344 .00 0.00 IMOD

ATOM 1176 CA VAL 149 -14.818 9.531 6.501 .00 0.00 IMOD

ATOM 1177 C VAL 149 -15.122 9.693 7.955 .00 0.00 IMOD

ATOM 1178 O VAL 149 -15.728 10.685 8.354 .00 0.00 IMOD

ATOM 1179 CB VAL 149 -15.831 8.608 5.896 .00 0.00 IMOD

ATOM 1180 CGl VAL 149 -17.236 9.166 6.175 .00 0.00 IMOD

ATOM 1181 CG2 VAL 149 -15.508 8.474 4.399 .00 0.00 IMOD

ATOM 1182 N HIS 150 -14.694 8.726 8.791 .00 0.00 IMOD

ATOM 1183 CA HIS 150 -14.980 8.794 10.200 .00 0.00 IMOD

ATOM 1184 C HIS 150 -16.453 8.961 10.403 .00 0.00 IMOD

ATOM 1185 O HIS 150 -16.885 9.886 11.091 1.00 0.00 IMOD

ATOM 1186 CB HIS 150 -14.288 9.956 10.933 1.00 0.00 IMOD

ATOM 1187 CG HIS 150 -12.842 9.703 11.225 1.00 0.00 IMOD

ATOM 1188 NDl HIS 150 -11.937 10.678 11.579 .00 0.00 IMOD

ATOM 1189 CD2 HIS 150 -12.149 8.533 11.224 .00 0.00 IMOD

ATOM 1190 CEl HIS 150 -10.746 10.055 11.768 .00 0.00 IMOD

ATOM 1191 NE2 HIS 150 -10.826 8.752 11.564 .00 0.00 IMOD

ATOM 1192 N ALA 151 -17.264 8.074 9.799 .00 0.00 IMOD

ATOM 1193 CA ALA 151 -18.694 8.171 9.896 .00 0.00 IMOD

ATOM 1194 C ALA 151 -19.181 7.976 11.302 .00 0.00 IMOD

ATOM 1195 O ALA 151 -20.038 8.725 11.770 .00 0.00 IMOD

ATOM 1196 CB ALA 151 -19.415 7.133 9.015 .00 0.00 IMOD

ATOM 1197 N THR 152 -18.654 6.971 12.027 .00 0.00 IMOD

ATOM 1198 CA THR 152 -19.195 6.689 13.326 .00 0.00 IMOD

ATOM 1199 C THR 152 -18.400 7.391 14.377 1.00 0.00 IMOD

ATOM 1200 O THR 152 -17.507 8.184 14.086 00 0.00 IMOD

ATOM 1201 CB THR 152 -19.219 5.221 13.649 00 0.00 IMOD

ATOM 1202 OGl THR 152 -20.056 4.973 14.769 00 0.00 IMOD

ATOM 1203 CG2 THR 152 -17.783 4.757 13.942 00 0.00 IMOD

ATOM 1204 N ARG 153 -18.734 7.103 15.649 00 0.00 IMOD

ATOM 1205 CA ARG 153 -18.064 7.701 16.762 00 0.00 IMOD

ATOM 1206 C ARG 153 -16.634 7.303 16.624 00 0.00 IMOD

ATOM 1207 O ARG 153 -16.340 6.285 16.002 00 0.00 IMOD

ATOM 1208 CB ARG 153 -18.606 7.201 18.113 00 0.00 IMOD

ATOM 1209 CG ARG 153 -18.220 8.069 19.310 1.00 0.00 IMOD

ATOM 1210 CD ARG 153 -18.998 7.714 20.579 .00 0.00 IMOD

ATOM 1211 NE ARG 153 -20.450 7.804 20.249 .00 0.00 IMOD

ATOM 1212 CZ ARG 153 -21.125 6.698 19.815 .00 0.00 IMOD

ATOM 1213 NHl ARG 153 -20.491 5.490 19.748 .00 0.00 IMOD

ATOM 1214 NH2 ARG 153 -22.437 6.796 19.453 1.00 0.00 IMOD

ATOM 1215 N THR 154 -15.711 8.117 17.176 00 0.00 IMOD

ATOM 1216 CA THR 154 -14.311 7.863 16.994 00 0.00 IMOD

ATOM 1217 C THR 154 -13.994 6.463 17.396 00 0.00 IMOD

ATOM 1218 O THR 154 -14.078 6.083 18.563 00 0.00 IMOD

ATOM 1219 CB THR 154 -13.417 8.804 17.754 00 0.00 IMOD

ATOM 1220 OGl THR 154 -12.055 8.497 17.493 00 0.00 IMOD

ATOM 1221 CG2 THR 154 -13.713 8.705 19.261 1.00 0.00 IMOD

ATOM 1222 N LEU 155 -13.652 5.639 16.388 1.00 0.00 IMOD

ATOM 1223 CA LEU 155 -13.313 4.277 16.647 1.00 0.00 IMOD

ATOM 1224 C LEU 155 -12.400 3.860 15.538 00 0.00 IMOD

ATOM 1225 O LEU 155 -12.608 4.235 14.385 00 0.00 IMOD

ATOM 1226 CB LEU 155 -14.548 3.357 16.666 00 0.00 IMOD

ATOM 1227 CG LEU 155 -14.270 1.912 17.114 00 0.00 IMOD

ATOM 1228 CDl LEU 155 -13.435 1.150 16.076 1.00 0.00 IMOD

ATOM 1229 CD2 LEU 155 -13.658 1.881 18.525 00 0.00 IMOD

ATOM 1230 N THR 156 -11.348 3.084 15.858 00 0.00 IMOD

ATOM 1231 CA THR 156 -10.419 2.670 14.846 00 0.00 IMOD

ATOM 1232 C THR 156 -10.392 1.174 14.866 00 0.00 IMOD

ATOM 1233 O THR 156 -10.770 0.551 15.857 00 0.00 IMOD

ATOM 1234 CB THR 156 -9.025 3.165 15.096 00 0.00 IMOD

ATOM 1235 OGl THR 156 -8.521 2.607 16.300 00 0.00 IMOD

ATOM 1236 CG2 THR 156 -9.062 4.698 15.212 00 0.00 IMOD

ATOM 1237 N GLN 157 -9.947 0.546 13.760 00 0.00 IMOD

ATOM 1238 CA GLN 157 -10.012 -0.888 13.694 00 0.00 IMOD

ATOM 1239 C GLN 157 -8.842 -1.540 14.367 00 0.00 IMOD

ATOM 1240 O GLN 157 -7.693 -1 380 13.952 00 0.00 IMOD

ATOM 1241 CB GLN 157 -10.062 1.427 12.256 00 0.00 IMOD

ATOM 1242 CG GLN 157 -11.287 0.944 11.478 00 0.00 IMOD

ATOM 1243 CD GLN 157 -11.235 1.563 10.090 00 0.00 IMOD

ATOM 1244 OEl GLN 157 -10.422 2.447 9.819 00 0.00 IMOD

ATOM 1245 NE2 GLN 157 -12.134 -1 094 9.185 00 0.00 IMOD

ATOM 1246 N LYS 158 -9.172 2.340 15.408 00 0.00 IMOD

ATOM 1247 CA LYS 158 -8.289 3.129 16.221 00 0.00 IMOD

ATOM 1248 C LYS 158 -7.927 4.318 15.386 00 0.00 IMOD

ATOM 1249 O LYS 158 -8.490 4.523 14.313 00 0.00 IMOD

ATOM 1250 CB LYS 158 -8.968 -3 609 17.522 00 0.00 IMOD

ATOM 1251 CG LYS 158 -8.005 ^• 4.120 18.597 00 0.00 IMOD

ATOM 1252 CD LYS 158 -8.626 ^• 4.199 19.997 00 0.00 IMOD

ATOM 1253 CE LYS 158 -9.608 ^■ 5.358 20.182 00 0.00 IMOD

ATOM 1254 NZ LYS 158 -10.028 5.445 21.599 00 0.00 IMOD

ATOM 1255 N ARG 159 -6.949 5.119 15.847 00 0.00 IMOD

ATOM 1256 CA ARG 159 -6.492 ^• 6.273 15.121 00 0.00 IMOD

ATOM 1257 C ARG 159 -7.627 7.239 14.995 00 0.00 IMOD

ATOM 1258 O ARG 159 -7.765 -7 936 13.991 00 0.00 IMOD

ATOM 1259 CB ARG 159 -5.325 ^■ 6.975 15.830 00 0.00 IMOD

ATOM 1260 CG ARG 159 -5.670 7.410 17.253 00 0.00 IMOD

ATOM 1261 CD ARG 159 -4.458 -7 891 18.050 00 0.00 IMOD

ATOM 1262 NE ARG 159 -4.929 ^■ 8.181 19.432 00 0.00 IMOD

ATOM 1263 CZ ARG 159 -4.212 9.012 20.242 00 0.00 IMOD

ATOM 1264 NHl ARG 159 -3.064 9.595 19.785 1.00 0.00 IMOD

ATOM 1265 NH2 ARG 159 -4.653 -9.264 21.508 00 0.00 IMOD

ATOM 1266 N TYR 160 -8.488 -7.301 16.018 00 0.00 IMOD

ATOM 1267 CA TYR 160 -9.577 -8.227 15.997 00 0.00 IMOD

ATOM 1268 C TYR 160 -10.434 -7.924 14.801 00 0.00 IMOD

ATOM 1269 O TYR 160 -10.855 -8.834 14.087 00 0.00 IMOD

ATOM 1270 CB TYR 160 -10.444 -8.079 17.251 00 0.00 IMOD

ATOM 1271 CG TYR 160 -11.505 -9.116 17.196 00 0.00 IMOD

ATOM 1272 CDl TYR 160 -11.233 -10.395 17.624 00 0.00 IMOD

ATOM 1273 CD2 TYR 160 -12.759 -8.810 16.723 00 0.00 IMOD

ATOM 1274 CEl TYR 160 -12.207 -11.361 17.582 00 0.00 IMOD

ATOM 1275 CE2 TYR 160 -13.735 -9.775 16.680 00 0.00 IMOD

ATOM 1276 CZ TYR 160 -13.459 -11.050 17.110 00 0.00 IMOD

ATOM 1277 OH TYR 160 -14.460 -12.042 17.068 00 0.00 IMOD

ATOM 1278 N LEU 161 -10.708 -6.631 14.540 00 0.00 IMOD

ATOM 1279 CA LEU 161 -11.540 -6.255 13.428 00 0.00 IMOD

ATOM 1280 C LEU 161 -10.849 -6.687 12.172 00 0.00 IMOD

ATOM 1281 O LEU 161 -11.472 -7.160 11.223 00 0.00 IMOD

ATOM 1282 CB LEU 161 -11.774 -4.736 13.336 00 0.00 IMOD

ATOM 1283 CG LEU 161 -12.566 -4.154 14.522 00 0.00 IMOD

ATOM 1284 CDl LEU 161 -11.799 -4.320 15.842 00 0.00 IMOD

ATOM 1285 CD2 LEU 161 -12.981 -2.699 14.257 00 0.00 IMOD

ATOM 1286 N VAL 162 -9.518 -6.543 12.166 00 0.00 IMOD

ATOM 1287 CA VAL 162 -8.654 -6.896 11.079 00 0.00 IMOD

ATOM 1288 C VAL 162 -8.816 -8.328 10.690 00 0.00 IMOD

ATOM 1289 O VAL 162 -8.908 -8.662 9.508 00 0.00 IMOD

ATOM 1290 CB VAL 162 -7.253 -6.814 11.544 00 0.00 IMOD

ATOM 1291 CGl VAL 162 -6.474 -7.825 10.714 00 0.00 IMOD

ATOM 1292 CG2 VAL 162 -6.755 -5.365 11.422 00 0.00 IMOD

ATOM 1293 N LYS 163 -8.826 -9.221 11.686 00 0.00 IMOD

ATOM 1294 CA LYS 163 -8.857 -10.628 11.428 00 0.00 IMOD

ATOM 1295 C LYS 163 -10.119 -10.999 10.718 1.00 0.00 IMOD

ATOM 1296 O LYS 163 -10.121 -11.876 9.856 00 0.00 IMOD

ATOM 1297 CB LYS 163 -8.781 -11.446 12.729 00 0.00 IMOD

ATOM 1298 CG LYS 163 -8.718 -12.964 12.541 00 0.00 IMOD

ATOM 1299 CD LYS 163 -8.271 -13.708 13.803 00 0.00 IMOD

ATOM 1300 CE LYS 163 -8.405 -15.228 13.700 1.00 0.00 IMOD

ATOM 1301 NZ LYS 163 -7.577 -15.736 12.585 .00 0.00 IMOD

ATOM 1302 N PHE 164 -11.240 -10.347 11.071 .00 0.00 IMOD

ATOM 1303 CA PHE 164 -12.498 -10.737 10.508 .00 0.00 IMOD

ATOM 1304 C PHE 164 -12.502 -10.525 9.025 .00 0.00 IMOD

ATOM 1305 O PHE 164 -12.937 -11.394 8.272 .00 0.00 IMOD

ATOM 1306 CB PHE 164 -13.681 -9.962 11.109 .00 0.00 IMOD

ATOM 1307 CG PHE 164 -14.922 -10.581 10.569 .00 0.00 IMOD

ATOM 1308 CDl PHE 164 -15.456 -11.708 11.149 ,00 0.00 IMOD

ATOM 1309 CD2 PHE 164 -15.552 -10.031 9.477 ,00 0.00 IMOD

ATOM 1310 CEl PHE 164 -16.604 -12.275 10.646 .00 0.00 IMOD

ATOM 1311 CE2 PHE 164 -16.698 -10.593 8.970 .00 0.00 IMOD

ATOM 1312 CZ PHE 164 -17.226 -11.717 9.555 .00 0.00 IMOD

ATOM 1313 N ILE 165 -12.004 -9.363 8.566 .00 0.00 IMOD

ATOM 1314 CA ILE 165 -12.025 -9.027 7.172 ,00 0.00 IMOD

ATOM 1315 C ILE 165 -11.206 -10.000 6.376 .00 0.00 IMOD

ATOM 1316 O ILE 165 -11.620 -10.417 5.295 .00 0.00 IMOD

ATOM 1317 CB ILE 165 -11.612 -7.600 6.943 .00 0.00 IMOD

ATOM 1318 CGl ILE 165 -10.209 -7.341 7.496 .00 0.00 IMOD

ATOM 1319 CG2 ILE 165 -12.682 -6.689 7.568 .00 0.00 IMOD

ATOM 1320 CDl ILE 165 -9.753 -5.902 7.293 .00 0.00 IMOD

ATOM 1321 N CYS 166 -10.032 -10.409 6.887 ,00 0.00 IMOD

ATOM 1322 CA CYS 166 -9.197 -11.345 6.187 ,00 0.00 IMOD

ATOM 1323 C CYS 166 -9.935 -12.641 6.052 ,00 0.00 IMOD

ATOM 1324 O CYS 166 -9.875 -13.293 5.011 .00 0.00 IMOD

ATOM 1325 CB CYS 166 -7.892 -11.655 6.942 .00 0.00 IMOD

ATOM 1326 SG CYS 166 -6.841 -10.189 7.165 .00 0.00 IMOD

ATOM 1327 N LEU 167 -10.651 -13.055 7.114 .00 0.00 IMOD

ATOM 1328 CA LEU 167 -11.351 -14.306 7.065 1.00 0.00 IMOD

ATOM 1329 C LEU 167 -12.418 -14.256 6.021 1.00 0.00 IMOD

ATOM 1330 O LEU 167 -12.626 -15.229 5.299 00 0.00 IMOD

ATOM 1331 CB LEU 167 -12.061 -14.683 8.373 00 0.00 IMOD

ATOM 1332 CG LEU 167 -12.875 -15.987 8.242 1.00 0.00 IMOD

ATOM 1333 CDl LEU 167 -11.969 -17.206 8 .001 00 0.00 IMOD

ATOM 1334 CD2 LEU 167 -13.836 -16.166 9.427 00 0.00 IMOD

ATOM 1335 N SER 168 -13.127 -13.118 . 918 00 0.00 IMOD

ATOM 1336 CA SER 168 -14.241 -13.016 .021 00 0.00 IMOD

ATOM 1337 C SER 168 -13.791 -13.211 . 611 00 0.00 IMOD

ATOM 1338 O SER 168 -14.481 -13.845 .814 00 0.00 IMOD

ATOM 1339 CB SER 168 -14.952 -11.653 .091 00 0.00 IMOD

ATOM 1340 OG SER 168 -14.099 -10.624 4 . 611 00 0.00 IMOD

ATOM 1341 N ILE 169 -12.608 -12.684 3.265 1.00 0.00 IMOD

ATOM 1342 CA ILE 169 -12.150 -12.758 1 .915 00 0.00 IMOD

ATOM 1343 C ILE 169 -11.994 -14.193 1 .548 00 0.00 IMOD

ATOM 1344 O ILE 169 -12.295 -14.589 0 . 423 00 0.00 IMOD

ATOM 1345 CB ILE 169 -10.840 -12.088 1 .735 00 0.00 IMOD

ATOM 1346 CGl ILE 169 -10.954 -10.678 2 .343 00 0.00 IMOD

ATOM 1347 CG2 ILE 169 -10.483 -12.161 0.237 00 0.00 IMOD

ATOM 1348 CDl ILE 169 -12.176 -9.899 1 .860 1.00 0.00 IMOD

ATOM 1349 N TRP 170 -11.490 -15.010 2. 490 00 0.00 IMOD

ATOM 1350 CA TRP 170 -11.275 -16.403 2.232 00 0.00 IMOD

ATOM 1351 C TRP 170 -12.584 -17.086 1 .977 00 0.00 IMOD

ATOM 1352 O TRP 170 -12.680 -17.940 1 . 098 00 0.00 IMOD

ATOM 1353 CB TRP 170 -10.572 -17.145 3.387 00 0.00 IMOD

ATOM 1354 CG TRP 170 -9.123 -16.756 3.606 00 0.00 IMOD

ATOM 1355 CDl TRP 170 -8.570 -15.956 4.564 1.00 0.00 IMOD

ATOM 1356 CD2 TRP 170 -8.038 -17.194 2.771 00 0.00 IMOD

ATOM 1357 NEl TRP 170 -7.209 -15.874 4.383 00 0.00 IMOD

ATOM 1358 CE2 TRP 170 -6.869 -16.629 3.281 00 0.00 IMOD

ATOM 1359 CE3 TRP 170 -8.017 -18.002 671 00 0.00 IMOD

ATOM 1360 CZ2 TRP 170 -5.656 -16.866 698 00 0.00 IMOD

ATOM 1361 CZ3 TRP 170 -6.794 -18.234 080 00 0.00 IMOD

ATOM 1362 CH2 TRP 170 -5.636 -17.678 585 00 0.00 IMOD

ATOM 1363 N GLY 171 -13.629 -16.761 2.756 00 0.00 IMOD

