Field of the Invention

This invention relates to an enhanced process for amplifying a specific nucleic acid sequence and its rapid detection and quantitation using electrochemiluminescent labeled binding species.

Background of the Invention

Detection and quantitation of a specific nucleic acid sequence present in a sample is a known diagnostic method with great specificity. This specificity is based on the knowledge of the specific sequence and the generation of probes which are specific and complementary.

Methods for detection and quantitation of specific nucleic acid sequences are illustrated by the following patents: (1) U.S. Patent No. 5,130,238 is directed toward an improved process for amplifying a specific nucleic acid sequence. The improvement of the amplification process involves the addition of dimethylsulfoxide (DMSO) alone or in combination with bovine serum albumin (BSA); (2) U.S. Patent No. 4,683,195 is directed toward a process for amplifying and detecting any target nucleic acid sequence contained in a nucleic acid or mixture thereof; (3) U.S. Patent No. 4,683,202 is directed toward a process for amplifying any desired specific nucleic acid sequence contained in a nucleic acid or mixture thereof; (4) U.S. Patent No. 4,486,539 is directed toward a method for identifying nucleic acids by a ont. .iep sandwich hybridization test; and (5) WO 91/02814 is directed toward a process for amplifying a specific nucleic acid sequence.

The use of highly specific nucleic acid probes is in some cases the only method which can yield accurate results when the protein is absent, such as is the case for analysis of genetic defects such as cystic fibrosis. It is also valuable in the case of a latent viral infection such as HIV1 or herpes where little or no protein is produced by the infection. The great specificity of the nucleic acid probes also makes them valuable in the diagnosis of infectious agents which are difficult to identify with antibodies due to cross reaction and lack of cross reaction between isotypes of these agents. In addition, the analysis of DNA sequences allows the rapid and effective selection of a probe which will be specific this is not possible with antibody-based reagents. The greatest difficulty and limitation with applying existing nucleic acid probe technology is the complexity and slow methodology for the detection of specific sequences. With the amplification of

nucleic acids, die limitations of nucleic acid probe methods associated with low levels of target molecules have been solved in U.S. Pat. No. 5,130,238; 4,683,195; 4,683,202, identified above.

The use of natural amplification has been used in certain cases to remove this problem. This is exemplified by the use of ribosomal RNA with up to 100,000 copies per cell as taught in U.S. Pat. No. 4,851,330. This method, in order to be effective without the need to culture the infectious agent, makes use of a rapid chemiluminescence detection system which requires a number of incubations and washes. This method, however, is also limited only to selected cellular pathogens and is of no use in the case of viral or genetic defects.

Notwithstanding the amplification processes disclosed in the prior art, the present invention requires no pretreatment of the sample such as binding to solid phases or membranes, denaturing of the sample, purification of the sample by extraction of oil, protein or by gel electrophoresis and the probes can be added directly to the amplification mixture hybridized and analyzed. This was surprising in the light of the potential that the probe sequences would be modified or cause sample destruction mediated by the enzymes and conditions in die amplification mixture. For example, the presence of RNAase H, which degrades hybrids between DNA and RNA (the basis of the probe hybridization), degrades the specific hybrids in any attempt to probe the impure amplificate mix. Also, the presence of reverse transcriptase would use the probes in the hybridization mixture as primers and remove mem from the specific hybridization complex formation reaction. In addition to these potential problems, the buffer contains many compounds which might cause problems both for hybridization and also for d e generation of ECL by the specific chemistries involved, for example, high levels of salts MgCl ₂ , KCl, nucleotides, dithiothreitol, spermidine, dimethyl sulphoxide, glycerol and proteins. This list contains many substances which interfere with other nucleic acid probe methods and would need to be removed to allow these methods to work, thus the present invention was surprisingly capable of carrying out a nucleic acid probe assay widi such a simple protocol.

Summary of the Invention

This invention relates to a diagnostics process for detection of specific nucleic acid sequences generated by amplification which is rapid, has fewer steps, and requires less user time than conventional diagnostic methods. The amplification takes place at a relatively constant temperature generating a plurality of single stranded RNA species. The hybridization to probes follows this amplification and is carried out at a relatively constant temperature followed by analysis for the bound or complexed electrochemiluminescent species. Hence, the diagnostic process is both rapid and sensitive unlike other

systems which require multiple cycles of incubations and multiple washes followed by multiple incubations for detection of nucleic acid.

According to one aspect of the invention, a process for amplifying a specific nucleic acid sequence is used followed by die addition of two oligonucleotide probes-one with a binding species, the capture probe (i.e., biotin or antigen) and one witii an electrochemiluminescent label.

The process involves the synthesis of single stranded RNA, single stranded DNA, and double stranded DNA. The single stranded antisense RNA is a first template for a second primer. The single stranded DNA is a second template for a first primer. The double stranded DNA is a third template for the synthesis of a plurality of copies of the first template. A sequence of the first or the second primer is sufficiently complementary to a sequence of the specific nucleic acid sequence and a sequence of the first or the second primer is sufficiently homologous to a sequence of the specific nucleic acid sequence. A second primer binds to die 3' end of the first RNA template and generates the second DNA template. A 3' end of the first primer hybridizes to the 3' end of die second DNA template. The second template is removed from the first template and is used to generate a complementary DNA strand. The resulting duplex DNA serves as a third template for syndiesizing a plurality of first templates which in turn repeats the above described cycle. This process of amplification is described in detail by the following publications: Kievits et al., 35 J. Vir Method 273-286 (1991); Bruisten et al., 9 AIDS Res, and Human Retroviruses 259-265 (1993); EP 0 329 822-A2, WO 91/02818, WO 91/02814 (an essentially similar method is also described in WO 88/10315). On completion of the incubation, as described above, samples from the said amplification are taken and a mixture of complementary probes and beads coated in a binding species complementary to one of die probes in hybridization buffer is added followed by incubation at a predetermined temperature to allow the hybridization of the probes to the said first template and the binding of one of die said probes to the beads via a binding interaction, i.e., antibody- antigen or biotin-streptavidin. On completion of die said incubation, a complex is formed which comprises the said first template generated from the amplification reaction as above hybridized to two said differing probe, one containing an electrochemiluminescent label and die other a binding species. This complex is further complexed to said coated bead which forms its complementary binding pair with the probe binding species. The resulting complex contains die amplified first template, die probe with its electrochemiluminescent label, die capture probe with its binding species, and the bead with its coating of binding species (see Fig. 1) all complexed via the specific interactions of each component. It will also be understood diat the DNA sequences generated during the NASBA cycling will be targets for hybridization and detection.

