Cross Reference to Related Applications

[0001] This application claims the benefit of U.S. Application Serial No. 62/320, 126 filed on April 8, 2016, the disclosure of which is hereby incorporated by reference in its entirety. Applicant also notes it is concurrently filing a potentially related patent application entitled, "SWCNT-DNA-ANTIBODY CONJUGATES, RELATED COMPOSITIONS, AND

SYSTEMS, METHODS AND DEVICES FOR THEIR USE", which claims the benefit of U.S. Application Serial No. 62/334,412 filed on May 10, 2016.

Field of Invention

[0002] This invention relates generally to the detection of nucleotide sequences or other biological materials. In particular embodiments, the invention relates to the combination of single-walled carbon nanotubes and DNA for the optical detection of microRNA.

Sequence Listing

[0003] The present specification makes reference to a Sequence Listing (submitted electronically as a .txt file named "2003080-1324_SL.txt" on April 7, 2017). The .txt file was generated on March 29, 2017 and is 29,854 bytes in size. The entire contents of the Sequence Listing are hereby incorporated by reference. Government Funding

[0004] This invention was made with government support under grant numbers

HD075698 and CA008748 awarded by National Institutes of Health. The government has certain rights in this invention.

Background

[0005] Detection of free oligonucleotides in body fluids holds great promise as diagnostic and prognostic markers for a variety of pathologies, including cancer, metabolic disease, organ rejection, fetal health, and infectious disease. The relative accessibility of body fluids containing these oligonucleotides has fueled progress in creating "liquid biopsies" to circumvent problems inherent to traditional, invasive biopsies. Potential oligonucleotides used for liquid biopsies include cell-free tumor DNA, mRNA, and circulating microRNA (miRNA). Somewhat surprisingly, miRNA was found to differ from other RNA types in that it is stable in body fluids, despite the presence of endogenous RNases. Encouragingly, many studies to date have identified specific expression patterns of miRNA in body fluids, including in serum and urine that are indicative of disease states. The promise of using miRNA in serum or urine for minimally invasive, early detection of a variety of diseases, either alone or in conjunction with other established biomarkers, is exciting because the early detection of cancer is associated with the best prognosis.

[0006] Because miRNA detection has tremendous potential in diagnostics and prognostics, great effort has been put forth in creating novel and reliable detection schemes. The detection of miRNA is complicated by their short length, approximately 22 nucleotides, as well as by a dynamic range that can span several orders of magnitude. Additionally, relative amounts of miRNA purified from biofluids can change depending on the protocol used. The current gold standard for miRNA detection and quantification is RT-qPCR using stem loop primers, which is based on time-consuming amplification of miRNA from purified samples. Innovative assays that avoid amplification, labeling, and purification from biofluids are needed for point-of-care diagnostics. Ideally, an implantable miRNA sensor could report changes in miRNA

concentration in real-time to continuously monitor the health status of a patient.

[0007] The current standard for miRNA measurement, with limits of detection ranging from attomolar (aM) to (fM), is quantitative PCR (qPCR). However, this method requires purification and amplification of miRNA that can introduce biases and variability.

Commercially available techniques that do not involve amplification, such as microarrays, suffer from poorer sensitivity (picomolar (pM) to nanomolar (nM)) and high false positive rates.

Detection strategies that avoid amplification, labeling, and purification from biofluids are under investigation, but in vivo detection strategies are sparse. The detection of nucleic acid biomarkers in real-time and in situ within living tissues and organisms remains an important challenge.

[0008] Nanotechnology-based solutions for miRNA detection represent a promising strategy for amplification-free and label-free detection of miRNA. In particular, individually- dispersed semiconducting single-walled carbon nanotubes (SWCNT s) exhibit ideal qualities as optical biomedical sensors. SWCNTs are fluorescent in the near-infrared, a wavelength range penetrant to tissue, raising the possibility of implantable sensors. Additionally, SWCNTs do not photobleach due to their excitonic nature of fluorescence. The emission wavelength and intensity is exquisitely sensitive to the immediate SWCNT environment, allowing changes at the surface to be transduced in an optical signal. Sensitivity to some analytes has been measured at the single-molecule level. It has been shown that single-strand DNA has an affinity for the nanotube surface and can be used as a dispersant to prepare optically active, single nanotube dispersions. Additionally, DNA-DNA hybridization between nanotube-associated DNA and free single-strand DNA in solution can mediate a solvatochromic shift in the nanotube emission.

[0009] The use of SWCNTs as optical sensors is complicated by the inability to use covalent chemistry for functionalization, as too many sp3 defects along the nanotube sidewall will quench their optical properties. Thus, non-covalent functionalization schemes are required for their application as biosensors. Using such strategies, sensors have been developed for Beta- D-glucose, DNA hybridization, divalent metal cations, assorted genotoxins, nitroaromatics, nitric oxide, pH, and the protein avidin. More recently, specific recognition of target analytes using changes in the corona phase of an adsorbed polymer has been developed. A major challenge in developing non-covalent, colloidally stable sensors for use in biological systems is imparting appropriate specificity for the target analyte while resisting non-specific interactions with other biological material.

[0010] Therefore, there remains a need for accurate and sensitive biosensing platforms.

Summary of Invention

[0011] Described herein are devices and methods for the optical detection of

oligonucleotide binding events for diagnostic, point-of-care, drug screening, and theranostic applications, for example, a robust and customizable system to detect specific DNA and RNA oligonucleotides, using a carbon nanotube optical signal. This optically based detection scheme is useful, e.g., for detecting circulating oligonucleotides that have diagnostic and prognostic value for cancer, metabolic disease, organ rejection, fetal health, and infectious disease. Potential targets include cell-free tumor DNA, circulating mRNA, and circulating microRNA (miRNA). Because this platform is compatible with biofluids, the platform provides, in various embodiments, purification-free, point-of-care diagnostics. Further described are implants comprising the sensing platform in live organisms (e.g., humans, rodents etc.), and methods to detect oligonucleotides in vivo with a noninvasive method. Thus, this platform can be used as an implantable sensor for biomarkers, allowing for real-time, non-invasive monitoring in vivo. Primarily, the devices are, or comprise, a sensor comprising a single-walled carbon nanotube (SWCNT) and a polymer associated with the SWCNT, wherein the polymer comprises a first domain and a second domain, e.g., wherein the first domain has a sequence complementary to a target nucleotide sequence and wherein the second domain is a stabilizing domain.

[0012] Moreover, described herein are engineered carbon-nanotube-based sensors capable of real-time optical quantification of hybridization events of microRNA and other oligonucleotides. The mechanism of the sensors arise from competitive effects between displacement of both oligonucleotide charge groups and water from the nanotube surface, which result in a solvatochromism-like response. The sensors, which allow for detection via single- molecule sensor elements and for multiplexing by using multiple nanotube chiralities, can monitor toehold-based strand-displacement events, which reverse the sensor response and regenerate the sensor complex. It is also shown that the sensors function in whole urine and serum, and can non-invasively measure DNA and microRNA after implantation in live mice.

[0013] In certain embodiments, a distinguishing features is that the polymer on the nanotube includes both a nanotube-binding domain and a target domain that hybridizes with a target/analyte. The target domain can be complementary to a target that is DNA, miRNA, IncRNA, mRNA, and the like. In various embodiments, the sensor can be used to detect DNA, miRNA, mRNA, lnRNA, and the like, of any length, e.g., fewer than 30 nucleotides, or 30 nucleotides or longer.

[0014] In one aspect, the invention is directed to a single-walled carbon nanotube

(SWCNT) sensor, comprising: a SWCNT; a polymer associated with the SWCNT (e.g., conjugated non-covalently or covalently to the SWCNT (e.g., directly or via a linker) (e.g., wrapped around the SWCNT), or otherwise associated with the SWCNT), (e.g., wherein the polymer comprises DNA, LNA, PNA, an amino-acid sequence, or a synthetic monomer), wherein the polymer comprises two or more domains ((e.g., wherein the sensor is capable of detecting species in a sample, e.g., the species having a target nucleotide sequence (e.g., microRNA) (e.g., wherein the target nucleotide sequence has fewer than 30 nucleotides, e.g., wherein the target nucleotide sequence has 30 or more nucleotides)).

[0015] In certain embodiments, the two or more domains comprise: a first domain comprising a stabilizing domain; and a second domain (e.g., or additional domains) comprising a sequence complementary to a target nucleotide sequence. In certain embodiments, the two or more domains comprise: a third domain that has a sequence complementary to a target sequence (e.g., wherein the first domain and the third domain are positioned on each end of the stability domain).

[0016] In certain embodiments, the linker comprises nucleic acid-based, hydrocarbon- based, or polymer-based (e.g., comprises polyethylene glycol (PEG)).

[0017] In certain embodiments, the polymer is single-stranded DNA. In certain embodiments, the polymer comprises a single-stranded DNA binding component containing a sequence complementary to a target nucleotide sequence. [0018] In certain embodiments, the target nucleotide sequence has fewer than 30 nucleotides. In certain embodiments, the target nucleotide sequence has 30 or more nucleotides. In certain embodiments, the target nucleotide sequence has from about 5 nucleotides to about 30 nucleotides. In certain embodiments, the target nucleotide sequence has from about 10 nucleotides to about 25 nucleotides.

[0019] In certain embodiments, the first domain has a sequence complementary to the target nucleotide sequence. In certain embodiments, the first domain has a sequence

complementary to a target miRNA sequence (or a truncated sequence of the target miRNA sequence). In certain embodiments, the target miRNA is a mammalian miRNA member selected from the group consisting of the miRNAs listed in Table 12.

[0020] In certain embodiments, the first domain has a sequence complementary to a target DNA sequence (or a truncated sequence of the target DNA sequence or to a

complementary region in a longer strand with non-complementary regions). In certain embodiments, the second domain is a stabilizing domain (e.g., wherein the stabilization domain provides adequate nanotube dispersion). In certain embodiments, stabilizing means

prevents/reduces agglomeration of SWCNTs and/or promotes stability of a suspension of the SWCNTs.

[0021] In certain embodiments, the second domain is an oligonucleotide sequence (e.g., a short oligonucleotide sequence) (e.g., a single-strand DNA that forms water soluble complexes with SWCNT).

[0022] In certain embodiments, the oligonucleotide sequence comprises a member selected from the group consisting of (GT)6 (SEQ ID NO: 2), (GT)15 (SEQ ID NO: 1), (AT)15 (SEQ ID NO: 3), (TAT)6 (SEQ ID NO: 4), (TCC)10 (SEQ ID NO: 5), (TGA)10 (SEQ ID NO: 6), (CCA) 10 (SEQ ID NO: 7), (TTA)4TT (SEQ ID NO: 8), (TTA)3TTGTT (SEQ ID NO: 9), (TTA)5TT (SEQ ID NO: 10), (TAT)4 (SEQ ID NO: 11), (CGT)3C (SEQ ID NO: 12), (ATT)4 (SEQ ID NO: 13), (ATT)4AT (SEQ ID NO: 14), (TATT)2TAT (SEQ ID NO: 15), (ATTT)3 (SEQ ID NO: 16), (GTQ2GT (SEQ ID NO: 17), (CCG)4 (SEQ ID NO: 18), (GTT)3G (SEQ ID NO: 19), (TGT)4T (SEQ ID NO: 20), (TATT)3T (SEQ ID NO: 22), (TCG)10 (SEQ ID NO: 23), (GTC)3 (SEQ ID NO: 24), (TCG)2TC (SEQ ID NO: 25), (TCG)4TC (SEQ ID NO: 26), (GTC)2 (SEQ ID NO: 27), (TGTT)2TGT (SEQ ID NO: 28), (TTTA)3T (SEQ ID NO: 29), (CCG)2CC (SEQ ID NO: 30), (TCG)4TC (SEQ ID NO: 31), T3C6T3 (SEQ ID NO: 32), (GTQ2GT (SEQ ID NO: 33), CTTC2TTC (SEQ ID NO: 34), TTA(TAT)2ATT (SEQ ID NO: 35),

TCT(CTC)2TCT (SEQ ID NO: 36), (ATT)4 (SEQ ID NO: 37), GC11 (SEQ ID NO: 38), (TC)3CTCCCT (SEQ ID NO: 39), CTTC3TTC (SEQ ID NO: 40), (GT)20 (SEQ ID NO: 41), CTC3TC (SEQ ID NO: 42), (TCT)2 (SEQ ID NO: 43), C5TC6 (SEQ ID NO: 44), T4C4T4 (SEQ ID NO: 45), and C5TTC5 (SEQ ID NO: 46).

[0023] In certain embodiments, the polymer comprises three or more domains. In certain embodiments, the domains have sequences complementary to one or more target nucleotide sequences. In certain embodiments, the domains have sequences complementary to one or more target miRNA sequences.

[0024] In certain embodiments, the sensor further comprises a surfactant. In certain embodiments, the sensor further comprises a surfactant, wherein the surfactant is selected from a group consisting of SDS, SDBS, SDC, SPAN-80, Brij 52, BSA, Triton X-100, Pluronic, Pyrene- PEG, TPGS, IGEPAL, and Phospholipid-PEG-NH ₂ . In certain embodiments, the sensor further comprises SDBS. [0025] In another aspect, the invention is directed to a method for detecting a target using a single-walled carbon nanotube (SWCNT) sensor, the method comprising: contacting a sample comprising a species having a target nucleotide sequence with the SWCNT sensor; exposing the sample to excitation electromagnetic radiation (excitation EMR) to produce an emission of electromagnetic radiation (emission EMR) by the SWCNT sensor; detecting the electromagnetic radiation emitted by the SWCNT sensor; and identifying the presence of the species having the target nucleotide sequence (e.g., a polynucleotide, oligonucleotide, radionucleotide, DNA, RNA, long non-coding RNA; microRNA, circulating microRNA, messenger RNA (mRNA), cell-free tumor DNA, or a fragment, an analogue, or a compound thereof) in the sample based at least in part on the detected emission EMR.

[0026] In certain embodiments, the method comprises detecting a wavelength shift (e.g., a blueshift or a redshift) in the emission EMR and/or an intensity shift (e.g., amplitude shift) or other changes in the spectral characteristics of the emission EMR or non-emission EMR changes, thereby identifying the presence of the species having the target nucleotide sequence in the test sample.

[0027] In certain embodiments, the other changes in the spectral characteristics of the emission EMR include ratiometric intensity changes (e.g., relative changes of one nanotube chirality intensity versus another), changes in full-width half-max (e.g., a measure of the

"thickness" of the spectral peak), changes in exiciton energy transfer (a unique spectral signature from energy exchange between nanotubes in close-contact), and combinations thereof.

[0028] In certain embodiments, the non-emission EMR changes include changes in light absorbance (such as bleaching), blueshift or redshift in the excitation EMR, changes in dynamic light scattering (sample bundling), visible flocculation (aggregation) of nanotubes in sample, and combinations thereof.

[0029] In certain embodiments, the method comprises detecting an intensity shift between an emission center wavelength (e.g., a peak) of the sample and an emission center wavelength (e.g., a peak) of a reference sample, wherein the reference sample is devoid of the species having the target nucleotide sequence.

[0030] In certain embodiments, the method comprises contacting the sample comprising multiple species having target nucleotide sequences with multiple SWCNT sensors, wherein the SWCNTs have different chiralities.

[0031] In certain embodiments, the excitation EMR has a wavelength between 100 nm and 3000 nm, 200 nm and 2000 nm, between 300 and 1500 nm, or between 500 and 1000 nm. In certain embodiments, the emission EMR has a wavelength between 300 nm and 3000 nm, between 400 and 2000 nm, between 500 and 1500 nm, between 600 nm and 1400 nm, or between 700 and 1350 nm. In certain embodiments, the emission wavelength shift is between 1 nm and 100 nm, between 2 nm and 100 nm, between 3 and 50 nm, or between 4 and 20 nm.

[0032] In certain embodiments, the wavelength shift is a blue shift.

[0033] In certain embodiments, the species having the target nucleotide sequence is microRNA.

[0034] In certain embodiments, the method comprisesidentifying a molecule or organism having, or associated with, the target nucleotide sequences. In certain embodiments, the molecule or organism comprises a member selected from the group consisting of a peptide, a polypeptide, a protein, a biologic, a biomolecule, a biosimilar, an aptamer, a virus, a bacterium, a toxin, a cell, an antibody, and a fragment thereof. [0035] In certain embodiments, the sample is a biological sample (e.g., in vitro, ex vivo, or in vivo, e.g., wherein the biological sample is a subject). In certain embodiments, the sample is a member selected from the group consisting of a cell culture sample, a laboratory sample, a tissue sample (e.g., muscle tissue, nervous tissue, connective tissue, and epithelial tissue), and a bodily fluid sample (e.g., Amniotic fluid, Aqueous humour and vitreous humour, Bile, Blood serum, Breast milk, Cerebrospinal fluid, Cerumen (earwax), Chyle, Chyme, Endolymph and perilymph, Exudates, Feces, Female ejaculate, Gastric acid, Gastric juice, Lymph, Menstrual fluid, Mucus (including nasal drainage and phlegm), Pericardial fluid, Peritoneal fluid, Pleural fluid, Pus, Rheum, Saliva, Sebum (skin oil), Serous fluid, Semen, Smegma, Sputum, Synovial fluid, Sweat, Tears, Urine, Vaginal secretion, Vomit., etc.).

[0036] In certain embodiments, the SWCNT sensor is the sensor.

[0037] In another aspect, the invention is directed to a kit for use in a laboratory setting, the kit comprising: at least one container (e.g., an ampule, a vial, a cartridge, a reservoir, a lyo- ject, or a pre-filled syringe); and a single-walled carbon nanotube (SWCNT) sensor as described herein.

[0038] In another aspect, the invention is directed to a system for the detection of microRNA, comprising a single-walled carbon nanotube (SWCNT) sensor, a source of electromagnetic radiation, and an electromagnetic radiation detector.

[0039] In another aspect, the invention is directed to an implantable detection device comprising the SWCNT sensor. In certain embodiments, the device is a point-of-care medical device (e.g., a urine dipstick, a test strip, a membrane, a skin patch, a skin probe, a gastric band, a stent, a catheter, a needle, a contact lens, a prosthetic, a denture, a vaginal ring, or other implant). In certain embodiments, the device is a device for monitoring environmental conditions. In certain embodiments, the device comprises a microfluidic chamber containing a surface- immobilized SWCNT sensor, or an SWCNT sensor contained in a semi-permeable enclosure.

[0040] In another aspect, the invention is directed to a dynamic DNA nanotechnology device comprising a single-walled carbon nanotube (SWCNT) sensor. In certain embodiments, the device is a circuit, a catalytic amplifier, an autonomous molecular motor, or a reconfigurable nanostructure.

[0041] Elements of the embodiments involving one aspect of the invention (e.g., methods) can be applied in embodiments involving other aspects of the invention (e.g., devices), and vice versa.

Definitions

[0042] In order for the present disclosure to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.

[0043] In this application, the use of "or" means "and/or" unless stated otherwise. As used in this application, the term "comprise" and variations of the term, such as "comprising" and "comprises," are not intended to exclude other additives, components, integers or steps. As used in this application, the terms "about" and "approximately" are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art. In certain

embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%), 2%), 1%), or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0044] "Administration": The term "administration" refers to introducing a substance into a subject. In general, any route of administration may be utilized including, for example, parenteral (e.g., intravenous), oral, topical, subcutaneous, peritoneal, intraarterial, inhalation, vaginal, rectal, nasal, introduction into the cerebrospinal fluid, or instillation into body compartments. In some embodiments, administration is oral. Additionally or alternatively, in some embodiments, administration is parenteral. In some embodiments, administration is intravenous.

[0045] "Affinity": As is known in the art, "affinity" is a measure of the tightness with a particular ligand binds to its partner. Affinities can be measured in different ways. In some embodiments, affinity is measured by a quantitative assay. In some such embodiments, binding partner concentration may be fixed to be in excess of ligand concentration so as to mimic physiological conditions. Alternatively or additionally, in some embodiments, binding partner concentration and/or ligand concentration may be varied. In some such embodiments, affinity may be compared to a reference under comparable conditions (e.g., concentrations).

[0046] "Amphipathic" or "Amphiphilic": The terms "amphipathic" and "amphiphilic" are interchangeably used herein, and each termrefers to a molecule containing both a hydrophilic (and/or charged) domain and a hydrophobic domain.

[0047] "Analog": As used herein, the term "analog" refers to a substance that shares one or more particular structural features, elements, components, or moieties with a reference substance. Typically, an "analog" shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, an analog is a substance that can be generated from the reference substance, e.g., by chemical manipulation of the reference substance. In some embodiments, an analog is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance. In some embodiments, an analog is or can be generated through performance of a synthetic process different from that used to generate the reference substance.

[0048] "Aptamer": As used herein, the term "aptamer" refers to a macromolecule composed of nucleic acid (e.g., RNA, DNA) that binds tightly to a specific molecular target (e.g., an umbrella topology glycan). A particular aptamer may be described by a linear nucleotide sequence and is typically about 15-60 nucleotides in length. Without wishing to be bound by any theory, it is contemplated that the chain of nucleotides in an aptamer form intramolecular interactions that fold the molecule into a complex three-dimensional shape, and this three- dimensional shape allows the aptamer to bind tightly to the surface of its target molecule. Given the extraordinary diversity of molecular shapes that exist within the universe of all possible nucleotide sequences, aptamers may be obtained for a wide array of molecular targets, including proteins and small molecules. In addition to high specificity, aptamers typically have very high affinities for their targets (e.g., affinities in the picomolar to low nanomolar range for proteins). In many embodiments, aptamers are chemically stable and can be boiled or frozen without loss of activity. Because they are synthetic molecules, aptamers are amenable to a variety of modifications, which can optimize their function for particular applications. For example, aptamers can be modified to dramatically reduce their sensitivity to degradation by enzymes in the blood for use in in vivo applications. In addition, aptamers can be modified to alter their biodistribution or plasma residence time. [0049] "Associated": As used herein, the term "associated" typically refers to two or more entities in physical proximity with one another, either directly or indirectly (e.g., via one or more additional entities that serve as a linking agent), to form a structure that is sufficiently stable so that the entities remain in physical proximity under relevant conditions, e.g., physiological conditions. In some embodiments, associated moieties are covalently linked to one another. In some embodiments, associated entities are non-covalently linked. In some embodiments, associated entities are linked to one another by specific non-covalent interactions (e.g., by interactions between interacting ligands that discriminate between their interaction partner and other entities present in the context of use, such as, for example, streptavidin/avidin interactions, antibody/antigen interactions, etc.). Alternatively or additionally, a sufficient number of weaker non-covalent interactions can provide sufficient stability for moieties to remain associated. Exemplary non-covalent interactions include, but are not limited to, electrostatic interactions, hydrogen bonding, affinity, metal coordination, physical adsorption, host-guest interactions, hydrophobic interactions, pi stacking interactions, van der Waals interactions, magnetic interactions, electrostatic interactions, dipole-dipole interactions, etc.

[0050] "Nucleic acid": As used herein, in its broadest sense, refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and/or nucleosides); in some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a "nucleic acid" is or comprises RNA; in some embodiments, a "nucleic acid" is or comprises DNA. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a nucleic acid is, comprises, or consists of one or more "peptide nucleic acids", which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention. Alternatively or additionally, in some embodiments, a nucleic acid has one or more phosphorothioate and/or 5'-N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural

nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2- thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5 -propynyl-cytidine, C5-methylcytidine, 2- aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)- methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2'- fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long. In some embodiments, a nucleic acid is single stranded; in some embodiments, a nucleic acid is double stranded. In some embodiments a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. In some embodiments, a nucleic acid has enzymatic activity.

[0051] "Polypeptide": As used herein refers to any polymeric chain of amino acids. In some embodiments, a polypeptide has an amino acid sequence that occurs in nature. In some embodiments, a polypeptide has an amino acid sequence that does not occur in nature. In some embodiments, a polypeptide has an amino acid sequence that is engineered in that it is designed and/or produced through action of the hand of man. In some embodiments, a polypeptide may comprise or consist of natural amino acids, non-natural amino acids, or both. In some embodiments, a polypeptide may comprise or consist of only natural amino acids or only non- natural amino acids. In some embodiments, a polypeptide may comprise D-amino acids, L- amino acids, or both. In some embodiments, a polypeptide may comprise only D-amino acids. In some embodiments, a polypeptide may comprise only L-amino acids. In some embodiments, a polypeptide may include one or more pendant groups or other modifications, e.g., modifying or attached to one or more amino acid side chains, at the polypeptide's N-terminus, at the polypeptide's C-terminus, or any combination thereof. In some embodiments, such pendant groups or modifications may be selected from the group consisting of acetylation, amidation, lipidation, methyl ati on, pegylation, etc., including combinations thereof. In some embodiments, a polypeptide may be cyclic, and/or may comprise a cyclic portion. In some embodiments, a polypeptide is not cyclic and/or does not comprise any cyclic portion. In some embodiments, a polypeptide is linear. In some embodiments, a polypeptide may be or comprise a stapled polypeptide. In some embodiments, the term "polypeptide" may be appended to a name of a reference polypeptide, activity, or structure; in such instances it is used herein to refer to polypeptides that share the relevant activity or structure and thus can be considered to be members of the same class or family of polypeptides. For each such class, the present specification provides and/or those skilled in the art will be aware of exemplary polypeptides within the class whose amino acid sequences and/or functions are known; in some embodiments, such exemplary polypeptides are reference polypeptides for the polypeptide class or family. In some embodiments, a member of a polypeptide class or family shows significant sequence homology or identity with, shares a common sequence motif (e.g., a characteristic sequence element) with, and/or shares a common activity (in some embodiments at a comparable level or within a designated range) with a reference polypeptide of the class; in some embodiments with all polypeptides within the class). For example, in some embodiments, a member polypeptide shows an overall degree of sequence homology or identity with a reference polypeptide that is at least about 30-40%, and is often greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more and/or includes at least one region (e.g., a conserved region that may in some embodiments be or comprise a characteristic sequence element) that shows very high sequence identity, often greater than 90% or even 95%, 96%, 97%), 98%), or 99%. Such a conserved region usually encompasses at least 3-4 and often up to 20 or more amino acids; in some embodiments, a conserved region encompasses at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more contiguous amino acids. In some embodiments, a useful polypeptide may comprise or consist of a fragment of a parent polypeptide. In some embodiments, a useful polypeptide as may comprise or consist of a plurality of fragments, each of which is found in the same parent polypeptide in a different spatial arrangement relative to one another than is found in the polypeptide of interest (e.g., fragments that are directly linked in the parent may be spatially separated in the polypeptide of interest or vice versa, and/or fragments may be present in a different order in the polypeptide of interest than in the parent), so that the polypeptide of interest is a derivative of its parent polypeptide.

[0052] "Prevent or prevention": As used herein when used in connection with the occurrence of a disease, disorder, and/or condition, refers to reducing the risk of developing the disease, disorder and/or condition and/or to delaying onset of one or more characteristics or symptoms of the disease, disorder or condition. Prevention may be considered complete when onset of a disease, disorder or condition has been delayed for a predefined period of time.

[0053] "Protein": As used herein, the term "protein" refers to a polypeptide (i.e., a string of at least two amino acids linked to one another by peptide bonds). Proteins may include moieties other than amino acids (e.g., may be glycoproteins, proteoglycans, etc.) and/or may be otherwise processed or modified. Those of ordinary skill in the art will appreciate that a

"protein" can be a complete polypeptide chain as produced by a cell (with or without a signal sequence), or can be a characteristic portion thereof. Those of ordinary skill will appreciate that a protein can sometimes include more than one polypeptide chain, for example linked by one or more disulfide bonds or associated by other means. Polypeptides may contain L-amino acids, D- amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, proteins may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, proteins are antibodies, antibody fragments, biologically active portions thereof, and/or characteristic portions thereof.

[0054] "Sample": As used herein, the term "sample" typically refers to a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, a source of interest comprises an organism, such as an animal or human. In some embodiments, a biological sample is or comprises biological tissue or fluid. In some embodiments, a biological sample may be or comprise bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine;

cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; washings or lavages such as a ductal lavages or broncheoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids, secretions, and/or excretions; and/or cells therefrom, etc. In some embodiments, a biological sample is or comprises cells obtained from an individual. In some embodiments, obtained cells are or include cells from an individual from whom the sample is obtained. In some embodiments, a sample is a "primary sample" obtained directly from a source of interest by any appropriate means. For example, in some embodiments, a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces etc.), etc. In some embodiments, as will be clear from context, the term "sample" refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane. Such a "processed sample" may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc.

[0055] "Substantially": As used herein, the term "substantially", and grammatic equivalents, refer to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the art will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result.

[0056] "Subject": As used herein, the term "subject" includes humans and mammals

(e.g., mice, rats, pigs, cats, dogs, and horses). In many embodiments, subjects are mammals, particularly primates, especially humans. In some embodiments, subjects are livestock such as cattle, sheep, goats, cows, swine, and the like; poultry such as chickens, ducks, geese, turkeys, and the like; and domesticated animals particularly pets such as dogs and cats. In some embodiments (e.g., particularly in research contexts) subject mammals will be, for example, rodents (e.g., mice, rats, hamsters), rabbits, primates, or swine such as inbred pigs and the like.

[0057] "Therapeutic agent": As used herein, the phrase "therapeutic agent" refers to any agent that has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect, when administered to a subject. [0058] "Treatment": As used herein, the term "treatment" (also "treat" or "treating") refers to any administration of a substance that partially or completely alleviates, ameliorates, relives, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition. Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition. Alternatively or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.

[0059] Drawings are presented herein for illustration purposes, not for limitation.

Brief Description of Drawings

[0060] FIG. 1 shows results of a screen of a certain number of nucleotide sequences for stability and resistance to non-specific oligonucleotide interactions.

[0061] FIG. 2A is a schematic for the construction of the SWCNT sensing platform, according to an illustrative embodiment of the invention. "(GT)15" disclosed as SEQ ID NO: 1.

[0062] FIG. 2B shows wavelength shifts from miR-19 and R23 sequences.

[0063] FIG. 2C shows atomic force microscopy (AFM) images of a sensor complex upon incubation with non-complementary (R23HP) or complementary (miR-19HP) hairpin DNA. [0064] FIG. 2D shows fluorescence restoration in the -presence of 1 μΜ miR-19 DNA vs. 1 μΜ Ι123.

[0065] FIG. 2E is a graphical representation of snapshot images of molecular dynamics simulations of the GT15mirl9 sensor (Unhyb) and GT15mirl9 sensor hybridized with miR-19 (Hyb) after equilibrating for 250 ns, according to an illustrative embodiment of the invention. Teal color denotes the (GT)i ₅ (SEQ ID NO: 1), nanotube-binding sequence, and orange denotes the miR-19 capture sequence. The purple strand denotes miR-19.

[0066] FIG. 2F shows a spectra from 730 nm excitation with and without target miR-19 in buffer only conditions in the top panel, and in the presence of 0.2% SDBS in the bottom panel.

[0067] FIG. 2G shows wavelength shifts from miR-19 and R23 (+presence of surfactant).

[0068] FIG. 2H is a graphic representation of the assembly of supramolecular complexes of SDBS, triggered by the detection of target RNA or DNA, according to an illustrative embodiment of the invention.

[0069] FIG. 21 shows density of water as a function of radial distance from the nanotube, calculated for both simulations.

[0070] FIG. 2J shows density of phosphate groups as a function of radial distance from the nanotube, calculated for the final frame of both simulations.

[0071] FIG. 3 shows complete photoluminescence spectroscopy (PL) plots for DNA- based and RNA-based target miR-19 / miR-23 sequences.

[0072] FIG. 4 shows intensity changes for selected chirality indexes following binding to

DNA miR-19 and RNA miR-19.

[0073] FIG. 5 shows shifts in the excitation wavelength against shifts in emission wavelengths following binding to DNA miR-19 and RNA miR-19. [0074] FIG. 6 shows AFM derived height maps (bottom) for hairpin decorated miR-19

(SEQ ID NO: 111) and R-23 (SEQ ID NO: 110) sequences (top).

[0075] FIG. 7 shows blueshifts for three different chiralities of GT6mirl9.

[0076] FIG. 8 is a graphic representation of restoration of Cy5 fluorescence upon binding of miR-19, according to an illustrative embodiment of the invention.

[0077] FIG. 9 shows blueshifts for three different chiralities of GT6mirl9-Cy5.

[0078] FIG. 10 shows representative PL plots - miR-19 RNA vs. Buffer.

[0079] FIG. 11 shows an impact of surfactant - Fold change of intensity for miR-19 and

R-23 sequences.

[0080] FIG. 12 shows a correlation between the excitation wavelength shift and the emission wavelength shift for the ensemble of chiralities.

[0081] FIGS. 13 A and 13B show an emission energy change (FIG. 13 A) and intensity shift (FIG. 13B) in relation to nanotube diameter for mod2 nanotube.

[0082] FIG. 14 show characteristics of emission of GT15mirl9 + SDBS, with 1 :2 serial dilution from 4% to 0.004% SDBS (128 mM to 0.0625 mM).

[0083] FIG. 15 shows an impact of presence of 1 μΜ of random sequences on wavelength for three measured chiralities.

[0084] FIGS. 16A-16L show characterization data of the described sensors comprising

SDBS.

[0085] FIG. 16 A shows blueshift behavior.

[0086] FIG. 16B shows an effect of concentration.

[0087] FIG. 16C shows a wavelength shift for (7,5) nanotube.

[0088] FIG. 16D shows blueshift rates for different chiralities. [0089] FIG. 16E shows truncated target sequences ranging from 10 to 15 nucleotides that can bind either from the 3' end or the 5' portion in the middle of the recognition sequence (SEQ

ID NOS 47, 55, 47 and 112, respectively, in order of appearance).

[0090] FIG. 16F shows wavelength shift for truncated target sequences.

[0091] FIG. 16G shows modelled orientation upon binding and resulting spectral shift of two sequences, R23-mirl9 and mirl9-R23 that have R23 at either the 3 ' end or 5' end.

[0092] FIG. 16H shows wavelength shift for R23-mirl9 and mirl9-R23 that have R23 at either the 3' end or 5' end.

[0093] FIG. 161 shows spectral responses (blue-shifts), of the sensor composed of the specified capture sequences, to related miR-200 family sequences (shown in the table below the graph of FIG. 161; differences shown in red). miR-141 : TAACACTGTCTGGTAAAGATGG (SEQ ID NO: 89); miR-200b: TAATACTGCCTGGTAATGATGA (SEQ ID NO.: 90); miR-429: TAATACTGTCTGGTAAAACCGT (SEQ ID NO: 91). Sequences disclosed as SEQ ID NOS 89- 91, respectively, in order of appearance.

[0094] FIG. 16J shows emission response of the sensor to a series of truncated sequences

(length specified in the x axis) designed to hybridize to either the middle or 3' end of the capture sequence.

[0095] FIG. 16K is a cartoon illustrating a modified analyte sequence and expected configuration upon binding to the GT15mirl9 sensor, according to an illustrative embodiment of the invention.

[0096] FIG. 16L shows spectral response of the (8,6) nanotube species upon introduction of long analyte sequences to the sensor. [0097] FIG. 17 shows dose-response curves to determine the limit and range of detection with various concentrations of nanotube.

[0098] FIG. 18 is a graphic representation of blueshift kinetics, according to an illustrative embodiment of the invention.

[0099] FIG. 19 shows PL plots after addition of miR-19 DNA or miR-19 RNA to measure eleven different chiralities.

[0100] FIG. 20 is a graphic representation of rate of blueshifting with miR-19 DNA across the measured chiralities, according to an embodiment of the invention.

