Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
SELECTIVE ANTI-VIRAL NUCLEOSIDE CHAIN TERMINATORS
Document Type and Number:
WIPO Patent Application WO/2002/074910
Kind Code:
A2
Abstract:
The present invention relates to dideoxynucleoside analog compounds containing a dideoxy ribofuranosyl moiety that exhibit selective anti-viral activity coupled with substantially low toxicity toward the host cells. In particular, the compoounds according to the present invention show potent inhibition of the replication of the human immunodeficience virus (HIV), while remaining substantially inert toward host cell DNA. Compounds according to the present invention exhibit primary utility as agents for inhibiting the growth or replication of retroviruses, particularly HIV. The compounds of the invention comprise a (2, 3'-dideoxy-$g(b)-ribofuranosyl) ring coupled to a heterocyclic nucleobase that lacks an '02 carbonyl', that enables them to selectively react with and inhibit viral reverse transcriptase, while remaining substantially unreactive toward human DNA polymerases.

Inventors:
Mclaughlin, Larry W. (28 Valley Road Dover, MA, 02465, US)
Fraley, Andrew W. (38 Elm Street, #2 West Newton, MA, 02465, US)
Chen, Dongli (219 Commonwealth Avenue, #44 Chestnut Hill, MA, 02467, US)
Lan, Tao (153 Perkins Street, #1 Somerville, MA, 02143, US)
Application Number:
PCT/US2002/007447
Publication Date:
September 26, 2002
Filing Date:
March 13, 2002
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
Trustees Of, Boston College The (140 Commonwealth Avenue Chestnut Hill, MA, 02467-3807, US)
Mclaughlin, Larry W. (28 Valley Road Dover, MA, 02465, US)
Fraley, Andrew W. (38 Elm Street, #2 West Newton, MA, 02465, US)
Chen, Dongli (219 Commonwealth Avenue, #44 Chestnut Hill, MA, 02467, US)
Lan, Tao (153 Perkins Street, #1 Somerville, MA, 02143, US)
International Classes:
A61K31/70; A61P31/12; C07D471/02; C07H19/048; C07H19/052; C07H19/06; C07H19/10; C07H19/23; (IPC1-7): C12N/
Domestic Patent References:
WO1994018971A11994-09-01
WO1994001117A11994-01-20
Foreign References:
EP0236935A21987-09-16
EP0043722A11982-01-13
EP0038569A21981-10-28
US4092472A1978-05-30
Other References:
CHEN ET AL.: 'Use of pKa differences to enhance the formation of base triplets involving C-G and G-C base pairs' JOURNAL OF ORGANIC CHEMISTRY vol. 65, no. 22, 03 November 2000, pages 7468 - 7474, XP002955747
HILDBRAND ET AL.: 'Synthesis of carbocyclic C-nucleosides containing nonnatural pyrimidine bases' HELVETICA CHIMICA ACTA vol. 79, no. 3, 1996, pages 702 - 709, XP002955748
AOYAGI ET AL.: 'Nucleosides and nucleotides 115. Synthesis of 3-alkyl-3-deazainosines via palladium-catalyzed intramolecular cyclization: a new conformational lock with the alkyl group at the 3-position of the 3-deazainosine in anti-conformation' TETRAHEDRON LETTERS vol. 34, no. 1, 01 January 1993, pages 103 - 106, XP000653639
SERAFINOWSKI ET AL.: 'Synthesis and antiviral activity of some new S-adenosyl-L-homocysteine derivatives' JOURNAL OF MEDICINAL CHEMISTRY vol. 35, no. 24, 27 November 1992, pages 4576 - 4583, XP002955749
Attorney, Agent or Firm:
Evans, Paula Campbell (Palmer & Dodge LLP 111 Huntington Avenue Boston, MA, 02199-7613, US)
Download PDF:
Claims:
CLAIMS
1. A compound of the formula: X represents C=O, C=S, CR7R8 ; Y represents CR3, N; Rl represents H, F, Cl, Br, I, CH3, CF3 ; R2 represents NHR wherein R is is H, lower straight or branched chain alkyl alkenyl or alkynyl comprising 1 to 6 carbons, which may be substituted; R2'represents 0, S, NH, Se R3 is H, lower straight or branched chain alkyl alkenyl or alkynyl comprising 1 to 6 carbons which may be substituted, F, Cl, Br, I ; R4 is H, lower straight or branched chain alkyl alkenyl or alkynyl comprising 1 to 6 carbons, which may be substituted; Rs is H, F, OH; R7 and R8 independently represent H, F, OH, N3+, provided that when wherein Y = CH, R2=NH2, R1 and R4 are both H, and X = CR7H or CHRg, R7 and R8 are both not OH; P (O) (OH) 2, CH2P (O) (OH) 2, OP (O) (OH) 2, OP (O) (OR, 1) 2, wherein RIO is straight chain or branched alkyl and Rl l is a protective substituent of a hydroxyl group; and Rio represents CH2, O, S, or a pharmaceutical complex or salt thereof.
2. A compound of Claim 1 wherein X is C=O, CR7R8 ; Y is CR3, N; Ri, R4, R5, R6, R7 and R8 are H; R2 is NH2 ; R2'is 0 ; R3 is H, CH3; R9 is OH, Rio is 0.
3. A compound of Claim 1 comprising the D isomer, the L isomer, mixtures thereof, or a racemate.
4. A compound of Claim 1 which is 2amino5 (2', 3'dideoxypDribofuranosyl)pyridine, 2amino5 (2', 3'dideoxylpLribofuranosyl)pyridine, mixtures thereof and racemic 2amino5 (2',3'dideoxyßribofuranosyl)pyridine.
5. A compound of Claim 1 that is capable of selectively inhibiting viral RNA, but incapable of inhibiting mammalian DNA polymerase.
6. The virus of claim 5 which is human immunodeficiency virus.
7. A process for preparation of the compound of Claim 1 comprising the steps of : i) selectively protecting the 5'hydroxyl group of a 2'deoxynucleoside ; ii) oxidation of the unprotected 3'hydroxyl group into the corresponding 3'ketone group; iii) converting the 3'ketone group to the corresponding 3'hydrazone, 3'thiocarbonate or 2', 3'cyclic silyl ether group ; and iv) reduction of said 3'hydrazone, 3'thiocarbonate and 2', 3'cyclic silyl ether group to a methylene group.
8. A method of treating a viral infection in a human comprising administering an effective amount of a compound of Claim 1.
9. The method of claim 8 wherein the viral infection is an HIV infection.
10. The method of claim 8 comprising bringing virus infected cells in contact with the compound of claim 1.
11. A pharmaceutical composition which comprises as active ingredient a compound according to claim 1 or a pharmaceutically acceptable salt, ester, or the 5"mono, dior tri phosphate thereof, optionally in combination with a pharmaceutically acceptable carrier.
12. The composition of claim 11 wherein the carrier is suitable for intravenous delivery.
13. The composition of claim 11 wherein the carrier is suitable for parenteral delivery.
14. The composition of claim 11 wherein the carrier is in the form of a tablet suitable for oral administration.
15. A diagnostic device comprising a compound of claim 1.
Description:
SELECTIVE ANTI-VIRAL NUCLEOSID CHAIN TERMINATORS STATEMENT AS TO FEDERALLY FUNDED RESEARCH The present invention was made with partial support from the National Science Foundation Grant No. MCB 0077667. The United States Government retains certain rights to the invention.