In another embodiment of the claimed in ^* , -ntion, the interaction between the probe and the bead

can be made prior to the hybridization step by formation of a covalent bond to said bead or via a binding species (where said binding species is coated eidier by covalent or non-covalent methods) interaction or indirectly via a covalent bond to a species which can non-covalendy coat said bead. An example of this indirect covalent coating could take the form of the probe being coupled to a carrier such as protein followed by coating via non-covalent me ods to the bead surface.

In anodier embodiment, samples of the amplification would be mixed with a probe labeled with an ECL species and a bead which is coated widi a binding species specific for the hybrid formed between said probe to die said amplified first template. For example, such a hybrid of DNA and RNA may be capture using a specific antibody. An example would be die use of a anti DNA:RNA antibody (Miles Inc. 4,833,084). Other antibodies which recognize such mixed hybrid molecules would also prove valuable such as those antibodies raised to hybrids of RNA or DNA to phosphorate, phosphorothioate, alkyl, or aryl phosphonate based nucleic acid sequences (Murakami et al., 24 Biochemistry 4041-4046 (1985), also available from Glenn Research, Sterling, Virginia). These methods are based on die formation of a new molecular species on hybridization which is a binding species for an antibody and raising antibodies or odier binding species to these molecular species.

In yet anodier embodiment, die assay method may also be used to quantitate the amount of nucleic acid in the starting material. This is achieved by die addition to the samples of specific 'spike' samples which are amplified during die reaction. The determination of die spike signal and sample signal allows a ratio to be calculated, which based on he original spike level, allows the determination of die sample level. This is most accurately determined by die use of multiple spikes which range in amount over me range of die potential sample amounts and allow die construction of a standard curve to give a reading at a ratio of 1:1 between target and sample. Memods based on tiiis are well under stood— Van Gemen et al., 43 J. Vir. Methods 177-187 (1993); Siebert and Larrick, 14 Biotechniques 244-249 (1993); Piatak et al., 14 Biotechniques 70-80 (1993). This method for quantitation is improved by die use of a rapid and accurate method for detection and quantitation provided by die use of die ECL labels and memods widi the NASBA amplification.

The invention further provides a process for the detection of a specific nucleic acid sequence, comprising die steps of:

(a) Providing a single reaction medium containing reagents comprising

(i) a first oligonucleotide primer,

(ϋ) a second oligonucleotide primer comprising an antisense sequence of a promoter,

(iii) a DNA-directed RNA polymerase diat recognizes said promoter, (iv) an RNA-directed DNA polymerase, (v) a DNA-directed DNA polymerase, (vi) a ribonuclease that hydrolyses RNA of an RNA-DNA hybrid widiout hydrolyzing single or double-stranded RNA or

DNA,

(b) Providing in said reaction medium RNA comprising an RNA first-template which comprises said specific nucleic acid sequence or a sequence complementary to said specific nucleic acid sequence, under conditions such that a cycle ensues wherein

(i) said first oligonucleotide primer hybridizes to said RNA first template, (ii) said RNA-directed DNA polymerase uses said RNA first template to synthesize a DNA second template by extension of said first oligonucleotide primer and diereby forms an RNA-DNA hybrid intermediate, (iii) said ribonuclease hydrolyses RNA which comprises said

RNA-DNA hybrid intermediate, (iv) said second oligonucleotide primer hybridizes to said DNA second template,

(v) said DNA-directed DNA polymerase uses said second oligonucleotide primer as template to synthesize said promoter by extension of said DNA second template; and (vi) said DNA-directed RNA polymerase recognizes said promoter and transcribes said DNA second template, diereby providing copies of said RNA first template; and thereafter

(c) Maintaining said conditions for a time sufficient to achieve a desired amplification of said specific nucleic acid sequence, followed by die addition of; (i) at least one probe sequence complementary to said RNA first template labeled with an electrochemiluminescent species, (ii) at least one second capture probe sequence

complementary to said RNA first template labeled with a binding species, (iii) a bead coated widi a complementary binding species to said second probe sequence; and diereafter

(d) Providing conditions of temperature and buffer to allow the hybridization of the probes to the said RNA first template and die binding of said binding species on said second capture probe with the complementary binding species on said bead to from a bead bound complex; and dien

(e) Detecting said bead bound complex using said electrochemiluminescent species.

The invention further provides a process for die detection of amplified products comprising die steps of :

(a) amplifying a sample nucleic acid under conditions to generate amplified product:

(b) mixing said amplified product with two binding species comprising

(i) an ECL labeled binding species which interacts with a trimolecular complex widi the amplified nucleic acid and bivalent binding species; (ii) a bivalent binding species which interacts widi a trimolecular complex with the amplified nucleic acid and ECL labeled binding species;

to form a binding complex reaction;

(c) incubating said binding complex reaction under conditions which allow the formation of a trimolecular complex of amplified product, ECL labeled binding species, and bivalent binding species;

(d) capturing said trimolecular complex via die bivalent binding species' remaining binding site to a solid phase; and

(e) quantitating ECL label captured on die solid phase.

Definitions

In order to more clearly understand the invention, certain terms are defined as follows:

".Amplified product" means nucleic acid sequences generated by copying sample nucleic acid sequences multiple times using an enzymatic reaction.

"Annealing" refers to hybridization between complementary single chain nucleic acids when d e temperature of a solution comprising the single chain nucleic acids is lowered below the melting or denaturing temperature.

"Binding species" means any species known to bind widi another molecular species and are normally defined as a pair of species but may be formed from higher complexes, i.e., 3 or 4 which bind, i.e., antibody:antigen or oligonucleotide:antibody or oligonucleotide: antigen or DNA:DNA or DNA:RNA or RNA:RNA or DNA:RNA:DNA or Biotin-DNA:DNA-ECL labeled or receptor: ligand or DNA binding protein such as restriction enzymes, lac repressor.

