LEONARD MICHAEL (US)
BETHUNE MICHAEL (US)
BALTIMORE DAVID (US)
WO2014127261A1 | 2014-08-21 | |||
WO2017070608A1 | 2017-04-27 | |||
WO2016168773A2 | 2016-10-20 |
REISER, J.-B. ET AL.: "Analysis of relationships between peptide/MHC structural features and naive T cell frequency in humans", THE JOURNAL OF IMMUNOLOGY, vol. 193, no. 12, 2014, pages 5816 - 5826, XP055581331, DOI: 10.4049/jimmunol.1303084
JOGLEKAR, A. ET AL.: "Abstract: T cell antigen discovery using signaling and antigen-presenting bifunctional receptors (SABRs)", THE JOURNAL OF IMMUNOLOGY, vol. 200, 1 May 2018 (2018-05-01), XP055581334
See also references of EP 3679065A4
WHAT IS CLAIMED IS: 1. A signaling and antigen-presenting bifunctional receptor (SABR) comprising: an antigen presenting domain; and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a major histocompatibility complex (MHC) molecule. 2. The SABR of Claim 1, wherein the antigen presenting domain comprises a MHC. 3. A nucleic acid encoding for the SABR of Claim 1. 4. A cell comprising the nucleic acid of Claim 3. 5. The SABR of Claim 1, wherein the MHC comprises a Class I MHC. 6. The SABR of Claim 1, wherein the MHC comprises a Class II MHC. 7. The SABR of Claims 5 or 6, further comprising a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain binds to the peptide. 8. The SABR of Claim 1, wherein the signal transduction domain comprises a T cell signaling domain. 9. The SABR of Claim 1, wherein the signal transduction domain is derived from a cytokine receptor, wherein the cytokine receptor comprises IL2 Receptor, IL4 Receptor, EPO Receptor, GM-CSF Receptor, JAK-STAT, CCL10 Receptor, a G protein coupled receptor, or a receptor of the TNF Receptor superfamily. 10. The SABR of Claim 1, wherein the signal transduction domain comprises 4- 1BB (CD137), CD28, CD27, DAP10, ICOS, OX40, PDl, CTLA4, TIM3, CD3zeta, Notch, synNotch, chemical-induced dimerization, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2 Receptor, IL4 Receptor, EPO Receptor, GM-CSF Receptor, JAK-STAT, CCL10 Receptor, a G protein coupled receptor, a receptor of the TNF receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, or a NOD-like receptors. 11. The SABR of Claim 1, further comprising a transmembrane domain. 12. The SABR of Claim 11, wherein the transmembrane domain comprises a transmembrane domain from one or more of 4-lBB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, CD3zeta, Notch, synNotch, chemical-induced dimerization, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2 Receptor, IL4 Receptor, EPO Receptor, GM-CSF Receptor, JAK-STAT, CCL10 Receptor, a G protein coupled receptor, a receptor of the TNF Receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, a NOD-like receptor, or an MHC molecule. 13. The SABR of Claim 11, wherein the transmembrane domain comprises any one or more of the transmembrane domains of Tables 0.1, 0.2, or 0.3 (as appropriate). 14. The SABR of Claim 1, wherein the antigen presenting domain comprises any one or more of the antigen presenting domains of Tables 0.1, 0.2, or 0.3 (as appropriate). 15. The SABR of Claim 1, wherein the signal transduction domain comprises any one or more of the signal transduction domains of Tables 0.1, 0.2, or 0.3 (as appropriate). 16. The SABR of Claim 1, wherein the antigen presenting domain is fused to the signal transduction domain. 17. The SABR of Claim 1, further comprising one or more linkers. 18. A cell comprising : an extracellular peptide-MHC complex comprising: an antigen presenting domain linked to a signal transduction domain, wherein the antigen presenting domain comprises an MHC molecule. 19. The cell of Claim 18, wherein the cell comprises any one or more of the SABRs from any one of Claims 1-2 and 5-17. 20. An isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs of Claims 1-2 and 5-17. 21. A method for preparing a signaling cell, the method comprising: providing a target cell; and introducing into the target cell a nucleic acid molecule comprising a nucleotide sequence coding for a SABR directed against at least one T cell receptor (TCR) expressed at the surface of a T cell, wherein the SABR comprises a MHC linked to a signal transduction domain. 22. A method for antigen discovery, the method comprising: expressing a SABR of any one of Claims 1-2, and 5-17 in at least one reporter cell, wherein the at least one reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of an antigen receptor to the antigen presenting domain; incubating the at least one reporter cell with the antigen receptor to be tested for binding to the SABR; detecting a presence of the measurable signal in the at least one reporter cell when the antigen receptor binds; and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor. 23. The method for antigen discovery of Claim 22, wherein the antigen receptor comprises a soluble molecule. 24. The method for antigen discovery of Claim 23, wherein the soluble molecule comprises an antibody. 25. The method for antigen discovery of Claim 22, wherein the antigen receptor is expressed on a cell. 26. The method for antigen discovery of Claim 25, wherein the antigen receptor comprises a TCR expressed on a T cell. 27. The method for antigen discovery of Claim 22, wherein the at least one reporter cell comprises a library of cells, wherein the library of cells has numerous different SABRs, and wherein the numerous different SABRs can bind to different antigen receptors. 28. The method for antigen discovery of Claim 22, wherein the antigen receptor comprises numerous antigen receptors. 29. The method for antigen discovery of Claim 22, wherein numerous different SABRs are expressed and one determines which SABR a particular antigen receptor binds to by monitoring the measurable signal and identifying which SABR is in the cell that exhibited the measurable signal. 30. The method for antigen discovery of Claim 22, wherein more than one antigen receptor is present and one determines which antigen receptor binds to a particular SABR. 31. The method for antigen discovery of Claim 22, wherein more than one antigen receptor and more than one SABR are present. 32. The method for antigen discovery of Claim 22, wherein the at least one reporter cell comprises NFAT-GFP-Jurkat cells. 33. The method for antigen discovery of Claim 22, wherein the measurable signal comes from expression of a detectable marker. 34. The method for antigen discovery of Claim 22, wherein the reporter cells expressing the measurable signal are identified using flow cytometry. 35. The method for antigen discovery of Claim 22, wherein the antigen receptor comprises an expressed orphan T cell receptors (TCR). 36. The method for antigen discovery of Claim 22, wherein the one or more reporter cells expresses a genetically encoded antigen or antigenic epitope. 37. The method for antigen discovery of Claim 36, further comprising identifying the genetically encoded antigen or antigenic epitope by DNA sequencing. 38. A library comprising: a SABR of any one of Claims 1-2, and 5-17; and at least one candidate antigen receptor. 39. The library of Claim 38, wherein the at least one antigen receptor is expressed on a cell, wherein the cell is an antigen receptor cell. 40. The library of Claim 38 or 39, wherein the SABR is expressed on a reporter cell, such that the cell provides a detectable marker upon binding of the SABR to the antigen receptor. 41. The library of Claim 40, wherein the reporter cell comprises NFAT-GFP- Jurkat cells. 42. The library of Claim 39, wherein the antigen receptor cell comprises T cells comprising TCR. 43. The library of Claim 39, wherein the antigen receptor cell comprises a cell expressing orphan TCR. 44. A method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs of Claims 1- 2 and 5-17; and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject. 45. The method for initiating a therapeutic response of Claim 44, wherein the cellular response results in one or more of: cell mediated cytotoxicity, release of inflammatory cytokines, release of suppressive cytokines, direct suppression of target cells, release of anti-inflammatory cytokines, induction of pro-proliferative signals, induction of anti-proliferative signals, induction of apoptosis, induction of cell exhaustion markers, and direct target cell activation. 46. The method for initiating a therapeutic response of Claim 44, wherein the therapeutic cell destroys a pathogenic T cell. 47. The method for initiating a therapeutic response of Claim 44, wherein the therapeutic cell activates a target T cell. 48. The method for initiating a therapeutic response of Claim 44, wherein the therapeutic cell suppresses a pathogenic T cell. 49. A composition comprising: a therapeutic T-cell comprising a SABR of any one of Claims 1, 2 and 5-17. 50. A method for treating a patient comprising introducing into the patient a therapeutic T cell comprising an extracellular peptide-MHC complex, the peptide-MHC complex comprising an antigen presenting domain linked to a signal transduction domain, wherein the antigen presenting domain comprises an MHC. 51. A SAB R comprising : an extracellular binding domain comprising an MHC and a peptide epitope; a transmembrane domain; and a cytoplasmic signaling domain. |
(SABR)
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] Any and all applications for which a foreign or domestic priority claim is identified in the Application Data Sheet as filed with the present application are hereby incorporated by reference under 37 CFR 1.57. This application claims the benefit of U.S. Provisional Application 62/554,652 filed on September 06, 2017, which is hereby incorporated by reference in its entirety.
BACKGROUND
Field
[0002] Embodiments described herein relate generally to molecules for immunological use and treatment.
Description
[0003] T cells are an integral part of the immune response to pathogens and cancers. T cells respond to specific antigenic epitopes presented on major histocompatibility complex (MHC) molecules on their target cells. Antigen recognition by T cells is mediated by their T cell receptor (TCR), which triggers an intracellular signal leading to T cell activation followed by a functional response. However, MHC molecules that present antigens lack signaling domains, and hence cannot induce a response in the target cells. Therefore, the TCR-Antigen-MHC interaction results in a unidirectional signal towards the T cell. Lack of signaling towards the target cells is a major limitation in the potential use of TCR-Antigen-MHC interactions for various functions. Thus, new, scalable techniques and molecules that expand the utilization of TCR-Antigen-MHC interactions are needed.
SUMMARY
[0004] Some embodiments herein relate to a signaling and antigen-presenting bifunctional receptor (SABR) comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. [0005] Some embodiments herein relate to a SABR, wherein the antigen presenting domain comprises a MHC.
[0006] Some embodiments herein relate to a nucleic acid encoding for a SABR.
[0007] Some embodiments herein relate to a cell comprising the nucleic acid encoding for a SABR.
[0008] Some embodiments herein relate to a SABR, wherein the MHC comprises a Class I MHC.
[0009] Some embodiments herein relate to a SABR, wherein the MHC comprises a Class II MHC.
[0010] Some embodiments herein relate to a SABR, further comprising a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain binds to the peptide.
[0011] Some embodiments herein relate to a SABR, wherein the signal transduction domain comprises a T cell signaling domain.
[0012] Some embodiments herein relate to a SABR, wherein the signal transduction domain is derived from a cytokine receptor, wherein the cytokine receptor comprises IL2, IL4, EPO, GM-CSF, JAK-STAT, CCLIO, a G protein coupled receptor, or a receptor of the TNF Receptor superfamily.
[0013] Some embodiments herein relate to a SABR, wherein the signal transduction domain comprises 4-1BB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, CD3zeta, Notch, synNotch, chemical-induced dimerization, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2, IL4, EPO, GM-CSF, JAK-STAT, CCLIO, a G protein coupled receptor, a receptor of the TNF receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, or a NOD-like receptors.
[0014] Some embodiments herein relate to a SABR, further comprising a transmembrane domain.
[0015] Some embodiments herein relate to a SABR, wherein the transmembrane domain comprises a transmembrane domain from one or more of 4-1BB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, CD3zeta, Notch, synNotch, chemical- induced dimerization, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2, IL4, EPO, GM-CSF, JAK-STAT, CCLIO, a G protein coupled receptor, a receptor of the TNF Receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, a NOD-like receptor, or an MHC molecule. [0016] Some embodiments herein relate to a SABR, wherein the transmembrane domain comprises any one or more of the transmembrane domains of Tables 0.1, 0.2, or 0.3 (as appropriate).
[0017] Some embodiments herein relate to a SABR, wherein the antigen presenting domain comprises any one or more of the antigen presenting domains of Tables 0.1, 0.2, or 0.3 (as appropriate).
[0018] Some embodiments herein relate to a SABR, wherein the signal transduction domain comprises any one or more of the signal transduction domains of Tables 0.1, 0.2, or 0.3 (as appropriate).
[0019] Some embodiments herein relate to a SABR, wherein the antigen presenting domain is fused to the signal transduction domain.
[0020] Some embodiments herein relate to a SABR, further comprising one or more linkers.
[0021] Some embodiments herein relate to a cell comprising: an extracellular peptide-MHC complex comprising: an antigen presenting domain linked to a signal transduction domain, wherein the antigen presenting domain comprises an MHC molecule.
[0022] Some embodiments herein relate to a cell, wherein the cell comprises any one or more of the SABRs described herein.
[0023] Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein.
[0024] Some embodiments herein relate to a method for preparing a signaling cell, the method comprising: providing a target cell, and introducing into the target cell a nucleic acid molecule comprising a nucleotide sequence coding for a SABR directed against at least one TCR expressed at the surface of a T cell, wherein the SABR comprises a MHC linked to a signal transduction domain.
[0025] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the at least one reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with the antigen receptor to be tested for binding to the SABR, detecting a presence of the measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor.
[0026] Some embodiments herein relate to a method for antigen discovery, wherein the antigen receptor comprises a soluble molecule.
[0027] Some embodiments herein relate to a method for antigen discovery, wherein the soluble molecule comprises an antibody.
[0028] Some embodiments herein relate to a method for antigen discovery, wherein the antigen receptor is expressed on a cell.
[0029] Some embodiments herein relate to a method for antigen discovery, wherein the antigen receptor comprises a TCR expressed on a T cell.
[0030] Some embodiments herein relate to a method for antigen discovery, wherein the at least one reporter cell comprises a library of cells, wherein the library of cells have numerous different SABRs, and wherein the numerous different SABRs can bind to different antigen receptors.
[0031] Some embodiments herein relate to a method for antigen discovery, wherein the antigen receptor comprises numerous antigen receptors.
[0032] Some embodiments herein relate to a method for antigen discovery, wherein numerous different SABRs are expressed and one determines which SABR a particular antigen receptor binds to by monitoring the measurable signal and identifying which SABR is in the cell that exhibited the measurable signal.
[0033] Some embodiments herein relate to a method for antigen discovery, wherein more than one antigen receptor is present and one determines which antigen receptor binds to a particular SABR.
[0034] Some embodiments herein relate to a method for antigen discovery, wherein more than one antigen receptor and more than one SABR are present.
[0035] Some embodiments herein relate to a method for antigen discovery, wherein the at least one reporter cell comprises NFAT-GFP-Jurkat cells.
[0036] Some embodiments herein relate to a method for antigen discovery, wherein the measurable signal comes from expression of a detectable marker.
[0037] Some embodiments herein relate to a method for antigen discovery, wherein the reporter cells expressing the measurable signal are identified using flow cytometry. [0038] Some embodiments herein relate to a method for antigen discovery, wherein the antigen receptor comprises an expressed orphan TCR.
[0039] Some embodiments herein relate to a method for antigen discovery, wherein the one or more reporter cells expresses a genetically encoded antigen or antigenic epitope.
[0040] Some embodiments herein relate to a method for antigen discovery, further comprising identifying the genetically encoded antigen or antigenic epitope by DNA sequencing.
[0041] Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor.
[0042] Some embodiments herein relate to a library, wherein the at least one antigen receptor is expressed on a cell, wherein the cell is an antigen receptor cell.
[0043] Some embodiments herein relate to a library, wherein the SABR is expressed on a reporter cell, such that the cell provides a detectable marker upon binding of the SABR to the antigen receptor.
[0044] Some embodiments herein relate to a library, wherein the reporter cell comprises NFAT-GFP-Jurkat cells.
[0045] Some embodiments herein relate to a library, wherein the antigen receptor cell comprises T cells comprising TCR.
[0046] Some embodiments herein relate to a library, wherein the antigen receptor cell comprises a cell expressing orphan TCR.
[0047] Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject.
[0048] Some embodiments herein relate to a method for initiating a therapeutic response, wherein the cellular response results in one or more of: cell mediated cytotoxicity, release of inflammatory cytokines, release of suppressive cytokines, direct suppression of target cells, release of anti-inflammatory cytokines, induction of pro-proliferative signals, induction of anti-proliferative signals, induction of apoptosis, induction of cell exhaustion markers, and direct target cell activation. [0049] Some embodiments herein relate to a method for initiating a therapeutic response, wherein the therapeutic cell destroys a pathogenic T cell.
[0050] Some embodiments herein relate to a method for initiating a therapeutic response wherein the therapeutic cell activates a target T cell.
[0051] Some embodiments herein relate to a method for initiating a therapeutic response, wherein the therapeutic cell suppresses a pathogenic T cell.
[0052] Some embodiments herein relate to a composition comprising: a therapeutic T-cell comprising any of the SABRs described herein.
[0053] Some embodiments herein relate to a method for treating a patient comprising introducing into the patient a therapeutic T cell comprising an extracellular peptide-MHC complex, the peptide-MHC complex comprising an antigen presenting domain linked to a signal transduction domain, wherein the antigen presenting domain comprises an MHC.
[0054] Some embodiments herein relate to a SABR comprising: an extracellular binding domain comprising an MHC and a peptide epitope, a transmembrane domain, and a cytoplasmic signaling domain.
BRIEF DESCRIPTION OF THE DRAWINGS
[0055] FIG. 1A illustrates an example SABR construct with CD8+ T cells according to various embodiments herein.
[0056] FIG. IB illustrates an example SABR construct with CD4+ T cells according to various embodiments herein.
[0057] FIG. 1C illustrates SABR constructs according to various embodiments herein.
[0058] FIG. ID illustrates a typical antigen presenting cell with an antigen presenting domain but no transduction signaling domain.
[0059] FIG. IE illustrates an antigen presenting cell with a SABR comprising both an antigen presenting domain and a transduction signaling domain capable of signal induction within an antigen presenting cell.
[0060] FIG. 2A illustrates a schematic describing a use of SABRs in a reporter cell line that expresses a signal upon TCR binding or recognition according to various embodiments herein. [0061] FIG. 2B illustrates a flowchart describing a process for antigen specific signaling by SABRs described herein.
[0062] FIG. 2C illustrates a schematic demonstrating a use of a SABR library for antigen discovery according to various embodiments herein.
[0063] FIG. 3A illustrates a schematic of T cells and target cells used to demonstrate a function of SABRs according to various embodiments herein.
[0064] FIG. 3B illustrates a chart depicting measurement of GFP expression in SABR transduced reporter cells upon co-incubation with T cells expressing TCRs.
[0065] FIG. 3C illustrates a chart demonstrating a function of B27-KK10-SCTRs in response to four different TCRs from different patients.
[0066] FIG. 4A illustrates a schematic describing a use of various SABR constructs for T cell antigen discovery according to various embodiments herein.
[0067] FIG. 4B illustrates a schematic describing a use of SCTRs to study TCR cross-reactivity or to identify heteroclitic ligands according to various embodiments herein.
[0068] FIG. 5A illustrates a schematic describing an ability of SABRs to induce cytotoxicity in response to recognition of particular T cell antigenic specificities according to various embodiments herein.
[0069] FIG. 5B illustrates a schematic describing a cytotoxicity assay used to test SABR-mediated cytotoxicity according to various embodiments herein.
[0070] FIG. 5C illustrates a chart showing results demonstrating TCR specific cytotoxicity induced by A2-NYESO-SCTRs.
[0071] FIG. 6A illustrates schematics showing SABR-F and SABR-E constructs according to various embodiments herein.
[0072] FIG. 6B illustrates a bar graph showing, on the Y-axis, %GFP+ cells at 8 hours in NFAT-GFP-Jurkats transduced with A2-MART1 -SABRs and co-cultured with Jurkat cells transduced with TCRs.
[0073] FIG. 7A illustrates schematics demonstrating SABRs and TCR-pMHC specific signaling.
[0074] FIG. 7B illustrates representative flow cytometry plots from an experiment 8 hours from incubation.
[0075] FIG. 7C illustrates a bar graph of GFP expression by SABR transduced NFAT-GFP- Jurkat cells upon co-culture with TCR-transduced Jurkat cells.
[0076] FIG. 7D illustrates a graph of detection of low cell numbers by SABRs. [0077] FIG. 7E illustrates a timecourse of GFP expression by A2-MART1-SABR transduced NFAT-GFP- Jurkat cells co-cultured with F5-transduced Jurkat cells.
[0078] FIG. 7F illustrates representative flow cytometry plots from the experiment of FIG. 7E.
[0079] FIG. 8A illustrates a schematic showing SCT, SABRs, empty SABRs, and tandem minigenes (TMGs) according to various embodiments.
[0080] FIG. 8B illustrates SABR vector constructs with a stuffer fragment showing BsmBI sites, and a cloning strategy using double stranded oligonucleotides with encoding an epitope flanked by overlaps according to various embodiments.
[0081] FIG. 8C illustrates an empty SABR construct according to various embodiments.
[0082] FIG. 8D illustrates an empty SABR (i.e. no encoded peptide) and endogenously expressed peptide according to various embodiments herein.
[0083] FIG. 8E illustrates a schematic of empty SABRs pulsed with exogenous peptide.
[0084] FIG. 8F illustrates a graph showing GFP expression by NFAT-GFP- Jurkats transduced with empty SABRs pulsed with soluble MARTI or KK10 peptides and co-cultured with Jurkat cells transduced with F5 or EC27 TCRs.
[0085] FIG. 8G illustrates a schematic of empty SABRs presenting newly translated epitopes with a TMG.
[0086] FIG. 8H illustrates a graph of GFP expression by NFAT-GFP-Jurkats co- transduced with empty B27-SABRs KK10-TMG or transduced with empty B27-SABRs and pulsed with KK10 peptide, and co-cultured with Jurkat cells transduced with F5 or EC27 TCRs.
[0087] FIG. 81 illustrates an SCDR construct with a CD3z signal transduction domain according to various embodiments herein.
[0088] FIG. 8J illustrates a bar graph showing %GFP+ frequency for various TCR-peptide variations.
[0089] FIG. 8K illustrates a bar graph showing %GFP+ frequency for various TCR-peptide composition and concentration variations.
[0090] FIG. 8L illustrates a schematic showing an SCDR construct with a tandem minigene (TMG) antigen according to various embodiments herein. [0091] FIG. 8M illustrates a bar graph showing %GFP+ frequency for various TCR-peptide variations.
[0092] FIG. 9A illustrates representative flow cytometry plots of induction of CD69 by SABRs.
[0093] FIG. 9B illustrates a graph of cytotoxicity induced by SABR-expressing primary T cells against Jurkat cells.
[0094] FIG. 9C illustrates a bar graph of cytotoxicity induced by SABR- expressing primary T cells against autologous target cells.
[0095] FIG. 9D illustrates a schematic of an assay to measure antigen sensitivity of A2-SABR and of F5-TCR.
[0096] FIG. 9E illustrates a plot of antigen sensitivity of SABR and TCR signaling.
[0097] FIG. 10A illustrates a schematic showing a pipeline to construct custom SABR libraries according to various embodiments.
[0098] FIG. 10B illustrates a schematic showing a co-culture experiment to select cells from a SABR library that are recognized by an orphan TCR according to various embodiments.
[0099] FIG. IOC illustrates a flowchart showing a computational analysis pipeline according to various embodiments.
[0100] FIG. 11A illustrates representative flow cytometry plots.
[0101] FIG. 11B illustrates a plot of average ranks from F5 and SL9 sorts.
[0102] FIG. l lC illustrates a plot of average ranks for hits from an F5 sort.
[0103] FIG. 11D illustrates a plot of average ranks for hits from an SL9 sort.
[0104] FIG. HE illustrates a plot of average ranks for EAAGIGILTV analogs in an A2-SABR library of Example 4.
[0105] FIG. 11F illustrates a plot of average ranks for SLYNTVATL analogs in an A2-SABR library.
[0106] FIG. 12A illustrates a representative flow cytometry plots.
[0107] FIG. 12B illustrates a plot of average ranks from neoTCR and mock sorts.
[0108] FIG. 12C illustrates a plot of average ranks for hits from a neoTCR sort.
[0109] FIG. 12D illustrates a plot of average ranks for USP7-derived epitopes in a NeoAg-SABR library. [0110] FIG. 12E illustrates a plot showing validation of top hits identified in a NeoAg-SABR screen.
[0111] FIG. 13A illustrates a plot of a gating strategy used in co-culture assays to measure GFP expression.
[0112] FIG. 13B illustrates a plot of a gating strategy used in co-culture assays to measure GFP and CD69 expression.
[0113] FIG. 13C illustrates a plot of a gating strategy used in cytotoxicity assays.
[0114] FIG. 14A illustrates a schematic showing the structure of a SABR and signal induction by SABRs upon TCR-pHLA recognition.
[0115] FIG. 14B illustrates a schematic of a SABR showing induction of a signal by a SABR presenting Ovalbumin peptide on a mouse class II pMHC (IAb-OVA) upon recognition by cognate T cells.
[0116] FIG. 14C illustrates a bar graph showing induction of a signal by SABRs presenting Ovalbumin peptide on a mouse class II pMHC (IAb-OVA) upon recognition by cognate T cells.
[0117] FIG. 14D illustrates four combinations of HLA-DQ alleles on APCs from DQ2-DQ8 heterozygous patients.
[0118] FIG. 14E illustrates SABRs encoding four DQ2/8 combinations on separate APCs allowing their distinction.
[0119] FIG. 15A illustrates a schematic of IAb-OVA and Hum IAb-OVA SABRs and signaling induction upon recognition of an OT-II TCR.
[0120] FIG. 15B illustrates a bar graph showing signaling induction upon recognition of OT-II TCR for IAb-OVA and Hum IAb-OVA SABRs.
[0121] FIG. 16A illustrates a schematic of IAb-OVA DCH and an IAb-OVA DCH-SABR and signaling induction upon recognition of an OT-II TCR.
[0122] FIG. 16B illustrates a bar graph showing signaling induction upon recognition of mouse splenocytes expressing the OT-II TCR for IAb-OVA and Hum IAb- OVA SABRs.
[0123] FIG. 17A illustrates a line graph depicting %GFP+ cells over time.
[0124] FIG. 17B illustrates representative flow cytometry plots from the experiment.
[0125] FIG. 18A illustrates a bar graph depicting the frequency of %GFP+ for TCR-transduced Jurkat cells incubated with SCTR-transduced NFAT-GFP-Jurkat cells. [0126] FIG. 18B illustrates a bar graph depicting the frequency of %GFP+ for TCR-transduced PBMCs incubated with SCTR-transduced NFAT-GFP-Jurkat cells.