ATOM 1364 CA GLY 171 -14.873 -17.452 2.565 00 0.00 IMOD

ATOM 1365 C GLY 171 -15.464 -17.146 1.222 00 0.00 IMOD

ATOM 1366 O GLY 171 -15.885 -18.050 0.502 00 0.00 IMOD

ATOM 1367 N LEU 172 -15.516 -15.852 0.852 00 0.00 IMOD

ATOM 1368 CA LEU 172 -16.160 -15.476 0.372 00 0.00 IMOD

ATOM 1369 C LEU 172 -15.386 -16.010 1.535 00 0.00 IMOD

ATOM 1370 O LEU 172 -15.965 -16.486 2.510 00 0.00 IMOD

ATOM 1371 CB LEU 172 -16.342 -13.957 0.503 00 0.00 IMOD

ATOM 1372 CG LEU 172 -17.203 -13.534 706 00 0.00 IMOD

ATOM 1373 CDl LEU 172 -18.601 -14.176 649 00 0.00 IMOD

ATOM 1374 CD2 LEU 172 -17.294 -12.004 802 00 0.00 IMOD

ATOM 1375 N SER 173 -14.044 -15.957 460 00 0.00 IMOD

ATOM 1376 CA SER 173 -13.225 -16.410 2.547 00 0.00 IMOD

ATOM 1377 C SER 173 -13.461 -17.874 2.751 00 0.00 IMOD

ATOM 1378 O SER 173 -13.533 -18.349 -3 882 00 0.00 IMOD

ATOM 1379 CB SER 173 -11.720 -16.220 2.292 00 0.00 IMOD

ATOM 1380 OG SER 173 -11.295 -17.066 1.235 00 0.00 IMOD

ATOM 1381 N LEU 174 -13.590 -18.627 1.646 00 0.00 IMOD

ATOM 1382 CA LEU 174 -13.796 -20.047 1.691 00 0.00 IMOD

ATOM 1383 C LEU 174 -15.129 -20.283 -2.322 00 0.00 IMOD

ATOM 1384 O LEU 174 -15.319 -21.243 -3.069 00 0.00 IMOD

ATOM 1385 CB LEU 174 -13.767 -20.648 -0.263 00 0.00 IMOD

ATOM 1386 CG LEU 174 -13.922 -22.177 -0.092 00 0.00 IMOD

ATOM 1387 CDl LEU 174 -13.841 -22.569 1.391 00 0.00 IMOD

ATOM 1388 CD2 LEU 174 -15.203 -22.736 -0.732 00 0.00 IMOD

ATOM 1389 N LEU 175 -16.093 -19.396 -2.028 00 0.00 IMOD

ATOM 1390 CA LEU 175 -17.437 -19.552 -2.492 00 0.00 IMOD

ATOM 1391 C LEU 175 -17.381 -19.626 -3 979 00 0.00 IMOD

ATOM 1392 O LEU 175 -17.997 -20.500 4.586 00 0.00 IMOD

ATOM 1393 CB LEU 175 -18.272 -18.313 2.110 00 0.00 IMOD

ATOM 1394 CG LEU 175 -19.785 -18.373 2.400 1.00 0.00 IMOD

ATOM 1395 CDl LEU 175 -20.098 -18.480 -3.902 1.00 0.00 IMOD

ATOM 1396 CD2 LEU 175 -20.463 -19.459 -1.553 1.00 0.00 IMOD

ATOM 1397 N LEU 176 -16.661 -18.693 -4.621 1.00 0.00 IMOD

ATOM 1398 CA LEU 176 -16.589 -18.760 -6.049 1.00 0.00 IMOD

ATOM 1399 C LEU 176 -15.726 -19.893 -6.527 1.00 0.00 IMOD

ATOM 1400 O LEU 176 -16.109 -20.636 -7.432 1.00 0.00 IMOD

ATOM 1401 CB LEU 176 -16.106 -17.450 -6.699 1.00 0.00 IMOD

ATOM 1402 CG LEU 176 -17.159 -16.327 -6.583 1.00 0.00 IMOD

ATOM 1403 CDl LEU 176 -17.404 -15.935 -5.119 1.00 0.00 IMOD

ATOM 1404 CD2 LEU 176 -16.828 -15.125 -7.481 1.00 0.00 IMOD

ATOM 1405 N ALA 177 -14.524 -20.036 -5.939 1.00 0.00 IMOD

ATOM 1406 CA ALA 177 -13.540 -20.987 -6.391 1.00 0.00 IMOD

ATOM 1407 C ALA 177 -13.887 -22.431 -6.164 1.00 0.00 IMOD

ATOM 1408 O ALA 177 -13.751 -23.250 -7.074 1.00 0.00 IMOD

ATOM 1409 CB ALA 177 -12.165 -20.751 -5.739 1.00 0.00 IMOD

ATOM 1410 N LEU 178 -14.329 -22.788 -4.945 1.00 0.00 IMOD

ATOM 1411 CA LEU 178 -14.509 -24.172 -4.596 1.00 0.00 IMOD

ATOM 1412 C LEU 178 -15.625 -24.872 -5.314 1.00 0.00 IMOD

ATOM 1413 O LEU 178 -15.486 -26.049 -5.638 1.00 0.00 IMOD

ATOM 1414 CB LEU 178 -14.592 -24.421 -3.082 1.00 0.00 IMOD

ATOM 1415 CG LEU 178 -13.193 -24.346 -2.432 1.00 0.00 IMOD

ATOM 1416 CDl LEU 178 -12.572 -22.948 -2.584 1.00 0.00 IMOD

ATOM 1417 CD2 LEU 178 -13.194 -24.885 -0.991 1.00 0.00 IMOD

ATOM 1418 N PRO 179 -16.715 -24.233 -5.594 1.00 0.00 IMOD

ATOM 1419 CA PRO 179 -17.798 -24.945 -6.214 1.00 0.00 IMOD

ATOM 1420 C PRO 179 -17.473 -25.482 -7.568 1.00 0.00 IMOD

ATOM 1421 O PRO 179 -18.208 -26.342 -8.047 1.00 0.00 IMOD

ATOM 1422 CB PRO 179 -18.993 -24.003 -6.147 1.00 0.00 IMOD

ATOM 1423 CG PRO 179 -18.734 -23.216 -4.848 1.00 0.00 IMOD

ATOM 1424 CD PRO 179 -17.201 -23.199 -4.703 1.00 0.00 IMOD

ATOM 1425 N VAL 180 -16.398 -25.010 -8.214 1.00 0.00 IMOD

ATOM 1426 CA VAL 180 -16.056 -25.522 -9.506 1.00 0.00 IMOD

ATOM 1427 C VAL 180 -15.821 -26.987 -9.359 1.00 0.00 IMOD

ATOM 1428 O VAL 180 -16.193 -27.776 -10.226 1.00 0.00 IMOD

ATOM 1429 CB VAL 180 -14.801 -24.898 -10.046 1.00 0.00 IMOD

ATOM 1430 CGl VAL 180 -13.650 -25.158 -9.060 1.00 0.00 IMOD

ATOM 1431 CG2 VAL 180 -14.539 -25.463 -11.451 1.00 0.00 IMOD

ATOM 1432 N LEU 181 -15.172 -27.398 -8.258 1.00 0.00 IMOD

ATOM 1433 CA LEU 181 -14.926 -28.796 -8.093 1.00 0.00 IMOD

ATOM 1434 C LEU 181 -16.247 -29.504 -7.990 1.00 0.00 IMOD

ATOM 1435 O LEU 181 -16.509 -30.445 -8.735 1.00 0.00 IMOD

ATOM 1436 CB LEU 181 -14.209 -29.120 -6.770 1.00 0.00 IMOD

ATOM 1437 CG LEU 181 -12.831 -28.456 -6.598 1.00 0.00 IMOD

ATOM 1438 CDl LEU 181 -12.198 -28.839 -5.248 1.00 0.00 IMOD

ATOM 1439 CD2 LEU 181 -11.908 -28.747 -7.792 1.00 0.00 IMOD

ATOM 1440 N LEU 182 -17.116 -29.048 -7.058 1.00 0.00 IMOD

ATOM 1441 CA LEU 182 -18.360 -29.715 -6.765 1.00 0.00 IMOD

ATOM 1442 C LEU 182 -19.327 -29.678 -7.902 1.00 0.00 IMOD

ATOM 1443 O LEU 182 -19.782 -30.716 -8.381 1.00 0.00 IMOD

ATOM 1444 CB LEU 182 -19.096 -29.089 -5.566 1.00 0.00 IMOD

ATOM 1445 CG LEU 182 -18.316 -29.149 -4.239 1.00 0.00 IMOD

ATOM 1446 CDl LEU 182 -18.028 -30.602 -3.829 1.00 0.00 IMOD

ATOM 1447 CD2 LEU 182 -17.061 -28.263 -4.276 1.00 0.00 IMOD

ATOM 1448 N PHE 183 -19.665 -28.472 -8.386 1.00 0.00 IMOD

ATOM 1449 CA PHE 183 -20.592 -28.419 -9.462 1.00 0.00 IMOD

ATOM 1450 C PHE 183 -19.820 -28.864 -10.614 1.00 0.00 IMOD

ATOM 1451 O PHE 183 -18.651 -28.525 -10.772 1.00 0.00 IMOD

ATOM 1452 CB PHE 183 -21.151 -27.020 -9.772 1.00 0.00 IMOD

ATOM 1453 CG PHE 183 -22.044 -26.626 -8.649 1.00 0.00 IMOD

ATOM 1454 CDl PHE 183 -23.361 -27.027 -8.631 1.00 0.00 IMOD

ATOM 1455 CD2 PHE 183 -21.560 -25.867 -7.611 1.00 0.00 IMOD

ATOM 1456 CEl PHE 183 -24.186 -26.666 -7.592 1.00 0.00 IMOD

ATOM 1457 CE2 PHE 183 -22.381 -25.502 -6.572 1.00 0.00 IMOD

ATOM 1458 CZ PHE 183 -23.696 -25.901 -6.561 1.00 0.00 IMOD

ATOM 1459 N ARG 184 -20.477 -29.577 -11.525 1.00 0.00 IMOD

ATOM 1460 CA ARG 184 -19.728 -30.006 -12.651 00 0.00 IMOD

ATOM 1461 C ARG 184 -19.302 -28.774 -13.402 00 0.00 IMOD

ATOM 1462 O ARG 184 -18.476 -28.867 -14.308 00 0.00 IMOD

ATOM 1463 CB ARG 184 -20.383 -31.129 -13.467 00 0.00 IMOD

ATOM 1464 CG ARG 184 -20.514 -32.410 -12.641 00 0.00 IMOD

ATOM 1465 CD ARG 184 -20.643 -33.684 -13.475 00 0.00 IMOD

ATOM 1466 NE ARG 184 -19.364 -33.837 -14.219 00 0.00 IMOD

ATOM 1467 CZ ARG 184 -19.279 -33.434 -15.520 00 0.00 IMOD

ATOM 1468 NHl ARG 184 -20.404 -33.023 -16.176 00 0.00 IMOD

ATOM 1469 NH2 ARG 184 -18.078 -33.446 -16.166 00 0.00 IMOD

ATOM 1470 N ARG 185 -19.896 -27.594 -13.053 00 0.00 IMOD

ATOM 1471 CA ARG 185 -19.364 -26.363 -13.530 00 0.00 IMOD

ATOM 1472 C ARG 185 -17.949 -26.477 -13.117 00 0.00 IMOD

ATOM 1473 O ARG 185 -17.616 -26.488 -11.932 00 0.00 IMOD

ATOM 1474 CB ARG 185 -19.974 -25.119 -12.869 1.00 0.00 IMOD

ATOM 1475 CG ARG 185 -19.673 -23.835 -13.641 1.00 0.00 IMOD

ATOM 1476 CD ARG 185 -18.262 -23.297 -13.411 1.00 0.00 IMOD

ATOM 1477 NE ARG 185 -18.220 -22.746 -12.028 00 0.00 IMOD

ATOM 1478 CZ ARG 185 -18.573 -21.445 -11.817 00 0.00 IMOD

ATOM 1479 NHl ARG 185 -18.973 -20.668 -12.866 00 0.00 IMOD

ATOM 1480 NH2 ARG 185 -18.534 -20.924 -10.556 00 0.00 IMOD

ATOM 1481 N THR 186 -17.071 -26.626 -14.114 00 0.00 IMOD

ATOM 1482 CA THR 186 -15.743 -26.920 -13.712 00 0.00 IMOD

ATOM 1483 C THR 186 -14.767 -26.107 -14.463 00 0.00 IMOD

ATOM 1484 O THR 186 -15.073 -25.145 -15.164 00 0.00 IMOD

ATOM 1485 CB THR 186 -15.311 -28.347 -13.917 00 0.00 IMOD

ATOM 1486 OGl THR 186 -15.445 -28.707 -15.284 00 0.00 IMOD

ATOM 1487 CG2 THR 186 -16.114 -29.284 -12.998 00 0.00 IMOD

ATOM 1488 N VAL 187 -13.521 -26.532 -14.253 00 0.00 IMOD

ATOM 1489 CA VAL 187 -12.320 -25.976 -14.752 00 0.00 IMOD

ATOM 1490 C VAL 187 -11.938 -26.706 -15.997 00 0.00 IMOD

ATOM 1491 O VAL 187 -11.792 -27.926 -15.985 00 0.00 IMOD

ATOM 1492 CB VAL 187 -11.256 -26.248 -13.750 00 0.00 IMOD

ATOM 1493 CGl VAL 187 -9.919 -26.074 -14.430 1.00 0.00 IMOD

ATOM 1494 CG2 VAL 187 -11.470 -25.336 -12.531 00 0.00 IMOD

ATOM 1495 N TYR 188 -11.752 -25.963 -17.108 00 0.00 IMOD

ATOM 1496 CA TYR 188 -11.340 -26.584 -18.333 00 0.00 IMOD

ATOM 1497 C TYR 188 -10.225 -25.724 -18.857 00 0.00 IMOD

ATOM 1498 O TYR 188 -10.152 -24.538 -18.542 00 0.00 IMOD

ATOM 1499 CB TYR 188 -12.476 -26.629 -19.372 00 0.00 IMOD

ATOM 1500 CG TYR 188 -12.574 -25.318 -20.072 00 0.00 IMOD

ATOM 1501 CDl TYR 188 -12.735 -24.137 -19.389 00 0.00 IMOD

ATOM 1502 CD2 TYR 188 -12.445 -25.277 -21.440 00 0.00 IMOD

ATOM 1503 CEl TYR 188 -12.806 -22.942 -20.070 00 0.00 IMOD

ATOM 1504 CE2 TYR 188 -12.518 -24.089 -22.125 00 0.00 IMOD

ATOM 1505 CZ TYR 188 -12.705 -22.913 -21.442 00 0.00 IMOD

ATOM 1506 OH TYR 188 -12.779 -21.692 -22.147 00 0.00 IMOD

ATOM 1507 N SER 189 -9.307 -26.303 -19.657 00 0.00 IMOD

ATOM 1508 CA SER 189 -8.165 -25.571 -20.136 00 0.00 IMOD

ATOM 1509 C SER 189 -8.596 -24.559 -21.145 00 0.00 IMOD

ATOM 1510 O SER 189 -9.615 -24.722 -21.811 00 0.00 IMOD

ATOM 1511 CB SER 189 -7.126 -26.451 -20.844 00 0.00 IMOD

ATOM 1512 OG SER 189 -6.600 -27.405 -19.937 00 0.00 IMOD

ATOM 1513 N SER 190 -7.804 -23.475 -21.288 00 0.00 IMOD

ATOM 1514 CA SER 190 -8.156 -22.460 -22.238 00 0.00 IMOD

ATOM 1515 C SER 190 -6.939 -22.084 -23.020 00 0.00 IMOD

ATOM 1516 O SER 190 -5.814 -22.376 -22.612 00 0.00 IMOD

ATOM 1517 CB SER 190 -8.682 -21.163 -21.596 00 0.00 IMOD

ATOM 1518 OG SER 190 -9.908 -21.407 -20.921 00 0.00 IMOD

ATOM 1519 N ASN 191 -7.153 -21.451 -24.200 00 0.00 IMOD

ATOM 1520 CA ASN 191 -6.076 -20.886 -24.968 00 0.00 IMOD

ATOM 1521 C ASN 191 -5.364 -22.007 -25.635 00 0.00 IMOD

ATOM 1522 O ASN 191 -5.923 -22.838 -26.348 00 0.00 IMOD

ATOM 1523 CB ASN 191 -4.968 -20.242 -24.103 00 0.00 IMOD

ATOM 1524 CG ASN 191 -5.556 -19.490 -22.916 1.00 0.00 IMOD

ATOM 1525 ODl ASN 191 -6.760 -19.275 -22.806 00 0.00 IMOD

ATOM 1526 ND2 ASN 191 -4.667 -19.121 -21.955 00 0.00 IMOD

ATOM 1527 N VAL 192 -4.050 -22.022 -25.351 00 0.00 IMOD

ATOM 1528 CA VAL 192 -3.065 -22.991 -25.724 00 0.00 IMOD

ATOM 1529 C VAL 192 -3.419 -24.230 -24.959 00 0.00 IMOD

ATOM 1530 O VAL 192 -2.847 -25.301 -25.160 00 0.00 IMOD

ATOM 1531 CB VAL 192 -1.669 -22.576 -25.336 00 0.00 IMOD

ATOM 1532 CGl VAL 192 -0.680 -23.706 -25.673 00 0.00 IMOD

ATOM 1533 CG2 VAL 192 -1.352 -21.231 -26.010 00 0.00 IMOD

ATOM 1534 N SER 193 -4.384 -24.079 -24.031 00 0.00 IMOD

ATOM 1535 CA SER 193 -4.731 -25.018 -23.019 00 0.00 IMOD

ATOM 1536 C SER 193 -3.635 -25.097 -21.980 00 0.00 IMOD

ATOM 1537 O SER 193 -3.537 -26.186 -21.407 00 0.00 IMOD

ATOM 1538 CB SER 193 -4.960 -26.439 -23.568 00 0.00 IMOD

ATOM 1539 OG SER 193 -6.077 -26.449 -24.444 00 0.00 IMOD

ATOM 1540 N PRO 194 -2.754 -24.113 -21.688 00 0.00 IMOD

ATOM 1541 CA PRO 194 -1.828 -24.249 -20.603 00 0.00 IMOD

ATOM 1542 C PRO 194 -2.458 -23.928 -19.289 00 0.00 IMOD

ATOM 1543 O PRO 194 -1.901 -24.523 -18.267 00 0.00 IMOD

ATOM 1544 CB PRO 194 -0.683 -23.274 -20.857 00 0.00 IMOD

ATOM 1545 CG PRO 194 -1.354 -22.148 -21.639 00 0.00 IMOD