The "complement" to a first nucleotide sequence is well known to be a second sequence comprising those bases which will pair by Watson-Crick hybridization widi die first sequence. Thus, the complement to die deoxyribonucleic acid (DNA) sequence 5'ATGC 3' is well known to be 5'-GCAT 3'. For duplex, or double stranded DNA, each of die two strands are described as complementary to die otiier or as a complementary pair. The terms complement and anticomplement may also be used. Widi reference to die identification of die strand of duplex DNA from which transcription to RNA proceeds, d e transcription strand is generally described as plus and its complement as minus ( " + " and "-"), or die transcription strand may be described as me sense strand, and its complement as antisense. Two strands each hybridized to die odier having all base pairs complementary, are 100% complementary to each other. Two strands, each hybridized to die otiier, have 5% of bases non-complementary, are 95% complementary (or me two strands have 95% complementarity). In addition, it will also be understood diat nucleic acid sequences can form triple helix strucmres based on a specific interaction of tiiree strands which would be considered to complementary in a specific way to each other within this triple stranded hybrid.

The terms "detection" and quantitation" are referred to as "measurement", it being understood diat quantitation may require preparation of reference compositions and calibrations.

"Electrochemiluminescent (ECL) species" means any compound known to electrochemiluminescense;

"Electrochemiluminescent (ECL) labels" are those which become luminescent species when acted on electrochemically. Electrochemiluminescent techniques are an improvement on chemiluminescent techniques. They provide a sensitive and precise measurement of die presence and concentration of an analyte of interest. In such techniques, die sample is exposed to a voltammetric working electrode in order to trigger luminescence. The light produced by the label is measured and indicates die presence or quantity of die analyte. Such ECL techniques are described in PCT published application by Bard et al. PCT Appl. No. US 85/02153, entitled "Luminescent Metal Chelate Labels and Means for Detection"and Massey et al. PCT Appl. No. US 87/00987, entided "Electrochemiluminescent Assays"; PCT Appl. No. US 88/03947, Publication No. WO 89/04302 " Electrochemiluminescent Moieties and Methods for Their Use"; Hall et al., "Method and Apparatus for Conducting Electrochemiluminescent

Measurements", U. S. Appl. Ser. No. 744,890 filed August 14, 1991; and Zoski and Woodward. "Apparatus for Conducting Measurements of Electrochemiluminescent Phenomena", PCT US 89.04854 corresponding to pending EPO Appl. No. 89/912913.4, Publication No. 0441880.

Examples of ECL tags are tag NHS (N-bydroxy-succinimide) and tag phosphoramidite. The tag- NHS ester is usefiil for labeling substances containing free amino groups capable of reaction with die NHS ester to form an amide bond. (See, for example, WO 86/02734.) The tag phosphoramidite (Gudibande et al. U.S. Appl. Ser. No. 805,537 f entitled "Improved Electrochemiluminescent Label for DNA Probe Assay" which is hereby incorporated herein by reference) is useful for labeling substances containing free amino, sulphydryl, or hydroxyl groups forming phosphor-linkages especially phosphodiester linkages.

An "ECL assay buffer" is a general diluent which contains tripropylamine that is necessary for the electrochemical reaction on die electrode in an ECL analyzer.

An "ECL diluent" is a diluent reagent used in diluting solutions containing labile biomolecules for storage purposes.

"ECL apparatus" is any apparatus for performing electrochemiluminescence based assays. Such ECL

apparatus are described in PCT Appl. No. US 85/02153 by Bard et al. entitled "Luminescent Metal Chelate Labels and Means for Detection" and in PCT Appl. No. US 87/00987 by Massey et al. entitied "Electrochemiluminescent Assays" ; PCT Appl. No. US 88/03947, Publication No. WO 89/04302 " Electrochemiluminescent Moieties and Mediods for Their Use"; Hall et al. "Method and Apparatus for Conducting Electrochemiluminescent Measurements", U. S. Appl. Ser. No. 744,890; and Zoski, G., and S. Woodward. "Apparatus for Conducting Measurements of Electrochemiluminescent Phenomena", PCT US 89.04854 corresponding to pending EPO Appl. No. 89/912913.4, Publication No. 0441880.

"Homology" between polynucleotide sequences refers to die degree of sequence similarity between the respective sequences. Two strands which are identical in sequence have 100% sequence homology.

Two strands which differ by 5% of sequences have 95% sequence homology. The greater the degree of homology between two strands A and B, die greater the complementarity between A and die complement of B.

"Hybridization" describes die formation of double stranded or duplex nucleic acid from complementary single stranded nucleic acids. Hybridization may take place between sufficiently complementary single stranded DNA and/or RNA to form: DNA:DNA, DNA:RNA, or RNA:RNA or DNA:RNA:DNA or Biotin-DNA:RNA:DNA-ECL label. This may also include sequences of nucleotides which are linked using modified natural chemistries such as phosphorate, phosphorothioate, alkyl or aryl phosphonate based nucleic acid sequences (Murakami et al., Biochemistry 24 (1985):4041-4046, also Glenn Research, Sterling, Virginia).

The term "label" or "labeled" when applied to a nucleic acid means at the nucleic acid in question is linked to a moiety which is detectable by its properties which may include: ECL and luminescence, catalysis of an identifying chemical substrate, radioactivity, or specific binding properties. Thus, die term "label" includes ligand moieties unless specifically stated odierwise.

It is also well know to the art that die term "nucleic acid" refers to a polynucleotide of any length, __ including DNA or RNA chromosomes or fragments d ereof with or without modified bases as described herein.

A "nucleotide" is at least one of the following bases: adenine, cytosine, guanine, thymine or uracil, plus a sugar (deoxyribose for DNA, ribose for RNA), plus a phosphate. In order to provide monomers for

die DNA polymerization reaction, typically all four of the deoxynucleotide triphosphates are required. A nucleotide, as defined herein, may also include modified bases such as 5-methyl-dCTP and 7-deaza- dGTP used to improve the action of polymerase on templates. The term nucleotide as used herein also includes bases linked to biotin and digoxigenin (Digoxigenin-11-UTP from Boehringer Mannheim, Indianapolis, Indiana) and biotin-21-UTP and amino-7-dUTP (Clontech, Palo Alto, California) and ECL labeled nucleotide (see Figs. 6 and 7) which may be incorporated direcdy into a primer or into a primer extension product during amplification, to provide for selective binding of amplified sequences.

An "oligonucleotide" is a sequence formed of at least two nucleotides.