FIELD OF THE INVENTION This invention relates to biologically active dideoxy nucleoside analogs and includes their physiologically acceptable derivatives and salts. Compounds of the invention exhibit selective activity against retroviruses, and in particular against human immunodeficiency virus (HIV). The present invention also relates to pharmaceutical compositions containing these compounds and to methods of inhibiting the replication of HIV virus while remaining substantially chemically inactive to mammalian DNA in the host cell, as well as treating HIV viral infections in mammals, particularly in humans.

BACKGROUND OF THE INVENTION Retroviruses are a class of viruses having a single-stranded RNA genome that reproduce in a host organism by generating a DNA copy of its genome by action of a virally coded RNA- directed DNA polymerase, reverse transcriptase. Reverse transcriptase can construct double- stranded DNA molecules from the single stranded RNA of the viral genome. The most notorious retrovirus is the human immunodeficiency virus (HIV), which is responsible for the generally fatal disease, acquired immune deficiency syndrome (AIDS). Although the disease itself has been studied greatly, it has been treated only with limited success.

A number of nucleosides have been utilized in the treatment of HIV infections. 3'--azido- 3'-deoxythymidine (AZT) is a prime example, although its ability to completely reverse the progress of the disease remains unconfirmed. A number of 2', 3'-dideoxynucleoside analogs have also been reported to exhibit activity against HIV, including 3'-deoxy-2', 3'-didehydrothymidine (d4T), the carbocyclic analog of 2', 3'-dideoxy-2', 3'-didehydroguanosine (Carbovir), 2', 3'- dideoxycytidine (ddC), 3'-azido-2', 3'-dideoxyguanosine (AZG), 2', 3'-dideoxyinosine (ddI), 2', 3'- dideoxy-2', 3'-didehydrocytidine (d4C), 3'-fluoro-2', 3'-dideoxyadenosine, 3'-fluoro-3'- deoxythymidine and 3'-azido-2', 3'-dideoxyuridine. Some of these analogs, including ddC, are presently used as anti-HIV agents. Among the dideoxynucleosides, ddC has been shown to be a potent inhibitor of HIV.

Although research has concentrated on developing an effective treatment for AIDS and certain potent anti-HIV nucleoside analogs have been synthesized and characterized, an ideal drug has not been found. The major limitation in providing an optimized drug for treatment against retroviral infections, including HIV, remains the inability to provide the necessary anti- viral activity while maintaining minimal toxicity to the host cell (mammalian DNA).

The viral replication process is believed to be an important event in the progress of AIDS.

It is also believed that the enzyme reverse transcriptase plays an essential role in the replication and life cycle of HIV, and consequently, in furthering the progress of the disease. The development of potential drugs for AIDS have therefore attempted to target this enzyme, especially because of it is absent in the uninfected host cell.

Anti-retroviral nucleoside derivative compounds such as azidothymidine (AZT), dideoxyinosine (ddl) and dideoxycytidine (ddC) function by inhibiting the activity of HIV reverse transcriptase. The mode of action for such compounds primarily requires their conversion to the corresponding 5'-triphosphates, thereby enabling them to function as substrates for reverse transcriptase. Upon incorporation of such chain terminating nucleoside triphosphates, DNA synthesis of the HIV cDNA genome is terminated, thus inhibiting replication by the virus. A

common problem with chain terminating nucleosides is that they exhibit significant toxicity toward non-infected healthy cells. This is presumably due to the fact that they also function as chain terminators for human DNA polymerases and therefore, interfere with normal DNA replication. The introduction of an azido functionality at the C3'-position of the furanosyl ring in AZT provides some discrimination, such that it is not accepted as well by human DNA polymerases. Nevertheless, AZT is one of the most effective anti-HIV compounds presently in clinical use.

SUMMARY OF THE INVENTION The present invention relates to synthetic nucleoside analogs and derivatives thereof that selectively exhibit potent anti-viral activity (in particular, anti-HIV activity) while remaining inert towards mammalian DNA polymerase, thereby resulting in significantly reduced toxicity to the host cell. In contrast to the prior art compounds, the nucleoside analogs and derivatives of the present invention represent a viable therapeutic approach to retrovirus infections, particularly for the inhibition of HIV and the treatment of AIDS. Compounds of the present invention can be used to inhibit the growth or replication of HIV or other retroviruses e. g. human T-lymphotropic virus type III (HTLV III), lymphadenopathy-associated virus (LAV), as well as Hepatitis B virus (HBV).

In one aspect, the present invention relates to nucleoside and nucleotide analog compounds that are capable of selectively reacting with viral RNA, while remaining substantially inert and unreactive towards mammalian DNA. More particularly, the present invention relates to nucleoside and nucleotide analog compounds that are capable of (i) exhibiting differential reactivity towards human polymerases a, P and y relative to reverse transcriptase with respect to their ability to be viable substrates for the enzymes; and (ii) effecting selective chain termination of the DNA replication process initiated by reverse transcriptase, thereby resulting in the inability of the virus to replicate in the infected host without terminating chain replication by human DNA

polymerases. The compounds of the present invention, therefore, do not interfere with processes initiated by human DNA polymerases, thereby rendering them substantially non-toxic compared to presently known nucleoside analog reverse transcriptase inhibitors.

The nucleoside analog compounds of the present invention comprise a combination of two important structural attributes that enable them to exhibit selectivity in their ability to react with viral reverse transcriptase but not with human polymerases: (1) absence of the 3'-hydroxyl group in the ribofuranosyl ring; and (2) absence of an 02-carbonyl group (pyrimidine analogs) or the N3-nitrogen (purine analogs) from the heterocyclic aromatic ring (i. e. the nucleobase portion of the compound). For the pyrimidine analogs, the Nl-nitrogen is also replaced by carbon in order to maintain correct base pair complementarity.

The absence of the 3'-hydroxyl group in the ribofuranosyl ring is an important structural feature in the compounds of the invention that is key to their ability to effect efficient termination of DNA polymer synthesis mediated by reverse transcriptase. Although such chain termination does not distinguish between enzyme type (it occurs both for the host processes as well as for the viral process), the presence of the altered heterocyclic nucleobase results in selective incorporation of the corresponding 2', 3'-dideoxy derivative by the viral-mediated process without affecting the processes initiated by human DNA polymerases a, P or y. Specifically, the absence of the 02 carbonyl in the nucleobase portion of the compounds prevent them from functioning as viable substrates for DNA polymerase, thereby rendering them chemically inert to host cell DNA. Stated another way, the absence of the 3'-hydroxyl group in the ribofuranosyl ring promotes chain termination of reverse transcriptase, and the absence of the 02 carbonyl group (or N3-nitrogen) in the nucleobase promotes selectivity between reverse transcriptase and host DNA polymerase.