[0127] FIG. 18C illustrates a line graph depicting the frequency over time of %GFP+ for TCR-transduced PBMCs incubated with SCTR-transduced NFAT-GFP-Jurkat cells.
[0128] FIG. 19 illustrates examples of antigenic epitopes according to various embodiments herein (e.g., for the treatment of diabetes).
[0129] FIG. 20A displays a sequence alignment for class I MHC across a wide variety of species.
[0130] FIG. 20B displays a sequence alignment for class I MHC across humans.
[0131] FIG. 20C displays a sequence alignment for class II alpha MHC across a wide variety of species.
[0132] FIG. 20D displays a sequence alignment for class II alpha MHC across humans.
[0133] FIG. 20E displays a sequence alignment for class II beta MHC across a wide variety of species.
[0134] FIG. 20F displays a sequence alignment for class II beta MHC across humans.
DETAILED DESRIPTION
[0135] MHC molecules that present antigens lack signaling domains, and hence cannot induce a response in the target cells. Therefore, a TCR-Antigen-MHC interaction results in a unidirectional signal towards the T cell. Lack of signaling towards the target cells is a major limitation in the potential use of TCR-Antigen-MHC interactions for various functions. Thus, new, scalable techniques and molecules that expand the utilization of TCR- Antigen-MHC interactions are needed and are provided herein (in some embodiments).
[0136] Described herein are compositions and methods for signaling and antigen- presenting bifunctional receptors (SABRs) comprising: one or more antigen presenting domains, and one or more signal transduction domains, wherein the one or more antigen presenting domains comprise a binding fragment of a major histocompatibility complex (MHC) molecule. Various immunological functions of the SABRs are also described. Various uses and functions of the SABRs are provided herein. For example, in some embodiments, the SABRs described herein may be used for antigen discovery, for suppressing and/or destroying pathogenic T cells, for initiating therapeutic responses, in methods of treatment, for construction of SABR libraries, for neoantigen discovery, as well as other uses.
Definitions and Various Embodiments
[0137] As used herein, the section headings are for organizational purposes only and are not to be construed as limiting the described subject matter in any way. All literature and similar materials cited in this application, including but not limited to, patents, patent applications, articles, books, treatises, and internet web pages are expressly incorporated by reference in their entirety for any purpose. When definitions of terms in incorporated references appear to differ from the definitions provided in the present teachings, the definition provided in the present teachings shall control.
[0138] In this application, the use of the singular includes the plural unless specifically stated otherwise. Also, the use of "comprise", "comprises", "comprising", "contain", "contains", "containing", "include", "includes", and "including" are not intended to be limiting. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. See, for example Singleton et al., Dictionary of Microbiology and Molecular Biology 2 nd ed., J. Wiley & Sons (New York, N.Y. 1994); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Springs Harbor Press (Cold Springs Harbor, N.Y. 1989). For purposes of the present invention, the following terms are defined below. It is to be understood that both the foregoing general description and the following detailed description, are exemplary and explanatory only and are not restrictive of the invention as claimed. In this application, the use of the singular includes the plural unless specifically stated otherwise. In this application, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including", as well as other forms, such as "includes" and "included", is not limiting. As used in this specification and claims, the singular forms "a," "an" and "the" include plural references unless the content clearly dictates otherwise.
[0139] As used herein, "about" means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.
[0140] As used herein, an "antigen presenting domain" refers to an extracellular domain that functions to present antigen peptide fragments to T cells responsible for cell- mediated immune responses.
[0141] As used herein, a "signal transduction domain" refers to any domain that can transmit an extracellular signal intracellularly.
[0142] As used herein, a "major histocompatibility molecule" (MHC) refers to a set of cell surface proteins essential for the acquired immune system to recognize foreign molecules. Unless otherwise noted, MHC refers to both Class I MHC and Class II MHC.
[0143] As used herein, "peptide" refers to a chain of amino acids linked to each other by peptide bonds.
[0144] As used herein, "epitope" refers to a part of an antigen that is recognized by the immune system. This can be by, for example, antibodies, B cells, or T cells.
[0145] As used herein, "T cell signaling domain" refers to a cytoplasmic T cell domain that functions to transmit an intracellular signal.
[0146] As used herein, "cytokine receptor" refers to any receptor that bind cytokines.
[0147] As used herein, "transmembrane domain" refers to an amino acid sequence that traverses and is present in the cell membrane.
[0148] As used herein, a "linker" refers to a peptide sequence occurring between protein domains.
[0149] As used herein, a "signaling cell" refers to any cell any cell that is capable for transmitting an extracellular signal intracellularly through a signaling domain.
[0150] As used herein, a "target cell" refers to a cell that bears receptors recognized by a signaling molecule.
[0151] As used herein, a "reporter cell" refers to a cell expressing reporter genes, which, when exposed to a stimulus, induces a measurable signal activity that can be readily assessed qualitatively and quantitatively.
[0152] As used herein, a "measurable signal" refers to any reporter activity that can be assessed qualitatively or quantitatively.
[0153] As used herein, "antigen discovery" refers to the process of discovering the antigens targeted by T cell responses. [0154] As used herein, a "soluble molecule" refers to a compound soluble in a liquid.
[0155] As used herein, a "library" refers to a collection of cells having one or more signaling molecules.
[0156] As used herein, a "detectable marker" refers to any discernable characteristic in response to signal transduction.
[0157] As used herein, "flow cytometry" refers to a laser- or impedance-based, biophysical technology employed in cell counting, cell sorting, biomarker detection and protein engineering, by suspending cells in a stream of fluid and passing them through an electronic detection apparatus.
[0158] As used herein, a "therapeutic cell" refers to a cell transduced with a SABR, wherein the SABR directs a cellular response in a subject upon binding to an antigen receptor in the subject.
[0159] As used herein, a "cellular response" refers to any biochemical reaction within a cell in response to a received signal.
[0160] As used herein, a "pathogenic T cell" refers to any T cell that causes or contributes to a disease, for example, in an autoimmune disease.
[0161] As used herein, a "cytoplasmic domain" refers to amino acid sequences within the cytoplasm of a cell.
[0162] As used herein, a "vector," interchangeably referred to as a transgenic construct, a targeting construct, or simply a construct, is a nucleic acid. As used herein, "nucleic acid" refers to deoxyribonucleic acid (DNA). In some embodiments, nucleic acid may refer to ribonucleic acid (RNA). In some embodiments, the construct as provided herein comprise one or more regulatory elements. Exemplary regulatory elements in prokaryotes include promoters, operators and ribosome binding sites. Regulatory elements that are used in eukaryotic cells can include, without limitation, transcriptional and translational control sequences, such as promoters, terminators, enhancers, insulators, splicing signals, polyadenylation signals, terminators, protein degradation signals, internal ribosome-entry element (IRES), 2A sequences, and the like, that provide for and/or regulate expression of a coding sequence and/or production of an encoded polypeptide in a host cell. For example, a promoter is a nucleotide sequence that permits binding of RNA polymerase and directs the transcription of a gene. Typically, a promoter is located in the 5' non-coding region of a gene, proximal to the transcriptional start site of the gene. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. Examples of promoters include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and mammals (including humans). A promoter can be inducible, repressible, and/or constitutive. Inducible promoters initiate increased levels of transcription from DNA under their control in response to some change in culture conditions (for example, a change in temperature). "Treating" or "treatment" of a condition may refer to preventing the condition, slowing the onset and/or rate of development of the condition, reducing the risk of developing the condition, preventing and/or delaying the development of symptoms associated with the condition, reducing or ending symptoms associated with the condition, generating a complete or partial regression of the condition, or some combination thereof. The term "prevent" does not require the absolute prohibition of the disorder or disease.
[0163] A "therapeutically effective amount" or a "therapeutically effective dose" is an amount that produces a desired therapeutic effect in a subject, such as preventing, treating a target condition, delaying the onset of the disorder and/or symptoms, and/or alleviating symptoms associated with the condition. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and/or the route of administration. One skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount through routine experimentation, for example by monitoring a subject's response to administration of a compound and adjusting the dosage accordingly, given the present disclosure. For additional guidance, see Remington: The Science and Practice of Pharmacy 21.sup.st Edition, Univ. of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, Pa., 2005.
[0164] The term "antibody" includes, but is not limited to, genetically engineered or otherwise modified forms of immunoglobulins, such as intrabodies, chimeric antibodies, fully human antibodies, humanized antibodies, antibody fragments, and heteroconjugate antibodies (e.g., bispecific antibodies, diabodies, triabodies, tetrabodies, etc.). The term "antibody" includes cys-diabodies and minibodies. The term "antibody" includes a polypeptide of the immunoglobulin family or a polypeptide comprising fragments of an immunoglobulin that is capable of noncovalently, reversibly, and in a specific manner binding a corresponding antigen. An exemplary antibody structural unit comprises a tetramer. In some embodiments, a full-length antibody can be composed of two identical pairs of polypeptide chains, each pair having one "light" and one "heavy" chain (, connected through a disulfide bond. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. For full length chains, the light chains are classified as either kappa or lambda. For full length chains, the heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD, and IgE, respectively. The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these regions of light and heavy chains respectively. As used in this application, an "antibody" encompasses all variations of antibody and fragments thereof. Thus, within the scope of this concept are full length antibodies, chimeric antibodies, humanized antibodies, single chain antibodies (scFv), Fab, Fab', and multimeric versions of these fragments (e.g., F(ab')2) with the same binding specificity. In some embodiments, the antibody binds specifically to a desired target.
[0165] The term "isolated," when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. In some embodiments, it can be in either a dry or aqueous solution. Purity and homogeneity can be determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified. In particular, an isolated gene is separated from open reading frames that flank the gene and encode a protein other than the gene of interest. The term "purified" denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. In some embodiments, this can denote that the nucleic acid or protein is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure of molecules that are present under in vivo conditions.
[0166] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double- stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed- base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al, J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al, Mol. Cell. Probes 8:91-98 (1994)).
[0167] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an alpha. -carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
Signaling and Antigen-Presenting Bifunctional Receptors
[0168] Some embodiments provided herein relate to a signaling and antigen- presenting bifunctional receptor (SABR) comprising: an antigen presenting domain, and a signal transduction domain. The antigen presenting domain comprises a binding fragment of a major histocompatibility complex (MHC) molecule. In some embodiments, the SABRs herein allow transduction of a signal within a target cell, which has various application as describe herein. Some embodiments provided herein relate to a SABR comprising: one or more antigen presenting domains, and a signal transduction domain, wherein the one or more antigen presenting domains comprise a binding fragment of a MHC molecule. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and one or more signal transduction domains, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments provided herein relate to a SABR comprising: one or more antigen presenting domains, and one or more signal transduction domains, wherein the one or more antigen presenting domains comprises a binding fragment of a MHC molecule.
[0169] FIG. 1A illustrates an example SABR construct with CD8+ T cells according to various embodiments herein. FIG. IB illustrates an example SABR construct with CD4+ T cells according to various embodiments herein. In some embodiments, SABRs are constructed by linking two parts: antigen-presenting domains 102 and signal transduction domains 104. Antigen presentation to a T cell is dependent on class I and class II MHC molecules, which present peptide epitopes 106 to T cells. Class I MHC molecules 108A usually present 8-1 laa long peptide epitopes to CD8+ T cells 110A, whereas Class II MHC 108B usually molecules present 12-15aa long peptide epitopes to CD4+ T cells HOB. In some embodiments, SABRs are created by linking antigen presenting domains 102 to signal transduction domains 104.
[0170] FIG. 1C illustrates SABR constructs according to various embodiments herein. In some embodiments, the antigen presenting domains 102 can be a class I MHC molecule 108A with covalently linked peptide 106 (SCTRs), or class I MHC molecule 108A without any peptide epitope (SCDRs), or a class II MHC molecules 108B with covalently linked peptide 106 (DCHR). In some embodiments, the signaling domains 104 can be derived from TCR-CD3 signaling domains similar to those used in chimeric antigen receptors (CARs), from cytokine receptors, or from other receptors that signal upon multimerization. In some embodiments, SABR-libraries can be constructed either by covalently linking the antigenic epitope or expressing the antigenic protein/epitope in SABR-expressing cells.
[0171] FIG. ID illustrates a typical antigen presenting cell 100D with an antigen presenting domain 102D but no transduction signaling domain. FIG. IE illustrates an antigen presenting cell 100E with a SABR comprising both an antigen presenting domain 102E and a transduction signaling domain 104E capable of signal induction within the antigen presenting cell 100E.
[0172] Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the antigen presenting domain comprises a MHC. [0173] Some embodiments provided herein relate to a nucleic acid encoding for any of the SABRs described herein. Some embodiments provided herein relate to a nucleic acid encoding for a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule.
[0174] Some embodiments provided herein relate to a cell comprising a nucleic acid encoding for any of the SABRs described herein. Some embodiments provided herein relate to a nucleic acid encoding for a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule.
[0175] Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the MHC comprises a Class I MHC.
[0176] Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the MHC comprises a Class II MHC.
[0177] Some embodiments provided herein relate to any of the SABRs described herein, further comprising a peptide. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a peptide. Some embodiments provided herein relate to a SABR wherein the peptide comprises an epitope. In some embodiments, any of the epitopes in tables 6.3 or 6.4 can be employed. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a peptide, wherein the peptide comprises an epitope, and wherein the peptide epitope is covalently linked to the SABR. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain binds to the peptide. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain does not bind to the peptide.
[0178] Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments provided herein relate to a SABR wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments provided herein relate to a SABR wherein the T cell signaling domain comprises 4-lBB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, or CD3zeta. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, wherein the signal transduction domain comprises a T cell signaling domain, and wherein the T cell signaling domain comprises PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, or PMID: 22437870. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments provided herein relate to a SABR wherein the T cell signaling domain comprises one or more of the domains of Table 0.1. In some embodiments, fragments of one or more of the following items in Table 0.1 can also be employed.
TABLE 0.1
Domain Class/Source Function Ref
Antigen discovery,
4-lBB T cell PMID: 23667569,
Fratricide Immunotherapy,
(CD 137) signaling PMID: 22437870
Tolerogenic Immunotherapy
CD28 T cell Antigen discovery, PMID: 23667569, signaling Fratricide Immunotherapy, PMID: 22437870
Tolerogenic Immunotherapy
Antigen discovery, PMID: 23667569,
T cell
CD27 Fratricide Immunotherapy, PMID: 22437870 signaling
Tolerogenic Immunotherapy
Antigen discovery, PMID: 23667569,
T cell
DAP10 Fratricide Immunotherapy, PMID: 22437870 signaling
Tolerogenic Immunotherapy
Antigen discovery, PMID: 23667569,
ICOS, OX40,
T cell Fratricide Immunotherapy, PMID: 22437870 PD1, CTLA4,
signaling Tolerogenic Immunotherapy,
TIM3
Modulating exhaustion
Antigen discovery, PMID: 23667569,
T cell
CD3zeta Fratricide Immunotherapy, PMID: 22437870 signaling
Tolerogenic Immunotherapy
[0179] Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments provided herein relate to a SABR wherein the signal transduction domain is derived from a cytokine receptor. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, wherein the signal transduction domain is derived from a cytokine receptor. Some embodiments provided herein relate to a SABR wherein the cytokine receptor comprises IL2, IL4, EPO, GM-CSF, JAK-STAT, CCL10, a G protein coupled receptor, or a receptor of the TNF Receptor superfamily. Some embodiments provided herein relate to a SABR wherein the signal transduction domain is derived from a cytokine receptor, wherein the cytokine receptor comprises PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 24679437, PMID: 24679437, PMID: 19239902. Some embodiments provided herein relate to a SABR wherein the cytokine receptor comprises one or more of the domains of Table 0.2. In some embodiments, a fragment of the cytokine receptor can be employed.
TABLE 0.2
Domain Class/Source Function Ref
Cytokines Cytokine Tolerogenic Immunotherapy, PMID: 17934481 ; such as IL2, signaling Immunomodulation, Vaccine boost PMID: 10808165; IL4, EPO, PMID: 27317733 GM-CSF JAK-STAT Cytokine Tolerogenic Immunotherapy, PMID: 17934481 ; signaling Immunomodulation, Vaccine boost PMID: 10808165;
PMID: 27317733
Chemokines Cytokine Tolerogenic Immunotherapy, PMID: 24679437 such as signaling Immunomodulation, Vaccine boost
CCLIO
G protein Cytokine Tolerogenic Immunotherapy, PMID: 24679437 coupled signaling Immunomodulation, Vaccine boost
receptors
TNF Receptor Cytokine Immunomodulation, Vaccine boost PMID: 19239902 superfamily signaling
[0180] Some embodiments provided herein relate to a SABR wherein the signal transduction domain comprises 4-lBB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, CD3zeta, Notch, synNotch, chemical-induced dimerization, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2, IL4, EPO, GM-CSF, JAK-STAT, CCLIO, a G protein coupled receptor, a receptor of the TNF Receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, or a NOD-like receptor. Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the signal transduction domain comprises PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 26830878, U.S. Patent No. 9,670,281, PMID: 26431673, PMID: 21816833, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 24679437, PMID: 19239902, PMID: 20567250, PMID: 25045879, PMID: 15932016, PMID: 21616437, or PMID: 26632377. Some embodiments provided herein relate to a SABR and wherein the signal transduction domain comprises one or more of the domains of Table 0.3. In some embodiments, a fragment of the signal transduction domain in Table 0.3 can be employed.
TABLE 0.3
Domain Class/Source Function Ref
Antigen discovery,
4-lBB T cell PMID: 23667569,
Fratricide Immunotherapy,
(CD137) signaling PMID: 22437870
Tolerogenic Immunotherapy
T cell Antigen discovery, PMID: 23667569,
CD28
signaling Fratricide Immunotherapy, PMID: 22437870 Tolerogenic Immunotherapy
Antigen discovery, PMID: 23667569,
T cell
CD27 Fratricide Immunotherapy, PMID: 22437870 signaling
Tolerogenic Immunotherapy
Antigen discovery, PMID: 23667569,
T cell
DAP10 Fratricide Immunotherapy, PMID: 22437870 signaling
Tolerogenic Immunotherapy
Antigen discovery, PMID: 23667569,
ICOS, OX40,
T cell Fratricide Immunotherapy, PMID: 22437870 PD1, CTLA4,
signaling Tolerogenic Immunotherapy,
TIM3
Modulating exhaustion
Antigen discovery, PMID: 23667569,
T cell
CD3zeta Fratricide Immunotherapy, PMID: 22437870 signaling
Tolerogenic Immunotherapy
Antigen discovery, PMID: 26830878;
Notch and Synthetic
Immunomodulation, Vaccine boost, U.S. Patent No. synNotch domains
Modulating exhaustion 9,670,281
Chemical-
Synthetic Antigen discovery,
induced PMID: 26431673 domains Immunomodulation
dimerization
B cell Tolerogenic Immunotherapy,
CD79A,B PMID: 21816833 signaling Immunomodulation, Vaccine boost
B cell Tolerogenic Immunotherapy,
CD72 PMID: 21816833 signaling Immunomodulation, Vaccine boost
B cell Tolerogenic Immunotherapy,
CD22 PMID: 21816833 signaling Immunomodulation, Vaccine boost
B cell Tolerogenic Immunotherapy,
CD5 PMID: 21816833 signaling Immunomodulation, Vaccine boost
B cell Tolerogenic Immunotherapy,
CD19 PMID: 21816833 signaling Immunomodulation, Vaccine boost
B cell Tolerogenic Immunotherapy,
CD45 PMID: 21816833 signaling Immunomodulation, Vaccine boost
Cytokines Tolerogenic Immunotherapy,
PMID: 17934481 ; such as IL2, Cytokine Immunomodulation, Vaccine boost
PMID: 10808165; IL4, EPO, signaling
PMID: 27317733 GM-CSF
Cytokine Tolerogenic Immunotherapy, PMID: 17934481 ;
JAK-STAT signaling Immunomodulation, Vaccine boost PMID: 10808165;
PMID: 27317733
Chemokines Cytokine Tolerogenic Immunotherapy,
such as signaling Immunomodulation, Vaccine boost PMID: 24679437 CCL10
G protein Cytokine Tolerogenic Immunotherapy,
coupled signaling Immunomodulation, Vaccine boost PMID: 24679437 receptors
TNF Receptor Cytokine
Immunomodulation, Vaccine boost PMID: 19239902 superfamily signaling
NK cell Innate
Immunomodulation, Vaccine boost PMID: 20567250 receptors immune signaling
Innate
Fc Receptors immune Immunomodulation, Vaccine boost PMID: 25045879 signaling
Innate
Toll-like
immune Immunomodulation, Vaccine boost PMID: 15932016 Receptors
signaling
Innate
RIG-I-like
immune Immunomodulation, Vaccine boost PMID: 21616437 receptors
signaling
Innate
NOD-like
immune Immunomodulation, Vaccine boost PMID: 26632377 receptors
signaling
[0181] In some embodiments, any of the options in table 0.1 can be combined with any of the options in table 0.2 and with any of the options in table 0.3. In some embodiments, any of the options in tables 0.1-0.3 can be combined with any antigen presenting domain (MHC I or MHC II or binding domain thereof). In some embodiments, any of the SABRs provided herein can have any of the components provided in tables 0.1-0.3 in it.
[0182] Some embodiments provided herein relate to a SABR comprising a transmembrane domain.
[0183] Some embodiments provided herein relate to a SABR comprising a transmembrane domain, wherein the transmembrane domain comprises a transmembrane domain from one or more of 4-1BB (CD137), CD28, CD27, DAP10, ICOS, OX40, PD1, CTLA4, TIM3, CD3zeta, Notch, synNotch, chemical-induced dimerization, CD79A, CD79B, CD72, CD22, CD5, CD19, CD45, IL2, IL4, EPO, GM-CSF, JAK-STAT, CCLIO, a G protein coupled receptor, a receptor of the TNF Receptor superfamily, a NK cell receptor, a Fc receptor, a toll-like receptor, a RIG-I-like receptor, or a NOD-like receptor, or a MHC molecule. Some embodiments provided herein relate to a SABR comprising a transmembrane domain, wherein the transmembrane domain comprises a transmembrane domain from one or more of PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 23667569, PMID: 22437870, PMID: 26830878, U.S. Patent No. 9,670,281, PMID: 26431673, PMID: 21816833, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 17934481, PMID: 10808165, PMID: 27317733, PMID: 24679437, PMID: 19239902, PMID: 20567250, PMID: 25045879, PMID: 15932016, PMID: 21616437, or PMID: 26632377. Some embodiments provided herein relate to a SABR comprising a transmembrane domain, wherein the transmembrane domain comprises a transmembrane domain from one or more of the domains of Table 0.3.
[0184] Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and a transmembrane domain, wherein the transmembrane domain comprises any one or more of the transmembrane domains of Tables 0.1, 0.2, or 0.3.
[0185] Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, wherein the antigen presenting domain comprises any one or more of the antigen presenting domains of Tables 0.1, 0.2, or 0.3.
[0186] Some embodiments provided herein relate to a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule, and wherein the signal transduction domain comprises any one or more of the signal transduction domains of Tables 0.1, 0.2, or 0.3.
[0187] Some embodiments provided herein relate to a SABR wherein the antigen presenting domain is fused to the signal transduction domain. In some embodiments, the MHC portion of the SABR includes some or all of a MHC. In some embodiments, the MHC is a human MHC. In some embodiments, the MHC includes one or more or all of the conserved sequences of the MHC (e.g., the conserved residues within any one of FIGS. 20A- 20F.
[0188] Some embodiments provided herein relate to a SABR comprising one or more linkers.
Cell Compositions
[0189] Each of the embodiments provided herein with regard to Signaling and Antigen-Presenting Bifunctional Receptors (SABRs) can be used within the present embodiments described herein with regard to Cell Compositions.
[0190] Some embodiments provided herein relate to a cell comprising: an extracellular peptide-MHC complex comprising: an antigen presenting domain linked to a signal transduction domain, wherein the antigen presenting domain comprises an MHC molecule.
[0191] Some embodiments herein relate to a cell comprising any of the SABRs described herein. Some embodiments herein relate to a cell comprising a SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the antigen presenting domain comprises a MHC. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the MHC comprises a Class I MHC. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the MHC comprises a Class II MHC. Some embodiments herein relate to a cell comprising any of the SABRs described herein, the SABR further comprising a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain binds to the peptide. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments herein relate to a cell comprising any of the SABRs described herein, the SABR further comprising a transmembrane domain. Some embodiments herein relate to a cell comprising any of the SABRs described herein, the SABR further comprising a transmembrane domain comprising any one or more of the transmembrane domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the antigen presenting domain comprises any one or more of the antigen presenting domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the signal transduction domain comprises any one or more of the signal transduction domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the antigen presenting domain is fused to the signal transduction domain. Some embodiments herein relate to a cell comprising any of the SABRs described herein, the SABR further comprising one or more linkers.
[0192] Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the cell is sourced from any T cell line such as Jurkat cells, NFAT- GFP-Jurkat cells. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the cell is sourced from primary T cells from a patient or healthy donors or Natural Killer cells. Some embodiments herein relate to a cell comprising any of the SABRs described herein, wherein the cell is sourced from regulatory T cells, dendritic cells, B cells, macrophages, or Natural Killer cells.
Nucleic Acid Encoding
[0193] Each of the embodiments provided herein with regard to Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Nucleic Acid Encoding.
[0194] Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR comprising: an antigen presenting domain, and a signal transduction domain, wherein the antigen presenting domain comprises a binding fragment of a MHC molecule. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the antigen presenting domain comprises a MHC. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the MHC comprises a Class I MHC. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the MHC comprises a Class II MHC. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR further comprising a peptide, wherein the peptide comprises an epitope, wherein the peptide epitope is covalently linked to the SABR, and wherein the antigen presenting domain binds to the peptide. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the signal transduction domain comprises a T cell signaling domain. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR further comprising a transmembrane domain. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR further comprising a transmembrane domain, wherein the transmembrane domain comprises any one or more of the transmembrane domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the antigen presenting domain comprises any one or more of the antigen presenting domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the signal transduction domain comprises any one or more of the signal transduction domains of Tables 0.1, 0.2, or 0.3. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, wherein the antigen presenting domain is fused to the signal transduction domain. Some embodiments herein relate to an isolated nucleic acid molecule comprising a nucleotide sequence encoding any one of the SABRs described herein, the SABR further comprising one or more linkers.