A "polynucleotide" is a long oligonucleotide and may be either RNA and DNA.

While the term oligonucleotide is generally used in die an to denote smaller nucleic acid chains, and "polynucleotide" is generally used in die art to denote larger nucleic acid chains including DNA or RNA chromosomes or fragments thereof, the use of one or die odier term herein is not a limitation or description of size unless expressly stated to be.

A "primer" is a relatively short segment of oligonucleotide which is complementary to a portion of the sequence of interest (die sequence of interest can be a subfragment within a larger nucleic acid sequence). A primer represents a 5' terminus of die resulting extension product. A primer which is complementary at its 3' terminus to he sequence of interest on the template strand enables this 3' terminus to be acted on by a polymerase on hybridization to die template. It is well known that modifications to die 3' end will affect the ability of an oligonucleotide to function as primer. An example is the incorporation of a dideoxynucleotide as in DNA sequencing tiius preventing die action of DNA polymerases. It is well known diat die length of die primer will depend upon die particular application, but that 20-30 base pairs is a common size. As is well known, a primer need not be a perfect complement for successful hybridization to take place. If the primer is an imperfect complement, an extension product will result which incorporates die primer sequence, and during a later cycle, d e _ complement to die primer sequence will be incorporated into the template sequence. Thus, it is well known diat a properly selected primer having a sequence altered from mat of die complement of die template may be used to provide in vitro mutagenesis. The primer may incorporate any art known nucleic acid bases, including any art known modified or labeled bases as defined above so mat the primer extension product will incorporate tiiese features to permit separation and detection of die primer

extension product. A tag or marker advantageously linked to a primer may include an ECL fluorescent or luminescent tag, an isotopic (e.g., radioisotope or magnetic resonance) label, a dye marker, an enzyme marker, an antigenic determinant detectable by an antibody, or a binding moiety such as biotin enabling yet anodier indicator moiety such as a streptavidin coated bead to specifically attach to the primer or any nucleic acid sequence incorporating that primer. When e labeled or tagged amplification product is formed, diat amplification product may be;detected by the characteristic properties of the tag or label.

The term "primer extension product" describes die primer sequence together with die complement to die template produced during extension of die primer.

A "probe" is a single or double stranded nucleic acid which has a sequence complementary to a target nucleic acid sequence of interest and which has some additional feature enabling die detection of die probe — target duplex. One skilled in die art will understand diat if die probe and/or die target is double stranded, die double stranded nucleic acid must undergo strand separation before hybridization can take place. It is possible, if a triple strand formation is used, tiien the double stranded target will not need to be rendered single stranded prior to hybridization.

A probe is rendered detectable by an attached tag or marker. A tag or marker linked to a probe may include a fluorescent, ECL or luminescent tag, an isotopic (e.g., radioisotope or magnetic resonance) label, a dye marker, an enzyme marker, an antigenic determinant detectable by an antibody, or a binding moiety such as biotin enabling yet anodier indicator moiety such as a streptavidin coated bead to specifically attach to the probe. When the labeled or tagged probe— target duplex is formed, that duplex may be detected by die characteristic properties of the tag or label. Alternatively, as described for the ECL assays in die following examples, the probe widi its binding moiety allows the capture of labeled target, via hybridization and duplex formation, allowing detection by a label or other art known means.

"Sample" means a mixture containing nucleic acids.

A "sequence" (e.g., sequence, genetic sequence, polynucleotide sequence, nucleic acid sequence) refers to die actual enumerated bases (e.g., ribose or deoxyribose) present in a polynucleotide strand (e.g., reading from the 5' and 3' direction) and die relative position of diese bases with respect to each other.

The term "single primer" means a single, unpaired, specific or selected primer designed to selectively hybridize wid a target nucleic acid sequence of interest.

"Specific nucleic acid sequence" means a single stranded or double stranded nucleic acid which one could use as a probe or amplify.

A "specific or selected" nucleotide sequence refers to a particular sequence distinguishable (i.e., by hybridization analysis) from other difference sequences (e.g., the specific nucleotide sequence 5'- ATGCCC-3' is not the same sequence as 5'-AAGCCC-3').

A specific or selected primer is one which is designed to hybridize widi a particular template sequence to achieve the desired result by making the primer complementary or approximately complementary to the 3' terminal of die template sequence. The specific primer will selectively achieve the desired result even if die target template sequence is present in a mixture of many otiier nucleic acid sequences.

The specific or selected primer is distinguished from a "universal primer" which will indiscriminately anneal to any DNA sequence to which a complementary (to die primer) adaptor terminal sequence has been attached. Widi a universal primer, care must be taken to isolate die nucleic acid of interest, or otherwise direct d e ligation procedure only to the. desired DNA sequence of interest, to avoid randomly attaching die adaptor to all nucleic acid sequences present.

A "strand" is a single nucleic acid sequence. Thus, a duplex or double stranded chromosome, chromosome fragment or other nucleic acid sequence may be separated into complementary single strands.

"Strand separation" refers to die conversion of a double stranded or duplex nucleic acid to two complementary single stranded polynucleotide. The separation process may employ well known techniques including: enzyme mediated separation (e.g., by die enzyme helicase, physical-chemical separation (pH, ionic concentration and die like), and diermal separation also known as thermal denaturing. Thermal denaturing (also referred to as "melting") is die separation of a double stranded polynucleotide (fully or partially duplex) into at least two single strands of polynucleotide by raising die temperature of the solution holding diat polynucleotide.

"Sufficiendy complementary" means diat two nucleic acids are capable of specific interaction which allows either a primer dependent and template directed syndiesis of DNA or a probe to bind to nucleic acid sequence.

A "template" is any sequences of nucleic acid upon which a complementary copy is synthesized. This may, in general, be DNA to DNA replication, DNA to RNA transcription, or RNA to DNA reverse transcription. A DNA template provides die sequence information for extension of die complementary primer by the DNA polymerase reaction. An RNA template may provide die sequence information for extension of a complementary DNA primer by an analogous reaction catalyzed by d e enzyme reverse trancriptase As is well known to the art, e template may be found in a single or double stranded form. If the template enters the amplification process in the double stranded form, the template strand will not hybridize to its complementary primer until it is denatured by d e first thermal denaturing cycle. If the template enters the amplification process alread- n die single stranded form, die primer will hybridize (described as annealing when d ermal cycling is utilized) widi its complementary template before die first thermal denaturing step.