ATOM 1546 CD PRO 194 -2.434 -22.889 -22.430 1.00 0.00 IMOD

ATOM 1547 N ALA 195 -3.589 -23.192 -19.276 00 0.00 IMOD

ATOM 1548 CA ALA 195 -4.174 -22.784 -18.031 00 0.00 IMOD

ATOM 1549 C ALA 195 .590 -23.247 -18.026 00 0.00 IMOD

ATOM 1550 O ALA 195 -6.148 -23.582 -19.068 00 0.00 IMOD

ATOM 1551 CB ALA 195 -4.205 -21.258 -17.845 00 0.00 IMOD

ATOM 1552 N CYS 196 -6.202 -23.309 -16.827 00 0.00 IMOD

ATOM 1553 CA CYS 196 -7.553 -23.765 -16.753 00 0.00 IMOD

ATOM 1554 C CYS 196 -8.404 -22.722 -16.100 00 0.00 IMOD

ATOM 1555 O CYS 196 -7.975 -22.028 -15.180 00 0.00 IMOD

ATOM 1556 CB CYS 196 -7.680 -25.111 -16.022 00 0.00 IMOD

ATOM 1557 SG CYS 196 -7.450 -26.533 -17.138 00 0.00 IMOD

ATOM 1558 N TYR 197 -9.651 -22.584 -16.603 00 0.00 IMOD

ATOM 1559 CA TYR 197 -10.574 -21.594 -16.132 00 0.00 IMOD

ATOM 1560 C TYR 197 -11.908 -22.250 -15.971 00 0.00 IMOD

ATOM 1561 O TYR 197 -12.029 -23.461 -16.141 00 0.00 IMOD

ATOM 1562 CB TYR 197 -10.703 -20.394 -17.079 00 0.00 IMOD

ATOM 1563 CG TYR 197 -9.349 -19.780 -17.068 00 0.00 IMOD

ATOM 1564 CDl TYR 197 -8.382 -20.231 -17.936 00 0.00 IMOD

ATOM 1565 CD2 TYR 197 -9.047 -18.778 -16.175 00 0.00 IMOD

ATOM 1566 CEl TYR 197 -7.126 -19.677 -17.930 00 0.00 IMOD

ATOM 1567 CE2 TYR 197 -7.790 -18.221 -16.166 00 0.00 IMOD

ATOM 1568 CZ TYR 197 -6.830 -18.674 -17.042 00 0.00 IMOD

ATOM 1569 OH TYR 197 -5.541 -18.106 -17.040 00 0.00 IMOD

ATOM 1570 N GLU 198 -12.942 -21.472 -15.591 00 0.00 IMOD

ATOM 1571 CA GLU 198 -14.254 -22.031 -15.405 .00 0.00 IMOD

ATOM 1572 C GLU 198 -14.792 -22.344 -16.759 .00 0.00 IMOD

ATOM 1573 O GLU 198 -14.236 -21.905 -17.764 00 0.00 IMOD

ATOM 1574 CB GLU 198 -15.250 -21.114 -14.675 00 0.00 IMOD

ATOM 1575 CG GLU 198 -14.883 -20.882 -13.209 00 0.00 IMOD

ATOM 1576 CD GLU 198 -14.661 -22.239 -12.549 00 0.00 IMOD

ATOM 1577 OEl GLU 198 -15.624 -23.049 -12.521 00 0.00 IMOD

ATOM 1578 OE2 GLU 198 -13.520 -22.491 -12.074 00 0.00 IMOD

ATOM 1579 N ASP 199 -15.873 -23.150 -16.834 00 0.00 IMOD

ATOM 1580 CA ASP 199 -16.283 -23.517 -18.150 00 0.00 IMOD

ATOM 1581 C ASP 199 -17.421 -22.688 -18.657 00 0.00 IMOD

ATOM 1582 O ASP 199 -18.446 -22.477 -18.012 00 0.00 IMOD

ATOM 1583 CB ASP 199 -16.595 -25.000 -18.348 00 0.00 IMOD

ATOM 1584 CG ASP 199 -16.543 -25.255 -19.845 00 0.00 IMOD

ATOM 1585 ODl ASP 199 -15.716 -24.595 -20.530 00 0.00 IMOD

ATOM 1586 OD2 ASP 199 -17.320 -26.128 -20.315 00 0.00 IMOD

ATOM 1587 N MET 200 -17.149 -22.145 -19.851 00 0.00 IMOD

ATOM 1588 CA MET 200 -17.873 -21.327 -20.767 00 0.00 IMOD

ATOM 1589 C MET 200 -18.834 -22.111 -21.616 1.00 0.00 IMOD

ATOM 1590 O MET 200 -19.547 -21.505 -22.410 00 0.00 IMOD

ATOM 1591 CB MET 200 -16.884 -20.598 -21.688 00 0.00 IMOD

ATOM 1592 CG MET 200 -16.126 -19.493 -20.950 00 0.00 IMOD

ATOM 1593 SD MET 200 -14.355 -19.384 -21.342 00 0.00 IMOD

ATOM 1594 CE MET 200 -14.562 -19.535 -23.139 00 0.00 IMOD

ATOM 1595 N GLY 201 -18.760 -23.461 -21.624 00 0.00 IMOD

ATOM 1596 CA GLY 201 -19.613 -24.269 -22.464 00 0.00 IMOD

ATOM 1597 C GLY 201 -20.961 -24.426 -21.825 00 0.00 IMOD

ATOM 1598 O GLY 201 -21.116 -24.199 -20.627 00 0.00 IMOD

ATOM 1599 N ASN 202 -21.984 -24.839 -22.615 00 0.00 IMOD

ATOM 1600 CA ASN 202 -23.299 -24.976 -22.043 00 0.00 IMOD

ATOM 1601 C ASN 202 -23.274 -25.982 -20.945 00 0.00 IMOD

ATOM 1602 O ASN 202 -23.596 -25.626 -19.814 00 0.00 IMOD

ATOM 1603 CB ASN 202 -24.395 -25.410 -23.034 00 0.00 IMOD

ATOM 1604 CG ASN 202 -24.879 -24.173 -23.777 00 0.00 IMOD

ATOM 1605 ODl ASN 202 -24.300 -23.096 -23.650 00 0.00 IMOD

ATOM 1606 ND2 ASN 202 -25.961 -24.330 -24.586 00 0.00 IMOD

ATOM 1607 N ASN 203 -22.846 -27.232 -21.246 00 0.00 IMOD

ATOM 1608 CA ASN 203 -22.715 -28.284 -20.277 00 0.00 IMOD

ATOM 1609 C ASN 203 -23.889 -28.275 -19.328 00 0.00 IMOD

ATOM 1610 O ASN 203 -23.857 -27.709 -18.243 00 0.00 IMOD

ATOM 1611 CB ASN 203 -21.339 -28.174 -19.622 00 0.00 IMOD

ATOM 1612 CG ASN 203 -20.348 -28.499 -20.726 00 0.00 IMOD

ATOM 1613 ODl ASN 203 -20.382 -29.586 -21.301 00 0.00 IMOD

ATOM 1614 ND2 ASN 203 -19.461 -27.526 -21.058 00 0.00 IMOD

ATOM 1615 N THR 204 -25.014 -28.856 -19.764 1.00 0.00 IMOD

ATOM 1616 CA THR 204 -26.236 -28.792 -19.014 00 0.00 IMOD

ATOM 1617 C THR 204 -26.163 -29.464 -17.669 00 0.00 IMOD

ATOM 1618 O THR 204 -26.659 -28.916 -16.687 00 0.00 IMOD

ATOM 1619 CB THR 204 -27.386 -29.414 -19.759 00 0.00 IMOD

ATOM 1620 OGl THR 204 -28.601 -29.229 -19.047 00 0.00 IMOD

ATOM 1621 CG2 THR 204 -27.099 -30.913 -19.955 00 0.00 IMOD

ATOM 1622 N ALA 205 -25.560 -30.666 -17.567 00 0.00 IMOD

ATOM 1623 CA ALA 205 -25.622 -31.414 -16.333 00 0.00 IMOD

ATOM 1624 C ALA 205 -24.981 -30.673 -15.201 00 0.00 IMOD

ATOM 1625 O ALA 205 -25.542 -30.562 -14.111 00 0.00 IMOD

ATOM 1626 CB ALA 205 -24.909 -32.772 -16.440 00 0.00 IMOD

ATOM 1627 N ASN 206 -23.780 -30.147 -15.460 00 0.00 IMOD

ATOM 1628 CA ASN 206 -22.934 -29.403 -14.577 00 0.00 IMOD

ATOM 1629 C ASN 206 -23.555 -28.089 -14.244 00 0.00 IMOD

ATOM 1630 O ASN 206 -23.338 -27.554 -13.157 00 0.00 IMOD

ATOM 1631 CB ASN 206 -21.578 -29.152 -15.229 00 0.00 IMOD

ATOM 1632 CG ASN 206 -21.849 -28.710 -16.632 00 0.00 IMOD

ATOM 1633 ODl ASN 206 -22.252 -29.525 -17.463 00 0.00 IMOD

ATOM 1634 ND2 ASN 206 -21.629 -27.398 -16.890 00 0.00 IMOD

ATOM 1635 N TRP 207 -24.362 -27.544 -15.169 00 0.00 IMOD

ATOM 1636 CA TRP 207 -24.967 -26.257 -14.979 00 0.00 IMOD

ATOM 1637 C TRP 207 -23.909 -25.213 -14.841 00 0.00 IMOD

ATOM 1638 O TRP 207 -23.909 -24.427 -13.898 00 0.00 IMOD

ATOM 1639 CB TRP 207 -25.818 -26.133 -13.708 00 0.00 IMOD

ATOM 1640 CG TRP 207 -27.021 -27.035 -13.634 00 0.00 IMOD

ATOM 1641 CDl TRP 207 -28.252 -26.905 -14.207 00 0.00 IMOD

ATOM 1642 CD2 TRP 207 -27.072 -28.215 -12.820 00 0.00 IMOD

ATOM 1643 NEl TRP 207 -29.066 -27.938 -13.809 00 0.00 IMOD

ATOM 1644 CE2 TRP 207 -28.354 -28.747 -12.949 00 0.00 IMOD

ATOM 1645 CE3 TRP 207 -26.129 -28.797 -12.018 00 0.00 IMOD

ATOM 1646 CZ2 TRP 207 -28.714 -29.878 -12.276 00 0.00 IMOD

ATOM 1647 CZ3 TRP 207 -26.492 -29.942 -11.347 00 0.00 IMOD

ATOM 1648 CH2 TRP 207 -27.761 -30.468 -11.476 00 0.00 IMOD

ATOM 1649 N ARG 208 -22.958 -25.187 -15.788 00 0.00 IMOD

ATOM 1650 CA ARG 208 -21.954 -24.167 -15.748 00 0.00 IMOD

ATOM 1651 C ARG 208 -22.611 -22.846 -15.963 00 0.00 IMOD

ATOM 1652 O ARG 208 -22.158 -21.835 -15.433 00 0.00 IMOD

ATOM 1653 CB ARG 208 -20.828 -24.363 -16.775 00 0.00 IMOD

ATOM 1654 CG ARG 208 -19.772 -25.339 -16.255 1.00 0.00 IMOD

ATOM 1655 CD ARG 208 -19.091 -26.172 -17.337 00 0.00 IMOD

ATOM 1656 NE ARG 208 -18.428 -27.330 -16.667 00 0.00 IMOD

ATOM 1657 CZ ARG 208 -18.101 -28.450 -17.378 00 0.00 IMOD

ATOM 1658 NHl ARG 208 -18.301 -28.500 -18.726 00 0.00 IMOD

ATOM 1659 NH2 ARG 208 -17.579 -29.538 -16.744 00 0.00 IMOD

ATOM 1660 N MET 209 -23.703 -22.822 -16.748 00 0.00 IMOD

ATOM 1661 CA MET 209 -24.356 -21.594 -17.090 00 0.00 IMOD

ATOM 1662 C MET 209 -24.826 -20.900 -15.847 00 0.00 IMOD

ATOM 1663 O MET 209 -24.655 -19.688 -15.718 00 0.00 IMOD

ATOM 1664 CB MET 209 -25.567 -21.830 -18.007 00 0.00 IMOD

ATOM 1665 CG MET 209 -25.172 -22.359 -19.387 00 0.00 IMOD

ATOM 1666 SD MET 209 -26.555 -23.007 -20.370 00 0.00 IMOD

ATOM 1667 CE MET 209 -26.567 -24.608 -19.515 00 0.00 IMOD

ATOM 1668 N LEU 210 -25.421 -21.636 -14.889 00 0.00 IMOD

ATOM 1669 CA LEU 210 -25.909 -20.994 -13.700 00 0.00 IMOD

ATOM 1670 C LEU 210 -24.759 -20.395 -12.960 00 0.00 IMOD

ATOM 1671 O LEU 210 -24.807 -19.240 -12.540 00 0.00 IMOD

ATOM 1672 CB LEU 210 -26.593 -21.978 -12.732 00 0.00 IMOD

ATOM 1673 CG LEU 210 -27.905 -22.578 -13.271 00 0.00 IMOD

ATOM 1674 CDl LEU 210 -28.985 -21.498 -13.424 00 0.00 IMOD

ATOM 1675 CD2 LEU 210 -27.671 -23.385 -14.558 00 0.00 IMOD

ATOM 1676 N LEU 211 -23.677 -21.172 -12.801 00 0.00 IMOD

ATOM 1677 CA LEU 211 -22.549 -20.732 -12.041 00 0.00 IMOD

ATOM 1678 C LEU 211 -21.897 -19.559 -12.683 00 0.00 IMOD

ATOM 1679 O LEU 211 -21.459 -18.665 -11.981 00 0.00 IMOD

ATOM 1680 CB LEU 211 -21.496 -21.829 -11.816 00 0.00 IMOD

ATOM 1681 CG LEU 211 -21.968 -22.917 -10.832 00 0.00 IMOD

ATOM 1682 CDl LEU 211 -22.185 -22.329 -9.428 00 0.00 IMOD

ATOM 1683 CD2 LEU 211 -23.202 -23.668 -11.352 00 0.00 IMOD

ATOM 1684 N ARG 212 -21.805 -19.483 -14.017 00 0.00 IMOD

ATOM 1685 CA ARG 212 -21.073 -18.393 -14.604 1.00 0.00 IMOD

ATOM 1686 C ARG 212 -21.685 -17.101 -14.187 00 0.00 IMOD

ATOM 1687 O ARG 212 -20.972 -16.155 -13.854 00 0.00 IMOD

ATOM 1688 CB ARG 212 -21.094 -18.399 -16.138 00 0.00 IMOD

ATOM 1689 CG ARG 212 -22.501 -18.275 -16.721 00 0.00 IMOD

ATOM 1690 CD ARG 212 -22.491 -17.971 -18.215 00 0.00 IMOD

ATOM 1691 NE ARG 212 -23.901 -17.913 -18.704 00 0.00 IMOD

ATOM 1692 CZ ARG 212 -24.382 -16.782 -19.304 00 0.00 IMOD

ATOM 1693 NHl ARG 212 -23.613 -15.654 -19.349 00 0.00 IMOD

ATOM 1694 NH2 ARG 212 -25.619 -16.791 -19.883 00 0.00 IMOD

ATOM 1695 N ILE 213 -23.025 -17.028 -14.191 00 0.00 IMOD

ATOM 1696 CA ILE 213 -23.656 -15.812 -13.786 1.00 0.00 IMOD

ATOM 1697 C ILE 213 -23.429 -15.590 -12.326 00 0.00 IMOD

ATOM 1698 O ILE 213 -23.177 -14.461 -11.907 00 0.00 IMOD

ATOM 1699 CB ILE 213 -25.133 -15.753 -14.046 00 0.00 IMOD

ATOM 1700 CGl ILE 213 -25.897 -16.817 -13.244 00 0.00 IMOD

ATOM 1701 CG2 ILE 213 -25.350 -15.838 -15.564 00 0.00 IMOD

ATOM 1702 CDl ILE 213 -27.406 -16.582 -13.245 00 0.00 IMOD

ATOM 1703 N LEU 214 -23.519 -16.655 -11.502 00 0.00 IMOD

ATOM 1704 CA LEU 214 -23.418 -16.431 -10.088 00 0.00 IMOD

ATOM 1705 C LEU 214 -22.076 -15.812 -9.787 00 0.00 IMOD

ATOM 1706 O LEU 214 -22.038 -14.768 -9.140 00 0.00 IMOD

ATOM 1707 CB LEU 214 -23.637 -17.715 -9.264 00 0.00 IMOD

ATOM 1708 CG LEU 214 -25.005 -18.381 -9.503 00 0.00 IMOD

ATOM 1709 CDl LEU 214 -25.171 -19.635 -8.627 00 0.00 IMOD

ATOM 1710 CD2 LEU 214 -26.158 -17.376 -9.354 00 0.00 IMOD

ATOM 1711 N PRO 215 -20.970 -16.384 -10.193 00 0.00 IMOD

ATOM 1712 CA PRO 215 -19.788 -15.592 -10.076 00 0.00 IMOD

ATOM 1713 C PRO 215 -19.688 -14.286 -10.794 00 0.00 IMOD

ATOM 1714 O PRO 215 -19.012 -13.406 -10.264 00 0.00 IMOD

ATOM 1715 CB PRO 215 -18.616 -16.547 -10.243 00 0.00 IMOD

ATOM 1716 CG PRO 215 -19.121 -17.772 -9.468 00 0.00 IMOD

ATOM 1717 CD PRO 215 -20.653 -17.664 -9.555 00 0.00 IMOD

ATOM 1718 N GLN 216 -20.314 -14.092 -11.968 00 0.00 IMOD

ATOM 1719 CA GLN 216 -20.136 -12.795 -12.555 1.00 0.00 IMOD

ATOM 1720 C GLN 216 20.744 -11.783 -11.642 1.00 0.00 IMOD

ATOM 1721 O GLN 216 20.123 -10.775 -11.310 1.00 0.00 IMOD

ATOM 1722 CB GLN 216 20.872 -12.597 -13.889 1.00 0.00 IMOD

ATOM 1723 CG GLN 216 20.348 -13.427 -15.057 1.00 0.00 IMOD

ATOM 1724 CD GLN 216 21.189 -13.050 -16.266 1.00 0.00 IMOD

ATOM 1725 OEl GLN 216 21.594 -11.898 -16.418 1.00 0.00 IMOD

ATOM 1726 NE2 GLN 216 21.464 -14.047 -17.149 1.00 0.00 IMOD

ATOM 1727 N SER 217 21.994 -12.038 -11.215 1.00 0.00 IMOD.