Methods for Signaling Cell Preparation
[0195] Each of the embodiments provided above with regard Signaling and Antigen-Presenting Bifunctional Receptors (SABRs) can be used within the present embodiments described herein with regard to Methods for Signaling Cell Preparation.
[0196] Some embodiments herein relate to a method for preparing a signaling cell. The method comprises: providing a target cell, and introducing into the target cell a nucleic acid molecule comprising a nucleotide sequence coding for an SABR directed against at least one T-cell receptor (TCR) expressed at the surface of a T-cell, wherein the SABR comprises a MHC linked to a signal transduction domain.
Methods for Antigen Discovery
[0197] Each of the embodiments provided above with regard Signaling and Antigen-Presenting Bifunctional Receptors (SABRs) can be used within the present embodiments described herein with regard to Methods for Antigen Discovery.
[0198] Antigen discovery refers to identifying one or more peptide sequences of a protein. In some embodiments, the identified antigens can be used in making vaccines for treatment of patients. In some embodiments, antigen receptor discovery refers to identifying one or more antigen receptors that recognizes a specific antigen. For example, antigen receptor discovery may comprise identifying one or more specific TCRs of a plurality of TCRs that recognize a specific antigen. In some embodiments, identified antigen receptors (e.g. TCRs) can be used for immunotherapy. In some embodiments, the SABRs described herein can be used for both antigen discovery and antigen receptor discovery.
[0199] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cells producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor.
[0200] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the at least one reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, identifying the at least one reporter cells producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, and identifying at least one peptide in the at least one reporter cell producing the measurable signal, thereby associating the peptide with the SABR with the antigen receptor.
[0201] FIG. 2A illustrates a schematic describing the use of SABRs in a reporter cell line that expresses a signal upon TCR signal transduction according to various embodiments herein. In some embodiments, for the use of SABRs 200 for antigen-discovery, TCR-cross-reactivity, and related approaches, SABRs 200 can be expressed in reporter cells 202 that produce a measurable signal upon signal transduction. An example of the use of SABRs 200 relies on a reporter cell line (e.g. NFAT-GFP- Jurkat cells), which express green fluorescent protein (GFP) upon T cell signal transduction. In some embodiments, T cells expressing a given TCR can be incubated with SABR-expressing, for example, NFAT-GFP- Jurkat cells. In some embodiments, the SABR-expressing cells can express GFP if a cognate antigen 204 presented by SABRs 200 is recognized by the T cells. In some embodiments, presentation of an irrelevant antigen 206, or an irrelevant TCR 208, by SABRs will not result in GFP expression, allowing identification of the SABRs 200 presenting the cognate antigen 204 by flow cytometry.
[0202] FIG. 2B illustrates a flowchart describing a process for antigen specific signaling by SABRs described herein. Jurkat cells expressing a given TCR can be co- incubated with, for example, NFAT-GFP- Jurkat cells expressing SABRs. SABRs comprising matching antigens to the expressed TCR can activate upon recognition by the TCR, which can induce signaling with the NFAT-GFP-Jurkat cell. SABRs comprising mismatched or irrelevant antigens may not be recognized by the expressed TCR and may not activate.
[0203] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the at least one reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor comprises a soluble molecule.
[0204] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor comprises a soluble molecule, wherein the soluble molecule comprises an antibody.
[0205] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor is expressed on a cell.
[0206] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor is expressed on a cell, and wherein the antigen receptor comprises a TCR expressed on a T cell.
[0207] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the at least one reporter cell comprises a library of cells, wherein the library of cells have numerous different SABRs, and wherein the numerous different SABRs can bind to different antigen receptors.
[0208] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor comprises numerous antigen receptors
[0209] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein numerous different SABRs are expressed and one determines which SABR a particular antigen receptor binds to ("antigen discovery") by monitoring the measurable signal and identifying which SABR is in the cell that exhibited the measurable signal.
[0210] Some embodiments herein relate to a method for antigen discovery (and/or antigen receptor discovery), the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein more than one antigen receptor is present and one determines which antigen receptor binds to a particular SABR.
[0211] Some embodiments herein relate to a method for antigen discovery (and/or antigen receptor discovery_, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein more than one antigen receptor and more than one SABR are present.
[0212] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the reporter cells comprise NFAT-GFP-Jurkat cells.
[0213] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the reporter cells comprise NFAT-GFP-Jurkat cells, cells of any T cell line, cells of any B cell line, cells of any NK cell line, monocytic cell line, or myeloid cell line
[0214] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the measureable signal comes from expression of a detectable marker. [0215] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the reporter cells expressing the measurable signal are identified using flow cytometry.
[0216] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor cells comprise cells expressing orphan T-cell receptors (TCR).
[0217] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the antigen receptor comprises an expressed orphan T-cell receptors (TCR).
[0218] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the at least one reporter cell expresses a genetically encoded antigen or antigenic epitope.
[0219] Some embodiments herein relate to a method for antigen discovery, the method comprising: expressing any of the SABRs described herein in at least one reporter cell, wherein the reporter cell produces a measurable signal upon a signal transduction event that occurs upon binding of a an antigen receptor to the antigen presenting domain, incubating the at least one reporter cell with an antigen receptor to be tested for binding to the SABR, detecting a presence of a measurable signal in the at least one reporter cell when the antigen receptor binds, and identifying the at least one reporter cell producing the measurable signal, thereby identifying an antigen by associating the SABR in the cell with the reporter, with the antigen receptor, wherein the at least one reporter cell expresses a genetically encoded antigen or antigenic epitope, and further comprising identifying the genetically encoded antigen or antigenic epitope by DNA sequencing.
Cell Libraries
[0220] Each of the embodiments provided herein with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Cell Libraries.
[0221] Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor.
[0222] Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the cell is an antigen receptor cell. Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the cell is a reporter cell.
[0223] Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the SABR is expressed on a reporter cell, such that the cell provides a detectable marker upon binding of the SABR to the antigen receptor.
[0224] Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the reporter cell comprises NFAT-GFP- Jurkat cells.
[0225] Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor, wherein the at least one antigen receptor is expressed on a cell, wherein the at least one antigen receptor is expressed on a cell, wherein the cell is an antigen receptor cell, and wherein the antigen receptor cell comprises T cells comprising TCR.
[0226] Some embodiments herein relate to a library comprising: any of the SABRs described herein, and at least one candidate antigen receptor wherein the at least one antigen receptor is expressed on a cell, wherein the cell is an antigen receptor cell, and wherein the antigen receptor cell comprises a cell expressing orphan TCR.
[0227] FIG. 2C illustrates a schematic demonstrating the use of a SABR library for antigen discovery according to various embodiments herein. In some embodiments, reporter cells, such as NFAT-GFP-Jurkat cells expressing a library of SABRs, can be used to uncover antigen specificities. In some embodiments, each cell 210, 212, 214, 216, 218, 220, 222, 224, and 226 in the SABR library expresses a unique genetically encoded antigen or antigenic epitope, which can be identified by DNA sequencing. In some embodiments, the SABR library can be co-incubated with T cells with unknown specificities, or T cell lines expressing a TCR with unknown specificity. In some embodiments, cells producing a signal, such as GFP+ cells 210, 216, and 222 can be sorted and the antigenic epitopes can be sequenced to determine the cognate antigen of the given T cell or TCR.
Therapeutic Methods
[0228] Each of the embodiments provided above with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Therapeutic Methods.
[0229] Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject. Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the therapeutic cell comprises CD8+ T cells, CD4+T cells, Regulatory T cells, B cells, NK cells, Dendritic cells, Macrophages, Monocytes, or any hematopoietic cells including, for example hematopoietic stem cells, progenitors, lymphoid and myeloid cells.
[0230] Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the cellular response results in one or more of: cell mediated cytotoxicity, release of inflammatory cytokines, release of suppressive cytokines, direct suppression of target cells, release of anti-inflammatory cytokines, induction of pro-proliferative signals, induction of anti-proliferative signals, induction of apoptosis, induction of cell exhaustion markers, or direct target cell activation.
[0231] Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the therapeutic cell destroys a pathogenic T cell.
[0232] Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the therapeutic cell activates a target T cell.
[0233] Some embodiments herein relate to a method for initiating a therapeutic response, the method comprising: transducing a therapeutic cell with any one or more of the SABRs described herein, and administering the therapeutic cell to a subject in need of treatment, wherein the SABR directs a cellular response in the subject upon binding to an antigen receptor in the subject, and wherein the therapeutic cell suppresses a pathogenic T cell.
[0234] Some embodiments herein relate to a method for treating a patient comprising introducing into the patient a therapeutic T-cell comprising an extracellular peptide-MHC complex, the peptide-MHC complex comprising an antigen presenting domain linked to a signal transduction domain, wherein the antigen presenting domain comprises an MHC.
Therapeutic T Cell Compositions
[0235] Each of the embodiments provided herein with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Therapeutic T Cell Compositions.
[0236] Some embodiments herein relate to a composition comprising: a therapeutic T-cell comprising any of the SABRs described herein.
Additional SABR Compositions
[0237] Provided in this section are additional options for arrangements and combinations of SABRs and uses thereof.
[0238] Some embodiments herein relate to a SABR comprising: an extracellular binding domain comprising an MHC and a peptide epitope, a transmembrane domain, and a cytoplasmic signaling domain.
Cell-based Platform for T cell Antigen Discovery:
[0239] Each of the embodiments provided herein with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to a Cell-Based Platform for T cell Antigen Discovery.
[0240] Some embodiments herein relate to chimeric SABRs in a novel cell-based platform for TCR antigen discovery. In some embodiments, SABRs present an extracellular peptide-MHC complex and induce intracellular signaling via a TCR-like signal upon binding with a cognate TCR. Some embodiments herein relate to antigen discovery using SABR libraries to screen, for example, thousands of antigenic epitopes. This platform was verified by identifying the targets recognized by public TCRs of known specificities. Moreover, this approach can be extended for personalized neoantigen discovery. In some embodiments, the antigen discovery platform described herein can provide a scalable and versatile way to develop novel targets for immunotherapy.
[0241] A CD8+ T cell encodes a unique surface T Cell Receptor (TCR) that recognizes 8-12 residue long peptide epitopes presented on class I MHC molecules, also known as Human Leukocyte Antigens (HLA) in humans. When a TCR complex binds cognate peptide-MHC (pMHC), the CD3ζ chains associated with the TCR complex dimerize to initiate downstream signaling. Multiple signaling cascades are activated, leading to rapid gene expression driven by the transcription factors NF-κΒ, AP-1, and NFAT7. In CD8+ T cells, TCR signaling induces expression of early activation markers (CD69 and CD107a), release of cytotoxic granules, and secretion of cytokines (IFNy, IL2, and TNFa), ultimately killing the target cell. The interaction of cognate TCR and pMHC complexes generates a high degree of specificity towards a target antigen. T cells can recognize epitopes presented by tumor cells and infiltrate the tumor microenvironment. Antitumor T cells respond to two kinds of tumor-derived epitopes: 1) Public or private epitopes originating from non-mutated, tissue specific antigens or cancer-testis antigens, and 2) Private neoantigens originating from non-synonymous mutations. Both endogenous antigens and neoantigens can be used to provide targets of immunotherapies.
[0242] One of the bottlenecks in the field of tumor immunology is the identification of the antigen recognized by a particular antitumor CD8+ T cell. Several techniques have been developed to identify cognate antigens for T cells. The most common approach uses pMHC multimers to identify antigen-specific T cells by flow cytometry. However, antigen discovery using pMHC multimers requires ab initio knowledge of the antigenic landscape, is not scalable beyond 10 3 antigens, but can identify multiple antigenic specificities simultaneously. This approach has been used to discover public tumor antigens as well as private neoantigens. One approach uses degenerate libraries of covalently linked. Following multiple rounds of selection, outgrowth, sequencing, and referencing tumor exome data, the cognate antigen of the TCR is identified. However, this approach is technically challenging because of the requirement of soluble TCR, does not represent the physiological TCR-pMHC interaction, but is antigen-agnostic and scalable to 106-108 epitopes. These limitations underscore the need for new techniques for T cell antigen discovery.
[0243] Some embodiments herein thus relate to novel antigen discovery techniques to address the unmet need. In some embodiments, cell-based platforms for T cell antigen discovery are presented. In some embodiments, by combining antigen presentation by pMHC complexes with intracellular signaling, SABRs allow identification of a successful TCR-pMHC interaction. Some embodiments relate to TCR antigen discovery using SABR libraries and its use for known public TCRs. Some embodiments relate to adaptation of SABR libraries for a personalized neoantigen-directed approach. Some embodiments describe a flexible and scalable method for T cell antigen discovery.
Additional Contemplated Embodiments
[0244] Each of the embodiments provided above with regard Signaling and Antigen-Presenting Bifunctional Receptors can be used within the present embodiments described herein with regard to Additional Contemplated Embodiments.
[0245] Various embodiments described herein address the limitations of the TCR- Antigen-MHC interaction through the introduction of SABRs. The use of SABRs, as discussed herein, allows for the utilization of TCR-Antigen-MHC interactions for various functions.
[0246] In some embodiments, a function enabled by the SABRs disclosed herein comprises uncovering T cell antigenic specificities in cancers, infectious diseases, and autoimmune diseases. T cell-mediated responses to cancers target multitude of antigens expressed on cancer cells. Knowing the antigens that are targeted is immensely useful for immunotherapy approaches to treat cancers. There are several technologies to uncover epitopes that are targeted by T cells. The most widely used technologies are based on using MHC-peptide-multimers. The use of MHC multimers has several drawbacks - it is labor intensive and not easily scalable, it is not trivial for class II MHC -peptide complexes, and it is not sensitive towards low-affinity interactions. Yeast display has also been tested for TCR antigen discovery but suffers from several drawbacks as well. Yeast display relies on using peptide-MHC-b2microglobulin single chain trimers (SCTs), which mimic antigen presentation and link the antigen genetically to MHC. However, the use of SCT Yeast display technology requires production of soluble TCR molecules, which is not robust, and which cannot be scaled to multiple TCRs easily. Moreover, because yeast lacks endogenous MHC, the SCTs may not fold correctly and may not represent physiological TCR binding. Other technologies that are antigen-directed require prior knowledge of antigenic epitopes from patient samples, or that require expansion of patient T cells that may bias the antigen specificity, or that require large amounts of patient samples that may not be available. The SABR technology described here uses an unbiased approach that will use a library of target cells that are recognized by a given T cell or a TCR. SABRs allow scalability of this approach to, for example, over 10 6 epitopes and virtually all MHC alleles, including class I and class II alleles, does not require soluble TCR production, allows for low-affinity TCR- pMHC interactions, and can be used without patient tumor samples.
[0247] In some embodiments, another function enabled by the SABRs disclosed herein comprises studying T cell receptor cross-reactivity and heteroclitic ligands. TCRs display considerable promiscuity in recognition of the variants of their cognate epitope. The study of TCR cross-reactivity is important to understand the safety and efficacy of a TCR or a T cell bearing a particular TCR. In cancer immunotherapy, the knowledge of the cross- reactivity of a TCR can help understand the off-target or on-target, but unintended effects of using that TCR therapeutically without undesirable side effects. In immunotherapy for viruses such as HIV, the knowledge of TCR cross-reactivity can help understand the propensity of immune escape of the pathogen from that TCR. The current technologies of studying TCR cross-reactivity are based either on low-throughput methods using individual variant peptides, or on yeast display technologies that are laborious and require production of soluble TCRs. In some embodiments, the SABR technology described herein allows for construction of libraries of, for example, 10 3 -10 6 antigenic epitope variants for any given MHC-peptide combination, and for subsequent identification of variants that are recognized, without the requirement for soluble TCR production. In addition, this approach can be used to identify variants of a given epitope that may have different binding properties, such as heteroclitic ligands with higher affinity and antagonists.
[0248] In some embodiments, yet another function enabled by the SABRs disclosed herein comprises inducing specific T cell responses. Vaccination approaches that elicit T cell responses require presentation of antigen epitopes to T cells and subsequent stimulation of those T cells. Professional antigen presenting cells (APCs) process endogenous or foreign antigens and present them to T cells. Antigen-specific immunity can be elicited by using live attenuated or inactive viruses, soluble antigenic proteins, or by using vectors. However, in these approaches, the antigenic epitopes are processed by the natural cellular machinery, and hence there is no control over whether a given epitope will elicit a strong immune response. To elicit a response to a given epitope, it is expressed in APCs via expression cassettes for entire proteins of via tandem minigenes encoding epitopes. Single chain trimers can also be used to express a given MHC-peptide complex on APCs to elicit an immune response. As single chain trimers cannot signal in the APC, they cannot manipulate how the APC will stimulate T cells. In some embodiments, the SABRs described herein can be coupled to specific signaling molecules that can allow the APCs to secrete cytokines and activate T cells that recognize them. In some embodiments, SABRs can be configured to elicit immunosuppressive cytokines in APCs, which can cause suppression of particular responses.
[0249] In some embodiments, yet another function enabled by the SABRs disclosed herein comprises eliminating T cell specificities. Pathogenic T cell clonal specificities may play a central role in T cell leukemias and autoimmune disorders. In T cell leukemia, the outgrown and transformed clones can be specifically targeted based on the antigenic epitopes recognized by them. In autoimmune disorders, T cell clones that are autoreactive can also be targeted based on their cognate epitopes. Eliminating T cell clones based on their antigenic specificities allows for precise targeting with minimal off-target effects. The approaches tested so far have relied on monoclonal antibodies that recognize particular TCR variable regions. Targeting specific TCR variable regions provides precision but does not allow for targeting TCRs that may comprise of different variable regions while recognizing the same antigenic specificity. In addition, this approach can result in depletion of all TCRs comprising of a given variable region without regard for their specificities. In some embodiments, SABRs can allow for targeting of TCRs based on their antigen specificity. T cells transduced with SABRs presenting a given epitope can be used therapeutically to eliminate pathogenic T cell specificities. In addition, the identification of antigens that can be recognized by clonal T cells can be used for developing SABRs even without the knowledge of their natural cognate antigen. In some embodiments, the drawbacks of existing technologies can be overcome by linking signaling and antigen presentations through SABRs. By combining antigen presentation and signaling, SABRs allow a robust, scalable, high-throughput, and sensitive approach to initiate signal transduction in cells recognized by given TCRs, therefore allowing a functional output to be generated by them.
[0250] In some embodiments, MHC molecules present peptide epitopes on a cell surface for recognition by T cells. In their native form, MHC molecules lack signaling domains, and cannot transduce any signal into the antigen presenting cell. Some embodiments described herein relate to a chimeric construct (e.g. SABR) that adds a signal transduction domain to the intracellular end of MHC molecules. In some embodiments, these SABRs are able to present antigen, and induce an intracellular signal upon recognition by a T cell. In some embodiments, SABRs have two or more distinct functional parts including, for example, including one or more antigen recognition domains that are based on MHC molecules, which present peptide epitopes to T cells. In some embodiments, these can either be genetically encoded and covalently linked to the MHC molecule or expressed in the cell and presented naturally by the MHC molecule. Additionally, in some embodiments, the SABRs comprise one or more signal transduction domains that induce an intracellular signal to induce a transcriptional response upon binding of the SABRs to their cognate T cells. The SABRs constructs can be used for multiple different purposes, such as for antigen-discovery in cancer, autoimmune disorders, and infectious diseases, for immunotherapeutic approaches to eliminate T cell specificities, for inducing antigen specific cytokine signaling.
[0251] FIG. 3A illustrates a schematic of the T cells and target cells used to demonstrate the function of SABRs according to various embodiments herein. In some embodiments, class I SABRs 302 can be constructed based on the two constructs shown in FIG. 1C. These include the SCTR constructs, which consist of the peptide epitope covalently linked to MHC, and the SCDR constructs, which can, in some embodiments, be forced to present a peptide epitope that is not genetically linked to MHC. In some embodiments, the SCTR constructs can be constructed to express, for example, either A2-NYESO (a cancer- specific MHC-antigen combination) or B27-KK10 (an HIV-specific MHC-antigen combination). In some embodiments, the SCDR constructs for A2 and B27 can be constructed and a peptide can be used to present, for example, either NYESO or KK10 antigen. In some embodiments, for example, NFAT-GFP-Jurkats, can be transduced with the SCTR constructs or with SCDR constructs and pulsed with peptide antigen as reporter cells 304. In some embodiments, the reporter cells 304 can be transduced with Jurkat cells 306 expressing, for example, either A2-NYESO-specific TCR or B27-KK10-specific TCR, and the frequency of GFP+ cells can be measured with flow cytometry.
[0252] As shown in FIG. 3B, NFAT-GFP-Jurkats may express GFP only upon specific recognition of MHC-antigen by SABRs. FIG. 3C illustrates a similar assay using NFAT-GFP-Jurkat cells expressing B27-KK10-SCTR constructs according to various embodiments. In some embodiments, Jurkat cells can be transduced with four different B27- KKlO-specific TCRs from four different HIV patients and incubated them with the NFAT- GFP-Jurkat cells. As shown in FIG. 3C, the reporter cells can express GFP upon being recognized by all four TCRs. Therefore, in some embodiments, class I SABRs function in the proposed way discussed above and can be used in a reporter cell line.
[0253] FIG. 4A illustrates a schematic describing the use of various SABR constructs for T cell antigen discovery according to various embodiments herein. FIG. 4B illustrates a schematic describing the use of SCTRs to study TCR cross-reactivity or to identify heteroclitic ligands according to various embodiments herein. In some embodiments, using these approaches, the antigenic reactivities of cancer-specific, pathogen- specific, or autoreactive T cells can be identified. In some embodiments, SABR libraries expressing antigens or antigenic epitopes from cancers, pathogens, normal cellular proteome can be constructed. In some embodiments, these libraries can be used to identify T cell specificities in, for example, cancer immunity, in autoimmune disorders including diabetes and neurodegenerative disorders, in immunity against pathogens, and in vaccine responses (FIG. 4A). In some embodiments, for a given T cell specificity, SABR libraries expressing variants of the cognate epitope can be constructed and used to understand TCR cross- reactivity and to identify heteroclitic ligands (FIG. 4B).
[0254] FIG. 5A illustrates a schematic describing the ability of SABRs to induce toxicity in response to recognition of particular T cell antigenic specificities according to various embodiments. In some embodiments, SABRs can also redirect T cell specificity to target other pathogenic T cells. As SABRs can induce signaling in T cells akin to CARs, they can be used to initiate a cytotoxic response towards T cells that recognize them. In some embodiments, a therapeutic T cell 502 transduced with SABRs recognizing a given antigen can be used to specifically eliminate pathogenic T cells 504 in a specific manner as described in FIG. 5A. In some embodiments, this ability can be tested using a cytotoxicity assay as described in FIG. 5B. In some embodiments, primary T cells can be transduced with two different A2-NYESO-SCTR constructs to allow their use as effector/therapeutic T cells. In some embodiments, Jurkat cells expressing A2-NYESO-, A2-MART1-, or B27-KK10- specific TCR can be used as target cells. In some embodiments, therapeutic T cells and target cells can be co-incubated and the survival of target cells can be measured after 24 hours. As described in FIG. 5B, A2-NYESO-SCTRs may be able to induce cytotoxicity specifically towards target cells expressing A2-NYESO-specific TCR, demonstrating the cytotoxic function of SABRs. In some embodiments, based on these results, SABRs can be used therapeutically to eliminate antigenic specificities from a T cell repertoire. In the case of, for example, autoimmune diseases, the pathogenic T cells may be autoreactive T cells, which can be recognized by the SABR expressing their cognate autoantigen. In the case of, for example, T cell leukemia, the pathogenic T cells may be clonally expanded T cells, which can be recognized by the SABR expressing either their cognate antigen or a heteroclitic ligand recognized by them. In some embodiments, the specificity of SABRs allows them to target particular T cell specificities while not targeting the normal T cell repertoire.
[0255] In summary, in various embodiments described herein, SABRs can be used as a robust, scalable, specific, and versatile way to couple antigen presentation and signaling. In various embodiments, this function can be exploited in several different ways to understand and manipulate T cell specificities.
[0256] In certain embodiments, SABRs can be used for antigen discovery. Current technologies for antigen discovery include MHC multimers, functional assays, yeast display, mass spectrometry, and DNA barcoding/NACS. These technologies have several disadvantages including a lack of scalability, lack of ability to expand to many MHC alleles, need for specialized instrumentation, and lack of robustness. Moreover, all the current technologies focus on cancer-specific T cells, and MHC-I antigens. There is a severe dearth of approaches/strategies to identify MHC-II antigens.
[0257] MHC multimers are produced by synthesizing peptide epitopes and refolding them with biotinylated MHC molecules. However, MHC multimers are limited to 10-100 antigens at one time are therefore are not scalable. Moreover, making multimers for MHC-II antigens is technically challenging due to their inherent instability. Functional assays such as ELISPOT also rely on synthesizing peptide epitopes and presenting them on target cells. While it has been a popular technology, the scale up to include numerous MHC-I and MHC-II alleles, as well as a broad range of epitopes is complex. Yeast display techniques use MHC -peptide presentation on yeast cell surface followed by staining the yeast using a soluble TCR. Production of soluble TCRs is highly non-robust and time consuming, and therefore not easily scalable. Mass spectrometry techniques identify prospective antigenic epitopes based on mass spectrometry of antigen presenting cells. However, mass spectrometry requires a large amount of tissue, which is difficult to obtain for many diseases such as Type 1 Diabetes. Moreover, it also requires validation based on MHC multimers. Finally, DNA barcoding/NACS uses specialized barcoded MHC multimers that are immobilized on chips or beads. While effective, this technique is limited by the requirement for specialized equipment to capture cells and read their barcode, and by the inability to handle multiple sample at once. [0258] Some embodiments herein are directed to novel technologies for discovering and validating antigen reactivity of T cells. T cells are an essential part of the adaptive immune system that fights infections and cancers. T cells use their surface TCR to recognize antigenic peptide epitopes presented by MHC proteins. Antigens displayed on MHC can be either from pathogens (e.g. peptides from Influenza virus), from cancerous cells (e.g. MARTl/MelanA peptide expressed on Melanoma cells), or from normal cells (e.g. Prolnsulin peptide from normal pancreatic cells). T cell responses are protective in their normal form but can be pathogenic if dysregulated.
