KOVALCHUK, Nataliya (1/45 Burley Griffen Boulevard, Brompton, South Australia 5007, AU)
SMITH, Jessica, Anne (6 Muir Avenue, Parkholme, South Australia 5043, AU)
GRAINS RESEARCH & DEVELOPMENT CORPORATION (PO BOX 5367, Kingston, Australian Capital Territory 2064, AU)
LOPATO, Sergiy (14 Tokay Crescent, Morphett Vale, South Australia 5162, AU)
KOVALCHUK, Nataliya (1/45 Burley Griffen Boulevard, Brompton, South Australia 5007, AU)
SMITH, Jessica, Anne (6 Muir Avenue, Parkholme, South Australia 5043, AU)
THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:
1. An isolated nucleic acid molecule comprising:
(i) a nucleotide sequence defining a transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide sequence in the embryo and/or Embryo Surrounding Region (ESR) of a plant seed; or
(ii) a nucleotide sequence defining a functionally active fragment or variant of
(i)-
2. The nucleic acid molecule of claim 1 wherein the seed is a monocot plant seed.
3. The nucleic acid molecule of claim 1 wherein the seed is a cereal crop plant seed.
4. The nucleic acid molecule of claim 1 wherein the seed is a barley seed.
5. The nucleic acid molecule of claim 4 wherein the nucleotide sequence of interest is specifically or preferentially expressed in the embryo and/or ESR of the barley seed at least between 6 DAP and 48 DAP.
6. The nucleic acid molecule of claim 1 wherein the seed is a rice seed.
7. The nucleic acid molecule of claim 6 wherein the nucleotide sequence of interest is specifically or preferentially expressed in the embryo of the rice seed at least between 7 DAP and 69 DAP.
8. The nucleic acid molecule of claim 1 wherein the seed is a wheat seed.
9. The isolated nucleic acid molecule of any one of claims 1 to 8 wherein said transcriptional control sequence is derived from a gene which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 or a homolog thereof.
10. The nucleic acid molecule of claim 9 wherein said transcriptional control sequence is derived from a plant gene.
11. The nucleic acid molecule of claim 10 wherein the plant gene is a monocot plant gene.
12. The nucleic acid molecule of claim 10 wherein the plant gene is a cereal crop plant gene.
13. The nucleic acid molecule of claim 10 wherein said transcriptional control sequence is derived from a Triticum sp. gene.
14. The nucleic acid molecule of claim 13 wherein said transcriptional control sequence is derived from a Triticum durum gene.
15. The nucleic acid molecule of any one of claims 9 to 14 wherein said transcriptional control sequence is derived from a gene which comprises an open reading frame comprising the nucleotide sequence set forth in SEQ ID NO: 2.
16. The nucleic acid molecule of any one of claims 1 to 15 wherein the transcriptional control sequence comprises the nucleotide sequence set forth in SEQ ID NO: 3 or a functionally active fragment or variant thereof.
17. The nucleic acid molecule of claim 16 wherein the functionally active fragment comprises the nucleotide sequence set forth in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23.
18. The nucleic acid molecule of any one of claims 1 to 17 wherein the transcriptional control sequence comprises a cz ' s-element comprising the nucleotide sequence set forth in one or more of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28.
19. A nucleic acid construct comprising the isolated nucleic acid of any one of claims 1 to 18.
20. The nucleic acid construct of claim 19, wherein said nucleic acid construct further comprises a nucleotide sequence of interest operably connected to the nucleic acid of any one of claims 1 to 18.
21. The nucleic acid construct of claim 20, wherein the nucleotide sequence of interest is heterologous with respect to the nucleic acid of any one of claims 1 to 18.
22. The nucleic acid construct of any one of claims 19 to 21 wherein the nucleic acid construct further comprises a nucleotide sequence defining a transcription terminator.
23. The nucleic acid construct of any one of claims 19 to 22 wherein the nucleic acid construct comprises an expression cassette comprising the structure:
( [N]w - TCS - [N]χ - SoI - [N] 7 - TT - [N]z )
wherein:
[N]w comprises one or more nucleotide residues, or is absent;
TCS comprises a nucleic acid of any one of claims 1 to 18; [N]χ comprises one or more nucleotide residues, or is absent;
SoI comprises a nucleotide sequence of interest which encodes an mRNA or non- translated RNA, wherein the nucleotide sequence, SoI, is operably connected to TCS; [N] y comprises one or more nucleotide residues, or is absent; TT comprises a nucleotide sequence defining a transcription terminator; [N]z comprises one or more nucleotide residues, or is absent.
24. A genetically modified cell comprising the nucleic add construct of any one of claims 19 to 23; and/or a cell comprising a genomically integrated form of said construct.
25. The cell of claim 24 wherein the cell is a plant cell.
26. The cell of claim 25 wherein the cell is a monocotyledonous plant cell.
27. The cell of claim 25 wherein the cell is a cereal crop plant cell.
28. The cell of claim 25 wherein the cell is a barley cell.
29. The cell of claim 25 wherein the cell is a rice cell.
30. The cell of claim 25 wherein the cell is a wheat cell.
31. A multicellular structure comprising one or more cells of any one of claims 24 to 30.
32. The multicellular structure of claim 31 wherein the multicellular structure comprises a plant or a part, organ or tissue thereof.
33. The multicellular structure of claim 32 wherein said multicellular structure comprises a plant seed or a part thereof.
34. The multicellular structure of claim 33 wherein the level, rate and/or pattern of expression of at least one nucleotide sequence is altered in the embryo and/or ESR in said seed relative to the wild type form of said plant seed.
35. The multicellular structure of any one of claims 32 to 34 wherein the plant is a monocot plant.
36. The multicellular structure of claim 35 wherein the monocot plant is a cereal crop plant.
37. The multicellular structure of claim 35 wherein the plant is a barley plant.
38. The multicellular structure of claim 37 wherein a nucleotide sequence of interest is specifically or preferentially expressed in the embryo and/or ESR of the barley seed at least between 6 DAP and 48 DAP.
39. The multicellular structure of claim 35 wherein the plant is a rice plant.
40. The multicellular structure of claim 39 wherein a nucleotide sequence of interest is specifically or preferentially expressed in the embryo of the rice seed at least between 7 DAP and 69 DAP.
41. The multicellular structure of claim 35 wherein the plant is a wheat plant.
42. A method for specifically or preferentially expressing a nucleotide sequence of interest in an embryo and/or ESR in a plant seed, the method comprising effecting transcription of the nucleotide sequence of interest in a plant under the transcriptional control of the nucleic add of any one of claims 1 to 18.
43. The method of claim 42 wherein the nucleotide sequence of interest is heterologous with respect to said transcriptional control sequence.
44. The method of claim 42 wherein the plant is a monocotyledonous plant.
45. The method of claim 42 wherein the plant is a cereal crop plant.
46. The method of claim 42 wherein the plant is a barley plant.
47. The method of claim 46 wherein the nucleotide sequence of interest is specifically or preferentially expressed in the embryo and/or ESR of a barley seed at least between 6 DAP and 48 DAP.
48. The method of claim 42 wherein the plant is a rice plant.
49. The method of claim 48 wherein the nucleotide sequence of interest is specifically or preferentially expressed in the embryo of a rice seed at least between 7 DAP and 69 DAP.
50. The method of claim 42 wherein the plant is a wheat plant.
51. An isolated nucleic acid selected from the list consisting of:
(i) a nucleic acid comprising the nucleotide sequence set forth in SEQ ID
NO: 3; (ii) a nucleic acid comprising a nucleotide sequence which is at least 50% identical to the nucleotide sequence mentioned in (i); (iii) a nucleic acid which hybridizes to the nucleic acid mentioned in (i) under stringent conditions;
(iv) a nucleic acid comprising a nucleotide sequence which is the complement or reverse complement of any one of (i), (ii) or (iii); and
(v) a fragment of any of (i), (ii), (iii) or (iv).
52. A nucleic acid construct comprising the nucleic acid of claim 51.
53. A genetically modified cell comprising the construct of claim 52; and/or a cell comprising a genomically integrated form of said construct.
54. A multicellular structure comprising a cell of claim 53. |
Seed specific expression in plants
PRIORITY CLAIM
The present application claims priority to Australian provisional patent application 2008900432, the contents of which is hereby incorporated by reference.
FIELD OF THE INVENTION
The present invention relates generally to transcriptional control sequences for effecting expression of a nucleotide sequence of interest in a plant. More particularly, the present invention relates to transcriptional control sequences that direct specific or preferential expression of an operably connected nucleotide sequence of interest in a plant embryo and/or embryo surrounding region (ESR) in a plant seed.
BACKGROUND OF THE INVENTION
The primary emphasis in genetic modification has been directed to prokaryotes and mammalian cells. For a variety of reasons, plants have proven more intransigent than other eukaryotic cells to genetically manipulate. However, in many instances, it is desirable to effect transcription of an introduced nucleotide sequence of interest in a plant.
Expression of a DNA sequence in a plant is dependent, in part, upon the presence of an operably linked transcriptional control sequence, such as a promoter or enhancer, which is functional within the plant. The transcriptional control sequence determines when and where within the plant the DNA sequence is expressed. For example, where continuous expression is desired throughout the cells of a plant, constitutive promoters are utilised. In contrast, where gene expression in response to a stimulus is desired, an inducible promoter may be used. Where expression in specific tissues or organs is
desired, a tissue-specific promoter may be used.
Accordingly, there is a substantial interest in identifying transcriptional control sequences, such as promoters or enhancers, which are active in plants. Frequently, it is also desirable to specifically or preferentially direct transcription in particular plant organs, tissues or cell types, or at particular developmental stages of the plant. Thus, isolation and characterisation of transcriptional control sequences, which can serve as regulatory regions for the expression of nucleotide sequences of interest in particular cell, tissues or organs of a plant, would be desirable for use in the genetic manipulation of plants.
Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country.
SUMMARY OF THE INVENTION
The present invention is predicated, in part, on the identification and functional characterisation of transcriptional control sequences which specifically or preferentially direct expression of an operably connected nucleotide sequence in an embryo and/or embryo surrounding region in a plant seed.
In a first aspect, the present invention provides an isolated nucleic acid molecule comprising: (i) a nucleotide sequence defining a transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide sequence in an embryo and/or Embryo Surrounding Region (ESR) of a plant seed; or
(ii) a nucleotide sequence defining a functionally active fragment or variant of
(i)-
In some embodiments, the transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide sequence in the embryo and/or ESR of a plant seed is derived from a gene which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 or a homolog thereof.