In one aspect, the nucleoside analog compounds of the present invention comprise deoxy derivatives of cytosine and thymine, coupled to a furanosyl carbohydrate or derivative thereof

and their corresponding nucleotide analogs which further comprise a triphosphate substituerit. In another aspect, the present invention pertains to triphosphate ribofuranosyl or related carbohydrate derivatives of pyridine, pyrimidine, azabenzimidazole and purine compounds wherein the 3'-hydroxyl group in the furanosyl ring is absent. Compounds belonging to this class have been found to be highly discriminating towards different enzyme types; they are viable substrates for the less selective viral reverse transcriptase, but essentially non-viable substrates for the more selective human DNA polymerases, due to the absence of the 02-carbonyl group from the heterocyclic aromatic ring.

The compounds of the present invention are useful for inhibiting the activity of reverse transcriptase. Thus, they are useful therapeutically as anti-viral drugs as well as in diagnostic applications. The compounds of the invention can also be used alone or in combination with other modified nucleosides and/or naturally occurring nucleosides to prepare oligonucleotides which can be used, for example, as probes or primers in diagnostic applications.

The therapeutic aspect of the present invention relates to methods for treating retroviral infections, including HIV infections in mammals, particularly in humans. The methods of the invention for the treatment of retroviral infections comprise administering the anti-viral nucleoside compounds of the invention in effective amounts sufficient to inhibit the growth or replication of such viruses in the animal or human being treated.

Pharmaceutical compositions based on the compounds of the invention comprise the nucleoside analog compounds in a therapeutically effective concentration for treating a viral infection, particularly HIV infection, optionally in combination with pharmaceutically acceptable additives, carriers or excipients. Additionally, the nucleoside compounds of the invention, in pharmaceutical dosage form, may also be used as prophylactic agents for inhibiting the growth or replication of retroviruses. Such agents are particularly effective as anti-HIV agents.

While not being limited by way of theory, it is believed that the compounds of the present

invention induce their inhibitory effect on replication of viruses, particularly HIV, by selectively reacting with and inhibiting the activity of enzymes responsible for virus replication, such as reverse transcriptase, while remaining chemically unreactive towards mammalian DNA polymerases.

The compounds according to the present invention are produced by synthetic methods and functional group transformations that are readily known to those of ordinary skill in the art; preferred synthetic processes are described in the Examples herein.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the incorporation of a nucleoside triphosphate into a growing primer/template complex Figures 2-11 illustrate chemical structures of the compounds of the invention. Schemes pertaining to the synthesis of particular compositions are referenced in the Examples set forth herein.

Figure 12 is a gel chromatograph showing primer extensions exhibited by the nucleoside analogs using human polymerase P and HIV reverse transcriptase.

Figure 13 is a gel chromatograph showing primer extensions exhibited by the nucleoside using human polymerase a and y.

DETAILED DESCRIPTION OF THE INVENTION The following terms and definitions are used throughout the specification to describe the present invention.

The numbering system used in the following descriptions is that standard for common pyrimidine and purine nucleosides even though changing the heteroatom nature of the heterocycles-particularly for the pyrimidines-would require changes in the nomenclature to

correctly describe positions in the heterocyclic ring. In the experimental synthesis descriptions the correct IUPAC nomenclature has been used. Thus, the compound la is the 2', 3'- dideoxynucleoside known as ddC. In the standard nomenclature for common pyrimidine nucleosides, the carbonyl of the ring is the 02-carbonyl designating its attachment to the C2- carbon of the heterocycle Ia. The NI-nitrogen is the site of attachment of the 2', 3'- dideoxycarbohydrate ring. One of the analogs described in this invention is illustrated by structure Ib. This derivative is described as a pyrimidine analog with the 02-carbonyl deleted and the N1-nitrogen replaced by carbon so that the structure can readily be related to that containing the corresponding natural heterocycle (Ia). But in fact, changes in the heteroatom character of the heterocycle require, according to the rules of nomenclature, that the remaining ring nitrogen of structure Ib be designated as the 1-position. The amino group of ddC (Ia) is attached to the C4-carbon, but in the analog it is formally attached to the carbon at the C2- position. Similarly, the atom that links the heterocycle to the carbohydrate ring in ddC is the nitrogen at position 1, in the analog this atom is a carbon, and is now, by virtue of the vagaries of the naming rules, located at position 5. Therefore for the description of the materials of the invention we note positional differences according to the standard pyrimidine nucleoside numbering positions (Ia), while in the synthetic descriptions the formal IUPAC nomenclature is used. The compound Ib then formally becomes 2-amino-5- (2', 3'-dideoxy-D-ribofuranosyl)- pyridine.

The term"deoxy"refers to describe ribofuranosyl moieties that contain a hydrogen in place of a hydroxyl group in the 2'positions of the sugar in the present compounds.

The term"dideoxy"refers to describe ribofuranosyl moieties that contain hydrogens in place of hydroxyl groups in the 2'and 3'positions of the sugar in the present compounds.

The term"didehydro"refers to describe ribofuranosyl moieties that contain a double bond. For example 2'3'-carbons of the sugar in the present compounds.

The term"02 carbonyl"refers to a carbonyl group on the C-2 carbon atom in the natural pyrimidine nucleosides and"N3-nitrogen"refers to the nitrogen at the 3-position in the purine rings, of the present compounds.

The term"inhibitory effective concentration"or"inhibitory effective amount"as used herein refers to concentrations or amounts of compounds according to the present invention which substantially or appreciably inhibit the growth or replication of susceptible viruses, includingHIV.

The term"therapeutic effective amount"as used herein refers to concentrations or amounts at which compounds according to the present invention are therapeutically effective in treating retroviral infections, and in particular, HIV infections in humans.

The term"L-conformer"and"D-conformer"as used herein refer to stereochemical configurations of the dideoxyribofuranosyl moiety in compounds according to the present invention.

The present invention is based on the discovery that certain dideoxynucleoside analogs which comprise a dideoxy ribofuranosyl moiety having a pyridine, pyrimidine or purine derivative as a substituent in which the"02"carbonyl group or the"N3"nitrogen is absent exhibit selective activity against retroviruses, particularly against HIV, while remaining relatively inert towards mammalian DNA polymerases. In particular, the compounds according to the present invention show potent inhibition of the replication of the viruses, combined with low toxicity to the host cells (i. e., animal or human tissue).