[0259] T-cells are essential for immunity against viral infections and cancers but can cause autoimmune diseases like Type 1 Diabetes if they become dysfunctional. One of the biggest challenges in studying T cells is in the discovery of the specific protein antigens they recognize. In some embodiments, SABRs can be used to present protein antigens and induce a readable output of a T cell that recognizes them. In some embodiments, this ability of SABRs can solve the challenge of antigen identification and benefit the development of T cell mediated therapies. Some embodiments herein relate to using SABR technology for use in antigen discovery in numerous diseases including, for example, cancers, Type 1 Diabetes, multiple sclerosis, HIV/ AIDS, and others. For example, FIG. 19 illustrates antigenic epitopes that, when combined with the SABR technology herein, could be useful in treatment of type 1 diabetes.
[0260] Protective cell responses, such as those towards pathogens or cancers, are manipulated for prevention/therapy via vaccines or immunotherapies. Dysfunctional T cell responses specific for autoantigens can be pathogenic, such as those targeting normal pancreatic cells in Type 1 Diabetes. Two types of T cells mediate the immune response: CD8+ T cells that recognize 8-12 residue long peptides presented on class I MHC (MHC-I) molecules and initiate direct killing of infected or cancerous cells, and CD4+ T cells that recognize 12-17 residue long peptides presented on class II MHC (MHCII) molecules and provide immunologic help to CD8+ T cells. Both CD8+ and CD4+ T cells play important roles in protective and pathogenic immunity. Understanding the antigens targeted by these cells is an important factor for manipulating these responses. There is a growing need for technologies to identify and validate targeted antigens.
[0261] Various embodiments herein are directed to novel technologies to identify and/or validate antigenic epitopes targeted by a given T cell. In some embodiments, the technology relies on synthetic proteins called SABRs. [0262] In some embodiments, SABRs perform various functions including presenting an antigenic epitope via an extracellular MHC domain and initiating a readable cellular signal upon recognition of that epitope via an intracellular signaling domain. In some embodiments, by combining these two functions, SABRs can present an antigen, and then transduce a signal if a T cell recognizes that antigen. In some embodiments, the transduced signal is converted to a readable output, such as expression of a reporter gene, e.g. GFP, to mark a recognized cell.
[0263] In some embodiments, the various abilities of SABRs described herein can be used to screen for or validate reactivity to a given antigen, similar to ELISPOT assays. Example uses of this strategy according to various embodiments include monitoring vaccine/disease induced T cell responses in Influenza infection and screening for pathogenic autoreactive T cells in Type 1 Diabetes. Alternatively, in some embodiments, libraries of SABRs presenting numerous antigens can be constructed to identify antigens recognized by T cells of unknown specificity. Example uses of this strategy according to various embodiments include identification of tumor antigens recognized by tumor infiltrating lymphocytes and identification of neoantigen-specific T cell responses in cancer patients.
[0264] In accordance with various embodiments herein, The SABR technologies present major advantages over existing technologies including scalability, ease of use, ability to identify MHC-II antigens, and easier commercialization. Therefore, in some embodiments, SABR technology can be used into a commercial method or kit that can enable T cell antigen discovery, diagnostics, and validation for infectious diseases, cancers, and autoimmune diseases. In some embodiments, the SABR technology can be commercialized include prepackaged lentiviral vectors to express SABRs and cell-based libraries expressing SABRs.
Advantages of SABR Technology
[0265] In some embodiments, the SABR library technology described herein has multiple advantages. In some embodiments, the SABR libraries described herein can be built at a flexible scale, from, for example, 1 to 10 6 antigens or more, 100, 200, 300, 400, 1000, or more antigens in a library, depending on the disease in question. In some embodiments, the library can include hundreds of antigens for identifying a full protein's epitope, a couple of thousand antigens for diseases (neoantigen, listeria), or hundreds of thousands of antigens for broad identification [0266] Moreover, in some embodiments, this scale up/down can be performed in a standard immunology laboratory without the need for specialized equipment. SABR libraries can also be built for any given number of MHC alleles, making it easier to toggle between universal or patient- specific antigen libraries. Additionally, in some embodiments, the intended product and its use is in a format that requires routine laboratory procedures. Therefore, the turnaround time for using the product can be as low as 3-5 days. Furthermore, unlike yeast display or DNA barcoding, the SABR technology can be used on multiple samples at a time, increasing the throughput. Finally, in some embodiments, SABR libraries can be built for both MHC-I and MHC-II antigens, unlike the current technologies, which are restricted largely to MHC-I antigens. In some embodiments, this versatility allows the use of the SABR technology to a large number of autoimmune diseases.
[0267] In some embodiments, The SABR technology may have a significant cost advantage over other approaches. In some embodiments, the implementation of the technology does not require the use of any specialized equipment that a standard immunology laboratory would not have. For instance, in some embodiments, a flow cytometry-based cell sorter and access to Illumina sequencing facilities is sufficient to implement the technology in an academic/industrial laboratory. Current technologies are limited by the need for specialized equipment, for instance, access to Mass Spectrometer (MS), or specialized chips for DNA barcoding/NACS. Also, in some embodiments, unlike other technologies, the SABR technology does not require synthesizing any specialized reagents that are critical to its implementation. For example, yeast display technology requires synthesizing a soluble TCR, which is highly non-robust and requires time consuming/expensive protein purification. In some embodiments, SABRs are used in simple cell-based assays which can be performed in a general BSL2 laboratory setting. In some embodiments, the SABR technology offers a higher throughput because of its ability to process multiple samples at once. Most of the current technologies can handle only one patient sample at a time.
[0268] In some embodiments, the SABR technology can be manufactured on a mass scale. In some embodiments, the number of antigens that can be encoded in the library can be scaled up/down as per the requirements that are diseases/user specific. For example, a library for cancer neoantigens for patient-specific screening may encode for 6000 peptides, whereas a universal library for multiple class I HLA alleles may have ~10 6 peptides. In some embodiments, the scalability at this level is dependent on large scale oligonucleotide synthesis. In some embodiments, a given SABR library, for instance, can be around 10 5 -10 6 cells. In some embodiments, this number can be scaled up relatively easily, similar to commercially available cell lines.
[0269] Any one or more of the embodiments described herein can be combined with another one or more of the embodiments described below. Any one or more of the compositions described below can be combined or substituted into any one of the methods and/or mechanisms described below.
Examples
Example 1: SABRs, Peptide Fusion, Signaling Domain-MHC, MHC -Peptide Antigen
[0270] T cell activation upon recognizing a target antigen induces detectable gene expression. However, as MHC molecules lack signaling domains, detection of recognized APCs is challenging. Fusing an intracellular signaling domain to pMHC complexes enables signal transduction. Chimeric receptors called SABRs were constructed. The extracellular domain of a SABR was a covalently linked peptide- P2microglobulin-MHC trimer, fused to an intracellular CD3ζ signaling domain with a CD28 co-stimulatory domain. Two variations of SABRs, SABR-F and SABR-E, were constructed which contained the entire MHC molecule or only the extracellular part of the MHC molecule respectively, as seen in FIG. 6A. FIG. 6A illustrates schematics showing the SABR-F and SABR-E constructs according to various embodiments. SABR-F 600A contains the transmembrane domain 602A from HLA, whereas SABR-E 600B contains the transmembrane domain 602B from CD3ζ. The two horizontal lines indicate two leaflets of the plasma membrane. FIG. 6B illustrates a bar graph showing, on the Y-axis, %GFP+ cells at 8 hours in NFAT-GFP-Jurkats transduced with A2- MARTl-SABRs and co-cultured with Jurkat cells transduced with TCRs. Co-culture assays were performed using 50,000 target cells and 50,000 effector cells. Within FIG. 6B, bars indicate mean ± sd, n=12.
[0271] Upon interaction with a TCR, SABRs presenting its cognate antigen can induce an intracellular signal. FIG. 7A illustrates schematics demonstrating SABRs and TCR-pMHC specific signaling, with single chain trimer (SCT) and antigen (Ag). Within FIG. 7A, dotted lines indicate Gly-Ser linkers. An SCT without a signaling domain will not induce an intracellular signal in an antigen presenting cell when recognized by a TCR. Similarly, a SABR presenting an irrelevant antigen will not induce an intracellular signal when recognized by a TCR. However, a SABR presenting a cognate antigen will induce an intracellular signal when recognized by a TCR.
[0272] To detect the signal induced by SABRs, NFAT-GFP-Jurkat cells were used, which express GFP upon receiving a signal via ΟΌ3ζ. NFAT-GFP-Jurkat cells were transduced with SABRs presenting the EAAGIGILTV epitope (from the MARTI protein) on HLA-A*0201 (hereafter known as A2-MART1-SABR) or the KRWIILGLNK epitope (KK10, from the HIV-1 Gag protein) from HIV-1 on HLA-B*2705 (hereafter known as B27- KK10-SABR). NFAT-GFP-Jurkat cells were co-incubated and transduced with Jurkat cells expressing TCRs and GFP expression was measured by flow cytometry after 8 hours. Specifically, F5 (recognizes A2-MART1), EC27 (recognizes B27-KK10), SL9 (recognizes A2-SLYNTVATL) TCRs or untransduced Jurkat cells were used. Robust GFP expression was detected only in co-culture assays with the cognate TCR-SABR-F pairs. FIG. 7C illustrates GFP expression by SABR transduced NFAT-GFP-Jurkat cells upon co-culture with TCR-transduced Jurkat cells. Within FIG. 7B, the Y-axis shows %GFP+ cells in co- culture assays performed with 10,000 effector and 10,000 target cells at 8 hours after co- culture. Within FIG. 7C, bars indicate mean ± sd, n=3. FIG. 7B illustrates representative flow cytometry plots from assays of FIG. 7C. Within FIG. 7B, frequency of GFP+ cells are indicated as a percentage.
[0273] The SABR-F construct showed higher signal than SABR-E construct, and therefore, was used for further experiments. To test if SABRs can detect T cell specificities in a polyclonal population, a number of Jurkat cells expressing F5 TCR were titrated with untranduced Jurkat cells and co-incubated them with NFAT-GFP-Jurkat cells expressing A2- MART1-SABR. SABR signaling was titratable and sensitive enough to detect at least as low as 10 F5+ Jurkat cells mixed with 10,000 mock-transduced Jurkat cells.
[0274] FIG. 7D illustrates a graph of detection of low cell numbers by SABRs. Within FIG. 7D, the Y-axis shows number of GFP+ cells in co-culture assays performed with 10,000 effector and 10,000 target cells at 8 hours after co-culture. The X-axis shows the number of F5+ Jurkat cells mixed with untransduced Jurkat cells. Within FIG. 7D, bars indicate values for n=l. FIG. 7E illustrates a timecourse of GFP expression by A2-MART1- SABR transduced NFAT-GFP-Jurkat cells co-cultured with F5-transduced Jurkat cells. The Y-axis shows %GFP+ cells in co-culture assays performed with 50,000 effector and 50,000 target cells. Within FIG. 7E, dots indicate mean ± sd, n=3. [0275] SABR signaling was also rapid, as GFP signal was detectable within 3 hours of co-incubation, and reached saturation within 6-8 hours, as shown in FIG. 7E and FIG. 7F. FIG. 7F illustrates representative flow cytometry plots from the experiment enumerated in FIG. 7E. Within FIG. 7F, the rectangle in the right bottom corners shows the gate for counting GFP+ cells. The time at which each sample was collected is shown as hours. The frequency of cells in the GFP+ gate is indicated as a percentage.
[0276] Taken together, these results show that SABRs can induce signaling upon successful and specific TCR-pMHC interaction, allowing identification of recognized APCs.
Example 2: SABRs Allow Different Modes of Antigen Presentation
[0277] The endogenous MHC complexes described above present epitopes from newly translated proteins or endocytosed proteins via cross-presentation. To test if SABRs can also utilize these pathways for antigen presentation, an 'empty' version of SABRs was constructed that linked P2-microglobulin with A2 or B27 but did not genetically encode for an epitope. FIG. 8A illustrates a schematic showing SCT, SABRs, empty SABRs, and tandem minigenes (TMGs) according to various embodiments, with epitope (EP), signal sequence (S), and MHC class I trafficking signal (MIHC). Within FIG. 8 A, numbers 1-6 indicate Gly-Ser linkers. FIG. 8B illustrates SABR vector constructs with a stuffer fragment showing BsmBI sites, and a cloning strategy using double stranded oligonucleotides with encoding the epitope flanked by overlaps according to various embodiments. FIG. 8C illustrates an empty SABR construct according to various embodiments. FIG. 8D illustrates an empty SABR (i.e. no encoded peptide) and endogenously expressed peptide according to various embodiments herein.
[0278] SABR-APCs were incubated with soluble peptides to test presentation and recognition of those peptides. FIG. 8E illustrates a schematic of empty SABRs pulsed with exogenous peptide. NFAT-GFP-Jurkat cells expressing the empty SABRs were incubated with soluble MARTI or KK10 peptides and co-cultured them with Jurkat cells expressing F5 or EC27 TCRs.
[0279] FIG. 8F illustrates a graph showing GFP expression by NFAT-GFP- Jurkats transduced with empty SABRs pulsed with soluble MARTI or KK10 peptides and co-cultured with Jurkat cells transduced with F5 or EC27 TCRs. The Y-axis shows %GFP+ cells in co-culture assays performed with 10,000 effector and 10,000 target cells at 8 hours after co-culture. The bars indicate mean ± sd, n=3. Both A2 and B27 empty SABRs induced a signal only in presence of the soluble peptide corresponding to the TCRs, and not in presence of mismatched peptide or in absence of soluble peptide. Moreover, the signal induced by correct peptide-TCR combinations was comparable to the signal induced by the corresponding SABRs presenting covalently linked epitopes.
[0280] Endogenously processed peptide epitopes were tested to determine if they could be presented on 'empty' SABRs. Therefore, pentameric TMGs were constructed to express the KK10 epitope along with four irrelevant CMV-derived epitopes. FIG. 8G illustrates a schematic of empty SABRs presenting the newly translated epitopes, with a TMG.
[0281] NF AT- GFP- Jurkat cells were co-transduced with the empty B27-SABR and the KK10 TMG. Following co-incubation with EC27- or F5-expressing Jurkat cells, the 'empty' SABRs were able to present the endogenously expressed epitopes and induce specific signaling, as illustrated in FIG. 8H. FIG. 8H illustrates a graph of GFP expression by NFAT-GFP-Jurkats co-transduced with empty B27-SABRs KK10-TMG or transduced with empty B27-SABR and pulsed with KK10 peptide, and co-cultured with Jurkat cells transduced with F5 or EC27 TCRs. The Y-axis shows %GFP+ cells in co-culture assays performed with 50,000 effector and 50,000 target cells at 8 hours after co-culture. Within FIG. 8H, bars indicate mean ± sd, n=3. However, the overall signal was lower than the corresponding empty SABRs were pulsed with soluble peptide. These results show that SABRs can present non-covalently linked epitopes generated through endogenous antigen processing and presentation pathways.
[0282] SABRs can present non-covalently linked epitopes generated through endogenous antigen processing and presentation pathways. FIG. 81 illustrates an SCDR construct with a CD3z signal transduction domain according to various embodiments herein. TCR-transduced Jurkat cells were incubated with the SCTR constructs and pulsed with peptide antigen. FIG. 8J illustrates a bar graph showing %GFP+ frequency for various TCR- peptide variations. FIG. 8K illustrates a bar graph showing %GFP+ frequency for various TCR-peptide composition and concentration variations. The results show that, like T cell signaling, SABR signaling is titratable with the amount of peptide presented.
[0283] FIG. 8L illustrates a schematic showing an SCDR construct with a tandem minigene (TMG) antigen according to various embodiments herein. TCR-transduced Jurkat cells were incubated with the SCTR-transduced NFAT-GFP-Jurkat cells transduced with TMG. FIG. 8M illustrates a bar graph showing %GFP+ frequency for various TCR-TMG variations. The results show that SABRs will present endogenous peptide (fragmented protein sequences derived from proteins in the cell) when not directly linked to an antigen.
Example 3: SABRs Initiating Bona Fide TCR Signal
[0284] To use SABRs as a therapeutic target, a SABR that binds to a pathogenic T cell in a patient can be identified. The SABR can be cloned into appropriate vectors for immunotherapy, such as lentiviral or retroviral vectors. The patient's own blood can be subjected to leukapheresis followed by isolation of T cells. The T cells can be activated and expanded using commercial methods such as using the OKT3 antibody. The expanded T cells can be transduced with the vector containing the SABR. The transduced cells can be reinfused into the patient as a therapeutic. The expanded T cells expressing the appropriate SABRs should target the pathogenic T cells in the patient and lead to elimination of the pathogenic T cells, leading to disease amelioration.
[0285] This can be done for type 1 diabetes, where a pathogenic T cell can target an insulin-derived epitope in the context of HLA-A2.1 (A2.1 -Insulin). In this case, a SABR comprising of HLA-A2.1, presenting the Insulin epitope, and a signaling domain can be cloned into a lentiviral vector. The patient's own T cells can be expanded and transduced with the A2.1-Insulin-SABR expressing vector. The cells can be reinfused into the patient, where they can eliminate the pathogenic T cells that target A2.1 -Insulin.
[0286] SABRs use a ΟΒ3ζ-ΟΌ28 domain for intracellular signaling, similar to chimeric antigen receptors (CARs) and TCRs. Therefore, intracellular signaling ability of SABRs is comparable to TCRs was tested. SABRs ability to induce early activation markers in NFAT-GFP-Jurkat cells was tested. NFAT-GFP-Jurkat cells transduced with the A2- MART1-SABR expressed CD69, an early T cell activation marker, upon co-culture with Jurkat cells transduced with F5 TCR. Co-expression of reporter-driven GFP and endogenous CD69 in cells expressing A2-MART1-SABR, but not the A2-MART1 single chain trimer implies that SABR signaling activates endogenous gene expression, as shown in FIG. 9A. FIG. 9A illustrates representative flow cytometry plots from one experiment of induction of CD69 by SABRs. GFP and CD69 expression in co-culture assays using 10,000 NFAT-GFP- Jurkat cells transduced with the indicated SABRs and 10,000 Jurkat cells transduced with F5 TCR is shown. The frequencies of cells in each gate are indicated as percentage.
[0287] In some embodiments, if SABRs induce a bona fide TCR signal, they can confer cytotoxic capabilities to primary T cells. Activated primary T cells were transduced with A2-MART1-SABR and incubated with CFSE-labeled target cells expressing F5 TCR. Transduced primary T cells lysed Jurkat cells or primary T cells expressing the F5 TCR specifically, as shown in FIG. 9B and FIG. 9C. FIG. 9B illustrates a graph of cytotoxicity induced by SABR-expressing primary T cells against Jurkat cells. The Y-axis shows % survival of CFSE-labeled target cells at 24 hours after co-culture. Cytotoxicity assays were performed with 200,000 SABR-transduced cells and 50,000 TCR-transduced cells. With FIG. 9B, bars indicate mean ± sd, n=8. FIG. 9C illustrates a bar graph of cytotoxicity induced by SABR-expressing primary T cells against autologous target cells. The Y-axis shows % survival of target cells at 24 hours after co-culture. Cytotoxicity assays were performed with 200,000 SABR-transduced cells and 50,000 TCR-transduced cells. Within FIG. 9C, bars indicate mean ± sd, n=8.
[0288] The antigen sensitivity of SABRs and TCRs was compared. To that end, NFAT-GFP- Jurkat cells were transduced with either empty A2-SABR or F5 TCR and used as effectors. As targets, Jurkat cells transduced with A2-SABR or F5 TCR were used, as shown in FIG. 9D. FIG. 9D illustrates a schematic of the assay to measure antigen sensitivity of A2- SABR 902 and of F5-TCR 904.
[0289] Effectors were co-cultured with their cognate targets in presence of a range of concentrations of the MARTI peptide, and GFP expression was measured. Antigen sensitivity was determined as the concentration of the peptide required for half-maximal signaling. The antigen sensitivity of SABRs was 30-fold lower as compared to TCRs, as shown in in FIG. 9E. FIG. 9E illustrates a plot of antigen sensitivity of SABR and TCR signaling. The Y-axis shows %maximum of %GFP+ cells at 8 hours in co-culture assays using 50,000 SABR- or TCR-transduced cells pulsed with the MARTI peptide. The X-axis shows the concentration of the MARTI peptide used to pulse the cells. Within, FIG. 9E, dots indicate mean ± sd, n=3. The dotted horizontal line indicates half-maximal signal.
[0290] Taken together, these results show that SABRs signal similar to TCRs, albeit, in some examples, with lower antigen sensitivity.
[0291] Example 3 above is also an example of SABRs as a therapeutic. For example, in a case where the F5 TCR can be substituted with a pathogenic TCR, such as a TCR recognizing type 1 diabetes antigens. In the therapeutic scenario, a similar experiment to show efficacy can be done where the SABR is presenting the antigen recognized by the pathogenic TCR. Primary T cells expressing the said SABR can then be used to induce cytotoxicity against the pathogenic TCR, and subsequently eliminate them for therapeutic benefit
Example 4: Antigen Discovery using SABR Libraries
[0292] In some embodiments, by virtue of genetically linking the peptide epitope with MHC, SABRs can be used to present a defined antigen and to report its successful recognition by a TCR. Therefore, SABR libraries ability to present a large number of epitopes to be used to screen successful TCR-pMHC interactions was tested. A strategy to construct and use SABR libraries for T cell antigen discovery of Orphan' antitumor TCRs with unknown antigens was created. First, a list of target epitopes was generated from an existing database or from tumor exome data followed by prediction of MHC binding. Pooled oligonucleotide libraries encoding for target epitopes were synthesized and cloned into the SABR plasmid, according to FIG. 10A. FIG. 10A illustrates a schematic showing the pipeline to construct custom SABR libraries according to various embodiments. The left panel 1002 shows the procedure to obtain and synthesize a list of epitopes. The right panel 1004 shows the schematic of the SABR library.
[0293] The SABR libraries were packaged into lentiviral vectors and used to transduce NFAT-GFP-Jurkat cells. NFAT-GFP-Jurkat cells expressing the SABR library were co-cultured with Jurkat cells expressing an Orphan' TCR. GFP+CD69+ NFAT-GFP- Jurkat cells were sorted using fluorescence activated cell sorting (FACS), followed by genomic DNA extraction. The epitope portion of the SABRs was amplified and subjected to high throughput sequencing, as shown in FIG. 10B. FIG. 10B illustrates a schematic showing the co-culture experiment to select cells from the SABR library that are recognized by an orphan TCR according to various embodiments. The left panel 1006 shows a SABR library presenting numerous unique epitopes. The middle panel 1008 shows cells APCs showing reporter expression induced by SABRs presenting the cognate epitope for the orphan TCR. The right panel 1010 shows processing steps of the selected cells.
[0294] The sequencing reads were aligned with the SABR vector backbone using Burrows-Wheeler alignment. Aligned reads were translated to reveal the epitope. The number of reads corresponding to each epitope was counted and reported in a list. A minimum of three replicates of the co-incubation assay were performed. For each replicate, a numerical rank was given to each epitope based on descending order of the number of reads. The rank from three replicates for each assay was averaged and reported as 'Average Rank' , according to the flowchart in FIG. IOC. FIG. IOC illustrates a flowchart showing the computational analysis pipeline.
[0295] The top ranked epitopes were putative antigens for that TCR and are subsequently validated by constructing individual SABRs presenting each of the epitopes and measuring GFP expression in co-culture assays.
[0296] To demonstrate proof-of-concept of the approach detailed in FIGS. 10A- 10C, the SABR libraries ability to identify the cognate antigens of known public TCRs in an unbiased manner was tested. A SABR library encoding 12,055 epitopes presented on HLA- A*0201 (A2-SABR-library) consisting of all known HLA-A*0201 -restricted epitopes from the Immune Epitope Database (IEDB) was constructed. The ability of the A2-SABR-library to identify the cognate antigen for two TCRs with known specificities (F5, which recognizes EAAGIGILTV, and SL9, which recognizes SLYNTVATL) was tested. NFAT- GFP- Jurkat cells were transduced with the A2-SABR-library and incubated with Jurkat cells expressing F5 or SL9 TCRs. After 10 hours of co-culture, GFP+CD69+ cells were sorted by FACS, the genomic DNA was extracted, the epitopes were sequenced, and average ranks for each epitope as described were calculated in FIGS. lOA-lOC. FIG. 11A illustrates representative flow cytometry plots from one replicate. The A2-SABR library cells were sorted based on reporter gene expression. Co-culture assays using 9 million library cells with 9 million TCR- transduced Jurkat cells were set up. At 10 hours post co-culture, the cells were stained for CD69 and sorted using FACS. The rectangle 1102 in the top right corner of each flow plot shows the gate used for the sort. The frequency of cells in the sort gate is indicated as a percentage.
[0297] The average ranks of each of the epitopes from the SL9 sort against those from F5 sort were plotted. FIG. 11B illustrates a plot of average ranks from the F5 and SL9 sorts. Within FIG. 11B, each dot represents the average rank for a unique epitope as calculated using the procedure described in FIGS. lOA-lOC. The Y-axis shows the average rank in the SL9 sort, and the X-axis shows the average rank in the F5 sort. Dots 1104 indicate EAAGIGILTV analogs and dots 1106 indicate SLYNTVATL analogs.
[0298] Six epitopes formed a distinct cluster by their rank in the F5 sort. In the SL9 sort, the top ranks were outliers, but did not form a separate cluster. FIG. 11C illustrates a plot of the average ranks for the top 24 hits from the F5 sort. The epitopes with asterisks indicate EAAGIGILTV analogs. The top six epitopes in the F5 sort were analogs of EAAGIGILTV, indicating successful identification of its antigen, as shown in FIG. 11C.