[0101] FIG. 21 is graphic representations of rate of blueshifting for 8 different miR for chirality (8,6), according to an embodiment of the invention.

[0102] FIG. 22 is graphic representations of rate of blueshifting for 8 different miR for chirality (9,4), according to an embodiment of the invention.

[0103] FIG. 23 shows a redshift of R23-mirl9-R23 compared with R23R23R23 and R23.

[0104] FIG. 24A shows an image of nanotubes absorbed on lysine coated plate.

[0105] FIG. 24B show wavelength shifts of spectra 50 min after addition of miR-19 RNA or R23.

[0106] FIG. 24C show single nanotube spectra before and after addition of miR-19 RNA,

[0107] FIG. 24D show single nanotube spectra before and after addition of R23 to surface-absorbed GT15mirl9 nanotubes.

[0108] FIGS. 25A and 25B show single nanotube spectra before and after addition of miR-19 RNA (FIG. 25 A) or R23 (FIG. 25B) to surface-absorbed GT15mirl9 nanotubes.

[0109] FIG. 26A shows a PL plot for a HiPCO preparation (NanoC) that is almost totally devoid of (6,5) suspended with GT15mirl9. [0110] FIG. 26B shows a PL plot for a CoMoCAT preparation of nanotubes, which is mostly the (6,5) and almost no (8,6) suspended with GT15mir509.

[0111] FIG. 26C shows wavelength shifts for both sensors employed separately or together.

[0112] FIG. 26D is a graphical representation of components of GT15cReporter-sensor detection system, according to an illustrative embodiment of the invention.

[0113] FIG. 26E shows wavelength shifts of components of GT15cReporter-sensor detection system.

[0114] FIG. 27 shows normalized absorbance for a preparation that is almost totally devoid of (6,5) suspended with GT15mirl9, but with (8,6) present, and a preparation of nanotubes, which is mostly the (6,5) and almost no (8,6), suspended with GT15mir509.

[0115] FIG. 28 show characterization of GT15cReporter-sensor detecting a reporter strand of DNA released from a structure-switching aptamer.

[0116] FIGS. 29A and 29B show wavelength shift (FIG. 29A) for GT15mirl9 with 6 bases removed from the end of the complementary binding region, compared with miR-19 DNA and RNA and R23 DNA and RNA (FIG. 29B) intensity fold shift for GT15mirl9 with 6 bases removed from the end of the complementary binding region, compared with miR-19 DNA and RNA and R23 DNA and RNA.

[0117] FIGS. 29C and 29D depict a time course taken after adding miR-19 DNA, measuring wavelength shifts and intensity (arrow: addition of the removing strand to the solution).

[0118] FIG. 29E depicts a model of toehold mediated strand displacement on the nanotube, beginning with the hybridized DNA containing a 6 nucleotide overhang [0119] FIG. 30 shows center wavelengths for GT15mirl9 tested in a solution of 10% fetal bovine serum (FBS) or buffer for three chiralities.

[0120] FIGS. 31 A-3 ID show wavelength shifts (FIG. 31 A) and changes of intensity

(FIG. 3 IB) for GT15mirl9 in various concentrations in urine; wavelength shifts (FIG. 31C) and changes of intensity (FIG. 3 ID) for GT15mirl9 in various concentrations in 10% fetal bovine serum (FBS).

[0121] FIG. 3 IE shows SDBS-pretreated GT15mirl9 nanotubes loaded into an implantable semipermeable membrane with a molecular weight cut off (500 kDa).

[0122] FIG. 3 IF shows a nanotube implant inserted into the peritoneum medially over mouse intestines.

[0123] FIG. 31G shows a graphical representation of excitation of the nanotubes with

730 nm light and collection of the nanotube emission, according to an illustrative embodiment of the invention.

[0124] FIG. 31H shows center wavelengths for two control groups and target microRNA group.

[0125] FIG. 3 II shows center wavelengths for two control groups and target microRNA group (repeat experiment).

[0126] FIG. 32 shows characterization of implantable sensor subjected to dialysis against buffer for 6 hours with three buffer changes.

[0127] FIG. 33 shows GT15mirl9 blueshifts upon specific recognition.

[0128] FIG. 34 shows a representative model of SDBS enhancement, according to an illustrative embodiment of the invention. SDBS associates with a nanotube as described herein, and gives a partial SDBS/DNA wrapped character. As hybridization occurs, the ratio of SDBS to DNA covered nanotube surface changes and increases SDBS.

[0129] FIG. 35 shows that binding of miRNA target to the nanotube displays a blueshift.

[0130] FIG. 36 shows that some miRNA targets in combination with some nanotubes produce an intensity increase.

[0131] FIG. 37 shows wavelength shifts of 6 different nanotube chiralities upon addition of DNA sequence analogues of miR-19 with truncated lengths. R23 is the full length, random sequence control, and mirl9 is the complete sequence length. The suffix after mirl9 indicates the length of the truncated strand..

[0132] FIG. 38 shows kinetic traces of wavelength shifts and intensity changes of 3 different nanotube chiralities upon addition of DNA sequence analogues of miR-19 with truncated lengths. R23 is the full length, random sequence control, and mirl9 is the complete sequence length. The suffix after mirl9 indicates the length of the truncated strand.

[0133] FIG. 39 shows intensity fold change for various target miRNAs using various nanotube chiralities.

[0134] FIG. 40 shows blueshift for various chiralities as a function of delta G

(kcal/mole).

[0135] FIG. 41 shows wavelength shifts for truncated DNA analogues for the (8,6) nanotube, and a PL plot depicting wavelength shifts for 12 chiralities of nanotubes as a function of target DNA length..

[0136] FIGS. 42A-42F each show a kinetic response of the GT15mirX sensor to three closely-related sequences. The response of the (9,4) chirality is shown. [0137] FIGS. 42A-42B each show a wavelength shift and intensity change of the sensor specific for miR- 141 (GT15mirl41).

[0138] FIGS. 42C and 42D each show wavelength shift and intensity change over time for sensor specific for miR-200b (GT15mir200b).

[0139] FIGS. 42E and 42F each showwavelength shift and intensity fold change over time for sensor specific for miR-429 (GT15mir429). Error bars represent standard error of the mean for n = 3 technical replicates.

[0140] FIG. 43 A shows wavelength shifts of 6 different chiralities upon addition of long strands of DNA with a short portion of complementary in the middle.

[0141] FIG. 43B depicts wavelength shifting for complementary DNA strands with non- complementary DNA on either the 5' or 3' end, which results in a blue or red shift

[0142] FIGS. 44A-44C show atomic force microscopy of the GT15mirl9 complex under aqueous conditions.

[0143] FIG. 44A shows the complementary binding partner after incubation with miR-

19HP (SEQ ID NO: 113).

[0144] FIG. 44B shows a non-complementary control after incubation with R23HP (SEQ

ID NO: 21).

[0145] FIG. 44C shows after incubation with buffer only.

[0146] FIGS. 45A-45F show structural parameters of the GT15mirl9 sensor complex computed for the (9,4) nanotube via molecular dynamics simulations.

[0147] FIGS. 45A and 45B show distribution of radial distance and (FIG. 45B) stacking angle relative the nanotube for nucleobases from the GT15 (SEQ ID NO: 1) nanotube binding domain and miR-19 miRNA capture sequence domain when hybridized to target miR-19. [0148] FIG. 45C and 45D show distribution of radial distance and (FIG. 45D) stacking angle relative to the nanotube for nucleobases from the hybridized target miR-19 when hybridized with the miRNA capture sequence.

[0149] FIG. 45E shows distributions of radial distance from the nanotube of the miR-19 miRNA capture sequence when target miR-19 is not hybridized. "GT15" disclosed as SEQ ID NO: 1.

[0150] FIG. 45F shows stacking angle of miR-19 miRNA capture sequence when target miR-19 is not hybridized. "GT15" disclosed as SEQ ID NO: 1.

[0151] FIGS. 46A-46B show starting configurations of molecular dynamics simulations involving the duplex miRNA capture sequence + miR-19 without the GT ₁₅ (SEQ ID NO: 1) nanotube binding domain.

[0152] FIG. 46A shows miRNA capture sequence/miR-19 duplex initially configured parallel to the axial vector of the nanotube.

[0153] FIG. 46B shows miRNA capture sequence/miR-19 duplex initially configured perpendicular to the axial vector of the nanotube.

[0154] FIG. 47 shows two calculations of hybridization free energy of DNA on the nanotube surface. Graphics are illustrative examples of the reference states and G in _d in _g values are taken the work by Jung et al. Case A depicts the scenario where single stranded DNA on a nanotube hybridizes with complementary DNA in solution. Case B depicts the scenario were both strands are first adsorbed to the nanotube surface.

[0155] FIGS. 48A and 48B show (FIG. 48A) mean peak wavelength and (FIG. 48B) intensity values of the GT15mirl9 complex after incubation with amphipathic molecules. Data is shown for the (7,5) nanotube species. Error bars represent standard deviation from three technical replicates.

[0156] FIGS. 49 A and 49B show change of the GT15mirl9 sensor response to miRNA upon interrogation with a panel of amphiphilic molecules. (FIG. 49A) Wavelength shift from buffer control and (FIG. 49B) intensity fold enhancement over buffer control are shown following incubation with the target oligonucleotide or non-complementary control after 4 hours.

[0157] FIG. 50 shows emission wavelength response of GT15mirX sensors to their complementary miR biomarker sequence or R23 non-complementary control (DNA). The responses of four nanotube chiralities are shown. Error bars represent standard error of the mean for n = 3 technical replicates.

[0158] FIGS. 51A-51F each show a kinetic response of the GT15mirX sensor to three closely-related sequences. The response of the (8,6) chirality is shown.

[0159] FIGS. 51 A and 5 IB each show wavelength shift and intensity fold change over time for sensor specific for miR-141 (GT15mirl41).

[0160] FIGS. 51C and 5 ID each show wavelength shift and intensity fold change over time for sensor specific for miR-200b (GT15mir200b).

[0161] FIGS. 5 IE and 5 IF each show wavelength shift and intensity fold change over time for sensor specific for miR-429 (GT15mir429). Error bars represent standard error of the mean for n = 3 technical replicates.

[0162] FIGS. 52A and 52B show GT15mirX sensor response rates vs. guanine content of the miRNA capture sequences.

[0163] FIG. 52A shows a response of the (9,4) nanotube chirality. [0164] FIG. 52B shows a response of the (8,6) nanotube chirality. Pearson correlation coefficients are indicated.

[0165] FIG. 53 shows GT15mirX sensor response rates vs. thymine, adenosine, and cytosine content of the miRNA capture sequence, or free energy of hybridization of the miRNA capture sequence. Response of the (9,4) chirality was measured. No statistically significant correlations were found.

[0166] FIG. 54 shows GT15mirX sensor response rates vs. thymine, adenosine, and cytosine content of the miRNA capture sequence, or free energy of hybridization of the miRNA capture sequence. Response of the (8,6) chirality was measured. No statistically significant correlations were found.

[0167] FIGS. 55A-55B show sensor response in urine from healthy donors.

[0168] FIG. 55A shows wavelength shift as a function of miR-19 RNA or non- complementary control R23 concentration for each individual donor.

[0169] FIG. 55B shows intensity fold enhancement as a function of added miR-19 RNA or non-complementary control R23 concentration. Error bars represent standard deviation of three technical replicates.

[0170] FIGS. 56A-56B show data of the sensor response in serum.

[0171] FIG. 56A shows wavelength shift of the GT15mirl9 sensor in whole serum with

0.2% SDBS and upon addition of proteinase K. The response of the (8,6) nanotube is shown.

[0172] FIG. 56B shows intensity change in the same conditions. Error bars represent standard deviation of three technical replicates. [0173] FIG. 57 shows intensity response of the GT15mir21 sensor after introducing the miR-21 RNA oligonucleotide in serum with proteinase K. Error bars represent standard deviation of three technical replicates.

[0174] FIGS. 58A-58B show persistence of wavelength shifting of the GT15mirl9 sensor upon dialysis of SDBS.

[0175] FIG. 58A shows emission wavelength response of the sensor, interrogated after the indicated dialysis time. Buffer changes are indicated by the arrows.

[0176] FIG. 58B shows average emission wavelength the sensor in response to miR-19

DNA and buffer control at all timepoints.

[0177] FIG. 59 shows response of the implanted sensor device to 1 nanomole of miR-19

RNA within live mice. The (8,6) nanotube chirality was measured; 3-4 spectra per animal were taken; 3 animals were measured per group (p<0.0001, Dunnet's multiple comparison test, ordinary one-way ANOVA).

[0178] FIG. 60 shows a dose-response curve of the GT15mirl9 sensor capillary device measured in vitro.

[0179] FIG. 61 shows emission from the implantable devices removed from one animal in each group after injection of buffer, 500 pmol miR-19 RNA, or 500 pmol R23 RNA. Error bars represent standard error of the mean for 3-4 measurements.

[0180] FIGS. 62A-62H show detection of miRNA in biofluids and non-invasively within live mice.

[0181] FIG. 62A shows response of the GT15mirl9 sensor emission wavelength to miR-

19 spiked into urine from 5 healthy donors. The (7,6) nanotube chirality was measured. Error bars represent standard deviation of technical triplicates. [0182] FIG. 62B shows intensity response of the sensor in urine. Error bars represent standard deviation of technical triplicates.

[0183] FIG. 62C shows wavelength response of the nanotube sensor complex to miR-21 and miR-19 miRNA in fetal bovine serum (FBS). Error bars represent standard deviation of technical triplicates.

[0184] FIG. 62D shows semi-permeable membrane encapsulating the GT15mirl9 sensor for implantation.

[0185] FIG. 62E is a diagram of R probe apparatus for illuminating and measuring the sensor response in vivo, according to an illustrative embodiment of the invention.

[0186] FIG. 62F shows an image of a NIR probe system measuring the nanotube response within a live mouse.

[0187] FIG. 62G shows a response of the implanted sensor device to miR-19 DNA within the live mouse (3-4 measurements per mouse; 3 mice per group). The (9,4) nanotube species was measured (p<0.0001, Dunnet's multiple comparison test, ordinary one-way

ANOVA).

[0188] FIG. 62H shows a response of the implanted sensor device to 500, 100, and 50 pmol of miR-19 RNA or R23 RNA injected into mice intraperitoneally (3-4 measurements per animal; 3 animals per group), shown for the (8,7) nanotube species. 50 pmol R23 was slightly red-shifted compared to buffer control. Error bars represent standard deviation. Statistical significance was calculated with Dunnet's multiple comparison test. Ordinary ANOVA was used to compare the mean of each group to the mean of the buffer control. Sidak's multiple comparison test with an alpha of 0.05 was used to compare miR-19 groups. [0189] FIGS. 63 A-63C show that use of a nanotube sensor with two or more binding domains (e.g., first and second binding domains) leads to a greater magnitude of shift, but not an increase in sensitivity, compared to a nanotube sensor with one binding domain. GT15mirl9 comprises two domains: a stability and a binding domain; and mirl9GT15mirl9 comprises three domains: two binding domains and a stability domain. Data is shown for 5 nanotube chiralities comparing the dose-response of added DNA oligonucleotide taret to the two-domain construct versus the three-domain construct.

Detailed Description

[0190] Described herein are devices and methods for the detection of microRNA

(miRNA) and other oligonucleotides in biofluids based on the triggered assembly of a surfactant supramolecular complex on DNA-dispersed SWCNTs. This triggered assembly results in a highly specific emission blueshift shift and an increase in quantum yield based on the resulting decrease in the effective solvent dielectric constant immediately surrounding the nanotube. In certain embodiments, it is possible to detect miRNA with a threshold of 10 pM, with a tunable dynamic range over 5 orders of magnitude (10 pM to 10 μΜ). Without wishing to be bound by theory, by imaging single nanotube shifting on a surface, it is possible to reduce the threshold theoretically to 10's of copies. In other embodiments, for example by using a structure- switching aptamer for ATP that releases a target oligonucleotide upon binding, it is possible to expand the platform for indirect detection of other biologically relevant analytes.

[0191] Described herein are label-free sensors that detect hybridization events of miRNA and other oligonucleotides transiently and in vivo. Included are sensors which transduce the hybridization of small DNA and RNA oligonucleotides into spectral changes of carbon nanotube photoluminescence. Without wishing to be bound by any particular theory, the mechanism of action of the sensors was determined via experiments and molecular dynamics simulations to be a competitive response to local dielectric and electrostatic factors. Accordingly, a scheme was designed where amphiphilic moieties undergo triggered assembly on the nanotube surface upon binding of target miRNA, resulting in a markedly enhanced spectral response. As provided herein, it is shown that the sensors enable multiplexed detection using different nanotube chiralities and real-time monitoring of toehold-mediated DNA-strand displacement, causing a reversal of the signal response. The sensors are highly resistant to non-specific interactions with biological molecules, allowing for direct detection in urine and serum. Further, described herein is the first in vivo optical detection of target DNA and miRNA by encasing the sensor within an implantable device through which hybridization is detected non-invasively via near-infrared fluorescence in live mice.

[0192] In certain embodiments, SWCNTs can be used for chirality specific sensing for multiplexed miRNA detection. Importantly, the triggered assembly of surfactant allows for specific and sensitive detection of oligonucleotides in the complex biological environments found in serum and urine, allowing for direct optical measurement of oligonucleotides in these biofluids without the need for purification or labeling. In certain embodiments, the nanotube sensor is encapsulated in a semi-permeable membrane. In certain specific embodiments, this encapsulated sensor can be used for the specific detection of a cancer biomarker miRNA in a live animal.

[0193] Individually-dispersed semiconducting single-walled carbon nanotubes

(SWCNTs) exhibit exciting properties for use as optical biomedical sensors. Semiconducting carbon nanotubes are fluorescent in the near-infrared spectral region, a wavelength range penetrant to tissue, and they do not photobleach. Their emission wavelength and intensity are sensitive to the local environment, allowing perturbations at the nanotube surface to be transduced via modulation of their emission, with up to single-molecule sensitivity. Moreover, there are about 17 distinct nanotube (n,m) species (chiralities) with unique and resolvable emission wavelengths that can be measured, potentiating multiplexed detection schemes.

Sensors

[0194] Described herein are devices and methods comprising a single-walled carbon nanotube (SWCNT) sensor. In certain embodiments, the sensor comprises a SWCNT and a nucleotide attached to the SWCNT. In certain embodiments, the sensor further comprises a surfactant.

Single-walled carbon nanotubes (SWCNTs)

[0195] Described herein are devices and methods comprising single-walled carbon nanotubes (SWCNTs). SWCNTs are rolled sheets of graphene with nanometer-sized diameters. SWCNTs are defined by their chirality. The sheets that make up the SWCNTs are rolled at specific and discrete, i.e., "chiral" angles. This rolling angle in combination with the nanotube radius determines the nanotube' s properties. SWCNTs of different chiralities have different electronical properties. These electronic properties are correlated with respective differences in optical properties. Thus, individually-dispersed semiconducting SWCNTs exhibit ideal qualities as optical biomedical sensors.

[0196] Semiconducting SWCNTs are fluorescent in the near-infrared (NIR, 900-1600 nm) due to their electronic band-gap between valence and conduction band. The semiconducting forms of SWNTs, when dispersed by surfactants in aqueous solution, can display distinctive near-infrared (IR) photoluminescence arising from their electronic band gap. IR is a wavelength range penetrant to tissue, and thus potentially suitable for implantable sensors or other devices. The band-gap energy is sensitive to the local dielectric environment around the SWNT, and this property can be exploited in chemical sensing. Among the molecules that can bind to the surface of SWNTs is DNA, which adsorbs as a double-stranded (ds) complex. Certain DNA

oligonucleotides will transition from the native, right-handed B form to the left-handed Z form as cations adsorb onto and screen the negatively charged backbone. Additionally, SWCNTs do not photobleach due to their excitonic nature of fluorescence. DNA-DNA hybridization between nanotube-associated DNA and free single-strand DNA in solution can mediate a solvatochromic shift in the nanotube emission.

Nucleotides

[0197] In certain embodiments, the sensor as described herein comprises a polymer capable of being non-covalently or covalently conjugated to the SWCNT. In certain

embodiments, the polymer is DNA, RNA, an artificial nucleic acid induing peptide nucleic acid (PNA), Morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), an amino-acid sequence, or a synthetic monomer

[0198] In certain embodiments, the sensor as described herein comprises a nucleotide attached to the SWCNT. In certain embodiments, the nucleotide can have fewer than 100,000, fewer than 50,000, fewer than 25,000, fewer than 10,000, fewer than 5,000, fewer than 1,000, fewer than 500, fewer than 250, fewer than 100, fewer than 75, fewer than 50, fewer than 30, fewer than 25, fewer than 20, 15, 12, 10, 8, 6 or 4 nucleotides.

[0199] In certain embodiments, the nucleotide can have a random sequence. In certain embodiments, the nucleotide can have an ordered sequence. In certain embodiments, the ordered sequence can be a predetermined sequence. In certain embodiments, the ordered sequence can be a repeating sequence. In certain embodiments, the repeat sequence can include fewer than 500, fewer than 400, fewer than 300, fewer than 200, fewer than 100, fewer than 50, fewer than 30, fewer than 25, fewer than 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 or 2 nucleotides. In certain embodiments, the polynucleotide can be poly(AT), poly(GT), poly(CT), poly(AG), poly(CG), or poly(AC). In certain embodiments, the polynucleotide can have a content. In certain embodiments, the content can be a percentage of a unique nucleotide present in the sequence.

[0200] In certain embodiments, the nucleotide sequence is a single-stranded DNA molecule. In certain embodiments, the single-stranded DNA (ssDNA) has a sequence complementary to a target nucleotide sequence. In certain embodiments, the ssDNA has a sequence complementary to sequence to miRNA. In certain embodiments, the miRNA is an endogenous piece of RNA with a 21-23 nucleotide sequence. In certain embodiments, the miRNA is mirl9, mir21, mir39, mir96, mirl26, mirl52, mirl82, mirl83, mir494, or mir509. In certain embodiments, the miRNA is a nucleotide described in Appendix B.

[0201] In certain embodiments, the nucleotide has a first domain and a second domain.

In certain embodiments, the first domain has a sequence complementary to a target nucleotide sequence as described below. In certain embodiments, the first domain has a sequence complementary to a target miRNA.

[0202] In certain embodiments, the second domain is a stabilizing domain, e.g., wherein stabilizing means prevents/reduces agglomeration of SWCNTs and/or promotes stability of a suspension of the SWCNTs. In certain embodiments, the second nucleotide sequence is a short oligonucleotide sequence, e.g., (GT)6 (SEQ ID NO: 2), (GT)15 (SEQ ID NO: 1), (AT)15 (SEQ ID NO: 3), (TAT)6 (SEQ ID NO: 4) , (TCC)10 (SEQ ID NO: 5), (TGA)10 (SEQ ID NO: 6), (CCA) 10 (SEQ ID NO: 7), (TTA)4TT (SEQ ID NO: 8), (TTA)3TTGTT (SEQ ID NO: 9), (TTA)5TT (SEQ ID NO: 10), (TAT)4 (SEQ ID NO: 11), (CGT)3C (SEQ ID NO: 12), (ATT)4 (SEQ ID NO: 13), (ATT)4AT (SEQ ID NO: 14), (TATT)2TAT (SEQ ID NO: 15), (ATTT)3 (SEQ ID NO: 16), (GTQ2GT (SEQ ID NO: 17), (CCG)4 (SEQ ID NO: 18), (GTT)3G (SEQ ID NO: 19), (TGT)4T (SEQ ID NO: 20), (TATT)3T (SEQ ID NO: 22), (TCG)10 (SEQ ID NO: 23), (GTC)3 (SEQ ID NO: 24), (TCG)2TC (SEQ ID NO: 25), (TCG)4TC (SEQ ID NO: 26), (GTC)2 (SEQ ID NO: 27), (TGTT)2TGT (SEQ ID NO: 28), (TTTA)3T (SEQ ID NO: 29), (CCG)2CC (SEQ ID NO: 30), (TCG)4TC (SEQ ID NO: 31), T3C6T3 (SEQ ID NO: 32), (GTQ2GT (SEQ ID NO: 33), CTTC2TTC (SEQ ID NO: 34), TTA(TAT)2ATT (SEQ ID NO: 35),

TCT(CTC)2TCT (SEQ ID NO: 36), (ATT)4 (SEQ ID NO: 37), GC11 (SEQ ID NO: 38), (TC)3CTCCCT (SEQ ID NO: 39), CTTC3TTC (SEQ ID NO: 40), (GT)20 (SEQ ID NO: 41), CTC3TC (SEQ ID NO: 42), (TCT)2 (SEQ ID NO: 43), C5TC6 (SEQ ID NO: 44), T4C4T4 (SEQ ID NO: 45), C5TTC5 (SEQ ID NO: 46), and/or other single-strand DNA that form water soluble complexes with SWCNT.

[0203] In certain embodiments, the nucleotide has two, three, four, five, six, seven, eight, or more domains. In certain embodiments, the domains have sequences complementary to one or more target nucleotide sequences.

Surfactants

[0204] In certain embodiments, the methods and devices described herein comprise one or more colloidal stabilization agents. A colloidal stabilization agent is any substance that hinders or prevents aggregation and sedimentation of liquid suspended particles. In certain embodiments, the colloidal stabilization agent is a surfactant. Surfactants are compounds that lower the surface tension (or interfacial tension) between two liquids or between a liquid and a solid. In certain embodiments, the surfactant is a detergent. In certain embodiments, the surfactant is an anionic surfactant, a carboxylate, a cationic surfactant, a zwitterionic surfactant, or a non-ionic surfactant. In certain embodiments, the methods and devices described herein comprise one or more of SDS, SDBS, SDC, SPAN-80, Brij 52, BSA, Triton X-100, Pluronic, Pyrene-PEG, TPGS, IGEPAL, and Phospholipid-PEG-NH2.

Targets and Analytes

[0205] Target conditions and diseases that can be diagnosed, treated and/or prevented using the devices and methods described herein include all cancers, metabolic disease, fetal health condition, kidney disease, organ rejection, hereditary diseases, nervous disease, obesity, and infectious disease. In certain embodiments, the condition or disease is at least in part characterized by a substance, i.e., an analyte.

[0206] In certain embodiments, the analytes that can be detected or otherwise manipulated using the devices and methods described herein include nucleotide sequences, e.g., polynucleotides, oligonucleotides, radionucleotides, DNA, RNA, long non-coding RNA, microRNA (miRNA), circulating microRNA, messenger RNA (mRNA), circulating messenger RNA, cell-free tumor DNA, or fragments, analogues, or compounds thereof. Analytes that can be detected or otherwise manipulated using the devices and methods described herein include any molecule or organism having or being associated with the target nucleotide sequences, including peptides, polypeptides, proteins, biologies, biomolecules, biosimilars, aptamers, viruses, bacteria, toxins, cells, antibodies, or fragments thereof.

[0207] In certain embodiments, the analyte is a nucleotide with the sequence mirl9, mir21, mir39, mir96, mirl26, mirl52, mirl82, mirl83, mir494, or mir509, or a nucleotide described in Table 12. Systems, Devices, and Methods

[0208] In certain embodiments, the device is a sensing platform. In certain embodiment, the device is a sensor. In certain embodiments, the device is in contact with a biofluid or bodily fluid sample. In certain embodiments, the bodily fluid sample is e.g., Amniotic fluid, Aqueous humour and vitreous humour, Bile, Blood serum, Breast milk, Cerebrospinal fluid, Cerumen (earwax), Chyle, Chyme, Endolymph and perilymph, Exudates, Feces, Female ejaculate, Gastric acid, Gastric juice, Lymph, Menstrual fluid, Mucus (including nasal drainage and phlegm), Pericardial fluid, Peritoneal fluid, Pleural fluid, Pus, Rheum, Saliva, Sebum (skin oil), Serous fluid, Semen, Smegma, Sputum, Synovial fluid, Sweat, Tears, Urine, Vaginal secretion, Vomit., etc. In certain embodiments, the bodily fluid in contact with the device is not treated or purified prior to contact with the device.

[0209] In certain embodiments, the device is a sensor, or comprises a sensor, as described herein, wherein the device is placed outside of an organism to be treated or diagnosed. In certain embodiments, the device is a point-of-care diagnostic device, a wearable device, or a piece of laboratory equipment. In certain embodiments, the device can be positioned on the surface of the organism, such as the arm, and, e.g., worn like a wristwatch. In certain embodiments, the device is implantable into the organism. In certain embodiments, the devices is a point-of-care medical device, e.g., a (urine) dipstick, a test strip, a membrane, a skin patch, a skin probe, a gastric band, a stent, a catheter, a needle, a contact lens, a prosthetic, a denture, a vaginal ring, or other implant. In certain embodiments, the device comprises a solid support, a membrane, a gel, or a microfluidic component. In certain embodiments, the device comprises a microfluidic chamber containing a sensor. In certain embodiments, the device comprises a sensor contained in a semi-permeable enclosure. [0210] In certain embodiments, the organism to be treated or diagnosed is a mammal, a human, a dog, a rodent, or a farm animal. In certain embodiments, the device is used in to detect oligonucleotides in vivo with a noninvasive method. In certain embodiments, the method is a real-time, non-invasive monitoring in vivo.

[0211] In certain embodiments, the device is a sensor, or comprises a sensor, as described herein, and is exposed excitation electromagnetic radiation (excitation EMR) to produce an emission of electromagnetic radiation (emission EMR) by the SWCNT sensor. In certain embodiments, the excitation EMR is ultraviolet light, infrared light, or near-infrared light (NIR). In certain embodiments, the excitation EMR is visible light. In certain embodiments, the excitation EMR has a wavelength between 100 nm and 3000 nm, 200 nm and 2000 nm, between 300 and 1500 nm, or between 500 and 1000 nm.

[0212] In certain embodiments, the emission EMR is ultraviolet light, infrared light, or near-infrared light (NIR). In certain embodiments, the emission EMR is visible light. In certain embodiments, the emission EMR has a wavelength between 300 nm and 3000 nm, between 400 and 2000 nm, between 500 and 1500 nm, between 600 nm and 1400 nm, or between 700 and 1350 nm.

[0213] In certain embodiments, the methods described herein can be used for diagnostic or therapeutic purposes to diagnose, prevent, or treat any condition or disease characterized by or associated with an analyte as described herein. In certain embodiments, the method comprises contacting a test sample comprising a species having a target nucleotide sequence with the SWCNT sensor; exposing the test sample to excitation electromagnetic radiation (excitation EMR) to produce an emission of electromagnetic radiation (emission EMR) by the SWCNT sensor; detecting the electromagnetic radiation emitted by the SWCNT sensor; and identifying the presence of the species having the target nucleotide sequence (e.g., a polynucleotide, oligonucleotide, radionucleotide, DNA, RNA , microRNA, circulating microRNA, messenger RNA (mRNA), cell-free tumor DNA, or a fragment, an analogue, or a compound thereof) in the test sample based at least in part on the detected emission EMR. Sources of excitation EMR can be any such source known in the art, e.g., a laser, a light emitting diode, or a lamp. Detectors of emission EMR can be any such detector known in the art, e.g., a fluorometer. In certain embodiments, the method comprises detecting a wavelength shift (e.g., a blue or red shift) in the emission EMR and/or an intensity shift (e.g., amplitude shift), or other changes in the spectral characteristics of in the emission EMR, thereby identifying the presence of the species having the target nucleotide sequence in the test sample.

[0214] In certain embodiments, a photoluminescence plot (PL plot), as previously described in Bachilo, S. M. et al. Science 298, 2361-6 (2002) can be generated from the emission EMR data. Without wishing to be bound by theory, from the complete PL plots, the peaks can be fit using Gaussian lineshapes to identify the peak center, which then can be used to calculate the magnitude of emission and excitation wavelength shifts relative to a control. In certain embodiments, the method comprises detecting an intensity shift between an emission center wavelength (e.g., a peak) of the test sample and an emission center wavelength (e.g., a peak) of a reference sample, wherein the reference sample is devoid of the species having the target nucleotide sequence. In certain embodiments, the emission wavelength shift is between 1 nm and 100 nm, between 2 nm and 100 nm, between 3 and 50 nm, or between 4 and 20 nm. In certain embodiments, the wavelength shift is a color shift, e.g., a redshift or a blueshift. In certain embodiments, the wavelength shift is a blueshift. [0215] In certain embodiments, the methods comprise the use of a structure-switching aptamer. Without wishing to be bound by theory, in certain embodiments, ATP causes the aptamer to release a target oligonucleotide upon binding. The released target oligonucleotide is detected using the sensors and methods described herein.

[0216] In certain embodiments, the device is a sensor, or comprises a sensor, as described herein, and is a device for a non-medical application. In certain embodiments, the device is a device for monitoring environmental conditions. In certain embodiments, the device comprises a solid support, a membrane, a gel, or a microfluidic component, or a combination thereof. In certain embodiments, the device comprises a microfluidic chamber containing a sensor. In certain embodiments, the device comprises a sensor contained in a semi-permeable enclosure.

[0217] Dynamic DNA nanotechnology using strand-displacement reactions has recently emerged as an attractive engineering system for various devices, including reconfigurable nanostructures, based on the specificity and versatility of DNA oligonucleotides. Strand displacement reactions can occur through the use of "toeholds," single-strand overhangs on duplexed DNA that facilitate binding of an invader strand to displace the shorter bound strand. In certain embodiments, the methods and devices described herein relate to Dynamic DNA nanotechnology. In certain embodiments, the device is a component of a nucleic acid system with designed dynamic functionalities related to its overall structures, such as computation and mechanical motion. DNA base pairing allows for the construction of DNA nanostructures and nanodevices through the programmed hybridization of complementary strands. Structures include (logic) circuits, catalytic amplifiers, autonomous molecular motors and reconfigurable nanostructures. Without wishing to be bound by theory, in certain embodiments, the devices described herein can be used in DNA strand-displacement reactions, in which two strands with partial or full complementarity hybridize, displacing in the process one or more pre-hybridized strands, causing dynamic behavior in the system of interest.

Experimental Examples

Development of Sensor

[0218] In this example, the basic design of the sensor / sensing platform uses a DNA oligonucleotide to both disperse and stabilize the SWCNTs as well as to provide specificity to target oligonucleotides. The DNA oligonucleotide has a modular design containing two domains; a domain to impart colloidal stability, and a contiguous domain complementary to a target oligonucleotide. A screen of a certain number of sequences found to stably disperse SWCNTs showed that (GT)i ₅ (SEQ ID NO: 1) provides the best stability and resistance to nonspecific oligonucleotide interactions (FIG. 1). For the targeting domain, the complementary sequence for the microRNA (miRNA) miR-19 was chosen as a model target, due to the importance of miR-19 miRNA in oncogenesis.

[0219] Sequences of miRNA used herein are provided in Table 1.

Table 1

[0220] The optical response of the GT15mirl9 sensor was tested using both a DNA- based and RNA-based analyte miR-19 sequence, as well as a length-matched, randomly generated, non-complementary control (R23). After incubation with miR-19 or R23, eleven different nanotube chiralities were measured via two-dimensional excitation/emission photoluminescence spectroscopy ("PL plots", FIG. 3). Each nanotube emission peak exhibited a shift in wavelength which was specific to the miR-19 target sequence over the R23 control (FIG. 2B). In general, nanotube emission peak wavelengths blue-shifted and intensity increased upon introduction of the target oligonucleotide (FIGS. 4 A and 4B); excitation peaks (E ₂₂ transitions) also blue-shifted (FIG. 5).