Brief Description of the Drawings

Fig. 1 is a general illustration of die nucleic acid hybridization process.

Fig. 2 is a general illustration of an alternative nucleic acid hybridization process.

Fig. 3 is a general illustration of an alternative nucleic acid hybridization process.

Fig. 4 is a general illustration of an alternative nucleic acid hybridization process.

Fig. 5 is a general illustration of an alternative nucleic acid hybridization process.

Fig. 6 is a general illustration of an alternative nucleic acid hybridization process.

Fig 7 is an ECL labeled nucleotide.

Detailed Description of the Preferred Embodiments

This invention relates to a process for amplifying a specific nucleic acid sequence and its rapid detection and quantitation. The amplification involves an alternate synthesis for DNA and RNA. In this process, single stranded antisense (-) RNA is converted to single stranded DNA which in turn is converted to dsDNA and becomes a functional template for the syndiesis of a plurality of copies of die original single stranded RNA. A first and a second primer are used in die amplification process. A sequence of the first primer or the second primer is sufficiendy complementary to a sequence of the specific nucleic acid sequence and a sequence of die first or the second primer is sufficiendy homologous to a sequence of die specific nucleic acid sequence. If die specific nucleic acid sequence is double stranded, tiien the primers can both be complementary and homologous. The detection, of die specific sequences which are amplified, is achieved by die use of probe sequences which form hybrids widi die amplification products eidier DNA or RNA. These probe sequences are generally sufficiendy complementary to a sequence of die specific nucleic acid sequence which results in die formation of a specific hybrid. These hybrids are then detected by die use of an ECL detection instrument which allows the ECL label to generate light in a controlled fashion at the surface of an electrode allowing botii its detection and quantitation (Figs. 1, 2, 3, 4, 5, 6).

The assays for these amplified products is possible using a number of formats. The preferred method makes use of two probe molecules after the amplification process one is labeled widi a binding species (i.e., biotin, digoxin, fluorescein), die other probe is labeled with an ECL label (i.e.. Ru chelate, Os chelate, Re. Rh). These probes are added to die sample from die amplification reaction which generates a plurality of RNA copies of the original single stranded RNA or DNA and are complementary or sufficiendy complementary to die plurality of RNA copies of die original single stranded RNA or DNA. This mixture of probes and amplified nucleic acid are allowed to hybridize by the control of the temperamre and buffer components which are selected for the specific probe and plurality of RNA copies of die original single stranded RNA or DNA using memods known to those skilled in the art. The formation of diese hybrids allows both probes to be linked in ie same hybrid complex. These are then captured from the incubation by die addition of die magnetic beads which are coated with a binding species which binds to die binding species on the capture probe (Fig. 1). For example, with biotin on the probe streptavidin or avidin might be coated on to the magnetic beads or with digoxigenin on die probe an antibody specific for digoxigenin would be coated on die bead. This mixture of the hybrid complex and die bead would tiien be incubated under conditions known to promote the binding interaction of the binding species. These conditions for binding of binding species are well known to

those skilled in the art; for example, biotin to streptavidin or avidin and antigen antibody interactions.

Following the capture of die hybrid complex on die magnetic beads, die sample may be washed by capture of the beads by a magnet used in close proximity to die sample tube, or more ideally, die sample would be sampled directly into an ECL instrument which would capture the magnetic beads and its bound complex followed by die electrochemical reaction of the surface bound ECL label. The ^,; ght generated from diis electrochemical reaction is measured and used to determine the amount of EC_- label which has formed a complex with die bead. This determination of die relative amounts of ECL label bound to die beads under certain conditions allows a determination of the amount of die plurality of RNA copies of the original single stranded RNA or DNA generated in the amplification. Using this information regarding the level of amplification of the specific DNA or RNA allows die diagnosis of die sample DNA or RNA for the presence of a specific DNA or RNA sequences which determine me presence of a gene and or organism in a sample.

Alternative to die above method, we may make use of two oligonucleotides which are labeled with binding species which allow the formation of a hybrid complex as described above but widiout a ECL label attached directly to die probe oligonucleotide. In diis alternative format, the ECL label is linked to die hybrid complex either before hybridization to for said complex or after by the formation of a binding pair complex. Examples of such a system would be die use of a probe labeled widi digoxin (binding species or antigen) and a probe labeled widi biotin (binding species) tiiese two probes would under well known conditions from a hybrid complex with die plurality of RNA copies of the original single stranded RNA or DNA generated in die amplification. After the formation of diis hybrid complex, the addition of ECL labeled anti-digoxin antibody (complementary binding species or specific antibody) and streptavidin (complementary binding species) coated magnetic beads under conditions known to allow the formation of binding interactions (pH 4-9, ImM to 2M salts, 0 to 10% detergents) allows the linkage of die ECL label to die hybrid complex by the binding of antigen to antibody. Also die complex is captured onto die surface of die bead via die binding interaction of streptavidin to biotin. The resulting extended complex of probes hybridized to die plurality of RNA copies of the original single stranded RNA or DNA generated in the amplification is men analyzed by die use of an ECL analyzer.

Alternatively, the formation of a specific complex labeled wid an ECL sper'es could be achieved by die use of a probe sequence labeled widi an ECL species which when . ridized to die plurality of RNA copies of the original single stranded RNA or DNA generated in die amplification forms a binding species. This hybrid complex, or said binding species, is then captured by using complementary binding species coated magnetic beads followed by analysis using an ECL analyzer. For

example, antibodies to DNA:RNA hybrids (Fig. 2).

Alternatively, the amplification could be performed widi a binding species such that said binding species are incorporated into die plurality of DNA and/or RNA molecules generated during die amplification process. Memods for this are well known to tiiose skilled in die art. Examples of this could be the use of a primer (see primer 2, U.S. Patent No. 5, 130,238) modified to include a binding species said primer is then incorporated into the DNA+ strand by the action of RT on die RNA- species and primer 2. The DNA + product would be a DNA+ species covalendy linked to a binding species molecule. This DNA-binding species molecule could tiien be hybridized to an ECL labeled probe and captured onto beads via a complementary binding species for ECL analysis (Fig. 4). In d e same format, the DNA-binding species molecule could be captured onto a bead by hybridization, followed by binding to die DNA-binding species with a complementary binding species labeled widi an ECL label. An example of the binding species could be biotin and its complementary binding species streptavidin. It will be understood diat die RNA- and DNA+ (Fig. 1) could be labeled with a binding species by inclusion of a nucleotide as described earlier which is modified to incorporate a binding species for example biotin and digoxigenin (Digoxigenin- 11-UTP from Boehringer Mannheim,

Indianapolis. Indiana), and biotin-21-UTP and amino-7-dUTP (Clontech, Palo Alto, California) and ECL labeled nucleotides (Fig. 7) into the amplification reaction. The resulting DNA+ and/or RNA- binding species molecules can dien be used in die assay formats as described above (Fig. 3).