ATOM 1728 CA SER 217 22.710 -11.111 -10.389 1.00 0.00 IMOD

ATOM 1729 C SER 217 22.070 -11.007 -9.048 1.00 0.00 IMOD

ATOM 1730 O SER 217 21.540 -9.962 -8.672 1.00 0.00 IMOD

ATOM 1731 CB SER 217 24.160 -11.559 -10.133 1.00 0.00 IMOD

ATOM 1732 OG SER 217 24.860 -11.695 -11.360 1.00 0.00 IMOD

ATOM 1733 N PHE 218 22.113 -12.115 -8.287 1.00 0.00 IMOD

ATOM 1734 CA PHE 218 21.631 -12.077 -6.944 1.00 0.00 IMOD

ATOM 1735 C PHE 218 20.161 -11.829 -6.929 1.00 0.00 IMOD

ATOM 1736 O PHE 218 19.677 -10.984 -6.177 1.00 0.00 IMOD

ATOM 1737 CB PHE 218 21.923 -13.371 -6.167 1.00 0.00 IMOD

ATOM 1738 CG PHE 218 23.407 -13.479 -6.080 1.00 0.00 IMOD

ATOM 1739 CDl PHE 218 24.095 -12.850 -5.067 1.00 0.00 IMOD

ATOM 1740 CD2 PHE 218 24.112 -14.191 -7.023 1.00 0.00 IMOD

ATOM 1741 CEl PHE 218 25.466 -12.944 -4.989 1.00 0.00 IMOD

ATOM 1742 CE2 PHE 218 25.482 -14.289 -6.949 1.00 0.00 IMOD

ATOM 1743 CZ PHE 218 26.162 -13.666 -5.930 1.00 0.00 IMOD

ATOM 1744 N GLY 219 19.397 -12.580 -7.738 1.00 0.00 IMOD

ATOM 1745 CA GLY 219 17.980 -12.394 -7.681 1.00 0.00 IMOD

ATOM 1746 C GLY 219 17.528 -11.078 -8.245 1.00 0.00 IMOD

ATOM 1747 O GLY 219 16.747 -10.379 -7.603 1.00 0.00 IMOD

ATOM 1748 N PHE 220 17.919 -10.759 -9.502 1.00 0.00 IMOD

ATOM 1749 CA PHE 220 17.451 -9.553 -10.139 1.00 0.00 IMOD

ATOM 1750 C PHE 220 18.171 -8.277 -9.799 1.00 0.00 IMOD

ATOM 1751 O PHE 220 17.581 -7.330 -9.279 1.00 0.00 IMOD

ATOM 1752 CB PHE 220 17.517 -9.643 -11.673 1.00 0.00 IMOD

ATOM 1753 CG PHE 220 16.654 -10.776 -12.108 1.00 0.00 IMOD

ATOM 1754 CDl PHE 220 17.155 -12.058 -12.125 1.00 0.00 IMOD

ATOM 1755 CD2 PHE 220 15.354 -10.563 -12.503 1.00 0.00 IMOD

ATOM 1756 CEl PHE 220 16.370 -13.114 -12.525 1.00 0.00 IMOD

ATOM 1757 CE2 PHE 220 14.565 -11.614 -12.903 1.00 0.00 IMOD

ATOM 1758 CZ PHE 220 15.072 -12.892 -12.916 1.00 0.00 IMOD

ATOM 1759 N ILE 221 19.486 -8.231 -10.108 1.00 0.00 IMOD

ATOM 1760 CA ILE 221 20.190 -6.975 -10.108 1.00 0.00 IMOD

ATOM 1761 C ILE 221 20.440 -6.384 -8.758 1.00 0.00 IMOD

ATOM 1762 O ILE 221 20.170 -5.202 -8.545 1.00 0.00 IMOD

ATOM 1763 CB ILE 221 21.470 -7.001 -10.916 1.00 0.00 IMOD

ATOM 1764 CGl ILE 221 22.572 -7.888 -10.312 1.00 0.00 IMOD

ATOM 1765 CG2 ILE 221 21.079 -7.425 -12.343 1.00 0.00 IMOD

ATOM 1766 CDl ILE 221 23.388 -7.208 -9.213 1.00 0.00 IMOD

ATOM 1767 N VAL 222 20.953 -7.171 -7.798 1.00 0.00 IMOD

ATOM 1768 CA VAL 222 21.291 -6.545 -6.556 1.00 0.00 IMOD

ATOM 1769 C VAL 222 20.081 -6.025 -5.845 1.00 0.00 IMOD

ATOM 1770 O VAL 222 20.167 -4.938 -5.275 1.00 0.00 IMOD

ATOM 1771 CB VAL 222 22.210 -7.345 -5.656 1.00 0.00 IMOD

ATOM 1772 CGl VAL 222 23.618 -7.266 -6.268 1.00 0.00 IMOD

ATOM 1773 CG2 VAL 222 21.754 -8.809 -5.542 1.00 0.00 IMOD

ATOM 1774 N PRO 223 18.951 -6.680 -5.831 1.00 0.00 IMOD

ATOM 1775 CA PRO 223 17.841 -6.100 -5.133 1.00 0.00 IMOD

ATOM 1776 C PRO 223 17.380 -4.874 -5.845 1.00 0.00 IMOD

ATOM 1777 O PRO 223 16.747 -4.019 -5.232 1.00 0.00 IMOD

ATOM 1778 CB PRO 223 16.782 -7.191 -5.034 1.00 0.00 IMOD

ATOM 1779 CG PRO 223 17.604 -8.490 -5.066 1.00 0.00 IMOD

ATOM 1780 CD PRO 223 18.850 -8.129 -5.892 1.00 0.00 IMOD

ATOM 1781 N LEU 224 17.643 -4.798 -7.156 1.00 0.00 IMOD

ATOM 1782 CA LEU 224 17.229 -3.670 -7.926 1.00 0.00 IMOD

ATOM 1783 C LEU 224 18.055 -2.490 -7.521 1.00 0.00 IMOD

ATOM 1784 O LEU 224 17.533 -1.395 -7.322 1.00 0.00 IMOD

ATOM 1785 CB LEU 224 -17.423 -3.910 -9.433 00 0.00 IMOD

ATOM 1786 CG LEU 224 -16.779 -2.842 -10.332 00 0.00 IMOD

ATOM 1787 CDl LEU 224 -17.485 -1 482 -10.226 00 0.00 IMOD

ATOM 1788 CD2 LEU 224 -15.268 2.752 -10.061 00 0.00 IMOD

ATOM 1789 N LEU 225 -19.380 2.689 -7.381 00 0.00 IMOD

ATOM 1790 CA LEU 225 -20.225 1.577 -7.062 00 0.00 IMOD

ATOM 1791 C LEU 225 -19.854 -1 053 -5.721 00 0.00 IMOD

ATOM 1792 O LEU 225 -19.728 0.156 -5.529 00 0.00 IMOD

ATOM 1793 CB LEU 225 -21.719 -1 920 -6.983 00 0.00 IMOD

ATOM 1794 CG LEU 225 -22.570 0.722 -6.517 00 0.00 IMOD

ATOM 1795 CDl LEU 225 -22.544 0.429 -7.534 00 0.00 IMOD

ATOM 1796 CD2 LEU 225 -23.994 1.161 -6.146 00 0.00 IMOD

ATOM 1797 N ILE 226 -19.651 -1 963 -4.757 1.00 0.00 IMOD

ATOM 1798 CA ILE 226 -19.346 ^■ 1.531 -3.433 00 0.00 IMOD

ATOM 1799 C ILE 226 -18.065 ^■ 0.770 -3.430 00 0.00 IMOD

ATOM 1800 O ILE 226 -17.977 0.291 -2.814 00 0.00 IMOD

ATOM 1801 CB ILE 226 -19.238 -2.663 -2.453 00 0.00 IMOD

ATOM 1802 CGl ILE 226 -18.749 2.121 -1.112 00 0.00 IMOD

ATOM 1803 CG2 ILE 226 -18.337 3.762 -3.026 00 0.00 IMOD

ATOM 1804 CDl ILE 226 -19.699 114 -0.481 00 0.00 IMOD

ATOM 1805 N MET 227 -17.038 1.278 -4.128 00 0.00 IMOD

ATOM 1806 CA MET 227 -15.767 0.621 -4.089 00 0.00 IMOD

ATOM 1807 C MET 227 -15.896 0.757 -4.660 1.00 0.00 IMOD

ATOM 1808 O MET 227 -15.387 1.717 -4.085 00 0.00 IMOD

ATOM 1809 CB MET 227 -14.687 -1 364 -4.899 00 0.00 IMOD

ATOM 1810 CG MET 227 -13.255 -0.888 -4.626 00 0.00 IMOD

ATOM 1811 SD MET 227 -12.870 0.794 -5.204 00 0.00 IMOD

ATOM 1812 CE MET 227 -11.149 0.792 -4.619 00 0.00 IMOD

ATOM 1813 N LEU 228 -16.570 0.898 -5.819 00 0.00 IMOD

ATOM 1814 CA LEU 228 -16.690 2.196 -6.429 00 0.00 IMOD

ATOM 1815 C LEU 228 -17.582 3.120 -5.657 00 0.00 IMOD

ATOM 1816 O LEU 228 -17.266 4.296 -5.491 00 0.00 IMOD

ATOM 1817 CB LEU 228 -17.180 2.167 -7.887 00 0.00 IMOD

ATOM 1818 CG LEU 228 -16.088 1.715 -8.871 00 0.00 IMOD

ATOM 1819 CDl LEU 228 -14.967 2.765 -8.971 00 0.00 IMOD

ATOM 1820 CD2 LEU 228 -15.561 0.318 -8.509 00 0.00 IMOD

ATOM 1821 N PHE 229 -18.724 2.615 -5.162 1.00 0.00 IMOD

ATOM 1822 CA PHE 229 -19.691 3.453 -4.511 00 0.00 IMOD

ATOM 1823 C PHE 229 -19.102 4.046 -3.268 00 0.00 IMOD

ATOM 1824 O PHE 229 -19.274 5.233 -2.991 00 0.00 IMOD

ATOM 1825 CB PHE 229 -20.974 2.668 -4.179 00 0.00 IMOD

ATOM 1826 CG PHE 229 -21.958 3.561 -3.506 00 0.00 IMOD

ATOM 1827 CDl PHE 229 -22.706 4.461 -4.237 00 0.00 IMOD

ATOM 1828 CD2 PHE 229 -22.122 3.509 -2.145 00 0.00 IMOD

ATOM 1829 CEl PHE 229 -23.615 5.288 -3.620 00 0.00 IMOD

ATOM 1830 CE2 PHE 229 -23.032 4.330 -1.526 00 0.00 IMOD

ATOM 1831 CZ PHE 229 -23.778 5.220 -2.259 00 0.00 IMOD

ATOM 1832 N CYS 230 -18.363 3.230 -2.496 00 0.00 IMOD

ATOM 1833 CA CYS 230 -17.776 3.694 -1.274 00 0.00 IMOD

ATOM 1834 C CYS 230 -16.827 4.793 -1.623 00 0.00 IMOD

ATOM 1835 O CYS 230 -16.655 5.752 -0.875 00 0.00 IMOD

ATOM 1836 CB CYS 230 -16.981 2.592 -0.553 00 0.00 IMOD

ATOM 1837 SG CYS 230 -16.232 3.167 1.000 00 0.00 IMOD

ATOM 1838 N TYR 231 -16.200 4.670 -2.800 00 0.00 IMOD

ATOM 1839 CA TYR 231 -15.226 5.590 -3.304 00 0.00 IMOD

ATOM 1840 C TYR 231 -15.844 6.945 -3.427 00 0.00 IMOD

ATOM 1841 O TYR 231 -15.216 7.945 -3.091 00 0.00 IMOD

ATOM 1842 CB TYR 231 -14.727 5.132 -4.684 00 0.00 IMOD

ATOM 1843 CG TYR 231 -13.830 6.152 -5.293 00 0.00 IMOD

ATOM 1844 CDl TYR 231 -12.549 6.341 -4.828 00 0.00 IMOD

ATOM 1845 CD2 TYR 231 -14.265 6.895 -6.365 00 0.00 IMOD

ATOM 1846 CEl TYR 231 -11.726 7.280 -5.406 00 0.00 IMOD

ATOM 1847 CE2 TYR 231 -13.444 7.832 -6.948 00 0.00 IMOD

ATOM 1848 CZ TYR 231 -12.173 8.028 -6.467 00 0.00 IMOD

ATOM 1849 OH TYR 231 -11.328 8.989 -7.061 1.00 0.00 IMOD

ATOM 1850 N GLY 232 -17.104 7.017 -3 882 .00 0.00 IMOD

ATOM 1851 CA GLY 232 -17.724 8.290 4.110 .00 0.00 IMOD

ATOM 1852 C GLY 232 -17.715 9.096 ^• 2.847 .00 0.00 IMOD

ATOM 1853 O GLY 232 -17.502 10.306 -2.887 .00 0.00 IMOD

ATOM 1854 N PHE 233 -17.964 8.457 -1.688 .00 0.00 IMOD

ATOM 1855 CA PHE 233 -18.002 9.184 ^■ 0.448 .00 0.00 IMOD

ATOM 1856 C PHE 233 -16.654 9.765 0.154 .00 0.00 IMOD

ATOM 1857 O PHE 233 -16.547 10.912 0.277 .00 0.00 IMOD

ATOM 1858 CB PHE 233 -18.361 8.313 0.767 .00 0.00 IMOD

ATOM 1859 CG PHE 233 -19.782 7.896 0.635 .00 0.00 IMOD

ATOM 1860 CDl PHE 233 -20.087 6.736 ^• 0.029 .00 0.00 IMOD

ATOM 1861 CD2 PHE 233 -20.806 8.655 1.165 .00 0.00 IMOD

ATOM 1862 CEl PHE 233 -21.393 6.342 ^• 0.156 .00 0.00 IMOD

ATOM 1863 CE2 PHE 233 -22.118 8.259 1.039 .00 0.00 IMOD

ATOM 1864 CZ PHE 233 -22.412 7.094 0.375 .00 0.00 IMOD

ATOM 1865 N THR 234 -15.590 8.976 ^• 0.380 .00 0.00 IMOD

ATOM 1866 CA THR 234 -14.244 9.349 ^• 0.058 .00 0.00 IMOD

ATOM 1867 C THR 234 -13.771 10.497 ^■ 0.888 .00 0.00 IMOD

ATOM 1868 O THR 234 -12.833 11.177 ^■ 0.482 .00 0.00 IMOD

ATOM 1869 CB THR 234 -13.231 8.245 ^• 0.211 .00 0.00 IMOD

ATOM 1870 OGl THR 234 -13.141 7.826 -1 564 .00 0.00 IMOD

ATOM 1871 CG2 THR 234 -13.630 7.066 0.689 .00 0.00 IMOD

ATOM 1872 N LEU 235 -14.360 10.742 -2.077 .00 0.00 IMOD

ATOM 1873 CA LEU 235 -13.822 11.788 -2.906 .00 0.00 IMOD

ATOM 1874 C LEU 235 -13.776 13.098 -2.180 .00 0.00 IMOD

ATOM 1875 O LEU 235 -12.796 13.830 -2.303 .00 0.00 IMOD

ATOM 1876 CB LEU 235 -14.585 12.075 -4.214 .00 0.00 IMOD

ATOM 1877 CG LEU 235 -14.294 11.124 -5.389 .00 0.00 IMOD

ATOM 1878 CDl LEU 235 -12.811 11.171 -5.795 .00 0.00 IMOD

ATOM 1879 CD2 LEU 235 -14.810 9.709 -5.133 .00 0.00 IMOD

ATOM 1880 N ARG 236 -14.824 13.445 -1.418 .00 0.00 IMOD

ATOM 1881 CA ARG 236 -14.838 14.731 -0.779 .00 0.00 IMOD

ATOM 1882 C ARG 236 -13.745 14.888 0.242 .00 0.00 IMOD

ATOM 1883 O ARG 236 -12.991 15.860 0.190 .00 0.00 IMOD

ATOM 1884 CB ARG 236 -16.159 15.004 -0.038 .00 0.00 IMOD

ATOM 1885 CG ARG 236 -17.394 15.007 -0.945 .00 0.00 IMOD

ATOM 1886 CD ARG 236 -18.718 15.156 -0.186 .00 0.00 IMOD

ATOM 1887 NE ARG 236 -19.161 16.574 -0.294 .00 0.00 IMOD

ATOM 1888 CZ ARG 236 -19.991 17.104 0.652 .00 0.00 IMOD

ATOM 1889 NHl ARG 236 -20.342 16.366 1.746 .00 0.00 IMOD

ATOM 1890 NH2 ARG 236 -20.469 18.373 0.500 .00 0.00 IMOD

ATOM 1891 N THR 237 -13.618 13.943 1.199 .00 0.00 IMOD

ATOM 1892 CA THR 237 -12.702 14.160 2.288 .00 0.00 IMOD

ATOM 1893 C THR 237 -11.293 14.246 1.807 .00 0.00 IMOD

ATOM 1894 O THR 237 -10.615 15.248 2.029 .00 0.00 IMOD

ATOM 1895 CB THR 237 -12.715 13.062 3.295 .00 0.00 IMOD

ATOM 1896 OGl THR 237 -14.039 12.820 3.734 .00 0.00 IMOD

ATOM 1897 CG2 THR 237 -11.876 13.541 4.487 .00 0.00 IMOD

ATOM 1898 N LEU 238 -10.811 13.186 1.128 .00 0.00 IMOD

ATOM 1899 CA LEU 238 -9.469 13.207 0.630 .00 0.00 IMOD

ATOM 1900 C LEU 238 -9.607 13.007 -0.841 .00 0.00 IMOD

ATOM 1901 O LEU 238 -9.576 11.879 -1.329 .00 0.00 IMOD

ATOM 1902 CB LEU 238 -8.611 12.041 1.150 .00 0.00 IMOD

ATOM 1903 CG LEU 238 -8.588 11.937 2.687 .00 0.00 IMOD

ATOM 1904 CDl LEU 238 -7.628 10.840 3.180 .00 0.00 IMOD

ATOM 1905 CD2 LEU 238 -8.361 13.304 3.356 ,00 0.00 IMOD

ATOM 1906 N PHE 239 -9.823 14.098 1.592 .00 0.00 IMOD

ATOM 1907 CA PHE 239 -10.043 13.891 2.990 .00 0.00 IMOD

ATOM 1908 C PHE 239 -8.801 13.469 3.726 ,00 0.00 IMOD

ATOM 1909 O PHE 239 -8.711 12.344 4.217 .00 0.00 IMOD

ATOM 1910 CB PHE 239 -10.559 15.167 3.676 .00 0.00 IMOD

ATOM 1911 CG PHE 239 -10.977 14.815 -5 059 ,00 0.00 IMOD

ATOM 1912 CDl PHE 239 -12.245 14.340 5.292 ,00 0.00 IMOD

ATOM 1913 CD2 PHE 239 -10.107 14.960 ^■ 6.116 ,00 0.00 IMOD

ATOM 1914 CEl PHE 239 -12.645 14.012 ^■ 6.566 1.00 0.00 IMOD

ATOM 1915 CE2 PHE 239 -10.503 14.633 -7.391 00 0.00 IMOD

ATOM 1916 CZ PHE 239 -11.774 14.160 -7.618 00 0.00 IMOD

ATOM 1917 N LYS 240 -7.823 14.400 -3.804 00 0.00 IMOD

ATOM 1918 CA LYS 240 -6.601 14.294 -4.565 00 0.00 IMOD

ATOM 1919 C LYS 240 -5.571 13.404 -3.948 00 0.00 IMOD

ATOM 1920 O LYS 240 -5.045 12.485 -4.577 00 0.00 IMOD

ATOM 1921 CB LYS 240 -5.955 15.679 -4.742 00 0.00 IMOD

ATOM 1922 CG LYS 240 -6.853 16.659 -5.501 00 0.00 IMOD

ATOM 1923 CD LYS 240 -6.494 18.131 -5.290 00 0.00 IMOD

ATOM 1924 CE LYS 240 -7.340 19.088 -6.133 00 0.00 IMOD

ATOM 1925 NZ LYS 240 -8.772 18.739 -6.012 00 0.00 IMOD

ATOM 1926 N ALA 241 -5.310 13.629 -2.653 00 0.00 IMOD

ATOM 1927 CA ALA 241 -4.267 12.955 -1.932 00 0.00 IMOD

ATOM 1928 C ALA 241 -2.938 12.921 -2.641 00 0.00 IMOD

ATOM 1929 O ALA 241 -2.734 12.151 -3.582 00 0.00 IMOD

ATOM 1930 CB ALA 241 -4.623 11.507 -1.542 00 0.00 IMOD

ATOM 1931 N HIS 242 -2.019 13.825 -2.203 00 0.00 IMOD

ATOM 1932 CA HIS 242 -0.662 13.915 -2.679 00 0.00 IMOD

ATOM 1933 C HIS 242 0.290 13.402 -1.605 00 0.00 IMOD

ATOM 1934 O HIS 242 1.249 12.714 -1.956 00 0.00 IMOD

ATOM 1935 CB HIS 242 -0.223 15.349 -3.027 00 0.00 IMOD

ATOM 1936 CG HIS 242 -0.887 15.882 -4.264 00 0.00 IMOD

ATOM 1937 NDl HIS 242 -0.599 15.448 -5.540 00 0.00 IMOD

ATOM 1938 CD2 HIS 242 -1.842 16.840 -4.406 00 0.00 IMOD

ATOM 1939 CEl HIS 242 -1.388 16.158 -6.385 00 0.00 IMOD

ATOM 1940 NE2 HIS 242 -2.160 17.015 -5.741 00 0.00 IMOD

ATOM 1941 N MET 243 0.082 13.743 -0.295 00 0.00 IMOD

ATOM 1942 CA MET 243 0.872 13.275 0.848 00 0.00 IMOD

ATOM 1943 C MET 243 0.043 13.471 2.145 00 0.00 IMOD

ATOM 1944 O MET 243 -0.712 14.431 2.214 00 0.00 IMOD

ATOM 1945 CB MET 243 2.186 14.042 1.091 00 0.00 IMOD

ATOM 1946 CG MET 243 3.248 13.879 0.005 00 0.00 IMOD

ATOM 1947 SD MET 243 4.872 14.537 0.488 00 0.00 IMOD

ATOM 1948 CE MET 243 4.314 16.253 0.689 00 0.00 IMOD

ATOM 1949 N GLY 244 0.213 12.650 3.241 00 0.00 IMOD

ATOM 1950 CA GLY 244 -0.528 12.610 4.504 00 0.00 IMOD

ATOM 1951 C GLY 244 -0.647 11.132 4.795 00 0.00 IMOD

ATOM 1952 O GLY 244 -0.521 10.341 3.869 00 0.00 IMOD

ATOM 1953 N GLN 245 -0.779 10.693 6.074 00 0.00 IMOD

ATOM 1954 CA GLN 245 -0.765 9.267 6.349 1.00 0.00 IMOD

ATOM 1955 C GLN 245 -2.002 8.525 5.932 00 0.00 IMOD

ATOM 1956 O GLN 245 -1.937 7.574 5.154 00 0.00 IMOD

ATOM 1957 CB GLN 245 -0.538 8.946 7.838 00 0.00 IMOD

ATOM 1958 CG GLN 245 -1.663 9.404 8.771 00 0.00 IMOD

ATOM 1959 CD GLN 245 -1.535 10.903 9.006 00 0.00 IMOD

ATOM 1960 OEl GLN 245 -1.937 11.728 8.186 00 0.00 IMOD

ATOM 1961 NE2 GLN 245 -0.964 11.273 10.181 00 0.00 IMOD

ATOM 1962 N LYS 246 -3.177 8.947 6.433 00 0.00 IMOD

ATOM 1963 CA LYS 246 -4.394 8.252 6.126 00 0.00 IMOD

ATOM 1964 C LYS 246 -4.625 8.482 4.685 00 0.00 IMOD

ATOM 1965 O LYS 246 -5.103 7.619 3.951 00 0.00 IMOD