[0299] FIG. 11D illustrates a plot of the average ranks for the top 24 hits from the SL9 sort. The epitopes with asterisks indicate SLYNTVATL analogs. Six out of the top ten epitopes from the SL9 sort were analogs of SLYNTAVATL, as shown in FIG. 11D. FIG. HE illustrates a plot of the average ranks for all the EAAGIGILTV analogs in the A2-SABR library. FIG. 11F illustrates a plot of the average ranks for all the SLYNTVATL analogs in the A2-SABR library. Epitopes enriched for their corresponding TCRs were not enriched in mismatched TCRs, as shown in FIGS. HE and 11F.
[0300] The noise observed in the SL9 sort was presumably due to the higher number of analogs of the SLYNTVATL peptide. The A2-SABR library contains 22 analogs EAAGIGILTV and 60 analogs of SLYNTVATL. A higher number of recognized analogs would lower the average rank for each of the epitopes because of competition among the epitopes.
[0301] The ranks of all the analogs of EAAGIGILTV and SLYNTVATL in the sorts were compared. Six out of twenty-two EAAGIGILTV analogs were identified in the F5 sort, as shown in FIG. HE, whereas nine out of sixty SLYNTVATL analogs were identified in the SL9 sort, as shown in FIG. 11F. The lack of identification of all the analogs is presumably due to reduced cross-reactivity of the F5 or SL9 TCRs towards them. Indeed, analogs SLYNTIATL (V6I) and SLFNTVATL (Y3F) are documented escape mutations in the SLYNTVATL epitope. Nevertheless, these experiments showed that a SABR library approach could identify the cognate antigen of a TCR by screening thousands of epitopes.
Example 5: Personalized Neoantigen Discovery Using SABRs
[0302] SABRs can be implemented to identify candidate T cell receptors (TCRs) for immunotherapy of a tumor. Genomic DNA or RNA from a tumor biopsy would first be sequenced and compared to non-tumor tissue from that patient. Mutations specific to the tumor, termed "neo-antigens", would be an ideal target for immunotherapy, with the hope of not inducing an immune response anywhere else in the patient's body. A list of these mutations would be generated, filtering out mutations that do not change the amino acid sequence of the patient's proteins. This list would be used to generate a list of short peptides (8 - 12 amino acids for class I MHC and 12-17 amino acids for class II MHC) that would contain these mutations. The peptide list would then be converted to short oligonucleotide sequences that contain the genetic encoding of those peptides flanked by the nucleotide sequences required for cloning into the SABR vector. These oligonucleotides would be synthesized and then cloned into the vector, using whatever molecular techniques are appropriate. Then that vector will be put in cells, using appropriate techniques. In our case, we used the In-Fusion kit that simplifies Gibson assembly to clone the vector. We generated lentivirus from the resultant plasmid, and infected NFAT-GFP-Jurkat cells. This batch of cells, each expressing a unique SABR, is what we call the SABR library. Overall, each cell contains an MHC molecule linked to a unique short peptide with a tumor mutation, and those MHC molecules are directly linked to a signaling domain, creating a SABR. Enough cells were infected with lentivirus so that the batch of cells cover all mutations in the list of short peptides.
[0303] To use the library to find a patient-specific therapy, the same tumor biopsy would be sequenced for RNA of TCR alpha and beta fragments. These fragments are from T cells that were invading the tumor in an attempt to suppress the tumor, known as tumor- infiltrating lymphocytes (TILs). Individual TCRs from these cells would be reconstructed from the sequencing, a fragment of DNA containing that TCR sequence would be synthesized and cloned into a vector, using whatever techniques are appropriate. Lentivirus of that plasmid would be generated and Jurkat cells (without the NFAT-GFP reporter) would be infected with that virus. The candidate TCR cells would then be co-incubated with the SABR library, for about 8 hours, then sorted on FACS sort for cells that show positive signal. In our case, the reporters were GFP and expression of CD69 cell marker. Genomic DNA from the sorted cells would be extracted, sequenced, and analyzed to determine which specific antigen is recognized by the candidate TCR. In our case, the genomic DNA was extracted with the NucleoSpin column extraction kit, PCR amplified with primers flanking the genetically encoded antigen sequence, re-amplified with primers specific for illumina sequencing, and sequenced. The resultant sequencing data was compared to a database of the short peptide sequences, and if the TCR recognizes those peptides, we expect to see an enriched genetic sequence in the pool of extracted genomic DNA.
[0304] If the TCR recognizes a mutation sequence, but not the unmutated sequence, it would be a good candidate for immunotherapy. That would involve extracting immune cells from the patient, using whatever technique desired to make those cells express the desired TCR, and infusing those adoptive cells back into the patient so that they can start attacking the tumor. [0305] To further demonstrate the versatility of SABR libraries, a personalized approach for neoantigen discovery was tested. A recent study identified a neoantigen- specific, tumor-reactive TCR from a melanoma patient using DNA-barcoded tetramers. The identified TCR (neoTCR) was shown to recognize a neoantigen epitope created by a non- synonymous mutation in the USP7 protein. The SABR library approach was used to identify the neoantigen epitope recognized by the neoTCR by screening all possible neoepitopes identified in the tumor sample. To that end, a SABR library presenting 3291 predicted HLA- A*0201 -restricted epitopes (NeoAg-SABR library) corresponding to 108 non-synonymous mutations found in the tumor was generated. The neoTCR was used as a surrogate for a tumor-reactive orphan TCR and the NeoAg-SABR library was used to identify its antigen. Jurkat cells transduced with neoTCR were co-cultured with NFAT-GFP-Jurkat cells expressing the NeoAg-SABR library, GFP+CD69+ cells were sorted, and epitopes from the sorted cells were sequenced and ranked. FIG. 12A illustrates a representative flow cytometry plots from one replicate. NeoAg-SABR library cells based on reporter gene expression were sorted. Co-culture assays using 6 million library cells with 6 million TCR-transduced Jurkat cells were set up. At 10 hours post co-culture, cells were stained for CD69 and sorted using FACS. The rectangle 1202 in the top right corner of each flow plot shows the gate used for the sort. The frequency of cells in the sort gate is indicated as percentage.
[0306] For each epitope, the average ranks from the neoTCR sort against a mock- sort were plotted. FIG. 12B illustrates a plot of the average ranks from the neoTCR and the mock sorts. Within FIG. 12B, each dot represents the average rank for a unique epitope as calculated using the procedure described in FIGS. lOA-lOC. The Y-axis shows average rank in the neoTCR sort, and the X-axis shows the average rank in the mock sort. Dots 1204 indicate USP7-derived epitopes. Seven epitopes formed a distinct cluster separated by their rank in the neoTCR sort.
[0307] FIG. 12C illustrates a plot of the average ranks for the top 24 hits from the neoTCR sort. Epitopes with asterisks indicate USP7-derived epitopes. The top seven hits in the neoTCR sort were epitopes derived from USP7, demonstrating successful identification of the neoantigen using our approach.
[0308] FIG. 12D illustrates a plot of the average ranks for all the USP7-derived epitopes in the NeoAg-SABR library. The non-synonymous D798Y mutation in USP7 was predicted to generate thirty overlapping neoepitopes, out of which seven were identified as cognate epitopes of neoTCR. The reason the remaining 23 epitopes were not recognized in the screen is probably due to the restricted register of the epitope recognized by the neoTCR. To validate the seven detected epitopes, individual SABRs to present them were constructed. NFAT-GFP-Jurkat cells transduced with these SABRs induced GFP expression upon co- culture with Jurkat cells expressing neoTCR, as shown in FIG. 12E. FIG. 12E illustrates a plot showing validation of top hits identified in the NeoAg-SABR screen. The Y-axis shows GFP expression at 8 hours in NFAT-GFP-Jurkat cells co-cultured with Jurkat cells transduced with neoTCR. Co-culture assays were set up using 10,000 Jurkat cells transduced with neoTCR and 10,000 NFAT-GFP-Jurkat cells expressing SABRs presenting epitopes indicated on the X-axis. The mock comprised untransduced NFAT-GFP-Jurkat cells. Within FIG. 12E, the bars represent mean ± sd, n=4.
[0309] These results demonstrate validation as well as successful personalization of the antigen discovery approach presented herein. Collectively, the results demonstrate that the SABRs are powerful tools for T cell antigen discovery.
Example 6: Materials and Methods
[0310] The specific reagents used in Examples 1-5 are detailed in Table 6.1. The oligonucleotide primers used for cloning and sequencing are listed in Table 6.2. The lists of epitopes in the A2-SABR libraries are listed in Tables 6. 3
TABLE 6.1
Solution, 100X
G-418 Sulfate Corning™, Corning, NY 30-234-CI
Immunocult™ CD3/28 T Cell StemCell Technologies™, Vancouver, 10991
Activator Canada
Human IL-2 IS, premium grade MACS Miltenyi Biotec, Bergisch 130-097-746
Gladbach, Germany
EAAGIGILTV Synthesized by Pierce Thermo Fisher N/A
KRWIILGLNK Synthesized by Pierce Thermo Fisher N/A
DMEM, IX with L-Glutamine, Corning™, Corning, NY 10-013-CV 4.5g/L Glucose and Sodium
Pyruvate
Clontech In-Fusion® HD Clontech, Takara Bio USA, Mountain 639650 Cloning Kit View, CA
BsmBI New England BioLabs®, Inc, Ipswich, R0580S
MA
Clontech Stellar™ Competent Clontech, Takara Bio USA, Mountain 636763
Cells View, CA
Zyppy™ Plasmid Miniprep Kit Zymo Research, Irvine, CA D4036
Carbenicillin (disodium) Gold Biotechnology®, Saint Louis, MO C-103-SL10
NucleoBond® Xtra Maxi EF Clontech, Takara Bio USA, Mountain 740424.50
Kit View, CA
TransIT®-293 Transfection Minis® Bio, LLC Madison, WI MIR 2704 Reagent
Gibco™ Opti-MEM™ I Life Technologies, Thermo Fisher 31985-062 Reduced Serum Medium Scientific, Waltham, MA
Millex®-HV Syringe Filter EMD Millipore, Burlington, MA SLHV033RS Unit, 0.45 μηι, PVDF, 33 mm,
gamma sterilized
MACSQuant® Analyzer 10 MACS Miltenyi Biotec, Bergisch 130-096-343
Gladbach, Germany
APC/Cy7 anti-human CD69 BioLegend®, San Diego, CA 310913 Clone: FN50
BD FACSort™ Becton Dickinson, Franklin Lakes, NJ
CFSE Cell Division Tracker Kit BioLegend®, San Diego, CA 423801
Invitrogen™ PureLink™ Invitrogen™ Life Technologies, Thermo K182001 Genomic DNA Mini Kit Fisher Scientific, Waltham, MA
KOD DNA Polymerase EMD Millipore, Burlington, MA 71085
Macherey-Nagel NucleoSpin® Clontech, Takara Bio USA, Mountain 740609.250 Gel and PCR Purification Kit View, CA
2100 Bioanalyzer Instrument Agilent, Santa Clara, CA G2939BA
Ilumina® HiSeq 2500 Illumina® San Diego, CA SY-401-2501 Sequencing System
TreeStar FlowJo® Flow FlowJo, LLC Ashland, Oregon N/A Cytometric Data Analysis
Software vlO
GraphPad Prism v7 GraphPad, San Diego, California N/A
TABLE 6.2 Primer name Sequence (5'-3') Purpose
SS-Fwd AGCTCCTCGAGATGGCGACGGGTTCAAG SABR cloning
CD28-Overlap- CCACCGCGAGACCTCTTGCTCCGCACTTTA SABR cloning HLA-A2-Rev CAAGCTGTGAGAGACACA
CD28-Overlap- CCACCGCGAGACCTCTTGCTCCGAGCTGTG SABR cloning HLA-B27-Rev AGAGACACATCAGAGC
CD28Intracell- CGGAGCAAGAGGTCTCGC SABR cloning Fwd
XhoI-CD3z- TTGACCTCGAGTCATCTTGGTGGCAGAGCC SABR cloning Rev
Oligo-Insert- CAGGAGGGCTCGGCA Cloning epitopes in Fwd SABRs
Oligo-Insert- GGACCCTCCGCATCC Cloning epitopes in Rev SABRs
Epitope-Oligo CAGGAGGGCTCGGCA NNN...NNN Cloning epitopes in
GGATGCGGAGGGTCC SABRs
TruSeq-Univ- AATGATACGGCGACCACCGAGATCTACAC High throughput SCTfixed-F TCTTTCCCTACACGACGCTCTTCCGATCTG sequencing
GCCTGCTTTGTTTGCC
TruSeq-Read2- GTGACTGGAGTTCAGACGTGTGCTCTTCCG High throughput SCTfixed-R ATCTCCTCCACCACCGCTACCTC sequencing
Truseq- CAAGCAGAAGACGGCATACGAGAT [index] High throughput Adapter-Index GTGACTGGAGTTCAGACGTGTGCTCTTCCG sequencing
[0311] Within Table 6.2, NNN...NNN indicates a back-translated epitope and [index] indicates the 6-nucleotide unique index used for sequencing.
[0312] For Examples 1-5, Jurkat cells (ATCC) were cultured in RIO (RPMI1640 (Corning) supplemented with 10% fetal bovine serum (Corning) and Penicillin/Streptomycin (Corning)). NFAT-GFP- Jurkat cells were cultured in R10 supplemented with 2 mg/ml G-418 (Corning). Primary T cells were activated in R10 supplemented with Immunocult CD3/28 (StemCell Technologies) and 40 U/ml IL-2 (Miltenyi Biotec). HEK-293T cells (ATCC) were cultured in D10 (DMEM (Corning) supplemented with 10% fetal bovine serum (Corning) and Penicillin/Streptomycin (Corning)). Peptides EAAGIGILTV and KRWIILGLNK were synthesized by Pierce Thermo Fisher.
[0313] For constructing the SABRs of Examples 1-5, single molecules encoding for 2-microglobulin and HLA were synthesized as gBlocks (IDT) and amplified using primers SS-Fwd and CD28-Overlap-HLA-Rev. CD3ζ/CD28 signaling domains were cloned from the J3 CAR using primers CD28Intracell-Fwd and XhoI-CD3z-Rev. The two parts of SABRs were assembled via PCR or via InFusion HD cloning kit (Takara). A synthetic 2kb fragment of non-specific stuffer DNA (IDT) flanked by BsmBI sites was cloned in place of the epitope. To clone a given epitope into a SABR vector, the vector was first linearized by BsmBI digestion (NEB) and gel purified using Nucleospin Gel and PCR kit (Takara). A single stranded oligonucleotide containing overlaps with the vector and the epitope was synthesized (IDT). The oligonucleotides were amplified using KOD polymerase (Milipore) and Oligo-Insert-Fwd and Oligo-Insert-Rev. Amplified oligonucleotide was cloned into the linearized SABR vector using InFusion HD cloning kit (Takara). All cloning reactions were transformed into Stellar competent cells (Takara), grown on LB+Agar plates containing 100 μg/ml Carbenicillin (Life Technologies), and individual colonies were inoculated in liquid culture. Plasmid minipreps were performed using Zyppy Miniprep kit (Zymo). Plasmids were verified by Sanger sequencing (Laragen).
[0314] For TCR cloning of Examples 1-5, sequences for the F5, SL9, and neoTCR were synthesized as gBlocks (IDT) and cloned in the pCCLc-MND-X backbone along with a truncated form of LNGFR gene as previously described. EC27 TCR was cloned as described previously. [0315] To generate lists of epitopes to be cloned into SABR vectors in Examples 1-5, two approaches were taken. In the universal A2-SABR library, all HLA-A*0201- restricted epitopes from Immune Epitope Database (IEDB) were downloaded. In the neoantigen SABR library, HLA-A*0201 -restricted neoepitopes generated from the tumor mutanome data were used. Protein sequences were back-translated to nucleotide sequences using the most abundant codon for each amino acid based on the GenScript Codon Usage Frequency Table Tool (GenScript). Oligonucleotides encoding for the epitopes and containing overlaps with the SABR vector were synthesized in pooled single stranded oligonucleotide libraries (Twist Biosciences). Oligonucleotide libraries were amplified and cloned into the SABR vector as described previously. To ensure sufficient coverage, bacterial cells transformed with the cloning reaction were inoculated directly into 500 ml liquid cultures overnight. The plasmid DNA containing the libraries was prepared using Nucleobond Xtra Maxi Plus EF.
[0316] Lentiviral vectors to express SABRs or TCRs were packaged using previously described procedures. Briefly, 5,000,000 HEK-293T cells were plated on poly-L- Lysine coated plates for 24 hours, followed by transfection of a mixture of the lentiviral shuttle plasmid, pMDG-VSVG, and pCMV-RD8.9 using TransIT-293 (Minis Bio) and OPTI-MEM (Life Technologies). Viruses were filtered through 0.45 micron syringe filters (Milipore) and stored at -80 0C until further use. To transduce Jurkat, NFAT-GFP-Jurkat, or Primary T cells, 2-5xl0 5 cells were plated in culture medium and mixed with an equal volume of thawed virus in 12-well plates for three days. For NFAT-GFP-Jurkat cells, G-418 was added to the transduction mixture 48 hours later.
[0317] For the co-culture assays to test SABR signaling in Examples 1-5, l-5xl0 4 transduced NFAT-GFP-Jurkat cells were incubated with equal number of transduced Jurkat cells on 96 well flat or round bottom plates for 8-10 hours. The cells were then acquired on MACSQuant (Miltenyi) or stained with anti-CD69-APC-Cy7 (Biolegend Clone #) and then acquired on MACSQuant (Miltenyi). For the SABR library assays, 1.5xl0 6 SABR library cells were incubated with 1.5xl0 6 Jurkat cells in each well of a 6 well plate. At 8-10 hours after co-culture, cells were harvested, stained with anti-CD69-APC-Cy7 (Biolegend), and sorted on a BD FACS SORP (Becton-Dickinson). Cytotoxicity assays were performed using target cells labeled with CFSE (Biolegend) as described previously. For the empty SABR assays, transduced NFAT-GFP-Jurkat cells were incubated with 100 mg/ml of soluble peptide for 2 hours at 37 0C. Equal numbers of transduced Jurkat cells were then added to the cells, followed by 8-10 hours of co-culture. Gating strategies for these assays is shown in FIGS. 13A-13C. FIG. 13A illustrates a plot of the gating strategy used in co-culture assays to measure GFP expression. FIG. 13B illustrates a plot of the Gating strategy used in co-culture assays to measure GFP and CD69 expression. FIG. 13C illustrates a plot of the gating strategy used in cytotoxicity assays.
[0318] For the high-throughput sequencing and analysis of Examples 1-5, genomic DNA was extracted from sorted cells immediately following sorting using PureLink genomic DNA extraction kit (Life Technologies). The SABR vectors were amplified using KOD polymerase (Milipore) and 10:1 : 10 mixture of primers TruSeq-Univ-SCTfixed-F, TruSeq-Read2-SCTfixed-R, and Truseq-Adapter-Index respectively. For each sample, 5-10 reactions using 1-30 ng of genomic DNA were performed for 30-35 cycles. The reactions were pooled and purified using Nucleospin Gel and PCR purification kit (Takara). The purified PCR product was analyzed on Bioanalyzer (Agilent) and subjected to sequencing on HiSeq 2500 (Illumina). Unaligned reads generated by the sequencer were stored in FASTQ files. The reads were first aligned to the SABR vector using Burrows-Wheeler Alignment with a mismatch penalty of l 22 . For each aligned read, the epitope was translated and counted. All epitopes were ranked according to the number of reads, and an average rank was calculated for each read. The average rank was then used for further analysis.
[0319] Flow cytometry plots were analyzed on FlowJo (Treestar). Statistical analyses and graphical representations were generated by Microsoft Excel (Microsoft) and GraphPad Prism (Graphpad).
[0320] The list of epitopes in the SABR libraries can be found in Tables 6.3.
TABLE 6.3
(UniProt:K4DSG3) cruzi
(UniProt:K4DPA8) cruzi Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
27158 ILLGSLSDL 1188 1196 Hantaan orthohantavirus Hantaan
protein orthohantavirus
27182 ILLNKHIDA 352 360 Nucleoprotein Nucleoprotein SARS coronavirus
27195 ILLWEIPDV 1267 1275 Genome polyprotein Genome polyprotein West Nile virus
27201 ILMEHIHKL 137 145 60S ribosomal protein L19 60S ribosomal protein L19 Homo sapiens
27202 ILMIFISSFL 81 90 Virion membrane protein A17 Virion membrane protein A17 Vaccinia virus precursor precursor
27205 ILMNDQEVGV 1587 1596 Genome polyprotein Genome polyprotein Coxsackievirus
B3
27217 ILMWEAVTL 100 108 Human polyomavirus 2 JC polyomavirus protein
27234 ILNNPKASL 303 311 Nucleoprotein Nucleoprotein Human
respiratory syncytial virus A strain Long
27241 ILPDPLKPT 787 795 Spike glycoprotein Spike glycoprotein SARS coronavirus
27245 ILPGQDLQYV 516 525 Hemagglutinin glycoprotein Hemagglutinin glycoprotein Measles
morbillivirus
27251 ILPSKSLEV 512 520 Hantaan orthohantavirus Hantaan
protein orthohantavirus
27258 ILQDGRIFI 13 21 Small nuclear Small nuclear Homo sapiens ribonucleoprotein-associated ribonucleoprotein-associated
proteins B and B' proteins B and B'
27259 ILQDMRNTI 334 342 Hantaan orthohantavirus Hantaan
protein orthohantavirus
27314 ILSDENYLL 172 180 Protein A6 Protein A6 Vaccinia virus WR
27345 ILSPFLPLL 371 379 Large envelope protein Large envelope protein Hepatitis B virus subtype ayw
27369 ILSVSSFLFV 7 16 Circumsporozoite (CS) Circumsporozoite (CS) Plasmodium protein protein falciparum 7G8
27377 ILTDITKGV 161 169 Elongation factor 2 Elongation factor 2 Homo sapiens
27387 ILTVILGVL 32 40 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
27467 IMDKNIILKA 123 132 Non-structural protein 1 Non-structural protein 1 H1 N1 subtype
27469 IMDQVPFSV 209 217 melanoma antigen gp100 Melanocyte protein PMEL Homo sapiens
27477 IMELATAGI 1273 1281 Hantaan orthohantavirus Hantaan
protein orthohantavirus
27500 IMIGHLVGV
27501 IMIGVLVGV 691 699 Carcinoembryonic antigen- Carcinoembryonic antigen- Homo sapiens related cell adhesion related cell adhesion
molecule 5 molecule 5
27513 IMLEALERV 68 76 Small nuclear Small nuclear Homo sapiens ribonucleoprotein G ribonucleoprotein G
(UniProt:P62308)
27525 IMMGVLVGV
27564 IMSSFEFQV 686 694 LPS-assembly protein LptD LPS-assembly protein LptD Francisella tularensis subsp. tularensis SCHU S4
27578 IMVLSFLFL 403 411 Circumsporozoite (CS) Circumsporozoite (CS) Plasmodium protein protein falciparum 7G8
27586 IMYNYPAML 4 12 ESAT-6-like protein EsxH ESAT-6-like protein EsxH Mycobacterium tuberculosis
28864 ITDQVPFSV 209 217 Melanocyte protein PMEL Melanocyte protein PMEL Homo sapiens
29304 IVIEAIHTV 187 195 Thymidylate kinase Thymidylate kinase Vaccinia virus
Ankara
29455 IVSPFIPLL 382 390 Large envelope protein Large envelope protein Hepatitis B virus subtype adw2
30968 KGILGFVFTLTV 57 68 Matrix protein 1 Matrix protein 1 Influenza A virus
31209 KIDYYIPYV 249 257 Protein E2 Protein E2 Vaccinia virus
Copenhagen
31210 KIEDUNQL 155 163 Telomere-binding protein 11 Telomere-binding protein 11 Vaccinia virus
Copenhagen Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
36669 UQEIVHEV 571 579 Early transcription factor 82 Early transcription factor 82 Vaccinia virus WR kDa subunit kDa subunit
36724 LITGRLQSL 978 986 Spike glycoprotein Spike glycoprotein SARS coronavirus
37097 LLALLSCLTV 178 187 Genome polyprotein Genome polyprotein Hepatitis C virus
(isolate 1 )
371 12 LLAVLTAAPL 8 17 Phosphate-binding protein Phosphate-binding protein Mycobacterium
PstS 1 PstS 1 tuberculosis
37120 LLCUFLLV 251 259 Large envelope protein Large envelope protein Hepatitis B virus subtype ayw
37127 LLCPAGHAV 1169 1177 Genome polyprotein Genome polyprotein Hepatitis C virus
37140 LLDAHIPQL 3 11 ESAT-6-like protein EsxG ESAT-6-like protein EsxG Mycobacterium tuberculosis
37146 LLDEGKQSL 28 36 6 kDa early secretory 6 kDa early secretory Mycobacterium antigenic target antigenic target tuberculosis
37149 LLDEPTNHL 251 259 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 2 family F member 2
37153 LLDFVRFMGV 284 293 Epstein-Barr nuclear antigen Epstein-Barr nuclear antigen Human
6 6 gammaherpesviru s 4
37182 LLDVPTAAV 24 32 Gamma-interferon-inducible Gamma-interferon-inducible Homo sapiens lysosomal thiol reductase lysosomal thiol reductase
37183 LLDVTAAV Other Homo sapiens Homo sapiens
(human) protein
37187 LLDYQGMLPV 260 269 Large envelope protein Large envelope protein Hepatitis B virus subtype ayw
37246 LLFEEYTNI 307 315 Protein Tax-1 Protein Tax-1 Human T- lymphotropic virus 1
37251 LLFGHPVYV 11 19 transcriptional activator Tax Protein Tax-1 Human T- lymphotropic virus 1
37253 LLFGYAVYV 11 19 transcriptional activator Tax Protein Tax-1 Human T- lymphotropic virus 1
37254 LLFGYPRYV 11 19 transcriptional activator Tax Protein Tax-1 Human T- lymphotropic virus 1
37255 LLFGYPVAV 11 19 transcriptional activator Tax Protein Tax-1 Human T- lymphotropic virus 1
37257 LLFGYPVYV 11 19 Protein Tax-1 Protein Tax-1 Human T- lymphotropic virus 1
37286 LLFNILGGWV 1807 1816 Genome polyprotein Genome polyprotein Hepatitis C virus
37317 LLGCIITSL 1039 1047 Genome polyprotein Genome polyprotein Hepatitis C virus
(isolate Japanese)
37347 LLGLWGLATA 743 752 Trans-sialidase, putative Trans-sialidase, putative Trypanosoma
(UniProt:K4DSI5) cruzi
37348 LLGLWGLTGL 668 677 Trans-sialidase, putative Trans-sialidase, putative Trypanosoma
(UniProt:K4DVP7) cruzi
37350 LLGLWGTAAL 188 197 Trans-sialidase, putative Trans-sialidase, putative Trypanosoma
(UniProt:K4DRP4) cruzi
37351 LLGLVWFAAL 573 582 Trans-sialidase, putative Trans-sialidase, putative Trypanosoma
(UniProt:K4DMA7) cruzi
37364 LLGRNSFEV 264 272 Cellular tumor antigen p53 Cellular tumor antigen p53 Homo sapiens
37397 LLHTDFEQV 276 284 Non-structural protein 1 Non-structural protein 1 Human parvovirus
B19
37398 LLHTDFEQVM 276 285 Non-structural protein 1 Non-structural protein 1 Human parvovirus
B19
37473 LLLDRLNQL 223 231 Nucleoprotein Nucleoprotein SARS coronavirus
37474 LLLDVPTAAV 15 24 Gamma-interferon-inducible Gamma-interferon-inducible Homo sapiens lysosomal thiol reductase lysosomal thiol reductase