Unlike bacterial DNA polymerases, human DNA polymerases will completely avoid the use of pyrimidine-like triphosphate analogs lacking the"02-carbonyl"as substrates, while reverse transcriptase is able to use them as viable substrates. The absence of the 02-carbonyl in these triphosphate analogs ensures that the formation of the critical hydrogen bond that stabilizes the incoming triphosphate in the correct position during DNA synthesis is precluded, thereby rendering the present nucleotides non-viable as substrates for human DNA polymerases. Reverse transcriptase on the other hand, being a less specific enzyme, is still able use such triphosphate analogs as substrates. The differential ability of triphosphate analog compounds of the present invention to function as viable substrates only towards reverse transcriptase provides a class of potent inhibitors for processes initiated by reverse transcriptase that remain substantially inert and non-toxic to the normal DNA replication processes in mammalian cells.

The present invention comprises novel nucleoside and nucleotide analog compounds containing a base residue that is discriminated against by human DNA polymerase but is accepted by HIV reverse transcriptase. The selectivity is achieved by elimination of the 02- carbonyl substituent from the pyrimidine-like nucleotide analog or the N3-nitrogen from the purine-like nucleotide analog (as well as converting the N1-nitrogen to a carbon to maintain base pairing complementarity), thereby precluding interaction with human DNA polymerase. Another key attribute of the compounds of the present invention is the absence of a hydroxyl substituent in the 3'position of the furanosyl ring of the nucleoside segment, thereby effecting chain termination of the HIV reverse transcriptase primer. Therefore, the combination of these attributes endows the present compounds with the ability to affect selective termination of DNA polymerization mediated by reverse transcriptase.

The fundamental chemistry involved in the elongation of the primer is illustrated in Figure 1. The 3'-hydroxyl of the terminal residue of the primer attacks the 5'-triphosphate of the incoming dNTP derivative forming the phosphodiester bond linking the new residue to the terminus of the primer. The new 3'-hydroxyl group subsequently functions as a nucleophile towards the next incoming triphosphate. Selection of the dNTP derivative is dependent largely upon the rules of complementary affinity (e. g., G selects C, C selects G, A selects T and T selects A). Most chain terminating nucleosides function via elimination of the 3-hydroxyl substituent of the incoming dNTP after its incorporation. It has been discovered that absence of the 3'-hydroxyl in the furanosyl ring in the compounds of the invention effects chain termination in reverse transcriptase mediated polymerization, but not in syntheses mediated by human DNA polymerases. The ability of such nucleoside and nucleotide analog compounds to present themselves as substrates selectively to reverse transcriptase, in particular to HIV reverse transcriptase, coupled with their ability to effect chain termination, enables them to function as effective chain terminators specifically towards processes initiated by HIV reverse transcriptase without affecting the chain elongation process that is initiated by human DNA polymerases.

Examples of compounds of the present invention include triphosphate sugar derivatives of pyridine and pyrimidine bases, including deoxycytosine, deoxy and dideoxy thymine, deoxy and dideoxy uracil and related compounds. In one embodiment, the compounds of the invention comprise analogs of purine bases, including adenine and guanine analogs. The general classes of pyridine and pyrimidine analog compounds in a preferred embodiment of the invention are described by Formulas IIa-d. In another preferred embodiment, the nucleoside analogs are purine analog compounds of the invention are described by Formulas nia-d. wherein: X = CO, CS, CR7R8 Y= CH, N R, is H, F, Cl, Br, I, CH3, CF3 R2 is NHR wherein R is lower alkyl comprising 1 to 6 carbons R3 = H, lower alkyl comprising 1 to 6 carbons, CH2C#CH, F, Cl, Br, I.

R4 = H, lower alkyl comprising 1 to 6 carbons, CH2C#CH

R5 = H, F, OH R7, = H, F, OH, N3+ Rs=H, F, OH R9 = OH, P (O) (OH) 2, CH2 P (O) (OH) 2, OP (O) (OH) 2, OP (O) (OR) 2 wherein R is a hydroxyl protecting group.

Rio = CH2, O, S Compounds of the invention may be optical isomers that have D and L conformers. All single optical isomers, enantiomerically enriched isomers and combinations thereof, including racemic mixtures are included herein. Examples of D-pyridine analog compounds of the invention are shown in Figures 2 (a-c) 3 (d-f), (g, h) and 5 (i, j) ; the corresponding L conformers are shown in Figures 6 (a-d), 7 (e-h). Examples of D-pyrimidine analog compounds of the invention are shown in Figure 8 (a-d); the corresponding L isomers are shown in Figure 9 (a-d).

The general classes of D-purine analog compounds of the present invention are shown in Figure 10 (a-c) and Figure 11 (d-f) ; the corresponding L-isomers of the purine compounds are obtained in a manner analogous to the pyridine and purine compounds.

In a preferred embodiment, compounds of the present invention comprise 5'-triphosphate ß-D-ribofuranosyl derivatives of pyridine and azabenzimidazole compounds, wherein the 3'- hydroxyl substituent in the furanose ring that is pre-requisite for subsequent elongation of the residue by the HIV reverse transcriptase is absent. In another preferred embodiment, 5'- triphosphate ß-D-ribofuranosyl pyridine and its derivatives (wherein the 2'and 3'-hydroxy groups in the ribofuranosyl ring are eliminated) are obtained by reacting the corresponding (2', 3'- dideoxy-p-D-ribofuranosyl)-pyridine compounds with trimethylphosphate, phosphorous oxychloride and tetra-n-butylammonium pyrophosphate (Scheme 1).

The nucleosides of the present invention wherein the critical 3'-hydroxy functional group is absent can still base pair effectively with their complementary partner and function as substrates

for HIV reverse transcriptase, but substantially inert toward human polymerases. This type of enzyme discrimination on the basis of the heterocyclic moiety enables the development of potentially potent HIV chain terminators that are relatively less toxic to humans in comparison with presently known inhibitors.

P-D-ribofuranosyl pyridine 5'-triphosphate P-D-ribofuranosyl pyridine Scheme 1 Compounds of the present invention include, but are not limited to, derivatives of pyrimidine and azabenzimidazole nucleoside analog derivatives, examples of which are shown below: Pyridine derivatives Azabenzimidazole derivatives

A synthetic scheme for 2-amino-5-(2',3'-dideoxyl-ß-D-ribofuranosyl)-pyridine is shown and described in Scheme 2 below, which can be used to prepare the D-conformer of the 2APy type nucleosides and nucleotide analog derivatives of the invention. i. I2/HIO4/H2SO4/HOAc/H20, 80°C, 4h, 83%, ii. (dba) 2Pd0/Ph3P/iPr2EtN/CH3CN, 95°C, 30h, 92%; iii. nBu4N+F-/CH3COOH/THF, 0°C, 97%; iv. CH3C6H4SO2NHNH2/ MeOH, rt, overnight, 97%; v. NaHBOAc/HAc/CHgCN, rt, 2h, 86%, Scheme 2 A synthetic scheme for 2-amino-5- (2', 3'-dideoxyl-p-L-ribofuranosyl)-pyridine is shown and described in Scheme 3 below, which can be used to prepare the L-conformer of the 2APy type nucleosides and nucleotide analog derivatives of the invention.