[0221] To verify that hybridization to the GT15mirl9 sensor occurred upon introduction of the target, a hairpin oligonucleotide was designed which would make binding of the target more apparent by atomic force microscopy (AFM). The oligonucleotide was composed of the miR-19 or R23 sequence, a short spacer, and a 52-nucleotide hairpin region (FIG. 6). After incubation with the miR-19-hairpin, the average height of the sample increased by -0.6 nm, as measured by AFM in dry conditions (FIG. 6). Upon imaging in aqueous conditions, it was observed distinct protrusions from the nanotubes which were absent in the R23 hairpin-treated sample and buffer controls (FIG. 2C, FIGS. 44A-44C-46C). Based on this pattern and other AFM studies, it was estimated that the GT15mirl9 sensor presents 5-10 binding sites per 100 nm of nanotube. The preparation method yielded nanotubes with a mean length of 166 nm (SD 149nm); thus it was calculated that an average single nanotube could potentially bind

approximately 8-17 copies of miRNA. [0222] Because the mechanism of nanotube spectral changes induced by oligonucleotide hybridization is poorly understood, a set of experiments was designed to better determine the structural changes of the sensor induced by hybridization. It was first investigated whether the hybridized duplex remained near the nanotube surface after the binding of target miRNA. An assay was developed using an organic fluorophore conjugated to the miRNA capture sequence under the premise that the fluorophore intensity would increase upon hybridization if the fluorophore desorbed from the nanotube surface, as organic fluorophores are known to quench upon interaction with the nanotube surface via an energy transfer mechanism. Nanotubes with the sequence GT6mirl9 were suspended, (shortened due to synthesis constraints) containing the Cy5 dye conjugated to the 3' end of the miR-19-binding domain (scheme in FIG. 8).

[0223] Upon addition of miR-19 to the modified complex, it was found that Cy5 fluorescence increased over time, while the R23 sequence caused no change in Cy5 fluorescence (FIG. 2D). To validate GT6mirl9-Cy5 as a proxy for the GT15mirl9 sequence, the nanotube emission was measured upon introduction of the miR-19 sequence to the fluorophore-labeled complex. Again, blue-shifting was seen upon hybridization with the target oligonucleotide, suggesting the same sensor function despite the shortened nanotube-binding domain (FIG. 9). In agreement with the Cy5 fluorescence change, it was found that nanotube fluorescence emission to blue-shift occurred at a slower rate compared to GT6mirl9 without Cy5 (FIG. 9). Without having to be bound to any theory, this relatively slow rate may be a result of the affinity of Cy5 for the nanotube surface, based on π stacking interactions between the Cy5 dye, which is rich with π electrons, and the graphitic π electrons of the nanotube. The fluorophore de-quenching and AFM together suggest a final hybridized structure consisting of a partial duplex dissociating from the nanotube surface. [0224] Using all-atom molecular dynamics simulations, it was assessed whether the

GT15mirl9 sequence could remain stable on the nanotube upon partial hybridization. The pre- hybridized sequence was placed in the vicinity of the (9,4) nanotube with explicit water and counterions, and a simulation was run for 250 ns (as provided herein). The single-stranded portion of the oligomer bound to the nanotube and the hybridized construct remained stable on the nanotube surface for the remainder of the simulation (FIG. 2E "Hyb"). A second simulation was run in absence of the hybridization strand. During the simulation, the entire oligomer bound to the surface and wrapped the nanotube, with the nucleobases orienting closely to the nanotube surface in a parallel orientation (FIG. 2E, "Unhyb").

[0225] The simulations allowed the quantification of nucleobase adsorption to the nanotube surface. The radial distance of the nucleobases was measured from the nanotube surface and their stacking angles relative to the nanotube surface (FIGS. 45A-45F). It was observed that all bases of the (GT)i ₅ (SEQ ID NO: 1) nanotube-binding domain remained adsorbed on the nanotube surface, whereas only 1-2 terminal bases of the double-stranded miR- 19/miRNA capture sequence adsorbed to the nanotube surface. In the simulation without the complementary strand, all bases of the (GT)i ₅ (SEQ ID NO: 1) nanotube binding domain adsorbed to the nanotube surface, as well as most of the bases of the miR-19 miRNA capture sequence (FIGS. 45A-45F).

[0226] The thermodynamic concerns regarding the stability of the hybridized duplex were assessed in the presence of the nanotube. Molecular dynamics simulations of hybridized miR-19, without the (GT)i ₅ (SEQ ID NO: 1) nanotube binding domain, in the presence of the nanotube were run using several different initial conditions (FIGS. 46A-46B). In all simulations, no de-hybridization of the duplex was observed, suggesting that the nanotube would not destabilize the hybridized duplex. To better determine how the partial hybridized state of the DNA is stable on the nanotube (or preferred over single strand adsorption on the nanotube), a free energy analysis was conducted (FIG. 47). The analysis suggests that hybridization of the dsDNA is favored if the analyte strand is not initially adsorbed on the nanotube surface, as is the case in the described experiments.

[0227] The molecular dynamics simulations were also analyzed to gain a quantitative determination of the carbon nanotube spectral response upon hybridization. Comparing the water density as a function of distance at the end of the two simulations, it was found that a slight increase in the water concentration near the nanotube in the hybridized structure (FIG. 21). In addition, it was found that the density of phosphate ions as a function of distance from the nanotube decreased upon hybridization (FIG. 2J). While an increase in local water density can cause red-shifting of the nanotube emission wavelength, a decrease in local anionic charge density in the local environment of the nanotube was found to cause a blue-shifting response. As the nanotube emission exhibited a net blue-shift upon hybridization, it was determined that the effect of the removal of phosphate charges from the nanotube surface out-competed the effects of increased local water density.

[0228] Table 2 shows surfactant and polymer suspended nanotubes spectral properties.

Note that numbers in parentheses indicate the molecular weight of polyethylene glycol; these surfactants share polyethlene glycol as a component. Accordingly, the numbers in parentheses are included for comparison. Table 2

Pluronic F 98 13,000 (10,400) 9.4 1.1 -97

Pluronic F 68 8,400 (6,720) 5.8 1.2 -103

Pluronic F 127 12,600 (8,820) 7.1 1.6 -84

Pluronic F 87 7,700 (5,390) 8.8 1.5 -105

Pluronic F 77 6,600 (4,620) 2.5 0.5 -208

Pluronic F 85 4,620 (2,310) 0 - -

[0229] As the simulations showed an increase in available nanotube surface area upon hybridization, it was hypothesized that additional small amphipathic molecules might assemble on this newly exposed nanotube surface to enhance the optical response. Low concentrations of several candidate surfactants (Table 3) were tested to determine whether they changed the optical response of the GT15mirl9 sensor (FIGS. 48A-48B and 49A-49B).

Table 3

l,2-distearoyl-sn-glycero-3- Lipid-PEG PEGylated lipid phosphoethanolamine- N[methoxy (polyethylene

glycol)- 1000] (ammonium

salt))

Bovine serum albumin BSA protein

[0230] The study found that a low concentration (0.2% wt/vol, or 5.7 mM) of sodium dodecylbenzenesulfonate (SDBS), a mild surfactant known to associate with nanotubes, resulted in an increase in the degree of hybridization-dependent blue-shifting and intensity enhancement by an order of magnitude (FIG. 2F). In the SDBS-supplemented buffer-only condition and in the presence of the R23 control, the emission bands broadened slightly but did not increase or shift appreciably. Upon hybridization in the presence of SDBS, all nanotube chiralities exhibited a greatly enhanced blue-shift (FIG. 2G, FIGS. 10-14), even those that that did not blue-shift in the absence of SDBS (FIG. 2B). A significant blue-shift in the excitation wavelength was also observed (FIG. 12). The magnitude of blue-shifting and intensity enhancement (FIG. 11) upon hybridization of DNA and RNA were identical. In the absence of the target oligonucleotide, the GT15mirl9 sensor emission remained stable over a wide-range of SDBS concentrations (FIGS. 13A-13B). A model of SDBS-mediated hybridization-dependent signal enhancement is presented in FIG. 2H, wherein hybridization triggers SDBS assembly on the newly-exposed nanotube surface. For a more detailed analysis of the observed spectroscopic changes induced by SDBS, see the below experiments.

[0231] To further assess the specificity of the sensor response, an ensemble of randomly generated oligonucleotides was introduced. A random library of 23 nt oligonucleotides, with a diversity of approximately 4 ²³ different sequences, was introduced to the GT15mirl9 sensor, resulting in no response (FIG. 15). In the presence of the random library, the GT15mirl9 sensor maintained sensitivity to miR-19.

[0232] FIG. 2A shows a schematic for the construction of the sensing platform. Briefly, the DNA oligonucleotide was sonicated by probe tip with HiPCO SWCNTs, followed by centrifugation to remove poorly suspended SWCNTs. The resulting construct, henceforth referred to as GT15mirl9 (GT15-encapsulation sequence (SEQ ID NO: 1) and miR-19 complementary sequence), showed a high degree of stability over at least several months (data not shown).

[0233] Functionality of the sensor was tested using both a DNA-based and an RNA- based target miR-19 sequence, as well as a length-matched random DNA and RNA sequence control (R23). After incubation with miR-19 or R23, eleven different nanotubes were sampled by measuring fluorescence intensity as a function of excitation wavelength and emission wavelength in a photoluminescence plot (PL plot). From the complete PL plots (FIG. 3), the peaks were fit using Gaussian line shapes to identify the peak center, which were then used to calculate the magnitude of emission and excitation wavelength shifts relative to a control that received buffer only. The resulting emission wavelength shifts from miR-19 and R23 are shown in FIG. 2B, arranged by nanotube chirality from smallest to largest diameter. For the DNA- based miR-19 sequence, the magnitude of blueshifting relative to the control is between 0.5 and 1 nm for most nanotubes, with the largest diameters showing no shift. Blueshifting was consistent with previous reports of DNA-hybridization on carbon nanotubes. The random sequence control elicited no change or in some cases a small redshift. For the RNA-based miR- 19 target, a smaller degree of blueshifting was observed for most chiralities, with the largest diameter nanotubes again showing little response. Overall, the pattern of shifting for DNA and RNA was similar, except that RNA hybridization produced a smaller magnitude of shifting. For some chiralities, an enhancement in intensity followed binding of DNA target (FIGS. 4A-4B). Shifts in the excitation wavelength were minor, and showed a similar pattern of sensitivity (FIG. 5).

[0234] To verify that the sensor was only interacting with the complementary

oligonucleotide, the height-profile changes were measured with AFM after incubation with the target sequence or with the random sequence control. To exacerbate a change in height after binding, hairpins were designed with a 20 nucleotide long stem and 12 nucleotide loop that contained the single strand miR-19 or miR-23 sequence at the end of the stem. After overnight incubation and washing, the sample was adsorbed to mica and measured with AFM. In both samples, the helical wrapping pattern of GT15mirl9 was visible, as reported previously for single-stranded DNA (see Gigliotti, B., Nano Lett. 6, 159-64 (2006)). A comparison of the average heights between the sample that had received miR-19-hairpin versus the R23 -hairpin showed that the miR-19-hairpin increased the average height by about 0.6 nm, consistent with the miR-19-hairpin being bound to the surface (FIG. 2C, FIG. 6).

[0235] Without wishing to be bound by theory, mechanistically, the change in nanotube optical response may be due to the hybridized duplex remaining on the nanotube surface after complementary base-pairing, or due to the newly formed duplex partially dissociating from the surface. To test this, SWCNTs were suspended with GT6mirl9 containing the fluorophore Cy5 conjugated to the end of the miR-19-binding domain. GT6 (SEQ ID NO: 2) was chosen as the dispersing domain due to length restraints for oligonucleotide functionalization with

fluorophores. While less effective at providing resistance to R23 binding at high concentrations, GT6mirl9 still specifically blueshifted upon hybridization with target oligonucleotide (FIG. 7). Without wishing to be bound by theory, SWCNTs may be effective quenchers of organic fluorophores through energy transfer when held in close proximity to the nanotube surface. Thus, without wishing to be bound by theory, restoration of Cy5 fluorescence upon binding of miR-19 would indicate removal from the surface, and support the hypothesis of the newly formed duplex partially dissociating from the surface (FIG. 8). With GT6mirl9-Cy5, it was found that Cy5 fluorescence was restored in the presence of 1 μΜ miR-19 DNA, while 1 μΜ R23 had no effect (FIG. 2D). Concurrent with the measurement of Cy5 fluorescence, the SWCNT fluorescence emission changes from three different chiralities were measured, as well as from control GT6mirl9 that did not have the Cy5 fluorophore. With Cy5, all nanotubes blueshifted (FIG. 9), indicating that the Cy5 dequenching was concurrent with nanotube blueshifting. When compared to GT6mirl9-suspended nanotubes without Cy5, the rate of blueshifting was severely hampered (FIG. 7, FIG. 9). Without wishing to be bound by theory, because Cy5 is rich with π electrons, the relatively slow rate may be due to the affinity of Cy5 for the nanotube surface based on π stacking interactions, hindering the complementary base- pairing induced removal of the duplex. Without wishing to be bound by theory, these data suggest that the mechanism of detection of target sequences is from duplex formation and partial dissociation from the nanotube at the recognition domain. Using all atom molecular dynamics, it was tested if the hypothesized partial duplex would remain stable with the SWCNT present in the simulated conditions (FIG. 2E).

[0236] It was hypothesized that the observed blueshifting could be enhanced by adding a small amount of amphipathic molecules to interact with and assemble upon the newly exposed carbon nanotube surface. After screening several amphipathic molecules, sodium

dodecylbenzenesulfonate (SDBS), a surfactant known to associate with SWCNTs, was found to greatly enhance the magnitude of blueshifting and intensity enhancement. FIG. 2F shows spectra from 730 nm excitation with and without target miR-19 in buffer only conditions in the top panel, and in the presence of 0.2% SDBS in the bottom panel, revealing a dramatic impact on wavelength and intensity. By taking PL plots (FIG. 10), twelve different chiralities were compared with target miR-19 DNA and RNA or R23 DNA and RNA controls. Each chirality displayed a greatly enhanced blueshift, even for chiralities that did not blueshift in buffer only conditions (FIG. 2G, compare FIG. 2B), as well as intensity enhancement for each chirality (FIG. 11). In all cases, R23 had no effect. From the PL plots, it was also found that there was a blueshift in excitation wavelength. Without wishing to be bound by theory, a change in the excitation wavelength reflects a change in the E22 transition, indicating a change in solvation energy associated with stabilizing the ground state. Thus, without wishing to be bound by theory, binding of miR-19 RNA and DNA can affect the ground state absorption energies in addition to the excited state, adding yet another detection modality for target miR binding. FIG. 12 shows the correlation between the excitation wavelength shift and the emission wavelength shift for the ensemble of chiralities. Excluding the outliers (8,7) and (10,5), a Pearson correlation coefficient of 0.87744 (p=0.00188, **) was found. When plotted as change in energy (FIG. 12), the Pearson correlation coefficient was similar 0.90656 (p=0.0007). The

environmental effects on nanotube optical properties can depend at least in part on the mod type of the nanotube. Stratifying the nanotubes by mod type, it was found that the mod2 nanotubes had an emission energy change that increased nearly linearly (R ² =0.9272) with nanotube diameter (FIG. 13 A). Interestingly, the intensity enhancement as a function of diameter for the mod2 nanotubes did not show the same linear relationship; although all nanotubes increased in intensity, a maximum was found for nanotubes around 0.9 nm in diameter (FIG. 13B). A slight difference also became apparent between DNA and RNA, with RNA showing a slightly enhanced intensity increase for small diameter nanotubes and a slightly dampened enhancement for larger diameter nanotubes. Without wishing to be bound by theory, this small, diameter dependent difference may be related to the difference in binding strength and hydration between DNA-DNA hybrids and DNA-RNA hybrids.

[0237] Optical transition energies for DNA- wrapped SWCNTs are red-shifted by 10-20 meV compared to nanotubes suspended entirely in surfactants like SDS or SDBS (See

Haggenmueller, R. et al. Langmuir 24, 5070-8 (2008); Fantini, C. et al. Chem. Phys. Lett. 473, 96-101 (2009)). This is due to incomplete coverage of the nanotube surface by DNA, which allows for greater accessibility of water and a resulting larger dielectric in the immediate vicinity of the nanotube (See Miyauchi, Y. et al. Chem. Phys. Lett. 442, 394-399 (2007). Additionally, SDBS suspended nanotube have been shown to produce a higher quantum yield than DNA- suspended nanotubes (See Fantini et al.). Without wishing to be bound by theory, the blueshifted shoulder-feature that SDBS produced on the spectra of DNA- wrapped nanotubes in the photoluminescence plots (FIG. 2F, FIG. 10) suggested that for each chirality, SDBS is binding to the exposed surfaces on the DNA-suspended nanotube. Without wishing to be bound by theory, the differing dielectric microenvironments from the DNA covered surface (relatively redshifted) and SDBS covered surface (relatively blueshifted) both contribute to the emission character, creating the observed elongation in emission. Without wishing to be bound by theory, when target RNA or DNA is bound and the duplex dissociates from the surface, more bare nanotube surface is exposed. Without wishing to be bound by theory, the newly exposed nanotube surfaces allow SDBS greater access to the nanotube, becoming the dominant determinate of the nanotube wavelength emission, excitation, and intensity character. Without wishing to be bound by theory, the remaining DNA covered portion of the nanotube now only contributes a minor red-shifted shoulder. Without wishing to be bound by theory, the net-effect is a dramatic blueshift (4-12 meV blueshift, depending on chirality (FIG. 12) and intensity increase from the assembly of supramolecular complexes of SDBS, triggered by the detection of target RNA or DNA (FIG. 2H).

[0238] To test the stability of GT15mirl9 with SDBS, PL plots after a 1 :2 serial dilution from 4% to 0.004% SDBS (128 mM to 0.0625 mM) were measured. Increasing SDBS showed only minor changes in the baseline emission of GT15mirl9, except at high concentrations for some large-diameter chiralities (above about 2%). GT15mirl9, for most chiralities, was remarkably stable over 4 orders of magnitudes of SDBS in the absence of target miR (FIG. 14).

[0239] The hybridization-triggered supramolecular assembly and resulting enhancement in blueshifting and quantum yield now provided a rationally designed platform for the detection of target RNA or DNA oligonucleotide. This was further characterized in terms of specificity. Because only one random sequence control was used, i.e., R23, random permutations of oligonucleotides each 23 bases long were generated to verify that the sensing platform could recognize the miR-19 target in the context of many random sequences. In the presence of 1 μΜ of the many random sequences, there was no significant change in wavelength for the measured chiralities (FIG. 15). Additionally, each chirality was able to recognize miR-19 in this context. To verify that the platform was extendible to any miR of interest, a panel of miR sequences that have been found to serve as biomarkers in the serum and urine was tested, as well as a miR sequence that is not found in human samples (miR-39) that could serve as a control. For each DNA miR sequence, the extent of blueshifting upon specific recognition was greatly enhanced by the addition of SDBS to 0.2% (FIG. 16A). Detection limi kinetics, and breadth of applicability

[0240] Given the variety of potential miRNA biomarkers, it was sought to assess the modularly of the sensor. The miRNA capture sequence was substituted with several sequences specific to 9 different serum or urine miRNA biomarkers, as well as a sequence not found in humans (C. elegans miR-39) used for standardization in clinical applications (Table 4). Each GT15mirX sensor was treated with SDBS and interrogated with its respective miRNA target sequence, resulting in a wavelength shift which was comparable to that of the original miR-19 sensor, with slight sequence-to-sequence variations (FIG. 16A and FIG. 50). Intensity was similarly enhanced (FIG. 65). In all of the sensors, no appreciable responses from the control sequence (R23) were observed.

[0241] Table 4 shows name, disease relevance, and biofluid of miCRNAs tested in FIG.

16 A.

Table 4

common spike-in control

[0242] To determine if the SDBS-GT15mirX sensor could discriminate among similar sequences, three related sequences from the miR-200 family were selected. The miR-200 family plays an essential role in the epithelial-to-mesenchymal transition (EMT) in cancer. Focusing on the wavelength response of the (9,4) nanotube chirality, a high degree of discrimination between the three sequences after one hour of incubation was observed (FIG. 161). Complete time-course data for both the (9,4) and (8,6) nanotubes (FIGS. 42A-44F and FIGS. 51A-51F, respectively) revealed that the intensity increase provided near-perfect discrimination in most cases. Although the SDBS-GT15mirX sensor responded to target miRNA via both wavelength shifting and intensity changes, detection limits, kinetics, and other sensor characteristics were assessed using the wavelength response, due to the inherent quantifiability and internal standard provided by this mode.

[0243] To determine the limit and range of detection, a dose-response curve of the sensor was constructed over several orders of magnitude of miR-19 concentrations. At a minimal sensor concentration of 0.02 mg/L, the limit of detection of miRNA was between 10 and 100 pM (500 attomoles to 5 femtomoles) (FIG. 16B). Signal saturation occurred at a high concentration between 1 and 10 nM. The dynamic range was tuned by adjusting the concentration of the GT15mirl9 sensor to cover at least 5 orders of magnitude, from 10 pM to 1 μΜ (FIG. 16B). The number of binding sites was calculated using the mass of DNA used to suspend 1 mg of nanotubes (see below). It was estimated that 2.117 nM of miR-19 binding sites were available in a solution of 0.02 mg/L of the GT15mirl9 sensor, consistent with the observed saturating range of concentrations (between 1 and 10 nM). [0244] Table 5 shows SWCNT concentration, limit of detection, binding sites, and saturating range of values shown in FIG. 16B.

Table 5

[0245] The kinetics of both DNA and miRNA detection were assessed via transient measurements. The kinetics of eleven different nanotube chiralities were measured by excitation/emission spectroscopy (FIG. 19). Within 10 minutes of introducing the analyte to the sensor, significant blue-shifting was discerned. The rate of blue-shifting behaved with pseudo- first order kinetics and showed no obvious dependence on nanotube structure (FIG. 20). The sensor kinetics were consistently faster for DNA (1.8x on average), as compared to RNA (FIG. 16C). Without wishing to be bound to any theory, this difference may be due to the longer persistence length and higher rigidity of single- stranded RNA as compared to single-strand DNA.

[0246] To test if the composition of the miRNA capture sequence influenced sensor kinetics, the response rates for the sensor was compared using 8 different miRNA capture sequences (FIGS. 21-22). On comparing the sensor kinetics as a function of guanine content, a significant correlation was found with Pearson coefficients of -0.74195 (p=0.035) for the (9,4) nanotube and -0.77215 (p=0.0248) for the (8,6) nanotube (FIGS. 52A-52B). Without wishing to be bound to any theory, this result may be explained by the high affinity of guanine for the nanotube surface, which was determined previously via both molecular dynamics and ab initio calculations to fall in the order: G > A > T > C. Thus, the affinity of guanine to the nanotube surface may slow the hybridization process. The content of other nucleotide bases, as well as the overall AG of hybridization, did not show any statistically significant correlations (FIGS. 55 and 56).

[0247] To better determine how the length and thermodynamics of hybridization relate to the optical response of the nanotube, several experiments were conducted using modified analyte oligonucleotides. The G15mirl9 sensor was interrogated using analyte sequences between 10 and 23 nucleotides long which were complementary to either the 3' terminal end of the miRNA capture sequence, or the middle of the sequence, as depicted in FIG. 16E. It was found that, in general, a shorter analyte sequence resulted in a smaller blue-shifting response of the nanotube, down to approximately 10 nucleotides, where there was virtually no response (FIG. 16J).

Additionally, the magnitude of the blue-shifting response was consistently smaller when the analyte sequence was designed to hybridize to the middle of the capture sequence. Without wishing to be bound to any theory, this difference may be explained by the affinity of the capture sequence to the nanotube, as suggested by the results of the fluorophore quenching experiment, MD simulations, and free energy analyses.

[0248] To assess its broad applicability for the detection of different nucleic acid types, it was determined whether the sensor could detect oligonucleotides longer than miRNA sequences. First, it was determined how the GT15mirl9 sensor would respond to a long oligonucleotide designed to contain a complementary sequence flanked by non-complementary sequences (FIG. 16K). On interrogating the sensor with R23-mirl9-R23, a 69-bp oligonucleotide with 23 complementary bases in the middle of the sequence, the sensor emission red-shifted— opposite of the blue-shifting response— even in the presence of SDBS (FIG. 16L, shown for the (8,6) chirality). Without wishing to be bound to any theory, it was therefore hypothesized that, when R23-mirl9-R23 hybridizes to the recognition sequence, the R23 portion at the 5' end may disrupt the sensor function by increasing the phosphate content near the nanotube surface to cause a red- shift of the nanotube emission. To test this hypothesis, two long oligonucleotide sequences, R23-mirl9 and mirl9-R23, were designed by placing the R23 portion at either the 3' end or 5' end. The proposed orientation upon binding and predicted spectral shifts are shown in FIG. 16G— the two sensors were hypothesized to give the opposite spectral responses. Upon interrogating the sensor, the R23-mirl9 oligonucleotide produced a red-shifting response, and the mirl9-R23 oligonucleotide produced a blue-shift, as predicted (FIG. 16H). The magnitude of the blue-shift in response to mirl9-R23 was smaller than that produced by the miR-19 control, thereby suggesting that the unhybridized single-stranded nucleotides may bind to the nanotube surface, diminishing the response.

[0249] The sequence for R23mirl9R23 is as follows:

TGATCGTTACTGGGTGACTGGCTAGTCAAAACGTATCTAAACGTGTGATCGTTACTG GGTGACTGGCT (SEQ ID NO: 52). The sequence for mirl9R23 is as follows:

AGTCAAAACGTATCTAAACGTGTGATCGTTACTGGGTGACTGGCT (SEQ ID NO: 53). The sequence for R23mirl9 is as follows:

TGATCGTTACTGGGTGACTGGCTAGTCAAAACGTATCTAAACGTGT (SEQ ID NO: 54).

[0250] Sensors based on the GT15 (SEQ ID NO: 1) nanotube binding domain and a general capture sequence can be extended to detect longer nucleic acid sequences, but the orientation of the oligonucleotide is critical for eliciting a desired spectral response.

[0251] To determine the limit and range of detection, a dose-response over several orders of magnitude was constructed (FIG. 17). By varying the concentration of nanotube, it was found that the dynamic range and limit of detection depends on the ratio of nanotube to target miRNA. At the lowest nanotube concentration that could be practically detected in solution, 0.02 mg/L, the limit of detection was found to be between 10 and 100 pM (FIG. 16B), with saturation (no additional blueshift) occurring between 1 and 10 nM. By varying the concentration of the nanotubes, it was possible to cover 5 orders of magnitude, from 10 pM to 1 μΜ (FIG. 17). To better determine this binding behavior, the number of binding sites in a given concentration of nanotubes was estimated by quantifying the amount of DNA used to suspend the nanotubes and the mass of unbound DNA that is removed by spin-filtration. From three suspensions, it was found that 3.5 (+/-1.8) mg of DNA suspends 1 mg of SWCNT, matching previous reports of 2.5 to 5 mg of DNA per 1 mg of SWCNT (See Zheng, M. et al. Nat. Mater. 2, 338-42 (2003)). For a SWCNT concentration of 0.02 mg/L, this corresponds to 2.117 nM of miR-19 binding sites, consistent with the observed saturating range. Without wishing to be bound by theory, when there are too many unoccupied binding sites relative to occupied binding sites, a net-blueshift is no longer distinguishable. Based on the observed limit of detection, when less than 5 to 0.5% of binding sites are occupied, a blueshift is no longer observable.

[0252] The kinetics of blueshifting were rapid, with changes evident within 5 minutes of miR-19 DNA addition (FIG. 18). To investigate potential chirality-dependent effects on kinetics, a series of PL plots after addition of miR-19 DNA and RNA to measure eleven different chiralities were fit to exponential decay functions (FIG. 19). As a representative plot, the kinetics of blueshifting and fits for the (7,5) nanotube are shown in FIG. 16C. The rate of blueshifting with miR-19 DNA was relatively constant across the measured chiralities (FIG. 20), with maximum blueshifting occurring around 90 minutes. The rate of blueshifting with miR-19 RNA was also fairly constant, but for every chirality measured the blueshifting was modestly slower than the matched DNA (FIG. 16C and FIG. 20). Without wishing to be bound by theory, the slower kinetics for RNA may be related to the shorter contour length, longer persistence length, and higher rigidity of single-strand RNA than single strand DNA.

[0253] Both molecular dynamics and ab initio calculations of nucleic acid interaction strengths with carbon nanotubes predict binding strengths in the order of G > A > T > C (See Johnson, R. R., et al. Small 6, 31-4 (2010)). To test if the base composition of the target recognition sequence initially bound to the nanotube played a role in the kinetics of blueshifting, the fitted rates for 8 different miR sequences whose recognition sequences had varying amounts of each base were compared. For the two chiralities measured, (9,4) and (8,6), a statistically significant correlation with the percent of guanine in the recognition sequence and the rate of blueshifting was found (FIG. 16D), showing that a higher percentage of guanine is negatively correlated with the rate. Other bases and the AG of hybridization did not show any statistically significant correlations (FIG. 21 and FIG. 22).

[0254] To better determine how the length and thermodynamics of hybridization relates to blueshifting of the nanotubes, truncated target sequences ranging from 10 to 15 nucleotides that can bind either from the 3' end or the 5' portion in the middle of the recognition sequence were used (depicted in FIG. 16E). For the same AG of binding, sequences that start in the middle of the recognition sequence had an attenuated response, whereas sequences that bind from the end of the recognition sequence steadily increased in blueshifting with more negative AG (FIG. 16F). Without wishing to be bound by theory, binding from the end of the recognition sequence appeared to facilitate greater blueshifting, possibly due to an unhindered cooperative "unzipping" effect from starting at the end. [0255] Table 6 shows truncated target sequences used for experiments depicted in FIGS.

16A-16H.

Table 6

[0256] It was tested if GT15mirl9 could detect a long sequence of ssDNA by addressing a smaller sequence in the middle. Using R23-mirl9-R23, a 69 bp oligonucleotide with 23 complementary bases in the middle, it was found that even in the presence of SDBS,

hybridization resulted in a small red-shift (FIG. 23). Because red-shifting from non-specific DNA interactions with other constructs was observed (FIG. 7), it was hypothesized that when R23mirl9R23 hybridizes to the recognition sequence, the R23 at the 5' end is held in close proximity to the nanotube surface due to the polarity of the wrapping sequence on the nanotube, and recapitulates the effect of non-specific oligonucleotide interactions. To test this, two sequences, R23-mirl9 and mirl9-R23 that have R23 at either the 3' end or 5' end, were designed. The orientation upon binding and resulting spectral shift is depicted in FIG. 16G. The results are shown for the (8,6) in FIG. 16H; both the miR-19 DNA control and mirl9R23 produced a blueshift, whereas R23mirl9 produced a redshift as predicted. Without wishing to be bound by theory, for detecting longer sequences, the orientation is critical in interpreting spectral shifts.

[0257] Without wishing to be bound by theory, the solution-phase dose-response data suggested that the limit of detection for miR-19 RNA is determined by ratio of nanotube binding sites to target RNA (FIG. 16B, FIG. 17) ). Without wishing to be bound by theory, the best possible sensitivity then is at the single nanotube-level, which would represent the intrinsic threshold of detection. To image single nanotubes over time, adsorbing them to a glass surface provides a stable platform for imaging. However, adsorption was found to prevent recognition of target oligonucleotide, even in the presence of SDBS (data not shown). Direct adsorption to glass may result in disruption of the DNA-wrapping and the necessary tertiary structure that is adopted upon binding the target miR. To circumvent the problems caused by adsorption, a lysine coated plate was first treated with SDS to create a hydrophobic layer for the nanotubes associate with. When SDS-treated GT15mirl9 nanotubes were added, a small percentage were able to loosely associate with the SDS layer for the duration of the experiment.

Measurements of single sensor complexes

[0258] The sensor function on the single-nanotube level was assessed via spectral imaging. The sensor was deposited on a lysine-coated glass surface with sodium dodecyl sulfate (SDS). Hyperspectral microscopy was used to spectroscopically image the (9,4) nanotube (FIG. 24A). By following single nanotubes on the surface before and after addition of miR-19 or R23 (FIG. 24A), it was possible to demonstrate microRNA detection on single nanotubes using wavelength shifting (FIG. 24B). FIG. 24C and D show representative single nanotube spectra before and after miR-19 RNA or R23 (complete set of spectra in FIG. 25 A and B). [0259] The blue-shifting of single nanotubes was apparent upon interrogating the sensor with miR-19 RNA, but not upon introducing R23 RNA (FIGS. 24B-24D, 25A-25B). Using the number of binding sites per nanotube length determined from AFM measurements (FIG. 2C), it was attempted to estimate the number of copies of miRNA detected per nanotube. Based on the banding pattern from AFM data provided herein and other AFM reports, 10-20 binding sites per 200 nm of nanotube were estimated. Because a diffraction-limited spot could contain a nanotube up to ~600nm long, a range of detection was estimated between 1-60 miRNA molecules.

Sensor multiplexing

[0260] Ideally, each chirality of SWCNT could act as a specific sensor for a given miR, with potentially 11-12 SWCNTs that can be easily measured in a PL plot for multiplexed detection of 11-12 miR species. Multiplexed detection of several miRs is advantageous due to increased specificity and sensitivity when using multiple miRs as a biomarker for disease conditions. For an implantable sensor, this would be an especially valuable feature. Using two nanotube preparations differentially enriched for different chiralities, multiplexed detection of two miR sequences was demonstrated.

[0261] The potential for the multiplexed detection of several miRNA sequences via the use of different nanotube chiralities was assessed. Two nanotube preparations enriched for different nanotube chiralities were suspended with binding sequences for either miR-19 or miR- 509. A preparation enriched in large diameter species, (Nano-C APT-200) was suspended by the GT15mirl9 sequence, and a CoMoCAT preparation enriched in small diameter species was suspended using the GT15mir509 sequence. Excitation/emission plots found that the

GT15mirl9 sensor, encapsulating the APT-200 nanotubes, effectively lacked the (6,5) species (FIG. 26A), while the GT15mir509 sensor, encapsulating the narrow-diameter enriched CoMoCAT preparation, lacked the (8,6) species (FIG. 26B). Absorbance spectra verified the differential enrichment of nanotube chiralites between these samples (FIG. 27). After mixing the two nanotube preparations, each miRNA sequence added individually was recognized by the appropriate nanotube chirality (FIG. 26C). When miR-19 and miR-509 were added together, the spectral shift almost identically recapitulated the shifts seen when either miRNA was added alone.

[0262] As purity of production methods improves, more chiralities can be used for greater multiplexing.

[0263] It was then assessed whether the platform could be extended to other analytes of interest by linking target recognition with DNA release from a structure-switching aptamer. As a model, a structure-switching aptamer that recognizes ATP was chosen, due to its role in extracellular communication and as a marker of bacterial growth. Because the aptamer was designed so that ATP binding releases a 12 bp reporter strand of DNA, the miR recognition sequence was substituted for a reporter recognition sequence (GT15cReporter, FIG. 26D).

Addition of the reporter strand alone or addition of the aptamer in the presence of ATP produced a blueshift, while the structure-switching aptamer with GTP or alone elicited no blueshift (FIG. 26E and FIG. 28). The ability to link structure-switching aptamers with the unique optical properties of SWCNTs expands the repertoire of targets for this sensor platform.

Toehold-mediated strand displacement

[0264] Dynamic DNA nanotechnology using strand-displacement reactions has recently emerged as an attractive engineering system for various devices, including reconfigurable nanostructures, based on the specificity and versatility of DNA oligonucleotides.

[0265] It was determined whether the spectral response of the sensor could be reversed via toehold-mediated strand displacement. Strand displacement reactions occur through the use of "toeholds," single-strand overhangs on duplexed DNA that facilitate binding of a

complementary strand, which is thermodynamically favored due to complete complementarity, and is thus able to displace the shorter bound strand.