(UniProt:K4E505) cruzi Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
48321 PLFGYPVYV 11 19 transcriptional activator Tax Protein Tax-1 Human T- lymphotropic virus 1
49485 PSQEPMSIYVY 104 114 65 kDa phosphoprotein 65 kDa phosphoprotein Human
betaherpesvirus 5
50129 PYLFWLAAI 131 139 Latent membrane protein 2 Latent membrane protein 2 Human
gammaherpesviru s 4
50596 QEGAMHTAL 536 544 Genome polyprotein Genome polyprotein Dengue virus 1
51311 QLDPARDVL 8 16 Protein X Protein X Hepatitis B virus
51342 QLFNHTMFI 478 486 Myosin-9 Myosin-9 Homo sapiens
51351 QLGAFLTNV 178 186 Protein Tax-1 Protein Tax-1 Human T- lymphotropic virus 1
51376 QLIPCMDWL 143 152 Other Triticum aestivum Triticum aestivum
(Canadian hard winter
wheat) protein
51436 QLLSSSKYT 16 24 Nucleoprotein Nucleoprotein Human
respiratory syncytial virus A strain Long
51441 QLMAEKLQL 877 885 Myosin-9 Myosin-9 Homo sapiens
51459 QLPEATFMV 21 1 219 Matrix protein Matrix protein Measles virus strain Edmonston
51526 QLRRHIDLLV 257 266 Genome polyprotein Genome polyprotein Hepatitis C virus
51604 QMDYSNGLFV 610 619 Trans-sialidase, putative Trans-sialidase, putative Trypanosoma
(UniProt:K4DPA8) cruzi
51657 QMWKCURL 1606 1614 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
51658 QMWQARLTV 155 163 65 kDa phosphoprotein 65 kDa phosphoprotein Human
betaherpesvirus 5
52886 QYDPVAALF 331 339 65 kDa phosphoprotein 65 kDa phosphoprotein Human
betaherpesvirus 5
53128 RAKFKQLL 190 197 Trans-activator protein Trans-activator protein Human
BZLF1 BZLF1 gammaherpesviru s 4
53138 RALAETSYV 269 277 Melanoma-associated Melanoma-associated Homo sapiens antigen 1 antigen 1
53399 RDNLMWYEL 489 497 Envelope glycoprotein B Envelope glycoprotein B Human
gammaherpesviru s 8
53935 RGPGRAFVTI 309 318 Envelope glycoprotein gp160 Envelope glycoprotein gp160 Human
immunodeficiency virus 1
54147 RIFAELEGV 522 530 65 kDa phosphoprotein 65 kDa phosphoprotein Human
herpesvirus 5 strain AD169
54486 RLAVYIDKV 42 50 Lamin-B1 Lamin-B1 Homo sapiens
54487 RLAVYIDRV 41 49 Prelamin-A/C Prelamin-A/C Homo sapiens
54501 RLDDDGNFQL 78 87 Genome polyprotein Genome polyprotein West Nile virus
NY-99
54520 RLERKWLDV 210 218 Nucleoprotein Nucleoprotein Measles virus strain Edmonston
54549 RLGAVILFV 7 15 Envelope glycoprotein D Envelope glycoprotein D Herpes simplex virus (type 1 / strain 17)
54587 RUGHISTL 345 353 Monooxygenase family Monooxygenase family Francisella protein protein tularensis subsp.
tularensis SCHU S4
54592 RUQNSITI 55 63 Nucleoprotein Nucleoprotein H5N1 subtype
54605 RUVFPDLGV 2580 2589 Genome polyprotein Genome polyprotein Hepatitis C virus subtype 1 a
proen cruz
acparum Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
69980 VMLAAQMFIV 284 293 Genome polyprotein Genome polyprotein Hepatitis C virus subtype 2a
69996 VMMSCSSEA 16 24 Trans-sialidase, putative Trans-sialidase, putative Trypanosoma
(UniProt:K4DPA8) cruzi
71409 VTLPTGQCL 378 386 Cysteine peptidase, Cysteine peptidase, Trypanosoma putative, cysteine peptidase, putative, cysteine peptidase, cruzi clan CA, family C1 , cathepsin clan CA, family C1 , cathepsin
L-like, putative L-like, putative
(UniProt:K4DPT9)
71657 VVFDITKWLL 888 897 Genome polyprotein Genome polyprotein Hepatitis C virus subtype 2a
71658 VVFEDVKGT 472 480 Human polyomavirus 1 Human
protein polyomavirus 1
71663 VVFLHVTYV 1042 1050 Spike glycoprotein Spike glycoprotein SARS coronavirus
71734 VVLDSLDPMV 2251 2260 Genome polyprotein Genome polyprotein Hepatitis C virus subtype 2a
71756 VVMACLVPAA 15 24 Cysteine peptidase, Cysteine peptidase, Trypanosoma putative, cysteine peptidase, putative, cysteine peptidase, cruzi clan CA, family C1 , cathepsin clan CA, family C1 , cathepsin
L-like, putative L-like, putative
(UniProt:K4DPT9)
72266 WATESPIYV 238 246 Protein ORF73 Protein ORF73 Human
gammaherpesviru s 8
72621 WIIKNSWTA 300 308 Cysteine peptidase, Cysteine peptidase, Trypanosoma putative, cysteine peptidase, putative, cysteine peptidase, cruzi clan CA, family C1 , cathepsin clan CA, family C1 , cathepsin
L-like, putative L-like, putative
(UniProt:K4DPT9)
72721 WLGNHGFEV 110 118 Other Francisella tularensis Francisella protein tularensis subsp.
tularensis SCHU S4
72722 WLGNIIQYA 2850 2858 Genome polyprotein Genome polyprotein Hepatitis C virus subtype 2a
72731 WUGFDFDV 294 302 Soluble interferon alpha/beta Soluble interferon alpha/beta Vaccinia virus WR receptor B18 receptor B18
72790 WLSDCGEAL 457 465 Trans-sialidase, putative Trans-sialidase, putative Trypanosoma
(UniProt:K4DPA8) cruzi
72794 WLSLLVPFV 335 343 Large envelope protein Large envelope protein Hepatitis B virus
72865 WMNRLIAFA 1915 1923 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
73195 WVFPESISPV 302 311 Trans-sialidase, putative Trans-sialidase, putative Trypanosoma
(UniProt:K4DXB0) cruzi
73263 WYELSKINP 494 502 Envelope glycoprotein B Envelope glycoprotein B Human
gammaherpesviru s 8
73710 YELSKINPT 495 503 Envelope glycoprotein B Envelope glycoprotein B Human
gammaherpesviru s 8
74015 YGIENEVFL 281 289 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
74185 YIDISDVKV 122 130 Telomere-binding protein 11 Telomere-binding protein 11 Vaccinia virus
Copenhagen
74223 YIGSGDSPV 65 73 differentiation antigen Myeloid cell surface antigen Homo sapiens
CD33
74234 YIIIGDSPV 65 73 differentiation antigen Myeloid cell surface antigen Homo sapiens
CD33
74241 YIILGDSPV 65 73 differentiation antigen Myeloid cell surface antigen Homo sapiens
CD33
74245 YIISGDLPV 65 73 differentiation antigen Myeloid cell surface antigen Homo sapiens
CD33
74246 YIISGDSPL 65 73 differentiation antigen Myeloid cell surface antigen Homo sapiens
CD33 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
76338 YVLEETSVML 315 324 55 kDa immediate-early 55 kDa immediate-early Human
protein 1 protein 1 herpesvirus 5 strain AD169
76342 YVLFEVFDVV 917 926 Hexon protein Hexon protein Human
adenovirus 5
76361 YVNAILYQI 93 101 Protein N2 Protein N2 Vaccinia virus
77774 CLGGLLTMVA 294 303 Latent membrane protein 2 Latent membrane protein 2 Human
gammaherpesviru s 4
77775 CLGGLLTMVAG 294 304 Latent membrane protein 2 Latent membrane protein 2 Human
gammaherpesviru s 4
78346 AFLGERVTL 23 31 Secreted protein BARF1 Secreted protein BARF1 Human
gammaherpesviru s 4
78382 FLGERVTLT 24 32 Secreted protein BARF1 Secreted protein BARF1 Human
gammaherpesviru s 4
78432 KLGPGEEQV 50 58 Secreted protein BARF1 Secreted protein BARF1 Human
gammaherpesviru s 4
78501 RFIAQLLLL 3 11 Secreted protein BARF1 Secreted protein BARF1 Human
gammaherpesviru s 4
78534 TLTSYWRRV 30 38 Secreted protein BARF1 Secreted protein BARF1 Human
gammaherpesviru s 4
78969 FAYDGKDYI 12 20 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, Cw-7 alpha chain antigen, Cw-7 alpha chain
78970 FAYDGKDYL 137 145 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, alpha chain E antigen, alpha chain E
78975 FVLPELPSV 290 298 IST1 homolog IST1 homolog Homo sapiens
79004 KQLDDLKVEL 19 28 60S ribosomal protein L35 60S ribosomal protein L35 Homo sapiens
79124 YGILGFVFTL
81067 DIRTLLPILL 99 108 Protein G3 Protein G3 Vaccinia virus WR
81563 EINNELELV 33 41 mRNA-capping enzyme mRNA-capping enzyme Vaccinia virus catalytic subunit catalytic subunit Copenhagen
82090 FIFLKKNEL 703 711 Protein E2 Protein E2 Vaccinia virus WR
84475 KUIDREVV 212 220 Protein I3 Protein I3 Vaccinia virus
Copenhagen
84532 KLTFLDVEV 157 165 DNA-directed RNA DNA-directed RNA Vaccinia virus WR polymerase 35 kDa subunit polymerase 35 kDa subunit
87289 PITDSLSFKL 550 559 Protein 01 Protein 01 Vaccinia virus
Copenhagen
88377 SAPLPSNRV 472 480 Major viral transcription Major viral transcription Human
factor ICP4 homolog factor ICP4 homolog alphaherpesvirus
3
88849 SLPRSRTPI 445 453 Major viral transcription Major viral transcription Human
factor ICP4 homolog factor ICP4 homolog alphaherpesvirus
3
90773 YIIKKNDIV 764 772 mRNA-capping enzyme mRNA-capping enzyme Vaccinia virus WR catalytic subunit catalytic subunit
92301 AIYDTMQYV 88 96 ATP-dependent Clp protease ATP-dependent Clp protease Mycobacterium proteolytic subunit 2 proteolytic subunit 2 tuberculosis
H37Rv
92817 GLAGGAATA 30 38 Diacylglycerol Diacylglycerol Mycobacterium acyltransferase/mycolyltransf acyltransferase/mycolyltransf tuberculosis erase Ag85B erase Ag85B H37Rv
93270 LLYDGSFAV 42 50 Other Mycobacterium Mycobacterium tuberculosis protein tuberculosis
H37Rv
95059 AMAGASTSA 425 433 65 kDa phosphoprotein 65 kDa phosphoprotein Human
herpesvirus 5 strain AD169
an gen, - ap a c an an gen, - ap a c an Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
1 18467 KLVGKTVKV 57 65 Protein K3 Protein K3 Vaccinia virus
Copenhagen
1 18607 SLLFIPDIKL 191 200 Interferon antagonist K1 L Interferon antagonist K1 L Vaccinia virus WR
1 18663 VLSLELPEV 70 78 Scaffold protein D13 Scaffold protein D13 Vaccinia virus WR
1 19850 EVGGEALGRL 23 32 Hemoglobin subunit beta Hemoglobin subunit beta Homo sapiens
(UniProt:P68871)
1 19885 FVNDIFERI 41 49 Histone H2B type 2-E Histone H2B type 2-E Homo sapiens
120130 PKFEVIEKPQA 98 108 ATP synthase-coupling factor ATP synthase-coupling factor Homo sapiens
6, mitochondrial 6, mitochondrial
120176 RLYPWGWEV 256 265 Septin-2 Septin-2 Homo sapiens
120239 TIIDLPGITRV 222 232 Interferon-induced GTP- Interferon-induced GTP- Homo sapiens binding protein Mx2 binding protein Mx2
120240 TIQKSSLDQL 657 666 Integrin alpha-D Integrin alpha-D Homo sapiens
120308 VVIRGNSIIML 60 70 Small nuclear Small nuclear Homo sapiens ribonucleoprotein G ribonucleoprotein G
(UniProt:P62308)
121572 LLWNGPMAV 214 222 Genome polyprotein Genome polyprotein Yellow fever virus
122258 ALAEGDLLA 355 363 Diaminopimelate Diaminopimelate Pseudomonas decarboxylase decarboxylase aeruginosa
122373 GLEALVPLAV 2 11 Cytochrome P450 2D6 Cytochrome P450 2D6 Homo sapiens
122376 GLLDKAVSNV 176 185 Cytochrome P450 2D6 Cytochrome P450 2D6 Homo sapiens
122380 GMVTTSTTL 306 314 Cytochrome P450 2D6 Cytochrome P450 2D6 Homo sapiens
122422 KAFLTQLDEL 245 254 Cytochrome P450 2D6 Cytochrome P450 2D6 Homo sapiens
122439 KLSEGDLLA 245 253 Dihydrolipoyllysine-residue Dihydrolipoyllysine-residue Homo sapiens acetyltransferase component acetyltransferase component
of pyruvate dehydrogenase of pyruvate dehydrogenase
complex, mitochondrial complex, mitochondrial
122467 LLDKAVSNVI 177 186 Cytochrome P450 2D6 Cytochrome P450 2D6 Homo sapiens
122558 RLLDLAQEGL 204 213 Cytochrome P450 2D6 Cytochrome P450 2D6 Homo sapiens
122618 TTLITNLSSV 393 402 Cytochrome P450 2D6 Cytochrome P450 2D6 Homo sapiens
124821 VLNEQVKEA 620 628 Nuclear autoantigenic sperm Nuclear autoantigenic sperm Homo sapiens protein (UniProt:P49321) protein
125100 ILLNKHID 352 359 Nucleoprotein Nucleoprotein SARS coronavirus
125682 AINVEKIEL 593 601 DNA-directed RNA DNA-directed RNA Vaccinia virus polymerase 147 kDa polymerase 147 kDa Copenhagen polypeptide polypeptide
125834 DLKPDNILL 307 315 Serine/threonine-protein Serine/threonine-protein Vaccinia virus WR kinase 2 kinase 2
125899 EIVNLLDNKV 978 987 DNA polymerase DNA polymerase Vaccinia virus WR
125914 ELNAELSDKL 436 445 A-type inclusion protein A25 A-type inclusion protein A25 Vaccinia virus WR
126028 FMYEGDTPL 862 870 ATP-dependent helicase ATP-dependent helicase Mycobacterium tuberculosis
H37Rv
126288 ILFPDDVQEL 18 27 Core protein D2 Core protein D2 Vaccinia virus WR
126294 ILNDEQLNL 224 232 Early transcription factor 82 Early transcription factor 82 Vaccinia virus WR kDa subunit kDa subunit
126408 KIDTTHVSKV 11 17 1126 DNA-directed RNA DNA-directed RNA Vaccinia virus WR polymerase 133 kDa polymerase 133 kDa
polypeptide polypeptide
12641 1 KIEIERKKL 676 684 RNA polymerase-associated RNA polymerase-associated Vaccinia virus transcription-specificity factor transcription-specificity factor Copenhagen RAP94 RAP94
126428 KLGFEEIKGL 260 269 Protein A11 Protein A1 1 Vaccinia virus WR
126429 KLGIGNSPV 292 300 Protein A11 Protein A1 1 Vaccinia virus WR
126481 KSLFNTIATLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126482 KSLFNTIAVL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126483 KSLFNTIAVLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
126484 KSLFNTVATL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126485 KSLFNTVATLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126486 KSLFNTVAVL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126487 KSLFNTVAVLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126488 KSLYNTIATLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126489 KSLYNTIAVLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126490 KSLYNTVATL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126491 KSLYNTVATLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126492 KSLYNTVAVLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126556 UDNPDNNL DNA-directed RNA DNA-directed RNA Vaccinia virus polymerase 147 kDa polymerase 147 kDa Copenhagen polypeptide polypeptide
126566 LLFLKDVEP 77 85 Core protein D2 Core protein D2 Vaccinia virus WR
126575 LLVNEFYI 202 209 Protein C4 Protein C4 Vaccinia virus
Copenhagen
126635 LVEKVLKIL 252 260 Protein E5 Protein E5 Vaccinia virus WR
126646 LVSIPRTNIV 182 191 Protein L3 Protein L3 Vaccinia virus WR
126699 MPQMKKILK 133 141 Semaphorin-like protein Semaphorin-like protein Vaccinia virus WR
VACWR164 VACWR164
126904 QVKDEKLNL 114 122 Viral late gene transcription Viral late gene transcription Vaccinia virus WR factor 3 factor 3
126993 RSLFNTIATLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126994 RSLFNTIAVLY 76 86 Gag-Pol polyprotein Gag-Pol polyprotein Human
immunodeficiency virus 1
126995 RSLFNTVATL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126996 RSLFNTVATLY 49 59 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126997 RSLFNTVAVLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
126999 RSLYNTIATLY 76 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
127000 RSLYNTIAVLY 76 86 Gag-Pol polyprotein Gag-Pol polyprotein Human
immunodeficiency virus 1
127001 RSLYNTVATL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
(UniProt:P62308) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
128022 IINEPTAM 174 182 Heat shock 70 kDa protein 1 - Heat shock 70 kDa protein 1 - Homo sapiens like like
128023 IIPASTGAA 206 214 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
128025 ILAADFEIGHFL 319 330 Nucleosome assembly Nucleosome assembly Homo sapiens protein 1-like 1 protein Mike 1
128026 ILGYTEHQV 273 281 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
128028 ILSGVVTKM 72 80 40S ribosomal protein S1 1 40S ribosomal protein S1 1 Homo sapiens
128034 KLDQDLNEV 436 444 Structural maintenance of Structural maintenance of Homo sapiens chromosomes protein 3 chromosomes protein 3
128036 KUGDPNLEFV 167 111 GTP-binding nuclear protein GTP-binding nuclear protein Homo sapiens
Ran Ran
128037 KLMELHGEGSS 227 231 40S ribosomal protein S3a 40S ribosomal protein S3a Homo sapiens
(UniProt:P61247)
128040 KVFDPVPVGV 696 105 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase A helicase A
128045 LLDVPTAA 27 34 Gamma-interferon-inducible Gamma-interferon-inducible Homo sapiens lysosomal thiol reductase lysosomal thiol reductase
128046 LLDVTPLSL 393 401 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniPro P11142) protein
128047 LLDVVHPA 68 15 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta
128048 LLDVVHPAA 68 16 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta
128049 LLGPRLVLA 23 31 Transmembrane emp24 Transmembrane emp24 Homo sapiens domain-containing protein 10 domain-containing protein 10
(UniProt:P49755)
128052 LMTTVHAITAT 174 184 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
128062 NLAEKPKTV 162 110 Proteasome-associated Proteasome-associated Homo sapiens protein ECM29 homolog protein ECM29 homolog
128063 NLDPAVHEV 54 62 GPN-loop GTPase 1 GPN-loop GTPase 1 Homo sapiens
128064 NMVAKVDEV 143 151 60S ribosomal protein L10a 60S ribosomal protein L10a Homo sapiens
128096 RVPPPPPIA 142 150 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoproteins C1/C2 ribonucleoproteins C1/C2
(UniProt:P07910)
128105 SLFEGTWY 455 462 Hydroxymethylglutaryl-CoA Hydroxymethylglutaryl-CoA Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
128106 SLFEGTWYL 447 455 Hydroxymethylglutaryl-CoA Hydroxymethylglutaryl-CoA Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
128108 SLLDIIEKV 526 534 Tuberin (UniProt:P49815) Tuberin Homo sapiens
128109 SLLEKSLGL 8 16 Eukaryotic translation Eukaryotic translation Homo sapiens elongation factor 1 epsilon-1 elongation factor 1 epsilon-1
12811 1 SMPDFDLHL 2580 2588 Neuroblast differentiation- Neuroblast differentiation- Homo sapiens associated protein AHNAK associated protein AHNAK
128114 SQVPEVTTV 906 914 Phosphoinositide 3-kinase Phosphoinositide 3-kinase Homo sapiens regulatory subunit 4 regulatory subunit 4
128118 SVIDYEUDQDA 184 195 Annexin A2 Annexin A2 Homo sapiens
128124 TLAEVERLKGL 213 223 U2 small nuclear U2 small nuclear Homo sapiens ribonucleoprotein A ribonucleoprotein A
128125 TLAEVSTRL 454 462 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase SIK1 kinase SIK1
128126 TLAKYLMEL 321 329 G2/mitotic-specific cyclin-B1 G2/mitotic-specific cyclin-B1 Homo sapiens
128127 TLQEVFEKATF 501 511 Nucleolin (UniProt:P19338) Nucleolin Homo sapiens
128128 TLWDIQKDLK 323 332 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
128129 TLWGIQKEL 321 329 L-lactate dehydrogenase A L-lactate dehydrogenase A Homo sapiens chain chain
128130 TLYEHNNEL 17 25 Aladin Aladin Homo sapiens
128137 VLPTETEVAPA 335 345 Microtubule-associated Microtubule-associated Homo sapiens protein 4 (UniProt:P27816) protein 4 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
140542 ALLGGLRPV 144 152 Mammalian cell entry protein Mammalian cell entry protein Mycobacterium
(UniProt:l6X7G8) tuberculosis
H37Rv
140543 AMAGSIDLL 1237 1245 Uncharacterized glycosyl Uncharacterized glycosyl Mycobacterium hydrolase Rv2006 hydrolase Rv2006 tuberculosis
H37Rv
140561 GMFANRWII 836 844 Probable cation-transporting Probable cation-transporting Mycobacterium
ATPase F ATPase F tuberculosis
H37Rv
140564 HLDDVGFLV 110 118 Esterase (UniProt:P96903) Esterase Mycobacterium tuberculosis
H37Rv
140597 SUDLLHKI 147 155 MCE-family protein MCE-family protein Mycobacterium tuberculosis
H37Rv
140599 SLRNWIATL 99 107 Mammalian cell entry protein Mammalian cell entry protein Mycobacterium
(UniProt:l6Y461) tuberculosis
H37Rv
140600 SLWKDGAPL 280 288 Glutamine synthetase 1 Glutamine synthetase 1 Mycobacterium tuberculosis
H37Rv
140615 WLYPGAQNL 71 79 Arginine decarboxylase Arginine decarboxylase Mycobacterium tuberculosis
H37Rv
140616 YLLADTFTV 166 174 Phospholipase C 2 Phospholipase C 2 Mycobacterium tuberculosis
H37Rv
140650 AMLGHAGDM 10 18 ESAT-6-like protein EsxH ESAT-6-like protein EsxH Mycobacterium tuberculosis
14071 1 MLGHAGDMA 11 19 ESAT-6-like protein EsxH ESAT-6-like protein EsxH Mycobacterium tuberculosis
140712 MMARDTAEA 83 91 ESAT-6-like protein EsxH ESAT-6-like protein EsxH Mycobacterium tuberculosis
H37Rv
140727 QAMEDLVRA 60 68 ESAT-6-like protein EsxH ESAT-6-like protein EsxH Mycobacterium tuberculosis
H37Rv
140732 QLVQSGAEV 3 11 Immunoglobulin Ig heavy chain V-l region EU Homo sapiens
140742 SLFLGILSV 188 196 B-lymphocyte antigen CD20 B-lymphocyte antigen CD20 Homo sapiens
140744 SQIMYNYPA 2 10 ESAT-6-like protein EsxH ESAT-6-like protein EsxH Mycobacterium tuberculosis
H37Rv
140773 YLGEVIVSV 41 49 myosin-lg Unconventional myosin-lg Homo sapiens
140774 YLGEVLVSV 41 49 myosin-lg Unconventional myosin-lg Homo sapiens
141 141 AUDCNPCTL 190 199 Histone demethylase UTY Histone demethylase UTY Homo sapiens
141 142 ALLMPAGVPL 1098 1107 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 143 ALLPTALDAL 1299 1308 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 144 CLLSGTYIFA 34 43 Protocadherin-11 Y-linked Protocadherin-1 1 Y-linked Homo sapiens
141 146 FIFPASKVYL 1468 1477 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 147 FLLDILGAT 428 436 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX3Y helicase DDX3Y
141 148 FLLENAAYL 448 456 Protocadherin-11 Y-linked Protocadherin-1 1 Y-linked Homo sapiens
141 149 FLLENAAYLD 448 457 Protocadherin-11 Y-linked Protocadherin-1 1 Y-linked Homo sapiens
141 150 FMHNRLQYSL 1999 2008 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 151 FTHNEYKFYV 602 611 Protocadherin-11 Y-linked Protocadherin-1 1 Y-linked Homo sapiens
141 154 HLLTSPKPSL 1236 1245 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5D 5D
141 155 KAFQDVLYV 148 156 Histone demethylase UTY Histone demethylase UTY Homo sapiens
141 156 KLLSSGAFSA 514 523 Histone demethylase UTY Histone demethylase UTY Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
141 157 KLMPPDRTAV 1046 1055 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 158 KLTQINFNM 965 973 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 159 KMAAFPETL 671 679 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5D 5D
141 160 LUADNPQL 719 727 Histone demethylase UTY Histone demethylase UTY Homo sapiens
141 161 LUKKLPRV 1786 1794 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 162 LLMPAGVPL 1099 1107 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 163 LLMPAGVPLT 1099 1108 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 164 LLSSGAFSA 515 523 Histone demethylase UTY Histone demethylase UTY Homo sapiens
141 165 LLVALAIGCV 1506 1515 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 166 LLVSEIDWL 1401 1409 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 167 LMASSPTSI 1197 1205 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5D 5D
141 168 NLATYMNSI 620 628 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 169 NVMPVLDQSV 498 507 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5D 5D