(vi) (dba) 2Pd°/Ph3P/i-Pr2EtN/CH3CN (vi) nBu4N+-F (vii) p-toluylsulfonylhydrazide (viii) Na (OCOCH3) 3BH, CH3COOH/CH3CN.

Scheme 3 The compounds of the invention can be also obtained as the corresponding phosphate or phosphate derivative analogs. For example, the compounds of the invention can be a neutral 5'- phosphate derivative represented by compound IV shown below. H3Cn COOCH3 NU 90Po5'-Nucleoside o IV

In a one embodiment, the compound IV is a phosphoralaniate derivative of 2-amino-5- (2', 3'- dideoxyl- (3-D-ribofuranosyl)-pyridine 11 (shown below), which is obtained by reacting 2-amino- 5- (2', 3'-dideoxyl-p-D-ribofuranosyl)-pyridine 7 with a phosphoranilate compound, such as for example, those described in the art (Qui et al., Antiviral Research, (1999), 43,37.).

The nucleosides of the present invention wherein both the 02 carbonyl in the pyridine, pyrimidine and azabenzimidazole ring and the critical 3'-hydroxy functional group in the ribofuranosyl ring are both absent, can also be prepared according to the synthetic process shown in Scheme 4 below. The process results in the conversion of 2'-deoxynucleoside 14 to the corresponding 2', 3'-dideoxynucleoside 17. In this procedure, the 5'-hydroxyl in 14 is protected in a high yield step with tBDMSi-Cl to give silyl ether 15. The 3'-OH is subsequently oxidized to the corresponding keto group in nearly quantitative yield using 1, 1, 1-triacetoxy-1, 1-dihydro-1, 2- benziodoxol-3-(lH)-one (Dess-Martin periodinane reagent). With a simple work up, without further purification, the 3'-keto derivative is converted to the corresponding hydrazone 16. The hydrazone is then reduced in high yield to the 2'3'-dideoxy compound 17.

(i) tBDMSi-Cl, (ii) Dess-Martin Periodinane, (iii) p-toluylsulfonylhydrazide, (iv) Na (OAc) 3H/CH3COOH/CH3CN, (v) nBu4N+~F Scheme 4 Another method of affecting a similar transformation by the process of the invention utilizes a synthetic reaction sequence known in the art for deoxygenation of alcohols. (Robins, et al. J. Am. Chem. Soc. 1981,103,932, Id., Pankiewicz, K. et al., J. Org. Chem. 1982,47,485.

Serafinowski, P. Synthesis-Stuttgart, 1990,757). The 5'-OH of diol 14 is protected as a silyl ether, following which the 3'-OH is converted to thiocarbonate 18. Thiocarbonate 18 is then treated with Bu3SnH and a free radical initiator such as AIBN to effect deoxygenation and yield the 2'3'-dideoxy compound 17 (Scheme 5). i. tBDMS-Cl/py, ii. PhOCS-Cl, iii. Bu3SnH/AIBN, iv. n-Bu4N+F- Scheme 5 A variation of the oxidation/reduction process described in Scheme 5 can also be used to convert ribonucleosides to 2'-deoxyribonucleosides by a method of the invention illustrated below in Scheme 6. The process involves protection of the 3'-and 5'-hydroxyls of triol 19 as the bis-silyl ether 20. The unprotected 2'-OH is then oxidized, converted to the corresponding

hydrazone and reduced, following which removal of the bis-silyl ether group generates the 2'- deoxynucleoside 14.

(i) (i-Pr2Si-Cl) 20/py (ii) Dess-Martin Periodinane (iii) p-toluyolsulfonylhydrazide (iv) Na (OAc) 3H/CH3COOH/CH3CN (v) n-Bu4N+F-, (v) H2/Pd-C Scheme 6 The present invention also provides an alternative deoxygenation method for the conversion of ribonucleosides to 2', 3'-dideoxynucleosides as shown in Scheme 7 utilizing either methods a or b, wherein triol 19 is converted to alkene 20, followed by reduction to give 17. HOB HO _ ? HOX O H H method a or b 19 21 17 method a: (i) tBDMS-Cl, (ii) SOCl2, (iii). NaIO4.RuCl, (iv). Na+-naphthlenide, (v) n-Bu4N+-F, (vi)H2/Pd-C method b: (i) tBDMS-Cl, (ii) Ms-Cl/py, (iii) Na2Te, (iv) n-Bu4N+-F, (v) H2/Pd-C.

Scheme 7

Differential selectivity exhibited by human DNA polymerases and HIV reverse transcriptase towards 2APy type analog compound: The differential selectivity between human DNA polymerases and HIV reverse transcriptase for compounds of the present invention as a substrate is illustrated in the experiment for the following primer/template complex: 5'CAATAGGAACCCATGTACCGTAA ppp*C 5'CAATAGGAACCCATGTACCGTAA*C 3'GTTATCCTTGGGTACATGGCATTGTCACTC 3'GTTATCCTTGGGTACATGGCATTGTCACTC wherein ppp*C = dd2ApyTP = The nucleoside incorporation experiment for one of the modified nucleotide analog compounds of the present invention is illustrated in Figures 12 and 13. In Figure 12, the right- hand side shows the results for human polymerase ß and the left-hand side shows the results for HIV reverse transcriptase. The first nucleoside added to the primer should be a C residue (coded by the G residue of the template). A single triphosphate of dC or the above analog is offered to the enzyme/primer/template complex. The dCTP is incorporated by human polymerase ß in the normal fashion and produces a band that is higher in the gel since the primer has been extended by one residue (dCTP lane, right-hand sides of Figure 12). By comparison, this same experiment with the HIV RT results in two additions of the nucleoside, one specifically for a template dG residue and one non-specifically. In the remaining lanes of the gel, experiments have been designed with only the analog dd2ApyTP present with the primer template complex.

No incorporation is observed by the human polymerase ß even after extensive incubation periods

at any concentration of analog triphosphate. HIV reverse transcriptase is a less specific enzyme than DNA polymerase, and therefore exhibits different characteristics under identical conditions.

As shown in Figure 12 left, the n=1 elongation product is present at every concentration and the higher the concentration of analog triphosphate, the better is the incorporation.

Figure 13 illustrates the results for polymerases a and y. The dCTP experiment contains only the native dCTP triphosphate and normal incorporation into the primer in response to a template dG is observed for both enzymes. DNA polymerase a is unable to incorporate the analog regardless of concentration (left-side panel, Figure 13). The results for DNA polymerase y are similar, although as the concentration of the analog triphosphate is increased, some minor amounts of incorporation are observed (right-hand panel, Figure 13).

Compounds of the present invention can be used in the treatment of viral infections, especially retroviral infection such as those caused by HIV. Compounds of the present invention also may have therapeutic applications for treating HIV infections because they are specifically recognized and incorporated by HIV reverse transcriptase, but not by human DNA polymerases.

The selectivity exhibited by compounds of the present invention provides a new class of potent inhibitors of HIV and other retroviruses with reduced mammalian toxicity, particularly in humans.

The modified nucleoside compounds of the present invention may be useful therapeutically as anti-viral drugs. They may also be incorporated into RNA, which may be useful for diagnostic applications. The nucleoside compounds of the invention can also be used, either alone or in combination with, other modified nucleosides and/or naturally occurring nucleosides, to prepare oligonucleotides. The general principles for their use in said applications are summarized below.

Use as Antiviral Compounds Several modified nucleosides are known to possess anti-viral activity. These are often

modified nucleosides, where the modification is at the 2'or 3'positions. Modified nucleosides can inhibit viral replication by inhibiting viral thymidine kinase by slowing replication.

Replication is slowed by reducing the amount of nucleotide monophosphates available.

Alternatively, nucleoside analogs like acyclovir take advantage of the different specificity of the thymidine kinases, viral and human, by only being phosphorylated by the viral enzyme. The phosphorylated nucleoside is subsequently incorporated by the infected cells, resulting in chain termination and cell death. The nucleoside compounds of the invention can be modified in a manner so as to be phosphorylated by viral kinases, in preference to the human kinases, leading to specificity and reduced toxicity. Modifications that result in increased specificity to viral kinases are well known to those of skill in the art. For example, the 3'position can be modified to contain an azide moiety, as in AZT. The structural modifications at the 2'and 3'positions of the ribofuranosyl ring, the modified nucleoside analog compounds of the invention are therefore, capable of have anti-viral activity similar to AZT. In addition, the compounds of the invention, unlike AZT, due to the absence of the 02 carbonyl in the nucleobase segment of the molecules are expected to be chemically inert to the host cell. Compounds of the invention are therefore capable of exhibiting selective antiviral activity while maintaining substantially reduced toxicity.

Methods for screening anti-viral activity are well known to those of skill in the art. Methods for administering nucleic acid-based protease inhibitors, such as AZT and ddI, to humans for tratedment of viral diseases such as HIV also are known.

Pre-and Post-SELEXModification The nucleoside compounds of the invention can be used to prepare oligonucleotides, either alone or in combination with other modified nucleosides and/or naturally occurring nucleosides. One problem associated with using naturally occurring nucleosides in therapeutic and in vivo diagnostic uses is that the oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. Chemically modified nucleosides have been known to increase the in vivo stability of the oligonucleotides. It is preferred that the

nucleosides be modified in such a way as to provide increased in vivo stability. When the nucleosides are used to prepare oligonucleotides according to the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) methodology, they can be used in both pre-and post-SELEX modification. Pre-SELEX modifications yield oligonucleotides with both specificity for their SELEX target and improved in vivo stability. Post-SELEX modifications made to nucleosides can result in improved in vivo stability without adversely affecting the binding or interacting capacity of the oligonucleotides.

Diagnostic Uses Nucleosides of the invention when modified to contain a radiolabel, a fluorescent tag such as rhodamine or fluorescein, are biotinylated, can be detected after the nucleoside is incorporated into viral RNA. Such embodiments are particularly useful as in vivo or in vitro diagnostics, e. g. for detection of HIV. Oligonucleotides that include the modified nucleosides of the invention can also be labeled, and when they specifically bind to or interact with a target site, the binding or interaction can be observed by detecting the label. This can be useful as a diagnostic tool, to determine whether a particular binding site is present in a sample by adding a specific oligonucleotide that selectively binds to or interacts with the site, washing away unbound oligonucleotide, and observing binding or interaction by looking for the label.

The synthesis of examples of the compounds of the invention and their ability to selectively react with viral reverse transcriptase is described in the following examples, which are not intended to be limiting in any manner with regards to the scope of the invention.

EXAMPLES 1. Synthesis of 2-amino-5-(2', 3'-dideoxy-ß-D-ribofuranosyl)-pyridine In general, compounds of the present invention are synthesized according to the synthetic methods described below. The methods utilized to synthesize the present compounds represents modifications of literature procedures. The references from which related chemical reactions have been modified to provide the present compounds are set forth in the examples below.

Spectroscopic and spectrophotometric analyses for chemical characterization of the present compounds were conducted using standard analytical methods.

EXAMPLE 1 2-Amino-5-iodopyridine (2) The iodo compound 2 was prepared by a standard method. A mixture of 2-aminopyridine (1) (2.4g, 25mmol), periodic acid dihydrate (0.86 g, 3.75 mmol), and iodine (2.7 g, 10.7 mmol) were heated in a mixed solution of acetic acid (60 ml), water (3 ml), and sulfuric acid (0.5 ml) at 80°C for 4h. It was then poured into 10% aqueous Na2S203 solution to remove unreacted iodine and extracted with ether. The extract was washed with 10% aqueous NaOH, dried (KZC03), and concentrated in vacuo. The residue was purified by flash chromatography on silica gel (eluted with ethyl acetate/hexanes 5: 2; Rf =0. 64), followed by recrystallization from ethanol to give colorless prisms of compound 2 (83% yield, 4.6g). UV-vis : max (CH30H) 247 (46330), 314nm (7970); IR (KBr): 3377 (s), 3301 (s), 3144 (sb), 3012 (m), 1640 (s), 1577 (s), 1545 (s), 1483 (s), 1381 (s), 1312 (s), 1256 (s), 1142 (s), 1086 (s), 998 (s), 828 (s), 526 (s), 457 (s) cm-1 ;'H NMR (400 MHz, CDCIs, ppm): 8.21 (s, lH), 7.62 (d, J=8Hz, 1H), 6.35 (d, J=8Hz, 1H), 4.51 (s, 2H); 13C NMR (100MHz, CDCl3, ppm) : 157.30,153.73,145.31,110.96,78.00. MP: 128-129°C. HRMS: calculated (m/e) for C5H4lN2 (M+l) : 220.9576; found, 220.9576.

EXAMPLE 2 5-(-D-glyceropentofuran-3'-ulos-1'-yl)-2-amino-pyridine (5) A mixture of bis (dibenzylideneacetone) palladium (0) (0.115g, 0.2mmol) and tris (pentafluorophenyl) phosphine (0. 213g, 0.4mmol) in acetonitrile (60ml) was stirred under nitrogen at room temperature for 30 min. Then, N, N-diisopropylethylamine (1. 4ml, 8mmol), 1,4- anhydro-2-deoxy-3-O- (1, 1-dimethylethyl) diphenylsilyl-D-erythro-1-enitol (3) (1.42g, 4mmol) and 2 (0.880g, 4mmol) were added in above mixture. The resulting reaction solution was refluxed under nitrogen at 95°C for 30h. The volatiles were removed in vacuo. The residue was

purified by flash chromatography on silica gel (eluent: methylene chloride/methanol =9 : 1, Rf = 0.37) to yield intermediate 4 (1.7g, 92% yield) as colorless foam slightly contaminated by trace amount of N, N-diisopropylethylamine. The characteristics of 4 is as follows :'H NMR (400MHz, CDC13, ppm): 7.86-7.83 (m, 2H), 7.77-7.72 (m, 3H), 7.47-7.741 (m, 6H), 7.07 (dd, 1H, J=2.4Hz), 6.27 (d, 1H, J=8.4Hz), 5.43 (d, 1H, J=2.8Hz), 4.67-4.65 (m, 1H), 4.22-4.20 (m, 1H), 3.85-3.80 (m, 2H), 1.09 (s, 9H).