In some embodiments, the transcriptional control sequence is derived from a gene which comprises an open reading frame comprising the nucleotide sequence set forth in SEQ ID NO: 2. In some embodiments, the transcriptional control sequence of the first aspect of the invention comprises the nucleotide sequence set forth in SEQ ID NO: 3 or a functionally active fragment or variant thereof.
In yet further embodiments, the transcriptional control sequence may also comprise the nucleotide sequence set forth in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23.
Furthermore, the transcriptional control sequence may also comprise a cz ' s-element that activates, enhances or otherwise modulates the activity and/or expression pattern of the transcriptional control sequence, the cz ' s-element comprising the nucleotide sequence set forth in one or more of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28.
In a second aspect, the present invention also provides a nucleic acid construct comprising the isolated nucleic acid molecule of the first aspect of the invention.
In a third aspect, the present invention provides a genetically modified cell comprising a nucleic acid construct of the second aspect of the invention or a genomically integrated form thereof.
In a fourth aspect, the present invention contemplates a multicellular structure
comprising one or more cells of the third aspect of the invention.
In a fifth aspect, the present invention provides a method for specifically or preferentially expressing a nucleotide sequence of interest in an embryo and/or ESR in a plant seed, the method comprising effecting transcription of the nucleotide sequence of interest in a plant under the transcriptional control of the nucleic acid of the first aspect of the invention.
In a sixth aspect, the present invention provides an isolated nucleic acid selected from the list consisting of:
(i) a nucleic acid comprising the nucleotide sequence set forth in SEQ ID
NO: 3; (ii) a nucleic acid comprising a nucleotide sequence which is at least 50% identical to the nucleotide sequence mentioned in (i); (iii) a nucleic acid which hybridizes to the nucleic acid mentioned in (i) under stringent conditions; (iv) a nucleic acid comprising a nucleotide sequence which is the complement or reverse complement of any one of (i), (ii) or (iii); and (v) a fragment of any of (i), (ii), (iii) or (iv).
In a seventh aspect, the present invention also provides a nucleic acid construct comprising the nucleic acid of the sixth aspect of the invention.
In an eighth aspect, the present invention provides a genetically modified cell comprising the construct of the seventh aspect of the invention or a genomically integrated form of the construct.
In a ninth aspect, the present invention provides a multicellular structure comprising a cell of the eighth aspect of the invention.
Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.
Nucleotide and amino acid sequences are referred to herein by a sequence identifier number (SEQ ID NO:). A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided at the end of the specification.
TABLE 1 - Summary of Sequence Identifiers
Sequence Sequence Sequence Listing Identifier Number
DESCRIPTION OF EXEMPLARY EMBODIMENTS
It is to be understood that the following description is for the purpose of describing particular embodiments only and is not intended to be limiting with respect to the above description.
The present invention is predicated, in part, on the identification and functional characterisation of transcriptional control sequences which specifically or preferentially direct expression of an operably connected nucleotide sequence in an embryo and/or ESR in a plant seed.
As used herein, the term "transcriptional control sequence" should be understood as a
nucleotide sequence that modulates at least the transcription of an operably connected nucleotide sequence. As such, the transcriptional control sequences of the present invention may comprise any one or more of, for example, a leader, promoter, enhancer or upstream activating sequence. As referred to herein, the term "transcriptional control sequence" preferably at least includes a promoter. A "promoter" as referred to herein, encompasses any nucleic acid that confers, activates or enhances expression of an operably connected nucleotide sequence in a cell.
As used herein, the term "operably connected" refers to the connection of a transcriptional control sequence, such as a promoter, and a nucleotide sequence of interest in such a way as to bring the nucleotide sequence of interest under the transcriptional control of the transcriptional control sequence. For example, promoters are generally positioned 5' (upstream) of a nucleotide sequence to be operably connected to the promoter. In the construction of heterologous transcriptional control sequence/nucleotide sequence of interest combinations, it is generally preferred to position the promoter at a distance from the transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, ie. the gene from which the promoter is derived. However, as is known in the art, some variation in this distance can be accommodated without loss of promoter function.
As set out above, in a first aspect, the present invention provides an isolated nucleic acid molecule comprising:
(i) a nucleotide sequence defining a transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide sequence in an embryo and/or ESR of a plant seed; or
(ii) a nucleotide sequence defining a functionally active fragment or variant of
(i)-
"Isolated" as used herein refers to material removed from its original environment (eg.
the natural environment if it is naturally occurring), and thus is altered "by the hand of man" from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be "isolated" because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide. An "isolated" nucleic acid molecule should also be understood to include a synthetic nucleic acid molecule, including those produced by chemical synthesis using known methods in the art or by in-vitro amplification (eg. polymerase chain reaction and the like).
The isolated nucleic acid molecule of the present invention may comprise polyribonucleotides or polydeoxyribonucleotides, which may be unmodified RNA or DNA or modified RNA or DNA. For example, the isolated nucleic acid molecules of the invention may comprise single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, the isolated nucleic acid molecules may comprise triple-stranded regions comprising RNA or DNA or both RNA and DNA. The isolated nucleic acid molecules may also contain one or more modified bases, or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus the term "nucleic add" also embraces chemically, enzymatically, or metabolically modified forms of DNA and RNA.
As set out above, the present invention contemplates a transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide sequence in the embryo and/or ESR of a plant seed.
As referred to herein, a plant "seed" should be understood to refer to a mature or
immature plant seed. As such, the term "seed" includes, for example, immature seed carried by a maternal plant or seed released from the maternal plant. The term "seed" should also be understood to include any seed plant sporophyte, together with any associated nutritive or protective tissues (which may or may not be clonal with the sporophyte embryo), between the developmental stages of fertilisation and germination.
As referred to herein, the "embryo" of a plant seed refers to the part of a seed that comprises the precursor tissues of the leaves, stem (ie. hypocotyl), and root (ie. radicle), as well as one or more cotyledons. The number of cotyledons comprised within the embryo can vary according to the plant taxon. For example, dicotyledonous angiosperm embryos comprise two cotyledons, monocotyledonous angiosperm embryos comprise a single cotyledon (also referred to as the scutellum), while gymnosperm embryos may comprise a variable number of cotyledons, typically ranging from 2 to 24. In light of the above, reference herein to an "embryo", particularly in the context of specific or preferential expression within an embryo (see later), may include expression in all of the embryo or expression in one or more cells, tissues or parts of the embryo.
As referred to herein, the "Embryo Surrounding Region" or "ESR" of a plant seed refers to the part of a seed that surrounds and/or is proximate to the embryo in the seed. The ESR is typically characterized by small and densely cytoplasmic cells with a high content of endoplasmic reticulum and Golgi vesicles. The ESR is thought to play a role in different types of exchanges between endosperm and embryo. In light of the above, reference herein to the ESR, particularly in the context of specific or preferential expression within the ESR (see later), may include expression in all of the ESR or expression in one or more cells, tissues or parts of the ESR.
As used herein, "specifically expressing" means that the nucleotide sequence of interest is expressed substantially only in a plant embryo and/or ESR in a plant seed.
"Preferentially expressing" should be understood to mean that the nucleotide sequence of interest is expressed at a higher level in a plant embryo and/or ESR in a plant seed than in one or more other tissues of the plant, eg. leaf tissue, root tissue or another tissue of the grain such as the starchy endosperm. Preferably, preferential expression in a plant embryo and/or ESR in a plant seed includes expression of a nucleotide sequence of interest in a plant embryo and/or ESR in a plant seed at a level of at least twice, more preferably at least 5 times and most preferably at least 10 times the level of expression seen in at least one other tissue of the plant.
As referred to herein, "expression of an operably connected nucleotide sequence in a plant embryo and/or ESR in a plant seed" refers to the transcription and/or translation of a nucleotide sequence in one or more cells of a plant embryo and/or ESR in a plant seed. This definition in no way implies that expression of the nucleotide sequence must occur in all cells of a plant embryo and/or ESR in a plant seed.
The transcriptional control sequence or functionally active fragment or variant thereof may effect specific or preferential expression in an embryo and/or ESR in a seed from any seed plant species, including monocotyledonous angiosperm plants ('monocots'), dicotyledonous angiosperm plants ('dicots') and gymnosperm plants. In some embodiments the plant is a monocot. In some embodiments, the plant is a cereal crop plant. As used herein, the term "cereal crop plant" may be a member of the Poaceae (grass family) that produces grain. Examples of Poaceae cereal crop plants include wheat, rice, maize, millets, sorghum, rye, triticale, oats, barley, teff, wild rice, spelt and the like. The term cereal crop plant should also be understood to include a number of non-Poaceae plant species that also produce edible grain, which are known as the pseudocereals and include, for example, amaranth, buckwheat and quinoa.
In some embodiments, the plant is a barley plant. In some embodiments wherein the plant is a barley plant, the transcriptional control sequence specifically or preferentially directs the expression of an operably connected nucleotide sequence in the embryo
and/or ESR of a barley seed at least between 6 DAP and 48 DAP.
As referred to herein, "barley" includes several members of the genus Hordeum. The term "barley" encompasses cultivated barley including two-row barley (Hordeum distichum), four-row barley (Hordeum tetrastichum) and six-row barley (Hordeum vulgare). In some embodiments, barley may also refer to wild barley, (Hordeum sγontaneum). In some embodiments, the term "barley" refers to barley of the species Hordeum vulgar e.
In some embodiments, the plant is a rice plant. In some embodiments wherein the plant is a rice plant, the transcriptional control sequence specifically or preferentially directs the expression of an operably connected nucleotide sequence in the embryo of the rice seed at least between 7 DAP and 69 DAP.
As referred to herein, "rice" includes several members of the genus Oryza including the species Oryza sativa and Oryza glaberrima. The term "rice" thus encompasses rice cultivars such as japonica or sinica varieties, indica varieties and javonica varieties. In some embodiments, the term "rice" refers to rice of the species Oryza sativa.
In some embodiments, the plant is a wheat plant.
As referred to herein, "wheat" should be understood as a plant of the genus Triticum. Thus, the term "wheat" encompasses diploid wheat, tetraploid wheat and hexaploid wheat. In some embodiments, the wheat plant may be a cultivated species of wheat including, for example, T. aestivum, T. durum, T. monococcum or T. sγelta. In some embodiments, the term "wheat" refers to wheat of the species Triticum aestivum.
In some embodiments, the transcriptional control sequences of the present invention may also specifically or preferentially direct the expression of an operably connected nucleotide sequence in a dicot. Exemplary dicots include, for example, Arabidσpsis spp.,
Nicotiana spp., Medicago spp., soybean, canola, oil seed rape, sugar beet, mustard, sunflower, potato, safflower, cassava, yams, sweet potato, other Brassicaceae such as Thellungiella haloγhila, among others.