Beads which are used in this assay are typically those from Dynal M450 and M280 coated wid streptavidin but odier beads can be used so long as die beads can be para-magnetic and are in the size range from 0.5 μm to 10 μm. It will be understood to one of ordinary skill in the art that die capture oligonucleotide could be coupled to tiiese beads obviating die need for a binding species (Fig. 5).

Having now generally described die invention, die following examples are included for purposes of illustration and are not intended to limit the scope of die invention.

Examples

Example 1 : Oligonucleotide Syndiesis and Labeling

The oligonucleotides were made on an Applied Biosystems (San Jose, California) automated oligonucleotide synthesizer using the ?-cyanoetiιyl phosphoramidite chemistry (Beaucage and Caruthers 22 Tetrahedron Lett. 1859-62 (1982)). Oligonucleotide amino modifications to die 5' end occurred at die last coupling step. Clontech (San Diego, California) supplied die amino modifiers, See U. S. Patent

5,141,813. The resulting 5' modified oligonucleotides all contain a six carbon spacer arm to die amino group, designated (C6, NH2).

All the syndietic oligonucleotides were purified to remove any contaminating amino groups by gel filtration on a BIOGEL™ P6 (Bio-Rad Labs, Richmond, California) column. Biotin was introduced via die 5 '-amino group of the oligonucleotides using NHS-biotin (Clontech, San Diego, California). Tag-NHS ester label (an NHS ester of the Ru tris bipyridyl complex) was introduced via die amino group of die modified oligonucleotides as follows. The oligonucleotides (0.1 /-mole) in 100 μl of PBS (pH 7.4) were reacted with 0.5 μmole of tag -NHS ester label dissolved in DMSO overnight at room temperature in die dark. Oligonucleotides were recovered from these labeling reactions by ethanol precipitation. The modifications to the oligonucleotide and the labeling are indicated as follows. Biotin: linker: 'oligonucleotide' to indicate an oligonucleotide modified widi a 5' amino group and tiien reacted widi a biotin NHS reagent to yield a 5' biotinylated oligonucleotide. Also R: linker: 'oligonucleotide' to indicate an oligonucleotide modified widi a 5' amino group and dien reacted widi die ruthenium tris bypyidine NHS reagent to yield a 5' ruthenium chelate oligonucleotide. Also 'oligonucleotϊ :linker:R to indicate an oligonucleotide modified widi a 3' amino group and tiien reacted widi die ruthenium tris bypyidine NHS reagent to yield a 3' ruthenium chelate oligonucleotide.

Probes for die Pol2 assay were as follows: OT1, TT.AAATTTTCCCATTAGCCCTATTGAGACT HIV! Genbank; HIV BH102 #1900-1929 and OT2, AGAAATCTGTTGACTCAGATTGGTTGCACT HIV1 Genbank; HIV BH102 #1869-1898.

These were made widi die following modifications: 50T1 , Biotm:linker:TTAAATTTTCCCATTAGCCCTATTGAGACT

350T1 , R:linker :TTAAATTTTCCCATTAGCCCTATTGAGACT:linker:R

50T2, Biotin:linker:AGAAATCTGTTGACTCAGATTGGTTGCACT

350T2, R:l_nker:AGAAATCTGTTGACTCAGATTGGTTGCACT:linker:R.

Amplification was as described in J. Vir.. Methods 35 (1991):273.

Probes for the Gag3 assay were as follows:

Sequences for analysis of the HIV1 gag gene, Genbank HIVBH102 #1139-1167

AKZOl TA GAA GAA ATG ATGACA GCA TGT CAGGGA (29 bases)

HTVBH102 #1208-1236

AKZ02 CA ATGAGC CAA GTAACAAATACA GCTACC (29bases).

made as:

AKZOl, Biotin:linker:TA GAA GAA ATG ATG ACA GCA TGT CAG GGA (29 bases) and AKZ02, R:linker:CA ATG AGC CAA GTA ACA AAT ACA GCT ACC:linker:R (29 bases) for the gag3 assays below. The amplifications were performed or described in Van Gemen et al. 43 J. Vir. Methods 177-187 (1993).

Further probes for quantitative gag assays were as follows:

Probe A: TGT TAA AAG AGA CCA TCA ATG AGG A (25 bases) genbank ref. HIVBH102 #710-734.

Probe B: GAA TGG GAT AGA GTG CAT CCA -GTG CAT G (29 bases) genbank ref. HIVBH102 #742-769.

Probe C: GAC AGT GTA GAT AGA TGA CAG TCG (24 bases) control sequence for quantitation as described in Van Gemen et al. J. Vir. Methods (1993).

The use of ώese probes A, B, and C would be as follows:

Using A as capture and B, C as detection or B, C as capture and A as detection.

To generate die needed probes, die following sequences were made incorporating biotin (binding species) and d e ruthenium tri bypyridine complex (ECL label).

Probe A made as:

AKZO-A2, R:linker:TGT TAA AAG AGA CCA TCA ATG AGG A:linker:R and as AKZO-A1, Biotin:linker:TGT TAA AAG AGA CCA TCA ATG AGG.

Probe B made as:

AKZO-B2, R:linker:GAA TGG GAT AGA GTG CAT CCA GTG CAT G:linker:R and as AKZO-B1, BiotimlinkeπGAA TGG GAT AGA GTG CAT CCA GTG CAT G.

Probe C made as:

AKZO-C2, R:linker:GAC AGT GTA GAT AGA TGA CAG TCG:linker:R and as AKZO-C1, Biotin.linkeπGAC AGT GTA GAT AGA TGA CAG TCG.

Where R is the ruthenium rrisbypyridine N-hydroxy succinamide ester reacted to an amino group on the oligonucleotide. The amino group introduced during synthesis.