141 170 QLLKLNVPA 2196 2204 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 172 RLLIKKLPRV 1785 1794 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 173 TLKKYFIPV 271 279 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 174 YIFAVLLVCV 40 49 Protocadherin-11 Y-linked Protocadherin-1 1 Y-linked Homo sapiens
141 175 YLDLLFQIL 2337 2345 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 176 YLDLLFQILL 2337 2346 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 177 YLLPEAEEI 2033 2041 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 178 YLQQNTHTL 558 566 Histone demethylase UTY Histone demethylase UTY Homo sapiens
141 179 YMIPSIRNSI 1578 1587 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141 180 YMNSIRLYA 624 632 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
141212 ALLDRDCRV 374 382 Tegument protein UL47 Tegument protein UL47 Human
alphaherpesvirus 1
141230 CLGLLTMV Latent membrane protein 2 Latent membrane protein 2 Human
gammaherpesviru s 4
141269 FLADAVVRL 286 294 Tegument protein UL47 Tegument protein UL47 Human
alphaherpesvirus 1
141270 FLIAYQPLL 448 456 Envelope glycoprotein B Envelope glycoprotein B Human
alphaherpesvirus 1
141271 FLWEDQTLL 367 375 Virion-packaging protein Virion-packaging protein Human
UL25 UL25 alphaherpesvirus
1
141313 IUEGIFFA 184 192 Ribonucleoside-diphosphate Ribonucleoside-diphosphate Human
reductase small chain reductase small chain alphaherpesvirus
1
141342 LLDFVRMGV Epstein-Barr nuclear antigen Epstein-Barr nuclear antigen Human
6 6 gammaherpesviru s 4 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
141373 PTLDKVLEL 55 63 Pumilio homolog 3 Pumilio homolog 3 Homo sapiens
141374 PTLDKVLEV 55 63 Pumilio homolog 3 Pumilio homolog 3 Homo sapiens
141396 RILGVLVHL 425 433 Ribonucleoside-diphosphate Ribonucleoside-diphosphate Human
reductase large subunit reductase large subunit alphaherpesvirus
1
141398 RLLGFADTV 545 553 Tegument protein UL47 Tegument protein UL47 Human
alphaherpesvirus 1
141399 RLNELLAYV 220 228 Tegument protein UL46 Tegument protein UL46 Herpes simplex virus (type 1 / strain 17)
141408 RTLDKVLEV 149 157 Pumilio homolog 3 Pumilio homolog 3 Homo sapiens
141423 SVYPYDEFV 280 288 Envelope glycoprotein B Envelope glycoprotein B Human
alphaherpesvirus 1
141430 TLLELWSV 389 397 Serine/threonine-protein Serine/threonine-protein Human
kinase UL13 kinase UL13 alphaherpesvirus
1
141759 TAMDVVYAL 83 91 Histone H4 Histone H4 Homo sapiens
142525 AUSAFSGS 135 143 Protein K8.1 Protein K8.1 Human
gammaherpesviru s 8
142528 AMLVLLAEI 281 289 Protein ORF73 Protein ORF73 Human
gammaherpesviru s 8
142577 DGGDGNKTL 417 425 Protein ORF73 Protein ORF73 Human
gammaherpesviru s 8
142692 GRRDPKCQW 1013 1021 Protein ORF73 Protein ORF73 Human
gammaherpesviru s 8
142893 LVLILYLCV 209 217 Protein K8.1 Protein K8.1 Human
gammaherpesviru s 8
142904 MLMIIIVIAI 736 745 Envelope glycoprotein B Envelope glycoprotein B Human
gammaherpesviru s 8
142944 PESSQRPPL 140 148 Protein ORF73 Protein ORF73 Human
gammaherpesviru s 8
142954 PLPLTQPGE 1109 1117 Protein ORF73 Protein ORF73 Human
gammaherpesviru s 8
142976 PVVSTHEQI 920 928 Protein ORF73 Protein ORF73 Human
gammaherpesviru s 8
143003 QQDEQQQQDE 639 648 Protein ORF73 Protein ORF73 Human
gammaherpesviru s 8
143035 RLAAGSPSS 73 81 Protein K8.1 Protein K8.1 Human
gammaherpesviru s 8
143086 SSMKVNVNGV 159 168 Envelope glycoprotein B Envelope glycoprotein B Human
gammaherpesviru s 8
143126 TIMPKDIQL 119 127 Histone H3.3 Histone H3.3 Homo sapiens
143220 WRLGAIPPLV 23 32 Protein K12 Protein K12 Human
gammaherpesviru s 8
143447 LHLGYLPNQLFR 727 738 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX1 helicase DDX1
143666 ALFHEVAKL 94 102 Genome polyprotein Genome polyprotein Hepatovirus A
143726 LLYNCCYHV 2025 2033 Genome polyprotein Genome polyprotein Hepatovirus A
143732 MMFGFHHSV 1000 1008 Genome polyprotein Genome polyprotein Hepatovirus A Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
150449 MMATIGIALL 1229 1238 Genome polyprotein Dengue virus 2
150529 RUTVNPIV 630 638 Genome polyprotein Dengue virus 2
150566 SIILEFFLMV 2202 2211 Genome polyprotein Genome polyprotein Dengue virus
150571 SLLFKTEDGV 136 145 Genome polyprotein Genome polyprotein Dengue virus 2
150610 TAAAWYLWEV 117 126 Genome polyprotein Dengue virus 2
150634 TLMAMDLGEL 149 158 Genome polyprotein Genome polyprotein Dengue virus 2
150639 TLYAVATTFV 2282 2291 Genome polyprotein Genome polyprotein Dengue virus 2
150640 TMTDDIGMGV 1176 1185 Genome polyprotein Dengue virus 2
150740 YLPAIVREA 1678 1686 Genome polyprotein Genome polyprotein Dengue virus 2
S221
150741 YQLAVTIMA 1157 1165 Genome polyprotein Dengue virus 2
150752 YVVIAILTV 2229 2237 Genome polyprotein Genome polyprotein Dengue virus 2
150753 YVVIAILTW 2215 2224 Genome polyprotein Dengue virus 2
151741 TLAPQVEPL 510 518 MFS-type drug efflux MFS-type drug efflux Mycobacterium transporter P55 transporter P55 tuberculosis
H37Rv
151766 YLAPQWEPV 510 518 aminoglycosides/tetracycline- MFS-type drug efflux Mycobacterium transport integral membrane transporter P55 tuberculosis protein H37Rv
151964 LFEEYTNI 308 315 Protein Tax-1 Protein Tax-1 Human T- lymphotropic virus 1
152102 RVLTGWGLN 422 430 Envelope glycoprotein gp62 Envelope glycoprotein gp62 Human T- lymphotropic virus 1
153845 KUDRTESL 197 205 Lymphocyte-specific protein Lymphocyte-specific protein Homo sapiens
1 1
153874 RLDSYVRSL + 129 137 Trafficking protein particle Trafficking protein particle Homo sapiens
PHOS(S4) complex subunit 1 complex subunit 1
154071 AIURVRNA 188 196 Probable membrane protein Probable membrane protein Mycobacterium
Rv1733c Rv1733c tuberculosis
H37Rv
154097 ALLALTRAI 181 189 Probable membrane protein Probable membrane protein Mycobacterium
Rv1733c Rv1733c tuberculosis
H37Rv
154493 ELAAEPTEV 314 322 Putative ATP-dependent 6- Putative ATP-dependent 6- Mycobacterium phosphofructokinase phosphofructokinase tuberculosis isozyme 2 isozyme 2 H37Rv
154749 GLWLSVAAV 170 178 Probable membrane protein Probable membrane protein Mycobacterium
Rv1733c Rv1733c tuberculosis
H37Rv
154794 GSFVRTVSL 96 104 Alpha-crystallin Alpha-crystallin Mycobacterium tuberculosis
H37Rv
154889 HVYAHQAQT 73 81 Probable membrane protein Probable membrane protein Mycobacterium
Rv1733c Rv1733c tuberculosis
H37Rv
154894 IADAALAAL 161 169 Probable membrane protein Probable membrane protein Mycobacterium
Rv1733c Rv1733c tuberculosis
H37Rv
155179 LTRAILIRV 185 193 Probable membrane protein Probable membrane protein Mycobacterium
Rv1733c Rv1733c tuberculosis
H37Rv
155504 QAQTRHPAT 78 86 Probable membrane protein Probable membrane protein Mycobacterium
Rv1733c Rv1733c tuberculosis
H37Rv
15571 1 RTVSLPVGA 100 108 Alpha-crystallin Alpha-crystallin Mycobacterium tuberculosis
H37Rv
155927 TLLTIDGGI 210 218 Glucose-regulated protein Glucose-regulated protein Trypanosoma
78, putative 78, putative cruzi (UniProt:K4DS68)
(UniProt:E7EW77) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
156803 YLDEDTIYHL 235 244 S-adenosylmethionine S-adenosylmethionine Homo sapiens synthase isoform type-2 synthase isoform type-2
156804 YLDQTLPRA 814 822 Putative ATP-dependent Putative ATP-dependent Homo sapiens
RNA helicase DDX1 1-like RNA helicase DDX11-like
protein 8 protein 8
156805 YLFERIKEL 409 417 Transmembrane protein 209 Transmembrane protein 209 Homo sapiens
156806 YLGDDYVRAM 675 684 Serotransferrin Serotransferrin Bos taurus
156808 YVDDTQFVRF 51 60 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, A-2 alpha chain antigen, A-2 alpha chain
158752 FIDKFTPPV 133 141 HLA class II HLA class II Homo sapiens histocompatibility antigen, histocompatibility antigen,
DR alpha chain DR alpha chain
158764 FLLKLTPLL 340 348 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 24 II transcription subunit 24
(UniProt:075448)
158766 FLTEAIVHSV 1004 1013 RNA-directed RNA RNA-directed RNA Human
polymerase L polymerase L orthopneumovirus
158786 FTWEGLYNV 626 634 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 11 hydrolase 1 1
158805 GPFGPPMPLHV 919 929 Phosphatidylinositol 3,4,5- Phosphatidylinositol 3,4,5- Homo sapiens trisphosphate 5-phosphatase trisphosphate 5-phosphatase
1 1
158959 LLGPTVML 663 670 Protein KRI1 homolog Protein KRI1 homolog Homo sapiens
158963 LLYGFVNYI 87 95 ELAV-like protein 4 ELAV-like protein 4 Homo sapiens
(Paraneoplastic
encephalomyelitis antigen
HuD) (Hu-antigen D)
158964 LLYGFVNYV 87 95 ELAV-like protein 4 ELAV-like protein 4 Homo sapiens
(Paraneoplastic
encephalomyelitis antigen
HuD) (Hu-antigen D)
159059 QVFPGLLERV 324 333 Ataxin-10 Ataxin-10 Homo sapiens
159112 SLQQEITLL 39 47 Nucleoprotein Nucleoprotein Human
metapneumovirus
159114 SLWGGDVVL 29 37 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13B associated protein 13B
159218 YLDLFGDPSV 140 149 Farnesyl pyrophosphate Farnesyl pyrophosphate Homo sapiens synthase synthase
161353 IMILLVLVSA 95 104 Uncharacterized transporter Uncharacterized transporter Mycobacterium
Rv2684 Rv2684 tuberculosis
H37Rv
161402 ULATMLVA 99 107 Other Mycobacterium Mycobacterium tuberculosis protein tuberculosis
H37Rv
161927 ALADGVQKV 160 168 Apolipoprotein L1 Apolipoprotein L1 Homo sapiens
161931 ALKKALAAA 61 69 Histone H1.2 Histone H 1.2 Homo sapiens
161935 ALNIATHVL 2 10 Putative tRNA Putative tRNA Homo sapiens
(cytidine(32)/guanosine(34)- (cytidine(32)/guanosine(34)-
2'-0)-methyltransferase 2'-0)-methyltransferase
161942 ALSSUHAL 376 384 X-ray repair cross- X-ray repair cross- Homo sapiens complementing protein 5 complementing protein 5
161944 ALVDHVAEL 306 314 Unconventional myosin-lg Unconventional myosin-lg Homo sapiens
162037 AVFDKTLAEL 621 630 Activating transcription factor Activating transcription factor Homo sapiens
7-interacting protein 1 7-interacting protein 1
162042 AVIGDVIRV 357 365 Nucleolar RNA helicase 2 Nucleolar RNA helicase 2 Homo sapiens
162078 DLHEKDFSL 512 520 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 4 polymerase 4
162144 EUERIPEL 575 583 Transferrin receptor protein 1 Transferrin receptor protein 1 Homo sapiens
162178 FASGLIHRV 110 118 Other Homo sapiens Keratinocyte-associated Homo sapiens
(human) protein protein 2
162199 FIFSDTHEL 797 805 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 4 polymerase 4 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
162205 FLDASGAKLDY 53 63 Basic leucine zipper and W2 Basic leucine zipper and W2 Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:Q7L1Q6)
162210 FLFGEVHKA 333 341 Protein MCM10 homolog Protein MCM10 homolog Homo sapiens
162212 FURESETL 153 161 Tyrosine-protein kinase Lyn Tyrosine-protein kinase Lyn Homo sapiens
162219 FLVTVIHTL 1065 1073 Plexin-C1 (UniProt:O60486) Plexin-C1 Homo sapiens
162222 FMIIPTLII 21 1 219 UDP-N- UDP-N- Homo sapiens acetylglucosamine/UDP- acetylg I u cosa m i n e/U D P- glucose/GDP-mannose glucose/GDP-mannose
transporter (UniProt:Q76EJ3) transporter
162246 FQNPFRSEL 330 338 DNA repair protein XRCC1 DNA repair protein XRCC1 Homo sapiens
162328 GLADASLLKKV 443 453 Ataxin-10 Ataxin-10 Homo sapiens
162329 GLIDKVNEL 302 310 Signal recognition particle 54 Signal recognition particle 54 Homo sapiens kDa protein kDa protein
162362 GQNDIHHKV 57 65 Ras GTPase-activating Ras GTPase-activating Homo sapiens protein-binding protein 2 protein-binding protein 2
162408 GVYGGSVHEA 269 278 Cytosolic non-specific Cytosolic non-specific Homo sapiens dipeptidase dipeptidase
162488 ILAAIVNHL 443 451 Nuclear receptor subfamily 2 Nuclear receptor subfamily 2 Homo sapiens group C member 2 group C member 2
162490 ILAQEIVKA 309 317 SUMO-activating enzyme SUMO-activating enzyme Homo sapiens subunit 1 subunit 1
162494 IUDPFHKA 133 141 60S ribosomal protein L15 60S ribosomal protein L15 Homo sapiens
162496 IUSKLLGA 19 27 Toll-like receptor 7 Homo sapiens
162516 ILVKHLTNV 512 520 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 10 protein 10
162526 IQIMKVEEI 95 103 60S ribosomal protein L18a 60S ribosomal protein L18a Homo sapiens
162585 ITQTVIHTV 192 200 Galectin-9C Galectin-9C Homo sapiens
162590 IVADHVASYGV 26 36 HLA class II HLA class II Homo sapiens histocompatibility antigen, histocompatibility antigen,
DQ alpha 1 chain DQ alpha 1 chain
(UniProt:P01909)
162607 KAISGVHTV 59 67 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 2 subunit 3 initiation factor 2 subunit 3
162665 KIYEGQVEV 117 125 60S ribosomal protein L5 60S ribosomal protein L5 Homo sapiens
(UniProt:P46777)
162670 KLFEGENEHL 1152 1161 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP2 protein IQGAP2
162672 KUDDVHRL 81 89 Signal recognition particle Signal recognition particle Homo sapiens receptor subunit alpha receptor subunit alpha
162688 KLSDLDNKL 4751 4759 Dystonin (UniProt:Q03001) Dystonin Homo sapiens
162691 KLYDIDVAKV 115 124 60S ribosomal protein L23a 60S ribosomal protein L23a Homo sapiens
(UniProt:P62750)
162700 KMPEINAKV 92 100 Homocysteine-responsive Homocysteine-responsive Homo sapiens endoplasmic reticulum- endoplasmic reticulum- resident ubiquitin-like domain resident ubiquitin-like domain member 1 protein member 1 protein
162777 KTASINQNV 241 249 Kinesin-like protein KIF18A Kinesin-like protein KIF18A Homo sapiens
162806 KVGPVPVLV 67 75 Protein transport protein Protein transport protein Homo sapiens
Sec61 subunit beta Sec61 subunit beta
162878 LLSDTVQHL 56 64 Signal transducer and Signal transducer and Homo sapiens activator of transcription 6 activator of transcription 6
162997 MMDPNSTQRY 20 29 Exportin-5 Exportin-5 Homo sapiens
163009 MVPRLTAVL 630 638 Pecanex-like protein 4 Pecanex-like protein 4 Homo sapiens
163026 NIIELVHQV 470 478 Tyrosine-protein kinase SYK Tyrosine-protein kinase SYK Homo sapiens
163027 NIQTAINQV Genome polyprotein Genome polyprotein Dengue virus 3
163034 NLMEMVAQL 1657 1665 Chromodomain-helicase- Chromodomain-helicase- Homo sapiens
DNA-binding protein 7 DNA-binding protein 7
163117 QLAQFVHEV 212 220 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX1 1 RNA helicase DDX11
163129 QLVDIIEKV 33 41 Proteasome activator Proteasome activator Homo sapiens complex subunit 3 complex subunit 3 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
163272 RLYPEGLAQL 246 255 V-type proton ATPase V-type proton ATPase Homo sapiens subunit d 1 subunit d 1
163317 RQYPWGTVQV 254 263 Septin-6 Septin-6 Homo sapiens
163366 RVSDINFTL 582 590 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 6 regulatory phosphatase 6 regulatory
subunit 3 (UniProt:Q5H9R7) subunit 3
163375 SAVDFIRTL 293 301 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase 17A kinase 17A
163426 SIAEVVHQL 305 313 Cyclin-G-associated kinase Cyclin-G-associated kinase Homo sapiens
163436 SLADIAQKL 418 426 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 3 ATPase regulatory subunit 3
163447 SLIRSVVAL 264 272 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 7 ATPase regulatory subunit 7
163481 SQFSYQHAI 136 144 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit H initiation factor 3 subunit H
163524 SQVEILQRV 65 73 DNA-binding protein inhibitor DNA-binding protein inhibitor Homo sapiens
ID-3 ID-3
163564 SVITQVFHV 74 82 Vigilin (UniProt:Q00341 ) Vigilin Homo sapiens
163614 TIAQLVHAV 77 85 Ribosomal RNA processing Ribosomal RNA processing Homo sapiens protein 1 homolog B protein 1 homolog B
163619 TINGHNAEV 176 184 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoproteins A2/B1 ribonucleoproteins A2/B1
163620 TITEEIAVQ 3127 3135 Genome polyprotein Genome polyprotein Dengue virus 2
Thailand/16681/8
4
163622 TLADLVHHV 378 386 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
163709 TVADHIQKV 584 592 Coatomer subunit gamma-1 Coatomer subunit gamma-1 Homo sapiens
163712 TVIAKVNNV 150 158 Threonine-tRNA ligase, Threonine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
163721 TVMGRIATL 265 273 Sodium/potassium- Sodium/potassium- Homo sapiens transporting ATPase subunit transporting ATPase subunit
alpha-1 alpha-1
163769 VLFEKEVNEV 367 376 Protein Niban Protein Niban Homo sapiens
163773 VLKEIVERV 232 240 Caprin-1 Caprin-1 Homo sapiens
163800 VQIEEVRQV 97 105 Interleukin enhancer-binding Interleukin enhancer-binding Homo sapiens factor 2 factor 2
163859 VTLLCUPTV Genome polyprotein Genome polyprotein Dengue virus 2
163893 YAYDGKDYI 115 123 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, A-2 alpha chain antigen, A-2 alpha chain
163894 YAYDGKDYIAL 140 150 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, A-2 alpha chain antigen, A-2 alpha chain
163932 YIYDKDMEII 46 55 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 22 hydrolase 22
163943 YUNEIDRI 981 989 Dystonin (UniProt:Q03001) Dystonin Homo sapiens
163944 YLKDUEEV 333 341 Cyclic AMP-dependent Cyclic AMP-dependent Homo sapiens transcription factor ATF-4 transcription factor ATF-4
163948 YMAEUERL 150 158 Geminin Geminin Homo sapiens
163950 YMIAHITGL 235 243 Thymidylate synthase Thymidylate synthase Homo sapiens
164013 YTFPLAEKV 257 265 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0 (UniProt:P05388) P0
164023 YVKDRVEKV 286 294 Rab GDP dissociation Rab GDP dissociation Homo sapiens inhibitor beta inhibitor beta
164233 FWPILLKA 129 137 Hantaan orthohantavirus Hantaan protein orthohantavirus
164335 QLSTRGVQI 357 365 Nucleoprotein Nucleoprotein H5N1 subtype
164417 VPILLKALY 131 139 Hantaan orthohantavirus Hantaan protein orthohantavirus
164547 RMLGDVMAV 562 570 Envelope glycoprotein B Envelope glycoprotein B Herpes simplex virus (type 1 / strain 17) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
164551 TMLEDHEFV 676 684 Envelope glycoprotein B Envelope glycoprotein B Herpes simplex virus (type 1 / strain 17)
164581 ALAVLSVTL 3 11 Thyroid peroxidase Thyroid peroxidase Homo sapiens
(UniProt:P07202)
164587 ALSEDLLSI 118 126 Thyroid peroxidase Thyroid peroxidase Homo sapiens
(UniProt:P07202)
164764 GLLDQVAAL 2355 2363 Thyroglobulin Thyroglobulin Homo sapiens
164765 GLREDLLSL 2750 2758 Thyroglobulin Thyroglobulin Homo sapiens
165028 LUGGFAGL 857 865 Thyroid peroxidase Thyroid peroxidase Homo sapiens
(UniProt:P07202)
165257 SLQDVPLAAL 841 850 Thyroglobulin Thyroglobulin Homo sapiens
167083 ATYVFLHTV 59 67 ORMUike protein 2 ORMMike protein 2 Homo sapiens
167161 SLSTFQQMW 349 357 Actin, gamma-enteric smooth Actin, gamma-enteric smooth Homo sapiens muscle muscle
167163 STLHLVLRL 65 73 Polyubiquitin-B Polyubiquitin-B Homo sapiens
(UniProt:P0CG47)
167652 QLSLLMWIT 155 163 Cancer/testis antigen 1 Cancer/testis antigen 1 Homo sapiens
167724 ALGGLLTMV 426 434 Latent membrane protein 2 Latent membrane protein 2 Human
gammaherpesviru s 4
167728 CLGALLTMV 426 434 Latent membrane protein 2 Latent membrane protein 2 Human
gammaherpesviru s 4
167729 CLGGLATMV 426 434 Latent membrane protein 2 Latent membrane protein 2 Human
gammaherpesviru s 4
167730 CLGGLLAMV 426 434 Latent membrane protein 2 Latent membrane protein 2 Human
gammaherpesviru s 4
168159 ALGDLFQSI 221 229 Zinc transporter 8 Zinc transporter s Homo sapiens
168235 AVAANIVLTV 185 194 Zinc transporter 8 Zinc transporter s Homo sapiens
168240 AVPEVTDVTL 19 28 Paraflagellar rod protein 3, Paraflagellar rod protein 3, Trypanosoma putative (UniProt:K4EBQ5) putative cruzi
168327 DIIEQMKGV 481 489 Paraflagellar rod component, Paraflagellar rod component, Trypanosoma putative putative cruzi
168356 DLTSFLLSL 110 118 Zinc transporter 8 Zinc transporter s Homo sapiens
168451 EILGALLSI 140 148 Zinc transporter 8 Zinc transporter s Homo sapiens
168578 FLLSLFSLWL 114 123 Zinc transporter 8 Zinc transporter s Homo sapiens
168607 FVSCCGELTV 432 441 Paraflagellar rod component, Paraflagellar rod component, Trypanosoma putative putative cruzi
168728 GVSGVINAL 488 496 Paraflagellar rod component, Paraflagellar rod component, Trypanosoma putative putative cruzi
168764 HIAGSLAVV 93 101 Zinc transporter 8 Zinc transporter s Homo sapiens
168865 ILAVDGVLSV 291 300 Zinc transporter 8 Zinc transporter s Homo sapiens
168867 ILGALLSIL 141 149 Zinc transporter 8 Zinc transporter s Homo sapiens
168874 ILKDFSILL 266 274 Zinc transporter 8 Zinc transporter s Homo sapiens
168880 ILSAHVATA 314 322 Zinc transporter 8 Zinc transporter s Homo sapiens
168881 ILVLASTITI 257 266 Zinc transporter 8 Zinc transporter s Homo sapiens
168988 KLEKIEDEL 156 164 Paraflagellar rod protein 3, Paraflagellar rod protein 3, Trypanosoma putative (UniProt:K4EBQ5) putative cruzi
169149 LUDLTSFL 107 115 Zinc transporter 8 Zinc transporter s Homo sapiens
169153 LLMEGVPKSL 273 282 Zinc transporter 8 Zinc transporter s Homo sapiens
169658 RLYKTLGQL 449 457 Paraflagellar rod protein 3, Paraflagellar rod protein 3, Trypanosoma putative (UniProt:K4EBQ5) putative cruzi
169725 SISVUSAL 228 236 Zinc transporter 8 Zinc transporter s Homo sapiens
169744 SLNYSGVKEL 281 290 Zinc transporter 8 Zinc transporter s Homo sapiens
169790 SVHSLHIWSL 299 308 Zinc transporter 8 Zinc transporter s Homo sapiens
170038 VVTGVLVYL 153 161 Zinc transporter 8 Zinc transporter s Homo sapiens
170324 ALLKDTVYT 191 199 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase pim-1 kinase pim-1
171037 FIFSILVLA 253 261 Zinc transporter 8 Zinc transporter s Homo sapiens
171556 IQATVMIIV 173 181 Zinc transporter 8 Zinc transporter s Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
177496 GILGFVTTL 58 66 Matrix protein 1 Matrix protein 1 Influenza A virus
177602 ALWGPDPAAV 15 24 insulin Insulin Homo sapiens
177609 AQWGPDPAAV 15 24 insulin Insulin Homo sapiens
177958 RQWGPDPAAV 15 24 Insulin precursor Insulin Homo sapiens
178829 FLGPLLVLQA 171 180 Large envelope protein Large envelope protein Hepatitis B virus
179688 WLGNIIMYA 2827 2835 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
179782 FFAGGIGIRTI 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
179784 FLAGGIGIRTL 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
179791 FWLLGAWAL 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
179792 FWLLPAWAL 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