ATOM 1966 CB LYS 246 -5.604 8.823 6.876 00 0.00 IMOD

ATOM 1967 CG LYS 246 -5.488 8.666 8.391 00 0.00 IMOD

ATOM 1968 CD LYS 246 -6.519 9.481 9.174 00 0.00 IMOD

ATOM 1969 CE LYS 246 -6.428 9.300 10.690 00 0.00 IMOD

ATOM 1970 NZ LYS 246 -7.488 10.088 11.357 00 0.00 IMOD

ATOM 1971 N HIS 247 -4.268 9.700 4.259 00 0.00 IMOD

ATOM 1972 CA HIS 247 -4.454 10.110 2..910 00 0.00 IMOD

ATOM 1973 C HIS 247 -3.637 9.210 2..042 00 0.00 IMOD

ATOM 1974 O HIS 247 -4.085 8.801 0.974 00 0.00 IMOD

ATOM 1975 CB HIS 247 -3.931 11.536 2.658 00 0.00 IMOD

ATOM 1976 CG HIS 247 -4.597 12.583 3.497 00 0.00 IMOD

ATOM 1977 NDl HIS 247 -4.469 12.665 4.865 00 0.00 IMOD

ATOM 1978 CD2 HIS 247 -5.407 13.616 3.138 00 0.00 IMOD

ATOM 1979 CEl HIS 247 -5.207 13.732 5.264 1.00 0.00 IMOD

ATOM 1980 NE2 HIS 247 -5.796 14.340 .253 .00 0.00 IMOD

ATOM 1981 N ARG 248 400 8.905 .483 .00 0.00 IMOD

ATOM 1982 CA ARG 248 460 8.150 .709 .00 0.00 IMOD

ATOM 1983 C ARG 248 930 6.745 .525 .00 0.00 IMOD

ATOM 1984 O ARG 248 879 6.202 0.423 .00 0.00 IMOD

ATOM 1985 CB ARG' 248 -0.061 8.108 2.344 .00 0.00 IMOD

ATOM 1986 CG ARG 248 1.044 7.751 1.349 .00 0.00 IMOD

ATOM 1987 CD ARG 248 2.451 8.018 1.885 .00 0.00 IMOD

ATOM 1988 NE ARG 248 3.412 7.713 0.788 .00 0.00 IMOD

10 ATOM 1989 CZ ARG 248 4.325 8.654 0.409 .00 0.00 IMOD

ATOM 1990 NHl ARG 248 4.350 9.866 1.034 .00 0.00 IMOD

ATOM 1991 NH2 ARG 248 5.200 8.393 0.606 .00 0.00 IMOD

ATOM 1992 N ALA 249 -2.430 6.119 2.603 .00 0.00 IMOD

ATOM 1993 CA ALA 249 -2.834 4.753 2.516 .00 0.00 IMOD

I ₅ ATOM 1994 C ALA 249 -3.929 4.649 1.503 .00 0.00 IMOD

ATOM 1995 O ALA 249 -3.981 3.702 0.724 .00 0.00 IMOD

ATOM 1996 CB ALA 249 -3.368 4.207 3.852 .00 0.00 IMOD

ATOM 1997 N MET 250 -4.839 5.633 1.477 .00 0.00 IMOD

ATOM 1998 CA MET 250 -5.947 5.599 0.569 .00 0.00 IMOD

20 ATOM 1999 C MET 250 -5.430 5.665 - 0.831 .00 0.00 IMOD

ATOM 2000 O MET 250 -5.986 5.064 ^■ 1.749 .00 0.00 IMOD

ATOM 2001 CB MET 250 -6.911 6.777 0.783 .00 0.00 IMOD

ATOM 2002 CG MET 250 -8.188 6.700 ^• 0.056 .00 0.00 IMOD

ATOM 2003 SD MET 250 -9.402 8.003 0.308 .00 0.00 IMOD

2S ATOM 2004 CE MET 250 -9.929 7.267 1.884 .00 0.00 IMOD

ATOM 2005 N ARG 251 -4.339 6.412 ^• 1.036 .00 0.00 IMOD

ATOM 2006 CA ARG 251 -3.793 6.556 ^■ 2.348 .00 0.00 IMOD

ATOM 2007 C ARG 251 -3.467 5.182 ^■ 2.838 .00 0.00 IMOD

ATOM 2008 O ARG 251 -3.765 4.845 -3 983 .00 0.00 IMOD

30 ATOM 2009 CB ARG 251 -2 488 7.377 -2.321 .00 0.00 IMOD

ATOM 2010 CG ARG 251 -1.829 7.585 -3.684 .00 0.00 IMOD

ATOM 2011 CD ARG 251 -2.604 8.520 -4.611 .00 0.00 IMOD

ATOM 2012 NE ARG 251 -1.821 8.626 -5.873 .00 0.00 IMOD

ATOM 2013 CZ ARG 251 -2.469 860 -7.051 .00 0.00 IMOD

3 ₅ ATOM 2014 NHl ARG 251 -3.828 970 -7.073 .00 0.00 IMOD

ATOM 2015 NH2 ARG 251 -1.756 978 -8.207 .00 0.00 IMOD

ATOM 2016 N VAL 252 -2 849 4.347 -1.979 .00 0.00 IMOD

ATOM 2017 CA VAL 252 ^■ 2.477 3.025 -2.397 .00 0.00 IMOD

ATOM 2018 C VAL 252 ^• 3.690 2.181 -2 610 .00 0.00 IMOD 0 ATOM 2019 O VAL 252 ^• 3.739 1.400 -3 558 .00 0.00 IMOD

ATOM 2020 CB VAL 252 •1.574 2.270 -1 452 .00 0.00 IMOD

ATOM 2021 CGl VAL 252 ^• 2.373 .734 •0.257 .00 0.00 IMOD

ATOM 2022 CG2 VAL 252 ^• 0.919 .116 ^■ 2.229 .00 0.00 IMOD

ATOM 2023 N ILE 253 ^• 4.712 2.312 - 1.741 .00 0.00 IMOD ₅ ATOM 2024 CA ILE 253 -5 855 1.452 1.850 .00 0.00 IMOD

ATOM 2025 C ILE 253 ^• 6.446 1.677 3.202 .00 0.00 IMOD

ATOM 2026 O ILE 253 ^■ 6.923 0.740 3.841 ,00 0.00 IMOD

ATOM 2027 CB ILE 253 ^• 6.900 1.690 0.785 ,00 0.00 IMOD

ATOM 2028 CGl ILE 253 -7.836 0.478 - 0.635 ,00 0.00 IMOD 0 ATOM 2029 CG2 ILE 253 •7.652 2.988 1.113 ,00 0.00 IMOD

ATOM 2030 CDl ILE 253 ^■ 8.713 0.192 1.851 ,00 0.00 IMOD

ATOM 2031 N PHE 254 ^■ 6.437 2.941 -3 666 ,00 0.00 IMOD

ATOM 2032 CA PHE 254 •6.946 3.280 4.963 00 0.00 IMOD

ATOM 2033 C PHE 254 •6.110 2.647 - 6.031 00 0.00 IMOD ₅ ATOM 2034 O PHE 254 ^■ 6.634 2.093 ^• 6.994 00 0.00 IMOD

ATOM 2035 CB PHE 254 •6.949 4.793 ^■ 5.235 00 0.00 IMOD

ATOM 2036 CG PHE 254 •7.491 4.978 -6.608 .00 0.00 IMOD

ATOM 2037 CDl PHE 254 ^■ 8.844 4.897 ^■ 6.845 00 0.00 IMOD

ATOM 2038 CD2 PHE 254 •6.645 5.236 ^■ 7.662 00 0.00 IMOD 0 ATOM 2039 CEl PHE 254 ■9.345 5.069 ^• 8.115 00 0.00 IMOD

ATOM 2040 CE2 PHE 254 ^■ 7.138 5.411 ^■ 8.934 00 0.00 IMOD

ATOM 2041 CZ PHE 254 ^■ 8.491 5.329 ^■ 9.160 00 0.00 IMOD

ATOM 2042 N ALA 255 ■4.777 2.703 ^• 5.888 00 0.00 IMOD

ATOM 2043 CA ALA 255 •3.922 2.193 ^• 6.921 00 0.00 IMOD ₅ ATOM 2044 C ALA 255 •4.207 0.737 ^■ 7.103 1.00 0.00 IMOD

ATOM 2045 O ALA 255 -4.211 0.226 -8.223 00 0.00 IMOD

ATOM 2046 CB ALA 255 -2.431 2.333 -6.579 00 0.00 IMOD

ATOM 2047 N VAL 256 -4.463 0.034 -5.991 00 0.00 IMOD

ATOM 2048 CA VAL 256 -4.707 ^• 1.375 -6.020 1.00 0.00 IMOD

ATOM 2049 C VAL 256 -5.893 ^• 1.663 -6.884 1.00 0.00 IMOD

ATOM 2050 O VAL 256 -5.889 ^■ 2.631 -7.644 1.00 0.00 IMOD

ATOM 2051 CB VAL 256 -5.034 1.912 -4.659 00 0.00 IMOD

ATOM 2052 CGl VAL 256 -5.512 ^• 3.356 -4.823 00 0.00 IMOD

ATOM 2053 CG2 VAL 256 -3.810 ^■ 1.765 -3.740 00 0.00 IMOD

ATOM 2054 N VAL 257 -6.958 ^■ 0.849 -6.777 00 0.00 IMOD

ATOM 2055 CA VAL 257 -8.144 -1 132 -7.532 00 0.00 IMOD

ATOM 2056 C VAL 257 -7.884 ^• 0.983 -9.001 00 0.00 IMOD

ATOM 2057 O VAL 257 -8.364 ^■ 1.779 -9.806 00 0.00 IMOD

ATOM 2058 CB VAL 257 -9.320 ^■ 0.265 -7.172 00 0.00 IMOD

ATOM 2059 CGl VAL 257 -9.102 1.154 -7.715 00 0.00 IMOD

ATOM 2060 CG2 VAL 257 -10.595 ^• 0.934 -7.710 00 0.00 IMOD

ATOM 2061 N LEU 258 -7.107 0.043 -9.390 00 0.00 IMOD

ATOM 2062 CA LEU 258 -6.873 0.306 10.782 00 0.00 IMOD

ATOM 2063 C LEU 258 -6.176 ^■ 0.875 11.381 00 0.00 IMOD

ATOM 2064 O LEU 258 -6.522 ^• 1.334 12.469 00 0.00 IMOD

ATOM 2065 CB LEU 258 -5.971 1.536 10.979 00 0.00 IMOD

ATOM 2066 CG LEU 258 -5.746 1.925 12.450 00 0.00 IMOD

ATOM 2067 CDl LEU 258 -7.058 2.384 13.106 ^■ 1.00 0.00 IMOD

ATOM 2068 CD2 LEU 258 -4.617 2.960 12.584 1.00 0.00 IMOD

ATOM 2069 N ILE 259 -5.177 ^• 1.403 10.658 1 00 0.00 IMOD

ATOM 2070 CA ILE 259 -4.379 ^■ 2.509 11.106 1 00 0.00 IMOD

ATOM 2071 C ILE 259 -5.262 ^• 3.703 ^■ 11.266 1 00 0.00 IMOD

ATOM 2072 O ILE 259 -5.141 ^■ 4.467 12.224 1 00 0.00 IMOD

ATOM 2073 CB ILE 259 -3.321 ^■ 2.873 ^■ 10.107 1.00 0.00 IMOD

ATOM 2074 CGl ILE 259 -2.383 ^• 1.685 -9.829 1 00 0.00 IMOD

ATOM 2075 CG2 ILE 259 -2.597 ^■ 4.112 10.647 1 00 0.00 IMOD

ATOM 2076 CDl ILE 259 -1.514 ^• 1.893 -8.587 1.00 0.00 IMOD

ATOM 2077 N PHE 260 -6.186 ^■ 3.887 ^■ 10.312 .00 0.00 IMOD

ATOM 2078 CA PHE 260 -7.064 ^• 5.016 10.299 .00 0.00 IMOD

ATOM 2079 C PHE 260 -7.827 ^• 5.055 11.582 .00 0.00 IMOD

ATOM 2080 O PHE 260 -7.888 ^■ 6.090 12.244 .00 0.00 IMOD

ATOM 2081 CB PHE 260 -8.091 ^■ 4.885 -9.164 .00 0.00 IMOD

ATOM 2082 CG PHE 260 -9.128 ^• 5.930 -9.370 .00 0.00 IMOD

ATOM 2083 CDl PHE 260 -8.872 ^■ 7.232 -9.021 .00 0.00 IMOD

ATOM 2084 CD2 PHE 260 -10.354 ^■ 5.607 -9.906 .00 0.00 IMOD

ATOM 2085 CEl PHE 260 -9.828 ^• 8.197 -9.212 .00 0.00 IMOD

ATOM 2086 CE2 PHE 260 -11.316 ^■ 6.570 10.098 .00 0.00 IMOD

ATOM 2087 CZ PHE 260 -11.051 ^• 7.871 -9.747 .00 0.00 IMOD

ATOM 2088 N LEU 261 -8.415 ^• 3.913 11.971 .00 0.00 IMOD

ATOM 2089 CA LEU 261 -9.230 ^■ 3.849 13.146 .00 0.00 IMOD

ATOM 2090 C LEU 261 -8.405 ^■ 4.137 14.357 .00 0.00 IMOD

ATOM 2091 O LEU 261 -8.829 ^■ 4.861 15.252 .00 0.00 IMOD

ATOM 2092 CB LEU 261 -9.847 ^• 2.457 13.369 .00 0.00 IMOD

ATOM 2093 CG LEU 261 -10.834 ^■ 2.024 12.270 .00 0.00 IMOD

ATOM 2094 CDl LEU 261 -11.406 ^• 0.628 12.559 .00 0.00 IMOD

ATOM 2095 CD2 LEU 261 -11.935 ^■ 3.072 12.063 .00 0.00 IMOD

ATOM 2096 N LEU 262 -7.185 -3 578 14.406 .00 0.00 IMOD

ATOM 2097 CA LEU 262 -6.399 3.711 15.591 ,00 0.00 IMOD

ATOM 2098 C LEU 262 -6.161 5.163 15.833 .00 0.00 IMOD

ATOM 2099 O LEU 262 -6.295 -5..644 16.957 ,00 0.00 IMOD

ATOM 2100 CB LEU 262 -5.037 -3.008 15.444 .00 0.00 IMOD

ATOM 2101 CG LEU 262 -4.223 -2.879 16.748 .00 0.00 IMOD

ATOM 2102 CDl LEU 262 -3.778 -4.243 - 17.296 ,00 0.00 IMOD

ATOM 2103 CD2 LEU 262 -4.971 -2.026 17.785 ,00 0.00 IMOD

ATOM 2104 N CYS 263 -5.786 -5.900 14.778 00 0.00 IMOD

ATOM 2105 CA CYS 263 -5.483 -7.290 14.922 00 0.00 IMOD

ATOM 2106 C CYS 263 -6.683 -8.095 15.325 00 0.00 IMOD

ATOM 2107 O CYS 263 -6.653 -8.816 16.321 00 0.00 IMOD

ATOM 2108 CB CYS 263 -4.981 -7.866 13.591 00 0.00 IMOD

ATOM 2109 SG CYS 263 -4.590 -9.629 13.688 1.00 0.00 IMOD

ATOM 2110 N TRP 264 -7.759 -8.014 -14.524 00 0.00 IMOD

ATOM 2111 CA TRP 264 -8.930 -8.823 -14.721 00 0.00 IMOD

ATOM 2112 C TRP 264 -9.844 -8.386 -15.814 00 0.00 IMOD

ATOM 2113 O TRP 264 -10.511 -9.228 -16.417 00 0.00 IMOD

ATOM 2114 CB TRP 264 -9.731 -9.062 -13.435 00 0.00 IMOD

ATOM 2115 CG TRP 264 -8.945 -9.967 -12.522 00 0.00 IMOD

ATOM 2116 CDl TRP 264 -8.426 -9.750 -11.281 00 0.00 IMOD

ATOM 2117 CD2 TRP 264 -8.519 -11.278 -12.921 00 0.00 IMOD

ATOM 2118 NEl TRP 264 -7.709 -10.851 -10.874 00 0.00 IMOD

ATOM 2119 CE2 TRP 264 -7.753 -11.798 -11.879 00 0.00 IMOD

ATOM 2120 CE3 TRP 264 -8.736 -11.982 -14.070 00 0.00 IMOD

ATOM 2121 CZ2 TRP 264 -7.188 -13.039 -11.973 00 0.00 IMOD

ATOM 2122 CZ3 TRP 264 -8.180 -13.237 -14.157 00 0.00 IMOD

ATOM 2123 CH2 TRP 264 -7.420 -13.755 -13.127 00 0.00 IMOD

ATOM 2124 N LEU 265 -9.943 -7.079 -16.093 00 0.00 IMOD

ATOM 2125 CA LEU 265 -10.965 -6.646 -17.001 00 0.00 IMOD

ATOM 2126 C LEU 265 -10.799 -7.299 -18.339 00 0.00 IMOD

ATOM 2127 O LEU 265 -11.786 -7.748 -18.912 00 0.00 IMOD

ATOM 2128 CB LEU 265 -11.007 -5.124 -17.197 00 0.00 IMOD

ATOM 2129 CG LEU 265 -12.228 -4.664 -18.012 00 0.00 IMOD

ATOM 2130 CDl LEU 265 -13.535 -5.036 -17.292 00 0.00 IMOD

ATOM 2131 CD2 LEU 265 -12.148 -3.165 -18.341 00 0.00 IMOD

ATOM 2132 N PRO 266 -9.615 -7.389 -18.874 00 0.00 IMOD

ATOM 2133 CA PRO 266 -9.458 -8.032 -20.146 1.00 0.00 IMOD

ATOM 2134 C PRO 266 -9.814 -9.483 -20.087 00 0.00 IMOD

ATOM 2135 O PRO 266 -10.326 -10.008 -21.073 00 0.00 IMOD

ATOM 2136 CB PRO 266 -8.024 -7.736 -20.596 00 0.00 IMOD

ATOM 2137 CG PRO 266 -7.357 -7.064 -19.377 00 0.00 IMOD

ATOM 2138 CD PRO 266 -8.537 -6.460 -18.598 00 0.00 IMOD

ATOM 2139 N TYR 267 -9.516 -10.156 -18.960 00 0.00 IMOD

ATOM 2140 CA TYR 267 -9.839 -11.543 -18.786 00 0.00 IMOD

ATOM 2141 C TYR 267 -11.314 -11.727 -18.647 00 0.00 IMOD

ATOM 2142 O TYR 267 -11.911 -12.601 -19.270 00 0.00 IMOD

ATOM 2143 CB TYR 267 -9.181 -12.129 -17.534 00 0.00 IMOD

ATOM 2144 CG TYR 267 -9.894 -13.387 -17.203 00 0.00 IMOD

ATOM 2145 CDl TYR 267 -9.737 -14.508 -17.978 00 0.00 IMOD

ATOM 2146 CD2 TYR 267 -10.712 -13.436 -16.099 00 0.00 IMOD

ATOM 2147 CEl TYR 267 -10.394 -15.670 -17.656 00 0.00 IMOD

ATOM 2148 CE2 TYR 267 -11.373 -14.593 -15.770 00 0.00 IMOD

ATOM 2149 CZ TYR 267 -11.212 -15.709 -16.553 00 0.00 IMOD

ATOM 2150 OH TYR 267 -11.886 -16.902 -16.225 00 0.00 IMOD

ATOM 2151 N ASN 268 -11.956 -10.900 -17.807 00 0.00 IMOD

ATOM 2152 CA ASN 268 -13.359 -11.071 -17.607 00 0.00 IMOD

ATOM 2153 C ASN 268 -14.069 -10.731 -18.872 00 0.00 IMOD

ATOM 2154 O ASN 268 -15.066 -11.363 -19.212 00 0.00 IMOD

ATOM 2155 CB ASN 268 -13.948 -10.255 -16.435 00 0.00 IMOD

ATOM 2156 CG ASN 268 -13.816 -8.757 -16.662 00 0.00 IMOD

ATOM 2157 ODl ASN 268 -14.340 -8.197 -17.623 00 0.00 IMOD

ATOM 2158 ND2 ASN 268 -13.106 -8.077 -15.722 00 0.00 IMOD

ATOM 2159 N LEU 269 -13.577 -9.724 -19.615 00 0.00 IMOD

ATOM 2160 CA LEU 269 -14.244 -9.326 -20.820 00 0.00 IMOD

ATOM 2161 C LEU 269 -14.232 -10.463 -21.795 00 0.00 IMOD

ATOM 2162 O LEU 269 -15.258 -10.821 -22.370 00 0.00 IMOD

ATOM 2163 CB LEU 269 -13.547 -8.134 -21.497 00 0.00 IMOD

ATOM 2164 CG LEU 269 -14.223 -7.666 -22.797 00 0.00 IMOD

ATOM 2165 CDl LEU 269 -15.611 -7.074 -22.515 00 0.00 IMOD

ATOM 2166 CD2 LEU 269 -13.309 -6.709 -23.576 00 0.00 IMOD

ATOM 2167 N VAL 270 -13.056 -11.083 -21.991 00 0.00 IMOD

ATOM 2168 CA VAL 270 -12.968 -12.161 -22.927 00 0.00 IMOD

ATOM 2169 C VAL 270 -13.829 -13.280 -22.444 00 0.00 IMOD

ATOM 2170 O VAL 270 -14.498 -13.946 -23.234 00 0.00 IMOD

ATOM 2171 CB VAL 270 -11.563 -12.657 -23.122 00 0.00 IMOD

ATOM 2172 CGl VAL 270 -10.862 -12.877 -21.774 00 0.00 IMOD

ATOM 2173 CG2 VAL 270 -11.681 -13.962 -23.902 00 0.00 IMOD

ATOM 2174 N LEU 271 -13.832 -13.498 -21.119 1.00 0.00 IMOD

ATOM 2175 CA LEU 271 -14.572 -14.555 ^• 20.502 00 0.00 IMOD

ATOM 2176 C LEU 271 -16.020 -14.319 ^■ 20.786 00 0.00 IMOD

ATOM 2177 O LEU 271 -16.744 -15.232 ^■ 21.182 00 0.00 IMOD

ATOM 2178 CB LEU 271 -14.353 -14.531 -18.971 00 0.00 IMOD

ATOM 2179 CG LEU 271 -14.955 -15.685 ^• 18.133 00 0.00 IMOD

ATOM 2180 CDl LEU 271 -14.625 -15.478 -16.645 00 0.00 IMOD

ATOM 2181 CD2 LEU 271 -16.464 -15.895 -18.352 00 0.00 IMOD

ATOM 2182 N LEU 272 -16.473 -13.068 ^■ 20.605 00 0.00 IMOD

ATOM 2183 CA LEU 272 -17.861 -12.744 ^■ 20.735 00 0.00 IMOD

ATOM 2184 C LEU 272 -18.288 -12.970 -22.142 00 0.00 IMOD

ATOM 2185 O LEU 272 -19.351 -13.533 ^• 22.395 00 0.00 IMOD

ATOM 2186 CB LEU 272 -18.147 -11.274 -20.380 00 0.00 IMOD

ATOM 2187 CG LEU 272 -19.641 -10.909 ^■ 20.237 00 0.00 IMOD

ATOM 2188 CDl LEU 272 -20.416 -11.014 ^• 21.558 00 0.00 IMOD

ATOM 2189 CD2 LEU 272 -20.294 -11.704 ^■ 19.097 00 0.00 IMOD

ATOM 2190 N ALA 273 -17.457 -12.538 -23.104 1.00 0.00 IMOD

ATOM 2191 CA ALA 273 -17.832 -12.655 ^• 24.481 .00 0.00 IMOD

ATOM 2192 C ALA 273 -17.987 -14.096 ^• 24.846 .00 0.00 IMOD

ATOM 2193 O ALA 273 -18.912 -14.453 -25.576 .00 0.00 IMOD

ATOM 2194 CB ALA 273 -16.810 -12.017 ^• 25.440 .00 0.00 IMOD

ATOM 2195 N ASP 274 -17.095 -14.970 ^■ 24.347 .00 0.00 IMOD

ATOM 2196 CA ASP 274 -17.170 -16.342 ^■ 24.756 .00 0.00 IMOD

ATOM 2197 C ASP 274 -18.499 -16.879 ^• 24.370 1.00 0.00 IMOD

ATOM 2198 O ASP 274 -19.185 -17.503 ^■ 25.179 1.00 0.00 IMOD

ATOM 2199 CB ASP 274 -16.095 -17.220 ^• 24.113 00 0.00 IMOD

ATOM 2200 CG ASP 274 -14.794 -16.898 ^■ 24.826 00 0.00 IMOD