In some embodiments, the transcriptional control sequence which specifically or preferentially directs expression of an operably connected nucleotide sequence in the embryo and/or ESR of a plant seed is derived from a gene which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 or a homolog thereof.
The term "derived from", as used herein, refers to a source or origin for the transcriptional control sequence. For example, a transcriptional control sequence "derived from a gene which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1" refers to a transcriptional control sequence which, in its native state, exerts at least some transcriptional control over a gene which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 in an organism.
The term "homolog", as used herein with reference to homologs of polypeptides comprising the amino acid sequence set forth in SEQ ID NO: 1, should be understood to include, for example, homologs, orthologs, paralogs, mutants and variants of polypeptides comprising the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the homolog, ortholog, paralog, mutant or variant of a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid sequence which comprises at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the amino add sequence set forth in SEQ ID NO: 1.
When comparing amino acid sequences to calculate a percentage identity, the
compared sequences should be compared over a comparison window of at least 20 amino acid residues, at least 40 amino acid residues, at least 60 amino acid residues, at least 80 amino acid residues, at least 100 amino acid residues or over the full length of SEQ ID NO: 1. The comparison window may comprise additions or deletions (ie. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschul et al. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998).
The transcriptional control sequences of the present invention may be derived from any source, including isolated from any suitable organism or they may be synthetic nucleic acid molecules. In some embodiments the transcriptional control sequences contemplated herein are derived from a plant. In some embodiments, the transcriptional control sequences of the present invention are derived from a monocot plant species and in some embodiments, the transcriptional control sequences of the present invention are derived from a cereal crop plant species. In some embodiments, the transcriptional control sequence is derived from a Triticum species (for example T. aestivum, T. durum, T. monococcum, T. dicoccon, T. sγelta or T. γolonicum). In some embodiments, the transcriptional control sequence is derived from a tetraploid wheat (for example T. durum, T. dicoccon, or T. γolonicum). In some embodiments, the transcriptional control sequence is derived from a durum wheat, and in some embodiments, the transcriptional control sequence is derived from Triticum durum.
In some embodiments, the transcriptional control sequence is derived from a gene which comprises an open reading frame comprising the nucleotide sequence set forth in SEQ ID NO: 2.
In some embodiments, the transcriptional control sequence contemplated by the first aspect of the invention comprises the nucleotide sequence set forth in SEQ ID NO: 3 or a functionally active fragment or variant thereof.
As set out above, the present invention also contemplates functionally active fragments or variants of the transcriptional control sequences of the present invention.
"Functionally active fragments" of the transcriptional control sequence of the invention include fragments of a transcriptional control sequence which retain the capability to specifically or preferentially direct expression of an operably connected nucleotide sequence in an embryo and/or ESR of a plant seed. In some embodiments of the invention the functionally active fragment is at least 500 nucleotides (nt), at least 1000 nt, at least 1500 nt, at least 2000 nt or at least 2500 nt in length. In further embodiments, the fragment comprises at least 500 nt, at least 1000 nt, at least 1500 nt, at least 2000 nt or at least 2500 nt contiguous bases from the nucleotide sequence set forth in SEQ ID NO: 3.
Examples of "functionally active fragments" of SEQ ID NO: 3 include truncated forms of SEQ ID NO: 3, such as transcriptional control sequences which comprise the nucleotide sequence set forth in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, or SEQ ID NO: 23.
"Functionally active variants" of the transcriptional control sequence of the invention include orthologs, mutants, synthetic variants, analogs and the like which are capable of effecting transcriptional control of an operably connected nucleotide sequence and/or are capable of specifically or preferentially directing the expression of an operably connected nucleotide sequence in a plant embryo and/or ESR in a plant seed. The term "variant" should be considered to specifically include, for example, orthologous transcriptional control sequences from other organisms; mutants of the transcriptional control sequence; variants of the transcriptional control sequence
wherein one or more of the nucleotides within the sequence has been substituted, added or deleted; and analogs that contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine.
In some embodiments, the functionally active fragment or variant comprises at least at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% at least 96%, at least 97%, at least 98%, at least 99% or 100% nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3. When comparing nucleic acid sequences to calculate a percentage identity, the compared nucleotide sequences should be compared over a comparison window of at least 100 nucleotide residues, at least 200 nucleotide residues, at least 500 nucleotide residues, at least 1000 nucleotide residues, at least 1500 nucleotide residues, at least 2000 nucleotide residues, at least 2500 nucleotide residues or over the full length of SEQ ID NO: 3. The comparison window may comprise additions or deletions (ie. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschul et al. (1997, supra). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. (1998, supra).
In some embodiments, the functionally active fragment or variant comprises a nucleic acid molecule which hybridises to a nucleic acid molecule defining a transcriptional control sequence of the present invention under stringent conditions. In some embodiments, the functionally active fragment or variant comprises a nucleic acid molecule which hybridises to a nucleic add molecule comprising the nucleotide sequence set forth in SEQ ID NO: 3 under stringent conditions.
As used herein, "stringent" hybridisation conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least 30 0 C. Stringent conditions may also be achieved with the addition of destabilising agents such as formamide. In some embodiments, stringent hybridisation conditions may be low stringency conditions, medium stringency conditions or high stringency conditions. Exemplary low stringency conditions include hybridisation with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in Ix to 2xSSC (20xSSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridisation in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5x to IxSSC at 55 to 60 0 C. Exemplary high stringency conditions include hybridisation in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.IxSSC at 60 to 65°C. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridisation is generally less than about 24 hours, usually about 4 to about 12 hours.
Specificity of hybridisation is also a function of post-hybridisation washes, with the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the thermal melting point (Tm) can be approximated from the equation of Meinkoth and Wahl (Anal. Biochem. 138: 267-284, 1984), ie. Tm =81.5°C +16.6 (log M)+0.41 (% GQ-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridisation solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridises to a perfectly matched probe. Tm is reduced by about 1°C for each 1% of mismatching; thus, Tm, hybridisation, and/or wash conditions can be adjusted to hybridise to sequences of different degrees of complementarity. For example, sequences with >90% identity can be hybridised by decreasing the Tm by about 10 0 C. Generally, stringent conditions are selected to be about 5°C lower than the Tm for the specific sequence and its complement
at a defined ionic strength and pH. However, high stringency conditions can utilise a hybridisation and/or wash at, for example, 1, 2, 3, or 4°C lower than the T m ; medium stringency conditions can utilise a hybridisation and/or wash at, for example, 6, 7, 8, 9, or 10 0 C lower than the T m ; low stringency conditions can utilise a hybridisation and/or wash at, for example, 11, 12, 13, 14, 15, or 20 0 C lower than the Tm. Using the equation, hybridisation and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridisation and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45°C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridisation of nucleic adds is found in Tijssen (Laboratory Techniques in Biochemistry and Molecular Biology-Hybridisation with Nucleic Acid Probes, Pt I, Chapter 2, Elsevier, New York, 1993), Ausubel et ah, eds. (Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, New York, 1995) and Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2 nd ed., Cold Spring Harbor Laboratory Press, Plainview, NY, 1989).
In some embodiments, the transcriptional control sequence may also comprise one or more cz ' s-elements that activate, enhance or otherwise modulate the activity and/or expression pattern of the transcriptional control sequence. The term cz ' s-element, as referred to herein, should be understood as a part, region or fraction of the transcriptional control sequence itself that activates, enhances or otherwise modulates the activity and/or expression pattern of the transcriptional control sequence as a whole. In exemplary embodiments, the cz ' s-element may comprise the nucleotide sequence set forth in one or more of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28.
Thus, the transcriptional control sequence may also comprise a cz ' s-element that activates, enhances or otherwise modulates the activity and/or expression pattern of the transcriptional control sequence, the cz ' s-element comprising the nucleotide
sequence set forth in one or more of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28.
In a second aspect, the present invention also provides a nucleic acid construct comprising an isolated nucleic acid molecule of the first aspect of the invention.
The nucleic acid construct of the second aspect of the present invention may comprise any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. For example, the nucleic acid construct may comprise single- and/or double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, the nucleic acid construct may comprise triple-stranded regions comprising RNA or DNA or both RNA and DNA. The nucleic acid construct may also comprise one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus the term "nucleic acid construct" embraces chemically, enzymatically, or metabolically modified forms.
In some embodiments, the nucleic acid construct comprises DNA. Accordingly, the nucleic acid construct may comprise, for example, a linear DNA molecule, a plasmid, a transposon, a cosmid, an artificial chromosome and the like. Furthermore, the nucleic acid construct may be a separate nucleic acid molecule or may be a part of a larger nucleic acid molecule.
In some embodiments, the nucleic acid construct further comprises a nucleotide sequence of interest that is heterologous with respect to the transcriptional control sequence or the functionally active fragment or variant thereof; wherein the nucleotide
sequence of interest is operably connected to the transcriptional control sequence or functionally active fragment or variant thereof.
The term "heterologous with respect to the transcriptional control sequence" refers to the nucleotide sequence of interest being any nucleotide sequence other than that which the transcriptional control sequence (or functionally active fragment or variant thereof) is operably connected to in its natural state. For example, in its natural state, SEQ ID NO: 3 is operably connected to the nucleotide sequence set forth in SEQ ID NO: 4. Accordingly, in this example, any nucleotide sequence other than a nucleotide sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 4 should be considered heterologous with respect to SEQ ID NO: 3. In accordance with the definition above, it would be recognised that a nucleotide sequence of interest which is heterologous to the transcriptional control sequence (or functionally active fragment or variant thereof) may be derived from an organism of a different taxon to the transcriptional control sequence (or functionally active fragment or variant thereof) or the nucleotide sequence of interest may be a heterologous sequence from an organism of the same taxon.
In some embodiments, the nucleic acid construct may further comprise a nucleotide sequence defining a transcription terminator. The term "transcription terminator" or
"terminator" refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are generally 3'-non-translated DNA sequences and may contain a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3'-end of a primary transcript. As with promoter sequences, the terminator may be any terminator sequence which is operable in the cells, tissues or organs in which it is intended to be used. Examples of suitable terminator sequences which may be useful in plant cells include: the nopaline synthase
(nos) terminator, the CaMV 35S terminator, the octopine synthase (ocs) terminator, potato proteinase inhibitor gene (pin) terminators, such as the γinll and γinlll terminators and the like.