[0266] Accordingly, the miRNA capture sequence of the GT15mirl9 sensor was truncated to leave a 6 nucleotide overhang after hybridization with the target strand to test whether the addition of a removing strand (RS) to bind the toehold and displace the target would reverse the spectral shift, according to the scheme depicted in FIG. 29C. Upon addition of miR- 19 to the modified GT15mirl9 sensor, the nanotube emission blue-shifted and the intensity increased (FIGS. 29D-29E). After 5 hours, the removing strand was added, at which point the blue-shifting ceased and the emission began to undergo a steady red-shift (FIG. 29D). The emission intensity exhibited a similar reversal (FIG. 29E). It is noted that the signal reversal was slower than detection in the forward direction, which is likely due to the energetic barrier for the truncated capture sequence to displace SDBS from the nanotube surface.

[0267] Because SWCNTs are extremely sensitive to their immediate environment, they are prone to non-specific interactions in complex biological environments. When GT15mirl9 was tested in a solution of 10% fetal bovine serum (FBS), there was a 2 nm redshift across all conditions, and target DNA could not be detected (FIG. 30). To test if SDBS-treated GT15mirl9 nanotubes can function in complex biological environments, both urine and FBS were tested due to their potential clinical value as sources of microRNA biomarkers. Using whole urine from a healthy donor, target microRNA was spiked in at various concentrations to recapitulate how a sample might be received clinically. A concentrated stock solution of SDBS was then added to the whole urine to bring the final concentration to 0.2%, and GT15mirl9 nanotubes were added to a final concentration of 0.02 mg/L. The resulting dose-response is shown in FIG. 31 A; based on the nanotube blueshift, miR-19 RNA was clearly detectable in whole urine to a threshold of 1 nM. The intensity enhancement also persisted in this biofluid, showing a similar threshold between 1 and 10 nM (FIG. 3 IB). In the more biologically complex situation found in FBS, SDBS enabled the detection of miR-19 DNA via blueshifting (FIG. 31C) and intensity enhancement (FIG. 3 ID). When miR-19 RNA was tested under identical conditions, no blueshift was observed for any concentration. Without wishing to be bound by theory, the detection of DNA, but not RNA, targets in serum could be due to RNA degradation or sequestration by components in the serum. The effect of bovine serum albumin, the major protein constituent in FBS, was tested at the low end and high end of the physiologically normal range (35 mg/L BSA and 50 mg/L BSA). At 35 mg/L BSA, it was found that RNA targets could be detected, but not with the same sensitivity as DNA targets (data not shown). At 50 mg/L BSA, RNA could not be detected at the same concentration, but the sensitivity to DNA target was unaffected (data not shown). Without wishing to be bound by theory, these data suggest that RNA has sensitivity to the total albumin content, while DNA is unaffected.

[0268] An application for the sensor/sensing platform is an implantable sensor for realtime monitoring of microRNA biomarkers. To demonstrate the utility of this platform for in vivo sensing, SDBS-pretreated GT15mirl9 nanotubes were loaded into an implantable semipermeable membrane with a molecular weight cut off (500 kDa) small enough to keep the nanotubes inside, but to also allow sampling of small oligonucleotides in the environment (FIG. 3 IE). To verify that SDBS stays associated with the nanotubes in the membrane, the

implantable sensor was subjected to dialysis against buffer for 6 hours with three buffer changes, and it was found that the characteristic blue-shifted shoulder of SDBS interacting with the nanotube persisted and provided enhanced blueshifting (FIG. 32). The nanotube implant was inserted into the peritoneum medially over the intestines (FIG. 3 IF). Two control groups received an IP injection of 1 μΜ R23 DNA or buffer only, and one experimental group received 1 μΜ of target miR-19 DNA. After incubation in the animals for 90 minutes, the mice were anesthetized and spectra were measured from the implanted sensor using a reflectance probe to both excite the nanotubes with 730 nm light and collect the nanotube emission (FIG. 31G). The two control groups did not show any significant difference, whereas the target microRNA group showed a significant blueshift (FIG. 31H). This experiment was repeated using miR-19 RNA, and again a statistically significant blueshift was found (FIG. 3 II). It is believed that this is the first demonstration of a solvatochromism-based carbon nanotube sensor for non-invasive in vivo detection of both microRNA and short DNA oligonucleotides.

Detection of miRNA in biofluids

[0269] The ability of the GT15mirl9 sensor to detect miRNA binding events in common biofluids— urine and serum— due to their clinical value was assessed as sources of microRNA biomarkers. The GT15mirl9 sensor and SDBS were introduced concomitantly to whole urine from 5 healthy donors before interrogating with miR-19 RNA. The wavelength shifting response was clearly detectable against controls down to 1 nM of miRNA, and intensity enhancement gave a similar sensitivity, between 1 and 10 nM (FIGS. 62A-62B, FIGS. 55A-55B). Variation from sample-to- sample was minimal. In whole serum, it was found that target miR-19 DNA was similarly detectable in the presence of SDBS (FIGS. 56A-56B).

[0270] When target miR-19 RNA was introduced to the sensor, it was found that only a small response at the highest tested concentration (FIGS. 56A-56B). It was hypothesized that the RNA detection was complicated by RNases in the serum which might degrade the analyte sequence, as reported elsewhere for synthetic RNA sequences. Therefore, proteinase K, a detergent-stable protease used to deactivate RNase, was introduced into the serum. Introduction of proteinase K allowed the detection of miR-19 RNA with the same sensitivity as for the DNA analogue (FIG. 62C, FIGS. 56A-56B). When proteinase K was introduced 12 h after mixing miR-19 with serum, the sensitivity of the response to miR-19 RNA was not improved, suggesting that the RNA had been destroyed. To verify broad applicability with this method, miR-21 was also used as a target, due to its significance as a serum colorectal cancer biomarker. Similarly, GT15mir21 sensor was also tested in whole serum treated with proteinase K. It was found that miR-21 RNA could be detected directly in minimally-treated serum via both blue- shifting and intensity enhancement (FIG. 62C, FIG. 57).

Detection of miRNA detection in vivo

[0271] The present Example provides the ability of the system to detect miRNA in vivo via a minimally-invasive implantable device. The SDBS-treated GT15mirl9 sensor was loaded into a semipermeable membrane capillary with a MWCO of 500 kDa (FIG. 62D). To determine whether this cutoff would to prevent the diffusion of the GT15mirl9 sensor complexes outside of the membrane, the molecular weight of the GT15mirl9 sensor was calculated. It was estimated that the sensor complexes composed of a small diameter (e.g., 0.8 nm) and average length of about 166 nm fall within the range of 701 kDa to 839 kDa. It was surmised that the miR-19 miRNA, with a molecular weight of 7.055 kDa, would pass through the membrane.

[0272] The likelihood that the enhanced signal response provided by SDBS would continue after device implantation was also assessed. Thus, the semi-permeable capillary was filled with SDBS-pretreated GT15mirl9 sensor and was placed in buffer dialysate for 6 hours. The buffer was changed and the sensor response was assessed with miR-19 every 2 hours (FIGS. 58A-58B). It was found that the GT15mirl9 sensor exhibited a nearly identical blue-shifting response after 6 hours of dialysis, suggesting that the SDBS remained associated with the sensor even under these conditions.

[0273] The sensor response was tested in vivo after surgically implanting the membrane into the peritoneal cavity of NU/J (nude) mice. The membrane was placed medially over the intestines and sutured to the parietal peritoneum to immobilize the device. It was first tested whether DNA could be detected intraperitoneally by injecting 1 nanomole of miR-19 DNA, R23, or the vehicle control. The mice exhibited no obvious adverse effects or changes in behavior following the implantation or injection. After 90 min, the mice were anesthetized using isofluorane. A fiber optic-based probe system was developed to excite an 0.8 cm ² area with a 730 nm CW laser (FIG. 62E), collect the emitted near-infrared light through the same fiber bundle, disperse the light with a Czerny-Turner spectrograph, and detect the light via a ID InGaAs array (FIG. 6F). Using the nanotube emission signal collected from the mouse, it was found that the target miR-19 DNA exhibited a significant blue-shifting response as compared to controls (FIG. 6G). The experiment was repeated using the RNA version of the analyte, resulting in a similar response (FIG. 59). [0274] The implantable device was tested in vitro by immersing the filled capillary into buffer containing RNA, finding that the threshold of detection was below 10 pmol (FIG. 60). To determine the limit of detection in vivo, 500 pmol, 100 pmol, or 50 pmol of miR-19 RNA was injected intraperitoneally into mice implanted with the devices. After 120 min, significant wavelength shifting responses were measured down to 100 pmol (FIG. 64H). The devices were removed from the animals and measured ex vivo, resulting in similar results (FIG. 61). Without wishing to be bound to any theory, it is suspected that the higher limit of detection of the device in vivo as compared to in vitro was due to the degradation of microRNA in the peritoneal fluid as well as fluid exchange out of the peritoneal cavity. The measurement of endogenous microRNA targets, which are highly stable due in part to their association with proteins such as Ago2, may help improve sensor performance.

Thermodynamic analysis of nucleic acid hybridization on the sensor

[0275] Two schemes shown in FIG. 47 were used to estimate the difference in free energy of ssDNA adsorption and dsDNA hybridization at the nanotube surface. As parameters needed for such a calculation are available for a 17-mer duplex strand, analysis was focued on this particular DNA length and sequence.

[0276] For case A, one ssDNA is already adsorbed on the nanotube surface and its complementary partner ssDNA is introduced in the solution like the experimental setup as provided herein. The change in free energy upon hybridization is approximately -135 kcal/mol (at (300 K, 1 bar), which clearly indicates that hybridization is preferred over adsorption).

[0277] Similarly for case B, where both strands are initially adsorbed on the nanotube surface, the change in free energy upon hybridization is approximately +9 kcal/mol. This indicates that when both strands are initially adsorbed (FIG. 47, Case B), ssDNA adsorption is slightly more favorable than dsDNA hybridization. In this experimental setup of miR-19 hybridization on the nanotube, case A was the relevant analysis as complementary strand is introduced after ssDNA and surfactant are allowed to adsorb on the nanotube surface. Thus, these analysis findings are similar to the observed hybridization leading to the function of biosensor / reporter.

Effects of amphipathic molecules on sensor response

[0278] Several classes of amphipathic molecules were introduced to the GT15mirl9 sensor to assess their potential to modulate the optical response to hybridization. Selected molecules included ionic surfactants, non-ionic triblock copolymers, non-ionic surfactants, PEG- functionalized lipid, and BSA due to their variety of steric and electrostatic properties (Table 3). After treatment for 4 hours with each amphipathic molecule, but before addition of target oligonucleotide, emission spectra were measured to assess the effect of each molecule in the absence of target miRNA. The impact on center wavelength and intensity are shown for the (7,5) nanotube, which was similar to the responses of other chiralities (FIGS. 48A-48B). All molecules either elicited a blue-shift to varying degrees or had no apparent effect. SDC was an outlier in that the intensity was enhanced 2-3 fold. While other molecules were found to also enhance intensity to different degrees, none matched the effect of SDC.

[0279] For each set of surfactant-treated nanotubes, complementary and non- complementary target oligonucleotides were introduced and incubated for 4 hours. Each amphipathic molecule was tested at a final concentration of 0.2% wt/vol with 2 mg/L of

GT15mirl9. Endpoint data showed that SDBS and IGEPAL provided the greatest enhancement of target miRNA-induced blue-shifting, followed by SDS, Brij52, and lipid-PEG to a smaller extent (FIGS. 49A-49B). The presence of Pluronic, SDC, and Triton X-100 resulted in no apparent blue-shift of the sensor upon introduction of target miRNA, although it is noted that SDC and Triton X-100 substantially blue-shifted the nanotube before target oligonucleotides were added. The initial blue-shift suggests that these amphiphiles likely coated the nanotube so efficiently as to displace water from the nanotube surface and prevent the capture sequence of the GT15mirl9 oligonucleotide from interacting with the nanotube surface prior to hybridization. There are no obvious patterns relating the structure of the amphiphiles to the modulation of the response to miRNA, although there are certain factors that can be noted. SDC caused an initial blue-shift and prevented the response to miRNA, for example, because it is a very strong surfactant that is known to efficiently suspend nanotubes and enhance nanotube emission.

Pluronic and Triton X-100 are fairly large/bulky surfactant molecules which may have similarly prevented interactions of the capture sequence with the nanotube surface. It is also noted that the structural similarity between SDBS and IGEPAL, the two surfactants that resulted in the largest hybridization-induced enhancements. It is also noted that supramolecular interactions of the surfactant molecules with each other and the nanotube surface are complex.

SDBS-induced spectroscopic changes

[0280] Optical transition energies for DNA- wrapped nanotubes are red-shifted by 10-20 meV (14-22 nm, depending on chirality) and quenched as compared to nanotubes suspended entirely with small molecule anionic surfactants like SDS or SDBS. A proposed mechanism has attributed this finding to incomplete coverage of the nanotube surface by DNA, which allows for greater accessibility of water, resulting in an increased polarity of the local solvent environment (higher local dielectric constant) in the immediate vicinity of the nanotube. However, a blue- shifted shoulder in the spectrum of the GTmirl9 sensor was observed in the absence of the complementary miR-19 strand upon introduction of SDBS (FIG. 2F and FIG. 10). Without wishing to be bound to any theory, this spectral change suggests that SDBS binds to the exposed surfaces on the DNA-suspended nanotube, causing the displacement of water from the nanotube surface, which produces a slight blue-shift in the emission. When target RNA or DNA hybridizes and the duplex dissociates from the surface, bare nanotube surface is exposed, allowing SDBS to bind and become the dominant factor determining of the nanotube emission peak wavelength, and intensity. The net effect was a dramatic blue-shift (4-17 nm, depending on the nanotube chirality) and intensity increase (1.3 -2.2 fold) from the assembly of supramolecular complexes of SDBS, triggered by the introduction of target RNA or DNA.

[0281] From spectroscopic studies of the GT15mirl9 sensor response, a blue shift in nanotube excitation wavelengths was observed, suggesting that the binding of miR-19 RNA and DNA affects the ground state absorption energies in addition to the excited state. FIG. 12 shows the correlation between the excitation wavelength shift and the emission wavelength shift for the ensemble of chiralities, yielding a Pearson correlation coefficient of 0.87744 (p=0.00188). When plotted as change in energy (FIG. 12), the Pearson correlation coefficient is similar 0.90656 (p=0.0007). The environmental effects on nanotube optical properties have been shown to depend at least in part on the mod type of the nanotube. On stratifying the nanotubes by mod type, defined for any nanotube as mod(n-m,3), it was found that mod2 nanotubes exhibited an emission energy modulation that increased nearly linearly (R ² =0.9272) with nanotube diameter (FIG. 11). Interestingly, for the mod2 nanotubes, the intensity enhancement did not show the same linear relationship with nanotube diameter, although all nanotubes increased in intensity. A maximum was found for nanotubes -0.9 nm in diameter (FIG. 11). A slight difference also became apparent between the responses to target DNA and RNA, with RNA eliciting a slightly enhanced intensity increase for small diameter nanotubes and a slightly dampened enhancement for larger diameter nanotubes. This small, diameter-dependent difference may be related to the difference in binding strength and hydration between DNA-DNA hybrids and DNA-RNA hybrids.

Molecular weight of the sensor complex

[0282] The molecular weight of the sensor was estimated using the lower limit of the nanotube diameters to be 0.8 nm, wherein there are 20 carbons around the nanotube

circumference. Thus, 80 carbon atoms are present for every 0.283 nm in nanotube length.

Taking the average length of the nanotube, as measured via AFM, to be 166 nm, the resulting molecular weight of the nanotube is 564 kDa. The molecular weight of the GT15mirl9 DNA sequence is 16.5 kDa. From AFM measurements, it was estimated that 5-10 copies of DNA per 100 nm, and thus 8.3 to 16.6 copies per 166 nm, adding 137 kDa to 275 kDa to the total complex. Thus, for an average length GT15mirl9 sensor with diameter near the lower limit, the molecular weight would be between 701 kDa and 839 kDa.

Applications

[0283] Herein, label-free, amplification-free optical sensors were engineered for the quantitative detection of oligonucleotide hybridization events in vitro and non-invasively in vivo. The sensor mechanism, resulting from competitive effects of the displacement of both

electrostatic charge and water from the carbon nanotube surface, has implications for the improvement of carbon nanotube-based optical and electronic sensors. A better determination of the effects of length, mismatches in sequence, and orientation of longer oligonucleotides on the optical response of the carbon nanotube was gained. The GT15mirX sensor enabled detection via single-molecule sensor elements and multiplexing using multiple nanotube chiralities. The monitoring of toehold-based strand displacement events portends use in nucleic acid-based logic circuits and also allowed the reversal of the sensor response and regeneration of the sensor complex, which may potentially be exploited for continuous use.

[0284] In vitro applications such as point-of-care diagnostics may provide the most immediate route to clinical use. It was found that the sensor can directly detect oligonucleotides in heterogeneous biofluids such as urine and serum with minimal pre-treatment, potentially circumventing biases and variability related to typical pre-analytical steps required for RT-qPCR. Regarding sensor parameters pertinent to clinical measurements, microRNA content in 12 body fluids were surveyed, providing useful quantitative information to estimate the physiological range of microRNA. The limit of detection of the provided sensor in bulk solution is in the picomolar range (e.g., greater than the picomolar range), although the threshold of detection and dynamic range depends on several factors, including binding site coverage. The ability to measure single-nanotube responses representing 1-60 copies of microRNA binding was also demonstrated, suggesting that sensitivities down to lO's of copies of microRNA can be obtained.

[0285] An implantable optical sensor device for the non-invasive detection of biomarkers such as miRNA may potentially be used in conjunction with wearable devices to facilitate the optical readout and data recording. The described sensor implants quantified miRNA down to 100 pmol in vivo. Further, miRNA is often found associated with the small protein Ago2, which makes it physiologically stable. Functionally, Ago2 binds to microRNA in a conformation to favor hybridization with target sequences, especially over an 8 nucleotide section called the seed sequence _.. , but steric hindrance or charge interactions of the protein with miRNA could slow access to the protein-bound sections of the strand.

Sequences

[0286] Table 7 shows GT15mirX sequences used herein. Table 7

[0287] Table 8 shows analyte/target sequences used herein.

Table 8

ID NO: 87) miR-39 TCACCGGGTGTAAATCAGCTTG (SEQ

ID NO: 88)

miR- 141 TAACACTGTCTGGTAAAGATGG (SEQ

ID NO: 89) miR-200b TAATACTGCCTGGTAATGATGA (SEQ

ID NO: 90) miR-429 TAATACTGTCTGGTAAAACCGT (SEQ

ID NO: 91)

Removing Seq. TCAGTTTTGCATAGATTTGCACA (SEQ

ID NO: 92)

[0288] Table 9 shows truncated miR analyte sequences designed to hybridize to the middle of miRNA capture sequence.

Table 9

[0289] Table 10 shows truncated miR analyte sequences designed to hybridize to the 5' end of miRNA capture sequence. Table 10

[0290] Table 11 shows elongated analyte sequences used herein.

Table 11

Methods

DNA-suspension of carbon nanotubes

[0291] Carbon nanotubes produced by the HiPco process (Unidym, Sunnyvale, CA),

CoMoCAT process (SG65i grade, Sigma-Aldrich, St. Louis, MO, US), or a combustion process (APT-200, Nano-C,Westwood, MA) were mixed with DNA oligonucleotides (IDT DNA, Coralville, IA) at a 2: 1 mass ratio in 1 mL of saline-sodium citrate (SSC) buffer and

ultrasonicated for 30 minutes at 40% amplitude (Sonics & Materials, Inc.). The complete list of DNA sequences used for suspension can be found in Supplementary Methods. Following ultrasonication, the dispersions were ultracentrifuged (Sorvall Discovery 90SE) for 30 minutes at 280,000 x g. The top 80% of the supernatant was collected. Absorbance spectra were acquired using a UV/Vis/nIR spectrophotometer (Jasco V-670, Tokyo, Japan). The concentration was calculated using the extinction coefficient Absgio = 0.02554 L mg^cm ^"1 . To remove free DNA, 100 kDa Amicon centrifuge filters (Millipore) were used. The DNA-nanotube complexes were re-suspended in saline-sodium citrate buffer (G Biosciences, St. Louis, MO).

Fluorescence spectroscopy of carbon nanotubes in solution

[0292] Fluorescence emission spectra from aqueous nanotube solutions were acquired using a home-built apparatus consisting of a tunable white light laser source, inverted

microscope, and InGaAs nIR detector. The SuperK EXTREME supercontinuum white light laser source (NKT Photonics) was used with a VARIA variable bandpass filter accessory capable of tuning the output 500 - 825 nm with a bandwidth of 20 nm. The light path was shaped and fed into the back of an inverted IX-71 microscope (Olympus) where it passed through a 20x nIR objective (Olympus) and illuminated a 50-100 μΐ. nanotube sample in a 96-well plate (Corning). The emission from the nanotube sample was collected through the 20x objective and passed through a dichroic mirror (875 nm cutoff, Semrock). The light was f/# matched to the spectrometer using several lenses and injected into an Isoplane spectrograph (Princeton

Instruments) with a slit width of 410 μιη which dispersed the emission using a 86 g/mm grating with 950 nm blaze wavelength. The spectral range was 930 - 1369 nm with a resolution of -0.7 nm. The light was collected by a PIoNIR InGaAs 640 x 512 pixel array (Princeton Instruments). A HL-3-CAL-EXT halogen calibration light source (Ocean Optics) was used to correct for wavelength-dependent features in the emission intensity arising from the spectrometer, detector, and other optics. A Hg/Ne pencil style calibration lamp (Newport) was used to calibrate the spectrometer wavelength. Background subtraction was conducted using a well in a 96-well plate filled with DI H20. Following acquisition, the data was processed with custom code written in Matlab which applied the aforementioned spectral corrections, background subtraction, and was used to fit the data with Lorentzian functions.

Atomic force microscopy

[0293] The GT15mirl9 sensor was incubated overnight at 20 mg/L with 10 μΜ of the miR-19-hairpin or 10 μΜ of the R23 -hairpin in saline sodium citrate diluted 20x in 20 mM HEPES + 5 mM MgCl ₂ . The sample was plated on a freshly cleaved mica substrate (SPI) for 4 minutes before washing with 10 mL of dH ₂ 0 and blowing dry with argon gas. An Asylum Research MFP-3D-Bio instrument was used with an Olympus AC240TS AFM probe in AC mode. Data was captured at 2.93 nm/pixel XY resolution and 15.63 pm Z resolution. For AFM under aqueous conditions, 20 mg/L of the GT15mirl9 sensor was incubated with 10 μΜ of the miR-19-hairpin, R23 -hairpin, or buffer overnight. All three conditions were spin-filtered 3x with 100 kDa Amicon centrifuge filters, and resuspended with 5 mM NiCl ₂ , 20 mM HEPES pH 6.7 buffer. The samples were plated onto freshly cleaved mica for 2 minutes before gently washing with the same buffer. Samples were imaged in a droplet of the buffer using an Asylum Research Cypher ES + BlueDrive AFM with an Olympus AC55 probe and imaged using BlueDrive excitation at the ambient temperature of 31°C within the AFM enclosure. All three samples were imaged with the same probe, consecutively, with the same scan settings, starting with the miR- 19-hairpin sample, followed by the R23 -hairpin control and the buffer control.

Hybridization experiments in buffer conditions and biofluids

[0294] Hybridization experiments were conducted with 2 mg/L of the GT15mirl9 sensor in saline-sodium citrate buffer at room temperature. Target DNA or RNA was introduced to reach a final concentration of 1 μΜ. Samples were incubated for 4 hours, unless otherwise noted. Free energy of hybridization was predicted using OligoAnalyzer 3.1 (IDT). Kinetics experiments were measured every 10 minutes using custom Lab View code. Hybridization experiments with sodium dodecylbenzenesulfonate (SDBS) were conducted using a final concentration 0.2% wt/v. SDBS was added to the GT15mirl9 sensor and allowed to equilibrate overnight at room temperature before target oligonucleotides were added. Toehold-mediated strand displacement experiments were performed with 1 μΜ of target miR-19 DNA, and 10 μΜ of the removing strand, composed of an ssDNA oligonucleotide with the complementary sequence to miR-19. Hybridization experiments in urine were conducted in samples from 5 healthy volunteers and stored on ice until the experiment. Concentrated GT15mirl9 was added to each sample to final concentration of 0.2 mg/L and SDBS to final concentration of 0.2%. Concentrated DNA and RNA target were added to the indicated concentrations and incubated at room temperature overnight. Serum experiments used fetal bovine serum (Life Sciences) with GT15mirl9 added to final concentration 0.2 mg/L and SDBS at 0.2%. Where indicated, proteinase K (New England Biolabs) was added to a final concentration of 0.5 mg/mL. Spectra were acquired after overnight incubation at room temperature.

Single-nanotube measurements

[0295] Single-nanotube measurements were performed by incubating SDS-treated

GT15mirl9 sensor (0.2% SDS in SSC buffer) on a poly-D-lysine coated glass bottom plate (Mattek, Ashland, MA) for 10 minutes before gently washing with 0.2% SDS in SSC buffer. A final volume of 1 mL SDS-buffer was left in the plate during hyperspectral imaging

measurements of the surface-bound nanotubes. A small volume (1 uL) of 1 mM solutions of miR-19 RNA or R23 RNA were then mixed with the buffer. Hyperspectral imaging

measurements were repeated after 15 minutes and 50 minutes. Single nanotube emission spectra were collected via a custom near-infrared hyperspectral microscope. Data was processed with ImageJ software. Peaks were fit to Voigt functions using custom Matlab code to obtain center wavelength values.

Molecular dynamics simulations

[0296] Molecular dynamics (MD) simulations were conducted using the (9,4) nanotube chirality in explicit water. The DNA molecule for GT15mirl9 (without complementary strand) was generated as an unstructured single stranded DNA and placed near the (9,4) nanotube, followed by a sufficiently long equilibration MD simulation enhanced with a replica-exchange based method to let the entire strand adsorb on (9,4) nanotube surface. Analysis of an additional 250 ns long MD simulation is presented herein. The DNA molecule for GT15mirl9 hybridized with the complementary strand was created in a partially double stranded form. miR-19 was generated in the double stranded form using NAB program of AmberTools and was

appropriately bonded via phosphodiester bond to the ss(GT)i ₅ segment (SEQ ID NO: 1) of the GT15mirl9 DNA. The ss(GT)15 (SEQ ID NO: 1) nanotube binding portion of the first strand was adsorbed to the nanotube. The entire DNA and nanotube construct was solvated in a 10.65 x 10.65 x 14.7179 nm water-box containing approximately 55,000 water molecules and 74 sodium counter-ions, placed randomly, to balance the negative charges from phosphates on the DNA. The total system was approximately 170,000 atoms. The nanotube extended to the edges of the water box and was kept frozen in place during the entire equilibration and simulation time. The nanotube atoms were modeled as sp2 hybridized carbon. All structures were visualized in VMD ⁶⁰ .

[0297] The Gromacs 4.6.7 simulation package was used with the Charmm36/TIP3P nucleic acid/water model. Long-range electrostatics were calculated using the particle mesh Ewald method with a 0.9 nm real space cutoff. For van der Waals interactions, a cutoff value of 1.2 nm was used. The energy minimized simulation box was then subjected to 100 ps equilibration in an NVT (T=300 K) ensemble where the number of water molecules were fine- tuned to make average pressure approximately equivalent to atmospheric pressure. Further equilibration runs were performed for 100-200 ns in NVT (T=300 K) ensemble. Systems were propagated with stochastic Langevin dynamics with a time step of 2 fs. The trajectories were saved every 10 ps, yielding a total of 25,000 snapshots for production analysis. Homemade python scripts calling MD Analysis module were used for all other analysis presented.

Quantification of DNA on the nanotube complex

[0298] The GT15mirl9 sequence was used to suspend nanotubes as described earlier.

After each of 4 centrifugation filter steps using the Amicon centrifuge filter (100 kDa MWCO), the concentration of the filtered DNA was measured using Abs ₂₆ o on a NanoDrop

spectrophotometer (ThermoScientific, Waltham, MA). The pellet from centrifugation was also filtered to measure free DNA. The final mass of DNA from the combined values was calculated from the concentration and subtracted from the initial value. From three suspensions, it was found that 3.5 (+/-1.8) mg of DNA suspended 1 mg of nanotube.

Device implantation and in vivo spectroscopy

[0299] All animal experiments were approved by the Institutional Animal Care and Use

Committee at Memorial Sloan Kettering Cancer Center. KrosFlo Implant Membranes (500 kD MWCO) were obtained from Spectrum Labs (Rancho Dominguez, CA). The membrane was cut to about 1 cm in length and filled with approximately 15 μL of 2 mg/L GT15mirl9-nanotubes. Each end was heat sealed. A total of 36 NU/J (nude) mice (Jackson Labs) were anesthetized with 2% isoflurane and implanted with the membrane. Nine mice were divided into three cohorts of three mice to receive miR-19 DNA, R23 DNA, or buffer vehicle via an intraperitoneal injection of 1 nanomole in 1 mL sodium saline citrate buffer. An identical experiment was performed with miR-19 RNA, R23 RNA, or buffer vehicle at 1 nanomole, 500 picomole, 100 picomole, or 50 picomole in 1 mL sodium saline citrate buffer. The mice were removed from anesthesia and allowed to regain consciousness. After 90 or 120 minutes, mice were

anesthetized and measured using a custom-built reflectance probe-based spectroscopy system. The system consisted of a continuous wave 1 watt 730 nm diode laser (Frankfurt). The laser light was injected into a bifurcated fiber optic reflection probe bundle. The sample leg of the bundle included one 200 μπι, 0.22 NA fiber optic cable for sample excitation located in the center of six 200 μπι, 0.22 NA fiber optic cables for collection of the emitted light. Emission below 1050 nm was filtered using longpass filters, and the light was focused into the slit of a Czerny-Turner spectrograph with 303 mm focal length (Shamrock 303i, Andor). The slit width of the spectrograph was set at 410 μπι. The light was dispersed using a 85 g/mm grating with 1350 nm blaze wavelength and collected with an iDus InGaAs camera (Andor). Spectra were fit to Voigt functions using custom Matlab code.

[0300] Table 12 shows a list of mammalian miRNAs that can be used with the sensor described herein.

Table 12

hsa-miR-125a breast cancer down-regulated hsa-miR-146a lung cancer up-regulated hsa-miR-146a Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-146a pancreatic cancer up-regulated hsa-miR-146a pancreatic cancer up-regulated hsa-miR-146a prostate cancer up-regulated hsa-miR-146a psoriasis up-regulated hsa-miR-146b breast cancer down-regulated hsa-miR-146b autism spectrum disorder (ASD) down-regulated hsa-let-7d lung cancer down-regulated hsa-let-7d ovarian cancer (OC) down-regulated hsa-let-7d breast cancer down-regulated hsa-let-7d epithelial ovarian cancer (EOC) down-regulated hsa-let-7d epithelial ovarian cancer (EOC) down-regulated hsa-let-7d hepatocellular carcinoma (HCC) down-regulated hsa-let-7d malignant melanoma down-regulated hsa-let-7d Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-let-7d pancreatic cancer up-regulated hsa-let-7d prostate cancer down-regulated hsa-let-7d* cardiac hypertrophy down-regulated hsa-let-7e lung cancer down-regulated hsa-let-7e acute lymphoblastic leukemia (ALL) down-regulated hsa-let-7e acute myeloid leukemia (AML) up-regulated hsa-let-7e acute myeloid leukemia (AML) up-regulated hsa-let-7e diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-let-7e head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-let-7e hepatocellular carcinoma (HCC) down-regulated hsa-let-7e malignant melanoma down-regulated hsa-let-7e Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-let-7e ovarian cancer (OC) down-regulated hsa-let-7e pituitary adenoma down-regulated hsa-let-7e psoriasis down-regulated hsa-let-7f lung cancer down-regulated hsa-miR-210 glioblastoma multiforme (GBM) up-regulated hsa-miR-125a acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-125a acute myeloid leukemia (AML) up-regulated hsa-miR-125a breast cancer down-regulated hsa-miR-125a chronic pancreatitis up-regulated hsa-miR-125a colorectal cancer down-regulated hsa-miR-125a epithelial ovarian cancer (EOC) down-regulated hsa-miR-125a hepatocellular carcinoma (HCC) down-regulated hsa-miR-125a lung cancer down-regulated hsa-miR-125a neuroblastoma (NB) down-regulated hsa-miR-125a pancreatic cancer up-regulated hsa-miR-125a prostate cancer down-regulated hsa-miR-125a serous ovarian cancer down-regulated hsa-miR-125a vascular disease down-regulated hsa-miR-125b anaplastic thyroid carcinoma (ATC) down-regulated hsa-miR-125b breast cancer down-regulated hsa-miR-125b breast cancer down-regulated hsa-miR-125b prostate cancer down-regulated hsa-miR-125b prostate cancer up-regulated lisa-miR-125b Alzheimer's disease up-regulated lisa-miR-125b cardiac hypertrophy up-regulated hsa-miR-125b Cerebellar neurodegeneration down-regulated hsa-miR-125b heart failure up-regulated hsa-miR-135a malignant melanoma down-regulated hsa-miR-135b colorectal cancer up-regulated hsa-miR-135b malignant melanoma down-regulated hsa-miR-150 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-150 polycythemia vera (PV) down-regulated hsa-miR-150 primary biliary cirrhosis (PBC) down-regulated hsa-miR-150 uterine leiomyoma (ULM) down-regulated hsa-miR-151 acute myeloid leukemia (AML) down-regulated hsa-miR-151 cardiac hypertrophy down-regulated hsa-miR-151 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-151 hepatocellular carcinoma (HCC) up-regulated hsa-miR-151 nasopharyngeal carcinoma (NPC) up-regulated hsa-miR-151 prostate cancer up-regulated hsa-miR-151* acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-151* acute myeloid leukemia (AML) down-regulated lisa-miR-152 asthma normal hsa-miR-152 breast cancer down-regulated hsa-miR-152 breast cancer down-regulated hsa-miR-152 epithelial ovarian cancer (EOC) down-regulated hsa-miR-153 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-154 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-154 dermatomyositis (DM) up-regulated hsa-miR-133a tongue squamous cell carcinoma down-regulated hsa-miR-133a epithelial ovarian cancer (EOC) down-regulated hsa-miR-133a glioblastoma multiforme (GBM) down-regulated lisa-miR-133a primary biliary cirrhosis (PBC) down-regulated hsa-miR-133a retinitis pigmentosa (RP) down-regulated hsa-miR-133a vascular disease down-regulated hsa-miR-133b Parkinson's disease down-regulated hsa-miR-133b tongue squamous cell carcinoma down-regulated hsa-miR-133b colorectal cancer down-regulated hsa-miR-133b glioblastoma multiforme (GBM) down-regulated hsa-miR-133b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-133b primary biliary cirrhosis (PBC) down-regulated hsa-miR-133b psoriasis down-regulated hsa-miR-133b testicular genn cell tumor up-regulated hsa-miR-134 acute promyelocytic leukemia (APL) down-regulated hsa-miR-134 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-134 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-134 epithelial ovarian cancer (EOC) down-regulated hsa-miR-134 limb-girdle muscular dystrophies ty pes 2A (LGMD2A) up-regulated hsa-miR-134 nemaline myopathy (NM) up-regulated hsa-miR-134 ovarian cancer (OC) down-regulated hsa-miR-136 breast cancer up-regulated hsa-miR-136 hepatocellular carcinoma (HCC) down-regulated hsa-miR-21 miyoshi myopathy (MM) up-regulated hsa-miR-21 ovarian cancer (OC) down-regulated hsa-miR-21 pancreatic cancer up-regulated hsa-miR-21 pancreatic cancer up-regulated hsa-miR-21 pancreatic cancer up-regulated hsa-miR-21 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-21 polymyositis (PM) up-regulated hsa-miR-21 prostate cancer up-regulated hsa-miR-21 prostate cancer up-regulated hsa-miR-21 psoriasis up-regulated hsa-miR-21 serous ovarian cancer up-regulated hsa-miR-21 uterine leiomyoma (ULM) up-regulated hsa-miR-21 uterine leiomyoma (ULM) up-regulated hsa-miR-210 breast cancer up-regulated hsa-miR-210 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-210 acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-210 acute myeloid leukemia (AML) down-regulated hsa-miR-210 Alzheimer's disease down-regulated hsa-miR-210 breast cancer up-regulated hsa-miR-210 dermatomyositis (DM) up-regulated hsa-miR-210 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-210 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-210 follicular lymphoma (FL) up-regulated hsa-miR-210 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-9 Hodgkin's lymphoma up-regulated hsa-miR-31 malignant melanoma down-regulated hsa-miR-31 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-368 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-368 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-368 miyoshi myopathy (MM) up-regulated hsa-miR-368 nemaline myopathy (NM) up-regulated hsa-miR-368 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-369-5p dermatomyositis (DM) up-regulated hsa-miR-369-5p Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-369-5p facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-369-5p nemaline myopathy (NM) up-regulated hsa-miR-370 cholangiocarcinoma down-regulated hsa-miR-370 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-370 prostate cancer up-regulated hsa-miR-371 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-371 testicular germ cell tumor up-regulated hsa-miR-372 non-small cell lung cancer (NSCLC) up-regulated hsa-miR-372 testicular germ cell tumor up-regulated hsa-miR-372 acute myeloid leukemia (AML) down-regulated hsa-miR-372 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-372 testicular germ cell tumor up-regulated hsa-miR-373 breast cancer up-regulated hsa-miR-373 testicular germ cell tumor up-regulated hsa-miR-182 prostate cancer up-regulated hsa-miR-182* prostate cancer up-regulated hsa-miR-183 lung cancer up-regulated hsa-miR-183 prostate cancer up-regulated hsa-miR-184 prostate cancer down-regulated hsa-miR-206 rhabdomyosarcoma down-regulated hsa-miR-206 rhabdomyosarcoma down-regulated hsa-miR-208 myocardial injury up-regulated hsa-miR-20a kidney cancer up-regulated hsa-miR-20a lung cancer up-regulated hsa-miR-20b kidnev cancer up-regulated hsa-miR-21 kidnev cancer up-regulated lisa-miR-21 myocardial infarction down-regulated hsa-miR-21 hepatocellular carcinoma (HCC) up-regulated hsa-miR-21 lung cancer up-regulated hsa-miR-21 cervical cancer up-regulated hsa-miR-21 cholesteatoma up-regulated hsa-miR-21 lung cancer up-regulated hsa-miR-210 pancreatic cancer up-regulated hsa-miR-210 lung cancer up-regulated hsa-miR-210 kidnev cancer up-regulated hsa-miR-214 kidnev cancer down-regulated hsa-miR-218 lung cancer down-regulated hsa-miR-22 lung cancer down-regulated hsa-miR-221 prostate cancer down-regulated hsa-miR-221 hepatocellular carcinoma (HCC) up-regulated hsa-miR-221 prostate cancer down-regulated hsa-miR-221 hepatocellular carcinoma (HCC) up-regulated hsa-miR-222 pancreatic cancer up-regulated hsa-miR-222 hepatocellular carcinoma (HCC) up-regulated hsa-miR-222 prostate cancer down-regulated hsa-miR-223 chronic lymphocytic leukemia (CLL) down-regulated lisa-miR-23a cardiac hypertrophy up-regulated lisa-miR-26a kidney cancer down-regulated hsa-miR-27a breast cancer up-regulated hsa-miR-27a kidney cancer up-regulated hsa-miR-29a kidney cancer up-regulated hsa-miR-29a neuroblastoma (NB) down-regulated hsa-miR-29b neuroblastoma (NB) down-regulated hsa-miR-29b kidnev cancer up-regulated hsa-miR-34a pancreatic cancer down-regulated hsa-miR-34b pancreatic cancer down-regulated lisa-miR-34c pancreatic cancer down-regulated hsa-miR-375 prostate cancer up-regulated hsa-miR-378 kidney cancer down-regulated hsa-miR-423 lung cancer up-regulated hsa-miR-424 kidney cancer up-regulated hsa-miR-424 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-425-5p lung cancer up-regulated hsa-miR-451 lung cancer down-regulated hsa-miR-489 kidney cancer up-regulated hsa-miR-497 lung cancer down-regulated hsa-miR-511 lung cancer down-regulated hsa-niiR-532-5p kidney cancer down-regulated hsa-miR-599 multiple sclerosis up-regulated hsa-miR-661 breast cancer down-regulated hsa-miR-7 Parkinson's disease down-regulated hsa-miR-7 lung cancer up-regulated hsa-miR-720 kidney cancer down-regulated hsa-miR-107 non-small cell lung cancer (NSCLC) down-regulated hsa-miR-107 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-107 schizophrenia up-regulated hsa-miR-122 hepatocellular carcinoma (HCC) down-regulated hsa-miR-122 hepatocellular carcinoma (HCC) down-regulated hsa-miR-122 kidney cancer up-regulated hsa-miR-125a ty pe 2 diabetes up-regulated hsa-miR-125a- lung cancer down-regulated hsa-miR-125b prostate cancer down-regulated hsa-miR-122a gastric cancer (stomach cancer) down-regulated hsa-miR-122a hepatocellular carcinoma (HCC) down-regulated hsa-miR-126 kidney cancer up-regulated hsa-miR-126 lung cancer down-regulated hsa-miR-126* lung cancer down-regulated hsa-miR-128 neuroblastoma down-regulated hsa-miR-130a lung cancer down-regulated hsa-miR-133b lung cancer down-regulated hsa-miR-135a Hodgkin's lymphoma down-regulated hsa-miR-139 lung cancer down-regulated hsa-miR-141 lung cancer up-regulated hsa-miR-199a Intrahepatic cholangiocarcinoma (ICC) down-regulated hsa-miR-199a* Intrahepatic cholangiocarcinoma (ICC) down-regulated lisa-miR-214 Intrahepatic cholangiocarcinoma (ICC) down-regulated hsa-miR-22 Intrahepatic cholangiocarcinoma (ICC) down-regulated hsa-miR-155 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-196a pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-122 hepatocellular carcinoma (HCC) down-regulated hsa-miR-208a cardiac hypertrophy down-regulated hsa-miR-200c lung cancer down-regulated hsa-miR-429 lung cancer down-regulated hsa-miR-221 bladder cancer up-regulated hsa-miR-21 pancreatic cancer up-regulated hsa-miR-221 pancreatic cancer up-regulated hsa-miR-140 colorectal cancer down-regulated hsa-miR-140 osteosarcoma down-regulated hsa-miR-21 colorectal cancer up-regulated hsa-miR-21 prostate cancer up-regulated hsa-miR-125b breast cancer normal hsa-miR-16 prostate cancer down-regulated hsa-miR-100 nasopharyngeal carcinoma (NPC) down-regulated hsa-miR-lOa pancreatic cancer up-regulated hsa-miR-1 lung cancer down-regulated hsa-miR-143 lung cancer down-regulated hsa-miR-130a lung cancer up-regulated hsa-miR-146b lung cancer up-regulated hsa-miR-21 lung cancer up-regulated hsa-miR-31 lung cancer up-regulated hsa-miR-377 lung cancer up-regulated hsa-miR-141 lung cancer down-regulated hsa-miR-200a lung cancer down-regulated hsa-miR-200b lung cancer down-regulated hsa-miR-221 acute promyelocytic leukemia (APL) down-regulated hsa-miR-128b acute promyelocytic leukemia (APL) down-regulated hsa-miR-127 Intrahepatic cholangiocarcinoma (ICC) down-regulated hsa-miR-376a Intrahepatic cholangiocarcinoma (ICC) down-regulated hsa-miR-424 Intrahepatic cholangiocarcinoma (ICC) down-regulated hsa-miR-17-3p prostate cancer down-regulated hsa-miR-34a glioblastoma down-regulated hsa-miR-34a glioma down-regulated hsa-miR-34a medulloblastoma down-regulated hsa-miR-1 myocardial infarction up-regulated hsa-miR-13 Ob glioma down-regulated hsa-miR-140 glioma down-regulated hsa-miR-15a glioma down-regulated hsa-miR-16 glioma down-regulated hsa-miR-184 glioma down-regulated hsa-miR-19a glioma down-regulated hsa-miR-20a glioma down-regulated hsa-miR-21 glioma down-regulated hsa-miR-210 glioma down-regulated hsa-miR-25 glioma down-regulated hsa-miR-28 glioma down-regulated hsa-miR-328 glioma down-regulated hsa-miR-9 glioma down-regulated hsa-miR-17 glioma up-regulated hsa-miR-200a Hodgkin's lymphoma down-regulated hsa-miR-520a Hodgkin's lymphoma down-regulated hsa-miR-614 Hodgkin's lymphoma down-regulated hsa-miR-140 Hodgkin's lymphoma up-regulated hsa-miR-155 Hodgkin's lymphoma up-regulated hsa-miR-16 Hodgkin's lymphoma up-regulated hsa-miR-186 Hodgkin's lymphoma up-regulated hsa-miR-18a Hodgkin's lymphoma up-regulated hsa-miR-196a Hodgkin's lymphoma up-regulated hsa-miR-20a Hodgkin's lymphoma up-regulated hsa-miR-21 Hodgkin's lymphoma up-regulated hsa-miR-30a-5p Hodgkin's lymphoma up-regulated hsa-miR-181b Oral Carcinoma up-regulated hsa-miR-21 Oral Carcinoma up-regulated hsa-miR-345 Oral Carcinoma up-regulated hsa-miR-30b Hodgkin's lymphoma up-regulated hsa-miR-374 Hodgkin's lymphoma up-regulated hsa-miR-9 Hodgkin's lymphoma up-regulated hsa-miR-lOb non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-let-7c non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-let-7d non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-let-7e non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-103 non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-107 non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-130a non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-140 non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-183 non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-200c non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-203 non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-375 esophageal cancer down-regulated hsa-niiR-1 2 esophageal cancer up-regulated hsa-miR-194 esophageal cancer up-regulated hsa-miR-21 esophageal cancer up-regulated hsa-miR-21 non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-26a-l non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-27b non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-29b non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-3 Oa non-alcoholic fatty liver disease (NAFLD) down-regulated hsa-miR-122a non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-126 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-132 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-151 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-154 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-16-1 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-17 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-187 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-22 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-29c non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-210 head and neck cancer down-regulated hsa-let-7a laryngeal carcinoma down-regulated hsa-miR-203 esophageal cancer down-regulated hsa-miR-30c non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-30d non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-31 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-33 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-34a non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-95 non-alcoholic fatty liver disease (NAFLD) up-regulated hsa-miR-223 esophageal cancer up-regulated hsa-miR-22 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-223 essential thrombocythemia (ET) up-regulated hsa-miR-146b primary myelofibrosis up-regulated hsa-miR-223 primary myelofibrosis up-regulated hsa-miR-26a hepatocellular carcinoma (HCC) down-regulated hsa-miR-26b hepatocellular carcinoma (HCC) down-regulated hsa-miR-29a lung cancer down-regulated hsa-let-7a lung cancer down-regulated hsa-miR-17 Polycystic Kidney Disease up-regulated hsa-miR-150 sepsis down-regulated hsa-miR-106b colorectal cancer up-regulated hsa-miR-130b colorectal cancer up-regulated hsa-miR-181b colorectal cancer up-regulated hsa-miR-20b multiple sclerosis down-regulated hsa-miR-1275 multiple sclerosis up-regulated hsa-miR-142-3p multiple sclerosis up-regulated hsa-miR-145 multiple sclerosis up-regulated hsa-miR-186 multiple sclerosis up-regulated hsa-miR-223 multiple sclerosis up-regulated hsa-miR-422a multiple sclerosis up-regulated hsa-miR-491-5p multiple sclerosis up-regulated hsa-miR-584 multiple sclerosis up-regulated hsa-miR-664 multiple sclerosis up-regulated hsa-miR-181a breast cancer down-regulated hsa-miR-26a breast cancer down-regulated lisa-miR-21 colorectal cancer up-regulated lisa-miR-141 colorectal cancer down-regulated hsa-miR-34a malignant melanoma down-regulated hsa-miR-15 malignant melanoma up-regulated hsa-miR-210 malignant melanoma up-regulated hsa-miR~196a-

2 gastric cancer (stomach cancer) down-regulated hsa-miR-326 multiple sclerosis up-regulated hsa-miR-143 colorectal cancer down-regulated hsa-miR-200b breast cancer down-regulated lisa-miR-200c breast cancer down-regulated hsa-miR-1 colorectal cancer down-regulated hsa-miR-lOb colorectal cancer down-regulated hsa-miR-125a colorectal cancer down-regulated hsa-miR-133a colorectal cancer down-regulated hsa-miR-139 colorectal cancer down-regulated hsa-miR-143 colorectal cancer down-regulated hsa-miR-145 colorectal cancer down-regulated hsa-miR-195 colorectal cancer down-regulated hsa-miR-30a-3p colorectal cancer down-regulated lisa-miR-30a-5p colorectal cancer down-regulated hsa-miR-30c colorectal cancer down-regulated hsa-miR-378* colorectal cancer down-regulated hsa-miR-422a colorectal cancer down-regulated hsa-miR-422b colorectal cancer down-regulated hsa-miR-497 colorectal cancer down-regulated hsa-miR-203 colorectal cancer down-regulated hsa-miR-34a colorectal cancer down-regulated hsa-miR-95 colorectal cancer down-regulated hsa-miR-106a colorectal cancer up-regulated hsa-miR-19a colorectal cancer up-regulated hsa-miR-19b colorectal cancer up-regulated hsa-miR-20a colorectal cancer up-regulated hsa-miR-21 colorectal cancer up-regulated hsa-miR-224 colorectal cancer up-regulated hsa-miR-25 colorectal cancer up-regulated hsa-miR-29a colorectal cancer up-regulated hsa-miR-96 colorectal cancer up-regulated hsa-miR-17-5p colorectal cancer up-regulated hsa-miR-182 colorectal cancer up-regulated hsa-miR-183 colorectal cancer up-regulated hsa-miR-18a colorectal cancer up-regulated hsa-miR-29b colorectal cancer up-regulated hsa-miR-93 colorectal cancer up-regulated hsa-miR-31 colorectal cancer up-regulated hsa-miR-124 hepatocellular carcinoma (HCC) down-regulated hsa-miR-203 hepatocellular carcinoma (HCC) down-regulated hsa-miR-126 asthma up-regulated hsa-miR-21 bladder cancer up-regulated hsa-miR-100 bladder cancer down-regulated hsa-miR-99a bladder cancer down-regulated hsa-miR-29b acute myelogeneous leukemia (AML) down-regulated hsa-let-7b multiple myeloma (MM) down-regulated hsa-miR-140-3p multiple myeloma (MM) down-regulated hsa-let-7e multiple myeloma (MM) up-regulated hsa-miR-125a-

5p multiple myeloma (MM) up-regulated hsa-miR-99b multiple myeloma (MM) up-regulated hsa-miR-15a papillary thyroid carcinoma (PTC) down-regulated hsa-miR-16 papillary thyroid carcinoma (PTC) down-regulated hsa-miR-199b papillary thyroid carcinoma (PTC) down-regulated hsa-miR-26a papillary thyroid carcinoma (PTC) down-regulated hsa-miR-29 papillary thyroid carcinoma (PTC) down-regulated hsa-miR-34 papillary thyroid carcinoma (PTC) down-regulated hsa-let-7b papillary thyroid carcinoma (PTC) up-regulated hsa-miR-106 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-193 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-200a papillary thyroid carcinoma (PTC) up-regulated hsa-miR-222 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-141 ovarian cancer (OC) up-regulated hsa-miR-200a ovarian cancer (OC) up-regulated hsa-miR-200b ovarian cancer (OC) up-regulated hsa-miR-200c ovarian cancer (OC) up-regulated hsa-miR-429 ovarian cancer (OC) up-regulated hsa-miR-214 cervical cancer down-regulated hsa-miR-500 hepatocellular carcinoma (HCC) up-regulated hsa-miR-31a breast cancer down-regulated hsa-miR-125a breast cancer down-regulated miR-BART21 nasopharyngeal carcinoma (NPC) up-regulated miR-BART22 nasopharyngeal carcinoma (NPC) up-regulated lisa-miR-125a ovarian cancer (OC) down-regulated hsa-miR-16-1 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-16-1 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-16-1 mantle cell lymphoma (MCL) normal hsa-miR-16-1 pituitary adenoma down-regulated hsa-miR-16-1 pancreatic cancer up-regulated hsa-miR-16-2 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-164 pituitary adenoma down-regulated hsa-miR-170 breast cancer up-regulated hsa-miR-172a-2 hepatocellular carcinoma (HCC) up-regulated hsa-miR-17-3p lung cancer up-regulated hsa-miR-17-3p anaplastic thyroid carcinoma (ATC) up-regulated hsa-miR-17-3p lung cancer up-regulated hsa-miR-17-3p MYC-rearranged lymphoma up-regulated hsa-miR-17-3p hepatocellular carcinoma (HCC) up-regulated hsa-miR-17-3p malignant lymphoma up-regulated hsa-miR-409-3p dermatomyositis (DM) up-regulated hsa-miR-409-3p Duchenne muscular dystrophy (DMD) up-regulated lisa-miR-409-3p miyoshi myopathy (MM) up-regulated hsa-miR-409-3p nemaline myopathy (NM) up-regulated hsa-miR-419 epithelial ovarian cancer (EOC) down-regulated hsa-miR-422a ovarian cancer (OC) down-regulated hsa-miR-422b head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-423 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-423 nemaline myopathy (NM) up-regulated hsa-miR-423 primaiy biliary cirrhosis (PBC) down-regulated hsa-miR-637 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-637 ovarian cancer (OC) up-regulated hsa-miR-642 uterine leiomyoma (ULM) down-regulated hsa-miR-648 ovarian cancer (OC) down-regulated hsa-miR-652 autism spectrum disorder (ASD) down-regulated hsa-miR-652 m eal melanoma up-regulated hsa-miR-657 ovarian cancer (OC) down-regulated hsa-miR-662 ovarian cancer (OC) down-regulated hsa-miR-663 breast cancer down-regulated hsa-miR-663 breast cancer down-regulated hsa-miR-663 ovarian cancer (OC) up-regulated hsa-miR-7 glioblastoma down-regulated hsa-miR-7 autism spectrum disorder (ASD) up-regulated hsa-miR-7 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-7 schizophrenia down-regulated hsa-miR-7- 1 pituitary adenoma down-regulated hsa-miR-7-2 kidney cancer up-regulated hsa-miR-7-3 chronic pancreatitis up-regulated hsa-miR-7-3 colorectal cancer up-regulated hsa-miR-7-3 pituitary adenoma down-regulated hsa-miR-802 Down syndrome (DS) up-regulated hsa-miR-9 metabolic disease up-regulated hsa-miR-9 recurrent ovarian cancer down-regulated hsa-miR-9 Alzheimer's disease up-regulated hsa-miR-lOa Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-lOa pancreatic cancer up-regulated hsa-miR-lOa prostate cancer up-regulated hsa-miR-lOa psoriasis down-regulated hsa-miR-lOa uterine leiomyoma (ULM) down-regulated hsa-miR-lOb breast cancer up-regulated hsa-miR-lOb B-cell chronic lymphocytic leukemia up-regulated hsa-miR-lOb breast cancer down-regulated hsa-miR-lOb cardiac hypertrophy down-regulated hsa-miR-lOb chronic pancreatitis up-regulated hsa-miR-lOb glioblastoma up-regulated hsa-miR-lOb ovarian cancer (OC) up-regulated hsa-miR-lOb pancreatic cancer up-regulated hsa-miR-lOb prostate cancer up-regulated hsa-miR-lOb serous ovarian cancer down-regulated hsa-miR-1-2 hepatocellular carcinoma (HCC) down-regulated hsa-miR-1-2 cardiomyopathy down-regulated hsa-miR-122a hepatocellular carcinoma (HCC) down-regulated hsa-miR-122a HCV infection up-regulated hsa-miR-122a hepatocellular carcinoma (HCC) down-regulated hsa-miR-122a metabolic disease down-regulated hsa-miR-122a breast cancer up-regulated hsa-miR-122a head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-122a hepatocellular carcinoma (HCC) up-regulated hsa-miR-122a hepatocellular carcinoma (HCC) down-regulated hsa-miR-184 epithelial ovarian cancer (EOC) down-regulated hsa-miR-184 malignant melanoma down-regulated hsa-miR-184 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-184 prostate cancer up-regulated hsa-miR-185 hepatocellular carcinoma (HCC) up-regulated hsa-miR-185 bladder cancer up-regulated hsa-miR-185 cardiac hypertrophy down-regulated hsa-miR-185 cardiac hypertrophy down-regulated hsa-miR-185 glioblastoma multiforme (GBM) down-regulated hsa-miR-185 kidney cancer up-regulated hsa-miR-185 malignant melanoma down-regulated hsa-miR-130a limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-130a miyoshi myopathy (MM) up-regulated hsa-miR-130a nemaline myopathy (NM) up-regulated hsa-miR-130a polymyositis (PM) up-regulated hsa-miR-130a-l hepatocellular carcinoma (HCC) up-regulated hsa-miR-130b acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-130b acute myeloid leukemia (AML) down-regulated hsa-miR-130b pancreatic ductal adenocarcinoma (PDAC) down-regulated hsa-miR-130b-l hepatocellular carcinoma (HCC) up-regulated hsa-miR-132 Huntington's disease (HD) down-regulated hsa-miR-132 autism spectrum disorder (ASD) up-regulated hsa-miR-132 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-139 uterine leiomyoma (ULM) down-regulated hsa-miR-132 colorectal cancer up-regulated hsa-miR-302c malignant melanoma down-regulated hsa-miR-302c* Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-302c* prostate cancer up-regulated lisa-miR-302d acute myeloid leukemia (AML) down-regulated lisa-miR-302d malignant melanoma down-regulated hsa-miR-302d testicular germ cell tumor up-regulated hsa-miR-30a hepatocellular carcinoma (HCC) down-regulated hsa-miR-30a uterine leiomyoma (ULM) up-regulated hsa-miR-30a-3p acute myeloid leukemia (AML) down-regulated hsa-miR-30a-3p cardiac hypertrophy down-regulated hsa-miR-30a-3p colorectal cancer up-regulated hsa-miR-30a-3p colorectal cancer down-regulated hsa-miR-30a-3p dermatomyositis (DM) down-regulated hsa-miR-30a-3p Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-30a-3p limb-girdle muscular dystrophies types 2A (LGMD2A) down-regulated hsa-miR-30a-3p miyoshi myopathy (MM) down-regulated hsa-miR-30a-3p nemaline myopathy (NM) down-regulated hsa-miR-30a-3p polymyositis (PM) down-regulated hsa-miR-30a-5p anaplastic thyroid carcinoma (ATC) down-regulated hsa-miR-30a-5p cardiac hypertrophy down-regulated hsa-miR-30a-5p Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-30a-5p lung cancer down-regulated hsa-miR-200b cancer down-regulated lisa-miR-30a-5p colorectal cancer up-regulated hsa-iniR-30d primary biliary cirrhosis (PBC) down-regulated hsa-miR-30d schizophrenia down-regulated hsa-miR-3 Oe hepatocellular carcinoma (HCC) down-regulated hsa-miR-30e cardiac hypertrophy down-regulated hsa-miR-30e cardiac hypertrophy down-regulated hsa-miR-30e schizophrenia down-regulated hsa-miR-30e* cardiac hypertrophy down-regulated hsa-miR-30e-5p Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-30e-5p head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-30e-5p Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-30e-5p ovarian cancer (OC) up-regulated hsa-miR-30e-5p psoriasis up-regulated hsa-miR-31 cardiac hypertrophy up-regulated hsa-miR-31 colorectal cancer up-regulated hsa-miR-31 colorectal cancer up-regulated hsa-miR-31 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-31 hepatocellular carcinoma (HCC) up-regulated hsa-miR-31 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-31 psoriasis up-regulated hsa-miR-32 PFV-1 infection down-regulated hsa-miR-32 colorectal cancer up-regulated hsa-miR-19a anaplastic thyroid carcinoma (ATC) up-regulated hsa-miR-19a Cowden Syndrome up-regulated hsa-miR-19a lung cancer up-regulated lisa-miR-19a B-cell chronic lymphocytic leukemia up-regulated lisa-miR-19a colorectal cancer up-regulated hsa-miR-19a head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-19a malignant lymphoma up-regulated hsa-miR-19a malignant melanoma up-regulated hsa-miR-19b malignant lymphoma up-regulated hsa-miR-19b prostate cancer down-regulated hsa-miR-19b-2 T-cell leukemia up-regulated hsa-miR-200a serous ovarian cancer up-regulated hsa-miR-200a breast cancer down-regulated lisa-miR-200a cancer down-regulated hsa-miR-200a epithelial ovarian cancer (EOC) up-regulated hsa-miR-200a head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-200a hepatocellular carcinoma (HCC) down-regulated hsa-miR-200a malignant melanoma down-regulated hsa-miR-200a ovarian cancer (OC) down-regulated hsa-miR-200a psoriasis up-regulated hsa-miR-200b serous ovarian cancer up-regulated hsa-miR-200b breast cancer down-regulated hsa-miR-200b cholangiocarcinoma up-regulated lisa-miR-24 schizophrenia down-regulated lisa-miR-24-1 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-24-1 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-24-1 colorectal cancer up-regulated hsa-miR-24-1 gastric cancer (stomach cancer) up-regulated hsa-miR-24-1 glioblastoma up-regulated hsa-miR-24-1 pancreatic cancer up-regulated hsa-miR-24-1 pancreatic cancer up-regulated hsa-miR-24-1 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-24-1 pituitary adenoma down-regulated hsa-miR-24-2 hepatocellular carcinoma (HCC) up-regulated hsa-miR-24-2 colorectal cancer up-regulated hsa-miR-24-2 gastric cancer (stomach cancer) up-regulated hsa-miR-24-2 glioblastoma up-regulated hsa-miR-24-2 lung cancer up-regulated hsa-miR-24-2 pancreatic cancer up-regulated hsa-miR-24-2 pancreatic cancer up-regulated hsa-miR-24-2 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-25 colorectal cancer down-regulated hsa-miR-25 gastric cancer (stomach cancer) up-regulated lisa-miR-25 glioblastoma up-regulated hsa-miR-25 pancreatic cancer up-regulated hsa-miR-25 prostate cancer up-regulated hsa-miR-26a anaplastic thyroid carcinoma (ATC) down-regulated hsa-miR-26a acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-204 malignant melanoma down-regulated hsa-miR-206 breast cancer down-regulated hsa-let-7a malignant melanoma down-regulated hsa-miR-136 pituitary adenoma down-regulated hsa-miR-210 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-424 acute lymphoblastic leukemia (ALL) down-regulated lisa-miR-9 Alzheimer's disease down-regulated lisa-miR-122a hepatocellular carcinoma (HCC) down-regulated hsa-miR-140 autism spectrum disorder (ASD) down-regulated hsa-miR-200b epithelial ovarian cancer (EOC) up-regulated hsa-miR-26a acute myeloid leukemia (AML) up-regulated hsa-miR-30a-5p ovarian cancer (OC) up-regulated hsa-miR-32 lung cancer down-regulated hsa-miR-373 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-154 Duchenne muscular dystrophy (DMD) up-regulated lisa-miR-125b malignant melanoma down-regulated lisa-miR-146b Becker muscular dystrophy (BMD) up-regulated hsa-miR- 192-2 hepatocellular carcinoma (HCC) down-regulated hsa-miR-196b pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-382 nemaline myopathy (NM) up-regulated hsa-miR-324-5p medulloblastoma down-regulated hsa-miR-23a lupus nephritis up-regulated hsa-let-7b neurodegeneration up-regulated hsa-miR-30d chronic lymphocytic leukemia (CLL) down-regulated hsa-miR- 155 breast cancer up-regulated hsa-miR-210 Acute Promyelocytic Leukemia (APL) down-regulated hsa-miR-200b hepatocellular carcinoma (HCC) down-regulated hsa-miR- 144 thalassemia down-regulated hsa-miR-21 Hepatocellular carcinoma (HCC) up-regulated hsa-miR-142-3p endometriosis down-regulated hsa-miR- 19a medulloblastoma up-regulated hsa-miR-223 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-9* Huntington's disease (HD) down-regulated hsa-miR-17-5p diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-222 prostate cancer up-regulated lisa-miR-19a medulloblastoma up-regulated hsa-miR- 10b glioma up-regulated hsa-miR- 133a bladder cancer down-regulated hsa-miR- 152 hepatocellular carcinoma (HCC) down-regulated hsa-miR-199a hepatocellular carcinoma (HCC) down-regulated hsa-miR-21 laryngeal carcinoma up-regulated hsa-miR-21 renal clear cell carcinoma up-regulated hsa-miR-21 non-small cell lung cancer (NSCLC) up-regulated hsa-miR-21 bladder cancer up-regulated hsa-miR-30a-5p prostate cancer down-regulated lisa-miR-30a-5p schizophrenia down-regulated hsa-miR-30b cardiac hypertrophy down-regulated hsa-miR-30b Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-30b head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-30b malignant melanoma down-regulated hsa-miR-30b nemaline myopathy (NM) up-regulated hsa-miR-30b prostate cancer down-regulated hsa-miR-30b schizophrenia down-regulated hsa-miR-30c cardiac hypertrophy down-regulated hsa-miR-30c Cerebellar neurodegeneration down-regulated hsa-miR-30c colorectal cancer up-regulated hsa-miR-30c colorectal cancer down-regulated hsa-miR-30c Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-30c miyoshi myopathy (MM) down-regulated hsa-miR-30c pancreatic cancer up-regulated hsa-miR-30c prostate cancer up-regulated hsa-miR-30c prostate cancer down-regulated hsa-miR-30c prostate cancer up-regulated hsa-miR-30c psoriasis down-regulated hsa-miR-30c-l hepatocellular carcinoma (HCC) down-regulated hsa-miR-30d acute myeloid leukemia (AML) up-regulated hsa-miR-30d anaplastic thyroid carcinoma (ATC) down-regulated hsa-miR-30d cardiac hypertrophy down-regulated hsa-miR-30d Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-101 glioblastoma multiforme (GBM) down-regulated hsa-iniR-155 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-155 pancreatic ductal andenocarcinoma (PDAC) up-regulated hsa-miR-15a hepatocellular carcinoma (HCC) down-regulated hsa-miR-16 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-16 hepatocellular carcinoma (HCC) up-regulated hsa-miR-17-5p pulmonary hypertension up-regulated hsa-miR-17-5p hepatocellular carcinoma (HCC) up-regulated hsa-miR-18 hepatocellular carcinoma (HCC) hepatocellular carcinom hsa-miR-182 lung cancer up-regulated hsa-miR-183 lung cancer up-regulated hsa-miR-184 adrenocortical carcinoma up-regulated hsa-miR-185 hepatocellular carcinoma (HCC) down-regulated hsa-miR-18a* colorectal cancer down-regulated hsa-miR-18a* squamous carcinoma down-regulated hsa-miR-194 hepatocellular carcinoma (HCC) down-regulated hsa-miR-195 hepatocellular carcinoma (HCC) down-regulated hsa-miR-195 bladder cancer down-regulated hsa-miR-195 hepatocellular carcinoma (HCC) down-regulated hsa-miR-195* Malignant mesothelioma (MM) up-regulated hsa-miR-373 testicular germ cell tumor up-regulated hsa-miR-373* Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-373* ovarian cancer (OC) up-regulated hsa-miR-373* prostate cancer up-regulated hsa-miR-374 acute myeloid leukemia (AML) up-regulated hsa-miR-374 epithelial ovarian cancer (EOC) down-regulated hsa-miR-374 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-374 hepatocellular carcinoma (HCC) up-regulated hsa-miR-374 malignant melanoma up-regulated hsa-miR-374 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-375 pancreatic cancer down-regulated hsa-miR-375 pancreatic ductal adenocarcinoma (PDAC) down-regulated hsa-miR-376a epithelial ovarian cancer (EOC) down-regulated hsa-miR-376a Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-376a limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated lisa-miR-376a miyoshi myopathy (MM) up-regulated hsa-niiR-376a nemaline myopathy (NM) up-regulated hsa-miR-376a pancreatic cancer up-regulated hsa-miR-376b epithelial ovarian cancer (EOC) down-regulated hsa-miR-376b uterine leiomyoma (ULM) up-regulated hsa-miR-377 epithelial ovarian cancer (EOC) down-regulated hsa-miR-377 uterine leiomyoma (ULM) up-regulated hsa-miR-378 cardiac hypertrophy down-regulated hsa-miR-154 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-154 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated lisa-miR-154 malignant melanoma down-regulated hsa-miR-154 miyoshi myopathy (MM) up-regulated hsa-miR-154 nemaline myopathy (NM) up-regulated hsa-miR-154 polymyositis (PM) up-regulated hsa-miR-154* glioblastoma multiforme (GBM) down-regulated hsa-miR-155 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-155 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-155 lung cancer up-regulated hsa-miR-155 acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-155 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-155 myeloproliferative disorder up-regulated hsa-miR-222 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-222 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-222 glioblastoma up-regulated hsa-miR-222 hepatocellular carcinoma (HCC) up-regulated hsa-miR-222 hepatocellular carcinoma (HCC) up-regulated hsa-miR-1 coronary artery disease up-regulated hsa-miR-1 hepatocellular carcinoma (HCC) down-regulated hsa-miR-1 Cerebellar neurodegeneration down-regulated hsa-miR-1 retinitis pigmentosa (RP) down-regulated hsa-miR-192 -2 pituitary adenoma down-regulated hsa-miR-192-3 pituitary adenoma up-regulated hsa-miR-193a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-193b autism spectrum disorder (ASD) down-regulated hsa-miR-193b Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-193b uveal melanoma up-regulated hsa-miR-194 hepatocellular carcinoma (HCC) down-regulated hsa-miR-194 cardiac hypertrophy down-regulated hsa-miR-194 chronic pancreatitis up-regulated hsa-miR-195 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-195 cardiac hypertrophy up-regulated hsa-miR-195 acute myeloid leukemia (AML) up-regulated hsa-miR-195 cardiac hypertrophy up-regulated hsa-miR-195 chronic pancreatitis up-regulated hsa-miR-195 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-195 heart failure up-regulated hsa-miR-195 hepatocellular carcinoma (HCC) down-regulated hsa-miR-195 hepatocellular carcinoma (HCC) down-regulated hsa-miR-195 ovarian cancer (OC) down-regulated hsa-miR-195 prostate cancer up-regulated hsa-miR-195 schizophrenia down-regulated hsa-miR-196a breast cancer up-regulated hsa-miR-196a-2 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-20a pulmonary hypertension up-regulated hsa-miR-210 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-218 prostate cancer up-regulated hsa-miR-200a meningioma down-regulated hsa-miR-200c kidney cancer down-regulated lisa-miR-200c breast cancer down-regulated hsa-miR-203 pancreatic cancer up-regulated hsa-miR-204 lung cancer down-regulated hsa-miR-205 prostate cancer down-regulated hsa-miR-29c kidney cancer up-regulated hsa-miR-29c chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-29c neuroblastoma (NB) down-regulated hsa-miR-30a-3p lung cancer down-regulated hsa-miR-30e-3p lung cancer down-regulated hsa-miR-30e-5p lung cancer down-regulated lisa-miR-31 prostate cancer down-regulated hsa-miR-324-3p lung cancer down-regulated hsa-miR-324-5p lung cancer up-regulated hsa-miR-330 prostate cance down-regulated hsa-miR-335 lung cancer down-regulated hsa-miR-338 lung cancer down-regulated hsa-miR-339 lung cancer up-regulated hsa-miR-340 kidnev cancer up-regulated hsa-miR-342-3p kidnev cancer up-regulated hsa-miR-342-3p prion disease up-regulated hsa-miR-345 lung cancer up-regulated hsa-miR-34a Alzheimer's disease down-regulated hsa-miR-221 coronary artery disease up-regulated hsa-miR-221 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-222 tongue squamous cell carcinoma down-regulated hsa-miR-222 coronary artery disease up-regulated hsa-miR-222 hepatocellular carcinoma (HCC) up-regulated hsa-miR-222 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-224 hepatocellular carcinoma (HCC) up-regulated hsa-miR-23b hepatocellular carcinoma (HCC) down-regulated hsa-miR-24 hepatocellular carcinoma (HCC) up-regulated hsa-miR-25 hepatocellular carcinoma (HCC) hepatocellular carcinom hsa-miR-25 hepatocellular carcinoma (HCC) up-regulated hsa-miR-26a hepatocellular carcinoma (HCC) down-regulated hsa-miR-26a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-26a bladder cancer down-regulated hsa-miR-26a glioma up-regulated hsa-miR-27a hepatocellular carcinoma (HCC) down-regulated hsa-miR-29a Oral Squamous Cell Carcinoma (OSCC) down-regulated lisa-miR-29c bladder cancer down-regulated hsa-miR-30-3p bladder cancer down-regulated hsa-miR-30b* Malignant mesothelioma (MM) up-regulated hsa-miR-30c bladder cancer down-regulated hsa-miR-30e-5p bladder cancer down-regulated hsa-miR-31 breast cancer down-regulated hsa-miR-32* Malignant mesothelioma (MM) up-regulated hsa-miR-320 cardiomyopathy down-regulated hsa-miR-320 renal clear cell carcinoma down-regulated hsa-miR-338 hepatocellular carcinoma (HCC) down-regulated hsa-miR-338 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-340* Malignant mesothelioma (MM) down-regulated hsa-miR-345 Malignant mesothelioma (MM) up-regulated hsa-miR-34a retinoblastoma down-regulated hsa-miR-34a* Malignant mesothelioma (MM) down-regulated hsa-miR-34b retinoblastoma down-regulated hsa-miR-373 esophageal cancer up-regulated hsa-miR-423 Malignant mesothelioma (MM) down-regulated hsa-miR-429 ovarian cancer (OC) down-regulated hsa-miR-483-3p Malignant mesothelioma (MM) up-regulated hsa-miR-485-3p anxietv disorder normal lisa-miR-494 renal clear cell carcinoma down-regulated hsa-miR-582 Malignant mesothelioma (MM) down-regulated hsa-miR-584 Malignant mesothelioma (MM) up-regulated hsa-miR-595 Malignant mesothelioma (MM) up-regulated hsa-miR-503 adrenocortical carcinoma up-regulated hsa-miR-509 anxiety disorder normal hsa-miR-511 adrenocortical carcinoma down-regulated hsa-miR-512-5p gastric cancer (stomach cancer) down-regulated lisa-miR-615-3p Malignant mesothelioma (MM) up-regulated hsa-miR-7-1* Malignant mesothelioma (MM) down-regulated hsa-miR-765 anxiety disorder normal hsa-miR-885-3p Malignant mesothelioma (MM) up-regulated hsa-miR-9 Malignant mesothelioma (MM) down-regulated hsa-miR-9-1 colorectal cancer down-regulated hsa-miR-92a acute myeloid leukemia (AML) down-regulated hsa-miR-93 hepatocellular carcinoma (HCC) up-regulated hsa-miR-9-3 breast cancer down-regulated hsa-miR-143 lung cancer down-regulated lisa-miR-143 colorectal cancer down-regulated hsa-miR-145 prostate cancer down-regulated hsa-miR-149 prostate cancer down-regulated hsa-miR-150 kidney cancer down-regulated hsa-miR-151-5p kidney cancer up-regulated hsa-miR-155 pancreatic cancer up-regulated hsa-miR-15a kidney cancer up-regulated

- I l l - hsa-miR-153 glioblastoma down-regulated hsa-miR-155 hepatocellular carcinoma (HCC) up-regulated hsa-miR-15a non-small cell lung cancer (NSCLC) down-regulated lisa-miR-15a schizophrenia up-regulated hsa-iriiR-15b schizophrenia up-regulated lisa-miR-16 non-small cell lung cancer (NSCLC) down-regulated hsa-miR-16 lung cancer down-regulated hsa-miR-16 prostate cancer down-regulated hsa-miR-17 kidney cancer up-regulated hsa-miR-185 non-small cell lung cancer (NSCLC) down-regulated hsa-miR-18a breast cancer up-regulated hsa-miR-18b multiple sclerosis up-regulated hsa-miR-191 kidnev cancer down-regulated lisa-miR-193b breast cancer down-regulated hsa-miR-195 schizophrenia up-regulated hsa-miR-195 breast cancer up-regulated hsa-miR-195 lung cancer down-regulated hsa-miR-196a-2 breast cancer up-regulated hsa-miR-197 lung cancer up-regulated hsa-miR-199a kidney cancer down-regulated hsa-miR-19b kidnev cancer up-regulated hsa-miR-200b kidnev cancer down-regulated lisa-miR-9 ovarian cancer (OC) down-regulated hsa-miR-9 hepatocellular carcinoma (HCC) up-regulated hsa-miR-9 lung cancer up-regulated hsa-miR-9* lung cancer up-regulated hsa-miR-93 lung cancer up-regulated hsa-miR-96 breast cancer up-regulated hsa-miR-96 multiple sclerosis up-regulated hsa-miR-96 prostate cancer up-regulated hsa-miR-98 lung cancer up-regulated hsa-miR-182* lung cancer up-regulated hsa-let-7c lung cancer down-regulated lisa-iriiR-1 heart failure down-regulated hsa-miR-1 rhabdomyosarcoma down-regulated hsa-miR-1 rhabdomyosarcoma down-regulated hsa-miR-101 lung cancer down-regulated hsa-miR-101 kidney cancer up-regulated hsa-miR-106a kidney cancer up-regulated hsa-miR-106b kidney cancer up-regulated hsa-miR-17-5p lung cancer up-regulated hsa-miR-181a chronic lymphocytic leukemia (CLL) down-regulated lisa-miR-181a chronic lymphocytic leukemia (CLL) down-regulated lisa-miR-181b prostate cancer down-regulated hsa-miR-182 breast cancer up-regulated hsa-miR-182 kidney cancer down-regulated hsa-miR-18 la-1 hepatocellular carcinoma (HCC) up-regulated hsa-miR-18 la-2 hepatocellular carcinoma (HCC) up-regulated hsa-miR-18 lb chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-181b-l hepatocellular carcinoma (HCC) up-regulated hsa-miR-181b-2 hepatocellular carcinoma (HCC) up-regulated hsa-miR-181c hepatocellular carcinoma (HCC) up-regulated hsa-miR-27a breast cancer up-regulated hsa-miR-27a hepatocellular carcinoma (HCC) up-regulated lisa-miR-133a myeloproliferative disorder down-regulated hsa-miR-133b bladder cancer down-regulated hsa-miR-137 colorectal cancer down-regulated hsa-miR-138 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-143 T-cell leukemia down-regulated hsa-miR-143 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-143 gastric cancer (stomach cancer) down-regulated hsa-miR-143 hepatocellular carcinoma (HCC) down-regulated hsa-miR-143 hepatocellular carcinoma (HCC) up-regulated hsa-miR-144* Malignant mesothelioma (MM) down-regulated hsa-miR-145 colorectal cancer down-regulated hsa-miR-145 vascular disease down-regulated hsa-miR-145 bladder cancer down-regulated hsa-miR-145 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-145 gastric cancer (stomach cancer) down-regulated hsa-miR-145 renal clear cell carcinoma down-regulated hsa-miR-145 hepatocellular carcinoma (HCC) down-regulated hsa-miR-145 bladder cancer down-regulated hsa-miR-200b hepatocellular carcinoma (HCC) down-regulated hsa-miR-200b malignant melanoma down-regulated hsa-miR-200b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-200c colorectal cancer up-regulated hsa-miR-200c breast cancer down-regulated hsa-miR-200c cancer down-regulated hsa-miR-200c cancer down-regulated hsa-miR-200c colorectal cancer down-regulated hsa-miR-200c epithelial ovarian cancer (EOC) up-regulated hsa-miR-200c malignant melanoma up-regulated lisa-miR-200c Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-200c testicular germ cell tumor up-regulated hsa-miR-202 breast cancer up-regulated hsa-miR-202 prostate cancer up-regulated hsa-miR-203 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-203 chronic myeloid leukemia (CML) down-regulated hsa-miR-203 psoriasis up-regulated lisa-miR-203 skin disease up-regulated hsa-miR-203 bladder cancer up-regulated hsa-miR-203 breast cancer up-regulated hsa-miR-203 colorectal cancer up-regulated hsa-miR-203 esophageal cancer down-regulated hsa-miR-203 lung cancer up-regulated hsa-miR-203 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-26a acute myeloid leukemia (AML) down-regulated hsa-miR-26a cardiac hypertrophy down-regulated hsa-miR-26a colorectal cancer up-regulated hsa-miR-26a Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-26a epithelial ovarian cancer (EOC) up-regulated hsa-miR-26a pituitary adenoma up-regulated lisa-miR-26a primary biliary cirrhosis (PBC) down-regulated hsa-miR-26a prostate cancer down-regulated hsa-miR-26a prostate cancer up-regulated hsa-miR-26a serous ovarian cancer down-regulated hsa-miR-26a-l hepatocellular carcinoma (HCC) down-regulated hsa-miR-26a-l lung cancer down-regulated hsa-miR-26a-l papillary thyroid carcinoma (PTC) up-regulated hsa-miR-26a-2 hepatocellular carcinoma (HCC) down-regulated hsa-miR-26b Alzheimer's disease down-regulated hsa-miR-26b bladder cancer up-regulated lisa-miR-26b cardiac hypertrophy down-regulated hsa-miR-26b epithelial ovarian cancer (EOC) up-regulated hsa-miR-26b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-26b pituitary adenoma up-regulated hsa-miR-26b prostate cancer down-regulated hsa-miR-26b schizophrenia down-regulated hsa-miR-27a acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-27a acute myeloid leukemia (AML) up-regulated hsa-miR-32 pancreatic cancer up-regulated hsa-miR-32 prostate cancer up-regulated lisa-miR-32 uterine leiomyoma (ULM) down-regulated hsa-miR-320 homozygous sickle cell disease (HbSS) down-regulated hsa-miR-320 Alzheimer's disease up-regulated hsa-miR-320 colorectal cancer up-regulated hsa-miR-320 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-320 follicular lymphoma (FL) down-regulated hsa-miR-320 prostate cancer up-regulated hsa-miR-320-2 hepatocellular carcinoma (HCC) up-regulated hsa-miR-320a autism spectrum disorder (ASD) down-regulated hsa-miR-323 glioblastoma multiforme (GBM) down-regulated lisa-miR-323 malignant melanoma down-regulated hsa-miR-323 uterine leiomyoma (ULM) up-regulated hsa-miR-324-3p primary biliary cirrhosis (PBC) down-regulated hsa-miR-324-5p acute myeloid leukemia (AML) up-regulated hsa-miR-324-5p hepatocellular carcinoma (HCC) up-regulated hsa-miR-324-5p malignant melanoma up-regulated hsa-miR-325 acute myeloid leukemia (AML) down-regulated hsa-miR-326 acute myeloid leukemia (AML) up-regulated hsa-miR-326 primary biliary cirrhosis (PBC) down-regulated lisa-miR-326 psoriasis down-regulated lisa-miR-325 malignant melanoma down-regulated hsa-miR-125b neuroblastoma (NB) down-regulated hsa-miR-125b non-small cell lung cancer ( SCLC) up-regulated hsa-miR-125b prostate cancer down-regulated hsa-miR-125b prostate cancer up-regulated hsa-miR-125b psoriasis down-regulated hsa-miR-125b serous ovarian cancer down-regulated hsa-miR-125b uterine leiomyoma (ULM) up-regulated lisa-miR-125b vascular disease down-regulated hsa-miR-125b-l chronic pancreatitis up-regulated hsa-miR-125b-l epithelial ovarian cancer (EOC) down-regulated hsa-miR-125b-l glioblastoma down-regulated hsa-miR-125b-l hepatocellular carcinoma (HCC) down-regulated hsa-miR-125b-l pancreatic cancer up-regulated hsa-miR-125b-l pancreatic cancer up-regulated hsa-miR-125b-2 chronic pancreatitis up-regulated hsa-miR-125b-2 Down syndrome (DS) up-regulated hsa-miR-125b-2 glioblastoma down-regulated hsa-miR-125b-2 hepatocellular carcinoma (HCC) down-regulated hsa-miR-125b-2 lung cancer down-regulated hsa-miR-126 hepatocellular carcinoma (HCC) down-regulated hsa-miR-126 acute promyelocytic leukemia (APL) down-regulated hsa-miR-126 breast cancer down-regulated hsa-miR-126 non-small cell lung cancer (NSCLC) down-regulated hsa-miR-126 chronic pancreatitis up-regulated hsa-miR-146a papillary thyroid carcinoma (PTC) down-regulated hsa-miR-146a hepatocellular carcinoma (HCC) down-regulated hsa-miR-146a pancreatic ductal adenocarcinoma (PDAC) up-regulated lisa-miR-146a vascular disease up-regulated hsa-miR-1228* Malignant mesothelioma (MM) up-regulated hsa-miR-122a hepatocellular carcinoma (HCC) down-regulated hsa-miR-124a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-124a hepatocellular carcinoma (HCC) down-regulated hsa-miR-124a acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-125a breast cancer down-regulated hsa-miR-125a hepatocellular carcinoma (HCC) down-regulated hsa-miR-125b bladder cancer down-regulated hsa-miR-125b Oral Squamous Cell Carcinoma (OSCC) down-regulated lisa-miR-125b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-125b hepatocellular carcinoma (HCC) down-regulated hsa-miR-125b prostate cancer up-regulated hsa-miR-126 hepatocellular carcinoma (HCC) down-regulated hsa-miR-126* hepatocellular carcinoma (HCC) down-regulated hsa-miR-128b hepatocellular carcinoma (HCC) up-regulated hsa-miR-129 bladder cancer down-regulated hsa-miR-129 hepatocellular carcinoma (HCC) down-regulated hsa-miR-379 dermatomyositis (DM) up-regulated hsa-miR-379 Duchenne muscular dystrophy (DMD) up-regulated lisa-miR-379 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-379 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-379 miyoshi myopathy (MM) up-regulated hsa-miR-379 nemaline myopathy (NM) up-regulated hsa-miR-379 polymyositis (PM) up-regulated hsa-miR-17-3p malignant melanoma down-regulated hsa-miR-17-5p colorectal cancer down-regulated hsa-miR-17-5p anaplastic thyroid carcinoma (ATC) up-regulated hsa-miR-17-5p breast cancer down-regulated lisa-miR-17-5p chronic myeloid leukemia (CML) down-regulated hsa-miR-17-5p lung cancer up-regulated lisa-miR-17-5p MYC-rearranged lymphoma up-regulated hsa-miR-17-5p bladder cancer up-regulated hsa-miR-17-5p breast cancer up-regulated hsa-miR-17-5p colorectal cancer up-regulated hsa-miR-17-5p diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-17-5p hepatocellular carcinoma (HCC) up-regulated hsa-miR-17-5p lung cancer up-regulated hsa-miR-17-5p malignant lymphoma up-regulated hsa-miR-17-5p neuroblastoma (NB) up-regulated hsa-miR-17-5p pancreatic cancer up-regulated hsa-miR-17-5p primary biliary cirrhosis (PBC) down-regulated hsa-miR-17-5p prostate cancer up-regulated hsa-miR-100 epithelial ovarian cancer (EOC) down-regulated hsa-miR-100 epithelial ovarian cancer (EOC) down-regulated hsa-miR-100 malignant melanoma down-regulated hsa-miR-100 non-small cell lung cancer (NSCLC) up-regulated hsa-miR-100 ovarian cancer (OC) down-regulated hsa-miR-100 ovarian cancer (OC) up-regulated hsa-miR-100 pancreatic cancer up-regulated hsa-miR-100 prostate cancer up-regulated hsa-miR-100 prostate cancer down-regulated hsa-miR-100 prostate cancer up-regulated hsa-miR-100 psoriasis down-regulated hsa-miR-100 serous ovarian cancer down-regulated hsa-miR-100-1 chronic pancreatitis up-regulated hsa-miR-100-1 pancreatic cancer up-regulated lisa-miR-100-1 pituitary' adenoma down-regulated hsa-miR-100-2 chronic pancreatitis up-regulated hsa-miR-100-2 pancreatic cancer up-regulated hsa-miR-100-2 pituitary adenoma down-regulated hsa-miR-101 Alzheimer's disease down-regulated hsa-miR-101 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-101 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-101 epithelial ovarian cancer (EOC) down-regulated hsa-miR-101 head and neck squamous cell carcinoma (HNSCC) down-regulated lisa-miR-101-1 breast cancer down-regulated hsa-miR-20a hepatocellular carcinoma (HCC) up-regulated lisa-miR-146a Alzheimer's disease up-regulated hsa-miR-148b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-196a-2 congenital heart disease up-regulated hsa-miR-199a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-203 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-203 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-207 hepatocellular carcinoma (HCC) up-regulated hsa-miR-21 breast cancer up-regulated hsa-miR-21 colorectal cancer up-regulated hsa-miR-21 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-21 pancreatic cancer up-regulated hsa-miR-21 lung cancer up-regulated hsa-miR-21 tongue squamous cell carcinoma up-regulated hsa-miR-210 lung cancer up-regulated hsa-miR-214 adrenocortical carcinoma down-regulated hsa-miR-22 breast cancer up-regulated hsa-miR-221 glioma up-regulated hsa-miR-221 hepatocellular carcinoma (HCC) up-regulated hsa-miR-222 glioma up-regulated hsa-miR-186 hepatocellular carcinoma (HCC) up-regulated hsa-miR-189 malignant melanoma down-regulated lisa-miR-1 myeloproliferative disorder down-regulated hsa-miR-107 pancreatic cancer up-regulated hsa-miR-107 hepatocellular carcinoma (HCC) up-regulated hsa-miR-126* lung cancer down-regulated hsa-miR-127 Burkitt lymphoma up-regulated hsa-miR-128 anxiety disorder normal hsa-miR-129-2 colorectal cancer down-regulated hsa-miR-130a hepatocellular carcinoma (HCC) up-regulated hsa-miR-199a* bladder cancer down-regulated hsa-miR-200a hepatocellular carcinoma (HCC) down-regulated lisa-miR-200a ovarian cancer (OC) down-regulated lisa-miR-200b ovarian cancer (OC) down-regulated hsa-miR-200b Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-200c breast cancer up-regulated hsa-miR-200c endometrial cancer up-regulated hsa-miR-200c ovarian cancer (OC) up-regulated hsa-miR-203 Malignant mesothelioma (MM) down-regulated hsa-miR-205 hepatocellular carcinoma (HCC) up-regulated hsa-miR-146b dermatomyositis (DM) up-regulated hsa-miR-146b Duchenne muscular dystrophy (DMD) up-regulated lisa-miR-146b facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-146b Inclusion body myositis (IBM) up-regulated hsa-miR-146b limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-146b miyoshi myopathy (MM) up-regulated hsa-miR-146b nemaline myopathy (NM) up-regulated hsa-miR-146b ovarian cancer (OC) up-regulated hsa-miR-146b papillary thyroid carcinoma (PTC) up-regulated hsa-miR-146b polymyositis (PM) up-regulated hsa-miR-146b psoriasis up-regulated hsa-miR-147 acute myeloid leukemia (AML) down-regulated hsa-miR-147 epithelial ovarian cancer (EOC) down-regulated hsa-miR-148a hepatocellular carcinoma (HCC) down-regulated hsa-miR-148a asthma normal hsa-miR-148a breast cancer down-regulated hsa-miR-148a breast cancer down-regulated hsa-miR-148a dermatomyositis (DM) up-regulated hsa-miR-148a Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-148a head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-148a limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-148a miyoshi myopathy (MM) up-regulated hsa-miR-148a nemaline myopathy (NM) up-regulated hsa-miR-148a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-148a pancreatic cancer down-regulated hsa-miR-1 cardiomyopathy down-regulated hsa-miR-192 nasopharyngeal carcinoma (NPC) up-regulated lisa-miR-192-1 hepatocellular carcinoma (HCC) down-regulated hsa-miR-221 gastric cancer (stomach cancer) up-regulated hsa-miR-222 gastric cancer (stomach cancer) up-regulated hsa-miR-25 gastric cancer (stomach cancer) up-regulated hsa-miR-26a primary biliary cirrhosis (PBC) down-regulated hsa-miR-299-5p primary biliary cirrhosis (PBC) up-regulated hsa-miR-31 colorectal cancer up-regulated hsa-miR-328 breast cancer up-regulated hsa-miR-346 schizophrenia down-regulated hsa-miR-34a hepatocellular carcinoma (HCC) down-regulated lisa-miR-34a malignant melanoma down-regulated hsa-miR-34b acute myeloid leukemia (AML) down-regulated hsa-miR-375 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-449a prostate cancer down-regulated hsa-miR-451 gastric cancer (stomach cancer) down-regulated hsa-miR-451 colorectal cancer down-regulated hsa-miR-7 lung cancer down-regulated hsa-miR-7 breast cancer down-regulated hsa-miR-7 glioblastoma down-regulated lisa-miR-92 colorectal cancer up-regulated lisa-miR-96 hearing loss normal hsa-miR-101-1 lung cancer down-regulated hsa-miR-lOla Cerebellar neurodegeneration down-regulated hsa-miR-lOlb-2 hepatocellular carcinoma (HCC) up-regulated hsa-miR-102 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-103 esophageal cancer up-regulated hsa-miR-103 acute myeloid leukemia (AML) down-regulated hsa-miR-103 cardiac hypertrophy up-regulated hsa-miR-103 Cerebellar neurodegeneration down-regulated hsa-miR-103 epithelial ovarian cancer (EOC) up-regulated hsa-miR-103 pancreatic cancer up-regulated hsa-miR-103 pituitary adenoma up-regulated hsa-miR-103 prostate cancer down-regulated hsa-miR-103-1 bladder cancer up-regulated hsa-miR-103-2 hepatocellular carcinoma (HCC) up-regulated hsa-miR-103-2 pancreatic cancer up-regulated hsa-miR-103-2 pituitary adenoma up-regulated hsa-miR-104 malignant melanoma down-regulated hsa-miR-105 epithelial ovarian cancer (EOC) down-regulated lisa-miR-105 malignant melanoma down-regulated hsa-miR-106a colorectal cancer down-regulated hsa-miR-106a lung cancer up-regulated hsa-miR-106a T-cell leukemia up-regulated lisa-miR-106a autism spectrum disorder (ASD) down-regulated lisa-miR-106a colorectal cancer up-regulated hsa-miR-424 acute myeloid leukemia (AML) up-regulated hsa-miR-424 cardiac hypertrophy up-regulated hsa-miR-424 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-424 ovarian cancer (OC) down-regulated hsa-miR-424 pancreatic cancer up-regulated hsa-miR-429 breast cancer down-regulated hsa-miR-429 cancer down-regulated hsa-miR-431 autism spectrum disorder (ASD) up-regulated hsa-miR-432 epithelial ovarian cancer (EOC) down-regulated hsa-miR-432 autism spectrum disorder (ASD) down-regulated hsa-miR-432 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-432 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-432 miyoshi myopathy (MM) up-regulated hsa-miR-432 nemaline myopathy (NM) up-regulated hsa-miR-432* primary biliary cirrhosis (PBC) down-regulated hsa-miR-451 breast cancer down-regulated hsa-miR-451 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-451 acute myeloid leukemia (AML) up-regulated hsa-miR-451 cardiac hypertrophy down-regulated hsa-miR-451 homozy gous sickle cell disease (HbSS) up-regulated hsa-miR-451 primary biliary cirrhosis (PBC) up-regulated hsa-miR-451 uterine leiomyoma (ULM) down-regulated hsa-miR-452 dennatomyositis (DM) up-regulated hsa-miR-122a malignant melanoma down-regulated hsa-miR-122a psoriasis down-regulated hsa-miR-123 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-123 glioblastoma up-regulated hsa-miR-123 hepatocellular carcinoma (HCC) down-regulated lisa-miR-124a breast cancer down-regulated lisa-miR-124a cancer down-regulated hsa-miR-124a chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-124a colorectal cancer down-regulated hsa-miR-124a glioblastoma multiforme (GBM) down-regulated hsa-miR-124a lung cancer down-regulated hsa-miR-124a medulloblastoma down-regulated hsa-miR-126 hepatocellular carcinoma (HCC) down-regulated hsa-miR-126 lung cancer down-regulated hsa-miR-126 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-126 prostate cancer up-regulated hsa-miR-126* prostate cancer down-regulated hsa-miR-126* hepatocellular carcinoma (HCC) down-regulated hsa-miR-126* lung cancer down-regulated hsa-miR-126-5p cardiac hypertrophy down-regulated hsa-miR-127 cancer down-regulated hsa-miR-127 cardiac hypertrophy up-regulated hsa-miR-127 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-9 epithelial ovarian cancer (EOC) down-regulated hsa-miR-9 follicular lymphoma (FL) up-regulated hsa-miR-9 hepatocellular carcinoma (HCC) up-regulated hsa-miR-9 lung cancer down-regulated hsa-miR-9 malignant melanoma down-regulated hsa-miR-9 neuroblastoma (NB) down-regulated hsa-miR-9 non-small cell lung cancer (NSCLC) down-regulated hsa-miR-9* acute myeloid leukemia (AML) down-regulated hsa-miR-9* hepatocellular carcinoma (HCC) up-regulated hsa-miR-9* Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-9-1 breast cancer down-regulated hsa-miR-9-1 breast cancer down-regulated hsa-miR-9-1 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-92 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-92 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-92 nemaline myopathy (NM) up-regulated hsa-miR-92 neuroblastoma (NB) up-regulated hsa-miR-92 primary biliary cirrhosis (PBC) down-regulated hsa-miR-92 prostate cancer down-regulated hsa-miR-92 schizophrenia down-regulated hsa-miR-9-2 hepatocellular carcinoma (HCC) down-regulated hsa-miR-9-2 glioblastoma up-regulated hsa-miR-9-2 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-92- 1 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-141 malignant melanoma down-regulated hsa-miR-141 pancreatic ductal adenocarcinoma (PDAC) down-regulated hsa-miR-126 epithelial ovarian cancer (EOC) down-regulated hsa-miR-16 hepatocellular carcinoma (HCC) up-regulated hsa-miR-17-5p colorectal cancer up-regulated hsa-miR-1 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-93 gastric cancer (stomach cancer) up-regulated hsa-miR-17 medulloblastoma up-regulated hsa-miR-18a medulloblastoma up-regulated hsa-miR-19b medulloblastoma up-regulated hsa-miR-20a medulloblastoma up-regulated hsa-miR-92a medulloblastoma up-regulated hsa-let-7a hepatocellular carcinoma (HCC) down-regulated hsa-let-7b* Malignant mesothelioma (MM) up-regulated hsa-let-7c prostate cancer up-regulated hsa-let-7e* Malignant mesothelioma (MM) down-regulated hsa-let-7g renal clear cell carcinoma up-regulated hsa-miR-100 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-100 prostate cancer up-regulated hsa-miR-106b hepatocellular carcinoma (HCC) up-regulated hsa-miR-140 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-140 cardiac hypertrophy up-regulated hsa-miR-140 epithelial ovarian cancer (EOC) down-regulated hsa-miR-140 epithelial ovarian cancer (EOC) down-regulated hsa-miR-140 homozygous sickle cell disease (HbSS) up-regulated hsa-miR-140 lung cancer down-regulated hsa-miR-140 malignant melanoma down-regulated hsa-miR-140 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-140 testicular germ cell tumor up-regulated hsa-miR-140* cardiac hypertrophy up-regulated hsa-miR-141 serous ovarian cancer up-regulated hsa-miR-141 breast cancer down-regulated hsa-miR-141 cancer down-regulated hsa-miR-141 cancer down-regulated hsa-miR-141 cholangiocarcinoma up-regulated hsa-miR-141 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-141 epithelial ovarian cancer (EOC) up-regulated hsa-miR-141 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-141 hepatocellular carcinoma (HCC) down-regulated hsa-miR-141 homozygous sickle cell disease (HbSS) down-regulated hsa-miR-141 prostate cancer down-regulated hsa-miR-141 psoriasis up-regulated hsa-miR-142-3p hepatocellular carcinoma (HCC) down-regulated hsa-miR-142-3p ovarian cancer (OC) up-regulated hsa-miR-124a-3 lung cancer down-regulated hsa-miR-223 endometriosis up-regulated hsa-miR-23b neuroblastoma (NB) up-regulated hsa-miR-27a gastric cancer (stomach cancer) up-regulated hsa-miR-298 Alzheimer's disease down-regulated hsa-miR-29b acute myeloid leukemia (AML) down-regulated hsa-miR-29c chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-29c head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-29c endometriosis up-regulated hsa-miR-31 bladder cancer down-regulated hsa-miR-320 cholangiocarcinoma down-regulated hsa-miR-320 acute myeloid leukemia (AML) down-regulated lisa-miR-328 Alzheimer's disease down-regulated hsa-miR-34a melanoma down-regulated hsa-miR-34c endometriosis down-regulated hsa-miR-363* Waldenstrom Macroglobulinemia (WM) up-regulated hsa-miR-365 endometriosis up-regulated hsa-miR-377 diabetic nephropathy up-regulated hsa-miR-424 endometriosis down-regulated hsa-miR-494 Waldenstrom Macroglobulinemia (WM) up-regulated hsa-miR-494 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-542-3p Waldenstrom Macroglobulinemia (WM) up-regulated lisa-miR-9 medulloblastoma down-regulated hsa-miR-145 lung cancer down-regulated hsa-miR-196a colorectal cancer up-regulated hsa-miR-155 pancreatic cancer up-regulated hsa-miR-155 acute myeloid leukemia (AML) up-regulated hsa-miR-155 breast cancer up-regulated hsa-miR-155 breast cancer up-regulated hsa-miR-155 Burkitt lymphoma up-regulated hsa-miR-155 Burkitt lymphoma down-regulated hsa-miR-155 Burkitt lymphoma down-regulated hsa-miR-155 cardiac hypertrophy down-regulated hsa-miR-155 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-155 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-155 colorectal cancer up-regulated hsa-miR-155 dermatomyositis (DM) up-regulated hsa-miR-155 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-155 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-155 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-155 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-155 Down syndrome (DS) up-regulated hsa-miR-155 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-155 epithelial ovarian cancer (EOC) down-regulated hsa-miR-155 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-155 follicular lymphoma (FL) up-regulated hsa-miR-155 hepatocellular carcinoma (HCC) down-regulated hsa-miR-155 Hodgkin's lymphoma up-regulated hsa-miR-155 glioblastoma multiforme (GBM) up-regulated hsa-miR-155 hepatocellular carcinoma (HCC) up-regulated hsa-miR-27a acute myeloid leukemia (AML) up-regulated hsa-miR-328 acute myeloid leukemia (AML) up-regulated hsa-miR-17-5p psoriasis up-regulated hsa-miR-181a-l prostate cancer up-regulated hsa-miR-92 medulloblastoma up-regulated hsa-miR-99a endometriosis up-regulated hsa-miR-99b endometriosis up-regulated hsa-miR-328 primary biliary cirrhosis (PBC) up-regulated hsa-miR-532-5p malignant melanoma up-regulated hsa-let-7d head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-101 bladder cancer down-regulated lisa-miR-101 prostate cancer down-regulated lisa-miR-106b Alzheimer's disease down-regulated hsa-miR-106b gastric cancer (stomach cancer) up-regulated hsa-miR-122a primary biliary cirrhosis (PBC) down-regulated hsa-miR-127 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-133a head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-141 gastric cancer (stomach cancer) down-regulated hsa-miR-143 colorectal cancer down-regulated hsa-miR-145 colorectal cancer down-regulated hsa-miR-146b glioma down-regulated lisa-miR-28 malignant melanoma down-regulated hsa-miR-296 colorectal cancer up-regulated hsa-miR-221 melanoma up-regulated hsa-miR-222 bladder cancer up-regulated hsa-miR-452 bladder cancer up-regulated hsa-miR-452* bladder cancer up-regulated hsa-miR-7 bladder cancer up-regulated hsa-miR-9 Huntington's disease (HD) down-regulated hsa-miR-9* Waldenstrom Macroglobulinemia (WM) down-regulated hsa-miR-183 colorectal cancer up-regulated hsa-miR-18a colorectal cancer up-regulated hsa-miR-196a esophageal cancer up-regulated hsa-miR-199b-5p medulloblastoma down-regulated hsa-miR-205 breast cancer down-regulated hsa-miR-205 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-20a colorectal cancer up-regulated hsa-miR-21 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-21 prostate cancer up-regulated hsa-miR-21 esophageal cancer up-regulated hsa-miR-221 prostate cancer up-regulated hsa-miR-221 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-27a autism spectrum disorder (ASD) up-regulated hsa-miR-27a cardiac hypertrophy up-regulated hsa-miR-27a cardiac hypertrophy up-regulated hsa-miR-27a colorectal cancer down-regulated hsa-miR-27a malignant melanoma down-regulated hsa-miR-27a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-27a prostate cancer down-regulated hsa-miR-27a prostate cancer up-regulated hsa-miR-27a serous ovarian cancer up-regulated hsa-miR-27a uterine leiomyoma (ULM) up-regulated hsa-niiR-27b acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-27b acute myeloid leukemia (AML) up-regulated hsa-miR-27b cardiac hypertrophy up-regulated hsa-miR-27b cardiac hypertrophy up-regulated hsa-miR-27b colorectal cancer down-regulated hsa-miR-27b lung cancer down-regulated hsa-miR-27b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-27b prostate cancer down-regulated hsa-miR-27b prostate cancer up-regulated hsa-miR-28 kidney cancer up-regulated hsa-miR-296 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-296 ovarian cancer (OC) up-regulated hsa-miR-296 primary biliary cirrhosis (PBC) down-regulated hsa-miR-296 prostate cancer up-regulated hsa-miR-328 colorectal cancer down-regulated hsa-miR-328 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-328 glioblastoma multiforme (GBM) down-regulated hsa-miR-328 primary biliary cirrhosis (PBC) down-regulated hsa-miR-328-1 hepatocellular carcinoma (HCC) up-regulated hsa-miR-33 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-33 lung cancer down-regulated hsa-miR-330 follicular lymphoma (FL) up-regulated hsa-miR-330 Huntington's disease (HD) up-regulated hsa-miR-330 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-331 acute myeloid leukemia (AML) up-regulated hsa-miR-331 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-331 epithelial ovarian cancer (EOC) down-regulated hsa-miR-331 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-331 malignant melanoma up-regulated hsa-miR-331 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-335 breast cancer down-regulated hsa-miR-335 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-335 acute myeloid leukemia (AML) up-regulated hsa-miR-335 dermatomyositis (DM) up-regulated hsa-miR-335 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-335 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-335 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-347 vascular disease down-regulated hsa-miR-21 glioblastoma up-regulated hsa-miR-21 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-1 endometriosis up-regulated hsa-miR-1 cardiac hypertrophy down-regulated hsa-let-7d Hepatocellular carcinoma (HCC) down-regulated hsa-let-7i ovarian cancer (OC) down-regulated hsa-miR-1 Hepatocellular carcinoma (HCC) down-regulated hsa-miR-100 endometriosis up-regulated hsa-miR-101 Hepatocellular carcinoma (HCC) down-regulated hsa-miR-101 Hepatocellular carcinoma (HCC) down-regulated hsa-miR-101 prostate cancer down-regulated hsa-miR-106a gastric cancer (stomach cancer) up-regulated hsa-miR-106b chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-lOa bladder cancer up-regulated hsa-miR-lOa chronic myeloid leukemia (CML) down-regulated hsa-miR-125a medulloblastoma down-regulated hsa-miR-125a endometriosis up-regulated hsa-miR-125b endometriosis up-regulated hsa-miR-126 breast cancer down-regulated hsa-miR-126 endometriosis up-regulated hsa-miR-141 kidney cancer down-regulated hsa-miR-127 bladder cancer down-regulated hsa-miR-127 breast cancer down-regulated hsa-miR-127 colorectal cancer down-regulated hsa-miR-127 prostate cancer down-regulated hsa-miR-125b bladder cancer up-regulated hsa-miR-133a Hepatocellular carcinoma (HCC) down-regulated hsa-miR-141 endometriosis down-regulated hsa-miR-142-3p head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-143 bladder cancer down-regulated hsa-miR-143 endometriosis up-regulated hsa-miR-143 colorectal cancer down-regulated hsa-miR-145 endometriosis up-regulated hsa-miR-146a* thyroid cancer normal hsa-miR-146b head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-15 chronic myeloid leukemia (CML) down-regulated hsa-miR-150 endometriosis up-regulated hsa-miR-155 Waldenstrom Macroglobulinemia (WM) up-regulated hsa-miR-155 head and neck squamous cell carcinoma (HNSCC) up-regulated lisa-miR-15b glioma down-regulated hsa-miR-18 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-184 Waldenstrom Macroglobulinemia (WM) up-regulated hsa-miR-192 colorectal cancer down-regulated hsa-miR-194 colorectal cancer down-regulated hsa-miR-17-92 Burkitt lymphoma up-regulated hsa-miR-17-92 colorectal cancer up-regulated hsa-miR-17-92 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-17-92 lymphoproliferative disease up-regulated hsa-miR-18 hepatocellular carcinoma (HCC) up-regulated hsa-miR-18 la acute myeloid leukemia (AML) up-regulated hsa-miR-18 la acute myeloid leukemia (AML) up-regulated hsa-miR-18 la Cerebellar neurodegeneration down-regulated hsa-miR-18 la chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-18 la colorectal cancer up-regulated hsa-miR-18 la glioblastoma down-regulated hsa-miR-18 la homozygous sickle cell disease (HbSS) down-regulated hsa-miR-18 la malignant melanoma up-regulated hsa-miR-18 la pancreatic cancer up-regulated hsa-miR-18 la pancreatic cancer up-regulated hsa-miR-18 la papillary tiiyroid carcinoma (PTC) up-regulated hsa-miR-18 la* Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-181a-l hepatocellular carcinoma (HCC) down-regulated hsa-miR-148a prostate cancer down-regulated hsa-miR-148b hepatocellular carcinoma (HCC) down-regulated hsa-miR-188 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-22 prostate cancer down-regulated hsa-miR-22 psoriasis down-regulated lisa-miR-142-3p psoriasis up-regulated hsa-miR-142-5p acute myeloid leukemia (AML) up-regulated hsa-miR-142-5p hepatocellular carcinoma (HCC) down-regulated hsa-miR-142-5p ovarian cancer (OC) down-regulated hsa-miR-143 Burkitt lymphoma down-regulated hsa-miR-143 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-143 colorectal cancer down-regulated hsa-miR-143 colorectal cancer down-regulated hsa-miR-143 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-143 Obesitv up-regulated hsa-miR-143 breast cancer down-regulated hsa-miR-143 cervical cancer down-regulated hsa-miR-143 colorectal cancer down-regulated hsa-miR-143 colorectal cancer down-regulated hsa-miR-143 epithelial ovarian cancer (EOC) down-regulated hsa-miR-143 hepatocellular carcinoma (HCC) down-regulated hsa-miR-143 pancreatic cancer up-regulated hsa-miR-143 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-143 prostate cancer down-regulated hsa-miR-143 serous ovarian cancer down-regulated hsa-miR-143 uveal melanoma up-regulated hsa-miR-143 vascular disease down-regulated hsa-miR-144 uterine leiomyoma (ULM) down-regulated hsa-miR-145 lung cancer down-regulated hsa-miR-145 Burkitt lymphoma down-regulated hsa-miR-213 malignant melanoma down-regulated hsa-miR-155 Inclusion body myositis (IBM) up-regulated hsa-miR-299-3p Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-335 miyoshi myopathy (MM) up-regulated hsa-miR-106a diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-130 Spinocerebellar ataxia 1 down-regulated hsa-miR-19 Spinocerebellar ataxia 1 down-regulated hsa-miR-130b T-cell leukemia up-regulated hsa-miR-93 T-cell leukemia up-regulated hsa-miR-196b endometriosis down-regulated hsa-miR-20 medulloblastoma up-regulated hsa-miR-200a endometriosis down-regulated hsa-miR-200b endometriosis down-regulated hsa-miR-200c kidney cancer down-regulated hsa-miR-204 cholangiocarcinoma down-regulated hsa-miR-205 Hepatocellular carcinoma (HCC) down-regulated hsa-miR-205 squamous carcinoma up-regulated hsa-miR-205 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-206 Waldenstrom Macroglobulinemia (WM) up-regulated hsa-miR-20a endometriosis down-regulated hsa-miR-21 gastric cancer (stomach cancer) up-regulated hsa-miR-21 heart failure up-regulated hsa-miR-215 colorectal cancer down-regulated hsa-miR-210 lung cancer up-regulated hsa-miR-210 miyoshi myopathy (MM) up-regulated hsa-miR-210 nemaline myopathy (NM) up-regulated hsa-miR-210 pancreatic cancer up-regulated hsa-miR-210 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-210 polymyositis (PM) up-regulated hsa-miR-210 prostate cancer up-regulated hsa-miR-211 epithelial ovarian cancer (EOC) down-regulated hsa-miR-211 malignant melanoma down-regulated hsa-miR-212 alcoholic liver disease (ALD) up-regulated hsa-miR-212 autism spectrum disorder (ASD) up-regulated hsa-miR-212 hepatocellular carcinoma (HCC) up-regulated hsa-miR-212 lung cancer up-regulated hsa-miR-212 nasopharyngeal carcinoma (NPC) down-regulated hsa-miR-212 pancreatic cancer up-regulated hsa-miR-212 pituitary adenoma down-regulated hsa-miR-212 primary biliary cirrhosis (PBC) down-regulated hsa-miR-212 schizophrenia down-regulated hsa-miR-212 uterine leiomyoma (ULM) down-regulated hsa-miR-213 B-cell chronic lymphocytic leukemia down-regulated hsa-miR-213 breast cancer up-regulated hsa-miR-213 follicular lymphoma (FL) up-regulated hsa-miR-213 pancreatic cancer up-regulated hsa-miR-213 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-144 malignant melanoma down-regulated hsa-miR-2 6 lupus nephritis down-regulated hsa-miR-30a-5p lupus nephritis up-regulated hsa-miR-30d lupus nephritis down-regulated hsa-miR-320 lupus nephritis up-regulated hsa-miR-324-3p lupus nephritis down-regulated hsa-miR-324-5p lupus nephritis up-regulated hsa-miR-325 lupus nephritis up-regulated hsa-miR-345 lupus nephritis down-regulated hsa-miR-346 lupus nephritis down-regulated hsa-miR-365 lupus nephritis down-regulated hsa-miR-381 lupus nephritis down-regulated hsa-miR-423 lupus nephritis down-regulated hsa-miR-433 lupus nephritis up-regulated hsa-miR-484 lupus nephritis do n-regulated hsa-miR-486 lupus nephritis down-regulated hsa-miR-494 lupus nephritis up-regulated hsa-miR-500 lupus nephritis down-regulated hsa-miR-513 lupus nephritis up-regulated hsa-miR-516-5p lupus nephritis up-regulated hsa-miR-518b lupus nephritis down-regulated hsa-miR-518c* lupus nephritis up-regulated hsa-miR-557 lupus nephritis down-regulated hsa-miR-575 lupus nephritis up-regulated hsa-miR-155 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-155 lung cancer up-regulated hsa-miR-155 miyoshi myopathy (MM) up-regulated hsa-miR-155 nemaline myopathy (NM) up-regulated hsa-miR-155 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-155 ovarian cancer (OC) down-regulated hsa-miR-155 pancreatic cancer down-regulated hsa-miR-155 pancreatic cancer up-regulated hsa-miR-155 pancreatic cancer up-regulated hsa-miR-155 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-138-2 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-138-2 pituitary adenoma down-regulated hsa-miR-139 cardiac hypertrophy down-regulated hsa-miR-139 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-139 follicular lymphoma (FL) down-regulated hsa-miR-139 hepatocellular carcinoma (HCC) down-regulated hsa-miR-139 malignant melanoma down-regulated hsa-miR-139 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-145 prostate cancer down-regulated hsa-miR-222 Inclusion body myositis (IBM) up-regulated hsa-miR-222 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-222 miyoshi myopathy (MM) up-regulated hsa-miR-222 nemaline myopathy (NM) up-regulated hsa-miR-222 malignant melanoma up-regulated hsa-miR-128 neurodegeneration up-regulated hsa-miR-139-5p neurodegeneration up-regulated hsa-miR-146a neurodegeneration up-regulated hsa-miR-181a-l* neurodegeneration up-regulated hsa-miR-203 neurodegeneration up-regulated hsa-miR-320 neurodegeneration up-regulated hsa-miR-328 neurodegeneration up-regulated hsa-miR-337-3p neurodegeneration down-regulated hsa-miR-338-3p neurodegeneration down-regulated hsa-miR-339-5p neurodegeneration up-regulated hsa-miR-342-3p neurodegeneration up-regulated hsa-let-7a non-small cell lung cancer (NSCLC) down-regulated hsa-let-7b non-small cell lung cancer (NSCLC) down-regulated hsa-let-7d non-small cell lung cancer (NSCLC) down-regulated hsa-let-7g non-small cell lung cancer (NSCLC) down-regulated hsa-miR-21 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-15a Polycystic Kidney Disease down-regulated hsa-miR-15a Polycystic liver disease down-regulated hsa-miR-145 prostate cancer down-regulated hsa-miR-15a prostate cancer down-regulated hsa-miR-16-1 prostate cancer down-regulated hsa-miR-221 prostate cancer down-regulated hsa-miR-222 prostate cancer down-regulated hsa-miR-302 teratocarcinoma up-regulated hsa-miR-302a malignant melanoma down-regulated hsa-miR-302b malignant melanoma down-regulated hsa-miR-302b* acute myeloid leukemia (AML) down-regulated hsa-miR-221 melanoma up-regulated hsa-miR-222 melanoma up-regulated hsa-let-7f ulcerative colitis (UC) up-regulated hsa-miR-126 ulcerative colitis (UC) up-regulated hsa-miR-16 ulcerative colitis (UC) up-regulated hsa-miR-192 ulcerative colitis (UC) down-regulated hsa-miR-195 ulcerative colitis (UC) up-regulated hsa-miR-199a* ulcerative colitis (UC) up-regulated hsa-miR-203 ulcerative colitis (UC) up-regulated hsa-miR-21 ulcerative colitis (UC) up-regulated hsa-miR-23a ulcerative colitis (UC) up-regulated hsa-miR-23b ulcerative colitis (UC) up-regulated hsa-miR-24 ulcerative colitis (UC) up-regulated hsa-miR-26a ulcerative colitis (UC) up-regulated hsa-miR-29a ulcerative colitis (UC) up-regulated hsa-miR-422b ulcerative colitis (UC) down-regulated hsa-miR-629 ulcerative colitis (UC) down-regulated hsa-miR-299-3p nemaline myopathy (NM) up-regulated hsa-miR-299-5p dermatomyositis (DM) up-regulated hsa-miR-299-5p Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-299-5p limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-299-5p miyoshi myopathy (MM) up-regulated hsa-miR-299-5p nemaline myopathy (NM) up-regulated hsa-miR-29a Alzheimer's disease down-regulated hsa-niiR-29a lung cancer down-regulated hsa-niiR-29a type 2 diabetes up-regulated hsa-miR-29a cardiac hypertrophy down-regulated hsa-miR-29a cardiac hypertrophy down-regulated hsa-miR-29a Cerebellar neurodegeneration down-regulated hsa-miR-29a Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-29a facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-29a homozygous sickle cell disease (HbSS) up-regulated hsa-iniR-29a Huntington's disease (HD) up-regulated hsa-miR-29a ovarian cancer (OC) up-regulated hsa-miR-29a prostate cancer down-regulated hsa-miR-29a schizophrenia down-regulated hsa-niiR-29a serous ovarian cancer down-regulated hsa-miR-29a-2 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-29a-2 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-29b cholangiocarcinoma down-regulated hsa-miR-29b chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-29b chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-452 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-452 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-452 nemaline myopathy (NM) up-regulated hsa-miR-483 chronic pancreatitis up-regulated hsa-miR-483 primary biliary cirrhosis (PBC) down-regulated hsa-miR-484 autism spectrum disorder (ASD) up-regulated hsa-miR-485-5p Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-486 cardiac hypertrophy down-regulated hsa-miR-486 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-486 uterine leiomyoma (ULM) down-regulated hsa-miR-487b dermatomyositis (DM) up-regulated hsa-miR-487b Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-487b limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-487b miyoshi myopathy (MM) up-regulated hsa-miR-487b nemaline myopathy (NM) up-regulated hsa-miR-487b ovarian cancer (OC) up-regulated hsa-miR-491 prostate cancer up-regulated hsa-miR-493-3p Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-493-3p limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-493-3p nemaline myopathy (NM) up-regulated hsa-miR-493-5p uterine leiomyoma (ULM) up-regulated hsa-miR-494 chronic pancreatitis up-regulated hsa-miR-494 ovarian cancer (OC) up-regulated hsa-miR-494 primary biliary cirrhosis (PBC) down-regulated hsa-miR-495 epithelial ovarian cancer (EOC) down-regulated hsa-miR-92-1 malignant lymphoma up-regulated hsa-miR-92-1 pancreatic cancer up-regulated hsa-miR-92-2 T-cell leukemia up-regulated hsa-miR-92-2 gastric cancer (stomach cancer) up-regulated hsa-miR-92-2 pancreatic cancer up-regulated hsa-miR-92-2 prostate cancer up-regulated hsa-miR-93 serous ovarian cancer up-regulated hsa-miR-93 gastric cancer (stomach cancer) up-regulated hsa-miR-93 vesicular stomatitis down-regulated hsa-miR-93 Alzheimer's disease down-regulated hsa-miR-93 autism spectram disorder (ASD) down-regulated hsa-miR-93 hepatocellular carcinoma (HCC) up-regulated hsa-miR-93 neuroblastoma (NB) up-regulated hsa-miR-93 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-9-3 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-9-3 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-9-3 pituitary adenoma down-regulated hsa-miR-9-3p schizophrenia down-regulated hsa-miR-95 autism spectrum disorder (ASD) up-regulated hsa-miR-95 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-95 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-95 lung cancer down-regulated hsa-miR-95 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-96 chronic pancreatitis down-regulated hsa-miR-127 epithelial ovarian cancer (EOC) down-regulated hsa-miR-127 malignant melanoma down-regulated hsa-miR-127 nemaline myopathy (NM) up-regulated hsa-miR-127 polymyositis (PM) up-regulated hsa-miR-128a acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-128a acute myeloid leukemia (AML) down-regulated hsa-miR-128a Alzheimer's disease up-regulated hsa-miR-128a autism spectram disorder (ASD) up-regulated hsa-miR-128a glioblastoma down-regulated hsa-miR-128a glioblastoma multiforme (GBM) down-regulated hsa-miR-128a malignant melanoma down-regulated hsa-miR-128a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-128a pituitary adenoma down-regulated hsa-miR-128b lung cancer down-regulated hsa-miR-128b acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-128b acute myeloid leukemia (AML) down-regulated hsa-miR-128b breast cancer up-regulated hsa-miR-128b chronic pancreatitis up-regulated hsa-miR-128b colorectal cancer up-regulated hsa-miR-128b lung cancer up-regulated hsa-miR-128b pancreatic cancer up-regulated hsa-miR-129 autism spectrum disorder (ASD) up-regulated hsa-miR-129 ovarian cancer (OC) up-regulated hsa-miR-95 malignant melanoma down-regulated hsa-miR-220 B-cell chronic lymphocytic leukemia down-regulated hsa-miR-326 medulloblastoma down-regulated hsa-miPv-335 multiple myeloma (MM) up-regulated hsa-miR-342 multiple myeloma (MM) up-regulated hsa-miR-34a chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-34a Glomerulosclerosis down-regulated hsa-miR-34a prostate cancer down-regulated hsa-miR-34b Burkitt lymphoma down-regulated hsa-miR-3 5 breast cancer down-regulated hsa-miR-365 breast cancer up-regulated hsa-miR-373* retinoblastoma up-regulated hsa-miR-492 retinoblastoma up-regulated hsa-miR-494 retinoblastoma down-regulated hsa-miR-497 breast cancer up-regulated hsa-miR-498 retinoblastoma up-regulated hsa-miR-503 retinoblastoma up-regulated hsa-miR-513-1 retinoblastoma up-regulated hsa-miR-513-2 retinoblastoma up-regulated hsa-miR- 16-3p breast cancer up-regulated hsa-miR-518c* retinoblastoma down-regulated hsa-miR-128b malignant melanoma down-regulated hsa-miR-129 colorectal cancer down-regulated hsa-miR-129 malignant melanoma down-regulated hsa-miR-23a Acute Promyelocvtic Leukemia (APL) up-regulated hsa-miR-17 B-cell lymphoma up-regulated hsa-miR-20a B-cell lymphoma up-regulated hsa-miR-155 breast cancer up-regulated hsa-miR-204 breast cancer up-regulated hsa-miR-21 breast cancer up-regulated hsa-miR-221 breast cancer up-regulated hsa-miR-221 breast cancer up-regulated hsa-miR-222 breast cancer up-regulated hsa-miR-222 breast cancer up-regulated hsa-miR-510 breast cancer down-regulated hsa-miR-7 breast cancer down-regulated hsa-miR-425 glioblastoma down-regulated hsa-miR-451 glioblastoma down-regulated hsa-miR-486 glioblastoma up-regulated hsa-miR-296 glioma down-regulated hsa-miR-30a glomerular disease up-regulated hsa-miR-21 glioblastoma multiforme (GBM) up-regulated hsa-miR-335 nemaline myopathy (NM) down-regulated hsa-miR-335 ovarian cancer (OC) up-regulated hsa-miR-335 uterine leiomyoma (ULM) down-regulated hsa-miR-337 epithelial ovarian cancer (EOC) down-regulated hsa-miR-337 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-338 hepatocellular carcinoma (HCC) up-regulated hsa-miR-338 follicular lymphoma (FL) down-regulated hsa-miR-338 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-339 chronic pancreatitis down-regulated hsa-miR-339 colorectal cancer up-regulated hsa-miR-340 acute myeloid leukemia (AML) up-regulated hsa-miR-340 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-341 cardiac hypertrophy down-regulated hsa-miR-342 colorectal cancer up-regulated hsa-miR-342 acute promyelocytic leukemia (APL) down-regulated hsa-miR-342 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-345 pancreatic cancer up-regulated hsa-miR-345 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-345 prostate cancer up-regulated hsa-miR-346 follicular thyroid carcinoma (FTC) down-regulated hsa-miR-346 ovarian cancer (OC) down-regulated hsa-miR-346 primary biliary cirrhosis (PBC) down-regulated hsa-miR-34a hepatocellular carcinoma (HCC) up-regulated hsa-miR-220 glioblastoma down-regulated hsa-miR-220 lung cancer up-regulated hsa-miR-220 pancreatic cancer up-regulated hsa-miR-220 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-221 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-221 glioblastoma up-regulated hsa-miR-221 hepatocellular carcinoma (HCC) up-regulated hsa-miR-221 malignant melanoma down-regulated hsa-miR-221 non-small cell lung cancer (NSCLC) up-regulated hsa-miR-221 non-small cell lung cancer (NSCLC) up-regulated hsa-miR-221 papillary thyroid carcinoma (PTC) down-regulated hsa-miR-221 prostate cancer down-regulated hsa-miR-221 acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-221 acute myeloid leukemia (AML) up-regulated hsa-miR-221 acute myeloid leukemia (AML) up-regulated hsa-miR-221 Becker muscular dystrophy (BMD) up-regulated hsa-miR-221 bladder cancer up-regulated hsa-miR-221 cardiac hypertrophy up-regulated hsa-miR-221 colorectal cancer up-regulated hsa-miR-221 dermatomyositis (DM) up-regulated hsa-miR-221 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-221 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-221 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-221 gastric cancer (stomach cancer) down-regulated hsa-miR-222 prostate cancer down-regulated hsa-miR-126 colorectal cancer down-regulated hsa-miR-127 breast cancer down-regulated hsa-miR-127 hepatocellular carcinoma (HCC) down-regulated hsa-miR-16a hepatocellular carcinoma (HCC) down-regulated hsa-miR-34a hepatocellular carcinoma (HCC) down-regulated hsa-miR-183 lung cancer up-regulated hsa-let-7a lupus nephritis up-regulated hsa-let-7e lupus nephritis up-regulated hsa-miR-124a lupus nephritis up-regulated hsa-miR-130b lupus nephritis down-regulated hsa-miR-133a lupus nephritis up-regulated hsa-miR-134 lupus nephritis up-regulated hsa-miR-142-5p lupus nephritis down-regulated hsa-miR-150 lupus nephritis up-regulated hsa-miR-15b lupus nephritis up-regulated hsa-miR-184 lupus nephritis up-regulated hsa-miR-185 lupus nephritis up-regulated hsa-miR-195 lupus nephritis up-regulated hsa-miR-1 7 lupus nephritis up-regulated hsa-miR-198 lupus nephritis up-regulated hsa-miR-200c lupus nephritis up-regulated hsa-miR-628 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-145 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-222 pancreatic cancer down-regulated hsa-miR-29b lung cancer up-regulated hsa-miR-382 polymyositis (PM) up-regulated hsa-miR-383 chronic pancreatitis up-regulated hsa-miR-409-3p chronic pancreatitis normal hsa-miR-155 hypertension down-regulated hsa-let-7a hepatocellular carcinoma (HCC) down-regulated hsa-let-7a malignant melanoma down-regulated hsa-let-7a squamous carcinoma down-regulated hsa-let-7c Burkitt lymphoma up-regulated hsa-let-7e retinoblastoma up-regulated hsa-let-7f breast cancer down-regulated hsa-miR-1 lung cancer up-regulated hsa-miR-1 retinitis pigmentosa (RP) up-regulated hsa-miR-106b multiple myeloma (MM) down-regulated hsa-miR-122 hepatocellular carcinoma (HCC) down-regulated hsa-miR-125b medulloblastoma up-regulated hsa-miR-126 acute myeloid leukemia (AML) up-regulated hsa-miR-126* acute myeloid leukemia (AML) up-regulated hsa-let-7a cholangiocarcinoma normal hsa-let-7a adenoma down-regulated hsa-let-7a breast cancer down-regulated hsa-let-7a Burkitt lymphoma down-regulated hsa-let-7a gastric cancer (stomach cancer) normal hsa-let-7a hamartoma up-regulated hsa-let-7a Hodgkin's lymphoma normal hsa-let-7a lipoma down-regulated hsa-let-7a lung cancer down-regulated hsa-let-7a lung cancer down-regulated hsa-let-7a lung cancer normal hsa-let-7a myoma down-regulated hsa-let-7a non-small cell lung cancer (NSCLC) down-regulated hsa-let-7a ovarian cancer (OC) normal hsa-let-7a sarcoma down-regulated hsa-let-7a acute lymphoblastic leukemia (ALL) up-regulated hsa-let-7a acute myeloid leukemia (AML) down-regulated hsa-let-7a chronic lymphocytic leukemia (CLL) down-regulated hsa-let-7a colorectal cancer down-regulated hsa-let-7a epithelial ovarian cancer (EOC) down-regulated hsa-let-7a gastric cancer (stomach cancer) up-regulated hsa-miR-583 lupus nephritis down-regulated hsa-miR-23b prostate cancer up-regulated hsa-miR-17-5p neuroblastoma (NB) up-regulated hsa-niiR-20a colorectal cancer up-regulated hsa-niiR-208 lupus nephritis down-regulated hsa-miR-210 lupus nephritis down-regulated hsa-miR-223 lupus nephritis down-regulated hsa-miR-596 lupus nephritis up-regulated hsa-miR-600 lupus nephritis up-regulated hsa-miR-601 lupus nephritis down-regulated hsa-miR-602 lupus nephritis up-regulated hsa-miR-608 lupus nephritis down-regulated hsa-miR-611 lupus nephritis up-regulated hsa-miR-612 lupus nephritis down-regulated hsa-miR-615 lupus nephritis up-regulated hsa-miR-622 lupus nephritis down-regulated hsa-miR-629 lupus nephritis down-regulated hsa-miR-637 lupus nephritis up-regulated hsa-miR-638 lupus nephritis down-regulated hsa-miR-642 lupus nephritis down-regulated hsa-miR-654 lupus nephritis up-regulated hsa-miR-657 lupus nephritis up-regulated hsa-miR-658 lupus nephritis up-regulated hsa-miR-662 lupus nephritis down-regulated hsa-miR-663 lupus nephritis down-regulated hsa-niiR-769-3p lupus nephritis down-regulated hsa-miR-92b lupus nephritis down-regulated hsa-miR-137 glioblastoma multiforme (GBM) up-regulated hsa-miR-137 non-small cell lung cancer (NSCLC) down-regulated hsa-miR-137 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-137 hepatocellular carcinoma (HCC) down-regulated hsa-miR-137 malignant melanoma down-regulated hsa-miR-138 anaplastic thyroid carcinoma (ATC) down-regulated hsa-miR-138 malignant melanoma down-regulated hsa-miR-138-1 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-138-1 papillary thyroid carcinoma (PTC) down-regulated hsa-miR-138-2 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-206 breast cancer normal hsa-miR-206 schizophrenia up-regulated hsa-miR-206 breast cancer down-regulated hsa-miR-206 ovarian cancer (OC) up-regulated hsa-miR-207 hepatocellular carcinoma (HCC) up-regulated hsa-miR-208 cardiac hypertrophy down-regulated hsa-miR-20a chronic myeloid leukemia (CML) up-regulated hsa-miR-20a lung cancer up-regulated hsa-miR-20a lung cancer up-regulated hsa-miPv-20a colorectal cancer up-regulated hsa-miR-20a colorectal cancer up-regulated hsa-miR-20a hepatocellular carcinoma (HCC) down-regulated hsa-miR-145 colorectal cancer down-regulated hsa-miR-145 colorectal cancer down-regulated hsa-miR-145 colorectal cancer down-regulated hsa-miR-145 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-148a pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-15b pancreatic cancer down-regulated hsa-miR-197 Inclusion body myositis (IBM) down-regulated hsa-miR-197 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-197 lung cancer down-regulated hsa-miR-197 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-197 pituitary adenoma down-regulated hsa-miR-197 primary biliary cirrhosis (PBC) down-regulated hsa-miR-197 psoriasis down-regulated hsa-miR-197 uterine leiomyoma (ULM) normal hsa-miR-1 8 schizophrenia up-regulated hsa-miR-1 8 chronic pancreatitis down-regulated hsa-miR-198 lung cancer up-regulated hsa-miR-198 prostate cancer down-regulated hsa-miR-199a cancer down-regulated hsa-miR-199a epithelial ovarian cancer (EOC) down-regulated hsa-miR-199a acute myeloid leukemia (AML) up-regulated hsa-miR-199a cardiac hypertrophy up-regulated hsa-miR-199a dermatomyositis (DM) up-regulated hsa-miR-199a Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-1 9a epithelial ovarian cancer (EOC) down-regulated hsa-miR-1 9b malignant melanoma up-regulated hsa-miR-1 9b prostate cancer up-regulated hsa-miR-21 bladder cancer up-regulated hsa-miR-21 breast cancer up-regulated hsa-miR-21 glioblastoma up-regulated hsa-miR-21 hepatocellular carcinoma (HCC) up-regulated hsa-miR-21 non-small cell lung cancer (NSCLC) up-regulated hsa-miR-210 breast cancer up-regulated hsa-miR-217 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-221 glioblastoma multiforme (GBM) up-regulated hsa-miR-25 multiple myeloma (MM) down-regulated hsa-miR-26a Burkitt lymphoma down-regulated hsa-miR-28 Glomerulosclerosis up-regulated hsa-miR-29b breast cancer up-regulated hsa-miR-29c breast cancer down-regulated hsa-miR-30a-3p breast cancer down-regulated hsa-miR-30b Glomerulosclerosis down-regulated hsa-miR-30c-l Glomerulosclerosis down-regulated hsa-miR-30c-2 Glomerulosclerosis down-regulated hsa-miR-30d Glomerulosclerosis up-regulated hsa-miR-32 multiple myeloma (MM) down-regulated hsa-miR-23a colorectal cancer up-regulated hsa-miR-17-5p hepatocellular carcinoma (HCC) down-regulated hsa-miR-17-5p breast cancer down-regulated hsa-miR-181a glioma up-regulated hsa-miR-181a multiple myeloma (MM) up-regulated hsa-miR-181b breast cancer down-regulated hsa-miR-181b glioma up-regulated hsa-miR-181b multiple myeloma (MM) up-regulated hsa-miR-181d breast cancer down-regulated hsa-miR-182 retinitis pigmentosa (RP) down-regulated hsa-miR-183 retinitis pigmentosa (RP) up-regulated hsa-miR-18a hepatocellular carcinoma (HCC) up-regulated hsa-miR-196a esophageal cancer up-regulated hsa-miR-196a pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-198 retinoblastoma up-regulated hsa-miR-19a hepatocellular carcinoma (HCC) up-regulated hsa-miR-1 a multiple myeloma (MM) up-regulated hsa-miR-1 b hepatocellular carcinoma (HCC) up-regulated hsa-miR-1 b multiple myeloma (MM) down-regulated hsa-miR-205 bladder cancer down-regulated hsa-miR-20a breast cancer up-regulated hsa-miR-222 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-222 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-222 polymyositis (PM) down-regulated hsa-miR-222 prostate cancer down-regulated hsa-miR-223 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-223 acute promyelocytic leukemia (APL) up-regulated hsa-miR-223 acute promyelocytic leukemia (APL) down-regulated hsa-miR-223 chronic myeloid leukemia (CML) down-regulated hsa-miR-223 hepatocellular carcinoma (HCC) down-regulated hsa-miR-223 neutrophilia up-regulated hsa-miR-223 recurrent ovarian cancer down-regulated hsa-miR-223 acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-223 acute myeloid leukemia (AML) up-regulated hsa-miR-223 bladder cancer up-regulated hsa-miR-223 colorectal cancer up-regulated hsa-miR-223 dermatomyositis (DM) up-regulated hsa-miR-223 gastric cancer (stomach cancer) down-regulated hsa-miR-223 hepatocellular carcinoma (HCC) up-regulated hsa-miR-223 Inclusion body myositis (IBM) up-regulated hsa-miR-223 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-223 miyoshi myopathy (MM) up-regulated hsa-miR-223 nemaline myopathy (NM) down-regulated hsa-miR-223 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-223 pancreatic cancer down-regulated hsa-miR-214 ovarian cancer (OC) up-regulated hsa-miR-214 cardiac hypertrophy up-regulated hsa-miR-214 cardiac hypertrophy up-regulated hsa-miR-214 dermatomyositis (DM) up-regulated hsa-miR-214 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-214 epithelial ovarian cancer (EOC) up-regulated hsa-miR-214 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-214 gastric cancer (stomach cancer) up-regulated hsa-miR-214 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-214 heart failure down-regulated hsa-miR-214 hepatocellular carcinoma (HCC) down-regulated hsa-miR-214 hepatocellular carcinoma (HCC) up-regulated hsa-miR-214 Inclusion body myositis (IBM) up-regulated hsa-miR-214 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-214 lung cancer up-regulated hsa-miR-214 miyoshi myopathy (MM) up-regulated hsa-miR-214 nemaline myopathy (NM) up-regulated hsa-miR-214 pancreatic cancer up-regulated hsa-miR-214 polymyositis (PM) up-regulated hsa-miR-214 prostate cancer down-regulated hsa-miR-214 serous ovarian cancer down-regulated hsa-miR-215 hepatocellular carcinoma (HCC) down-regulated hsa-miR-215 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-215 psoriasis down-regulated hsa-miR-216 lung cancer up-regulated hsa-miR-214 vascular disease down-regulated hsa-miR-215 malignant melanoma up-regulated hsa-miR-216 hepatocellular carcinoma (HCC) up-regulated hsa-miR-495 dermatomyositis (DM) up-regulated hsa-miR-96 colorectal cancer up-regulated hsa-miR-129 primary biliary cirrhosis (PBC) up-regulated hsa-miR-34a colorectal cancer up-regulated hsa-miR-221 glioblastoma down-regulated hsa-miR-128 glioma up-regulated hsa-miR-128a breast cancer up-regulated hsa-miR- 129-1 retinoblastoma up-regulated hsa-miR- 129-2 retinoblastoma up-regulated hsa-miR-133 retinitis pigmentosa (RP) up-regulated hsa-miR- 142 retinitis pigmentosa (RP) up-regulated hsa-miR-143 Obesity down-regulated hsa-miR-145 colorectal cancer up-regulated hsa-miR- 146a Alzheimer's disease up-regulated hsa-miR- 146a breast cancer up-regulated hsa-miR- 146a hepatocellular carcinoma (HCC) up-regulated hsa-miR- 146a ovarian cancer (OC) up-regulated hsa-miR-521 prostate cancer up-regulated hsa-miR- 194 endometriosis up-regulated hsa-miR-495 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-495 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-495 miyoshi myopathy (MM) up-regulated hsa-miR-495 nemaline myopathy (NM) down-regulated hsa-miR-497 chronic pancreatitis down-regulated hsa-miR-497 prostate cancer up-regulated hsa-miR-498 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-498 ovarian cancer (OC) up-regulated hsa-miR-498 prostate cancer down-regulated hsa-miR-498 uterine leiomyoma (ULM) up-regulated hsa-miR-5 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-5 acute myeloid leukemia (AML) up-regulated hsa-miR-501 dermatomyositis (DM) up-regulated hsa-miR-501 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-501 nemaline myopathy (NM) up-regulated hsa-miR-501 polymyositis (PM) up-regulated hsa-miR-503 prostate cancer up-regulated hsa-miR-508 ovarian cancer (OC) normal hsa-miR-510 diarrhea predominant irritable bowel syndrome (IBS-D) up-regulated hsa-miR-511 Alzheimer's disease up-regulated hsa-miR-513 prostate cancer down-regulated hsa-miR-515-3p ovarian cancer (OC) down-regulated hsa-miR-516-5p ovarian cancer (OC) up-regulated hsa-miR-518a-2* Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-518a-2* limb-girdle muscular dystrophies types 2A (LGMD2A) down-regulated hsa-miR-lOa colorectal cancer up-regulated hsa-miR-205 non-small cell lung cancer (NSCLC) up-regulated hsa-miR-20a colorectal cancer down-regulated hsa-miR-31 breast cancer down-regulated hsa-miR-320 breast cancer up-regulated hsa-miR-320 colorectal cancer up-regulated hsa-miR-320 retinoblastoma up-regulated hsa-miR-561 multiple myeloma (MM) up-regulated hsa-miR-615-3p HBV-related cirrhosis normal hsa-miR-659 frontotemporal dementia up-regulated hsa-miR-7 breast cancer up-regulated hsa-miR-92 colorectal cancer up-regulated hsa-miR-92a hepatocellular carcinoma (HCC) up-regulated hsa-miR-93 multiple myeloma (MM) down-regulated hsa-miR-96 retinitis pigmentosa (RP) up-regulated hsa-miR-98 breast cancer up-regulated hsa-miR-196b acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-708 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-29b-2 rhabdomyosarcoma (RMS) down-regulated hsa-miR-29c rhabdomyosarcoma (RMS) down-regulated hsa-miR-101 Spinocerebellar ataxia 1 up-regulated hsa-miR-96 hepatocellular carcinoma (HCC) up-regulated hsa-miR-96 hepatocellular carcinoma (HCC) down-regulated hsa-miR-96 malignant melanoma down-regulated hsa-miR-96 non-small cell lung cancer (NSCLC) down-regulated hsa-miR-96 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-96 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-96 retinitis pigmentosa (RP) up-regulated hsa-miR-98 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-99a chronic pancreatitis down-regulated hsa-miR-99a diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-99a Down syndrome (DS) down-regulated hsa-miR-99a epithelial ovarian cancer (EOC) down-regulated hsa-miR-99a epithelial ovarian cancer (EOC) down-regulated hsa-miR-99a hepatocellular carcinoma (HCC) down-regulated hsa-miR-99a lung cancer up-regulated hsa-miR-99a neuroblastoma (NB) up-regulated hsa-miR-99a ovarian cancer (OC) down-regulated hsa-miR-99a prostate cancer down-regulated hsa-miR-99a serous ovarian cancer up-regulated hsa-miR-99b dermatomyositis (DM) up-regulated hsa-miR-99b facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-99b limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-99b miyoshi myopathy (MM) down-regulated hsa-miR-130a acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-130a acute myeloid leukemia (AML) up-regulated hsa-miR-130a dermatomyositis (DM) up-regulated hsa-miR-130a Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-130a glioblastoma down-regulated hsa-let-7c acute lymphoblastic leukemia (ALL) up-regulated hsa-miR-1 cardiomyopathy down-regulated hsa-miR-124a Cerebellar neurodegeneration down-regulated hsa-miR-139 pancreatic cancer down-regulated hsa-miR-145 breast cancer up-regulated hsa-miR-155 acute myeloid leukemia (AML) down-regulated hsa-miR-16 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-18 la-2 hepatocellular carcinoma (HCC) down-regulated hsa-miR-18 lb chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-18 lb acute myeloid leukemia (AML) down-regulated hsa-miR-18 lb acute promyelocytic leukemia (APL) up-regulated hsa-miR-18 lb B-cell chronic lymphocytic leukemia up-regulated hsa-miR-18 lb colorectal cancer up-regulated hsa-miR-18 lb colorectal cancer up-regulated hsa-miR-18 lb colorectal cancer down-regulated hsa-miR-18 lb glioblastoma up-regulated hsa-miR-181b-l breast cancer up-regulated hsa-miR-181b-l pancreatic cancer up-regulated hsa-miR-183 colorectal cancer up-regulated hsa-miR-183 hepatocellular carcinoma (HCC) down-regulated hsa-miR-183 malignant melanoma down-regulated hsa-miR-184 neuroblastoma (NB) up-regulated hsa-miR-196a pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-196a-2 breast cancer down-regulated hsa-miR-196b cervical cancer up-regulated hsa-miR-196b uterine leiomyoma (ULM) up-regulated hsa-miR-197 follicular thyroid carcinoma (FTC) up-regulated hsa-miR-197 Alzheimer's disease up-regulated hsa-miR-197 chronic pancreatitis down-regulated hsa-miR-197 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-197 glioblastoma down-regulated hsa-miR-197 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-381 autism spectrum disorder (ASD) up-regulated hsa-miR-381 dermatomyositis (DM) up-regulated hsa-miR-381 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-381 Inclusion body myositis (IBM) up-regulated hsa-miR-381 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-381 miyoshi myopathy (MM) up-regulated hsa-miR-381 nemaline myopathy (NM) down-regulated hsa-miR-381 ovarian cancer (OC) down-regulated hsa-miR-381 psoriasis up-regulated hsa-miR-382 dermatomyositis (DM) up-regulated hsa-miR-29b type 2 diabetes down-regulated hsa-miR-29b cardiac hypertrophy down-regulated hsa-miR-29b Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-29b facioscapulohumeral muscular dystrophy (FSHD) down-regulated hsa-miR-29b glioblastoma multiforme (GBM) down-regulated hsa-miR-29b head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-29b limb-girdle muscular dystrophies types 2A (LGMD2A) down-regulated hsa-miR-29b malignant melanoma down-regulated hsa-miR-29b nemaline myopathy (NM) up-regulated hsa-miR-29b papillary thyroid carcinoma (PTC) down-regulated hsa-miR-29b primary biliary cirrhosis (PBC) down-regulated hsa-miR-29b prostate cancer down-regulated hsa-miR-29b schizophrenia down-regulated hsa-miR-29b uterine leiomyoma (ULM) down-regulated hsa-miR-29b uterine leiomyoma (ULM) down-regulated hsa-miR-29b-l Alzheimer's disease down-regulated hsa-miR-29b-2 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-29b-2 breast cancer up-regulated hsa-miR-29b-2 colorectal cancer down-regulated hsa-miR-29b-2 lung cancer up-regulated hsa-miR-29b-2 pancreatic cancer up-regulated hsa-miR-29b-2 prostate cancer down-regulated hsa-miR-29c chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-204 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-205 breast cancer up-regulated hsa-miR-205 bladder cancer down-regulated hsa-miR-205 breast cancer down-regulated hsa-miR-205 esophageal cancer up-regulated hsa-miR-205 Head and neck cancer up-regulated hsa-miR-205 lung cancer up-regulated hsa-miR-205 pancreatic cancer up-regulated hsa-miR-205 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-205 prostate cancer down-regulated hsa-miR-206 breast cancer up-regulated hsa-miR-155 polymyositis (PM) up-regulated hsa-miR-15a chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-15a hepatocellular carcinoma (HCC) down-regulated hsa-miR-15a acute promyelocytic leukemia (APL) up-regulated hsa-miR-15a chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-15a chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-15a chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-15a pituitary adenoma down-regulated hsa-miR-15a Alzheimer's disease down-regulated hsa-miR-15a autism spectrum disorder (ASD) up-regulated hsa-miR-15a head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-99a lupus nephritis down-regulated hsa-miR-1 9a facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-199a heart failure up-regulated hsa-miR-199a hepatocellular carcinoma (HCC) down-regulated hsa-miR-199a limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-199a malignant melanoma down-regulated hsa-miR-199a miyoshi myopathy (MM) up-regulated hsa-miR-199a nemaline myopathy (NM) up-regulated hsa-miR-199a ovarian cancer (OC) up-regulated hsa-miR-199a polymyositis (PM) up-regulated hsa-miR-199a prostate cancer down-regulated hsa-miR-199a uveal melanoma up-regulated hsa-miR-199a* cancer down-regulated hsa-miR-199a* cardiac hypertrophy up-regulated hsa-miR-199a* dermatomyositis (DM) up-regulated hsa-miR-199a* Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-199a* facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-199a* hepatocellular carcinoma (HCC) down-regulated hsa-miR-199a* limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-199a* miyoshi myopathy (MM) up-regulated hsa-miR-199a* nemaline myopathy (NM) up-regulated hsa-miR-199a* ovarian cancer (OC) down-regulated hsa-miR-199a* prostate cancer down-regulated hsa-miR-199a-l chronic pancreatitis up-regulated hsa-miR-199a-l lung cancer up-regulated hsa-miR-133a cardiac hypertrophy down-regulated hsa-miR-223 pancreatic cancer up-regulated hsa-miR-189 tourette's syndrome normal hsa-miR-18a anaplastic thyroid carcinoma (ATC) up-regulated hsa-miR-18a lung cancer up-regulated hsa-miR-18a pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-18b cardiac hypertrophy up-regulated hsa-miR-190 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-190 malignant melanoma down-regulated hsa-miR-190 ovarian cancer (OC) up-regulated hsa-miR-191 breast cancer up-regulated hsa-miR-191 colorectal cancer up-regulated hsa-miR-191 colorectal cancer down-regulated hsa-miR-191 colorectal cancer up-regulated hsa-miR-191 gastric cancer (stomach cancer) up-regulated hsa-miR-191 glioblastoma up-regulated hsa-miR-191 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-191 lung cancer up-regulated hsa-miR-191 lung cancer up-regulated hsa-miR-191 pancreatic cancer up-regulated hsa-miR-191 prostate cancer up-regulated hsa-miR-191 prostate cancer up-regulated hsa-miR-192 B-cell chronic lymphocytic leukemia down-regulated hsa-miR-192 lung cancer up-regulated hsa-let-7a nemaline myopathy (NM) up-regulated hsa-let-7a prostate cancer down-regulated hsa-let-7a-l colorectal cancer down-regulated hsa-let-7a-l hepatocellular carcinoma (HCC) down-regulated hsa-let-7a-l Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-let-7a-l pituitary adenoma down-regulated hsa-let-7a-2 lung cancer down-regulated hsa-let-7a-2 hepatocellular carcinoma (HCC) down-regulated hsa-let-7a-2 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-let-7a-3 acute promyelocytic leukemia (APL) up-regulated hsa-let-7a-3 epithelial ovarian cancer (EOC) down-regulated hsa-let-7a-3 lung cancer up-regulated hsa-let-7a-3 breast cancer down-regulated hsa-let-7a-3 hepatocellular carcinoma (HCC) down-regulated hsa-let-7a-3 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-let-7b serous ovarian cancer down-regulated hsa-let-7b lung cancer down-regulated hsa-let-7b lung cancer down-regulated hsa-let-7b malignant melanoma down-regulated hsa-let-7b acute lymphoblastic leukemia (ALL) down-regulated hsa-let-7b acute myeloid leukemia (AML) up-regulated hsa-let-7b cardiac hypertrophy up-regulated hsa-let-7b cervical cancer down-regulated hsa-miR-223 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-223 pituitary adenoma down-regulated hsa-miR-223 primary biliary cirrhosis (PBC) down-regulated hsa-miR-223 prostate cancer up-regulated hsa-miR-224 hepatocellular carcinoma (HCC) up-regulated hsa-miR-224 epithelial ovarian cancer (EOC) down-regulated hsa-miR-224 hepatocellular carcinoma (HCC) up-regulated hsa-miR-224 hepatocellular carcinoma (HCC) up-regulated hsa-miR-224 lung cancer down-regulated hsa-miR-224 malignant melanoma down-regulated hsa-miR-224 Oral Squamous Cell Carcinoma (OSCC) up-regulated hsa-miR-224 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-224 prostate cancer up-regulated hsa-miR-23a hepatocellular carcinoma (HCC) up-regulated hsa-miR-23a acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-23a acute myeloid leukemia (AML) up-regulated hsa-miR-23a autism spectrum disorder (ASD) up-regulated hsa-miR-23a bladder cancer up-regulated hsa-miR-23a cardiac hypertrophy up-regulated hsa-miR-23a glioblastoma up-regulated hsa-miR-23a heart failure up-regulated hsa-miR-23a hepatocellular carcinoma (HCC) up-regulated hsa-miR-34a neuroblastoma (NB) down-regulated hsa-miR-34a neuroblastoma (NB) down-regulated hsa-miR-34a neuroblastoma (NB) down-regulated hsa-miR-34a non-small cell lung cancer (NSCLC) down-regulated hsa-miR-34a pancreatic cancer down-regulated hsa-miR-34a dermatomyositis (DM) up-regulated hsa-miR-34a Duchenne muscular dystrophy (DMD) up-regulated lisa-miR-34a facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-34a Inclusion body myositis (ΓΒΜ) up-regulated hsa-miR-34a limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated lisa-miR-34a miyoshi myopathy (MM) up-regulated hsa-miR-34a nemaline myopathy (NM) up-regulated hsa-miR-34a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-34a papillary thyroid carcinoma (PTC) up-regulated hsa-miR-34a polymyositis (PM) up-regulated hsa-miR-34a uterine leiomyoma (ULM) up-regulated hsa-miR-34b colorectal cancer down-regulated hsa-miR-34b non-small cell lung cancer (NSCLC) down-regulated hsa-miR-34b ovarian cancer (OC) down-regulated lisa-miR-34b malignant melanoma down-regulated hsa-miR-34b nasopharyngeal carcinoma (NPC) down-regulated hsa-miR-34b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-34c non-small cell lung cancer (NSCLC) down-regulated hsa-miR-34c colorectal cancer down-regulated hsa-miR-145 breast cancer down-regulated hsa-miR-145 colorectal cancer down-regulated hsa-miR-145 colorectal cancer down-regulated hsa-miR-145 colorectal cancer down-regulated hsa-miR-145 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-145 epithelial ovarian cancer (EOC) down-regulated hsa-miR-145 epithelial ovarian cancer (EOC) down-regulated hsa-miR-145 hepatocellular carcinoma (HCC) down-regulated hsa-miR-145 hepatocellular carcinoma (HCC) down-regulated hsa-miR-145 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-145 prostate cancer down-regulated hsa-miR-145 prostate cancer up-regulated hsa-miR-145 serous ovarian cancer down-regulated hsa-miR-145 testicular germ cell tumor up-regulated hsa-miR-145 vascular disease down-regulated hsa-miR-146a chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-146a breast cancer up-regulated hsa-miR-146a breast cancer down-regulated hsa-miR-146a papillary thyroid carcinoma (PTC) up-regulated hsa-miR-146a prostate cancer down-regulated hsa-miR-146a breast cancer up-regulated hsa-miR-146a cardiac hypertrophy up-regulated hsa-miR-221 hepatocellular carcinoma (HCC) up-regulated hsa-miR-221 hepatocellular carcinoma (HCC) up-regulated hsa-miR-221 hepatocellular carcinoma (HCC) up-regulated hsa-miR-221 Inclusion body myositis (IBM) up-regulated hsa-miR-221 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-221 miyoshi myopathy (MM) up-regulated hsa-miR-221 nemaline myopathy (NM) up-regulated hsa-miR-221 neuroblastoma (NB) up-regulated hsa-miR-221 ovarian cancer (OC) up-regulated hsa-miR-221 pancreatic cancer up-regulated hsa-miR-221 pancreatic cancer up-regulated hsa-miR-221 pancreatic cancer up-regulated hsa-miR-221 pancreatic ductal adenocarcinoma (PDAC) up-regulated hsa-miR-221 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-221 polymyositis (PM) up-regulated hsa-miR-221 prostate cancer down-regulated hsa-miR-222 glioblastoma up-regulated hsa-miR-222 malignant melanoma up-regulated hsa-miR-222 non-small cell lung cancer (NSCLC) up-regulated hsa-miR-222 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-222 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-222 acute myeloid leukemia (AML) up-regulated hsa-miR-222 acute myeloid leukemia (AML) up-regulated hsa-miR-222 cardiac hypertrophy up-regulated hsa-miR-132 polymyositis (PM) up-regulated hsa-miR-20a hepatocellular carcinoma (HCC) up-regulated hsa-miR-216 malignant melanoma down-regulated hsa-miR-518b ovarian cancer (OC) up-regulated hsa-miR-99b nemaline myopathy (NM) up-regulated hsa-miR-181b-l pancreatic cancer up-regulated hsa-miR-1 9a-l Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-29c lung cancer down-regulated hsa-miR-106a follicular lymphoma (FL) up-regulated hsa-miR-106a malignant melanoma down-regulated hsa-miR-106a neuroblastoma (NB) up-regulated hsa-miR-106a pancreatic cancer up-regulated hsa-miR-106a prostate cancer up-regulated hsa-miR-106a psoriasis up-regulated hsa-miR-106a-l hepatocellular carcinoma (HCC) up-regulated hsa-miR-124a colorectal cancer down-regulated hsa-miR-124a epithelial ovarian cancer (EOC) down-regulated hsa-miR-124a malignant melanoma down-regulated hsa-miR-124a teratocarcinoma down-regulated hsa-miR-124a-l lung cancer down-regulated hsa-miR-124a-2 hepatocellular carcinoma (HCC) down-regulated hsa-miR-124a-2 hepatocellular carcinoma (HCC) down-regulated hsa-miR-124a-3 breast cancer down-regulated hsa-miR-124a-3 breast cancer down-regulated hsa-miR-21 colorectal cancer up-regulated hsa-miR-21 pancreatic cancer up-regulated hsa-miR-21 vascular disease up-regulated hsa-miR-21 glioma up-regulated hsa-miR-21 hepatocellular carcinoma (HCC) up-regulated hsa-miR-29c nasopharyngeal carcinoma (NPC) down-regulated hsa-miR-29c type 2 diabetes up-regulated hsa-miR-29c cardiac hypertrophy down-regulated hsa-miR-29c cardiac hypertrophy down-regulated hsa-miR-29c Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-29c nemaline myopathy (NM) down-regulated hsa-miR-29c ovarian cancer (OC) up-regulated hsa-miR-29c pancreatic ductal adenocarcinoma (PDAC) down-regulated hsa-miR-29c papillary thyroid carcinoma (PTC) up-regulated hsa-miR-29c schizophrenia down-regulated hsa-miR-29c uterine leiomyoma (ULM) down-regulated hsa-miR-301 follicular lymphoma (FL) up-regulated hsa-miR-301 hepatocellular carcinoma (HCC) up-regulated hsa-miR-301 pancreatic cancer up-regulated hsa-miR-302a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-302b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-20a malignant lymphoma up-regulated hsa-miR-20a pancreatic cancer up-regulated hsa-miR-20a primary biliary cirrhosis (PBC) down-regulated hsa-miR-20a prostate cancer up-regulated hsa-miR-20a psoriasis up-regulated hsa-miR-20a serous ovarian cancer up-regulated hsa-miR-20b T-cell leukemia up-regulated hsa-miR-20b schizophrenia down-regulated hsa-miR-21 colorectal cancer up-regulated hsa-miR-21 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-21 diffuse large B-cell lymphoma (DLBCL) up-regulated hsa-miR-21 lung cancer up-regulated hsa-miR-21 pancreatic cancer up-regulated hsa-miR-21 breast cancer up-regulated hsa-miR-21 breast cancer up-regulated hsa-miR-21 breast cancer up-regulated hsa-miR-21 breast cancer up-regulated hsa-miR-21 breast cancer up-regulated hsa-miR-21 cardiac hypertrophy up-regulated hsa-miR-21 cholangiocarcinoma up-regulated hsa-miR-21 Cowden Syndrome up-regulated hsa-miR-21 glioblastoma up-regulated hsa-miR-21 hepatocellular carcinoma (HCC) up-regulated hsa-miR-21 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-216 nasopharyngeal carcinoma (NPC) down-regulated hsa-miR-216 pancreatic ductal adenocarcinoma (PDAC) down-regulated hsa-miR-217 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-217 nasopharyngeal carcinoma (NPC) down-regulated hsa-miR-217 pancreatic ductal adenocarcinoma (PDAC) down-regulated hsa-miR-218 cervical cancer down-regulated hsa-miR-218 cardiac hypertrophy down-regulated hsa-miR-218-2 lung cancer down-regulated hsa-miR-219 malignant melanoma down-regulated hsa-miR-219-1 hepatocellular carcinoma (HCC) up-regulated hsa-miR-219-1 hepatocellular carcinoma (HCC) up-regulated hsa-miR-219-1 lung cancer down-regulated hsa-miR-219-1 papillary thyroid carcinoma (PTC) up-regulated hsa-miR-22 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-22 acute myeloid leukemia (AML) up-regulated hsa-miR-22 Alzheimer's disease down-regulated hsa-miR-22 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-22 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-124a Alzheimer's disease down-regulated hsa-miR-16 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-16 gastric cancer (stomach cancer) down-regulated hsa-miR-16 prostate cancer down-regulated hsa-miR-16 serous ovarian cancer up-regulated hsa-miR-16-1 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-199a-l pancreatic cancer up-regulated hsa-miR-199a-l pancreatic cancer up-regulated hsa-miR-1 9a-l prostate cancer up-regulated hsa-miR-1 9a-l- 5p hepatocellular carcinoma (HCC) down-regulated hsa-miR-199a-2 chronic pancreatitis up-regulated hsa-miR-199a-2 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-199a-2 pancreatic cancer up-regulated hsa-miR-199a-2- 5p hepatocellular carcinoma (HCC) down-regulated hsa-miR-199a-3p serous ovarian cancer down-regulated hsa-miR-1 9b acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-1 9b acute myeloid leukemia (AML) up-regulated hsa-miR-1 9b cardiac hypertrophy up-regulated hsa-miR-199b chronic pancreatitis up-regulated hsa-miR-199b dermatomyositis (DM) up-regulated hsa-miR-199b Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-199b epithelial ovarian cancer (EOC) down-regulated hsa-miR-199b facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-199b hepatocellular carcinoma (HCC) down-regulated hsa-miR-199b limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-199b lung cancer down-regulated hsa-miR-1 9b nemaline myopathy (NM) up-regulated hsa-miR-1 9b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-1 9b polymyositis (PM) up-regulated hsa-miR-519a ovarian cancer (OC) down-regulated hsa-miR-519d primary biliary cirrhosis (PBC) down-regulated hsa-miR-520c breast cancer up-regulated hsa-miR-524* ovarian cancer (OC) down-regulated hsa-miR-524* psoriasis down-regulated hsa-miR-525* ovarian cancer (OC) up-regulated hsa-miR-539 autism spectrum disorder (ASD) down-regulated hsa-miR-542-3p ovarian cancer (OC) down-regulated hsa-miR-542-3p uterine leiomyoma (ULM) up-regulated hsa-miR-542-5p uterine leiomyoma (ULM) down-regulated hsa-miR-550 autism spectram disorder (ASD) down-regulated hsa-miR-551a ovarian cancer (OC) down-regulated hsa-miR-563 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-565 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-572 head and neck squamous cell carcinoma (HNSCC) up-regulated hsa-miR-572 ovarian cancer (OC) up-regulated hsa-miR-582 uterine leiomyoma (ULM) up-regulated hsa-miR-594 hepatocellular carcinoma (HCC) down-regulated hsa-miR-594 ovarian cancer (OC) up-regulated hsa-miR-598 autism spectram disorder (ASD) up-regulated hsa-miR-605 ovarian cancer (OC) up-regulated hsa-miR-608 ovarian cancer (OC) down-regulated hsa-miR-611 ovarian cancer (OC) up-regulated hsa-miR-622 ovarian cancer (OC) down-regulated hsa-miR-627 ovarian cancer (OC) down-regulated hsa-miR-99b polymyositis (PM) up-regulated hsa-miR-99b prostate cancer up-regulated hsa-miR-99b psoriasis down-regulated hsa-miR-106b gastric cancer (stomach cancer) up-regulated hsa-miR-106b Alzheimer's disease down-regulated hsa-miR-106b autism spectram disorder (ASD) down-regulated hsa-miR-106b ovarian cancer (OC) down-regulated hsa-miR-106b schizophrenia up-regulated hsa-miR-106b-l hepatocellular carcinoma (HCC) up-regulated hsa-miR-107 esophageal cancer up-regulated hsa-miR-107 Alzheimer's disease down-regulated hsa-miR-107 cardiac hypertrophy up-regulated hsa-miR-107 colorectal cancer up-regulated hsa-miR-107 colorectal cancer down-regulated hsa-miR-107 gastric cancer (stomach cancer) up-regulated hsa-miR-107 malignant melanoma down-regulated hsa-miR-107 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-107 pancreatic cancer up-regulated hsa-miR-107 pancreatic cancer up-regulated hsa-miR-107 pancreatic cancer up-regulated hsa-miR-107 pancreatic cancer up-regulated hsa-miR-lOa cardiac hypertrophy down-regulated hsa-miR-lOa colorectal cancer up-regulated hsa-miR-181b-l prostate cancer up-regulated hsa-miR-181b-2 pancreatic cancer up-regulated hsa-miR-181c acute myeloid leukemia (AML) up-regulated hsa-miR-181c Alzheimer's disease down-regulated hsa-miR-181c glioblastoma down-regulated hsa-miR-181c hepatocellular carcinoma (HCC) down-regulated hsa-miR-181c lung cancer down-regulated hsa-miR-181c pancreatic cancer up-regulated hsa-miR-181c pancreatic cancer up-regulated hsa-miR-181c papillary thyroid carcinoma (PTC) up-regulated hsa-miR-181d autism spectram disorder (ASD) down-regulated hsa-miR-181d Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-181d nemaline myopathy (NM) up-regulated hsa-miR-181d pancreatic cancer up-regulated hsa-miR-182 acute myeloid leukemia (AML) down-regulated hsa-miR-182 epithelial ovarian cancer (EOC) up-regulated hsa-miR-182 hepatocellular carcinoma (HCC) up-regulated hsa-miR-182 malignant melanoma down-regulated hsa-miR-182* non-small cell lung cancer (NSCLC) up-regulated hsa-miR-182* hepatocellular carcinoma (HCC) up-regulated hsa-miR-183 B-cell chronic lymphocytic leukemia up-regulated hsa-miR-183 ovarian cancer (OC) down-regulated hsa-miR-183 retinitis pigmentosa (RP) up-regulated hsa-miR-23a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-23a pancreatic cancer up-regulated hsa-miR-23a prostate cancer down-regulated hsa-miR-23a serous ovarian cancer up-regulated hsa-miR-23b chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-23b acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-23b acute myeloid leukemia (AML) up-regulated hsa-miR-23b bladder cancer up-regulated hsa-miR-23b cardiac hypertrophy up-regulated hsa-miR-23b cervical cancer down-regulated hsa-miR-23b glioblastoma up-regulated hsa-miR-23b hepatocellular carcinoma (HCC) up-regulated hsa-miR-23b malignant melanoma down-regulated hsa-miR-23b Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-23b pancreatic cancer up-regulated hsa-miR-23b prostate cancer down-regulated hsa-miR-23b serous ovarian cancer up-regulated hsa-miR-23b uterine leiomyoma (ULM) up-regulated hsa-miR-24 vesicular stomatitis down-regulated hsa-miR-24 acute lymphoblastic leukemia (ALL) down-regulated hsa-miR-24 acute myeloid leukemia (AML) up-regulated hsa-miR-24 cardiac hypertrophy up-regulated hsa-miR-24 heart failure up-regulated hsa-miR-24 hepatocellular carcinoma (HCC) up-regulated hsa-miR-25 hepatocellular carcinoma (HCC) up-regulated hsa-miR-34c ovarian cancer (OC) down-regulated hsa-miR-148b asthma normal hsa-miR-372 colorectal cancer up-regulated hsa-miR-34c acute myeloid leukemia (AML) down-regulated hsa-miR-34c malignant melanoma down-regulated hsa-miR-34c nasopharyngeal carcinoma (NPC) down-regulated hsa-miR-34c Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-34c ovarian cancer (OC) down-regulated hsa-miR-351 cardiac hypertrophy up-regulated hsa-miR-352 vascular disease up-regulated hsa-miR-361 Duchenne muscular dystrophy (DMD) down-regulated hsa-miR-361 nemaline myopathy (NM) up-regulated hsa-miR-361 ovarian cancer (OC) down-regulated hsa-miR-361 primary biliary cirrhosis (PBC) down-regulated hsa-miR-362 dermatomyositis (DM) up-regulated hsa-miR-362 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-362 miyoshi myopathy (MM) up-regulated hsa-miR-362 nemaline myopathy (NM) up-regulated hsa-miR-362 polymyositis (PM) up-regulated hsa-miR-363 Alzheimer's disease down-regulated hsa-miR-365 psoriasis down-regulated hsa-miR-365 vascular disease down-regulated hsa-miR-367 acute myeloid leukemia (AML) down-regulated hsa-miR-367 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-367 testicular germ cell tumor up-regulated hsa-miR-368 epithelial ovarian cancer (EOC) down-regulated hsa-miR-368 dermatomyositis (DM) up-regulated hsa-miR-148b autism spectrum disorder (ASD) up-regulated hsa-miR-148b dermatomyositis (DM) up-regulated hsa-miR-148b head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-148b limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-148b nemaline myopathy (NM) up-regulated hsa-miR-148b pancreatic cancer down-regulated hsa-miR-148b pancreatic ductal adenocarcinoma (PDAC) down-regulated hsa-miR-149 breast cancer up-regulated hsa-miR-149 cardiac hypertrophy down-regulated hsa-miR-149 cardiac hypertrophy down-regulated hsa-miR-149 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-149 follicular lymphoma (FL) down-regulated hsa-miR-149 glioblastoma multiforme (GBM) down-regulated hsa-miR-149 malignant melanoma down-regulated hsa-miR-149 pituitary adenoma up-regulated hsa-miR-15 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-150 cardiac hypertrophy down-regulated hsa-miR-150 cardiac hypertrophy down-regulated hsa-miR-150 chronic lymphocytic leukemia (CLL) down-regulated hsa-miR-150 diffuse large B-cell lymphoma (DLBCL) down-regulated hsa-miR-150 epithelial ovarian cancer (EOC) down-regulated hsa-miR-150 hepatocellular carcinoma (HCC) down-regulated hsa-miR-153 glioblastoma multiforme (GBM) down-regulated hsa-miR-15a malignant melanoma down-regulated hsa-miR-15a-2 prostate cancer up-regulated hsa-miR-15b gastric cancer (stomach cancer) down-regulated hsa-miR-15b acute myeloid leukemia (AML) down-regulated hsa-miR-15b acute promyelocytic leukemia (APL) up-regulated hsa-miR-15b autism spectram disorder (ASD) up-regulated hsa-miR-15b B-cell chronic lymphocytic leukemia up-regulated hsa-miR-15b cardiac hypertrophy up-regulated hsa-miR-15b colorectal cancer down-regulated hsa-miR-15b colorectal cancer up-regulated hsa-miR-15b non-small cell lung cancer (NSCLC) up-regulated hsa-let-7c acute myeloid leukemia (AML) up-regulated hsa-let-7c cardiac hypertrophy up-regulated hsa-let-7c cervical cancer down-regulated hsa-let-7c Down syndrome (DS) up-regulated hsa-let-7c epithelial ovarian cancer (EOC) down-regulated hsa-let-7c hepatocellular carcinoma (HCC) down-regulated hsa-let-7c lung cancer up-regulated hsa-let-7c lung cancer down-regulated hsa-let-7c prostate cancer up-regulated hsa-let-7c prostate cancer down-regulated hsa-let-7c uterine leiomyoma (ULM) up-regulated hsa-miR-133a cardiac hypertrophy down-regulated hsa-miR-133a cardiomyopathy up-regulated hsa-miR-186 head and neck squamous cell carcinoma (HNSCC) down-regulated hsa-miR-222 dermatomyositis (DM) up-regulated hsa-miR-106a colorectal cancer up-regulated hsa-miR-125b-2 hepatocellular carcinoma (HCC) down-regulated hsa-miR-147 acute promyelocytic leukemia (APL) up-regulated hsa-miR-195 prostate cancer down-regulated hsa-miR-433 Parkinson's disease normal hsa-miR-518b psoriasis down-regulated hsa-miR-9* follicular lymphoma (FL) up-regulated hsa-miR-99a pancreatic cancer up-regulated hsa-miR-122a Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-130a hepatocellular carcinoma (HCC) down-regulated hsa-miR-143 lung cancer down-regulated hsa-miR-199a* uveal melanoma up-regulated hsa-miR-200c serous ovarian cancer up-regulated hsa-miR-155 papillary thyroid carcinoma (PTC) up-regulated hsa-let-7f ovarian cancer (OC) down-regulated hsa-let-7f prostate cancer down-regulated hsa-let-7f-l breast cancer up-regulated hsa-let-7f-l colorectal cancer up-regulated hsa-let-7f-l lung cancer up-regulated hsa-let-7f-l pancreatic cancer up-regulated hsa-let-7f-l pituitary adenoma down-regulated hsa-let-7f-2 breast cancer down-regulated hsa-let-7f-2 hepatocellular carcinoma (HCC) down-regulated hsa-let-7b colorectal cancer up-regulated hsa-let-7b facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-let-7b hepatocellular carcinoma (HCC) down-regulated hsa-let-7b limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-let-7b miyoshi myopathy (MM) up-regulated hsa-let-7b nemaline myopathy (NM) up-regulated hsa-let-7b neuroblastoma (NB) up-regulated hsa-let-7b primary biliary cirrhosis (PBC) down-regulated hsa-let-7b prostate cancer down-regulated hsa-let-7b uveal melanoma up-regulated hsa-let-7c acute promyelocytic leukemia (APL) up-regulated hsa-let-7c lung cancer down-regulated hsa-let-7c ovarian cancer (OC) down-regulated hsa-let-7c prostate cancer down-regulated hsa-let-7c uterine leiomyoma (ULM) down-regulated hsa-miR-132 dermatomyositis (DM) up-regulated hsa-miR-132 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-132 glioblastoma multiforme (GBM) down-regulated hsa-miR-132 hepatocellular carcinoma (HCC) down-regulated hsa-miR-132 limb-girdle muscular dystrophies types 2A (LGMD2A) up-regulated hsa-miR-132 miyoshi myopathy (MM) up-regulated hsa-miR-132 nemaline myopathy (NM) up-regulated hsa-miR-132 Oral Squamous Cell Carcinoma (OSCC) down-regulated hsa-miR-132 pituitary adenoma down-regulated hsa-miR-21 acute myeloid leukemia (AML) up-regulated hsa-miR-21 autism spectrum disorder (ASD) up-regulated hsa-miR-21 breast cancer up-regulated hsa-miR-21 cardiac hypertrophy up-regulated hsa-miR-21 cardiac hypertrophy up-regulated hsa-miR-21 cervical cancer up-regulated hsa-miR-21 chronic lymphocytic leukemia (CLL) up-regulated hsa-miR-21 colorectal cancer up-regulated hsa-miR-21 colorectal cancer up-regulated hsa-miR-21 colorectal cancer up-regulated hsa-miR-21 colorectal cancer up-regulated hsa-miR-21 dermatomyositis (DM) up-regulated hsa-miR-21 Duchenne muscular dystrophy (DMD) up-regulated hsa-miR-21 epithelial ovarian cancer (EOC) down-regulated hsa-miR-21 esophageal cancer up-regulated hsa-miR-21 facioscapulohumeral muscular dystrophy (FSHD) up-regulated hsa-miR-21 gastric cancer (stomach cancer) up-regulated hsa-miR-21 gastric cancer (stomach cancer) up-regulated hsa-miR-21 glioblastoma up-regulated hsa-miR-21 glioblastoma multiforme (GBM) up-regulated hsa-miR-21 glioma up-regulated hsa-miR-21 hepatocellular carcinoma (HCC) up-regulated hsa-miR-21 Inclusion body myositis (Π3Μ) up-regulated