Description The present invention relates to Apium graveolens plants being resistant to the plant pathogen Septoria apiicola. The present invention further relates to hybrid celery or celeriac plants being resistant to the plant pathogen Septoria apiicola and to molecular markers suitable for detecting the present Septoria apiicola resistance.

Celery {Apium graveolens) and celeriac {Apium graveolens var. rapaceum) both are members of the Umbelliferae, a family of aromatic flowering plants together with carrot, parsnip, parsley and e.g. coriander, fennel and dill. Many members of this family are cultivated for their leaves, petioles, hypocotyl bulbs, taproots or seeds; in some cases compounds with supposed health promoting effects like apiin and apigenin can be extracted from celery and parsley plants or seeds. Celery seed is used as a spice; its extracts are used in medicines.

The seeds can be ground and mixed with salt, to produce celery salt. Celery salt can also be made from an extract of the roots or using dried leaves. Celery salt is used as a seasoning.

Lunularin is a dihydrostilbenoid found in common celery. Some aromatic compounds of celery leaves and stalks are reported as butylphthalide and sedanolide which are primarily responsible for the taste and aroma of celery.

Celery has a very long history of cultivation, the first written mention of the crop stems from 1664 and Linnaeus described the plant in his Species Plantarum in 1753.

The family Umbelliferae was named after their characteristic inflorescence, a simple or compound umbel (a number of short flower stalks growing from a common point). Flowers in this umbel are in general creamy white, and about 3 mm in diameter. Seeds produced are roughly ovoid and in general 1.5 - 2 mm long.

The wild celery known as "smallage" can be as high as 1 meter; it has a furrowed stalk with wedge shaped leaves; the whole plant has a strong, earthy taste and a distinctive smell. From the cultivated forms, celery and celeriac, leaves, leaf stalks and taproot are used in salads (leaves, stalks) and stews and soups (bulbs from celeriac). Stalks can easily be separated into strings of vascular bundles.

Breeding developed modern cultivars which were selected, amongst others for solid petioles and large leaves. These leaves are featherlike (pinnate, bipinnate) from 3 - 6 cm long and 2 - 4 cm broad.

With cultivation and blanching, the stalks lose their acidic properties and assume the mild, sweetish and aromatic taste typical for celery as a salad plant. Next to these useful properties, surprisingly celery and celeriac are also plants which might provoke allergic reactions; the allergen is present in all parts and most abundantly in the seeds. Cooking does not destroy the allergen; even an allergenic reaction can be triggered by consuming food that has been processed with machines that previously processed celery. Therefore in the European Union, foods that contain or may contain (traces of) celery must be clearly labeled as such.

Bergapten, a furocoumarin, in the seeds can increase photosensitivity, so the use of essential oil externally in bright sunshine should be avoided.

Three main types of celery are known for cultivation: celery for cutting leaves and using leaf stalks (Λ. graveolens var. secalinum), blanched celery (var. dulce) where petioles are harvested (blanched by treatment or as character of the crop) and celeriac (var. rapaceum) from which the bulb or tuber (more correct, a thickened hypocotyl) is harvested. All varieties are used for soups and/or stews.

For cultivation, celery plants are grown from seed, sown either in a hot bed or in the open garden according to the season of the year, and they are, on attaining a height of 15-20 cm, planted out in deep trenches for convenience of blanching, which is effected by earthing up to exclude light from the stems. However, modern cultivars have leaves/stalks that also blanch without this laborious treatment.

Celeriac (incorrectly named celery root) forms a large bulb from its hypocotyl which is white on the inside. This bulb can be stored for months and serves as a main ingredient for stews and soups. Also from celeriac leaves are used as seasoning.

Due to the very high uniformity which modern cultivars possess, fields are only harvested once. After removing leaves and stalks, celery can be stored for several weeks at temperatures between 0 to 2 °C.

Celery is eaten around the world as a vegetable. In North America the crisp petiole

(leaf stalk) is used. In Europe celeriac, the hypocotyl, is used as a root vegetable. The leaves are strongly flavored and are used less often, either as a flavoring in soups and stews or as a dried herb.

As with many cultivated crops, also Apium graveolens is challenged by several pathogens. Next to viruses and several insects as leaf miners and shield bugs like Graphosoma sp., the most important pathogen threatening celery and celeriac cultivation is celery leaf spot or late blight, caused by the Ascomycete fungus Septoria apiicola.

Spores from S. apiicola are deposited on the plant by splashing or by movement of spores by contact. Infection of the host plant is promoted by cool and wet weather conditions. Temperatures below 24 °C combined with a high humidity allow for a great production of spores which then easily spread further in the crop. Septoria produces large amounts of asexual spores in fruiting bodies called pycnidia. Also, Septoria is seed borne and fruiting bodies can be found on the seed coat of celery seeds.

Thus, first appearance of the disease can already be noticed on the seedbed. Spores that are splashed onto healthy leaves germinate when moisture is available and produce initially a fungal thread called germ tube. This tube grows on the epidermis of the plant and then enters the leaf. Internally, the fungus keeps proliferating, causing yellow and then brown spots on the host. These leaf spots render a crop which unsuitable for sales, even when it is a minor affection of the leaf and/or the stalk. By severe infections also total yield and storability of the crop are affected. This holds especially for celery rather than celeriac since on this part of the plant no symptoms are developed. However, an infection with Septoria can also lead to loss of yield of celeriac.

It is therefore a desire to provide Apium graveolens plants with an improved tolerance or resistance to Septoria apiicola, the causal agent of leaf spot or late blight.

When Apium graveolens plants with an improved tolerance or resistance to Septoria apiicola are available, several advantages can be achieved. Yield and quality of the crop improve and a reduction in the application of fungicides can be reached.

One interesting approach was performed two decades ago, when researchers applied the process of somaclonal variation and selection to develop resistant cells, and consequently resistant plants. As described in ref. 1, authors used an isolate of S. apiicola to select A. graveolens cells by co-culturing cells on solid medium or in the fungal culture filtrate from the fungus. Resistant cells were developed, presumably by somaclonal variation, that were not killed off by the toxic compounds secreted by the fungus.

When plants were regenerated from these cells, they showed a range of different degrees of tolerance to S. apiicola in greenhouse tests. Plants yielded tolerant progenies but there are to our knowledge, no varieties on the market with an improved tolerance to S. apiicola originating from this or similar research.

To develop a solution for this problem, a breeding program was developed where first a source of resistance was identified. During several years, this source plant was crossed, backcrossed and finally self-pollinated to develop a parent line.

Considering the above, it is an object of the present invention, amongst other objects to obviate the above problems in the prior art.

This object, amongst other objects, is achieved by the present invention through the plants outlined in the appended claims.

Specifically, this object, amongst other objects, is achieved by providing an Apium graveolens plant, preferably cytoplasmic male sterile, which plant comprises one or more genomically encoded resistances against the plant pathogen Septoria apiicola. According a preferred embodiment the present at least one genomically encoded resistance against the plant pathogen Septoria apiicola is the genomically encoded resistance against the plant pathogen Septoria apiicola as present in deposit NCIMB 42711 (National Collections of Industrial, Food and Marine Bacteria (NCIMB), NCIMB Limited, Ferguson Building; Craibstone Estate, Bucksburn Aberdeen, Scotland, AB21 9YA United Kingdom) deposited on January 6, 2017.

According to another preferred embodiment, the present at least one genomically encoded resistance against the plant pathogen Septoria apiicola is obtained, or derived, from deposit NCIMB 42711.

The present Apium graveolens plants preferably comprise in their genome at least one sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15 and SEQ ID No. 17. The present sequences represent the resistance providing allele while plants comprising in their genome at least one sequence selected from the group consisting of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16 and SEQ ID No. 18 comprise the susceptible allele.

The present Apium graveolens plants further preferably comprise in their genome at least one sequence selected from the group consisting of SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25. The present sequences represent the resistance providing allele while plants comprising in their genome at least one sequence selected from the group consisting of SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24 and SEQ ID No. 26 comprise the susceptible allele.

The present Apium graveolens plants more preferably comprise in their genome at least one sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15 and SEQ ID No. 17 and at least one sequence selected from the group consisting of SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25. The present sequences represent the resistance providing alleles while plants comprising in their genome at least one sequence selected from the group consisting of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16 and SEQ ID No. 18 and at least one sequence selected from the group consisting of SEQ ID No. 20, SEQ ID No. 22, SEQ ID No. 24 and SEQ ID No. 26 comprise susceptible alleles.

Preferably, the present at least one sequences are at least two, at least three, at least four, at least five, at least six, at least seven, at least eight or nine of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15 and SEQ ID No. 17 and two, at least three or four of SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25.

According to an especially preferred embodiment, the present plant is selected from the group consisting of A. graveolens var. secalinum, A. graveolens var. dulce, and Apium graveolens var. rapaceum.

The present invention also relates to hybrid celery or celeriac obtainable by crossing Septoria apiicola susceptible celery or celeriac with the present Apium graveolens plants or hybrid celery or celeriac obtainable by crossing a Septoria apiicola susceptible celery or celeriac with deposit NCIMB 42711.

The present invention further relates to a method for identifying a genomically encoded resistance against the plant pathogen Septoria apiicola as present in deposit NCIMB 42711, the method comprises the step of detecting the genomically encoded resistance using one or more molecular markers.

The present invention further also relates to seeds or plant parts of plants defined above or to seeds capable of providing the present plants and to molecular markers which markers co-segregate with a genomically encoded resistance against the plant pathogen Septoria apiicola as present in deposit NCIMB 42711.

The present invention furthermore relates to molecular markers which markers co- segregate with a genomically encoded resistance against the plant pathogen Septoria apiicola as present in deposit NCIMB 42711 which molecular markers are selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, SEQ ID No. 21, SEQ ID No. 23 and SEQ ID No. 25. Figures

Figures 1 to 3: show photographs of representative plants according to the present invention.

These photographs were taken on one test location with natural infection with Septoria apiicola.

Specifically, figure 1 shows an overview of material grown from the deposit seeds, with affected susceptible plants in the background, figure 2 shows healthy unaffected leaf stalks of material grown from the deposit seeds and figure 3 shows healthy, unaffected leaves of material grown from the deposit seeds. Examples

Example 1: general protocol for assessing resistance. The pathogen Septoria apiicola is kept on dry, infected leaves at 4 °C. To prepare an inoculum, a layer of leaves of about 3 - 4 cm thick is put on filter paper in a plastic container of 21 * 15 * 2.5 cm; these leaves are wetted by spraying water until they are completely wet (not soaked). These containers are closed and put under light for three days; after this period leaves are washed with 0.5 liter of water. Spore concentration is not determined since Septoria apiicola spores are too small; the presence of the spores is only confirmed by microscopy. The inoculum can be used directly but can be stored for up to 6 hours at 4 °C.

Per genotype to be tested, 40 plants were assessed in two replicates. As susceptible control varieties Tango and /or Golden Spartan were used. For tests in the Netherlands, seeds were sown at the end of May or beginning of June; emerged plants are grown further in the field with a distance of 50 * 20 cm for celery or 50 * 35 cm for celeriac.

Inoculation is performed from the beginning of August; depending on conditions this inoculation has to be repeated, preferably under wet or drizzling conditions. To inoculate, infected leaves are spread in the crop or the spore suspension is dispersed using an ultra-low volume or droplet sprayer.

Tests in other parts of the world can also be performed provided the inoculation is done under circumstances with high relative humidity and moderate temperatures.

To assess the level of damage to the leaves, a score is made on a scale of 0 (completely affected) to 9 (no symptoms). When the plant stands longer, symptoms increase.

Damage is scored visually for leaves and stalks. For both celery and celeriac, a crop without any symptoms on leaves and/or leafstalks is highly preferred.

Example 2: as second example is described how disease resistance is assessed under field circumstances in Guatemala. In contrast to the Netherlands, the test location is on an altitude of 1300 - 1500 meters above sea level. This temperate area is characterized by a wet season (from mid-May until the end of October) where there is enough rainfall (total about 1100 mm) and, due to the low temperatures at night, relative humidity is high. Daytime temperature ranges from 15 to 25 °C; night temperature from 9 to 14 °C. During the rainy season, this results every night in a long wet leaf period (WLP) which is important for development of S. apiicola on the crop. These favorable conditions are very predictable resulting in good annual disease tests. Example 3: results of assessment for resistance against Septoria apiicola.

The assessment of resistance is scored on a scale from 0 to 9, where 0 is completely susceptible and 9 is high resistant.

Example 4: production ofFl seed applying CMS:

One of the requisites for a modern hybrid variety is that inbreeding, resulting in off type plants, is minimized. In celery, a reliable system for hybrid production is available based on cytoplasmic male sterility. Applying this feature for seed production with male and female parent lines, hybrids essentially are resulting 100 % from pure cross pollinations.

Example 5: genomically encoded resistance against Septoria apiicola in Apium graveolens plant

The genomic analysis of the Septoria apiicola resistant Apium graveolens plants has shown QTLs on linkage group 1 (LGl) and/or linkage group 9 (LG9). These QTLs are defined by the SNP markers listed in the table below.

SEQ ID No. Genetic position Sequence

(linkage group, cM) (SNP nucleotide is highlighted bold and underlined, first nucleotide is of the resistant allele and second of the susceptible one)

CGAACCCGAAACCTAAAGCTCAACAAfC/AlCACCAGTGCCAATGCCA

SEQ ID No. 1/2

LG01, 59.195 CCATCAC

CTTCCTTTC AGTTG AG CTG G ATAC A Af T/ G 1 AG C ATCTG G ATT AACC AC

SEQ ID No. 3/4 LG01, 60.618

ACCAAC

TAAAAAAAGAAAAAGAAGAGGAACAAfC/TlAACACACAATTCTATCA

SEQ ID No.5/6 LG01, 60.861

TTAAACT

AATGATCAATCGTAGGTTGTATTGCTfT/ClGAACATGCCCTTACATGC

SEQ ID No. 7/8 LG01, 61.580

ATAGAA

CGAACCTCCTCTAAACTCTCTCCGCCfT/AlATCCCAACAACCCCAACAA

SEQ ID No. 9/10 LG01, 61.892

ACTCC

GCTGTAGCACTGATACTACACCATCAfG/TlGCTCTTGATAKAGAGAGT

SEQ ID No.11/12 LG01, 62.187

TCTTTG

TCC ATTCTTCC ACTTCTC AAC A ATG C f C/ Al G G ATC A AGTTTCTCT AC AT

SEQ ID No.13/14 LG01, 62.187

GATTA

GATATTGGGTCAGGGTGAGAACAAGCfT/ClAGCCCAACCAGTAACAC

SEQ ID No.15/16 LG01, 62.501

TCTCCTC

AGTTCTAGCCTGCTACTTGCTACTCTfG/ClCTACTCAGAAGCAGAGGC

SEQ ID No.17/18 LG01, 63.110

GTCCGA

GATTTTTGAGCTAAAAGAATTGCTGTfT/ClTGTTTGAGATGTTACATA

SEQ ID No. 19/20 LG09, 112.525

CAAAAA

TGCATCCATTAGCAACGACAACCCTGfC/TlGCTAGTTTCATGTGTTGA

SEQ ID No. 21/22 LG09, 113.396

TGATGA

ATTTCTCCATACAGATGGCATTCTTTfT/ClGAGTTGATAMTATACAGT

SEQ ID No. 23/24 LG09, 115.647

GCAGCC

AAAGGTTATCGTCAAGTACTTCAAATfG/ClTTTCCTCTCTTGACAAAA

SEQ ID No. 25/26 LG09, 116.512

AGATYA

Example of pedigree, leading to the described hybrid with high level of resistance to Septoria apiicola.

In intermediate years plants were field-tested for their level of resistance.

Deposit information

A sample of A. graveolens 1520725 with resistance to Septoria apiicola as described herein was deposited at the NCIMB (National Collections of Industrial, Food and Marine Bacteria (NCIMB), NCIMB Limited, Ferguson Building; Craibstone Estate, Bucksburn Aberdeen, Scotland, AB21 9YA United Kingdom) on January 6, 2017 under number NCIMB 42711.

Reference

1. Plant Cell, Tissue and Organ Culture: 39,(3) 203-210 (1994) SEQUENCE LISTING

<110> Bejo Zaden B.V. <120> SEPTORIA RESISTANCE IN CELERY

<130> 4/2WM66/28

<150> NL2018464

<151> 2017-03-02

<160> 26

<170> BiSSAP 1.3.6

<210> 1

<211> 51

<212> DNA

<213> Apium graveolens

<400> 1

cgaacccgaa acctaaagct caacaaccac cagtgccaat gccaccatca c 51

<210> 2

<211> 51

<212> DNA

<213> Apium graveolens

<400> 2

cgaacccgaa acctaaagct caacaaacac cagtgccaat gccaccatca c 51

<210> 3

<211> 51

<212> DNA

<213> Apium graveolens <400> 3

cttcctttca gttgagctgg atacaatagc atctggatta accacaccaa c 51

<210> 4

<211> 51

<212> DNA

<213> Apium graveolens

<400> 4

cttcctttca gttgagctgg atacaagagc atctggatta accacaccaa c 51

<210> 5

<211> 51

<212> DNA

<213> Apium graveolens

<400> 5

taaaaaaaga aaaagaagag gaacaacaac acacaattct atcattaaac t 51

<210> 6

<211> 51

<212> DNA

<213> Apium graveolens

<400> 6

taaaaaaaga aaaagaagag gaacaataac acacaattct atcattaaac t 51

<210> 7

<211> 51

<212> DNA

<213> Apium graveolens <400> 7

aatgatcaat cgtaggttgt attgcttgaa catgccctta catgcataga a 51

<210> 8

<211> 51

<212> DNA

<213> Apium graveolens

<400> 8

aatgatcaat cgtaggttgt attgctcgaa catgccctta catgcataga a 51

<210> 9

<211> 51

<212> DNA

<213> Apium graveolens

<400> 9

cgaacctcct ctaaactctc tccgcctatc ccaacaaccc caacaaactc c 51

<210> 10

<211> 51

<212> DNA

<213> Apium graveolens

<400> 10

cgaacctcct ctaaactctc tccgccaatc ccaacaaccc caacaaactc c 51

<210> 11

<211> 51

<212> DNA

<213> Apium graveolens <400> 11

gctgtagcac tgatactaca ccatcaggct cttgatakag agagttcttt g

<210> 12

<211> 51

<212> DNA

<213> Apium graveolens

<400> 12

gctgtagcac tgatactaca ccatcatgct cttgatakag agagttcttt g

<210> 13

<211> 51

<212> DNA

<213> Apium graveolens

<400> 13

tccattcttc cacttctcaa caatgccgga tcaagtttct ctacatgatt

<210> 14

<211> 51

<212> DNA

<213> Apium graveolens

<400> 14

tccattcttc cacttctcaa caatgcagga tcaagtttct ctacatgatt

<210> 15

<211> 51

<212> DNA

<213> Apium graveolens <400> 15

gatattgggt cagggtgaga acaagctagc ccaaccagta acactctcct

<210> 16

<211> 51

<212> DNA

<213> Apium graveolens

<400> 16

gatattgggt cagggtgaga acaagccagc ccaaccagta acactctcct

<210> 17

<211> 51

<212> DNA

<213> Apium graveolens

<400> 17

agttctagcc tgctacttgc tactctgcta ctcagaagca gaggcgtccg

<210> 18

<211> 51

<212> DNA

<213> Apium graveolens

<400> 18

agttctagcc tgctacttgc tactctccta ctcagaagca gaggcgtccg

<210> 19

<211> 51

<212> DNA

<213> Apium graveolens <400> 19

gatttttgag ctaaaagaat tgctgtttgt ttgagatgtt acatacaaaa a 51

<210> 20

<211> 51

<212> DNA

<213> Apium graveolens

<400> 20

gatttttgag ctaaaagaat tgctgtctgt ttgagatgtt acatacaaaa a 51

<210> 21

<211> 51

<212> DNA

<213> Apium graveolens

<400> 21

tgcatccatt agcaacgaca accctgcgct agtttcatgt gttgatgatg a 51

<210> 22

<211> 51

<212> DNA

<213> Apium graveolens

<400> 22

tgcatccatt agcaacgaca accctgtgct agtttcatgt gttgatgatg a 51

<210> 23

<211> 51

<212> DNA

<213> Apium graveolens <400> 23

atttctccat acagatggca ttcttttgag ttgatamtat acagtgcagc

<210> 24

<211> 51

<212> DNA

<213> Apium graveolens

<400> 24

atttctccat acagatggca ttctttcgag ttgatamtat acagtgcagc

<210> 25

<211> 51

<212> DNA

<213> Apium graveolens

<400> 25

aaaggttatc gtcaagtact tcaaatgttt cctctcttga caaaaagaty

<210> 26

<211> 51

<212> DNA

<213> Apium graveolens

<400> 26

aaaggttatc gtcaagtact tcaaatcttt cctctcttga caaaaagaty a 51