In some embodiments, the nucleic acid construct comprises an expression cassette comprising the structure:
( [N]w - TCS - [N]χ - SoI - [N] y - TT - [N]z )
wherein:
[N]w comprises one or more nucleotide residues, or is absent;
TCS comprises a nucleic acid of the first aspect of the invention; [N]χ comprises one or more nucleotide residues, or is absent;
SoI comprises a nucleotide sequence of interest which encodes an mRNA or non- translated RNA, wherein the nucleotide sequence, SoI, is operably connected to TCS; [N] y comprises one or more nucleotide residues, or is absent; TT comprises a nucleotide sequence defining a transcription terminator; [N]z comprises one or more nucleotide residues, or is absent.
The nucleic acid constructs of the present invention may further comprise other nucleotide sequences as desired. For example, the nucleic acid construct may include an origin of replication for one or more hosts; a selectable marker gene which is active in one or more hosts or the like.
As used herein, the term "selectable marker gene" includes any gene that confers a phenotype on a cell, in which it is expressed, to facilitate the identification and/or selection of cells which are transfected or transformed with a nucleic acid construct of the invention. A range of nucleotide sequences encoding suitable selectable markers are known in the art. Exemplary nucleotide sequences that encode selectable markers include: antibiotic resistance genes such as ampicillin-resistance genes, tetracycline- resistance genes, kanamydn-resistance genes, the AURI-C gene which confers resistance to the antibiotic aureobasidin A, neomycin phosphotransferase genes (eg. nptl and nγtlϊ) and hygromycin phosphotransferase genes (eg. hpt); herbicide resistance
genes including glufosinate, phosphinothridn or bialaphos resistance genes such as phosphinothricin acetyl transferase-encoding genes (eg. bar), glyphosate resistance genes including 3-enoyl pyruvyl shikimate 5-phosphate synthase-encoding genes (eg. aroA), bromyxnil resistance genes including bromyxnil nitrilase-encoding genes, sulfonamide resistance genes including dihydropterate synthase-encoding genes (eg. sul) and sulfonylurea resistance genes including acetolactate synthase-encoding genes; enzyme-encoding reporter genes such as GUS and chloramphenicolacetyltransf erase (CAT) encoding genes; fluorescent reporter genes such as the green fluorescent protein-encoding gene; and luminescence-based reporter genes such as the luciferase gene, amongst others.
The genetic constructs described herein may further include nucleotide sequences intended for the maintenance and/or replication of the genetic construct in prokaryotes or eukaryotes and/or the integration of the genetic construct or a part thereof into the genome of a eukaryotic or prokaryotic cell.
In some embodiments, the construct of the invention is adapted to be at least partially transferred into a plant cell via Agrobacterium-mediated transformation. Accordingly, in some embodiments, the nucleic acid construct comprises left and/or right T-DNA border sequences. Suitable T-DNA border sequences would be readily ascertained by one of skill in the art. However, the term "T-DNA border sequences" should be understood to include, for example, any substantially homologous and substantially directly repeated nucleotide sequences that delimit a nucleic acid molecule that is transferred from an Agrobαcterium sp. cell into a plant cell susceptible to Agrobαcterium- mediated transformation. By way of example, reference is made to the paper of Peralta and Ream (Proc. Nαtl. Acαd. ScL USA, 82(15): 5112-5116, 1985) and the review of Gelvin (Microbiology and Molecular Biology Reviews, 67(1): 16-37, 2003).
In some embodiments, the present invention also contemplates any suitable modifications to the genetic construct which facilitate bacterial mediated insertion into
a plant cell via bacteria other than Agrobacterium sp., for example, as described in Broothaerts et al. (Nature 433: 629-633, 2005).
Those skilled in the art will be aware of how to produce the constructs described herein, and of the requirements for obtaining the expression thereof, when so desired, in a specific cell or cell-type under the conditions desired. In particular, it will be known to those skilled in the art that the genetic manipulations required to perform the present invention may require the propagation of a genetic construct described herein or a derivative thereof in a prokaryotic cell such as an E. coli cell or a plant cell or an animal cell. Exemplary methods for cloning nucleic acid molecules are described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory Press, New York, 2000).
In a third aspect, the present invention provides a genetically modified cell comprising a nucleic acid construct of the second aspect of the invention or a genomically integrated form thereof.
As referred to herein, a "genetically modified cell" includes any cell comprising a non- naturally occurring and/or introduced nucleic add. Generally, in the case of the cells of the third aspect of the present invention, the introduced nucleic acid comprises a construct of the second aspect of the invention.
The nucleic acid construct may be maintained in the cell as a nucleic acid molecule, as an autonomously replicating genetic element (eg. a plasmid, cosmid, artificial chromosome or the like) or it may be integrated into the genomic DNA of the cell.
As used herein, the term "genomic DNA" should be understood in its broadest context to include any and all endogenous DNA that makes up the genetic complement of a cell. As such, the genomic DNA of a cell should be understood to include chromosomes, mitochondrial DNA, plastid DNA, chloroplast DNA, endogenous
plasmid DNA and the like. As such, the term "genomically integrated" contemplates chromosomal integration, mitochondrial DNA integration, plastid DNA integration, chloroplast DNA integration, endogenous plasmid integration, and the like. The "genomically integrated form" of the construct may be all or part of the construct. However, in some embodiments the genomically integrated form of the construct at least includes the nucleic acid molecule of the first aspect of the invention.
The cells contemplated by the third aspect of the invention include any prokaryotic or eukaryotic cell. In some embodiments, the cell is a plant cell. In some embodiments the cell is a monocot plant cell. In some embodiments the cell is a cereal crop plant cell. In some embodiments, the cell is a barley, rice or wheat cell.
In some embodiments, the cell may also comprise a prokaryotic cell. For example, the prokaryotic cell may include an Agrobacterium sp. cell (or other bacterial cell), which carries the nucleic acid construct and which may, for example, be used to transform a plant. In some embodiments, the prokaryotic cell may be a cell used in the construction or cloning of the nucleic acid construct (eg. an E. coli cell).
In a fourth aspect, the present invention contemplates a multicellular structure comprising one or more cells of the third aspect of the invention.
In some embodiments, the multicellular structure comprises a plant or a part, organ or tissue thereof. As referred to herein, "a plant or a part, organ or tissue thereof" should be understood to specifically include a whole plant; a plant tissue; a plant organ; a plant part; a plant embryo; and cultured plant tissue such as a callus or suspension culture.
In some embodiments, the multicellular structure comprises a plant seed. In some embodiments, the multicellular structure comprises a plant embryo and/or ESR in a plant seed.
In some embodiments, a nucleotide sequence of interest is operably connected to the transcriptional control sequence or the functionally active fragment or variant thereof, and the nucleotide sequence of interest is specifically or preferentially expressed in the embryo and/or ESR of the plant seed. In some embodiments, the level, rate and/or pattern of expression of at least one nucleotide sequence is altered in the embryo and/or ESR in said seed relative to the wild type form of said plant seed.
In some embodiments, the plant or a part, organ or tissue thereof comprises a monocot plant or a part, organ or tissue thereof. In some embodiments the plant or a part, organ or tissue thereof comprises a cereal crop plant or a part, organ or tissue thereof. In some embodiments, the plant or a part, organ or tissue thereof comprises a barley, rice or wheat plant or a part, organ or tissue thereof.
In some embodiments, the multicellular structure may comprise a plant seed. In some embodiments, the plant seed comprises a monocot plant seed. In some embodiments, the plant seed comprises a cereal crop plant seed. In some embodiments, the plant seed is a barley seed and in further embodiments the nucleotide sequence of interest is expressed in the barley seed at least between 6 DAP and 48 DAP. In some embodiments, the plant seed is a rice seed and in further embodiments the nucleotide sequence of interest is expressed in the rice seed at least between 7 DAP and 69 DAP. In some embodiments, the plant seed is a wheat seed.
In a fifth aspect, the present invention provides a method for specifically or preferentially expressing a nucleotide sequence of interest in an embryo and/or ESR in a plant seed, the method comprising effecting transcription of the nucleotide sequence of interest in a plant under the transcriptional control of the nucleic acid of the first aspect of the invention.
As set out above, in the fifth aspect, the present invention is predicated, in part, on
effecting transcription of the nucleotide sequence of interest under the transcriptional control of a transcriptional control sequence of the first aspect of the invention. In some embodiments, this is effected by introducing a nucleic acid molecule comprising the transcriptional control sequence, or a functionally active fragment or variant thereof, into a cell of the plant, such that the nucleotide sequence of interest is operably connected to the transcriptional control sequence. The nucleic acid molecule may be introduced into the plant via any method known in the art. For example, an explant or cultured plant tissue may be transformed with a nucleic acid molecule, wherein the explant or cultured plant tissue is subsequently regenerated into a mature plant including the nucleic acid molecule; a nucleic acid may be directly transformed into a plant seed, either stably or transiently; a nucleic acid may be introduced into a seed via plant breeding using a parent plant that carries the nucleic acid molecule; and the like.
In some embodiments, the nucleic acid molecule is introduced into a plant cell via transformation. Plants may be transformed using any method known in the art that is appropriate for the particular plant species. Common methods include Agrobacterium- mediated transformation, microprojectile bombardment based transformation methods and direct DNA uptake based methods. Roa-Rodriguez et al. (Agrobacterium-medzαted transformation of plants, 3 rd Ed. CAMBIA Intellectual Property Resource, Canberra, Australia, 2003) review a wide array of suitable Agrobacterium-mediated plant transformation methods for a wide range of plant species. Other bacterial-mediated plant transformation methods may also be utilised, for example, see Broothaerts et αl. (2005, supra). Microprojectile bombardment may also be used to transform plant tissue and methods for the transformation of plants, particularly cereal plants, are reviewed by Casas et al. (Plant Breeding Rev. 13: 235-264, 1995). Examples of direct DNA uptake transformation protocols such as protoplast transformation and electroporation are described in detail in Galbraith et al. (eds.), Methods in Cell Biology Vol. 50, Academic Press, San Diego, 1995). In addition to the methods mentioned above, a range of other transformation protocols may also be used. These include infiltration, electroporation of cells and tissues, electroporation of embryos, microinjection, pollen-tube pathway-,
silicon carbide- and liposome mediated transformation. Methods such as these are reviewed by Rakoczy-Trojanowska (Cell. MoI. Biol. Lett. 7: 849-858, 2002). A range of other plant transformation methods may also be evident to those of skill in the art and, accordingly, the present invention should not be considered in any way limited to the particular plant transformation methods exemplified above.