Example 2: Preparation of Streptavidin Magnetic Beads

To 15 mg of BSA (in 2-3 ml PBS), 105 μl of dimethylsulfoxide containing 50 mg/ml of biotin-x- NHS (Clontech, San Diego, California) was added followed by mixing and incubation at room temperature for 30 minutes. ^" Tie reaction was stopped by adding 30 μl of 1M glycine and incubation at room temperature for 10 minutes. The reaction mix was purified by gel filtration chromatography (Bio- Gel P6, Bio-rad Labs, Richmond, California). This biotin-BSA was filtered using a 0.2 μm filter and syringe. 5 mg biotin-BSA in 10 ml of 0.2 M sodium carbonate/bicarbonate buffer pH 9.6 was added to 300 mg of DYNABEADS™ (DYNAL No. 14002) (DYNABEADS is a trademark of DYNAL, Great Neck, New York) The beads comprise either:

(i) Dynal M-450 Dynabeads, 4.5 μm diameter superparamagnetic particles, 30 mg/mL, obtained from Dynal, 45 North Station Plaza, Great Neck, New York 11021; or

(ii) Dynal M-280 Dynabeads, 2.8 μm diameter superparamagnetic particles, 10 mg/mL, obtained from Dynal, 45 North Station Plaza, Great Neck, New York 11021).

and washed widi carbonate/bicarbonats: This mixture was vortexed and incubated overnight at room temperature with mixing. The beads were magnetically separated followed by d e addition of 10 ml

ECL diluent (37.5 mM KH ₂ P0 ₄ , 109.2 mM K ₂ HP0 ₄ 3H ₂ 0, 151.7 mM CaCI, 0.65 mM NaN ₃ , 0.43 mM bovine serum albumin in H ₂ 0) and 100 μl tRNA (10 mg/ml). This mixture was incubated for 3-4 hours at room temperature with mixing. The beads were washed once widi 10 ml of ECL diluent and

resuspended in 10 ml of ECL diluent and 100 μl tRNA (10 mg/ml). This mixture was mixed and incubated at 2-6 'C overnight to stabilize proteins on beads. The beads were magnetically separated and suspended in 10 ml of phosphate buffered saline (PBS) containing 15 mg of streptavidin (Scripps Laboratories, San Diego, California, Catalog No. S1214) followed by mixing for one hour. The beads were washed 4 times in 10 ml ECL diluent, widi 5 minutes mixing for each wash. The beads were finally resuspended in 29.7 ml of ECL diluent and 300 μl tRNA (10 mg/ml) to a final concentration of 10 mg/ml particles + 100 μg/ml tRNA.

Example 3: Pol 2 Assay

Probe solution I: for 50 assays we combined:

50μl of 350T1 (ECL oligo at lμg/ml),

50μl 50T2 (biotin labeled oligonucleotide at 2μg/ml).

Amplifications were carried out using primers OT188 and OT42 following methods described in J. Vir. Method 35 (1991):273.

The samples were prepared by eidier of two methods:

A) 4 μl of sample from amplification add 16 μl of AKZO buffer containing 0.1 % SDS,

20mM EDTA and heat for 5 minutes at 95 °C. B) 20 μl of sample add 1.8 μl of 1.25% SDS, 240 mM EDTA and heat for 5 minutes at 95 °C.

In an assay tube, he following were combined: 5 μl of probe solution I and 5 μl of sample from above. These samples were incubated at 50 °C for 30 minutes followed by die addition of 5 μl of beads (20 μg Dynal 450) and mixed for 60 minutes. To is mixture 485 μl of ECL assay buffer was added and die samples assayed in an ECL analyzer. The samples tested were 'NT' a no template __ control, 'A' 10 copies of HIV1 and 'B' 10,000 copies of HIV1. These were 1 μl aliqoutes from the amplification reaction.

The results were as follows:

Sample ECL signal

Background signal 204

NT 1908 1884

1913

A 1952

1862 1911

B 175679

179986

167539

The results demonstrated die ability of the amplification and ECL to rapidly and sensitively detect die HIV 1 sequences. Example 4: Gag3 and Pol 2 Assay

To improve on die assay system as demonstrated above, we made use of more probe and beads to provide an assay with unparalleled range. Amplifications were carved out as in Example 3 and using primers OT83 and OT82 as described in 35 J. Vir. Method 273 (1991) for the gag gene.

Probe solution I: for 50 po!2 assays we combined: 50 μl of 350T1 (ECL oligo at 20 μg/ml), 50 μl 50T2 (biotin labelled oligonucleotide at 20 μg/ml).

Probe solution 2: for 50 gag3 assays we combined: 50 μl of AKZ02 (ECL oligo at 20 μg/ml), 50 μl of AKZOl (biotin labelled oligonucleotide at 20 μg/ml).

The samples were prepared by either of two methods:

A) 4 μl of sample from amplification add 16 μl of AKZO buffer containing 0.1 % SDS, 20

mM EDTA and heat for 5 minutes at 95 °C. B) 20 μl of sample add 1.8 μl of 1.25% SDS, 240 mM EDTA and heat for 5 minutes at 95 °C.

Initial assay protocol in assay tube combine in die following order: 5 μl of probe 5 μl of sample.

Incubate at 50 °C for 30 minutes followed by die addition of 10 μl of beads (40 μg) and shaking for 60 minutes. These samples were diluted widi ECL assay buffer 485 μl and analyzed on an ECL analyzer. The samples tested were gag3 'Gil', 10" copies of HIVl; 'G10', 10'° copies of HIVl; 'G9', 10 ⁹ copies of HIVl; 'G8\ 10 ⁸ copies of HIVl; and 'BB' buffer blank for hybridization background.

These were samples of pure RNA generated as test samples containing this number of RNA molecules in die assay.

The results were as follows:

Sample ^• ECL signal Background signal 82

Gil 249559 252442

G10 12783 16059

G9 1427 1429

G8 334 330

BB 250 250

and pol2 samples from an amplification reaction which had used 10,000 copies of starting HIVl sequences and estimated at 5 X 10'° copies per μl based on gel electrophoresis after amplification. This sample was diluted to determine die range of die new assay format for diis sample. Samples were 'P10', 5X10'°; 'P9\ 5X10 ⁹ ; 'P8\ 5X10 ⁸ ; 'P7', 5X10 ⁷ ; 'P6\ 5X10 ⁶ , and 'BB' sample which has no amplified sample and controls for the non-specific binding in the assay.

