This invention relates to the use of nucleotides which contain a modified polyphosphate unit in the sequencing of nucleic acids such as naturally-occurring or synthetic DNA or RNA.

In our previous applications WO 2014/053853, WO 2014/053854, WO2014/167323, WO2014/167324, WO2014/111723 and WO2015/121675, we have described a new sequencing method which involves progressive digestion of a polynucleotide analyte to generate an ordered stream of single nucleotides, preferably a stream of single nucleoside triphosphates, each of which can be captured one-by-one into corresponding droplets in a microdroplet stream. Thereafter, each droplet can be chemically and/or enzymatically manipulated to reveal the particular single nucleotide it originally contained. In one embodiment, these chemical and/or enzymatic manipulations comprise a method involving the use of one or more two-component oligonucleotide probe types each of which is adapted to be able to selectively capture one of the single nucleotide types from which the analyte is constituted. Typically, in each of such probe types, one of the two oligonucleotide components comprises characteristic fluorophores, and in the probe's unused state, the ability of these fluorophores to fluoresce remains extinguished by virtue of the presence of quenchers located close-by or by mutual quenching using like fluorophores. In use, when the probe has captured its corresponding single nucleotide, it is rendered susceptible to subsequent exonucleolysis and/or endonucleolysis thereby liberating the fluorophores from the quenchers and/or each other enabling them to fluoresce freely. By this means, the original single nucleotide present in each droplet can be inferred indirectly by spectroscopic means.

Variants of this method have been described in other of our pending applications including WO201405385 and WO2016012789; the latter involving the use of a three-component probe. In particular, WO2016012789 describes an improved method characterised by the steps of (1) generating a stream of single nucleoside triphosphates by progressive digestion of the nucleic acid; (2) producing at least one substantially double-stranded oligonucleotide used probe by reacting in the presence of a polymerase and a ligase at least one of the single nucleoside triphosphates with a corresponding probe comprising (a) a first single-stranded oligonucleotide labelled with e.g. characteristic fluorophores in an undetectable state and (b) second and third single-stranded oligonucleotides capable of hybridising to complementary regions on the first oligonucleotide; (3) digesting the used probe with an enzyme having double-stranded exonucleolytic activity to yield the fluorophores in a detectable state and a single-stranded fourth oligonucleotide which is at least in part the sequence complement of the first oligonucleotide; (4) reacting the fourth oligonucleotide with another first oligonucleotide to produce a substantially double-stranded oligonucleotide product corresponding to the used probe; (5) repeating steps (3) and (4) in a cycle and (6) detecting the fluorophores released in each iteration of step (3). This method has the advantage that by iterating steps (3) and (4) in a cycle the fluorescence signal can be made to grow strongly thereby improving the overall sensitivity and therefore reliability of nucleotide detection. In one embodiment, the second and third oligonucleotides are linked so that, after nucleotide capture, they form a closed-loop single-stranded oligonucleotide component which is advantageously resistant to exonucleolysis.

One potential problem with methods of the type described in these patent applications is that, because they rely on accurately identifying only those single nucleoside triphosphate molecules derived from the sample being analysed, they risk being compromised by the presence of adventitious single nucleoside triphosphate contaminants. This can in some instances be a particular problem as these contaminants (1) are common in analyte samples derived from lysed cellular material; (2) are often present at low levels in the sort of reagents routinely used in laboratories and (3) have a tendency to naturally build-up on the surface of equipment components over time. This problem can be solved in part by pre-treating the sample and any reagents used with an enzyme which renders these contaminants inert to the probe systems described in the above-mentioned patent applications; for example, by means of a phosphatase to convert them to the corresponding unreactive nucleoside monophosphates. However, this approach requires the enzyme to be removed or deactivated prior to the pyrophosphorolysis step in order to prevent corresponding deactivation of the single nucleoside triphosphates of interest as they are released from the analyte. As such, this approach does not solve the problem of downstream build-up of surface contaminants.

We have now developed an approach which overcomes these problems meaning that the phosphatase can be present at all times during the sequencing method. It relies on modifying the pyrophosphorolysis step so that the product produced is a stream of single and isolated modified single nucleoside polyphosphates which although not hydrolysable by this phosphatase are still compatible with the types of probe system we have described previously. At the heart of this approach is an enzymatic digestion method which is more generally applicable to the production of modified single nucleoside polyphosphates.

W02014/165210 teaches the preparation of modified nucleoside phosphates by pyrophosphorolysis of a polynucleotide in the presence of for example imidodiphosphate ions. WO00/49180 teaches depolymerisation of a polynucleotide using a modified pyrophosphate ion. Accordingly, there is provided a method of sequencing a polynucleotide characterised by comprising the steps of; (1) reacting the polynucleotide with a Group IA, Group IIA or ammonium salt of an acid having the formula Y-H wherein Y- corresponds to the general formula (X-0) ₂ P(=B)- (Z-P(=B)(0-X)) _n - wherein n is an integer from 1 to 4; each Z- is selected independently from -0-, - NH- or -CH2-; each B is independently either O or S; the X groups are independently selected from - H, -Na, -K, alkyl, alkenyl, or a heterocyclic group with the proviso that when both Z and B correspond to -O- and when n is 1 at least one X group is not H and a pyrophosphorolysis enzyme under conditions such that the polynucleotide is progressively pyrophosphorolysed into a corresponding stream of single modified nucleoside polyphosphate molecules each comprised of a polyphosphate unit of formula Y-Q' wherein Q' is comprised of phosphate and a nucleoside unit including one of the constituent nucleobases of the polynucleotide; (2) reacting each modified single nucleoside polyphosphate in the stream in the presence of a polymerase and optionally a ligase with a probe system comprised of one or more oligonucleotide probes each having a capture site complementary to that of one of the nucleobases of the polynucleotide and labelled with one or more fluorophores characteristic thereof and which in the probe's unused state are non-fluorescing to produce a corresponding stream of used probes; (3) reacting each used probe in the stream with a restriction endonuclease and/or an exonuclease to render the fluorophores fluorescing and (4) analysing the characteristic fluorescence from the fluorescing fluorophores and inferring therefrom the nucleobase associated with captured modified single nucleoside triphosphate.

The products produced by step (1) of the method of the invention are in one embodiment modified single nucleoside polyphosphates in which Y corresponds to the general formula (X- 0) ₂ P(=B)-(Z-P(=B)(0-X)) _n - wherein n is 1, 2, 3 or 4. In another embodiment, the Y group corresponds to the general formula (X-0) ₂ P(=0)-Z-P(=0)(0-H)- wherein one of the X groups is -H. In yet another preferred embodiment, Y corresponds to the general formula (X-0) ₂ P(=0)-Z-P(=0)(0-X)-- wherein at least one of the X groups is selected from methyl, ethyl, allyl or dimethylallyl.

In an alternative embodiment, the modified nucleoside polyphosphate is one in which Y- corresponds to either of the general formulae (H-0) ₂ P(=0)-Z-P(=0)(0-H)- wherein Z is either -NH- or -CH2- or (X-0) ₂ P(=0)-Z-P(=0)(0-X)-- wherein the X groups are all either- Na or -K and Z is either - NH- or -CH2-.

In another embodiment, the modified nucleoside polyphosphate is one in which Y- corresponds to the general formula (H-0) ₂ P(=B)-0-P(=B)(0-H)- wherein each B group is independently either O or S, with at least one being S. Specific examples of preferred Y groups include those of the formula (X1-0)(H0)P(=0)-Z- P(=0)(0-X2) wherein Z is O, NH or Ch and (a) XI is g,g-dimethylallyl, and X2 is -H; or (b) XI and X2 are both methyl; or (c) XI and X2 are both ethyl; or (d) XI is methyl and X2 is ethyl or vice versa.

Where the analyte is DNA, it is suitably a double-stranded polynucleotide the length of which can in principle be unlimited; for example, including up to the many millions of nucleotides found in a human gene or chromosome fragment. Typically, however, the polynucleotide will be at least 10, preferably at least 50 nucleotide pairs long; suitably it will be greater than 100, greater than 500 and in many cases thousands of nucleotide pairs long. In one embodiment, the analyte is preferably RNA or DNA of natural origin (e.g. derived from a plant, animal, bacterium or a virus) although the method can also be used with synthetically-produced RNA or DNA or other nucleic acids made up wholly or in part of nucleotides whose nucleobases are not commonly encountered in nature; i.e. nucleobases other than adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Examples of such nucleobases include 4-acetylcytidine, 5-(carboxyhydroxylmethyl)uridine, 2-0- methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylamino- methyluridine, dihydrouridine, 2-O-methylpseudouridine, 2-O-methylguanosine, inosine, N6- isopentyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1- methylinosine, 2,2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5- methoxyaminomethyl-2-thiouridine, 5-methoxyuridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 2-methylthio-N6-isopentenyladenosine, uridine-5-oxyacetic acid-methylester, uridine-5-oxyacetic acid, wybutoxosine, wybutosine, pseudouridine, queuosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, 2-0-methyl-5- methyluridine and 2-O-methyluridine.

According to step (1) of the method of the invention, in one embodiment a polynucleotide analyte is progressively digested by a pyrophosphorolysing enzyme (typically a polymerase exhibiting such behaviour) in the presence of the salt of the corresponding acid Y-H to generate a stream of the single modified nucleoside polyphosphates the order of which corresponds to that of the nucleobase sequence of the analyte. Suitably the salt is a Group IA, IIA or ammonium salt; for example, a sodium salt. The term 'single' is used herein to distinguish the isolated monomeric products produced by the pyrophosphorolysis reaction from polymeric material comprised of two or more of such monomer units. Such pyrophosphorolysis may suitably be carried out at a temperature in the range 20 to 90°C. In one embodiment, it is carried out under conditions of continuous flow so that the single modified nucleoside polyphosphates are continually removed from around the analyte as they are liberated. Most preferably, this digestion reaction is carried out by causing an aqueous buffered medium containing the enzyme, the salt and the other typical additives to continuously flow over a surface such as a particle e.g. a microbead to which the analyte has previously been bound.

Further information and examples regarding the pyrophosphorolysis reaction as applied to the digestion of polynucleotides using unmodified pyrophosphate anion can be found in J. Biol. Chem. 244 (1969) pp. 3019-3028 or our earlier applications mentioned above.

In one embodiment of the method of the invention, at least step (1), preferably all of steps (1) to (3), are carried out in the presence of a phosphatase. In another embodiment, the polynucleotide is a constituent of an analyte sample, for example, one derived from lysis of cellular material by fractionation, which has thereafter been pre-treated with a phosphatase and wherein the phosphatase is retained in the reaction medium employed in the sequencing method for at least some of steps (1) to (3).

Examples of the oligonucleotide probes which may be employed in step (2) of the sequencing method described can be found in our earlier applications WO2014053853, WO2014167323, WO2016012789, EP16187112, EP16187493, EP161897791 and EP17171168 to which the reader is directed for further details and for information about the enzymes required to make the probes function (some or all of ligase, polymerase, exonuclease, endonuclease etc.). These detector probes are characterised by being quenched in their used state but after use are capable of undergoing exonucleolysis and/or endonucleolysis to release their constituent fluorophores in a fluorescing state. They are also characterised by being selective for nucleoside polyphosphates over nucleoside monophosphates.

In one embodiment, these oligonucleotide probes are comprised of (a) a first single- stranded oligonucleotide labelled with characteristic fluorophores in an undetectable state and (b) second and third single-stranded oligonucleotides capable of hybridising to complementary regions on the first oligonucleotide.

In another, they are comprised of (a) a first single-stranded oligonucleotide including a restriction endonuclease nicking-site, a single nucleotide capture site for capturing the single nucleoside triphosphate and oligonucleotide regions juxtaposed either side of the nicking-site bearing respectively at least one fluorophore and at least one quencher so as to render the fluorophores quenched and (b) second and third single-stranded oligonucleotides capable of hybridising to complementary regions on the first oligonucleotide either side of the capture site. In yet another embodiment, they are comprised of either (a) a first single-stranded oligonucleotide including an exonuclease blocking-site, a restriction endonuclease recognition-site located on the 5' side of the blocking-site and including a single nucleotide capture-site for capturing the single nucleoside triphosphate, and at least one fluorophore region located on the 5' side of the recognition-site arranged so as to render the fluorophore(s) quenched and (b) a second and optionally a third single-stranded oligonucleotide each separate from the first oligonucleotide and capable of hybridising to complementary regions on the first oligonucleotide flanking the 3' and 5' sides of the capture-site or (a) a first single-stranded oligonucleotide including an exonuclease blocking-site, a restriction endonuclease recognition-site located on the 3' side of the blocking-site and including a single nucleotide capture-site for capturing the single nucleoside triphosphate, and at least one fluorophore region located on the 3' side of the recognition-site arranged so as to render the fluorophore(s) quenched and (b) a second and optionally a third single- stranded oligonucleotide each separate from the first oligonucleotide and capable of hybridising to complementary regions on the first oligonucleotide flanking the 3' and 5' sides of the capture-site.

In a further embodiment, they are comprised of either (i) two components comprising; (a) a first oligonucleotide comprising a double-stranded region and a single-stranded region and (b) a second single-stranded oligonucleotide whose nucleobase sequence is at least partially complimentary to that of the single-stranded region of the first oligonucleotide or (ii) a single oligonucleotide comprising a single-stranded nucleotide region the ends of which are attached to two different double-stranded oligonucleotide regions; and wherein the oligonucleotide capture systems are labelled with fluorophores in an undetectable state

In another embodiment they are comprised of a single-stranded nucleotide region the ends of which are attached to double-stranded oligonucleotide regions wherein at least one of the oligonucleotide regions comprises fluorophores in an undetectable state.

In step (3), the used probes created in step (2) are progressively digested to cause the hitherto undetectable fluorophores to fluoresce and become detectable. Exactly how this occurs will be dependent on the particular types of described above and the reader is directed to the corresponding patent listed above for further information. Briefly, this step comprises endonucleolytic and/or exonucleolytic digestion of the used probe to separate the probes fluorophores and quenchers or regimes of self-quenching fluorophores. In one embodiment, where an exonucleolysis step is included, the fluorophores are typically separated from each other or quenchers by digesting a component of the used probe into constituent nucleoside monophosphates. Thereafter, and in step (4), the fluorophores liberated in step (3) are detected and the nature of the nucleobase attached to each modified single nucleoside triphosphate determined by inference. By carrying out the method of the invention systematically for all the modified single nucleoside triphosphates in the stream generated in step (1), a data stream characteristic of the sequence of the original polynucleotide can be generated and analysed. Methods of generating this data stream are well-known in the art; for example the reaction medium can be interrogated with light from a laser or like source of high-intensity electromagnetic radiation and any fluorescence generated detected using a photodetector or an equivalent device tuned to the characteristic fluorescence wavelength(s) or wavelength envelope(s) of the various fluorophores. This in turn causes the photodetector to generate a characteristic electrical signal which can be processed and analysed in a computer or other microprocessor using known algorithms.

In one preferred embodiment, at least one of steps (2) to (4) preferably all are carried out in microdroplets dispersed within an immiscible carrier medium in accordance with our earlier applications.

The method of the invention is now illustrated with reference to the following examples. Example 1: Pyrophosphorolysis using pyrophosphate analogues

A single-stranded first oligonucleotide 1 was prepared, having the following nucleotide sequence:

5'-AT G ACCT CGT AAGCC AGT GT C AG AG F FTT QTTCCAGCCGT-3'

wherein A, C, G, and T represent nucleotides bearing the relevant characteristic nucleobase of DNA; F represents a deoxythymidine nucleotide (T) labelled with Atto 594 dye using conventional amine- attachment chemistry and Q represents a deoxythymidine nucleotide labelled with a BHQ-2 quencher.

Another single-stranded oligonucleotide 2 was also prepared, having the following nucleotide sequence:

5'-TTCACACGGCTGGAAAAAAACTCTGACACTGGCTTACGAGGTCATTAGATX-3'

wherein X represents an inverted 3' dT nucleotide, such that when oligonucleotide 2 is annealed to oligonucleotide 1 the 3' end of oligonucleotide 1 is recessed, making it a target for

pyrophosphorolysis, while the 3' end of oligonucleotide 2 is protected from pyrophosphorolysis by the presence of the terminal inverted nucleotide.

A reaction mixture was then prepared, having a composition corresponding to that derived from the following formulation:

20uL 5x buffer pH 8.0 lOuL oligonucleotide 1, 1000 nM

lOuL oligonucleotide 2, 1000 nM

2.5U Mako DNA polymerase (ex. Qiagen Beverly)

lOuL inorganic pyrophosphate, 6mM OR imidodiphosphate, lOmM OR water

Water to lOOuL

wherein the 5x buffer comprised the following mixture:

50uL Trizma Acetate, 1M, pH 8.0

25uL aqueous Magnesium Acetate, 1M

25uL aqueous Potassium Acetate, 5M

50uL Triton X-100 surfactant (10%)

Water to lmL

Pyrophosphorolysis of oligonucleotide 1 was then carried out by incubating the mixture at 37°C for 75 minutes. As oligonucleotide 1 was progressively pyrophosphorolysed, the fluorescent dye molecules were separated from the quenchers and were then able to generate a fluorescent signal. The growth in this fluorescence during the incubation was monitored using a CLARIOStar microplate reader (ex. BMG Labtech) and used to infer the rate of pyrophosphorolysis of the oligonucleotide in the presence of inorganic pyrophosphate, imidodiphosphate or water.

The results of this experiment are shown graphically in figure 1. From this it can be seen that pyrophosphorolysis proceeds in the presence of pyrophosphate or imidodiphosphate, but not in their absence. Similarly, in a comparative experiment where no polymerase was present no fluorescent signal was generated. Pyrophosphorolysis in the presence of pyrophosphate produces free nucleotide triphosphates, while pyrophosphorolysis in the presence of imidodiphosphate produces modified free nucleotide triphosphates with an N-H group in place of O between the beta and gamma phosphates (2'-Deoxynucleoside-5'-[( ,y)-imido]triphosphates).

Example 2: Detection of modified nucleotides

A single-stranded first oligonucleotide 1 was prepared, having the following nucleotide sequence:

5'-GTGCCGGGCTCGTGTCTCTGCGTTTCTTGFFQACTTGACCGTTGCTCCTTTCTCCTA TCTX-3' wherein A, C, G, and T represent nucleotides bearing the relevant characteristic nucleobase of DNA; F represents a deoxythymidine nucleotide (T) labelled with Atto 655 dye using conventional amine- attachment chemistry; Q represents a deoxythymidine nucleotide labelled with a BHQ-2 quencher and X represents an inverted 3' dT nucleotide. It further comprises a capture site (C nucleotide) at the 40 ^th base from its 5' end, selective for capturing deoxyguanosine triphosphate nucleotides (dGTPs) in a mixture of deoxynucleoside triphosphates (dNTPs), and the recognition sequence for the nicking restriction endonuclease HpyCH4lll, 'ACNGT'.

Another single-stranded oligonucleotide 2, comprising an oligonucleotide region having a sequence complementary to the 3' region flanking the capture site of the first oligonucleotide, and a single-stranded oligonucleotide 3, comprising an oligonucleotide region having a sequence complementary to the 5' region flanking the capture site of the first oligonucleotide, a 5' phosphate group, and a 3' inverted dT nucleotide, were also prepared. They had the following nucleotide sequences:

Oligonucleotide 2: 5'-GAAAGGAGCAAC-3'

Oligonucleotide 3: 5' -PGT CAAGT AAAC AAG AAACGCTX-3'

wherein P represents the 5' phosphate group and X the inverted 3' dT nucleotide.

A reaction mixture comprising the probe system was then prepared. It had a composition corresponding to that derived from the following formulation:

20uL 5x buffer pH 8.0

lOuL oligonucleotide 1, 350 nM

lOuL oligonucleotide 2, 5 nM

lOuL oligonucleotide 3, 1000 nM

lOuL spermine solution, lOmM

5U HpyCH4l II restriction endonuclease (ex. New England Biolabs Inc.)

2.9U Bst Large Fragment polymerase

1.2U KOD Xtreme polymerase

6.7U Thermostable Inorganic Pyrophosphatase

lOuL 2'-Deoxyguanosine-5'-[( ,y)-imido]triphosphate (dGppNHp), 1 nM OR water Water to lOOuL

wherein the 5x buffer comprised the following mixture:

50uL Trizma Acetate, 1M, pH 8.0

25uL aqueous Magnesium Acetate, 1M

25uL aqueous Potassium Acetate, 5M

50uL Triton X-100 surfactant (10%)

Water to lmL

Capture of the dGppNHp onto oligonucleotide 2 to form a used probe was then carried out by incubating the mixture at 37°C for 10 minutes after which the temperature was increased to 50°C for a further 120 minutes to allow iterated cleaving of the first oligonucleotide by the HpyCH4l 11 enzyme. The temperature was then increased to 73.5°C for a further 45 minutes to allow digestion of the cleaved first oligonucleotide components bearing the fluorophores and quenchers. The fluorescence intensity of the Atto655 dye in the reaction mixture was measured using a CLARIOStar microplate reader (ex. BMG Labtech) as the reaction proceeded.

The intensity of fluorescence after the final 45-minute digestion step was measured in the presence and absence of the dGppNHp component of the reaction and the results shown graphically in figure 2. From this it can be seen that the probe system efficiently captures the dGppNHp and the cyclic nature of the reaction process leads to the generation of a substantial fluorescence signal. On the contrary, in a comparative experiment where no dGppNHp was present in the reaction mixture the Atto 655 dye on oligonucleotide 1 did not exhibit fluorescence to any significant extent.

Example 3: Phosphatase resistance of modified nucleotides

A reaction mixture was prepared, having a composition corresponding to that derived from the following formulation:

20uL 5x buffer pH 8.0

2.5U Mako DNA polymerase (ex. Qiagen Beverly)

lOuL inorganic pyrophosphate, 0.6mM

lOuL dGTP, 0.25nM OR 2'-Deoxyguanosine-5'-[( ,y)-imido]triphosphate (dGppNHp), 1 nM OR water

0.04U Apyrase or equivalent volume water

Water to lOOuL

wherein the 5x buffer comprised the following mixture:

50uL Trizma Acetate, 1M, pH 8.0

25uL aqueous Magnesium Acetate, 1M

25uL aqueous Potassium Acetate, 5M

50uL Triton X-100 surfactant (10%)

Water to lmL

The mixture was incubated for 30 minutes at 37°C to allow the Apyrase to hydrolyse any nucleotide triphosphates present, and was then combined with a second reaction mixture, having a composition corresponding to that derived from the following formulation:

20uL 5x buffer pH 8.0

lOuL oligonucleotide 1, 350 nM

lOuL oligonucleotide 2, 5 nM lOuL oligonucleotide 3, 1000 nM

lOuL spermine solution, 20mM

10U HpyCH4lll restriction endonuclease (ex. New England Biolabs Inc.)

5.8U Bst Large Fragment polymerase

2.4U KOD Xtreme polymerase

13.3U Thermostable Inorganic Pyrophosphatase

Water to lOOuL

wherein the 5x buffer comprised the following mixture:

50uL Trizma Acetate, 1M, pH 8.0

25uL aqueous Magnesium Acetate, 1M

25uL aqueous Potassium Acetate, 5M

50uL Triton X-100 surfactant (10%)

Water to lmL

and wherein oligonucleotides 1, 2 and 3 are as described in Example 2.

Capture of any deoxyguanosine nucleoside triphosphates onto oligonucleotide 2 to form a used probe was then carried out by incubating the mixture at 37°C for 10 minutes after which the temperature was increased to 50°C for a further 120 minutes to allow iterated cleaving of the first oligonucleotide. The temperature was then increased to 73.5°C for a further 45 minutes to allow digestion of the cleaved first oligonucleotide components bearing the fluorophores and quenchers. The fluorescence intensity of the Atto655 dye in the reaction mixture was measured using a CLARIOStar microplate reader (ex. BMG Labtech) as the reaction proceeded.

The intensity of fluorescence after the final 45-minute digestion step was measured in the presence and absence of Apyrase and in the presence of dGTP, dGppNHp or water in the first reaction mix. The fluorescence over background observed in the presence of Apyrase as a fraction of that observed in the absence of Apyrase is shown graphically in figure 3 for dGTP, dGppNHp and water. From this it can be seen that Apyrase efficiently hydrolyses the dGTP, substantially reducing the signal observed in this sample, while the dGppNHp is unaffected by incubation with Apyrase. When neither dGTP nor dGppNHp is present no significant fluorescence is observed.