As set out above, the transcriptional control sequence of the present invention is introduced into a plant cell such that the nucleotide sequence of interest is operably connected to the transcriptional control sequence and the present invention contemplates any method to effect this. For example, the subject transcriptional control sequence and a nucleotide sequence of interest may be incorporated into a nucleic acid molecule such that they are operably connected, and this construct may be introduced into the target cell. In another example, the nucleic acid sequence of the present invention may be inserted into the genome of a target cell such that it is placed in operable connection with an endogenous nucleic acid sequence. As would be recognised by one of skill in the art, the insertion of the transcriptional control sequence into the genome of a target cell may be either by non-site specific insertion using standard transformation vectors and protocols or by site-specific insertion, for example, as described in Terada et al. (Nat Biotechnol 20: 1030-1034, 2002).
The nucleotide sequence of interest, which is placed under the regulatory control of the transcriptional control sequence of the present invention, may be any nucleotide sequence of interest. General categories of nucleotide sequences of interest include nucleotide sequences which encode, for example: reporter proteins, such as, GUS, GFP and the like; proteins involved in cellular metabolism such as Zinc finger proteins, kinases, heat shock proteins and the like; proteins involved in agronomic traits such as disease or pest resistance or herbicide resistance; proteins involved in grain characteristics such as grain biomass, nutritional value, post-harvest characteristics and the like; heterologous proteins, such as proteins encoding heterologous enzymes or structural proteins or proteins involved in biosynthetic pathways for heterologous
products; "terminator" associated proteins such as barnase, barstar or diphtheria toxin. Furthermore, the nucleotide sequence of interest may alternatively encode a non- translated RNA, for example an siRNA, miRNA, antisense RNA and the like.
In some embodiments, the nucleotide sequence of interest is heterologous with respect to the transcriptional control sequence, as defined supra.
The method of the fifth aspect of the invention contemplates the specific or preferential expression of a nucleotide sequence of interest in the embryo and/or ESR in any suitable seed plant species. In some embodiments, the method contemplates expression in a monocot. In some embodiments, the method contemplates expression in a cereal crop plant. In some embodiments, the method contemplates expression in a barley plant, and in further embodiments the method contemplates expression in the embryo and/or ESR of a barley seed at least between 6 DAP and 48 DAP. In some embodiments, the method contemplates expression in a rice plant, and in further embodiments the method contemplates expression in the embryo of a rice seed at least between 7 DAP and 69 DAP. In some embodiments, the method contemplates expression in the embryo and/or ESR of a wheat plant.
In a sixth aspect, the present invention provides an isolated nucleic acid selected from the list consisting of:
(i) a nucleic acid comprising the nucleotide sequence set forth in SEQ ID
NO: 3;
(ii) a nucleic acid comprising a nucleotide sequence which is at least 50% identical to the nucleotide sequence mentioned in (i);
(iii) a nucleic acid which hybridizes to the nucleic acid mentioned in (i) under stringent conditions; (iv) a nucleic acid comprising a nucleotide sequence which is the complement or reverse complement of any one of (i), (ii) or (iii); and (v) a fragment of any of (i), (ii), (iii) or (iv).
In some embodiments, the isolated nucleic acid defined at (ii) comprises at least 50% sequence identity, more preferably at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 3.
In another embodiment, the isolated nucleic acid of the sixth aspect of the invention comprises a nucleotide sequence which defines a transcriptional control sequence or a complement, reverse complement or fragment thereof.
As set out at (iii) above, the sixth aspect of the invention provides isolated nucleic acids which hybridize to any of the nucleic acids mentioned at (i) under stringent conditions. As hereinbefore defined, exemplary stringent conditions include low stringency conditions, medium stringency conditions and high stringency conditions (as previously described).
The sixth aspect of the present invention also contemplates nucleic acid fragments. In some embodiments of the invention, the fragment comprises at least 500 nucleotides
(nt), at least 1000 nt, at least 1500 nt, at least 2000 nt or at least 2500 nt the nucleotide sequence set forth in SEQ ID NO: 3. For example, fragments of SEQ ID NO: 3 contemplated in this aspect of the invention include, for example, truncated forms of
SEQ ID NO: 3 such as those nucleotide sequences set forth in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 or SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO:
21, SEQ ID NO: 22, or SEQ ID NO: 23.
In further embodiments, the fragment may also comprise a cz ' s-element derived from SEQ ID NO: 3, such as the cz ' s-elements comprising the nucleotide sequences set forth
in one or more of SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 or SEQ ID NO: 28.
In a seventh aspect, the present invention also provides a nucleic acid construct comprising the nucleic acid of the sixth aspect of the invention.
In an eighth aspect, the present invention provides a genetically modified cell (as hereinbefore described) comprising the construct of the seventh aspect of the invention; and/or a cell comprising a genomically integrated form of said construct.
In a ninth aspect, the present invention provides a multicellular structure (as hereinbefore described) comprising a cell of the eighth aspect of the invention.
Finally, reference is made to standard textbooks of molecular biology that contain methods for carrying out basic techniques encompassed by the present invention, including DNA restriction and ligation for the generation of the various genetic constructs described herein. See, for example, Maniatis et ah, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, New York, 1982) and Sambrook et al. (2000, supra).
The present invention is further described by the following non-limiting examples:
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows a Southern blot confirming the successful integration of pMDC164- TdPR61 into transgenic plant lines. The coding region of Hygromydn phosphotransferase was used as a probe. 1 - line G81-1, 2 - line G81-2, C -positive control: plant transformed with empty vector; W - negative control: wild type Hordeum vulgar e cv. Golden promise, 6 - line G81-6, 7 - line G81-7, 9 - line G81-9, 11 - line G81- 11. The number of bands reflects the number of integrated copies of the vector.
Figure 2 shows the activity of the TdPR61 promoter in barley grain at different stages of grain development in the transgenic plant line G81-2. The figure shows promoter activity at different ages of the grain (measured in DAP) and shows the transgenic grain in different orientations (crease up or crease down) and the grain sectioned in different orientations (longitudinal or lateral).
Figure 3 shows the activity of the TdPR61 promoter in barley grain at different stages of grain development in transgenic plant line G81-11. The figure shows the age of the grain in DAP, the orientation of the grain (eg. crease up or crease down) and the orientation of the section (longitudinal (L) or lateral).
Figure 4 shows isolated embryos and embryo surrounding regions (ESR) from the grain (10 DAP) of control and transgenic barley plants transformed with TdPR61 Promoter:GUS construct. At this stage of grain development GUS activity was detected in the ESR. A - Embryo axis, scutellum and ESR of the control, non-transformed plant. B - Embryos and ESRs from several grains of transgenic plants. C - Closer look on isolated ESR of transgenic plants. E - embryo; ESR - endosperm surrounding region; S - scutellum.
Figure 5 shows isolated embryos from the grain (15 DAP) of control (A) and transgenic (B - F) barley plants transformed with TdPR61 Promoter:GUS construct. GUS activity can be seen as two strong points between embryo axis and scutellum (B) and three weaker points in scutellum (C). The same can be seen in the grains from three independent transgenic lines (D - F). E - embryo axis; S - scutellum.
Figure 6 shows histological analyses of grain from transgenic barley plants transformed with the TdPR61 Promo ter-GUS construct. GUS expression was detected in the embryo axis, in the part of coleorhiza close to connection of embryo axis to the scutellum. A and B - GUS activity in the ESR at 21 DAP; C and D - GUS activity in the
first node of the embryo axis, at the connection of the embryo axis to the scutellum. (24 DAP); E -G - At 27 DAP some GUS activity remains in ESR, in the region of the connection of the embryo axis to the scutellum and in part of the coleorhiza; H and I - At 34 DAP GUS activity can be seen mainly in part of the coleorhiza and very low activity remains in the proximal to the interface of the embryo axis and scutellum.
Figure 7 shows the results of the promoter mapping of the TdPR61 promoter. A - First round of mapping using transient expression assay. Two promoter segments, containing putative proximal and distal to TATA box cz ' s-elements are shown as blue and brown boxes. B - Second round of mapping of the promoter segment, containing potential distal cz ' s-element. Positions of predicted embryo (EMB) and endosperm (END) specific cz ' s-elements are indicated with arrows; sequences of predicted putative cz ' s-elements are shown. C - shows the activity of the TdPR61 promoter deletions in colour forming units (cfu). CFU(GUS) per embryo is shown on the Y-axis.
Figure 8 shows examples of transient GUS expression in isolated wheat embryos driven by TdPR61 promoter. Promoter-GUS fusion constructs were bombarded into isolated embryo (12-17 DAP) and stained for GUS activity in 24 hours.
Figure 9 shows the activity of the TdPR61 promoter in To transgenic rice lines. A, B - rice grain at 7 DAP collected from the line with strong transgene expression. No GUS activity has been detected before 8 DAP. D, E - rice grain at 9 DAP. The strongest GUS expression was observed in embryo and in the opposite pole of the grain. C - GUS activity was detected in vascular tissue of lemma, however, only in one plant from several analyzed transgenic lines with strong GUS expression in embryo. Grain from control plants is on the left side of each picture.
Figure 10 shows the activity of the TdPR61 promoter in To transgenic rice lines. A-D - rice grain at 11 DAP; E-H - rice grain at 14 DAP. B, F - longitudinal sections through the main vascular bundle of grain at 11 and 14 DAP, respectively. Strong GUS activity
has been detected in the embryo and along the main vascular bundle of the grain (and/or in ETC). GUS activity in vascular bundle (ETC) is indicated with red arrows. Grain from control plants is on the left side of each picture.
Figure 11 shows the activity of the TdPR61 promoter in To transgenic rice lines. A, B - rice grain at 18 DAP; B - longitudinal sections through the main vascular bundle of grain at 18 DAP. Very strong expression was observed in grain. Weak expression of GUS still can be detected in ETC (indicated with arrow). Grain from control plant is on the left side of the picture. C-F - crossections of rice grain at 11, 18, 21, and 26 DAP, respectively. Weak expression in ETC cannot be detected after 21 DAP.
Figure 12 shows the activity of the TdPR61 promoter in To transgenic rice lines. Al dose look on embryo isolated from control (left) and transgenic (right) grain at 26 DAP. C - endosperm after embryo isolation: no GUS staining at 26 DAP. Two different longitudinal sections at 30 DAP show strong GUS expression exclusively in embryo.
Figure 13 shows the activity of the TdPR61 promoter in To transgenic rice lines. Intact grain (A, C) and different longitudinal sections of grain (B, D-F) at 35 (A, B), 45 (C, D), and 50 DAP (E, F). Strong GUS staining was detected in the embryo and/or ESR of the grain only. Grain from control plants is on the left side of each picture.