The results were as follows:

Sample ECL signal

Background signal 82

P10 58762

62039

P9 4696 4391

P8 677 665

P7 330 319

P6 254 263

BB 250

250

This experiment demonstrated the ability of the new assay format to function over at least 3.5 logs of sample concentrations and give a good linear response.

Example 5: Gag3

To improve on die assay system as demonstrated above we made use of more probe and beads to provide an assay widi unparalleled range.

Probe solution 2: for 50 gag3 assays we combined: 50 μl of AKZ02 (ECL oligo at 20μg/ml),

50 μl of AKZOl (biotin labeled oligonucleotide at 20μg/ml).

The samples were prepared by eidier of two methods:

A) 4 μl of sample from amplification add 16 μl of AKZO buffer containing 0.1 % SDS, 20 mM EDTA and heat for 5 minutes at 95°C . B) 20 μl of sample add 1.8 μl of 1.25% SDS, 240 mM EDTA and heat for 5 minutes at 95 °C .

Initial assay protocol: in assay tube combine in the following order: 5 μl of probe solution 2 5 μl of sample.

Incubate at 50 °C for 30 minutes followed by die addition of 10 μl of beads (40 μg) and shaking for 60 minutes. These samples were diluted widi ECL assay buffer 485 μl and analyzed on an ECL analyzer. The samples tested were gag3 'G6', 10 ⁶ copies of HIVl; 'G5\ 105 copies of HIVl; 'G4\ 10* copies of HIVl; 'G3', 10 ³ copies of HIVl; 'G2\ 10 ² copies of HIV1;'G1', 10' copies of HIVl;and 'NT1','NT2','NT3' no template controls for background. The samples of these copy numbers were amplified as in Example 4 and 1 μl analyzed for die presence of amplified sequences. Also a 'BB' sample which has no amplified sample and controls for the non-specific binding in die assay.

The results were as follows:

Sample ECL signal

G6 55870 56541

G5 57798 58354

G4 66316 59120

G3 74763 71190 G2 75315 69284

Gl 301 296

NT1 276 285

NT2 283 295

NT3 312 283 BB 272 289

Example 6: Patient Correlation Study

Samples of patients blood were fractionated and extracted to yield RNA for amplification. As in

Example 4. This yielded samples from Whole blood (V), Platelets (T), Macrophages (M) and Plasma (P). These samples were amplified and subjected to Soutiiern blot analysis with specific probes to determine die level and nature of die amplification from these samples. Samples from this amplification analysis were then subjected to analysis by the ECL system. In addition, standard samples generated in vitro were used as positive controls C2, 10 ² ; C3 10 ³ ; C4, 10 ⁴ ;

Probe solution 2: for 50 gag3 assays we combined:

50 μl of .AKZ02 (ECL oligo at 20 μg/ml),

50 μl of AKZOl (biotin labeled oligonucleotide at 20 μg/ml).

The lμl samples were diluted to 5 μl and made 0.1% SDS, 20mM EDTA and heated for 5 minutes at 95°C. This was followed by die addition of 5 μl of probe solution. Incubated at 50°C for 30 minutes followed by die addition of lOμl of beads (40 μg) and shaking for 60 minutes. These samples were diluted widi ECL assay buffer 485 μl and analyzed on an ECL analyzer.

ECL counts

Patient Number T M P V

203 100124 316769 154032 581

204 499 227775 52619 310007

205 581 98188 501 75430

206 510 368765 101581 524

207 7990 251266 115186 81173

208 533 254802 81832 288289

C2 66644

C3 138150

C4 146093

C5 125322

NT2 207099

NT3 581

BB 605 605

Further patient samples were analyzed.

ECL counts

Patient Number T M P V

209 648 777 813 670

210 672 261234 142876 162615

211 237886 242394 187486 228249

212 676 796 697 2802

213 699 8004 152223 143648

228 592 173790 609 539

C2 169992

C3 128430

C4 157989

C5 142345

NT 575

NT2 209712

All of this data correlated with die northern blot hybridization studies carried out on die amplified samples including die problems with die no templates showing problems with contamination. The assay did show evidence of a hook effect in sample 204P which gave higher results after dilution than with die 1 μl of sample. This sample most likely has greater than the 10' ² limit for the present assays linear response.

This data was followed up widi assays on plasma isolated samples, split for gag3 assays and po!2 assays. Also samples were made from whole blood (V) and macrophages (M) where indicated.

GAG3 assay ECL peak signals.

Sample Sample volume used in die assay nl 20 1,000

114 869 602

115 747 674

116 756 646

117 792 770

118 735 709

201 V 878 9651

201 943 11149

202 V 756 1592

202 722 671

203 21370 196556

204 11450 229730

205 686 686

206 11930 269703

207 13996 151126

208 13217 259667

209 663 585

210 663 608

211 30663 174421

212 684 690

213 21257 227918

228 703 568

NT 869 627

C2 3383 181566

C3 37989 103653

C4 31531 106488

37 V 1156 20282

37 M 1602 53922

41 V 8716 262440

41 M 3579 192855

42 V 747 863 42 M 739 806

POL2 assay ECL peak signals.

Sample volume used in die assay nl 20 1,000

Samples: 203 183 191

204 24301 >300000

205 236 234

206 217 278

207 190 558 208 16232 >300000

209 15150 >300000

210 204 516

211 3493 254728

212 192 335 213 358 7773

228 200 404

NT 221 398

C2 202 404

C3 11893 >300000 C4 17613 >300000

'an Gemen et al. .45 J. Vir. Method

(1993)).

Example 7

In addition to die above assay formats, we ran a set of samples in which all the components were added and hybridized, i.e., sample probes and beads tiiese were incubated at 50 °C as previously and samples taken from this mix at 5 through 30 minutes the signal was maximal at the 5 minute time point indicating die speed of die hybridization and flexibility of the assay system. The samples were a mix of two control amplified samples from 10 ² and 10 ³ input template molecules tiiese samples had been tested positive earlier. The NT was a sample which was negative.

Sample Time (min) ECL signal

C2/C3mix 5.40 39200

16.15 49025

29.25 42960 NT 7.40 863 22.15 1008

>30 85: