FIELD OF THE INVENTION

The invention relates to assays for studying viral infection and/or effector particle entry into or effector cell fusion with cells. Typical effector particles would be pseudotyped viral particles, or wild-type viral particles. Furthermore the invention relates to selection of cells resistant to infection and to identification of inhibitors of infection/entry.

BACKGROUND TO THE INVENTION

Viral infections are a continuing threat to health throughout the world, in particular human health. The number of casualties for human immunodeficiency virus (HIV) alone was three million in 2003, and the number of casualties for hepatitis exceeded one million. Furthermore, new viral species such as the avian flu virus (often referred to as "bird flu") continue to be identified and can become extremely dangerous for other species such as humans.

There is a clear need for tools for the study of these viruses, and in particular for the assay of potential modulators of viral entry and infection.

Existing viral infection assays are based on the expression of a reporter gene upon viral infection. For example, so-called LTR-driven reporter genes have been established to monitor HIV infections. In such a prior art system, a gene encoding a fluorophore such as green fluorescent protein (GFP) is arranged to be expressed in a cell upon infection with HIV. The assay read-out is fluorescence of said GFP. One of the problems with this system is that positive signal is coupled to infection and not to inhibition.

Thus, known assays for the inhibition of viral infections couple a positive readout (e.g. a fluorescence signal) to the infection itself and not to its inhibition. These systems are based on the expression of a reporter gene (e.g. gfp) within the host cell upon viral cell entry. When screening for potential inhibitors of viral infection, viral particles and host cells are incubated in presence of drug candidate(s). Subsequently, the reporter gene expression (e.g. fluorescence) is determined. A decreased signal in a given sample (in comparison to the control sample without any drug) should therefore result from a potent inhibitor of viral cell entry. However, a drug candidate that inhibits the reporter gene expression (e.g. by killing the host cell) rather than viral cell entry will inevitably be selected as a false positive in prior art systems. Furthermore, adverse side effects of the drug candidate on the host cell cause similar problems.

Adelson et al (Antimicrob Agents and Chemotherapy 2003 pages 501-508) disclose the development of a virus cell based assay for studying novel compounds against HTVl. The systems disclosed in this publication involve using established replication deficient HTV based vectors. These vectors are equipped with reporter genes such as GFP. The assays are partly conducted in producer cell lines and partly conducted in packaging cell lines. The processing and life cycle of these viral vectors are monitored within these different cellular contexts. All of the reporting and readout of these assays is based on reporter genes such as GFP which are carried on the viral vectors. Compounds which switch off the reporter genes are considered interesting. Clearly, these assays are not capable of distinguishing between generally cytotoxic compounds and those which have a specific effect on the viral life cycle. The cell lines used in these methods do not express reporter genes.

US 6,884,576 discloses methods of monitoring HIV drug resistance. This system is founded upon the use of recombinant cells comprising reporter gene whose expression is regulated by proteins specific to HIV viruses which are expressed by the genome of an HTV virus upon infection of the recombinant cell by that virus. Regulation of the expression of this reporter gene is discussed in column 9 of US 6,884,576. It is explained there that the regulatory protein responsible for modulating the expression of the reporter gene may be an HIV transactivator, HIV accessory protein, HIV structural protein or HIV enzymatic protein. Examples of these different possibilities are given.

Thus, US 6,884,576 appears to be primarily concerned with utilising viral effects on particular promoters in order to operate the assays. Dong's system couples expression of the reporter to infection, thereby producing a positive readout when a virus infects the cell. The assays described by Dong require viral replication, so interference with any aspect of the viral life cycle may result in a positive signal in this system. Lastly, Dong's system cannot distinguish non-infection related events (such as loss of the viral receptor) and is thus prone to selection of false positives on this account.

Siegert et al. (2005 AIDS Res. and Therapy vol. 2 p. 7) disclose assessment of HIV-I entry inhibitors using MLV/HIV-1 pseudotyped vectors. They disclose MLV particles pseudotyped with HIV-I env protein and bearing a retroviral vector genome encoding green fluorescent protein (GFP). Again, this system is based on the principle that successful infection leads to expression of GFP from the incoming viral genome, so that inhibition of infection leads to lack of signal. This system suffers from the problem that inhibition of any aspect of the signalling system itself will cause a 'false positive' readout.

WO 2006/082385 discloses an assay for viral inhibitors wherein inhibition of infection is coupled to a positive signal. The assay is based on the generation of a steady-state signal by a reporter gene in the absence of virus infection. Upon viral entry, the reporter gene is downregulated, for instance by (a) shRNA encoded by the viral particle suppressing reporter gene mRNA or (b) by suppression of the promoter controlling the reporter gene on viral entry (e.g. by fusing the reporter gene to CD4, which is downregulated on viral entry). Agents which inhibit viral entry are therefore identified as those which prevent or reduce downregulation of the reporter gene.

An advantage of the assay of WO 2006/082385 is that it reduces the number of false positive inhibitors identified, since any non-specific reductions in the signal (for instance through toxicity of the agent on the cells) will not be identified as being indicative of inhibition of viral entry. On the other hand, this method requires the construction of a system wherein the reporter gene is specifically downregulated on viral entry. For instance, the viral particles need to be modified to encode an shRNA specific for the reporter gene or the reporter gene can be fused to a gene which is known to be downregulated on viral entry (e.g. CD4). A further issue is that, even in the absence of reporter gene activity, a signal can sometimes be produced by nonspecific conversion of the reporter substrate by other cellular enzymes. This could potentially generate false positive results. Accordingly, there is still a need for an antiviral assay method which further improves on the advantages provided by WO 2006/082385, and which is simple to construct and operate.

SUMMARY OF THE INVENTION

In one aspect, the present invention provides a method for determining antiviral activity of an agent, comprising providing an indicator cell which produces a signal; contacting the indicator cell with an effector particle or effector cell and the agent; and detecting the signal; wherein fusion of the effector particle or effector cell with the indicator cell results in death of the indicator cell.

In one embodiment, death of the indicator cell reduces the signal, such that antiviral activity of the agent is indicated by an elevated level of the signal in the presence of the agent compared to a control level of the signal in the absence of the agent.

Preferably the indicator cell expresses a reporter gene. The reporter gene may, for example, encode a product which is directed to the cell surface. Examples of preferred reporter genes include β-lactamase, tissue plasminogen activator (tPA) or β- galactosidase.

In one embodiment, the effector particle or effector cell comprises a nucleic acid sequence, expression of which in the indicator cell mediates death of the indicator cell. For example, the nucleic acid sequence may encode an enzyme, such as an en2yme which produces a product which is toxic to the indicator cell. One example of such an enzyme is thymidine kinase.

hi one embodiment, the nucleic acid sequence encodes an shRNA. The shRNA may, for example, inhibit expression of a selectable marker gene (such as an antibiotic resistance gene) expressed by the indicator cell. In one embodiment the antibiotic resistance gene provides resistance to puromycin.

In one embodiment step (b) of the method comprises (i) co-compartmentalising the indicator cell and the agent; (ii) contacting the indicator cell with the effector particle or effector cell; and (iii) incubating to allow any fusion of the effector particle or effector cell and indicator cell to take place. The co-compartmentalisation may be performed, for example, by forming one or more aqueous droplets comprising both the agent and the indicator cell. In one embodiment the aqueous droplets are part of a water-in-oil emulsion.

Preferably the effector particle comprises a virus.

In one embodiment the reporter gene encodes an enzyme or an active fragment thereof, and detecting the signal comprises (i) contacting the indicator cell with a substrate for the enzyme; (ii) incubating to allow the enzyme to act on the substrate; and (iii) detecting the presence of enzymatic product, presence of the product indicating survival of the indicator cell.

In one embodiment the indicator cell expresses an affinity tag. In this embodiment detecting the signal may comprise (i) contacting the indicator cell with an antibody capable of binding to the affinity tag; (ii) incubating to allow binding of said antibody to the affinity tag; and (iii) detecting the presence of antibody binding, presence of the antibody indicating survival of the indicator cell.

In an embodiment where the indicator cell is contacted with an effector particle, preferably entry of the effector particle into the indicator cell induces death of the indicator cell, i.e. fusion of the effector particle with the indicator cell leads to entry of the particle into the cell and subsequently cell death. In an embodiment where the indicator cell is contacted with an effector cell, preferably fusion of the effector cell with the indicator cell induces death of the indicator cell.

In one embodiment the effector cell expresses a viral protein, e.g. a viral envelope protein.

In another aspect, the present invention provides a method for identifying an antiviral agent, comprising determining antiviral activity of a plurality of candidate agents by a method as described above, and selecting an agent showing elevated antiviral activity.

In one embodiment an agent is selected if a signal from the indicator cell is above a predetermined level. Preferably each candidate agent is a recombinant polypeptide expressed by an indicator cell, or by a further cell type present in the assay sample (e.g. a hybridoma or B-cell).

In another aspect, the invention provides a method for the controlled killing of cells, comprising expressing a gene conferring resistance to an antibiotic in a cell; co- expressing an shRNA targeting said antibiotic resistance gene in the cell; and incubating said cell with the antibiotic, thereby killing the cell.

In a further aspect, the invention provides an isolated nucleic acid encoding an shRNA, wherein the shRNA targets an antibiotic resistance gene.

In one embodiment the antibiotic resistance gene is puromycin N-acetyltransferase. In this embodiment, the nucleic acid may comprise the sequence

CTGCAAGAACTCTTCCTCA (SEQ ID NO:5), or a sequence having at least 80% sequence identity thereto. The nucleic acid may further comprise a loop-encoding sequence, and optionally the sequence TGAGGAAGAGTTCTTGCAG (SEQ ID

NO: 6). In one embodiment the loop-encoding sequence comprises TTCAAGAGA (SEQ ID NO:7).

In a further aspect, the invention provides a vector comprising a nucleic acid as defined above.

In a further aspect, the invention provides a viral particle comprising a nucleic acid as defined above.

In a further aspect, the invention provides an isolated shRNA which downregulates (e.g. reduces or prevents) expression of an antibiotic resistance gene.

Preferably the shRNA downregulates puromycin N-acetyltransferase. In one embodiment the shRNA comprises the sequence CUGCAAGAACUCUUCCUCA (SEQ ID NO:2), or a sequence having at least 80% sequence identity thereto.

In embodiments of the present invention fusion of an effector particle or effector cell with an indicator cell, e.g. viral particle entry results in death of the indicator cell, thereby eliminating the signal. Coupling viral entry to cell death may be more easily achieved than specific downregulation of a reporter gene, since it does not require a specific link between the effector particle and the reporter gene. Moreover, cell death following viral entry may be more effective in eliminating the signal than specific downregulation of a reporter gene, since any non-specific generation of the signal by other cellular components is reduced. An inhibition of viral entry by an agent can therefore be reliably detected by maintenance of (i.e. prevention of a decrease in) the signal from the indicator cell in the presence of the effector particle and the agent. Furthermore, since viral particle entry leads to cell death, there is no need to sort cells showing a (e.g. fluorescent) signal from those which do not show the signal - the indicator cells either survive and produce the signal or are eliminated. Thus no further sorting step, e.g. using FACS, is required.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1: Coupling a positive fluorescence signal to the inhibition of viral cell entry. Human indicator cells displaying a membrane-bound and HA-tagged form of the tissue plasminogen activator (HA-tPA) convert plasminogen into plasmin, which in turn converts a non-fluorescent substrate into a fluorescent product. This reporter gene signal can be shut down upon viral cell-entry using different types of effector particles, (a) As described in WO 2006/082385, particles having packaged a vector encoding shRNA mediating the degradation of tPA-HA mRNA (α-tPA) enter the indicator cells and decrease the expression of the reporter gene, (b) In an embodiment of the present invention, particles having packaged a vector encoding Herpes Simplex Virus Thimidine Kinase (HSV-TK) enter the indicator cells and mediate cell death upon the addition of Ganciclovir (GCV). (c) In an embodiment of the present invention, particles having packaged a vector encoding shRNA targeting the puromycin resistance of the indicator cells (α-Puro) enter the indicator cells and mediate cell death upon the addition of Puromycin.

Figure 2: Fluorescence signals for the three different particle types shown in Figure 1. Indicator cells were incubated with the corresponding MLV(VSV-G)- derived particles in presence (white) and absence (black) of 25 μM AZT. Subsequently, the fluorescence signals (Y-axis) were determined using a plate reader. Figure 3 shows the nucleic acid sequence of Herpes simplex virus type 1 thymidine kinase gene (database accession no. EU814922).

Figure 4 shows the amino acid sequence of Herpes simplex virus type 1 thymidine kinase (database accession no. ACF21986).

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a universal, rapid and sensitive assay to screen and select compounds (e.g. small molecules, peptides, proteins, antibodies) for their ability to inhibit viral infections. It is based on the use of an indicator cell which provides a signal in the absence of viral infection, but which dies following fusion with an effector particle or effector cell (indicating viral entry), thereby abolishing the signal. Thus, the approach described herein couples a positive signal with the inhibition of an infection.

The positive signal viral inhibition assays (PSVIA) of the present invention represent a system that couples a positive readout signal to the inhibition of viral infection. Consequently, the probability of selection of false positives is significantly decreased and the system favours drug candidates (or concentrations thereof) that do not harm the host cells. In addition, the direct coupling of a positive signal to the desired property is highly advantageous for directed evolution strategies and high throughput screening (HTS). Moreover, cell death following viral entry is a particularly effective way of abolishing the signal and reduces the background signal level from cells where the agent does not prevent viral entry. There is also no need to sort fluorescent cells from non-fluorescent cells, since cells undergoing viral entry are removed by cell death.

The invention makes use of genetically engineered host cells (indicator cells) which produce a signal, for instance by expressing (preferably constitutively) a membrane- bound affinity tag and/or reporter enzyme. Consequently, these cells can be stained with antibodies and/or assayed for conversion of a non-fluorogenic substrate into a fluorogenic product. To assay the inhibition of viral cell entry, the indicator cells can be incubated with effector particles (e.g. viral particles) or effector cells. These may transduce gene(s) which result in cell death, for instance by leading to the production of a toxic product or abolishing antibiotic resistance. Thus, effector particle or effector cell fusion with the indicator cell (indicating viral entry) results in a decreased reporter gene signal, whereas non-transduced cells show the maximum signal intensity.

In a preferred embodiment, the current system is based on indicator cells expressing a membrane-bound and HA-tagged form of the human tissue plasminogen activator (tP A-HA). This enzyme converts plasminogen into plasmin which then converts a non-fluorogenic substrate into a fluorogenic product. As effector particles, MLV(VSV- G Env) pseudotyped particles are preferred.

It is an advantage of the invention that the assays have a decreased probability of selecting false positive inhibitors compared to prior art techniques. The invention enables easy determination of optimal inhibitor concentrations. The invention provides high flexibility, and allows selection of inhibitors of different viral species.

The invention has numerous safety features such as alleviating the need to work with wild-type virus, for example using pseudotyped particles. However, some embodiments involve the use of actual virus particles, which is advantageous in studying the behaviour of the most clinically relevant virus samples.

Since in preferred embodiments the invention can use non-replication competent retroviral pseudotyped particles instead of wild type virus, it offers further advantages over existing technology. Firstly, in this embodiment all work can be performed in low containment level laboratories (containment level 1 to 2) since live virus is not required.

Furthermore, the modular system of pseudotyping allows selection of inhibitors of different viral species. For that purpose, only the applied envelope protein has to be exchanged. Since the tropism of a retroviral particle is determined by its envelope protein (Env), exchanging the VSV-G protein against envelope proteins of other viral species (e.g. HIV, HCV, Coronaviruses associated with SARS, influenza) results in cell-entry assays for a variety of viruses. The applied indicator cell line can advantageously be the same for different viral species, so long as the corresponding receptor(s) axe expressed by that cell line (whether endogenously or by genetic modification of the cell line to provide receptor expression). Therefore, the assays of the invention can easily be modified for varied applications.

Antiviral activity

In one aspect the present invention provides a method for determining antiviral activity of an agent. Typically the method involves identifying the activity of an agent in inhibiting viral entry, i.e. the ability of the agent to prevent viral particles from fusing with and/or entering a cell (the indicator cell).

Agent

The agent is typically a candidate inhibitor compound such as a chemical entity which it is desired to test. The agent may be an organic compound or other chemical. The agent may be a compound, which is obtainable from or produced by any suitable source, whether natural or artificial.

In specific embodiments, the agent may be an amino acid molecule, a polypeptide, or a chemical derivative thereof, or a combination thereof. The agent may be a polynucleotide molecule. The agent may be an antibody. The agent may be designed or obtained from a library of compounds, which may comprise peptides, as well as other compounds, such as small organic molecules.

By way of example, the agent may be a natural substance, a biological macromolecule, or an extract made from biological materials such as bacteria, fungi, or animal

(particularly mammalian) cells or tissues, an organic or an inorganic molecule, a synthetic agent, a semi-synthetic agent, a structural or functional mimetic, a peptide, a peptidomimetic, a derivatised agent, a peptide cleaved from a whole protein, or a peptide synthesised synthetically (such as using a peptide synthesiser or by recombinant techniques or combinations thereof).

Typically, the agent will be an organic compound. Typically, the organic compound will comprise two or more hydrocarbyl groups. Here, the term "hydrocarbyl group" means a group comprising at least C and H and may optionally comprise one or more other suitable substituents. Examples of such substituents may include halo-, alkoxy-, nitro-, alkyl groups, cyclic groups etc; substituent groups may be unbranched- or branched-chain. In addition to the possibility of the substituents being cyclic groups, a combination of substituents may form a cyclic group. If the hydrocarbyl group comprises more than one C then those carbons need not necessarily be linked to each other. For example, at least two of the carbons may be linked via a suitable element or group. Thus, the hydrocarbyl group may contain hetero atoms. Suitable hetero atoms will be apparent to those skilled in the art and include, for instance, sulphur, nitrogen and oxygen. For some applications, preferably the agent comprises at least one cyclic group. The cyclic group may be a polycyclic group, such as a non-fused polycyclic group.

Preferably the candidate inhibitor is a polypeptide. When the candidate inhibitor is a polymer such as a polynucleotide or a polypeptide, preferably the candidate inhibitor is produced by the indicator cell. This may be by use of an expression library encoding candidate inhibitors such as a peptide library. For instance, a gene capable of directing expression of a candidate inhibitor may be introduced into an indicator cell. Trasfection may be stable or transient, preferably stable. Alternatively, the candidate inhibitor is an antibody produced by single or multiple hybridoma or B -cells added to the assay sample.

Indicator cell

By "indicator cell" it is meant any type of cell which is capable of providing a detectable signal, e.g. as a read-out from the assay method. Typically the indicator cell is a eukaryotic cell, particularly a mammalian cell, more particularly a human cell. Preferred indicator cells are 293 EBNA T cells or HEK293T cells; preferably the indicator cells are derived from HEK293T cells. When the effector particle is a virus, preferably the indicator cells are derived from the natural host species of said virus. In one embodiment, the indicator cell may be an indicator cell as described in WO 2006/082385. The indicator cell may be, for example, a cell which expresses a receptor for an envelope protein displayed on the effector particle or effector cell surface, e.g. a cell which is susceptible to infection by the virus or effector particle. In other words, the indicator cell is typically capable of supporting fusion with the effector particle or effector cell, e.g. entry of the effector particle into the indicator cell. By "fusion" it is meant that the effector particle or effector cell can combine with or enter into the indicator cell, e.g. by viral particle entry into the indicator cell (fusion of the viral membrane with the host cell membrane) or by fusion of the effector cell and indicator cell membranes. Typically the effector particle penetrates the cell surface and delivers its nucleic acid to the inside of the cell in the usual manner, unless an inhibitor is present. To render a cell capable of supporting entry, the appropriate viral receptors/co-receptors may need to be supplied such as by transfection or transduction of constructs capable of directing their expression.

The indicator cell may produce any type of signal. Preferably the signal is indicative of survival and/or viability of the indicator cell. The signal may be an endogenous signal produced naturally by the cells, or the cells may be genetically modified (e.g. using recombinant DNA techniques) to produce the signal. Preferably, the signal is a fluorescent signal. In one embodiment, the indicator cell expresses a reporter gene, i.e. the signal is associated with reporter gene activity. The indicator cell may be produced by transfection, transformation or transduction of the reporter gene. The transfection may be transient or stable, preferably stable. Most preferably the indicator cell expresses a reporter gene which has stably integrated into the genome of the cell. The reporter gene may be assayed by any suitable means.

As used herein, the term 'reporter genes' has its normal meaning in the art, i.e. of a gene whose product can be readily detected, for example so as to derive information about the expression state of said gene. Typical reporter genes include fluorescent proteins or enzymes. A preferred reporter gene is β-lactamase (beta-lactamase), tissue plasminogen activator (tPA) or β-galactosidase which are all well known in the art; preferably the reporter is tPA. Preferably the reporter gene encodes an enzyme or active fragment thereof capable of converting a fluorogenic or chromogenic substrate to a fluorophore or chromophore whose presence can be detected thereby. The enzyme may be an intracellular enzyme or may be displayed on the cell surface. Alternatively, the enzyme may be released in soluble form (i.e. secreted) by the indicator cells.

Preferably the enzyme or fragment is displayed on the cell surface. This may be achieved by fusion to a cell surface protein such as CD4, or may be by incorporation (e.g. fusion) of a suitable signal sequence (e. g. that of Ig-K) and a membrane anchor such as a transmembrane domain e.g. PDGFR-TM. Preferably that part of the reporter gene product which mediates detection is extracellular. This enables easy access to reagents/substrates used for detection without having to propel them across the cell membrane.

In another embodiment, the indicator cell expresses a detectable marker such as an affinity tag (e.g. a peptide tag such as a hemagglutinin (HA) tag, myc tag, flag tag or any other suitable tag), typically on the cell surface, to facilitate its detection. A signal may be provided by detection of the marker.

In a preferred embodiment, the indicator cells express a membrane-bound and HA- tagged form of the human tissue plasminogen activator (tP A-HA).

In one embodiment, the indicator cell expresses (typically constitutively) a selectable marker gene. Selection markers are described in Kaufman, R. J., Meth. Enzymology

185:537 (1988) and in Maniatis, Molecular Biology: A Laboratory Manual, Cold

Spring Harbor Laboratory, N.Y., 1989; pgs 16.9-16.14. Resistance to cytotoxic or antibiotic drugs is the characteristic most frequently used as a selection marker.

Typically the presence of the selectable marker gene is essential to survival of the indicator cell in the presence of the cytotoxic or antibiotic drug. In such embodiments, viral entry may abolish or reduce activity of the selectable marker gene product, such that the indicator cell becomes susceptible to killing by the drug.

Preferably the selectable marker gene is an antibiotic resistance gene. Suitable selectable marker genes include, for example, those encoding dihydrofolate reductase, adenosine deaminase, glutamine synthase, puromycin N-acetyl-transferase, thymidine kinase, aminoglycoside phosphotransferase, hygromycin B phosphotransferase, P- glycoprotein (multiple drug resistance or MDRl), xanthine-guanine phosphoribosyl transferase or asparagine synthetase. Suitable cytotoxic compounds which result in cell death in the absence of one of the above selectable marker genes are well known. In these embodiments, the step of contacting the indicator cell with the effector particle and the agent is performed in the presence of a suitable cytotoxic compound.

For instance, in one embodiment the indicator cell constitutively expresses puromycin N-acetyl-transferase (PAC), which confers resistance to puromycin. In the absence of viral entry, the indicator cell will survive exposure to puromycin. However, if the effector particle comprises an shRNA which targets PAC mRNA, puromycin resistance is abolished on exposure to virus, unless a viral entry inhibitor is present. Thus indicator cells die on exposure to the effector particle and puromycin and the signal decreases. Where an effective viral inhibitor is present, puromycin resistance is preserved, the cells survive and signal is maintained. In an alternative embodiment, the indicator cell expresses dihydrofolate reductase and the cytotoxic compound is methotrexate.

Effector particle or effector cell

As used herein, the terms 'effector particles' and "effector cells" mean any particles or cells capable of emulating infection, transduction or cell entry by a pathogen. The particle or cell may be any particle or cell useful in the simulation or emulation of infection by a pathogen. Most preferably the particles or cells can carry a nucleic acid moiety and are capable of delivering this to the inside of an indicator cell, preferably by a mechanism similar to that of a pathogen such as a virus, preferably by a mechanism identical to that of a pathogen such as a virus. Preferably the particles are (or are derived from) viruses or virus like particles, preferably gamma-retroviruses or lentiviruses, preferably lentiviruses; preferably recombinant viruses; more preferably recombinant viruses pseudotyped with heterologous envelope protein(s). In one embodiment the effector particle comprises a virus, e.g. the virus is a recombinant virus, or the virus is a pseudotyped virus. In another embodiment, the virus is a wild-type virus, which offers the advantage of providing an assay closer to the biological situation.

In another embodiment an effector cell is used in place of an effector particle. An effector cell which fuses with an indicator cell can be used to mimic viral entry. For example, the effector cell may express a viral protein such as a viral envelope protein. On contact with an indicator cell expressing a corresponding viral receptor, the effector cell membrane fuses with the indicator cell, leading to death of the indicator cell (e.g. through introduction of a gene present in the effector cell). In another embodiment, the effector cell may express a viral receptor and the indicator cell expresses a corresponding viral envelope protein. Typically the effector cell is a recombinant cell, e.g. into which a gene encoding a viral envelope protein from a viral species of interest has been introduced.

Recombinant effector particles may be employed such as pseudotyped particles comprising a nucleic acid capable of inducing death of the indicator cell and displaying an envelope protein of a viral species of interest. Said envelope protein may be modified (e.g. C-terminally truncated) if desired. Pseudotyping and related techniques are well known in the art.

By using recombinant effector particles or effector cells, the assays of the invention can easily be modified for different viral species. Simply by exchanging the viral envelope protein expressed in the packaging cells (and subsequently displayed on the particles) or expressed by the effector cells, inhibitors against a variety of species can be selected. There is no need to alter the nature of the packaged nucleic acid element of the vector, nor to create a new reporter gene construct. Advantageously there is not even a requirement for species-specific indicator cells, as long as the corresponding viral receptors are expressed.

In one embodiment, the effector particle or effector cell encodes an shRNA, expression of which in the indicator cell leads to cell death. For instance, the shRNA may target a selectable marker gene, e.g. an antibiotic resistance gene expressed by the indicator cell. In one embodiment, the effector particle or effector cell encodes an shRNA against puromycin N-acetyl-transferase, which abolishes puromycin resistance in the indicator cell. The method may then comprise a further step of adding an antibiotic compound such as puromycin, leading to death of cells in which there is no inhibition of viral entry. Alternatively, the shRNA may target genes that are absolutely essential for cell survival (e.g. anabolic or metabolic enzymes).

Thus in one aspect the invention provides a method for the controlled killing of cells, comprising expressing a gene conferring resistance to an antibiotic in a cell; co- expressing an shRNA targeting said antibiotic resistance gene in the cell; and incubating said cell with the antibiotic, thereby killing the cell. This method may be used generally to control cell death in any cell type expressing an antibiotic resistance gene. Cells which it is not desired to select can be removed by abolishing the antibiotic resistance using an shRNA and adding an antibiotic compound, whereas cells in which the shRNA is not expressed survive, maintain antibiotic resistance and can be selected.

Appropriate shRNAs can be constructed using the sequences of selectable marker genes, e.g. antibiotic resistance genes, as available in public databases. For instance, the effector particles may comprise a vector (e.g. a DNA vector) encoding an shRNA against puromycin N-acetyl-transferase comprising the nucleotide sequence CTGCAAGAACTCTTCCTCA (SEQ ID NO:5), or a sequence showing at least 80% sequence identity thereto. The vector may comprise further control elements for expressing the shRNA in the indicator cell, such as a promoter, transcription terminator etc. as is well known in the art.

Preferably the shRNA comprises a target RNA binding region, a hairpin loop region and a terminal region complementary to the target RNA binding region. Thus where the shRNA targets N-acetyl-transferase, the vector preferably comprises SEQ ID

NO:5, a nucleotide sequence encoding a loop region, and a nucleotide sequence which is complementary to SEQ ID NO:5, i.e. TGAGGAAGAGTTCTTGCAG (SEQ ID

NO:6). The sequence encoding a loop region may be any sequence, provided it forms a loop in the encoded RNA (i.e. this region does not hybridise to itself or another region of the shRNA). The loop sequence may be of any length, although preferably the loop sequence has a length of less than 50 nucleotides, e.g. 5 to 50 nucleotides, more preferably 5 to 25 nucleotides, most preferably 5 to 15 nucleotides. In one embodiment a sequence in the vector encoding the loop region comprises the sequence TTCAAGAGA (SEQ ID NO:7).

Thus in a preferred embodiment the vector comprises the sequence CTGCAAGAACTCTTCCTCATTCAAGAGATGAGGAAGAGTTCTTGCAG (SEQ ID NO:1), or a sequence showing at least 80% sequence identity thereto.

shRNA sequences which are encoded by the above DNA sequences are described in Example 1 and defined in SEQ ID NO:s 2 to 4. The invention also encompasses vector and shRNAs comprising sequences showing at least 80%, at least 90%, at least

95%, at least 97%, or at least 99% sequence identity to any one of SEQ ID NO:s 1 to

7, particularly preferably sequences showing one of the above degrees of sequence identity to one of SEQ ID NO:s 1 to 7 excluding any nucleotides therein forming the hairpin loop. Percentage sequence identity may be calculated by standard sequence alignment and comparison tools.

In another embodiment, the effector particle or effector cell encodes a product which is itself toxic to the indicator cell, or which acts on a further compound to produce a toxic product. For instance, in one embodiment the effector particle or effector cell encodes an enzyme, and the enzyme converts a non-toxic substrate (or prodrug) to a toxic product. In this embodiment, viral entry leads to expression of the enzyme and consequent production of the toxic product in the indicator cell. Thus in the absence of an effective inhibitor of viral entry the indicator cell dies and the signal is lost.

One example of such an enzyme is thymidine kinase of herpes simplex virus (HSV- TK). The HSV-TK gene specifically converts a nucleoside analog (ganciclovir) into a toxic intermediate and causes death of the host cell. Additional examples are thymidine kinase of varicella zoster virus (VZV-TK) and the bacterial gene cytosine deaminase, which can convert 5-fluorocytosine to the highly toxic compound 5- fluorouracil. Alternative prodrugs to ganciclovir include acyclovir and FIAU [l-(2- deoxy-2-fluoro-beta-D-arabinofuranosyl)-5-iodouracil], and 6-methoxypurine arabinoside for VZV-TK. In these embodiments, the step of contacting the indicator cell with the effector particle or effector cell and the agent is performed in the prescence of the non-toxic substrate (prodrug). Cells which do not undergo viral entry (e.g. due to the presence of a viral entry inhibitor) do not produce the toxic intermediate and consequently survive, maintaining the reporter signal.

In general, death of the indicator cell may result by any mechanism, e.g. either by necrosis or by apoptosis. Thus in one embodiment the effector particle or effector cell may encode a gene product which induces apoptosis in the indicator cell. For example, the effector particle or effector cell may encode one or more proteins involved in the apoptosis pathway, e.g. Fas (Fas receptor), FasL (Fas ligand), FADD (Fas associated death domain protein), caspase 8, caspase 10, protein kinase R, p53, BAX (Bcl-2-associated X protein), BID (BH3 interacting domain death agonist), BAK (Bcl-2 homologous antagonist/killer), or BAD (Bcl-2-associated death promoter).

Contacting the indicator cell with an effector particle or effector cell and the agent

Typically the indicator cell is first contacted with the agent, and then the effector particle or effector cell is added. However, the indicator cell may be contacted with the effector particle or effector cell and the agent simultaneously. La some embodiments, the agent may be added to the indicator cell after the effector particle or effector cell, provided that the agent is added in time to influence viral entry into the indicator cell.

In one embodiment, the agent is co-compartmentalised with the indicator cell before contacting with the effector particle or effector cell. Co-compartmentalising preferably means that the elements are in the same aqueous phase such that they may contact one another. Co-compartmentalising may mean that the elements are within the actual cell e.g. when the candidate inhibitor is expressed by the indicator cell it may be regarded as being 'co-compartmentalised' with that cell. Preferably co-compartrnentalisation is by forming one or more aqeuous droplets comprising both the agent and the indicator cell. For some embodiments, co- compartmentalisation is preferably by forming one or more aqeuous droplets comprising the agent and the indicator cell and the effector particle or effector cell(s). Preferably the aqueous droplets are part of a water-in-oil emulsion.

In some embodiments, after the contacting step there may be an incubation step before detecting the signal. The incubation step is to allow for any entry to take place, if it is possible. Clearly, when an inhibitor is present entry will not be possible i.e. it will be inhibited. The incubation should be of suitable duration that when no inhibitor is present normal entry occurs and the expected cell death takes place. The time required for this will vary depending on the cell, effector particle or effector cell and/or reporter systems chosen. The precise time of incubation for a given system may be determined by conducting the assay without inhibitor over a time course and choosing the time at which entry has occurred and cell death has resulted.

Detecting a signal

In embodiments of the present invention, the assay read-out is provided by detecting a signal associated with the indicator cell. Presence of a signal is typically indicative of survival of the indicator cell, thus the signal level shows a negative correlation with viral entry. Agents which show relatively activity as viral entry inhibitors will prevent cell death and produce a corresponding high signal in the indicator cell with which they are contacted, ie. an antiviral agent will prevent a decrease in the signal associated with cell death due to viral entry.

Any suitable detection method, depending on the nature of the signal, may be used. For instance, where the indicator cell comprises a reporter gene encoding an enzyme, or an active fragment thereof, detection of the signal may comprise contacting the indicator cell with a substrate for the enzyme, incubating to allow the enzyme to act on the substrate, and detecting the presence of enzymatic product, presence of the product indicating reporter gene activity. The signal may comprise a fluorescent, luminescent or visible light signal. For instance, the indicator cell may express a reporter gene encoding a fluorophore or a chromophore or other entity capable of direct detection. In particular embodiments, detection may be by fluorescent resonance energy transfer (FRET), by change in fluorescence and/or absorbance, by abolition of fluorescence and/or absorbance or by generation/initiation of fluorescence and/or absorbance at the appropriate wavelengths. Preferably detection is by generation/initiation of fluorescence (or absorbance) wherein the substrate is non-fluorescent (or non-absorbent) but the cleaved product is fluorescent (or absorbent). In other words (or alternatively) detection may be by discernibly different fluorescence (or absorbance) spectra of substrate and product.

In another embodiment detection is by the generation of luminescence, wherein conversion of a substrate by the reporter gene product results in luminescence (e.g. oxidation of luciferin by luciferase).

In another embodiment wherein the indicator cell expresses a detectable marker (e.g. a peptide tag), detecting may involve contacting the indicator cell with an antibody capable of reacting with the marker. A signal associated with the indicator cell may be determined by detecting the presence of bound antibody on the indicator cell.

In one preferred embodiment the indicator cells are genetically engineered host cells that express (preferably constitutively) a membrane-bound affinity tag and/or reporter enzyme. Consequently, a signal can be detected in these cells by staining with antibodies and/or assaying for conversion of a non-fiuorogenic substrate into a fluorogenic product. Thus, viral entry results in cell death and a decreased signal, whereas inhibition of viral entry (by activity of the agent) leads to the maximum signal intensity.

In a preferred embodiment, the current system is based on indicator cells expressing a membrane-bound and HA-tagged form of the human tissue plasminogen activator (tP A-HA). This enzyme converts plasminogen into plasmin which then converts a non-fiuorogenic substrate into a fluorogenic product. Clearly in some embodiments the detection of tPA may be by its direct action on a chromogenic or fluorogenic substrate, rather than its action on plasmin and the subsequent action of plasmin on a chromogenic or fluorogenic substrate.

Applications

The invention finds application in many areas including high-throughput screens and directed evolution techniques, since it drastically reduces the selection of false positive compounds (compounds that bypass the selection criteria of a given infection assay but do not specifically inhibit infection). Furthermore, the present invention can advantageously be applied to different types, species or clades of virus. A further advantage is that pseudotyped particles can be used in the methods of the invention and therefore use of live or intact virus is advantageously avoided. This has another benefit in that high containment level work can be reduced or eliminated from the procedures, which improves safety and reduces the cost and administrative burden of the processes according to the present invention. Further applications and benefits are described herein.

The assays of the invention allow screening of drug candidates for inhibiting viral cell- entry and/or reverse transcription and/or integration into the host cell genome. In particular, the invention finds application in the screening of small molecules within microtitre plates or microfluidic devices (emulsions), and screening genetically- encoded libraries of peptides, shRNAs or antibodies making use of effector particle or effector cell mediated cell-death. In embodiments of the invention, there is no need for FACS sorting, since cells not producing a signal are removed by cell death. This application advantageously allows new drugs and also new drug targets to be identified.

Furthermore the invention may be used to detect virus or infectivity in a sample. In this embodiment, indicator cells according to the present invention would be contacted with a sample thought to comprise the virus of interest. The reporter gene in the indicator cells will remain On' (i.e. giving continuous readout) in the absence of infection, but would be lost upon infection due to cell death. Thus, if, following contact with the sample, the signal is lost then it would indicate that the sample is likely to have comprised the virus of interest. Since the loss of signal can in theory be mediated by different agents (e.g. also by cytotoxic compounds), in one embodiment a control sample with a specific inhibitor of the viral species of interest (the species to be detected) may be included. If this sample shows the signal, while in absence of the specific inhibitor the signal is lost, the test sample is likely to have comprised the virus of interest.

Assays of the invention

The present invention is based on genetically modified target cells (indicator cells which may comprise a stable cell line) expressing the viral receptor(s) of interest, together with any co-receptors which might be required for infection or entry. These cells may be genetically modified in the sense that they express a reporter gene, such as an affinity tag, a fluorogenic protein or an enzyme able to convert substrates into fluorogenic, chromogenic or luminometric products. Coupling this type of reporter signal to an inhibition of viral infection is accomplished by ensuring that cell death of the indicator cell (and thus loss of the reporter signal) occurs upon infection with the virus of interest.

Thus, the present invention provides a strategy to generate modular recombinant viral particles or effector cells (recombinant effector particles) allowing to screen for inhibitors of completely different viral species. For this purpose, gamma retrovirus e.g. murine leukaemia virus-derived (MLV-derived) or lentiviral (e.g. HIV-derived) particles may be generated which have packaged a vector encoding a product which results in cell death in the indicator cell line and can functionally incorporate or display a variety of different envelope proteins on their surface. The resulting pseudotype particles thus show the host range tropism that is mediated by the corresponding envelope protein and can be used instead of wildtype viruses within the inhibition assay. This not only has strong safety benefits, but also advantageously broadens the application range of the invention.

Thus in one aspect a compound library may be screened for the ability to inhibit the infection of CD4-positive cells with the human immunodeficiency virus (HIV). An appropriate indicator cell line is generated that stably expresses a reporter gene, the CD4-receptor and one or more of the required coreceptors (such as CXCR4, CCR5, etc.). These indicator cells are seeded in microtiter plates and incubated with HTV-I particles (ie. effector particles) in presence of different compounds in each well. Upon infection, the cell death of the indicator cell results, for instance due to expression of a product encoded by the virus. Consequently, only cells that have not been infected with HTV will survive and produce a signal from the reporter gene. Thus, wells that exhibit a positive reporter signal contain compounds that inhibit HIV infection. Variations and modifications of these assays will be apparent from the relevant sections of the description which explain individual parts of the assay in more detail.

The invention may be applied to any suitable viral system selected for study. Particularly preferred are HIV (e.g. with receptor: CD4 co-receptors: CXCR4, CCR5); Hepatitis C (HCV) ₅ Influenza and related species such as bird flu (cell entry via sialic acid receptors), or coronaviruses (cell entry via coronavirus receptors/aminopeptidases such as CEA family).

Assay formats

Microfluidic handling techniques, emulsion based droplet comparmentalisation and microtitre plate wells (such as 12, 24, 96 or 384-well format) are all useful formats for the assays of the present invention. These techniques are well known in the art. hi particular, reference is made to WO99/02671 and WOOO/40712 which both describe optical sorting methods of application to the methods described herein. The way in which the readout is collected and the optimal assay formats depend upon operator preferences. Factors to be taken into account may include the number of samples to be processed. For example, if sample numbers are small, it may be convenient to process them manually in a microtitre plate with manual pipetting; in this embodiment 'co- compartmentalisation' may refer to the elements being placed into the same microtitre well. However, where sample numbers are large, it may be more convenient to use an automated or semi-automated processing apparatus to conduct the screening and selection. These choices are well within the ordinary skill of the person working the invention. Reporters/Substrates/Readout

The reporter may be detected directly (e.g. by antibody based detection) or indirectly (e.g. by assay of reporter activity). Direct detection of reporter gene activity may be based on the gene activity such as detection of transcription, translation or direct detection of a gene product of the reporter gene. Indirect detection principally refers to assaying for activity of the gene product such as an enzymatic activity, e.g. by supplying a substrate and monitoring cleavage of same or by some similar technique.

In choosing a reporter enzyme, preferably it should mediate a rapid turnover of substrate (ie. have high Kcat/Krn). Preferably is should be an enzyme for which fluorogenic, luminogenic and/or chromogenic substrate(s) are available.

Preferably the reporter enzyme or fragment thereof is displayed on the cell surface. Preferably the reporter gene comprises a surface targeting element such as a transmembrane domain to achieve cell surface localization of the reporter enzyme or fragment thereof. Preferred cell surface targeting element is a single-spanning membrane protein, or a single spanning domain from a multiple membrane-spanning protein. For example, the reporter gene could be fused to the SU domain of retroviral env protein(s), preferably N-terminally fused thereto. Expression of the reporter gene should preferably be driven by a strong promoter.

It will be noted that when the reporter enzyme activity is located at the cell surface, that the substrate for conversion to a chromogenic or fluorogenic product will also need to be available at the cell surface. Typically this is achieved by presenting the substrate extracellularly so that it will be able to be acted upon by the cell surface localized reporter enzyme activity. In these embodiments, it will be apparent that droplet co-compartmentalisation is advantageous in that it allows a pool of cleaved substrate to be detected in the extracellular part of the droplet and thereby associates that with the cell in the droplet. Thus, droplet format is advantageously used when selecting cells on the basis of extracellular readout. Alternatively non-transduced indicator cells (e.g. expressing a genetically-encoded inhibitor of viral cell-entry) can be selected directly by effector particle-mediated cell death, avoiding the need for cell sorting e.g. by FACS). The skilled worker may easily choose the format which best suits their application of the invention.

As is described herein, it will be noted that some reporter genes may give readout via intermediate steps. For example, when the reporter is tPA, then the readout is preferably via the action of tPA on plasminogen; this creates plasmin; the plasmin acts on the substrate such as HDLVK-Amc and this creates a fluorogenic product. Thus, when using multi-step readouts such as this, then each of the necessary elements must be provided to the indicator cells. In the case of tPA readout, this may involve supplying both plasminogen as well as HDLVK-Amc to the indicator cells to allow the readout to be produced.

Plasminogen may be obtained from Roche, Switzerland. The plasmin substrate HDLVK-Amc is preferably used and may be obtained from Bachem, Switzerland (see examples). Alternatively, other plasmin substrates such as Rhodamine 110- bisCBZ-L-Phe-L-Arg from Molecular Probes, USA may be used.

When the reporter gene is β-lactamase ₅ preferably Fluorocillin™ Green 495/525 β- lactamase substrate (Molecular Probes) is the substrate.

When the reporter gene is β-galactosidase, preferably Fluorescein-di-beta-D- galactopyranoside (FDG) is the substrate.

When the reporter gene is luciferase, preferably luciferin is the substrate.

The invention finds application in many different selection strategies. In one embodiment, the invention may be used in selection of genetically-encoded inhibitors such as antibodies or peptides inhibiting viral infection. These applications benefit from effector-particle mediated cell death, preferably based on the expression of an shRNA mediating the downregulation of a gene conferring resistance to an antibiotic.

The principle of the inhibition assay is that inhibition of viral cell entry or early steps of the viral life cycle (such as reverse transcription or integration into the host cell genome) by a candidate inhibitor means that the indicator cell survives and maintains readout such as fluorescence due to product being produced from the substrate by the action of the cell surface reporter such as tPA. Inhibition of these early steps of the viral life cycle is therapeutically superior to inhibition of later steps like viral assembly or budding since at that late stage the viral genome has already integrated into the host cell genome and is thus inevitably conserved. An alternative readout method is to stain the cells with antibodies raised against a reporter gene.

Where the candidate substance is a non-potent inhibitor and where there is no significant inhibition of infection, the indicator cell dies following viral entry and consequently a signal (e.g. a fluorescent signal) from a reporter such as tPA on the cell surface is reduced.

In another embodiment, the invention may be used to determine optimal concentrations of a given inhibitor. When effector particles or effector cells and indicator cells are co-compartmentalized at different concentrations of the inhibitor, the resulting fluorescence will correlate with the number of transduction events. An advantage of the present invention is that within the present assays adverse side effects of the inhibitor on the cells will cause a decreased fluorescence signal. This is due to the fact that only viable cells will express the reporter gene and thus generate a positive readout signal.

In a broad aspect the invention relates to techniques to select antibodies, peptides and small molecules inhibiting viral infection such as HTV ₅ HCV or influenza infections. Preferably said techniques are compartmentalization-based. Advantageously signal to noise ratios enhance the selection procedures of the invention.

In one embodiment, the invention may be used in selection of antibodies or peptides inhibiting HIV-infection. The selection procedure itself focuses on the enzymatic conversion of fluorogenic or chromogenic substrates or the effector particle or effector cell mediated death of the indicator cells.

In another embodiment, the invention may be used in screening of small molecules for activity in inhibiting HIV-infection. These applications require positive sorting signal which is advantageously provided by the present invention. Further Aspects

The methods of the invention are often described in connection with inhibitors of viral entry. Clearly, the read-out used is preferably a decrease in a signal produced by the indicator cell as a result of cell death triggered by viral entry. However, it is important to note that said cell death may be triggered by viral entry, or may be triggered by inhibition of early steps of the viral life cycle such as inhibition of reverse transcription, or integration into the host cell genome. The skilled addressee can easily adapt the techniques described herein to more closely connect them to such a downstream event if is it desired.

It is an advantage of the invention that use of wild type virus can be avoided. Indeed, for any given virus being studied, it is possible to eliminate all elements except the env protein of that virus using the assays of the present invention. The env protein will typically be required for pseudotyping of the effector particles being used in place of the wild type virus. This provides benefits such as safety and cost in being able to conduct the assays in low level containment facilities when avoiding wild type virus. Furthermore, it enables poorly characterized virus to be studied, since by using pseudotyped effector particles no knowledge about virally mediated downregulation of cellular proteins is required.

It is an advantage of the invention that signal amplification is enabled. Whether using direct or indirect detection of reporter gene activity, amplification can be easily introduced. For example, using direct detection antibody sandwich techniques can be used to amplify the signal, and when using these or indirect techniques involving enzymatic activity, each enzyme molecule can repeatedly turn over substrate molecules to provide more signal. This is in contrast to prior art techniques such as GFP expression where a strict 1 : 1 stoichiometry is inherent to the signal system.

It is an advantage of the invention that the readout is advantageously at the cell surface. In this way, substrate does not need to be able to penetrate the cell, but can be easily supplied extracellularly. The invention is now described by way of examples, which are not intended to limit the scope of the invention but rather are intended to illustrate ways in which the invention can be worked.

Example 1

Coupling inhibition of viral cell entry with a positive fluorescence signal

Most cell-based assays for the inhibition of viral infections couple a positive readout signal (e.g. fluorescence) to the infection itself and not to its inhibition. When performing drug screens candidates decreasing the readout signal (compared to a sample without the drug) are therefore considered as putative inhibitors. However, these screens are prone for the selection of false positives, since for example killing of the host cell instead of inhibiting viral cell-entry results in the same readout signal.

This example describes a system that couples a positive readout to the inhibition of viral transduction. Consequently, the system favours drug candidates (and concentrations thereof) that do not harm the host cells and the number of false positives is greatly decreased. The assay makes use of genetically engineered host cells (indicator cells) constitutively expressing a membrane-bound reporter enzyme (tPA) capable of converting a non-fluorescent substrate into a fluorescent product. To assay the inhibition of viral cell-entry, the indicator cells are incubated with viral particles (effector particles) transducing a gene which leads to death of the indicator cells. Thus, viral transduction results in a decreased reporter gene signal, whereas non- transduced cells show the maximum signal intensity. The assay allows z-factors of >0.9, takes cytotoxic side effects into account and can be used for high throughput screening of inhibitors of clinically-relevant viral species such as HIV.

In this example using engineered host cells (indicator cells) constitutively express a reporter gene. Infection by engineered viral particles (effector particles) leads to death of the indicator cells and loss of the reporter gene signal. To implement this idea we generated HEK293T cell-derived indicator cells stably expressing a membrane-bound and HA-tagged form of the human tissue plasminogen activator (tP A-HA). This enzyme can be used to convert plasminogen into plasmin which itself allows the conversion of a non-fluororescent substrate (HD VLK- Amc, Bachem, Switzerland) into a fluorescent product (Fig. 1). Furthermore, the HA-tag can be used for antibody-based stainings as an alternative readout system. The assay of this example, including the indicator cells, fluorescence detection and readout, may in general be performed as described in WO 2006/082385. However, the present invention differs from WO 2006/082385 in terms of the effector particles and how the reporter gene signal is decreased. Furthermore, effector particle mediated cell death as part of the current invention can be used to directly select non-transduced cells (potentially expressing a genetically-encoded inhibitor) without the need for any physical sorting procedure such as FACS.

As a first model for effector particles, we chose murine leukemia virus particles pseudotyped with the G-protein of vesicular stomatitis virus (MLV(VSV-G Env)), capable of entering HEK293T-derived cells at high efficiencies. To achieve a decrease in the reporter gene signal upon cell-entry, we compared three different approaches based on RNA interference (RNAi, REF3) and genes which induce cell death (Fig. 1).

First, we generated effector particles having packaged a vector encoding short hairpin RNA (shRNA) mediating the degradation of tPA-HA rnRNA (α-tPA particles). This way, the reporter enzyme is downregulated upon viral entry into the indicator cells, but viral entry does not result in cell death. This approach adopts the method described in WO 2006/082385.

Second, in an embodiment according to the present invention, we produced effector particles transducing a gene (Herpes-Simplex Virus Thymidine Kinase; HSV-TK particles) which, upon addition of the corresponding substrate (Ganciclovir), mediates cell death of the indicator cells. Hence the reporter gene activity is eliminated as well as non-specific conversion of the fluorogenic substrate due to other cellular enzymes. Effector particles were produced comprising a HSV-TK sequence as disclosed in database accession nos. EU814922 and ACF21986, see Figures 3 and 4 (SEQ ID NO:s 8 and 9). Thirdly, in an embodiment according to the present invention, we also generated effector particles having packaged a vector encoding shRNA abolishing the puromycin resistance of the indicator cells (α-Puro particles). Hence in the presence of puromycin the indicator cells are killed efficiently. The vector comprises the nucleotide sequence 5'- CTGCAAGAACTCTTCCTCATTCAAGAGATGAGGAAGAGTTCTTGCAG-S' (SEQ ID NO:1). This sequence encodes an shRNA targeting puromycin N- acetyltransferase (pac), thus abolishing the resistance to puromycin in the indicator cells. The encoded shRNA comprises a target RNA binding region (which hybridises to puromycin N-acetyltransferase mRNA) having the sequence 5'- CUGCAAGAACUCUUCCUCA -3' (SEQ ID NO:2) ₅ followed by a loop region having the sequence 5'-UUCAAGAGA-3' (SEQ ID NO:3) and a 3' terminal region complementary to the target RNA binding region, and having the sequence 5'- UGAGGAAGAGUUCUUGC AG-3' (SEQ ID NO:4).

AU three types of effector particles mediate a decreased reporter gene signal upon cell- entry, whereas non-transduced cells show the maximum signal intensity. However, in embodiments according to the present invention, the background signal is reduced and the signal-to-noise ratio is improved.

To demonstrate this, we incubated indicator cells with the three types of effector particles in the presence and absence of 25 μM AZT. This well-characterized inhibitor of reverse transcriptase efficiently inhibits transduction in the corresponding samples. During the following days we then performed the fluorescence readout. For each type of effector particle, we determined the optimal time point (resulting in the highest difference of the fluorescence signal for samples with and without AZT) for the fluorescence readout and the addition of compounds (Ganciclovir, Puromycin) mediating cell death (only for HSV-TK particles and α-Puro particles). Subsequently the best results for each kind of effector particles were compared to determine the most powerful assay system (Fig. 2).

While all types of particles mediated a high fluorescence signal in presence of AZT and a low fluorescence signal in absence of AZT ₅ the signal to background ratio (the quotient of those two values) differed significantly: Using α-tPA particles, the ratio was just 4.9, whereas for HSV-TK particles and α-Puro particles values of 9.3 and 16.5 were obtained, respectively. To analyse the power of each assay system we also determined the z-factor (Table 1), a statistical parameter characterizing the power of a high throughput assay. It is defined as:

Z - factor = 1 -

σ = standard deviation

μ = mean signal

X _(p) = parameter of the positive control

X _(n) = parameter of the negative control

Assays having a z-factor between 0.5—1 are considered as excellent assays (with 1 being the theoretical optimum). For the three different particle types we obtained z- factors of 0.5 (α-tPA), 0.8 (HSV-TK) and 0.9 (α-Puro). Taken together this clearly shows that assays according to the present invention, wherein cell death results from viral entry, are most suitable for excellent signal to noise ratios and highly reproducible results.

Tablel: Characteristics of the different assays:

Example 2

Coupling inhibition of cell-cell fusion with a positive fluorescence signal The cell-entry of enveloped viruses (fusion of the viral membrane with the host cell membrane) can be mimicked by performing cell-cell fusion (as reviewed by Mike Westby et al., 2005, Antiviral Research 67 121-140). In this case, cells expressing the envelope protein of the viral species of interest are co-cultivated with cells expressing the corresponding viral receptor(s). Upon contact of both cells, the viral envelope protein can then mediate membrane fusion after binding to the viral receptor (presented on the surface of the neighbouring cell). However, instead of fusing a viral membrane with the host cell membrane, two cellular membranes are fused.

In this example the present invention is employed for performing viral inhibition assays based on cell-cell fusion. The method may be performed largely as described in

Example 1, e.g. using indicator cells expressing the receptor for the viral species of interest. However instead of using viral particles, in this example the indicator cells are co-cultivated with effector cells. These effector cells express the envelope protein of the viral species of interest (such as HTV Env) and a further gene (e.g. an shRNA abolishing puromycin resistance or a gene encoding HSV-TK) which leads to cell death of the indicator cell upon cell-cell fusion.

Hence upon cell-cell fusion (mimicking the fusion between the viral membrane and the host cell membrane), the reporter gene signal will be decreased in the same way as described for the use of effector particles. This example may also be performed using effector cells expressing the viral receptor and indicator cells expressing the viral envelope protein, instead of effector cells expressing the viral envelope protein and indicator cells expressing the viral receptor.

A fluorescence readout is then performed after the addition of different drug candidates to the samples, as described in Example 1, to monitor inhibitory effects of these compounds. A high fluorescence signal indicates a good inhibitor whereas a low fluorescence signal indicates a compound with no inhibitory effect or an adverse effect on the indicator cells.

Example 3 Selection of candidate inhibitors expressed in indicator cells

In this example, genetically encoded inhibitors such as antibodies or peptides are selected in a directed evolution approach. For this purpose, an indicator cell line expressing a library of inhibitors (candidate inhibitors of infection) is constructed. Effector particles are used that have packaged a vector encoding shRNA targeting puromycin N-acetyltransferase (pac).

For selection, single indicator cells and effector particles are co-compartmentalised and incubated to allow cell-entry of the effector particles. Subsequent to a time period sufficient for cell-entry and expression of the shRNA in the indicator cell, puromycin is added. In case of transduction/entry, the indicator cell dies due to becoming sensitive to puromycin. In contrast, if a particular candidate inhibitor variant prevents cell-entry of the effector particles, the indicator cell does not become sensitive to puromycin and survives.

This allows the operator to specifically select non-transduced cells. This can even be done after pooling the contents of the compartments, or optionally even after recultivating the cells.

Once the non-transduced cells are selected, the identity of the inhibitor(s) that prevented cell-entry is determined by sequencing the nucleic acid encoding the candidate inhibitor from the recovered non-transduced cells.

Each of the applications and patents mentioned in this document, and each document cited or referenced in each of the above applications and patents, including during the prosecution of each of the applications and patents ("application cited documents") and any manufacturer's instructions or catalogues for any products cited or mentioned in each of the applications and patents and in any of the application cited documents, are hereby incorporated herein by reference. Furthermore, all documents cited in this text, and all documents cited or referenced in documents cited in this text, and any manufacturer's instructions or catalogues for any products cited or mentioned in this text, are hereby incorporated herein by reference.

Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments and that many modifications and additions thereto may be made within the scope of the invention. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the claims. Furthermore, various combinations of the features of the following dependent claims can be made with the features of the independent claims without departing from the scope of the present invention.