Figure 14 shows the activity of the TdPR61 promoter in To transgenic rice lines. Longitudinal sections of grain from transgenic rice lines with strong (A, C and D) and weak (B, E) transgene expression. GUS activity has been detected only in the embryo and/or ESR of the grain. Grain from control plants is on the left side of each picture.
Figure 15 shows the activity of the TdPR61 promoter in transgenic barley lines. A - longitudinal section through the T2 transgenic barley grain at 20 and 40 DAP. GUS activity can be observed in the middle of embryo and in the embryo surrounding region (ESR). B - histological analysis of Ti grain from transgenic barley plants
transformed with TdPR61 promo ter-GUS construct: different longitudinal sections through embryos at 21, 24, 27, and 34 DAP. GUS staining is observed in endosperm surrounding region and in the connection between embryo axis and scutellum.
Figure 16 shows the activity of the TdPR61 promoter in T2 transgenic barley lines. Al- A6 - temporal pattern of TdPR61 expression in barley grain at 5, 8, 14, 20, 40, and 50 DAP, respectively. GUS activity was detected as early as 5 DAP (Al) in the close to embryo part of endosperm and was still detectible after 50 DAP. Grain from control plants is in the upper part of each picture. A7 - endosperm of transgenic barley grain at 11 DAP after isolation of embryo. GUS staining is clearly seen in the embryo surrounding region of endosperm. A8-A11 - embryo isolated from transgenic grain at 15 (A8), 17 (A9, AlO), and 20 (All) DAP shown from the embryo axis side (A8, AlO, All) and scutellum side (A9). GUS staining was observed as two close spots. Grain from control plants is on the left side of each of A8-A10 picture. B1-B9 - histological analysis of grain from transgenic barley plants transformed with TdPR61 promoter- GUS construct: Bl and B6 - longitudinal section of transgenic grain at 5 DAP; B2-B5 and B6-B9 sections through the embryo isolated from transgenic grain at 20 DAP. B2, B3, and B7 - sections were done from the side of scutellum. GUS staining is observed in the tissue, which connect embryo axis to scutellum. B4, B5, B8, and B9 - sections were done from the side of embryo axis. GUS staining is observed in root radical of embryo.
EXAMPLE 1
Isolation of promoter sequences and preparation of reporter constructs
The cDNA of TaPR61 was isolated from the cDNA library prepared from the liquid part of the syncytial endosperm of Triticum aestivum at 3-6 DAP. A single cDNA of TaPR61 was identified among about 200 cDNAs randomly selected for sequencing.
The amino acid sequence corresponding to the TaPR61 cDNA showed some homology
to barley ENDl (Doan et ah, 20 Plant MoI. Biol. 31: 877-886, 1996). Furthermore, all multiple ESTs from databases with 100% sequence match to TaPR61 originate only from cDNA libraries prepared from early grain and early endosperm.
The full length cDNA sequence of TaPR61 was used to probe BAC libraries prepared from genomic DNA of Triticum durum cv. Langdon (described in Cenci et ah, Theor Aγγl Genet 107: 931-939, 2003) using Southern hybridisation as described in Example 2. Seven BAC clones which strongly hybridised with the probe were selected for further analysis. The T. durum homolog of TaPR61 (putatively contained within the BACs) was designated TdPR61.
EXAMPLE 2 Hybridisation Protocol for BAC Colony Membranes
Pre-hybridisation procedure
Membranes were soaked in 5x SSC making sure that any residual precipitated SDS on pre-used filters had re-dissolved. The membranes were then placed into a bottle and approximately 30 ml of pre-hybridisation solution (see below) was added before incubating overnight at 65°C.
Pre-hybridisation Solution (-30 ml was used per bottle).
300 ml of pre-hybridisation solution was prepared by mixing: 150 ml 10x SSC, 105 ml nanopure water, 30 ml Denhardt's III and 15 ml salmon sperm DNA (5mg/ml, autoclaved) followed by incubation at 55 - 65°C for 5 minutes.
Hybridisation procedure
After pre-hybridisation, the pre-hybridisation solution in the bottle was replaced with hybridisation solution prior to adding the labelled probe.
500 μl carrier DNA (5 mg/ml, autoclaved) was added to the labelled probe. This was
boiled for 5 minutes, then chilled for a further 5 minutes on ice, and then added to the bottle. The bottle was then incubated overnight at 65°C. The hybridisation mix was then poured out, leaving the membrane in the bottle. The membrane was washed with about 40-50 ml 2x SSC, 0.1% SDS before further incubation at 65°C for about 20 minutes. The membrane was then removed from the bottle and transferred to storage container. The membranes were then washed with pre- warmed Ix SSC, 0.1% SDS at 65°C using a shaking water bath for approximately 30 minutes. This wash step was repeated where needed. Finally, binding of the probe to the samples was then detected using standard autoradiography methods.
Hybridisation Solution (-lOmls is required per bottle)
100 ml of Hybridisation Solution was prepared by mixing: 5 ml nanopure water, 30 ml 5x HSB buffer, 30 ml Denhardt's III, 30 ml 25% Dextran sulphate and 5 ml salmon sperm DNA (5mg/ml, autoclaved) followed by incubation at 55 - 65°C for 5 minutes.
EXAMPLE 3 DNA isolation from BACs
DNA was isolated from positive clones selected according to the Southern hybridisation (described above) using the method set out below:
7.5 ml of Luria Broth (LB) supplemented with chloramphenicol (Cm) was inoculated with a single colony before incubation overnight at 37°C with shaking at 225 rpm. The cells were then resuspended in 400 μl Pl (QIAGEN #19051 - Tris.Cl-EDTA resuspension buffer) buffer by vortexing. 400 μl P2 (QIAGEN #19052 - NaOH/SDS lyses buffer) buffer was then added followed by gentle mixing and incubation at room temperature for no more than 5 min. 400 μl of P3 (QIAGEN #19053 - acidic potassium acetate) was then added followed by gentle mixing and incubation on ice for 5 min. The samples were then centrifuged at 15000 rpm for 15 min at room temperature and the supernatant subsequently transferred to a new tube. 0.6ml of 100% isopropanol
was then added to the new tube. The samples were then mixed followed by centrifugation at 15000 rpm for 15 min at room temperature. Immediately after centrifugation, the supernatant was decanted without disturbing the pellet. The DNA pellet was then washed by adding ImI of room-temperature 70% ethanol followed by centrifugation and decanting of the supernatant as described above. The pellet was then air-dried before being resuspended in 500 μl TE+5 μl RNAase cocktail (Geneworks, cat # AM-2286) followed by incubation at 37°C for 15 min. 500 μl of (25:24:1) phenol: chloroform: isoamyl alcohol was then added followed by centrifugation at 15000 rpm for 10 min at room temperature. After centrifugation, the aqueous phase was removed and transferred to a new tube, to which 50 μl 3M Sodium Acetate pH 5.2 and 300 μl 100% isopropanol were added before incubation at -20 0 C for 60 min. After incubation, the sample was centrifuged at 15000 rpm for 15 min at room temperature and the supernatant removed. The resulting DNA pellet was then washed with 1 ml of 70% ethanol followed by centrifugation at 15000 rpm for 5 min and removal of the supernatant. The final pellet was then air-dried before being resuspended in 30 μl TE pH 8.
EXAMPLE 4 Amplification and cloning of TdPR61 sequences from BAC DNA
The promoter sequence was first identified on the BAC clone by several consecutive sequencing reactions. In the first sequencing reaction, reverse primers derived from the 5' end of the gene sequence were used. In subsequent reactions, primers were used that were derived from segments of DNA obtained during sequencing. As a result of such 'walking' along the DNA, about 3000 bp of sequence upstream from the translation start codon was obtained. This sequence was subsequently used to design forward and reverse primers for the isolation of the promoter segment.
A promoter with a full-length 5'-untranslated region of TdPR61 was isolated by PCR using AccuPrime™ Pfx DNA polymerase (Invitrogen) from DNA of BAC clone W61-1
as a template using the primers shown below in Table 2. The length of promoter used in constructs was 2669 bp.
TABLE 2 - Primers used to amplify the 5'-untranslated region of TdPR61
■ii-L.m Sequence (5'-3') Sequence Identifier
As shown in table 2, the tetranucleotide sequence CACC was introduced into the 5' ends of the forward primer. The PCR product including the TdPR61 promoter sequence was directionally cloned into the pENTR-D-TOPO vector using pENTR Directional TOPO Cloning Kits (Invitrogen). The construct was linearised with Mlul and used for cloning of the promoter by recombination into the destination binary vector for plant transformation, pMDC164 (Curtis and Grossniklaus, Plant Physiol. 133: 462-469, 2003), upstream of a β-glucoronidase (GUS) cDNA. This construct was subsequently used for barley transformation, as described in the following example and may also be used for transformation of other cereals such as rice and wheat.
EXAMPLE 5 Plant transformation
Barley Transformation Agrobacterium tumefaciens-mediated transformation of barley (Hordeum vulgαre cv Golden Promise) was performed with plasmid pMDC164-TdPR61 promoter using the procedure developed by Tingay et αl. (Plant /. 11: 1369-1376, 1997) and modified by
Matthews et al. (MoI Breed. 7: 195-202, 2001). Developing spikes were harvested from donor plants grown in the glasshouse when the immature embryos were approximately 1-2 mm in diameter. The immature embryos were aseptically excised from the surface-sterilised grain, and the scutella were isolated by removing the embryonic axes. Twenty five freshly isolated scutella were cultured cut side-up in the centre of a 90 mm x 10 mm Petri dish containing callus induction medium, based on the recipe of Wan and Lemaux (Plant Physiol. 104: 37-48, 1994). This medium is composed of MS macro-nutrients (Murashige and Skoog, Physiol. Plant. 15: 473-497, 1962), FHG micro-nutrients (Hunter, Plant regeneration from microspores of barley, Hordeum vulgare, PhD thesis, Wye College, University of London, Ashford, Kent, 1988), supplemented with 30 g/L maltose, 1 mg/L thiamine-HCl, 0.25 g/L myo-inositol, 1 g/L casein hydrolysate, 0.69 g/L L proline, 10 μM CuSCu, 2.5 mg/L Dicamba (3,6-dichloro- o-anisic add), and is solidified with 3.5 g/L Phytagel (Sigma Chemicals, St. Louis, MO, USA). Agrobacterium suspension (50 ml) was aliquotted onto the scutella, and the Petri dish was held at a 45° angle to drain away excess bacterial suspension. The explants were then turned over and dragged across the surface of the medium to the edge of the Petri dish. The scutella were transferred to a fresh plate of callus induction medium and cultured cut side-up for three days in the dark at 22-24°C.
Following co-cultivation, the scutella were removed to fresh callus induction medium containing 95 μM hygromycin B (Becton Dickinson Bio sciences, Palo Alto, CA, USA) and cultured in the dark. The entire callus of an individual scutellum was transferred to fresh selection medium every fortnight for a further six weeks. At the end of the callus selection period, the callus derived from each treated scutellum was transferred to shoot regeneration medium. This medium is based on the FHG recipe of Wan and Lemaux (1994, supra). It contains FHG macro- and micro-nutrients (Hunter, 1988, supra), 1 mg/L thiamine-HCl, 1 mg/L benzylaminopurine (BAP), 0.25 g/L myo-inositol, 0.73 g/L L-glutamine, 62 g/L maltose, 10 μM CuSO4, 38 μM hygromycin B, and is solidified with 3.5 g/L Phytagel. The cultures were exposed to light (16 h day/8 h night photo-period) for three to four weeks at 22-24°C. The regenerated shoots were excised
from the callus and transferred to culture boxes (Magenta Corporation, Chicago, IL, USA) that contained hormone-free callus induction medium, supplemented with 95 μM hygromydn B to induce root formation. The tissue culture-derived plants were finally established in soil and grown to maturity.
AU the above media contain 150 mg/L Timentin (SmithKline Beecham, Pty. Ltd., Melbourne, Australia) to inhibit the growth of Agrobacterium tumefaciens following co- cultivation.
Rice transformation
Seed embryo-derived callus of cv. Nipponbare (Oryza sativa ssp. japonica) was co- cultured with the Agrobacterium strain EHA105 or LBA4404 carrying the pMDC164- TdPR61 promoter plasmid following the procedure detailed in Sallaud et al. (Theor. Appl. Genet. 106: 1396-1408, 2003).
Dehulled seeds were sterilised, inoculated on NB medium and incubated for 18-21 days in the dark as described in Chen et al. (Plant Cell Rep. 18: 25-31, 1998). Embryogenic nodular units (0.5-1 mm long), released from the primary embryo scutellum-derived callus at the explant/medium interface, were transferred onto fresh NB medium and incubated for an additional 10-15 days depending on the variety.
Between 50 and 100, 3- to 5-mm-long, embryogenic nodular units were immersed into 25 ml of liquid co-culture medium (CCL) containing Agrobacterium cells at a density of 3-5 x 10 9 cells ml" 1 (ODβoo = 1) in a 100 mm diameter petri dish for 10-15 min. Ten callus pieces were then blotted dry on sterilised filter paper, transferred to a petri dish containing solid co-culture medium (CCS) and incubated for 3 days at 25°C in the dark. Five to seven uncontaminated co-cultured calli were then individually transferred to one dish of R2S (Ohira et al, Plant & Cell Physiol. 14: 1113-1121, 1973) selection medium, which contains hygromydn for selection of transformed tissues and
cefotaxime and vancomycin for eliminating Agrobacterium, and incubated at 27°C in the dark.
Following 2 weeks of selection on R2S medium, the calli were transferred to NBS medium. After 1 week of incubation, the protuberances developed into brownish globular structures, which were gently teased apart with forceps on the medium around the original callus and incubated for 10-15 days in the resealed petri dish. After co-culture, the globular structures developed into calli.
The putatively transgenic, hygromycin-resistant calli were gently picked out, placed on the PRAG pre-regeneration medium and incubated for a further week. AU of the resistant calli originating from a single co-cultured embryogenic nodular unit were grouped in a sector of the PRAG dish, which can accommodate 40-50 resistant calli.
Four to five, creamy- white, lobed calli with a smooth and dry appearance were individually transferred to one dish of RN regeneration medium, kept for 2 days in the dark, then maintained for 3 weeks under a 12/12-h (day/night) photoperiod. Shoots regenerating from a resistant callus were dissected and sub-cultured in test tubes containing P medium for a further 3-week growth period to promote vigorous tiller and root development before being transferred to Jiffy peat pellets in the containment greenhouse for acclimatisation.
Wheat transformation
Immature seeds of wheat cv. Bob white were surface-sterilized by immersing into 70% ethanol for 2 min, followed by incubation in 1% Sodium Hypochlorite solution with shaking at 125 rpm for 20 min and finally by three washes in sterile distilled water. Immature embryos (1.0-1.5 mm in length, semitransparent) were isolated aseptically and were placed, with the scutellum side up, on solid culture medium. Embryos developing compact nodular calli were selected using a stereomicroscope and used for bombardment 7-21 days after isolation. The cultures were kept in dark at 25°C on solid
MS (Duchefa, M0222; Murashige and Skoog 1962) with 30 g/1 sucrose, 2 mg/1 2,4-D (MS2).
Plasmid constructs were purified using Macherey-Nagel or Qiagen kits according to the manufacturer's protocols.
A DNA-gold coating according to the protocol of Sanford et al. (In: Methods in Enzymology, ed. R. Wu, 217: 483-509, 1993) was performed as follows: 50 μl of gold powder (1.0 μm) in 50% glycerol (60 mg/ml) was mixed with 10 μl DNA (1 mg/ml), 50 μl CaCb (2.5M) and 20 μl of 0.1 M spermidine. For co-transformation the plasmids were mixed at a ratio 1:1 (5 μg + 5 μg). The mixture was vortexed for 2 min, followed by incubation for 30 min at room temperature, brief centrifugation, and serial washing in 70% and 99.5% ethanol. Finally, the pellet was resuspended in 60 μl of 99.5% ethanol (6 μl/shot). All manipulations were done at room temperature.
Microprojectile bombardment was performed utilizing the Biolistic PDS-1000/He Particle Delivery System (Bio-Rad). Before bombardment, immature embryos were pre-treated for 4 hours on MS2 medium supplemented with 100 g/1 sucrose. Embryos (50/plate) were then placed in the centre of a plate to form a circle with a diameter of 10 mm. Bombardment conditions were 900 or 1100 psi, with a 15 mm distance from the macrocarrier launch point to the stopping screen and a 60 mm distance from the stopping screen to a target tissue. The distance between the rupture disk and the launch point of the macrocarrier was 12 mm.
For regeneration, two days after bombardment treated calli may be transferred to MS selection medium supplemented with 2.0 mg/1 2,4-D and 150 mg/1 hygromydn B. After 3-6 selections (4-6 months) greening callus tissues may be subcultured on MS regeneration medium supplemented with lmg/1 kinetin and 5-10 mg/1 zeatin. Regenerating plantlets may then be transferred to jars with the half-strength hormone- free MS medium supplemented with 50 mg/1 hygromydn B.
Fully developed plantlets may be acclimated for 7-10 days at room temperature in a liquid medium containing four-fold diluted MS salts. Plants with strong roots are then transplanted into soil and grown under greenhouse conditions to maturity.
EXAMPLE 6 Detection of the hpt selectable marker
The presence of the transformation vector in the putative transformed plants was investigated by using Southern blotting to detect the kpt selectable marker in DNA isolated from putatively transformed plant tissue.
Figure 1 shows a Southern Blot confirming the successful integration of pMDC164- TdPR61 into transgenic plant lines. In this figure, the number of bands hybridising with the probe reflects the number of integrated copies of the vector.
Plant DNA isolation
Leaf samples were homogenised in Eppendorf tubes with a sand powder in 0.3-5.0 ml of hot (55°C) 2x CTAB solution. Equal volumes of the CTAB solution and 0.6 - 10.0 ml of chloroform-isoamyl alcohol mixture (24:1 v/v) were added to the extracts. The tubes were incubated on a shaker (Mild Mixer PR-12, TAITEC) at a speed 5 at room temperature for 15-30 min. Phases were separated by centrifugation (3600-15000 rprn, 20 0 C, 5 min) and the supernatants were carefully transferred into new tubes with 0.6- 10.0 ml isopropanol. DNA pellets (12 000-15 000 rpm, 20 0 C, 20 min) were washed by 70% ethanol, resuspended in 0.3-1.0 ml TE and RNAse treated for 30 min. After two sequential chloroform extractions DNA samples were pelleted by adding 0.1-0.33 ml of 10 M NH 4 Ac and 0.3-1.0 ml of isopropanol (15 000 rpm, 20 0 C, 20 min). Pellets were washed by 70% and 99.5% ethanol and redissolved in 20-500 ml of 0.1 TE.
Southern Blotting
Isolated plant DNA was subjected to agarose gel electrophoresis and staining with ethidium bromide.
A Southern transfer assembly was constructed as follows: a sponge soaked in 0.4 M NaOH was placed in a Perspex tray. One sheet of filter paper soaked in 0.4 M NaOH was then placed over the sponge. The agarose gel was then overlaid on the soaked filter paper. A Hybond N+ membrane was then serially soaked in nanopure water and in 0.4 M NaOH for 30 seconds before being overlaid on the agarose gel. A further sheet of filter paper soaked in 0.4 M NaOH was then placed on top of the membrane, followed by a 10 cm stack of dry paper towels. A glass plate was then placed on top of the stack and the perspex tray was filled with 0.4 M NaOH.
The DNA was then allowed to transfer for at least 2 hours before disassembly of the transfer assembly. The membrane was then rinsed for 1 minute in 100 ml 2x SSC and blotted dry on filter paper.
The membrane was then probed with a 1.1 kb fragment of the hygromycin phosphotransferase gene (kpt) amplified from the vector pCAMBIA1380 using standard techniques.
EXAMPLE 7 Expression pattern of the TdPR61 promoter in barley
The expression pattern of the TdPR61 promoter was observed in barley transformed with GUS under the control of the TdPR61 promoter. Figures 2 and 3 show the expression of a GUS reporter under the control of the TdPR61 promoter in two transgenic barley lines, G81-2 and G81-11.
As shown in figures 2 and 3, GUS expression in the transgenic barley lines was
observed predominantly in the embryo surrounding region and later in the embryo. GUS expression was observed at 6 DAP and continued to be observed at 48 DAP, with the strongest expression being seen between 12 DAP and 15 DAP in the embryo surrounding region. Later expression of the GUS reporter is seen mainly in the embryo. No detectable expression was observed in other tissues.
EXAMPLE 8 Expression pattern of the TdPR61 promoter in isolated barley embryos and ESR
High resolution spatial analysis of the activity of TdPR61 promoter was performed in embryos and embryo surrounding regions (ESRs) isolated from transgenic barley grain (8-15 DAP). The isolated ESRs and embryos were stained to detect GUS activity. Results are shown in Figures 4 and 5.
Approximately 2 mL of GUS staining solution was added to each well, which contained several embryos and ESRs from the same transgenic line. The samples were vacuum infiltrated at 26 mm Hg for 20 minutes, the plates were then sealed with Parafilm and incubated in the dark at 37°C overnight (or at least 5 h). The GUS stain solution was removed, and the tissues were washed using an ethanol dilution series of 20%, 35% and 50% at 4°C. Treatment with each ethanol concentration was for at least 2 h. Whole mount images were captured with a LEICA MZFLIII stereomicroscope and LEICA DC 300F camera. The imaging software used was Image-Pro plus version 5.1.2.59 (Media Cybernetics).
EXAMPLE 9
Histochemical activity assays
β-glucuronidase activity in transgenic plants was analysed by histochemical staining using the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-glucuronic acid (X- Glue) (Bio Vectra) as described by Hull and Devic (Methods MoI Biol. 49: 125-141, 1995).
Different plant organs, whole grain and grain sections of different ages were immersed in a lmg/ml X-Gluc solution in 5OmM sodium phosphate, pH 7.0, 1OmM Na EDTA, 2mM FeK 3 (CN)6, 2mM K 4 Fe(CN)e and 0.1% Triton X-100. After vacuum infiltration at -75 KPa for 20 min, the samples were incubated at 37°C until satisfactory staining was observed. Tissues were then serially incubated in 20%, 35% and 50% ethanol before being fixed in FAA (50% ethanol, 10% glacial acetic acid, 5% formaldehyde) and cleared in 70% ethanol. Pictures were taken using a LEICA MZFLIII microscope and a LEICA P/N: 10446271 camera.
For wax embedding, grain sections were serially dehydrated in 80%, 95%, and 100% ethanol. The samples were then serially incubated in 25% xylene in molecular sieve 100% ethanol (1:3) for 1 hour; 50% xylene : 50% molecular sieve 100% ethanol (1:1) for 1 hour; and 100% xylene for 1 hour. The samples were then incubated in paraffin wax for at least 6 hours at 60 0 C. This step was repeated such that the wax was changed at least six times before embedding.
The sectioning and mounting was carried out on a Leica RM2265 Microtome. Each individual grain segment was cut into 12 μm-thick sections and the ribbons were mounted onto saline-coated slides. The slides were dried on a 42°C slide warmer overnight and deparaffinised.
For counter staining, the slides were soaked in xylene for 10 min and moved to fresh xylene for another 10 min or until the specimens were clear. The specimen on each slide was mounted in DPX medium and covered with a cover slip. The slides were air- dried in the fume hood overnight. The specimens were then observed using a compound microscope under bright-field illumination.
As shown in Figure 6 the histological assays showed GUS expression in the embryo surrounding region, particularly at the interface between the scutellum and the
remainder of the embryo (24 DAP). Later, expression is also seen in particular regions of the scutellum.
EXAMPLE 10 Expression pattern of the TdPR61 promoter in T2 generation transgenic barley
Figures 15 and 16 show the activity of the TdPR61 promoter in transgenic T2 generation barley lines. As shown in Figures 15 and 16, the TdPR61 promoter was active (observed as GUS staining) in the embryo and in the embryo surrounding region (ESR) in the T2 generation barley plants.
EXAMPLE 11 TdPR61 expression in wheat and promoter mapping
The activity of the TdPR61 promoter in wheat (Triticum aestivum cv. Bobwhite) was confirmed by observing expression of a TdPR61:GUS construct in wheat embryos transformed using biolistic bombardment. Results are shown in Figure 8.
Mapping of the promoter regions was also performed using biolistic bombardment of promoter constructs into embryos and ESR tissues isolated from wheat (Triticum aestivum cv. Bobwhite) at 12-14 DAP.
The full length promoter (TdPR61-l; SEQ ID NO: 3) and four truncated versions of the full length promoter, TdPR61-2 (SEQ ID NO: 13), TdPR61-3 (SEQ ID NO: 14), TdPR61-4 (SEQ ID NO: 15) and TdPR61-5 (SEQ ID NO: 16) were individually cloned in the pMDC164 binary vector upstream of a GUS gene. The resultant constructs were used for biolistic bombardment.
As shown in Figure 7, progressively shorter fragments of the TdPR61 promoter fused to the GUS gene resulted in a decreased number of GUS cfu. The location of putative
regulatory elements can be deduced from the obtained data: TdPR61-3 deletion (possibly close to or on the border with TdPR61-2 deletion) contains a cz ' s-element that is able to activate the promoter (cz ' s-element 1; SEQ ID NO: 17); while a fragment between the full length promoter and TdPR61-2 deletion contains a cz ' s-element defining a putative enhancer/modulator of activity (cz ' s-element 2; SEQ ID NO: 18), which increases promoter activity approximately 5 fold.
A second set of truncated TdPR61 promoters, was produced for more precise mapping of the distal cz ' s-element(s). These truncated promoters were designated TdPR61-l.l (SEQ ID NO: 19), TdPR61-1.2 (SEQ ID NO: 20), TdPR61-1.3 (SEQ ID NO: 21), TdPR61- 1.4 (SEQ ID NO: 22) and TdPR61-1.5 (SEQ ID NO: 23).
They were cloned in pMDC164 binary vector and used for mapping by the transient expression assay.
A putative cz ' s-element (Cz ' s-element 3;
ATGTCAAACCCACACACGAACCTACAAGAGCCAGCCACCCACCCACTATTTACACAG CAACAGC TACCGCACTCCGCACGTACACGCAAGAACTGAAACTTGGTGCCATGGCAAGGCTCTTTGC TGTG TGCTTGGTTCTGCTCGC; SEQ ID NO: 24) was localized on the 2164-2067 bp region of the TdPR61 promoter.
Analysis of SEQ ID NO: 24 using PLACE software (Higo et ah, Nucleic Acids Research 27(1): 297-300, 1999; Prestridge, CABIOS 7: 203-206, 1991) revealed three potential cz ' s- elements, which were found earlier to be responsible for embryo and endosperm specific expression.
The pair of predicted embryo specific elements (AAACCCACACACG; SEQ ID NO: 25) were adjacent one to another and had single base pair overlap, which is shown in bold in the sequence above.
The first predicted embryo specific element (AAACCCA; SEQ ID NO: 26) shows homology to the SEF3 binding site from a soybean (Glycine max) consensus sequence from the 5' upstream region of beta-conglydnin (7S globulin) gene (AACCCA(-27bp- )AACCCA). This is the binding site of soybean embryo factors, SEF2 and SEF3.
The second predicted embryo specific element (ACACACG; SEQ ID NO: 27) shows homology to the binding site of bZIP transcription factors DPBF-I and 2 (Dc3 promoter-binding factor-1 and 2) from carrot. Dc3 expression is normally embryo- specific, and also can be induced by ABA.
The predicted endosperm specific element (CACGTAC; SEQ ID NO: 28) is situated relatively close to the embryo-specific elements. This element shows homology to an element found originally in GIuB-I gene in rice which is required for endosperm- specific expression and conserved in the 5'-flanking region of glutelin genes.
Plasmid preparation for bombardment
Plasmid constructs were purified using commercially available kits. DNA-gold compositions for Biolistic transformation were then produced as follows: 50 μl of gold powder (1.0 μm) in 50% glycerol (60 mg/ml) was mixed with 10 μl DNA (1 mg/ml), 50 μl CaCb (2.5M) and 20 μl of 0.1 M spermidine. For co-transformation plasmids were mixed at a ratio 1:1 (5 μg + 5 μg). The mixture was vortexed for 2 min, followed by incubation for 30 min at room temperature, brief centrifugation, washing by 70% and 99.5% ethanol. Finally, the pellet was resuspended in 60 μl of 99.5% ethanol (6 μl/shot). In some experiments spermidine and CaCb were replaced with 10 μl of PEG/Mg. All manipulations were done at room temperature.
Bombardment
Microprojectile bombardment was performed utilizing the Biolistic PDS-1000/He Particle Delivery System (Bio-Rad). Immature embryos were pre-treated for 4 hours on MS2 medium supplemented with 100 g/1 sucrose.
Embryos (50/plate) were placed in the centre of the plate to form a circle with a diameter of 10 mm. These embryos were then bombarded under the following conditions: 900 or 1100 psi, 15 mm distance from a macrocarrier launch point to the stopping screen and 60 mm distance from the stopping screen to a target tissue. The distance between the rupture disk and the launch point of the macrocarrier was 12 mm.
Analysis of results The embryos were acclimated in the same media and stained for GUS activity after 24hr of acclimation. Three repeats (independent bombardment events, three plates) with ten embryos on each plate were used in the experiment. After GUS staining, the tissues were examined for GUS colour forming units (CFU) and images were captured using a LEICA DC 300F camera attached to a LEICA MZ FLIII stereomicroscope. The CFU were counted by eye using the images viewed with Microsoft Office Document Imaging.
Primers
The primers used for the amplification of the full length TdPR61 and truncated promoter regions for the wheat transformation and promoter mapping are shown below in Table 3.
TABLE 3 - Primers used for amplification of TdPR61 promoter regions li-jimm Sequence (5'-3') Sequence Identifier
EXAMPLE 12 Expression pattern of the TdPR61 promoter in rice
33 independent transgenic lines were selected using hygromicin selection and confirmed by PCR; strong GUS activity was detected in 22 of them, 6 lines showed no GUS activity, 4 lines showed very weak GUS activity. All lines showed the same pattern of GUS expression.
GUS activity was not detected before 7 DAP and during first 2-3 days could be seen mainly in the embryo and in the opposite pole of the grain. In one of transgenic plants (from 3 tested) it was also detected in vascular tissue of lemma at the 8 DAP (see Figure 9).
As shown in Figures 10 to 14, between 11 and 21 DAP GUS activity was detected in the embryo and weakly in the main vascular bundle (presumably in the ETC). Activity in ETC slowly diminished and after 21 DAP promoter activity was detected only in the embryo. Strong GUS activity could still be seen in the embryo and/or ESR at 69 DAP. At this point, in lines with weaker transgene expression GUS activity was detected in the scutellum, but not in the embryo axes. No analyses were performed at later stages of grain development. No GUS activity was detected in any other plant tissue.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The
invention also includes all of the steps, features, compositions and compounds referred to, or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features.
Also, it must be noted that, as used herein, the singular forms "a", "an" and "the" include plural aspects unless the context already dictates otherwise.
Next Patent: APERTURES OF A GRATE ELEMENT FOR A GRINDING MILL