To a solution of compound 4 (1.7g, 3.7mmol) in THF (20ml) at 0°C was added acetic acid (0.88ml, 16mmol) followed by 8ml of an 1 M solution of tetra-n-butyl-ammonium fluoride in THF (8mmol). The desilylation reaction was completed in 40min. based on TLC analysis. The volatiles were removed, and the residue was separated by flash chromatography (eluted with CH2C12/CH30H = 9: 1, Rf =0.23) to afford compound 5 (0.74g). Yield for two steps was 89%.

UV-vis : max (CH30H) 239 (15570), 300 (3910) nm ; IR (KBr): 3440 (s), 3325 (sb), 3204 (sb), 3053 (w), 2950 (w), 2921 (w), 28819w), 2857 (w), 28239w), 1761 (s), 1634 (s), 1611 (s), 15139s), 14219s0, 1323 (s), 1161 (s), 1103 (s), 844 (s), 775 (m) cm-1 ;'H NMR (400MHz, CD30D, ppm): 7.97 (d, 1H, J=2.4Hz), 7.68 (dd, 1H, J1=2. 4, J2=8.8Hz), 6.61 (d, 1H, J=8.8Hz), 5.08 (dd, 1H, J1=6. 0, J2=11. 2Hz), 3.98 (t, 1H, J=3.2Hz), 3.82 (d, 2H, 3.2Hz), 2.75 (dd, 1H, Jl=6. 0Hz, J2=17.2Hz), 2.45 (dd, 1H, Jl=11. 2Hz, J2=17.2Hz) ; 13C NMR (100MHz, CD30D, ppm): 215.56, 160.99,146.67,138.19,126.09,110.44,84.38,76.89,62.04,46.19. MP: 140°C decompose; HRMS: calculated for CloHl3N203 (M+l) : 209.0926; found: 209.0926.

EXAMPLE 3 5-( (-)-D-glyceropentofuran-3'-ulos-1'-yl)-2-aminopyridine p-toluenesulfonyl-hydrazone (6) To 1 g (4.8mmoles) of compound 5 in 30ml of methanol was added 1.8g (9.6mmoles) of p- toluenesulfonylhydrazide. The solution was stirred at room temperature for overnight.

Crystallization from methanol gave hydrazone compound 5 (1.75g, yield 97%). UV-vis : max (CH30H) 273,300 nm ; IR (KBr): 3741 (s), 3370 (s), 3213 (s), 3026 (m), 2923 (m), 2845 (m), 1677 (s), 1639 (s), 1515 (m), 1337 (s), 1167 (s), 1041 (s), 941 (m), 551 (s) cm-1 ;'H NMR (400MHz, DMSO, ppm) 10.33 (sb, 1H), 7.86 (d, 1H, J=1. 6Hz), 7.71 (d, 2H, J=8Hz), 7.40-7.38 (m, 3H),

6.41 (d, 1H, J=8.4Hz), 5.96 (s, 2H), 4.76-4.72 (m, 2H), 4.20-4. 19 (m, 1H), 3.61-3.57 (m, 1H), 3.39- 3.31 (m, 1H), 2.92 (dd, 1H, Jl=6Hz, J2=17.6Hz), 2.29 (ddd, 1H, Jl=2Hz, J2=lOHz, J3=17.6Hz); 13C NMR (100MHz, DMSO, ppm): 161.52,159.53,146.29,143. o3, 135.92,135.51,129.25, 127.18,123.01,107.58,80.73,76.55,62.85,36.93,21.09; MP: 150°C decomp.; HRMS: calculated for C17H2lN404S (M+l) : 377.1284; found: 377.1283.

EXAMPLE 4 2-amino-5- (2', 3'-dideoxyl--D-ribofuranosyl)-pyridine (7) To 377mg (lmmole) of compound 6 in 20ml of 1: 1 mixture of acetic acid and acetonitrile 424mg (2mmoles) of sodium triacetoxyborohydride was added at 0°C. The mixture was stirred for 2h. Volatiles were then removed in vacuo, and the resulting residue was purified by column chromatography on silica gel (eluted with methanol/methylene chloride, 1: 9) to give compound 6 (168mg, 86%). UV-vis : max (CH30H) 273,300 nm ; IR (KBr): 3345 (sb), 3225 (m), 2923 (m), 2867 (m), 1627 (s), 1501 (s), 1420 (m), 1356 (m), 1041 (s) ;'H NMR (400MHz, CDC13, ppm) 7.96 (s, 1H), 7.41 (d, 1H, J=8.4Hz), 4.75-4.72 (m, lH), 4.59 (sb, 2H), 4.14-4.08 (m, lH), 3.74 (dd, 1H, J1=3. 6Hz, J2=11. 6Hz), 3.59 (dd, 1H, Jl=6Hz, J2=12Hz), 2.22-2.15 (m, 1H), 2.06- 1.97 (m, lH), 1.87-1.73 (m, 2H) ; 13C NMR (100MHz, CD30D, ppm) 158.13,146.13,136.33, 127.17,108.69,80.19,79.59,65.22,33.92,27.88; HRMS: calculate for CloHI4N202 (M): 194.1055; found: 194.1059.

EXAMPLE 5 5-(-L-glyceropentofuran-3'-ulos-1'-yl)-2-amino-pyridine (10) A mixture of bis-(dibenzylideneacetone)-palladium (O) (0.115g, 0.2mmol) and tris- (pentafluorophenyl)-phosphine (0.213g, 0.4mmol) in acetonitrile (60ml) was stirred under nitrogen at room temperature for 30 min. Then, N, N-diisopropylethylamine (1.4ml, 8mmol), 1,4- anhydro-2-deoxy-3-0- (l, l-dimethylethyl) diphenylsilyl-L-erythro-l-enitol (8) (800mg, 2.25mmol) and 2 (500mg, 2.27mmol) were added in above mixture. The resulting reaction solution was refluxed under nitrogen at 95°C for 30h. The volatiles were removed in vacuo. The

residue was purified by flash chromatography on silica gel (eluent: methylene chloride/ methanol =9: 1, Rf = 0.37) to yield intermediate 9 (935mg, 93% yield) as colorless foam. The characteristics of 9 is as follows :'H NMR (400MHz, CDCl3, ppm): 7.86-7.83 (m, 2H), 7.77- 7.72 (m, 3H), 7.47-7.741 (m, 6H), 7.07 (dd, 1H, J=2.4Hz), 6.27 (d, 1H, J=8.4Hz), 5.43 (d, 1H, J=2.8Hz), 4.67-4.65 (m, 1H), 4.22-4.20 (m, 1H), 3.85-3.80 (m, 2H), 1. 09 (s, 9H).

To a solution of compound 9 (935mg, 2.09mmol) in THF (20ml) at 0°C was added acetic acid (O. 5ml), followed by 3ml of an 1 M solution of tetra-n-butyl-ammonium fluoride in THF (3mmol). The desilylation reaction was completed in 40min. based on TLC analysis. The volatiles were removed, and the residue was separated by flash chromatography (eluted with CH2C12/CH30H = 9: 1, Rf = 0.23) to afford compound 10 (426mg). Yield for two steps was 91%. UV-vis : max (CH30H) 239 (15570), 300 (3910) nm ; IR (KBr): 3440 (s), 3325 (sb), 3204 (sb), 3053 (w), 2950 (w), 2921 (w), 28819w), 2857 (w), 28239w), 1761 (s), 1634 (s), 1611 (s), 15139s), 14219sO, 1323 (s), 1161 (s), 1103 (s), 844 (s), 775 (m) cm-l ;'H NMR (400MHz, CD30D, ppm): 7.97 (d, 1H, J=2.4Hz), 7.68 (dd, 1H, J1=2. 4, J2=8.8Hz), 6.61 (d, 1H, J=8.8Hz), 5.08 (dd, 1H, J1=6. 0, J2=11. 2Hz), 3.98 (t, 1H, J=3.2Hz), 3.82 (d, 2H, 3.2Hz), 2.75 (dd, 1H, Jl=6. 0Hz, J2=17.2Hz), 2.45 (dd, 1H, J1=11. 2Hz, J2=17. 2Hz) ; 13C NMR (100MHz, CD30D, ppm): 215.56,160.99,146.67,138.19,126.09,110.44,84.38,76.89,62.04, 46.19. MP: 140oC decompose; HRMS: calculated for CloH13N203 (M+1) : 209.0926; found: 209.0926.

EXAMPLE 6 5-(-L-glyceropentofuran-3'-ulos-1'-yl)-2-aminopyridine p-toluenesulfonyl-hydrazone (11) To 250mg (1.2mmoles) of compound 10 in 10ml of methanol was added 437mg (2.4mmoles) of p-toluenesulfonylhydrazide. The solution was stirred at room temperature for overnight. Crystallization from methanol gave hydrazone compound 11 (443mg, yield 98%).

UV-vis: max (CH30H) 273,300 nm ; IR (KBr): 3741 (s), 3370 (s), 3213 (s), 3026 (m), 2923 (m), 2845 (m), 1677 (s), 1639 (s), 1515 (m), 1337 (s), 1167 (s), 1041 (s), 941 (m), 551 (s) cm-1 ;'HNMR (400MHz, DMSO, ppm) 10.33 (sb, 1H), 7.86 (d, 1H, J=1. 6Hz), 7.71 (d, 2H, J=8Hz), 7.40-7.38 (m, 3H), 6.41 (d, 1H, J=8.4Hz), 5.96 (s, 2H), 4.76-4. 2 (in, 2H), 4.20-4.19 (m, 1H), 3.61-3.57

(m, 1H), 3.39-3.31 (m, 1H), 2.92 (dd, 1H, Jl=6Hz, J2=17.6Hz), 2.29 (ddd, 1H, Jl=2Hz, J2=lOHz, J3=17.6Hz) ; 3C NMR (100MHz, DMSO, ppm): 161.52,159.53,146.29,143.03, 135. 92,135.51,129.25,127.18,123.01,107.58,80.73,76.55,62.85,36.9 3,21.09; MP : 150oC decompose; HRMS: calculated for Cl7H2lN404S (M+1) : 377.1284; found: 377.1284.

EXAMPLE 7 2-amino-5- (2', 3'-dideoxyl-p-L-ribofuranosyl)-pyridine (12) To 200mg (0.53mmole) of compound 11 in 10ml of 1: 1 mixture of acetic acid and acetonitrile 318mg (1.5 mmoles) of sodium triacetoxyborohydride was added at 0°C. The mixture was stirred for lh. Volatiles were then removed in vacuo, and the resulting residue was purified by column chromatography on silica gel (eluted with methanol/methylene chloride, 1: 9) to give compound 12 (89mg, 87%). UV-vis : max (CH30H) 273,300 nm; IR (KBr): 3345 (sb), 3225 (m), 2923 (m), 2867 (m), 1627 (s), 1501 (s), 1420 (m), 1356 (m), 1041 (s) ; 1H NMR (400MHz, CDC13, ppm) 7.96 (s, 1H), 7.41 (d, 1H, J=8.4Hz), 4.75-4.72 (m, lH), 4.59 (sb, 2H), 4.14-4.08 (m, lH), 3.74 (dd, 1H, Jl=3. 6Hz, J2=11. 6Hz), 3.59 (dd, 1H, J1=6Hz, J2=12Hz), 2.22-2.15 (m, 1H), 2.06- 1.97 (m, lH), 1.87-1.73 (m, 2H) ;'3C NMR (lOOMHz, CD30D, ppm) 158.13,146.13,136.33, 127.17,108.69,80.19,79.59,65.22,33.92,27.88; HRMS: calculated for CloHI4N202 (M): 194.1055; found: 194.1056.

II. Biological Activity EXAMPLE 8 General procedure for chain termination and primer extension The following buffers were used for each polymerase: DNA polmerase a, 50 mM Tris-Cl pH 8.0,5 mM Mg (AcO) 2, 1 mM DTT, 1 mM spermidine ; DNA pol P 50 mM Tris-Cl pH 8.0,10 mM MgCl2, 1 mM DTT; DNA Polymerase y 50 mM Tris-Cl pH 7.5,100 mM NaCl, 2.5 mM MgCl2 ; HIV RT 50 mM Tris-ci pH 8.5,10 mM MgCl2, 40 mM KCl, 1 mM DTT.

Template, primer and the corresponding buffer were mixed and heated to 100°C for 1 min,

allowed to cool to room temperature then placed on ice for 30 min. Once the template and primer had been allowed to anneal the polymerase was added. The appropriate amount of template- primer mixture was added to a vial containing water and the NTP (s) at the desired concentration.

Typical reaction volumes were 10 I1L. The reactions were incubated at 37°C for 45 min. The reactions were quenched using Na-EDTA, heated at 100°C for 1 min, and then flash frozen in liquid N2. Primer extensions were analyzed by standard methods by denaturing Polyacrylamide Gel Electrophoresis (PAGE).

EXAMPLE 9 Gel electrophoresis Analytical polyacrylamide gel electrophoresis was performed using a 38 x 50 cm Sequi-Gen GT sequencing cell with a thickness of 0.4 mm and 15% monomer (acrylamide: bisacrylamide 19: 1). Gels were run using 90 mM Tris-Borate 1 mM EDTA buffer (pH 8.3). Gels were imaged on Phosphorimager: 425 from Molecular Dynamics (Sunnyvale, CA).