ATOM 2201 ODl ASP 274 -14.868 -16.363 ^■ 25.963 00 0.00 IMOD

ATOM 2202 OD2 ASP 274 -13.708 -17.168 ^■ 24.249 00 0.00 IMOD

ATOM 2203 N THR 275 -18.912 -16.628 ^■ 23.121 00 0.00 IMOD

ATOM 2204 CA THR 275 -20.192 -17.097 ^■ 22.699 00 0.00 IMOD

ATOM 2205 C THR 275 -21.258 -16.375 ^• 23.457 00 0.00 IMOD

ATOM 2206 O THR 275 -22.262 -16.962 ^• 23.859 00 0.00 IMOD

ATOM 2207 CB THR 275 -20.453 -16.836 ^■ 21.259 00 0.00 IMOD

ATOM 2208 OGl THR 275 -19.537 -17.547 ^• 20.439 00 0.00 IMOD

ATOM 2209 CG2 THR 275 -21.897 -17.249 ^• 20.994 00 0.00 IMOD

ATOM 2210 N LEU 276 -21.052 -15.067 ^■ 23.678 00 0.00 IMOD

ATOM 2211 CA LEU 276 -22.055 -14.238 ^• 24.269 00 0.00 IMOD

ATOM 2212 C LEU 276 -22.380 -14.735 ^■ 25.644 00 0.00 IMOD

ATOM 2213 O LEU 276 -23.550 -14.723 ^• 26.026 00 0.00 IMOD

ATOM 2214 CB LEU 276 -21.613 -12.760 ^■ 24.331 00 0.00 IMOD

ATOM 2215 CG LEU 276 -22.699 -11.725 ^■ 24.711 00 0.00 IMOD

ATOM 2216 CDl LEU 276 -22.124 -10.304 ^• 24.639 00 0.00 IMOD

ATOM 2217 CD2 LEU 276 -23.345 -11.991 ^• 26.080 00 0.00 IMOD

ATOM 2218 N MET 277 -21.373 -15.191 ^• 26.421 00 0.00 IMOD

ATOM 2219 CA MET 277 -21.647 -15.610 ^• 27.771 00 0.00 IMOD

ATOM 2220 C MET 277 -22.716 -16.649 ^■ 27.764 00 0.00 IMOD

ATOM 2221 O MET 277 -22.504 -17.806 ^■ 27.398 00 0.00 IMOD

ATOM 2222 CB MET 277 -20.427 -16.197 ^■ 28.505 00 0.00 IMOD

ATOM 2223 CG MET 277 -20.735 -16.640 29.939 00 0.00 IMOD

ATOM 2224 SD MET 277 -21.059 -15.291 31.115 00 0.00 IMOD

ATOM 2225 CE MET 277 -21.423 -16.389 32.516 00 0.00 IMOD

ATOM 2226 N ARG 278 -23.917 -16.216 28.190 00 0.00 IMOD

ATOM 2227 CA ARG 278 -25.057 -17.071 28.242 00 0.00 IMOD

ATOM 2228 C ARG 278 -25.742 -16.776 29.532 00 0.00 IMOD

ATOM 2229 O ARG 278 -25.869 -15.618 29.925 00 0.00 IMOD

ATOM 2230 CB ARG 278 -26.085 -16.747 27.148 00 0.00 IMOD

ATOM 2231 CG ARG 278 -26.554 -15.296 27.255 00 0.00 IMOD

ATOM 2232 CD ARG 278 -27.615 -14.869 26.241 00 0.00 IMOD

ATOM 2233 NE ARG 278 -27.781 -13.396 26.401 00 0.00 IMOD

ATOM 2234 CZ ARG 278 -29.013 -12.818 26.323 00 0.00 IMOD

ATOM 2235 NHl ARG 278 -30.119 -13.587 26.099 00 0.00 IMOD

ATOM 2236 NH2 ARG 278 -29.139 -11.467 26.477 00 0.00 IMOD

ATOM 2237 N THR 279 -26.189 -17.832 30.233 00 0.00 IMOD

ATOM 2238 CA THR 279 -26.947 -17.651 31.432 00 0.00 IMOD

ATOM 2239 C THR 279 -28.329 -18.071 - 31.070 1.00 0.00 IMOD

ATOM 2240 O THR 279 -28.747 17.913 -29.924 00 0.00 IMOD

ATOM 2241 CB THR 279 -26.485 18.488 -32.587 00 0.00 IMOD

ATOM 2242 OGl THR 279 -26.560 19.867 -32.255 00 0.00 IMOD

ATOM 2243 CG2 THR 279 -25.040 18.093 -32.941 00 0.00 IMOD

ATOM 2244 N GLN 280 -29.091 18.609 -32.037 00 0.00 IMOD

ATOM 2245 CA GLN 280 -30.393 19.041 -31.645 00 0.00 IMOD

ATOM 2246 C GLN 280 -30.150 20.145 -30.678 00 0.00 IMOD

ATOM 2247 O GLN 280 -29.091 20.770 -30.702 00 0.00 IMOD

ATOM 2248 CB GLN 280 -31.266 19.580 -32.786 00 0.00 IMOD

ATOM 2249 CG GLN 280 -32.734 19.665 -32.374 00 0.00 IMOD

ATOM 2250 CD GLN 280 -33.173 18.232 -32.104 00 0.00 IMOD

ATOM 2251 OEl GLN 280 -34.142 17.970 -31.393 00 0.00 IMOD

ATOM 2252 NE2 GLN 280 -32.416 17.262 -32.686 00 0.00 IMOD

ATOM 2253 N VAL 281 -31.115 20.391 -29.776 00 0.00 IMOD

ATOM 2254 CA VAL 281 -30.884 21.374 -28.765 1.00 0.00 IMOD

ATOM 2255 C VAL 281 -30.593 22.675 -29.425 00 0.00 IMOD

ATOM 2256 O VAL 281 -31.296 23.102 -30.339 00 0.00 IMOD

ATOM 2257 CB VAL 281 -32.058 21.584 -27.854 00 0.00 IMOD

ATOM 2258 CGl VAL 281 -32.324 20.278 -27.084 00 0.00 IMOD

ATOM 2259 CG2 VAL 281 -33.248 22.070 -28.700 00 0.00 IMOD

ATOM 2260 N ILE 282 -29.503 23.322 -28.977 00 0.00 IMOD

ATOM 2261 CA ILE 282 -29.163 24.610 -29.488 00 0.00 IMOD

ATOM 2262 C ILE 282 -28.896 25.463 -28.295 00 0.00 IMOD

ATOM 2263 O ILE 282 -28.361 24.998 -27.288 00 0.00 IMOD

ATOM 2264 CB ILE 282 -27.953 24.616 -30.385 00 0.00 IMOD

ATOM 2265 CGl ILE 282 -27.790 25.973 -31.093 00 0.00 IMOD

ATOM 2266 CG2 ILE 282 -26.734 24.200 -29.552 00 0.00 IMOD

ATOM 2267 CDl ILE 282 -28.884 26.246 -32.119 00 0.00 IMOD

ATOM 2268 N GLN 283 -29.288 26.744 -28.376 00 0.00 IMOD

ATOM 2269 CA GLN 283 -29.068 27.612 -27.264 00 0.00 IMOD

ATOM 2270 C GLN 283 -27.598 27.637 -27.078 00 0.00 IMOD

ATOM 2271 O GLN 283 -27.096 27.667 -25.956 00 0.00 IMOD

ATOM 2272 CB GLN 283 -29.531 29.052 -27.515 00 0.00 IMOD

ATOM 2273 CG GLN 283 -29.276 29.972 -26.319 1.00 0.00 IMOD

ATOM 2274 CD GLN 283 -30.059 29.447 -25.123 00 0.00 IMOD

ATOM 2275 OEl GLN 283 -29.615 29.544 -23.981 00 0.00 IMOD

ATOM 2276 NE2 GLN 283 -31.265 28.877 -25.389 00 0.00 IMOD

ATOM 2277 N GLU 284 -26.868 27.601 -28.205 00 0.00 IMOD

ATOM 2278 CA GLU 284 -25.447 27.617 -28.115 00 0.00 IMOD

ATOM 2279 C GLU 284 -25.048 26.378 -27.384 00 0.00 IMOD

ATOM 2280 O GLU 284 -25.817 25.425 -27.274 1.00 0.00 IMOD

ATOM 2281 CB GLU 284 -24.734 27.685 -29.477 00 0.00 IMOD

ATOM 2282 CG GLU 284 -23.264 28.094 -29.362 00 0.00 IMOD

ATOM 2283 CD GLU 284 -22.790 28.572 -30.730 00 0.00 IMOD

ATOM 2284 OEl GLU 284 -23.463 29.470 -31.301 00 0.00 IMOD

ATOM 2285 OE2 GLU 284 -21.740 28.065 -31.210 00 0.00 IMOD

ATOM 2286 N THR 285 -23.826 26.383 -26.830 00 0.00 IMOD

ATOM 2287 CA THR 285 -23.366 25.306 -26.008 00 0.00 IMOD

ATOM 2288 C THR 285 -23.363 24.019 -26.770 00 0.00 IMOD

ATOM 2289 O THR 285 -23.539 23.998 -27.987 00 0.00 IMOD

ATOM 2290 CB THR 285 -21.970 25.497 -25.503 00 0.00 IMOD

ATOM 2291 OGl THR 285 -21.063 25.479 -26.595 00 0.00 IMOD

ATOM 2292 CG2 THR 285 -21.884 26.847 -24.772 00 0.00 IMOD

ATOM 2293 N CYS 286 -23.203 22.896 -26.030 00 0.00 IMOD

ATOM 2294 CA CYS 286 -23.151 21.579 -26.612 00 0.00 IMOD

ATOM 2295 C CYS 286 -21.762 21.046 -26.412 00 0.00 IMOD

ATOM 2296 O CYS 286 -21.568 19.968 -25.856 00 0.00 IMOD

ATOM 2297 CB CYS 286 -24.082 20.581 -25.905 00 0.00 IMOD

ATOM 2298 SG CYS 286 -25.826 21.080 -25.960 00 0.00 IMOD

ATOM 2299 N GLU 287 -20.757 21.872 -26.730 00 0.00 IMOD

ATOM 2300 CA GLU 287 -19.351 21.574 -26.680 00 0.00 IMOD

ATOM 2301 C GLU 287 -18.730 21.261 -28.012 00 0.00 IMOD

ATOM 2302 O GLU 287 -17.548 20.930 -28.059 00 0.00 IMOD

ATOM 2303 CB GLU 287 -18.540 22.718 -26.029 00 0.00 IMOD

ATOM 2304 CG GLU 287 -17.120 - 22.349 -25.578 1.00 0.00 IMOD

ATOM 2305 CD GLU 287 -16.117 -22.774 -26.639 00 0.00 IMOD

ATOM 2306 OEl GLU 287 -16.518 -23.514 -27.577 00 0.00 IMOD

ATOM 2307 OE2 GLU 287 -14.934 -22.358 -26.528 00 0.00 IMOD

ATOM 2308 N ARG 288 -19.433 -21.486 -29.138 00 0.00 IMOD

ATOM 2309 CA ARG 288 -18.738 -21.458 -30.405 00 0.00 IMOD

ATOM 2310 C ARG 288 -18.770 -20.138 -31.109 00 0.00 IMOD

ATOM 2311 O ARG 288 -19.827 -19.552 -31.327 00 0.00 IMOD

ATOM 2312 CB ARG 288 -19.340 -22.413 -31.442 00 0.00 IMOD

ATOM 2313 CG ARG 288 -19.282 -23.897 -31.107 00 0.00 IMOD

ATOM 2314 CD ARG 288 -20.035 -24.717 -32.154 00 0.00 IMOD

ATOM 2315 NE ARG 288 -21.483 -24.416 -31.982 00 0.00 IMOD

ATOM 2316 CZ ARG 288 -22.366 -24.723 -32.975 00 0.00 IMOD

ATOM 2317 NHl ARG 288 -21.913 -25.309 -34.120 00 0.00 IMOD

ATOM 2318 NH2 ARG 288 -23.693 -24.439 -32.822 00 0.00 IMOD

ATOM 2319 N ARG 289 -17.577 -19.681 -31.544 00 0.00 IMOD

ATOM 2320 CA ARG 289 -17.417 -18.493 -32.337 00 0.00 IMOD

ATOM 2321 C ARG 289 -16.052 -18.606 -32.924 00 0.00 IMOD

ATOM 2322 O ARG 289 -15.293 -19.497 -32.548 00 0.00 IMOD

ATOM 2323 CB ARG 289 -17.407 -17.181 -31.533 00 0.00 IMOD

ATOM 2324 CG ARG 289 -17.311 -15.934 -32.417 00 0.00 IMOD

ATOM 2325 CD ARG 289 -16.927 -14.657 -31.665 00 0.00 IMOD

ATOM 2326 NE ARG 289 -16.879 -13.552 -32.664 00 0.00 IMOD

ATOM 2327 CZ ARG 289 -16.843 -12.252 -32.249 00 0.00 IMOD

ATOM 2328 NHl ARG 289 -16.806 -11.957 -30.916 00 0.00 IMOD

ATOM 2329 NH2 ARG 289 -16.855 -11.241 -33.163 00 0.00 IMOD

ATOM 2330 N ASN 290 -15.689 -17.717 -33.872 00 0.00 IMOD

ATOM 2331 CA ASN 290 -14.336 -17.803 -34.318 00 0.00 IMOD

ATOM 2332 C ASN 290 -13.494 -17.511 -33.130 00 0.00 IMOD

ATOM 2333 O ASN 290 -13.593 -16.456 -32.503 00 0.00 IMOD

ATOM 2334 CB ASN 290 -13.924 -16.814 -35.421 00 0.00 IMOD

ATOM 2335 CG ASN 290 -14.166 -17.438 -36.787 00 0.00 IMOD

ATOM 2336 ODl ASN 290 -13.217 -17.623 -37.549 00 0.00 IMOD

ATOM 2337 ND2 ASN 290 -15.443 -17.770 -37.111 00 0.00 IMOD

ATOM 2338 N HIS 291 -12.645 -18.483 -32.776 1.00 0.00 IMOD

ATOM 2339 CA HIS 291 -11.766 -18.293 -31.672 00 0.00 IMOD

ATOM 2340 C HIS 291 -10.469 -18.932 -32.002 00 0.00 IMOD

ATOM 2341 O HIS 291 -10.387 -19.850 -32.816 00 0.00 IMOD

ATOM 2342 CB HIS 291 -12.244 -18.841 -30.316 00 0.00 IMOD

ATOM 2343 CG HIS 291 -13.296 -17.976 -29.683 00 0.00 IMOD

ATOM 2344 NDl HIS 291 -13.126 -16.630 -29.444 00 0.00 IMOD

ATOM 2345 CD2 HIS 291 -14.539 -18.280 -29.221 00 0.00 IMOD

ATOM 2346 CEl HIS 291 -14.267 -16.189 -28.855 00 0.00 IMOD

ATOM 2347 NE2 HIS 291 -15.153 -17.155 -28.699 00 0.00 IMOD

ATOM 2348 N ILE 292 -9.403 -18.422 -31.373 00 0.00 IMOD

ATOM 2349 CA ILE 292 -8.097 -18.924 -31.623 00 0.00 IMOD

ATOM 2350 C ILE 292 -7.561 -19.227 -30.268 00 0.00 IMOD

ATOM 2351 O ILE 292 -8.036 -18.684 -29.273 00 0.00 IMOD

ATOM 2352 CB ILE 292 -7.239 -17.888 -32.307 00 0.00 IMOD

ATOM 2353 CGl ILE 292 -5.990 -18.479 -32.987 00 0.00 IMOD

ATOM 2354 CG2 ILE 292 -6.917 -16.805 -31.261 00 0.00 IMOD

ATOM 2355 CDl ILE 292 -4.876 -18.888 -32.031 00 0.00 IMOD

ATOM 2356 N ASP 293 -6.588 -20.140 -30.178 00 0.00 IMOD

ATOM 2357 CA ASP 293 -6.035 -20.441 -28.897 00 0.00 IMOD

ATOM 2358 C ASP 293 -5.405 -19.198 -28.363 00 0.00 IMOD

ATOM 2359 O ASP 293 -5.352 -18.991 -27.153 00 0.00 IMOD

ATOM 2360 CB ASP 293 -5.021 -21.601 -28.940 00 0.00 IMOD

ATOM 2361 QG ASP 293 -4.028 -21.365 -30.071 00 0.00 IMOD

ATOM 2362 ODl ASP 293 -4.469 -21.495 -31.246 00 0.00 IMOD

ATOM 2363 OD2 ASP 293 -2.839 -21.050 -29.795 00 0.00 IMOD

ATOM 2364 N ARG 294 -4.920 -18.330 -29.264 00 0.00 IMOD

ATOM 2365 CA ARG 294 -4.250 -17.117 -28.899 00 0.00 IMOD

ATOM 2366 C ARG 294 -5.152 -16.174 -28.161 00 0.00 IMOD

ATOM 2367 O ARG 294 -4.701 -15.503 -27.236 00 0.00 IMOD

ATOM 2368 CB ARG 294 -3.741 -16.314 -30.108 00 0.00 IMOD

ATOM 2369 CG ARG 294 -2.615 -16.986 -30.891 1.00 0.00 IMOD

ATOM 2370 CD ARG 294 -1.892 16.029 ^■ 31.842 00 0.00 IMOD

ATOM 2371 NE ARG 294 -1.200 15.027 30.983 00 0.00 IMOD

ATOM 2372 CZ ARG 294 -0.104 14.353 31.440 00 0.00 IMOD

ATOM 2373 NHl ARG 294 0.350 14.566 32.708 00 0.00 IMOD

ATOM 2374 NH2 ARG 294 0.543 13.468 30.626 00 0.00 IMOD

ATOM 2375 N ALA 295 -6.442 16.075 ^■ 28.536 00 0.00 IMOD

ATOM 2376 CA ALA 295 -7.233 15.008 27.980 00 0.00 IMOD

ATOM 2377 C ALA 295 -7.305 15.051 26.483 00 0.00 IMOD

ATOM 2378 O ALA 295 -7.052 14.043 25.825 00 0.00 IMOD

ATOM 2379 CB ALA 295 -8.680 15.008 ^■ 28.500 00 0.00 IMOD

ATOM 2380 N LEU 296 -7.653 16.209 ^• 25.903 00 0.00 IMOD

ATOM 2381 CA LEU 296 -7.804 16.368 ^■ 24.485 00 0.00 IMOD

ATOM 2382 C LEU 296 -6.462 16.367 ^• 23.810 00 0.00 IMOD

ATOM 2383 O LEU 296 -6.322 15.915 ^■ 22.675 00 0.00 IMOD

ATOM 2384 CB LEU 296 -8.517 17.690 ^• 24.162 00 0.00 IMOD

ATOM 2385 CG LEU 296 -9.862 17.859 24.896 00 0.00 IMOD

ATOM 2386 CDl LEU 296 -10.598 19.125 ^■ 24.434 00 0.00 IMOD

ATOM 2387 CD2 LEU 296 -10.725 16.598 24.790 00 0.00 IMOD

ATOM 2388 N ASP 297 -5.433 16.889 ^■ 24.498 00 0.00 IMOD

ATOM 2389 CA ASP 297 -4.142 17.101 ^• 23.906 00 0.00 IMOD

ATOM 2390 C ASP 297 -3.558 15.840 ^• 23.348 00 0.00 IMOD

ATOM 2391 O ASP 297 -3.055 15.840 ^■ 22.225 00 0.00 IMOD

ATOM 2392 CB ASP 297 -3.128 17.665 ^■ 24.915 00 0.00 IMOD

ATOM 2393 CG ASP 297 -1.832 17.961 ^• 24.181 1.00 0.00 IMOD

ATOM 2394 ODl ASP 297 -1.850 17.959 ^■ 22.922 .00 0.00 IMOD

ATOM 2395 OD2 ASP 297 -0.801 18.181 ^■ 24.870 .00 0.00 IMOD

ATOM 2396 N ALA 298 -3.593 14.731 ^■ 24.105 .00 0.00 IMOD

ATOM 2397 CA ALA 298 -2.938 13.547 23.630 .00 0.00 IMOD

ATOM 2398 C ALA 298 -3.575 13.021 ^• 22.379 .00 0.00 IMOD

ATOM 2399 O ALA 298 -2.895 12.774 ^■ 21.388 .00 0.00 IMOD

ATOM 2400 CB ALA 298 -2.953 12.413 ^■ 24.669 .00 0.00 IMOD

ATOM 2401 N THR 299 -4.907 12.871 ^■ 22.358 .00 0.00 IMOD

ATOM 2402 CA THR 299 -5.557 12.268 ^■ 21.230 .00 0.00 IMOD

ATOM 2403 C THR 299 -5.386 13.132 20.023 .00 0.00 IMOD

ATOM 2404 O THR 299 -5.197 12.630 ^■ 18.916 .00 0.00 IMOD

ATOM 2405 CB THR 299 -7.023 12.058 21.470 .00 0.00 IMOD

ATOM 2406 OGl THR 299 -7.590 11.302 20.411 .00 0.00 IMOD

ATOM 2407 CG2 THR 299 -7.705 -13.433 ^■ 21.593 .00 0.00 IMOD

ATOM 2408 N GLU 300 -5.470 -14.464 20.205 .00 0.00 IMOD

ATOM 2409 CA GLU 300 -5.388 -15.389 19.111 .00 0.00 IMOD

ATOM 2410 C GLU 300 -4.026 -15.329 18.489 .00 0.00 IMOD

ATOM 2411 O GLU 300 -3.897 -15.257 17.269 .00 0.00 IMOD

ATOM 2412 CB GLU 300 -5.561 -16.857 19.552 .00 0.00 IMOD

ATOM 2413 CG GLU 300 -6.867 -17.150 20.288 .00 0.00 IMOD

ATOM 2414 CD GLU 300 -8.024 -16.668 19.431 .00 0.00 IMOD

ATOM 2415 OEl GLU 300 -7.788 -16.405 18.224 .00 0.00 IMOD

ATOM 2416 OE2 GLU 300 -9.154 -16.538 19.973 .00 0.00 IMOD

ATOM 2417 N ILE 301 -2.976 -15.366 19.331 .00 0.00 IMOD

ATOM 2418 CA ILE 301 -1.614 -15.400 18.881 .00 0.00 IMOD

ATOM 2419 C ILE 301 -1.278 -14.112 18.186 .00 0.00 IMOD

ATOM 2420 O ILE 301 -0.620 -14.120 17.148 .00 0.00 IMOD

ATOM 2421 CB ILE 301 -0.653 -15.637 20.017 .00 0.00 IMOD

ATOM 2422 CGl ILE 301 0.740 -16.055 19.511 .00 0.00 IMOD

ATOM 2423 CG2 ILE 301 -0.670 -14.404 20.930 ,00 0.00 IMOD

ATOM 2424 CDl ILE 301 1.481 -14.992 18.704 ,00 0.00 IMOD

ATOM 2425 N LEU 302 -1.725 -12.967 18.738 00 0.00 IMOD

ATOM 2426 CA LEU 302 -1.423 -11.681 18.171 ,00 0.00 IMOD

ATOM 2427 C LEU 302 -2.002 -11.572 16.798 .00 0.00 IMOD

ATOM 2428 O LEU 302 -1.418 -10.939 15.920 00 0.00 IMOD

ATOM 2429 CB LEU 302 -1.940 -10.489 18.992 ,00 0.00 IMOD

ATOM 2430 CG LEU 302 -1.008 -10.061 20.140 00 0.00 IMOD

ATOM 2431 CDl LEU 302 0.261 -9.390 19.593 00 0.00 IMOD

ATOM 2432 CD2 LEU 302 -0.674 -11.227 21.076 00 0.00 IMOD

ATOM 2433 N GLY 303 -3.168 -12.194 16.579 00 0.00 IMOD

ATOM 2434 CA GLY 303 -3.861 -12.120 - 15.326 1.00 0.00 IMOD

ATOM 2435 C GLY 303 -2.981 -12.664 -14.241 00 0.00 IMOD

ATOM 2436 O GLY 303 -3.071 -12.253 -13.086 00 0.00 IMOD

ATOM 2437 N ILE 304 -2.096 -13.604 -14.611 00 0.00 IMOD

ATOM 2438 CA ILE 304 -1.203 -14.349 -13.763 00 0.00 IMOD

ATOM 2439 C ILE 304 -0.365 -13.393 -12.966 00 0.00 IMOD

ATOM 2440 O ILE 304 0.127 -13.734 -11.892 00 0.00 IMOD

ATOM 2441 CB ILE 304 -0.301 -15.231 -14.573 00 0.00 IMOD

ATOM 2442 CGl ILE 304 -1.168 -16.204 -15.382 00 0.00 IMOD

ATOM 2443 CG2 ILE 304 0.701 -15.925 -13.634 00 0.00 IMOD

ATOM 2444 CDl ILE 304 -0.427 -16.832 -16.552 00 0.00 IMOD

ATOM 2445 N LEU 305 -0.168 -12.179 -13.502 00 0.00 IMOD

ATOM 2446 CA LEU 305 0.617 -11.108 -12.951 00 0.00 IMOD

ATOM 2447 C LEU 305 0.070 -10.737 -11.598 00 0.00 IMOD

ATOM 2448 O LEU 305 0.783 -10.183 -10.761 00 0.00 IMOD

ATOM 2449 CB LEU 305 0.529 -9.861 -13.850 00 0.00 IMOD

ATOM 2450 CG LEU 305 1.327 -8.642 -13.360 00 0.00 IMOD

ATOM 2451 CDl LEU 305 2.841 -8.902 -13.410 00 0.00 IMOD

ATOM 2452 CD2 LEU 305 0.918 -7.372 -14.125 00 0.00 IMOD

ATOM 2453 N HIS 306 -1.219 -11.037 -11.353 00 0.00 IMOD

ATOM 2454 CA HIS 306 -1.940 -10.685 -10.162 00 0.00 IMOD

ATOM 2455 C HIS 306 -1.233 -11.230 -8.958 00 0.00 IMOD

ATOM 2456 O HIS 306 -1.431 -10.753 -7.842 00 0.00 IMOD

ATOM 2457 CB HIS 306 -3.363 -11.260 -10.170 1.00 0.00 IMOD

ATOM 2458 CG HIS 306 -4.225 -10.713 -9.078 .00 0.00 IMOD

ATOM 2459 NDl HIS 306 -4.972 -9.565 -9.203 .00 0.00 IMOD

ATOM 2460 CD2 HIS 306 -4.461 -11.179 -7.821 .00 0.00 IMOD

ATOM 2461 CEl HIS 306 -5.622 -9.392 -8.025 .00 0.00 IMOD

ATOM 2462 NE2 HIS 306 -5.342 -10.347 -7.155 .00 0.00 IMOD

ATOM 2463 N SER 307 •0.441 -12.296 -9.146 .00 0.00 IMOD

ATOM 2464 CA SER 307 0.281 -12.917 -8.077 .00 0.00 IMOD

ATOM 2465 C SER 307 1.319 -12.001 -7.475 .00 0.00 IMOD

ATOM 2466 O SER 307 582 -12.087 -6.279 .00 0.00 IMOD

ATOM 2467 CB SER 307 029 -14.178 -8.540 .00 0.00 IMOD

ATOM 2468 OG SER 307 036 -13.835 -9.481 .00 0.00 IMOD

ATOM 2469 N CYS 308 064 -11.239 -8.303 .00 0.00 IMOD

ATOM 2470 CA CYS 308 3.124 -10.367 -7.841 .00 0.00 IMOD

ATOM 2471 C CYS 308 2.830 -8.906 -7.596 .00 0.00 IMOD

ATOM 2472 O CYS 308 3.475 -8.278 -6.758 .00 0.00 IMOD

ATOM 2473 CB CYS 308 4.345 -10.418 -8.775 1.00 0.00 IMOD

ATOM 2474 SG CYS 308 3.960 -9.822 ^■ 10.450 00 0.00 IMOD

ATOM 2475 N LEU 309 1.898 -8.300 -8.352 00 0.00 IMOD

ATOM 2476 CA LEU 309 1.805 -6.860 -8.400 00 0.00 IMOD

ATOM 2477 C LEU 309 1.501 -6.213 -7.087 00 0.00 IMOD

ATOM 2478 O LEU 309 2.038 -5.146 -6.792 00 0.00 IMOD

ATOM 2479 CB LEU 309 0.803 -6.369 -9.464 00 0.00 IMOD

ATOM 2480 CG LEU 309 -0.642 -6.876 -9.301 00 0.00 IMOD

ATOM 2481 CDl LEU ^' 309 ^• 1.363 -6.175 -8.136 00 0.00 IMOD

ATOM 2482 CD2 LEU 309 -1.405 -6.815 ^■ 10.636 00 0.00 IMOD

ATOM 2483 N ASN 310 0.639 -6.809 -6.253 00 0.00 IMOD

ATOM 2484 CA ASN 310 0.275 -6.107 -5.061 00 0.00 IMOD

ATOM 2485 C ASN 310 1.441 -5.868 -4.143 00 0.00 IMOD

ATOM 2486 O ASN 310 1.481 -4.800 -3.537 00 0.00 IMOD

ATOM 2487 CB ASN 310 ^■ 0.936 -6.706 -4.303 00 0.00 IMOD

ATOM 2488 CG ASN 310 ^■ 0.743 -8.182 -4.006 00 0.00 IMOD

ATOM 2489 ODl ASN 310 ^■ 0.904 -9.039 -4.873 00 0.00 IMOD

ATOM 2490 ND2 ASN 310 ^■ 0.343 -8.486 -2.742 00 0.00 IMOD

ATOM 2491 N PRO 311 2.400 -6.734 -3.960 00 0.00 IMOD

ATOM 2492 CA PRO 311 3.455 -6.396 -3.050 00 0.00 IMOD

ATOM 2493 C PRO 311 4.288 -5.287 -3.599 00 0.00 IMOD

ATOM 2494 O PRO 311 4.905 -4.562 -2.822 00 0.00 IMOD

ATOM 2495 CB PRO 311 4.229 -7.688 -2.806 00 0.00 IMOD

ATOM 2496 CG PRO 311 3.192 -8.792 -3.063 00 0.00 IMOD

ATOM 2497 CD PRO 311 2.252 -8.171 -4.107 00 0.00 IMOD

ATOM 2498 N LEU 312 4.337 -5.157 -4 937 00 0.00 IMOD

ATOM 2499 CA LEU 312 5.154 -4.156 -5.552 1.00 0.00 IMOD

ATOM 2500 C LEU 312 4.614 -2.815 -5.184 00 0.00 IMOD

ATOM 2501 O LEU 312 5.351 -1.917 -4.777 00 0.00 IMOD

ATOM 2502 CB LEU 312 5.120 -4.233 -7.087 00 0.00 IMOD

ATOM 2503 CG LEU 312 6.005 -3.175 -7.773 00 0.00 IMOD

ATOM 2504 CDl LEU 312 .494 -3.494 -7 582 00 0.00 IMOD

ATOM 2505 CD2 LEU 312 .613 -2.965 9.243 00 0.00 IMOD

ATOM 2506 N ILE 313 .286 -2.662 5.308 00 0.00 IMOD

ATOM 2507 CA ILE 313 2.672 -1.400 -5 058 00 0.00 IMOD

ATOM 2508 C ILE 313 2.858 -1.064 -3.616 00 0.00 IMOD

ATOM 2509 O ILE 313 3.117 0.085 -3.262 00 0.00 IMOD

ATOM 2510 CB ILE 313 1.207 -1.373 -5.400 00 0.00 IMOD

ATOM 2511 CGl ILE 313 0.736 0.078 -5.540 00 0.00 IMOD

ATOM 2512 CG2 ILE 313 0.423 -2.179 -4.352 00 0.00 IMOD

ATOM 2513 CDl ILE 313 1.338 0.791 -6.751 00 0.00 IMOD

ATOM 2514 N TYR 314 2.745 -2.085 -2.751 00 0.00 IMOD

ATOM 2515 CA TYR 314 2.804 -1.935 -1.330 00 0.00 IMOD

ATOM 2516 C TYR 314 4.148 -1.382 -0.962 00 0.00 IMOD

ATOM 2517 O TYR 314 4.250 -0.432 -0.187 00 0.00 IMOD

ATOM 2518 CB TYR 314 2.605 -3.315 -0.668 00 0.00 IMOD

ATOM 2519 CG TYR 314 2.304 -3.179 0.781 00 0.00 IMOD

ATOM 2520 CDl TYR 314 .043 -2.814 1.191 00 0.00 IMOD

ATOM 2521 CD2 TYR 314 .261 -3.449 1.727 00 0.00 IMOD

ATOM 2522 CEl TYR 314 0.746 -2.694 2.527 00 0.00 IMOD

ATOM 2523 CE2 TYR 314 2.970 -3.332 3.064 00 0.00 IMOD

ATOM 2524 CZ TYR 314 1.713 -2.953 3.465 00 0.00 IMOD

ATOM 2525 OH TYR 314 1.416 -2.835 4.838 00 0.00 IMOD

ATOM 2526 N ALA 315 5.225 -1.949 -1.532 00 0.00 IMOD

ATOM 2527 CA ALA 315 6.527 -1.491 -1.158 00 0.00 IMOD

ATOM 2528 C ALA 315 6.687 -0.050 -1.540 00 0.00 IMOD

ATOM 2529 O ALA 315 7.162 0.754 -0.741 00 0.00 IMOD

ATOM 2530 CB ALA 315 7.656 -2.281 -1 841 00 0.00 IMOD

ATOM 2531 N PHE 316 6.301 0.330 2.776 00 0.00 IMOD

ATOM 2532 CA PHE 316 6.508 1.693 - 3.195 1.00 0.00 IMOD

ATOM 2533 C PHE 316 5.629 2.648 - 2.439 00 0.00 IMOD

ATOM 2534 O PHE 316 6.092 3.676 -1 945 00 0.00 IMOD

ATOM 2535 CB PHE 316 6.247 1.931 -4 696 00 0.00 IMOD

ATOM 2536 CG PHE 316 7.285 1.200 -5 468 00 0.00 IMOD

ATOM 2537 CDl PHE 316 8.500 1.791 ^■ 5.724 00 0.00 IMOD

ATOM 2538 CD2 PHE 316 7.044 -0.073 5.923 00 0.00 IMOD

ATOM 2539 CEl PHE 316 9.460 1.112 6.437 00 0.00 IMOD

ATOM 2540 CE2 PHE 316 8.002 -0.749 6.636 1.00 0.00 IMOD

ATOM 2541 CZ PHE 316 9.216 -0.161 ^■ 6.895 1.00 0.00 IMOD

ATOM 2542 N ILE 317 4.324 2.341 2.344 .00 0.00 IMOD

ATOM 2543 CA ILE 317 3.393 3.245 ^■ 1.742 .00 0.00 IMOD

ATOM 2544 C ILE 317 3.564 3.394 0.265 .00 0.00 IMOD

ATOM 2545 O ILE 317 3.415 4.504 0.245 .00 0.00 IMOD

ATOM 2546 CB ILE 317 1.956 2.966 -2.080 .00 0.00 IMOD

ATOM 2547 CGl ILE 317 1.756 3.241 -3.584 .00 0.00 IMOD

ATOM 2548 CG2 ILE 317 1.060 3.844 -1.187 .00 0.00 IMOD

ATOM 2549 CDl ILE 317 0.345 3.000 -4.109 .00 0.00 IMOD

ATOM 2550 N GLY 318 3.857 2.308 0.477 .00 0.00 IMOD

ATOM 2551 CA GLY 318 3.947 2.451 1.903 .00 0.00 IMOD

ATOM 2552 C GLY 318 5.365 2.669 2.320 .00 0.00 IMOD

ATOM 2553 O GLY 318 6.230 1.808 2.169 00 0.00 IMOD

ATOM 2554 N GLN 319 5.613 3.854 2.899 00 0.00 IMOD

ATOM 2555 CA GLN 319 6.899 4.238 3.387 ,00 0.00 IMOD

ATOM 2556 C GLN 319 7.262 3.371 4.546 .00 0.00 IMOD

ATOM 2557 O GLN 319 8.390 2.892 4.645 00 0.00 IMOD

ATOM 2558 CB GLN 319 6.844 5.683 3.901 00 0.00 IMOD

ATOM 2559 CG GLN 319 8.070 6.144 4.679 00 0.00 IMOD

ATOM 2560 CD GLN 319 7.739 7.542 5.181 00 0.00 IMOD

ATOM 2561 OEl GLN 319 7.681 8.493 4.404 00 0.00 IMOD

ATOM 2562 NE2 GLN 319 7.487 7.667 6.511 00 0.00 IMOD

ATOM 2563 N LYS 320 6.302 3.141 5.459 00 0.00 IMOD

ATOM 2564 CA LYS 320 6.591 2.405 6.656 1.00 0.00 IMOD

ATOM 2565 C LYS 320 7.003 1.007 6.336 00 0.00 IMOD

ATOM 2566 O LYS 320 8.011 0.525 6.848 00 0.00 IMOD

ATOM 2567 CB LYS 320 5.409 2.347 7.639 00 0.00 IMOD

ATOM 2568 CG LYS 320 4.862 0.941 7.900 00 0.00 IMOD

ATOM 2569 CD LYS 320 3.397 0.777 7.481 00 0.00 IMOD

ATOM 2570 CE LYS 320 2.769 -0.561 7.874 1.00 0.00 IMOD

ATOM 2571 NZ LYS 320 1.292 -0.476 7.764 .00 0.00 IMOD

ATOM 2572 N PHE 321 6.246 0.333 5.455 .00 0.00 IMOD

ATOM 2573 CA PHE 321 6.522 -1.022 5.071 .00 0.00 IMOD

ATOM 2574 C PHE 321 7.847 -1.077 4.380 .00 0.00 IMOD

ATOM 2575 O PHE 321 8.627 -2.003 4.598 .00 0.00 IMOD

ATOM 2576 CB PHE 321 5.456 -1.579 4.102 .00 0.00 IMOD

ATOM 2577 CG PHE 321 5.840 -2.938 3.607 1.00 0.00 IMOD

ATOM 2578 CDl PHE 321 5.659 -4.063 4.380 1.00 0.00 IMOD

ATOM 2579 CD2 PHE 321 6.354 -3.090 2.338 1..00 0.00 IMOD

ATOM 2580 CEl PHE 321 6.007 -5.307 3.902 1.00 0.00 IMOD

ATOM 2581 CE2 PHE 321 6.704 -4.332 1.854 1..00 0.00 IMOD

ATOM 2582 CZ PHE 321 6.532 -5.446 2.638 1,.00 0.00 IMOD

ATOM 2583 N ARG 322 8.138 -0.073 3.532 1.00 0.00 IMOD

ATOM 2584 CA ARG 322 9.341 -0.049 2.749 1..00 0.00 IMOD

ATOM 2585 C ARG 322 10.510 -0.131 3.680 1..00 0.00 IMOD

ATOM 2586 O ARG 322 11.429 -0.922 3.470 1,.00 0.00 IMOD

ATOM 2587 CB ARG 322 9.492 1.281 1.989 1. 00 0.00 IMOD

ATOM 2588 CG ARG 322 10.752 1.381 1.128 1, .00 0.00 IMOD

ATOM 2589 CD ARG 322 11.130 2.820 0.766 1..00 0.00 IMOD

ATOM 2590 NE ARG ^■ 322 11.869 3.378 1.935 1,.00 0.00 IMOD

ATOM 2591 CZ ARG 322 11.214 4.046 2.931 1,.00 0.00 IMOD

ATOM 2592 NHl ARG 322 9.872 4.278 2.840 1..00 0.00 IMOD

ATOM 2593 NH2 ARG 322 11.907 4.478 4.024 1..00 0.00 IMOD

ATOM 2594 N HIS 323 10.483 0.690 4.746 1,.00 0.00 IMOD

ATOM 2595 CA HIS 323 11.514 0.752 5.745 1,.00 0.00 IMOD

ATOM 2596 C HIS 323 11.589 -0.581 6.405 1..00 0.00 IMOD

ATOM 2597 O HIS 323 12.676 -1.123 6.613 1..00 0.00 IMOD

ATOM 2598 CB HIS 323 11.139 1.766 6.849 1..00 0.00 IMOD

ATOM 2599 CG HIS 323 12.049 1.847 8.046 1,.00 0.00 IMOD

ATOM 2600 NDl HIS 323 12.438 3.033 8.630 1..00 0.00 IMOD

ATOM 2601 CD2 HIS 323 12.589 0.863 8.817 1.00 0.00 IMOD

ATOM 2602 CEl HIS 323 13.183 2.711 9.717 1..00 0.00 IMOD

ATOM 2603 NE2 HIS 323 13.303 1.405 9.870 1..00 0.00 IMOD

ATOM 2604 N GLY 324 10.410 -1.137 6.739 1.00 0.00 IMOD

ATOM 2605 CA GLY 324 10.316 -2.377 7.441 1..00 0.00 IMOD

ATOM 2606 C GLY 324 10.973 -3.439 6.627 1.00 0.00 IMOD

ATOM 2607 O GLY 324 11.647 -4.315 7.165 1..00 0.00 IMOD

ATOM 2608 N LEU 325 10.759 -3.397 5.303 1.00 0.00 IMOD

ATOM 2609 CA LEU 325 11.325 -4.357 4.404 1..00 0.00 IMOD

ATOM 2610 C LEU 325 12.814 -4.213 4.431 1.00 0.00 IMOD

ATOM 2611 O LEU 325 13.550 -5.183 4.599 1..00 0.00 IMOD

ATOM 2612 CB LEU 325 10.880 -4.055 2.967 1..00 0.00 IMOD

ATOM 2613 CG LEU 325 11.429 -5.031 1.918 00 0.00 IMOD

ATOM 2614 CDl LEU 325 10.821 -6.433 2.108 00 0.00 IMOD

ATOM 2615 CD2 LEU 325 11.251 -4.476 0.496 00 0.00 IMOD

ATOM 2616 N LEU 326 13.293 -2.963 4.299 00 0.00 IMOD

ATOM 2617 CA LEU 326 14.698 -2.688 4.233 00 0.00 IMOD

ATOM 2618 C LEU 326 15.329 -3.108 5.515 00 0.00 IMOD

ATOM 2619 O LEU 326 16.426 -3.665 5.523 00 0.00 IMOD

ATOM 2620 CB LEU 326 15.001 -1.190 4.018 00 0.00 IMOD

ATOM 2621 CG LEU 326 16.503 -0.836 3.944 00 0.00 IMOD

ATOM 2622 CDl LEU 326 17.177 -0.824 5.326 00 0.00 IMOD

ATOM 2623 CD2 LEU 326 17.229 -1.766 2.962 00 0.00 IMOD

ATOM 2624 N LYS 327 14.648 -2.856 6.641 00 0.00 IMOD

ATOM 2625 CA LYS 327 15.258 -3.158 7.893 00 0.00 IMOD

ATOM 2626 C LYS 327 15.507 -4.631 7.923 00 0.00 IMOD

ATOM 2627 O LYS 327 16.544 -5.072 8.406 00 0.00 IMOD

ATOM 2628 CB LYS 327 14.385 -2.775 9.105 00 0.00 IMOD

ATOM 2629 CG LYS 327 13.621 -3.925 9.767 1.00 0.00 IMOD

ATOM 2630 CD LYS 327 14.519 ■4.747 10.696 00 0.00 IMOD

ATOM 2631 CE LYS 327 13.776 ^■ 5.740 11.586 00 0.00 IMOD

ATOM 2632 NZ LYS 327 14.709 ^■ 6.292 12.591 00 0.00 IMOD

ATOM 2633 N ILE 328 14.558 ^■ 5.441 7.413 00 0.00 IMOD

ATOM 2634 CA ILE 328 14.742 ^■ 6.865 7.419 00 0.00 IMOD

ATOM 2635 C ILE 328 15.875 ^■ 7.244 6.513 00 0.00 IMOD

ATOM 2636 O ILE 328 16.736 •8.036 6.894 00 0.00 IMOD

ATOM 2637 CB ILE 328 13.522 ^■ 7.620 6.975 00 0.00 IMOD

ATOM 2638 CGl ILE 328 12.392 •7.424 7.997 00 0.00 IMOD

10 ATOM 2639 CG2 ILE 328 13.923 -9.091 6.769 00 0.00 IMOD

ATOM 2640 CDl ILE 328 12.753 -7 .936 9.390 00 0.00 IMOD

ATOM 2641 N LEU 329 15.916 .687 5.286 00 0.00 IMOD

ATOM 2642 CA LEU 329 16.966 -7.068 4.382 00 0.00 IMOD

ATOM 2643 C LEU 329 18.282 -6.691 4.971 00 0.00 IMOD

I ₅ ATOM 2644 O LEU 329 19.209 -7.495 5, .018 00 0.00 IMOD

ATOM 2645 CB LEU 329 16.890 -6.368 3..010 00 0.00 IMOD

ATOM 2646 CG LEU 329 15.829 -6.918 2.037 00 0.00 IMOD

ATOM 2647 CDl LEU 329 14.412 -6.865 2.622 00 0.00 IMOD

ATOM 2648 CD2 LEU 329 15.930 -6.207 0.676 00 0.00 IMOD 0 ATOM 2649 N ALA 330 18.385 -5 446 5.455 00 0.00 IMOD

ATOM 2650 CA ALA 330 19.608 ^• 4.955 6.010 00 0.00 IMOD

ATOM 2651 C ALA 330 19.924 •5.737 7.241 00 0.00 IMOD

ATOM 2652 O ALA 330 21.088 5.954 7.572 00 0.00 IMOD

ATOM 2653 CB ALA 330 19.523 -3 475 6.412 00 0.00 IMOD

2S ATOM 2654 N ILE 331 18.859 6.166 7.941 00 0.00 IMOD

ATOM 2655 CA ILE 331 18.886 6.725 9.258 00 0.00 IMOD

ATOM 2656 C ILE 331 19.829 -5 844 9.998 00 0.00 IMOD

ATOM 2657 O ILE 331 20.961 6.181 10.332 00 0.00 IMOD

ATOM 2658 CB ILE 331 19.259 •8.193 9.300 00 0.00 IMOD

30 ATOM 2659 CGl ILE 331 18.991 8.788 10.695 00 0.00 IMOD

ATOM 2660 CG2 ILE 331 20.683 ^■ 8.397 8.758 00 0.00 IMOD

ATOM 2661 CDl ILE 331 19.799 ^• 8.162 11.829 00 0.00 IMOD

ATOM 2662 N HIS 332 19.305 ■4.655 10.321 00 0.00 IMOD

ATOM 2663 CA HIS 332 20.055 3.615 10.939 00 0.00 IMOD 5 ATOM 2664 C HIS 332 19.199 2.413 10.739 00 0.00 IMOD

ATOM 2665 O HIS 332 18.099 ^■ 2.331 11.284 00 0.00 IMOD

ATOM 2666 CB HIS 332 21.428 -3 365 10.281 00 0.00 IMOD

ATOM 2667 CG HIS 332 22.227 ■2.272 10.938 00 0.00 IMOD

ATOM 2668 NDl HIS 332 22.919 •2.412 12.120 00 0.00 IMOD 0 ATOM 2669 CD2 HIS 332 22.432 •0.986 10.540 00 0.00 IMOD

ATOM 2670 CEl HIS 332 23.503 •1.212 12.377 00 0.00 IMOD

ATOM 2671 NE2 HIS 332 23.235 ^• 0.317 11.446 00 0.00 IMOD

ATOM 2672 N GLY 333 19.675 — 1 453 9.926 00 0.00 IMOD

ATOM 2673 CA GLY 333 18.905 0.267 9.710 00 0.00 IMOD 5 ATOM 2674 C GLY 333 19.466 0.445 8.526 00 0.00 IMOD

ATOM 2675 O GLY 333 19.841 0.168 7.527 00 0.00 IMOD

ATOM 2676 N LEU 334 19.566 1.779 8.650 00 0.00 IMOD

ATOM 2677 CA LEU 334 20.074 2.619 7.613 00 0.00 IMOD

ATOM 2678 C LEU 334 19.052 2.645 6.510 00 0.00 IMOD 0 ATOM 2679 O LEU 334 19.374 2.745 5.329 00 0.00 IMOD

ATOM 2680 CB LEU 334 21.420 2.080 7.079 00 0.00 IMOD

ATOM 2681 CG LEU 334 22.396 3.118 6.478 00 0.00 IMOD

ATOM 2682 CDl LEU 334 21.857 3.863 5.250 00 0.00 IMOD

ATOM 2683 CD2 LEU 334 22.901 4.063 7.580 00 0.00 IMOD 5 ATOM 2684 N ILE 335 17.758 2.543 6.867 00 0.00 IMOD

ATOM 2685 CA ILE 335 16.779 2.706 5.834 00 0.00 IMOD

ATOM 2686 C ILE 335 16.390 4.144 5.886 00 0.00 IMOD

ATOM 2687 O ILE 335 15.282 4.503 6.276 00 0.00 IMOD

ATOM 2688 CB ILE 335 15.566 1.845 6.021 00 0.00 IMOD 0 ATOM 2689 CGl ILE 335 14.522 2.140 4.931 00 0.00 IMOD

ATOM 2690 CG2 ILE 335 15.076 2.008 7.465 00 0.00 IMOD

ATOM 2691 CDl ILE 335 14.965 1.775 3.514 00 0.00 IMOD

ATOM 2692 N SER 336 17.319 5.020 5.471 00 0.00 IMOD

ATOM 2693 CA SER 336 17.038 6.418 5.525 00 0.00 IMOD 5 ATOM 2694 C SER 336 16.195 6.744 4.348 1.00 0.00 IMOD

ATOM 2695 O SER 336 16.448 6.282 3.236 00 0.00 IMOD

ATOM 2696 CB SER 336 18.298 7.297 5.468 00 0.00 IMOD

ATOM 2697 OG SER 336 19.104 7.074 6.616 00 0.00 IMOD

ATOM 2698 N LYS 337 15.163 7.573 4.570 1.00 0.00 IMOD

ATOM 2699 CA LYS 337 14.284 7.912 3.496 00 0.00 IMOD

ATOM 2700 C LYS 337 14.038 9.400 3.574 00 0.00 IMOD

ATOM 2701 O LYS 337 14.949 10.133 .948 00 0.00 IMOD

ATOM 2702 CB LYS 337 12.924 .198 .582 00 0.00 IMOD

ATOM 2703 CG LYS 337 12.203 .091 .236 00 0.00 IMOD

ATOM 2704 CD LYS 337 12.876 6.099 .283 00 0.00 IMOD

ATOM 2705 CE LYS 337 12.187 5. .963 -0.076 00 0.00 IMOD

ATOM 2706 NZ LYS 337 12.895 4.964 -0.912 00 0.00 IMOD

ATOM 2707 N ASP 338 12.805 9.858 3.209 00 0.00 IMOD

ATOM 2708 CA ASP 338 12.364 11.239 3.062 00 0.00 IMOD

ATOM 2709 C ASP 338 11.896 11.899 4.355 00 0.00 IMOD

ATOM 2710 O ASP 338 12.302 11.508 5.449 00 0.00 IMOD

ATOM 2711 CB ASP 338 11.185 11.389 2.085 00 0.00 IMOD

ATOM 2712 CG ASP 338 11.661 11.063 0.680 1.00 0.00 IMOD

ATOM 2713 ODl ASP 338 12.887 10.833 0.498 00 0.00 IMOD

ATOM 2714 OD2 ASP 338 10.795 11.040 -0.234 00 0.00 IMOD

ATOM 2715 N SER 339 11.072 12.988 4.202 00 0.00 IMOD

ATOM 2716 CA SER 339 10.542 13.940 5.177 00 0.00 IMOD

ATOM 2717 C SER 339 9.673 13.397 6.298 00 0.00 IMOD

ATOM 2718 O SER 339 10.177 13.161 7.394 00 0.00 IMOD

ATOM 2719 CB SER 339 9.706 15.050 4.521 00 0.00 IMOD

ATOM 2720 OG SER 339 9.227 15.937 5.521 1.00 0.00 IMOD

ATOM 2721 N LEU 340 8.342 13.212 6.068 1. 00 0.00 IMOD

ATOM 2722 CA LEU 340 7.438 12.852 7.145 1.00 0.00 IMOD

ATOM 2723 C LEU 340 7.596 11.402 7.465 1.00 0.00 IMOD

ATOM 2724 O LEU 340 7.632 10.551 6.580 1.00 0.00 IMOD

ATOM 2725 CB LEU 340 5.955 13.110 6.834 1.00 0.00 IMOD

ATOM 2726 CG LEU 340 5.021 12.718 7.995 1.00 0.00 IMOD

ATOM 2727 CDl LEU 340 5.316 13.536 9.265 1.00 0.00 IMOD

ATOM 2728 CD2 LEU 340 3.550 12.793 7.565 1.00 0.00 IMOD

ATOM 2729 N PRO 341 7.728 11.138 8.739 1.00 0.00 IMOD

ATOM 2730 CA PRO 341 7.921 9.786 9.200 1.00 0.00 IMOD

ATOM 2731 C PRO 341 6.673 9.040 9.535 1.00 0.00 IMOD

ATOM 2732 O PRO 341 5.614 9.649 9.679 1.00 0.00 IMOD

ATOM 2733 CB PRO 341 8.884 9.865 10.387 1.00 0.00 IMOD

ATOM 2734 CG PRO 341 8.798 11.325 10.850 1.00 0.00 IMOD

ATOM 2735 CD PRO 341 8.466 12.086 9.559 1.00 0.00 IMOD

ATOM 2736 N LYS 342 6.810 7.707 9.683 1.00 0.00 IMOD

ATOM 2737 CA LYS 342 5.751 6.833 10.075 1.00 0.00 IMOD

ATOM 2738 C LYS 342 6.203 6.275 11.388 1.00 0.00 IMOD

ATOM 2739 O LYS 342 7.189 6.742 11.957 1.00 0.00 IMOD

ATOM 2740 CB LYS 342 5.565 5.627 9.137 1.00 0.00 IMOD

ATOM 2741 CG LYS 342 4.210 4.929 9.281 1.00 0.00 IMOD

ATOM 2742 CD LYS 342 3.078 5.669 8.566 1.00 0.00 IMOD

ATOM 2743 CE LYS 342 3.132 7,.187 8.739 00 0.00 IMOD

ATOM 2744 NZ LYS 342 2.230 7,.838 7.761 00 0.00 IMOD

ATOM 2745 N ASP 343 5.485 5..264 11.906 00 0.00 IMOD

ATOM 2746 CA ASP 343 5.829 4.652 13.155 00 0.00 IMOD

ATOM 2747 C ASP 343 6.953 3.702 12.863 00 0.00 IMOD

ATOM 2748 O ASP 343 456 3.671 11.741 00 0.00 IMOD

ATOM 2749 CB ASP 343 665 3.821 13.729 00 0.00 IMOD

ATOM 2750 CG ASP 343 4.941 .489 15.187 00 0.00 IMOD

ATOM 2751 ODl ASP 343 5.900 .067 15.762 00 0.00 IMOD

ATOM 2752 OD2 ASP 343 4.186 .648 15.746 00 0.00 IMOD

ATOM 2753 N SER 344 7.392 .922 13.877 00 0.00 IMOD

ATOM 2754 CA SER 344 8.441 .960 13.691 00 0.00 IMOD

ATOM 2755 C SER 344 7.819 0.609 13.858 00 0.00 IMOD

ATOM 2756 O SER 344 6.707 0.494 14.373 00 0.00 IMOD

ATOM 2757 CB SER 344 9.573 2.052 14.731 00 0.00 IMOD

ATOM 2758 OG SER 344 10.536 1.034 14.499 00 0.00 IMOD

ATOM 2759 N ARG 345 8.514 -0.443 13.373 1.00 0.00 IMOD

ATOM 2760 CA ARG 345 8 . 017 1.789 13.458 .00 0.00 IMOD

ATOM 2761 C ARG 345 9 . 213 2.696 13.396 .00 0.00 IMOD

ATOM 2762 O ARG 345 9 . 793 2.865 12.326 .00 0.00 IMOD

ATOM 2763 CB ARG 345 7 . 172 2.149 12.226 .00 0.00 IMOD

ATOM 2764 CG ARG 345 895 1.317 12.091 .00 0.00 IMOD

ATOM 2765 CD ARG 345 4 60 -1 081 10.641 .00 0.00 IMOD

ATOM 2766 NE ARG 345 746 2.314 9.855 .00 0.00 IMOD

ATOM 2767 CZ ARG 345 601 2.289 8.498 .00 0.00 IMOD

ATOM 2768 NHl ARG 345 5.152 -1 155 7.888 .00 0.00 IMOD

ATOM 2769 NH2 ARG 345 5.910 3.391 7.752 .00 0.00 IMOD

ATOM 2770 N PRO 346 9.707 3.158 14.505 .00 0.00 IMOD

ATOM 2771 CA PRO 346 10.774 4.128 14.368 .00 0.00 IMOD

ATOM 2772 C PRO 346 10.587 291 15.297 .00 0.00 IMOD

ATOM 2773 O PRO 346 9.646 279 16.089 .00 0.00 IMOD

ATOM 2774 CB PRO 346 12.054 384 14.726 .00 0.00 IMOD

ATOM 2775 CG PRO 346 11.576 400 15.802 .00 0.00 IMOD

ATOM 2776 CD PRO 346 10.137 071 15.375 .00 0.00 IMOD

ATOM 2777 N SER 347 11.469 -6.315 15.213 1.00 0.00 IMOD

ATOM 2778 CA SER 347 11.502 -7 328 16.233 00 0.00 IMOD

ATOM 2779 C SER 347 12.270 6.830 17.429 00 0.00 IMOD

ATOM 2780 O SER 347 11.707 6.336 18.406 00 0.00 IMOD

ATOM 2781 CB SER 347 12.200 8.620 15.775 00 0.00 IMOD

ATOM 2782 OG SER 347 12.205 9.568 16.834 00 0.00 IMOD

ATOM 2783 N PHE 348 13.617 6.965 17.346 00 0.00 IMOD

ATOM 2784 CA PHE 348 14.521 644 18.422 00 0.00 IMOD

ATOM 2785 C PHE 348 14.654 170 18.638 00 0.00 IMOD

ATOM 2786 O PHE 348 14.676 706 19.778 00 0.00 IMOD

ATOM 2787 CB PHE 348 15.915 282 18.267 00 0.00 IMOD

ATOM 2788 CG PHE 348 16.632 6.727 17.087 00 0.00 IMOD

ATOM 2789 CDl PHE 348 16.416 7.237 15.825 00 0.00 IMOD

ATOM 2790 CD2 PHE 348 17.527 -5 693 17.247 00 0.00 IMOD

ATOM 2791 CEl PHE 348 17.085 6.726 14.739 00 0.00 IMOD

ATOM 2792 CE2 PHE 348 18.199 5.179 16.165 00 0.00 IMOD

ATOM 2793 CZ PHE 348 17.978 -5.695 14.910 00 0.00 IMOD

ATOM 2794 N VAL 349 14.728 387 17.543 00 0.00 IMOD

ATOM 2795 CA VAL 349 14.856 -2.954 17.611 00 0.00 IMOD

ATOM 2796 C VAL 349 13.541 -2.484 18.146 00 0.00 IMOD

ATOM 2797 O VAL 349 12.673 3.323 18.362 00 0.00 IMOD

ATOM 2798 CB VAL 349 15.054 2.353 16.238 00 0.00 IMOD

ATOM 2799 CGl VAL 349 15.191 0.819 16.303 00 0.00 IMOD

ATOM 2800 CG2 VAL 349 16.252 -3 046 15.583 00 0.00 IMOD

ATOM 2801 N GLY 350 13.417 1.165 18.446 00 0.00 IMOD

ATOM 2802 CA GLY 350 12.257 0.422 18.891 00 0.00 IMOD

ATOM 2803 C GLY 350 11.027 1.279 18.949 00 0.00 IMOD

ATOM 2804 O GLY 350 10.907 185 19.752 1.00 0.00 IMOD

ATOM 2805 N SER 351 10.043 027 18.093 00 0.00 IMOD

ATOM 2806 CA SER 351 8 . 819 785 18.094 00 0.00 IMOD

ATOM 2807 C SER 351 8 . 109 595 19.383 00 0.00 IMOD

ATOM 2808 O SER 351 7 . 214 2.371 19.715 00 0.00 IMOD

ATOM 2809 CB SER 351 8 . 927 3.307 17.850 00 0.00 IMOD

ATOM 2810 OG SER 351 9 . 272 4.021 19.025 00 0.00 IMOD

ATOM 2811 N SER 352 8 . 476 0.548 20.140 00 0.00 IMOD

ATOM 2812 CA SER 352 7 . 757 0.317 21.349 00 0.00 IMOD

ATOM 2813 C SER 352 6 . 522 0.384 20.911 00 0.00 IMOD

ATOM 2814 O SER 352 6 . 553 1.153 19.954 00 0.00 IMOD

ATOM 2815 CB SER 352 8 . 503 0.585 22.348 00 0.00 IMOD

ATOM 2816 OG SER 352 7 . 720 0.763 23.517 00 0.00 IMOD

ATOM 2817 N SER 353 5 . 388 0.124 21.581 00 0.00 IMOD

ATOM 2818 CA SER 353 4 . 195 0.801 21.173 00 0.00 IMOD

ATOM 2819 C SER 353 4 . 238 2.166 21.777 00 0.00 IMOD

ATOM 2820 O SER 353 4 . 979 2.408 22.729 00 0.00 IMOD

ATOM 2821 CB SER 353 2 . 899 0.115 21.639 00 0.00 IMOD

ATOM 2822 OG SER 353 1 . 771 0.851 21.189 00 0.00 IMOD

ATOM 2823 N GLY 354 3 . 450 3.102 21.218 00 0.00 IMOD

ATOM 2824 CA GLY 354 3 . 425 4.431 21.750 1.00 0.00 IMOD

ATOM 2825 C GLY 354 2.895 4.329 23.136 1.00 0.00 IMOD

ATOM 2826 O GLY 354 3.399 4.972 24.055 1.00 0.00 IMOD

ATOM 2827 N HIS 355 1.850 3.501 23.323 1.00 0.00 IMOD

ATOM 2828 CA HIS 355 1.321 3.355 24.640 1.00 0.00 IMOD

ATOM 2829 C HIS 355 1.845 2.070 25.187 1.00 0.00 IMOD

ATOM 2830 O HIS 355 1.725 1.017 24.562 1.00 0.00 IMOD

ATOM 2831 CB HIS 355 -0.210 3.272 24.705 1.00 0.00 IMOD

ATOM 2832 CG HIS 355 -0.714 3.381 26.111 1.00 0.00 IMOD

ATOM 2833 NDl HIS 355 -0.653 2.369 27.041 1.00 0.00 IMOD

ATOM 2834 CD2 HIS 355 -1.291 4.438 26.748 1.00 0.00 IMOD

ATOM 2835 CEl HIS 355 -1.191 2.859 28.187 1.00 0.00 IMOD

ATOM 2836 NE2 HIS 355 -1.591 4.111 28.058 1.00 0.00 IMOD

ATOM 2837 N THR 356 2.472 2.140 26.373 1.00 0.00 IMOD

ATOM 2838 CA THR 356 2.976 0.966 27.015 1.00 0.00 IMOD

ATOM 2839 C THR 356 2.861 1.229 28.473 1.00 0.00 IMOD

ATOM 2840 O THR 356 2.546 2.345 28.883 1.00 0.00 IMOD

ATOM 2841 CB THR 356 4.425 0.699 26.735 1.00 0.00 IMOD

ATOM 2842 OGl THR 356 5.226 1.761 27.233 1.00 0.00 IMOD

ATOM 2843 CG2 THR 356 4.620 0.554 25.214 1.00 0.00 IMOD

TER 2844 THR 356 IMOD

MASTER 0 0 0 0 0 0 0 0 2843 1 0 IMOD

END IMOD

SEQUENCE LISTING

The following sequences are provided in the Sequence Listing:

5 SEQ. ID NO: 1 Human CXCRl protein (Hum_CXCRl) shown in Figures IA, 5, 19 and 20.

SEQ. ID NO: 2 Human CXCR2 protein (Hum_CXCR2) shown in Figures IA, 5, 19 and 20.

SEQ. ID NO: 3 Human CXCRl protein fragment (Hum_CXCRl) shown in Figure o 10.

SEQ. ID NO: 4 Human CXCR2 protein fragment (Hum_CXCR2) shown in Figure

10.

SEQ. ID NO: 5 Human CCRl protein fragment shown in Figure 16.

SEQ. ID NO: 6 Human CCR2 protein fragment shown in Figure 16. s SEQ. ID NO: 7 Human CCR3 protein fragment shown in Figure 16.

SEQ. ID NO: 8 Human CCR4 protein fragment shown in Figure 16.

SEQ. ID NO: 9 Human CCR5 protein fragment shown in Figure 16.

SEQ. ID NO: 10 Human CCR6 protein fragment shown in Figure 16.

SEQ. ID NO: 11 Human CCR7 protein fragment shown in Figure 16. o SEQ. ID NO: 12 Human CCR8 protein fragment shown in Figure 16.

SEQ. ID NO: 13 Human CCR9 protein fragment shown in Figure 16.

SEQ. ID NO: 14 Human CCRlO protein fragment shown in Figure 16.

SEQ. ID NO: 15 Human CCRl 1 protein fragment shown in Figure 16.

SEQ. ID NO: 16 Human CXCRl protein fragment shown in Figure 16. ₅ SEQ. ID NO: 17 Human CXCR2 protein fragment shown in Figure 16.

SEQ. ID NO: 18 Human CXCR3 protein fragment shown in Figure 16.

SEQ. ID NO: 19 Human CXCR4 protein fragment shown in Figure 16.

SEQ. ID NO: 20 Human CXCR5 protein fragment shown in Figure 16.

SEQ. ID NO: 21 Human CXCR6 protein fragment shown in Figure 16. 0 SEQ. ID NO: 22 Human CX3CR1 protein fragment shown in Figure 16.

SEQ. ID NO: 23 Human CXCRl protein fragment shown in Figure 18.

SEQ. ID NO: 24 Human CXCR2 protein fragment shown in Figure 18.

SEQ. ID NO: 25 Human CCR2 protein fragment shown in Figure 18.

SEQ. ID NO: 26 Human CX3CR1 protein fragment shown in Figure 18.

SEQ. ID NO: 27 Human CCR4 protein fragment shown in Figure 18.

SEQ. ID NO: 28 Human CCR5 protein fragment shown in Figure 18. SEQ. ID NO: 29 Human CCR7 protein fragment shown in Figure 18.

SEQ. ID NO: 30 Bovine rhodopsin protein (Bovine_Rho) shown in Figure 19.

SEQ. ID NO: 31 Human CCRl protein (CKRl) shown in Figure 19.

SEQ. ID NO: 32 Human CCR2 protein (CKR2) shown in Figure 19.

SEQ. ID NO: 33 Human CCR3 protein (CKR3) shown in Figures 19 and 20. SEQ. ID NO: 34 Human CCR4 protein (CKR4) shown in Figure 19.

SEQ. ID NO: 35 Human CCR5 protein (CKR5) shown in Figure 19.

SEQ. ID NO: 36 Human CCR6 protein shown in Figure 19.

SEQ. ID NO: 37 Human CCR7 protein shown in Figure 19.

SEQ. ID NO: 38 Human CCR8 protein (CKR8) shown in Figure 19. SEQ. ID NO: 39 Human CCR9 protein shown in Figure 19.

SEQ. ID NO: 40 Human CCRl 0 protein shown in Figure 19.

SEQ. ID NO: 41 Human CXCR3 protein shown in Figure 19.

SEQ. ID NO: 42 Human CXCR4 protein shown in Figure 19.

SEQ. ID NO: 43 Human CXCR5 protein shown in Figure 19. SEQ. ID NO: 44 Human CXCR6 protein shown in Figure 19.

SEQ. ID NO: 45 Human CX3CR1 protein shown in Figure 19.

SEQ. ID NO: 46 Human XCRl protein shown in Figure 19.

SEQ. ID NO: 47 Human CCR2b protein shown in Figure 20.

SEQ. ID NO: 48 CXCRl AfIF mutagenesis primer shown in Table 1 (Example 4). SEQ. ID NO: 49 CXCRl AfIR mutagenesis primer shown in Table 1 (Example 4).

SEQ. ID NO: 50 CXCR2 AfIF mutagenesis primer shown in Table 1 (Example 4).

SEQ. ID NO: 51 CXCR2 AfIF mutagenesis primer shown in Table 1 (Example 4).

SEQ. ID NO: 52 CXCRl N31 IK F mutagenesis primer shown in Table 1 (Example

4). SEQ. ID NO: 53 CXCRl N31 IK R mutagenesis primer shown in Table 1 (Example

4).

SEQ. ID NO: 54 CXCRl F316L F mutagenesis primer shown in Table 1 (Example 4).

SEQ. ID NO: 55 CXCRl F316L R mutagenesis primer shown in Table 1 (Example

4).

SEQ. ID NO: 56 CXCR2 K320N F mutagenesis primer shown in Table 1 (Example

4).

SEQ. ID NO: 57 CXCR2 K320N R mutagenesis primer shown in Table 1 (Example

4).

SEQ. ID NO: 58 CXCRl N311K/F316L F mutagenesis primer shown in Table 1 (Example 4). SEQ. ID NO: 59 CXCRl N311K/F316L R mutagenesis primer shown in Table 1

10 (Example 4). SEQ. ID NO: 60 CXCR2 K320N/L325F F mutagenesis primer shown in Table 1 (Example 4). SEQ. ID NO: 61 CXCR2 K320N/L325F R mutagenesis primer shown in Table 1 (Example 4).

I ₅ SEQ. ID NO: 62 GST-CXCR2-C-tail fusion protein shown in Example 12.