179820 ILAKFLHWL 540 548 Telomerase reverse Telomerase reverse Homo sapiens transcriptase transcriptase
179924 WLLPAWGV 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
179925 WLLPTWGV 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
180168 SLFNAVATL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
180191 SLFNTIATL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
180233 SLFNTVATV 60 68 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
180236 SLFNTVAVL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
180255 SLFNTVVTL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
180320 AMDTISVFL 2130 2138 Genome polyprotein Genome polyprotein Yellow fever virus
17D
180348 VMLFILAGL 2161 2169 Genome polyprotein Genome polyprotein Yellow fever virus
17D
180390 CLMMMLPATL 104 113 Genome polyprotein Genome polyprotein Dengue virus
180465 FTMGVLCLAI 1133 1142 Genome polyprotein Genome polyprotein Dengue virus
180541 ITLLCLIPTV 102 111 Genome polyprotein Genome polyprotein Dengue virus
180607 LMLLALIAVL 2149 2158 Genome polyprotein Genome polyprotein Dengue virus
180609 LMMMLPATL 105 113 Genome polyprotein Genome polyprotein Dengue virus
180610 LMMMLPATLA 105 114 Genome polyprotein Genome polyprotein Dengue virus
180661 MMMLPATLA 106 114 Genome polyprotein Genome polyprotein Dengue virus
180706 QLLNSVLTL 248 256 Uncharacterized protein Uncharacterized protein Homo sapiens
KIAA1551 KIAA1551
180772 TLLCLIPTV 103 111 Genome polyprotein Genome polyprotein Dengue virus
180773 TLMLLAUAV 2148 2157 Genome polyprotein Genome polyprotein Dengue virus
180775 TLTAAVLLLV 2348 2357 Genome polyprotein Genome polyprotein Dengue virus
180799 VLLLVTHYAI 2353 2362 Genome polyprotein Genome polyprotein Dengue virus
180810 VTYECPLLV 162 170 Genome polyprotein Genome polyprotein Dengue virus
181016 SLGGLLTMA Latent membrane protein 2 Latent membrane protein 2 Human
herpesvirus 4 strain B95-8
181347 ILDAHSLYL 165 173 Rift Valley fever phlebovirus Rift Valley fever protein virus
181500 VLSEWLPVT 121 129 Rift Valley fever phlebovirus Rift Valley fever protein virus
181640 GLVPFLVSV 377 385 Importin subunit alpha-1 Importin subunit alpha-1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
188705 KVVKLTPQV 142 150 Protein L3 Protein L3 Vaccinia virus
Copenhagen
188709 ULDPKINV 254 262 Soluble interferon alpha/beta Soluble interferon alpha/beta Vaccinia virus WR receptor B18 receptor B18
188724 MIKPCCERV 27 35 Protein A51 Protein A51 Vaccinia virus
Copenhagen
188733 PLALYSADKV 254 263 Serine/threonine-protein Serine/threonine-protein Vaccinia virus WR kinase 2 kinase 2
188735 QIDVEKKIV 462 470 Early transcription factor 82 Early transcription factor 82 Vaccinia virus kDa subunit kDa subunit Copenhagen
188737 QVSIIQEKL 134 142 Intermediate transcription Intermediate transcription Vaccinia virus WR factor 3 small subunit factor 3 small subunit
188748 SIHTIKTLGV 140 149 Envelope protein F13 Envelope protein F13 Vaccinia virus
Copenhagen
188749 SIIFGRQPSL 375 384 DNA-directed RNA DNA-directed RNA Vaccinia virus polymerase 147 kDa polymerase 147 kDa Copenhagen polypeptide polypeptide
188759 TIEELKQKL 96 104 Protein A52 Protein A52 Vaccinia virus
Copenhagen
188760 TIINKFFEV 168 176 mRNA-decapping protein mRNA-decapping protein Vaccinia virus
D10 D10 Copenhagen
188761 TINDLKMML 68 76 Protein A31 Protein A31 Vaccinia virus
Copenhagen
188762 TUGNFAAHL 57 66 Glutaredoxin-2 Glutaredoxin-2 Vaccinia virus
Copenhagen
188763 TLRVLQDQL 458 466 DNA ligase DNA ligase Vaccinia virus WR
188769 TVMINNVKL 249 257 Early transcription factor 82 Early transcription factor 82 Vaccinia virus kDa subunit kDa subunit Copenhagen
188770 TVYDINNEV 125 133 Protein F1 Protein F1 Vaccinia virus
Copenhagen
188772 VLESCWPDV 113 121 Myristoylated protein G9 Myristoylated protein G9 Vaccinia virus WR
188773 VUSPVSIL 16 24 Serine proteinase inhibitor 1 Serine proteinase inhibitor 1 Vaccinia virus
Copenhagen
188774 VLNDQYAKV 566 574 Protein 01 Protein 01 Vaccinia virus
Copenhagen
188778 YILNSLTKGL 717 726 DNA-directed RNA DNA-directed RNA Vaccinia virus WR polymerase 147 kDa polymerase 147 kDa
polypeptide polypeptide
188779 YINNNIEEI 99 107 Protein C5 Protein C5 Vaccinia virus
Copenhagen
188780 YITNRLELL 271 279 DNA polymerase DNA polymerase Vaccinia virus
Copenhagen
188781 YLLDRGADIV 528 537 Other Vaccinia virus protein Ankyrin repeat protein Vaccinia virus
VACWR203 Copenhagen
189204 ALYNTVATL 77 85 Gag protein Gag polyprotein Human
immunodeficiency virus 1
189275 SLFNAVAVL 47 55 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189277 SLFNTIAVL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189280 SLYLTVATL 77 85 Gag protein Gag polyprotein Human
immunodeficiency virus 1
189285 SLYNSVATL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189286 SLYNTAATL 77 85 Gag protein Gag polyprotein Human
immunodeficiency virus 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
189287 SLYNTIAIL 68 76 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189288 SLYNTIATL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189289 SLYNTISVL 68 76 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189290 SLYNTITVL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189291 SLYNTVAAL 77 85 Gag protein Gag polyprotein Human
immunodeficiency virus 1
189292 SLYNTVAIF 1 9 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189293 SLYNTVAVL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189294 SLYNTVSTL 51 59 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189295 SLYNTVVTL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189297 SLYQTVATL 77 85 Gag protein Gag polyprotein Human
immunodeficiency virus 1
189300 SVYNTVATL 77 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
189566 ALADLPVTV 288 296 PGL/p-HBAD biosynthesis PGL/p-HBAD biosynthesis Mycobacterium glycosyltransferase Rv2958c glycosyltransferase Rv2958c tuberculosis
189569 AMLDHAGDM 10 18 ESAT-6-like protein esxH ESAT-6-like protein EsxH Mycobacterium tuberculosis
189849 SIIIPTLNV 26 34 PGL/p-HBAD biosynthesis PGL/p-HBAD biosynthesis Mycobacterium glycosyltransferase Rv2957 glycosyltransferase Rv2957 tuberculosis
189894 VLAGSVDEL 165 173 Cyclopropane-fatty-acyl- Cyclopropane-fatty-acyl- Mycobacterium phospholipid synthase phospholipid synthase tuberculosis (UniProt:Q7D9T1)
189944 ALAGIGILTV 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
189960 ELAAIGILTV 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
189961 ELAGIAILTV 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
189962 ELAGIGALTV 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
189963 ELAGIGIATV 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
189964 ELAGIGILAV 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
190821 KLLGLGINAV 303 312 Genome polyprotein Genome polyprotein Hepatitis C virus
190822 KLSGLGINAI 1406 1415 Genome polyprotein Genome polyprotein Hepatitis C virus
190826 KSLFNTIATL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190827 KSLYNTIATL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
190828 KSLYNTIAVL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190829 KSLYNTVAVL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190959 RSLFNTIATL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190960 RSLFNTIAVL 76 85 Gag-Pol polyprotein Gag-Pol polyprotein Human
immunodeficiency virus 1
190961 RSLFNTVAVL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190962 RSLYNTIATL 76 85 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190963 RSLYNTIAVL 76 85 Gag-Pol polyprotein Gag-Pol polyprotein Human
immunodeficiency virus 1
190974 SLFNTIATLY 77 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190975 SLFNTVAVLY 77 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190978 SLYNTIATLY 77 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190979 SLYNTIAVLY 77 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190980 SLYNTVATLY 77 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
190981 SLYNTVAVLY 77 86 Gag polyprotein Gag polyprotein Human
immunodeficiency virus 1
191486 KLGPAGTTI 86 94 Erythroid differentiation- Erythroid differentiation- Homo sapiens related factor 1 related factor 1
191716 RVAPEEHPVL 85 94 Actin, cytoplasmic 2 Actin, cytoplasmic 2 Homo sapiens
191728 RYLEQLHQL 13 21 Signal transducer and Signal transducer and Homo sapiens activator of transcription 3 activator of transcription 3
192156 YQFDKVGILTL 420 430 THO complex subunit 5 THO complex subunit 5 Homo sapiens homolog homolog
193622 AIKKKDELERVA 189 200 40S ribosomal protein S5 40S ribosomal protein S5 Homo sapiens
193623 AILETAPKEV 168 177 Ribosome-binding protein 1 Ribosome-binding protein 1 Homo sapiens
193624 AILTWPKI 628 636 Protein VPRBP Protein VPRBP Homo sapiens
193625 AIVRSLPSV 331 339 Sarcoplasmic/endoplasmic Sarcoplasmic/endoplasmic Homo sapiens reticulum calcium ATPase 3 reticulum calcium ATPase 3
193626 ALAAALAHI 247 255 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX50 helicase DDX50
193627 ALAALHVTL 99 107 Zinc transporter ZIP1 Zinc transporter ZIP1 Homo sapiens
193628 ALADKELLPSV 178 188 Apoptosis-inducing factor 2 Apoptosis-inducing factor 2 Homo sapiens
193629 ALAEIAKAEL 343 352 Splicing factor, proline- and Splicing factor, proline- and Homo sapiens glutamine-rich glutamine-rich
193630 ALAGHQDGITFI 187 198 DDB1 - and CUL4-associated DDB1- and CUL4-associated Homo sapiens factor 1 1 factor 11
193632 ALAKEIDSV 100 108 Ras-related C3 botulinum Ras-related C3 botulinum Homo sapiens toxin substrate 2 toxin substrate 2
193633 ALAKLVEAI 90 98 60S ribosomal protein L7a 60S ribosomal protein L7a Homo sapiens
193634 ALANHUKV 516 524 EH domain-containing EH domain-containing Homo sapiens protein 1 protein 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
193635 ALAQRLLEV 457 465 Nesprin-3 Nesprin-3 Homo sapiens
193636 ALATUHQV 26 34 COP9 signalosome complex COP9 signalosome complex Homo sapiens subunit 7a subunit 7a
193637 ALDEYNMKI 1524 1532 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX60 RNA helicase DDX60
193638 ALDKALTSV 310 318 Cullin-2 Cullin-2 Homo sapiens
193639 ALDPASLPRV 12 21 Protein THEMIS2 Protein THEMIS2 Homo sapiens
(UniProt:Q5TEJ8)
193640 ALDSQVPKV 112 120 FYVE, RhoGEF and PH FYVE, RhoGEF and PH Homo sapiens domain-containing protein 3 domain-containing protein 3
193641 ALEEKIPNI 73 81 Glutathione S-transferase A4 Glutathione S-transferase A4 Homo sapiens
193642 ALFDQDKSSMRL 94 105 Copine-2 Copine-2 Homo sapiens
193643 ALFDSGLHPA 198 207 Endonuclease 8-like 3 Endonuclease 8-like 3 Homo sapiens
193644 ALFEGKVQL 442 450 WD repeat-containing protein WD repeat-containing protein Homo sapiens
19 19
193645 ALFKAWAL 69 76 Interferon regulatory factor 4 Interferon regulatory factor 4 Homo sapiens
193646 ALFQPHLINV 264 273 Actin-related protein 2 Actin-related protein 2 Homo sapiens
193647 ALFQRPPU 179 187 H/ACA ribonucleoprotein H/ACA ribonucleoprotein Homo sapiens complex subunit 4 complex subunit 4
193648 ALGAGIERMGL 560 570 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein M ribonucleoprotein M
(UniProt:P52272)
193649 ALGPTGRGV 292 300 Serine palmitoyltransferase 2 Serine palmitoyltransferase 2 Homo sapiens
193650 ALGTDAEGQKV 373 383 Syntaxin-binding protein 3 Syntaxin-binding protein 3 Homo sapiens
193651 ALIARVTNV 121 129 Apoptosis-associated speckApoptosis-associated speckHomo sapiens like protein containing a like protein containing a
CARD CARD
193652 AUDRMVNL 158 166 DNA damage-inducible DNA damage-inducible Homo sapiens transcript 3 protein transcript 3 protein
193653 ALIEAEKVAQV 214 224 Erlin-2 (UniProt:O94905) Erlin-2 Homo sapiens
193654 AUEKLVEL 22 30 DNA polymerase alpha DNA polymerase alpha Homo sapiens subunit B subunit B
193655 AUTRIFGV 1259 1267 Thyroid adenoma-associated Thyroid adenoma-associated Homo sapiens protein protein
193656 ALKDUNEA 18 26 Proliferating cell nuclear Proliferating cell nuclear Homo sapiens antigen antigen
193657 ALLAGPLRPA 10 19 Protein FAM127B Protein FAM127B Homo sapiens
193658 ALLAGSEYLKL 439 449 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit D initiation factor 3 subunit D
193659 ALLDGRLQVV 368 377 Fatty acid synthase Fatty acid synthase Homo sapiens
193660 ALLDSAHLL 461 469 AP-3 complex subunit delta- 1 AP-3 complex subunit delta-1 Homo sapiens
193661 ALLEDEERVVRL 87 98 Extended synaptotagmin-2 Extended synaptotagmin-2 Homo sapiens
193662 ALLEMDARL 197 205 Exosome complex Exosome complex Homo sapiens component RRP41 component RRP41
193663 ALLGDLTKA 689 697 Transportin-1 Transportin-1 Homo sapiens
193664 ALLGILQHV 12 20 NudC domain-containing NudC domain-containing Homo sapiens protein 3 protein 3
193665 ALLGLTLGV 17 25 Envelope glycoprotein B Envelope glycoprotein B Herpes simplex virus (type 1 / strain 17)
193666 ALLGRIPSA 320 328 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
193667 ALLKGLAAV 19 27 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 35 hydrolase 35
193668 ALLKQVEI 292 299 Protein FAM186B Protein FAM186B Homo sapiens
193669 ALLQQVHSA 900 908 Proline and serine-rich Proline and serine-rich Homo sapiens protein 1 protein 1
193670 ALLSGLREA 696 704 Lysine-specific histone Lysine-specific histone Homo sapiens demethylase 1A demethylase 1A
193671 ALMDLDVKKMPL 207 218 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 3 polymerase 3
193672 ALMEQVAHQTI 204 214 Hsp90 co-chaperone Cdc37 Hsp90 co-chaperone Cdc37 Homo sapiens
(UniProt:Q16543) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
193673 ALMSRPAQV 332 340 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase-binding protein 1 kinase-binding protein 1
193674 ALNEEAGRLLL 128 138 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 S enzyme E2 S
193675 ALNELLQHV 777 785 Talin-1 Talin-1 Homo sapiens
193676 ALNEQIARL 274 282 Kinetochore protein NDC80 Kinetochore protein NDC80 Homo sapiens homolog homolog
193677 ALNGKLYIV 460 468 Influenza virus NS1 A-binding Influenza virus NS1 A-binding Homo sapiens protein protein
193678 ALQEKLWNV 235 243 Integrator complex subunit 4 Integrator complex subunit 4 Homo sapiens
193679 ALQEKVQAV 215 223 BRISC complex subunit BRISC complex subunit Homo sapiens
Abrol Abrol
193680 ALQEMVHQV 657 665 Enhancer of filamentation 1 Enhancer of filamentation 1 Homo sapiens
193681 ALQSLIPSL 395 403 LisH domain and HEAT LisH domain and HEAT Homo sapiens repeat-containing protein repeat-containing protein
KIAA1468 KIAA1468
193682 ALRDVSEEL 67 75 Alpha-taxilin Alpha-taxilin Homo sapiens
193683 ALREENEQL 24 32 SET and MYND domain- SET and MYND domain- Homo sapiens containing protein 4 containing protein 4
193684 ALRGEIETV 797 805 Leucine-rich PPR motif- Leucine-rich PPR motif- Homo sapiens containing protein, containing protein,
mitochondrial mitochondrial
193685 ALSEKLARL 219 227 HAUS augmin-like complex HAUS augmin-like complex Homo sapiens subunit 1 subunit 1
193686 ALSKEGIVAL 162 171 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens zeta zeta
193687 ALSNLEVKL 326 334 Fermitin family homolog 3 Fermitin family homolog 3 Homo sapiens
193688 ALTRLHITV 33 41 Ras-related GTP-binding Ras-related GTP-binding Homo sapiens protein C protein C
193689 ALVDHLNVGV 37 46 Biogenesis of lysosome- Biogenesis of lysosome- Homo sapiens related organelles complex 1 related organelles complex 1 subunit 1 subunit 1
193690 ALVSSLHLL 159 167 Coatomer subunit gamma-1 Coatomer subunit gamma-1 Homo sapiens
193691 ALWEDEGVRA 142 151 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein G(s) subunit alpha protein G(s) subunit alpha
isoforms short isoforms short
193692 ALWEGPSKA 602 610 FERM, RhoGEF and FERM, RhoGEF and Homo sapiens pleckstrin domain-containing pleckstrin domain-containing protein 2 protein 2
193693 ALWSVGGEVHV 34 44 Probable G-protein coupled Probable G-protein coupled Homo sapiens receptor 146 receptor 146
193694 ALYASRLYL 254 262 Mannose-1 -phosphate Mannose-1 -phosphate Homo sapiens guanyltransferase alpha guanyltransferase alpha
(UniProt:Q96IJ6)
193695 ALYDEVRTV 656 664 Structural maintenance of Structural maintenance of Homo sapiens chromosomes flexible hinge chromosomes flexible hinge
domain-containing protein 1 domain-containing protein 1
193696 ALYDNVEKL 131 139 Asparagine synthetase Asparagine synthetase Homo sapiens
[glutamine-hydrolyzing] [glutamine-hydrolyzing]
193697 ALYGKLLKL 766 774 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13B associated protein 13B
193698 ALYGRAEAAEV 446 456 Hypermethylated in cancer 1 Hypermethylated in cancer 1 Homo sapiens protein protein
193699 ALYHLAIKL 579 587 A-kinase anchor protein 11 A-kinase anchor protein 1 1 Homo sapiens
193700 ALYNDISHMKI 279 289 Nuclear receptor coactivator Nuclear receptor coactivator Homo sapiens
7 7
193701 AMAQEGLREV 869 878 Nck-associated protein 1 -like Nck-associated protein Mike Homo sapiens
193702 AMFDHIPVGV 146 155 tRNA-splicing ligase RtcB tRNA-splicing ligase RtcB Homo sapiens homolog homolog
193703 AMFGKLMTI 534 542 Sister chromatid cohesion Sister chromatid cohesion Homo sapiens protein PDS5 homolog A protein PDS5 homolog A
193704 AMLAVLHTV 20 28 Autophagy-related protein Autophagy-related protein Homo sapiens
101 (UniProt:Q9BSB4) 101 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
193705 AMLENASDIKL 258 268 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 1 family F member 1
193706 AMLTVLHEI 233 241 Activating signal cointegrator Activating signal cointegrator Homo sapiens
1 complex subunit 3 1 complex subunit 3
(UniProt:Q8N3C0)
193707 AMNGHVPAV 1231 1239 Ankyrin repeat and KH Ankyrin repeat and KH Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:Q8IWZ3)
193708 AMWEHPITA 65 73 Phosphopantothenoylcystein Ph os ph opan toth e n oyl cystei n Homo sapiens e decarboxylase e decarboxylase
193709 AMYEHKIFV 492 500 Glucose-6-phosphate Glucose-6-phosphate Homo sapiens isomerase (UniProt:P06744) isomerase
193710 ATIQRIPEV 324 332 Beta-1 ,3-galactosyl-O- Beta-1 ,3-galactosyl-O- Homo sapiens glycosyl-glycoprotein beta- glycosyl-glycoprotein beta- 1 ,6-N- 1 ,6-N- acetylglucosaminyltransferas acetylglucosaminyltransferas e e
19371 1 AVIDVGINRV 270 279 Bifunctional Bifunctional Homo sapiens methylenetetrahydrofolate methylenetetrahydrofolate
dehydrogenase/cyclohydrola dehydrogenase/cyclohydrola se, mitochondrial se, mitochondrial
193712 AVTKTAGPIASA 973 984 Microtubule-associated Microtubule-associated Homo sapiens protein 4 (UniProt:P27816) protein 4
193716 DLKDQIQDV 117 125 Leucine-rich repeat flightless- Leucine-rich repeat flightless- Homo sapiens interacting protein 2 interacting protein 2
(UniProt:A8MXR0)
193718 DVIRHGADAV 119 128 Dermokine Dermokine Homo sapiens
(UniProt:Q6E0U4)
193719 EITNVTQKI 378 386 Synaptonemal complex Synaptonemal complex Homo sapiens protein 2 protein 2
193720 EMEKKLKEI 448 456 Mitotic checkpoint Mitotic checkpoint Homo sapiens serine/threonine-protein serine/threonine-protein
kinase BUB1 beta kinase BUB1 beta
193721 FASHVSPEV 152 160 ADP-ribosylation factor ADP-ribosylation factor Homo sapiens
GTPase-activating protein 3 GTPase-activating protein 3
193724 FIFDVHVHEV 335 344 Plexin-B2 Plexin-B2 Homo sapiens
193725 FIFEKKLAQA 100 109 Ankyrin repeat and LEM Ankyrin repeat and LEM Homo sapiens domain-containing protein 2 domain-containing protein 2
193726 FIFSEKPVFV 574 583 Sortilin-related receptor Sortilin-related receptor Homo sapiens
193727 FIIEKQPPQV 332 341 Signal transducer and Signal transducer and Homo sapiens activator of transcription 5B activator of transcription 5B
193728 FIINGIEKV 170 178 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA2 polymerase I subunit RPA2
(UniProt:Q9H9Y6)
193729 FIMEGPLTRI 472 481 Son of sevenless homolog 2 Son of sevenless homolog 2 Homo sapiens
193730 FIMEGTLTRV 444 453 Son of sevenless homolog 1 Son of sevenless homolog 1 Homo sapiens
193731 FINARNWTL 548 556 Phosphoribosylformylglycina Phosphoribosylformylglycina Homo sapiens midine synthase midine synthase
193732 FINIWHSV 323 331 Formin-like protein 2 Formin-like protein 2 Homo sapiens
193733 FIQEIEHAL 169 177 Exocyst complex component Exocyst complex component Homo sapiens
4 4
193734 FISEFEHRV 63 71 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit ATPase regulatory subunit
13 (UniProt:Q9UNM6) 13
193735 FIWENIHTL 6137 6145 Dystonin (UniProt:Q03001) Dystonin Homo sapiens
193736 FIYHGEVPQA 254 263 MHC class II transactivator MHC class II transactivator Homo sapiens
193737 FLADVDKLKL 478 487 Cytoskeleton-associated Cytoskeleton-associated Homo sapiens protein 5 protein 5
193738 FLAEDPKVTL 107 116 DNA dC->dU-editing enzyme DNA dC->dU-editing enzyme Homo sapiens
APOBEC-3G APOBEC-3G
193739 FLAEHDYGL 1351 1359 Protein virilizer homolog Protein virilizer homolog Homo sapiens
193740 FLAEHPNVTL 119 128 DNA dC->dU-editing enzyme DNA dC->dU-editing enzyme Homo sapiens
APOBEC-3D APOBEC-3D Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
193741 FLAHDQAVRTL 609 619 General transcription factor General transcription factor Homo sapiens
3C polypeptide 2 3C polypeptide 2
193742 FLANIGTSV 208 216 DCC-interacting protein 13- DCC-interacting protein 13- Homo sapiens alpha alpha
193743 FLAVKPDGV 25 33 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase 3 kinase 3
193744 FLAVRVQQV 195 203 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 31 protein 31
193745 FLDASGAKL 53 61 Basic leucine zipper and W2 Basic leucine zipper and W2 Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:C9IZ80)
193746 FLDDVVHSL 23 31 Probable JmjC domain- Probable JmjC domain- Homo sapiens containing histone containing histone
demethylation protein 2C demethylation protein 2C
193747 FLDENVHFA 72 80 Dipeptidyl peptidase 8 Dipeptidyl peptidase 8 Homo sapiens
(UniProt:H3BNM2)
193748 FLDHIIASV 1335 1343 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
3B 3B
193749 FLDIHNIHV 308 316 Myotubularin Myotubularin Homo sapiens
193750 FLDITNPKA 132 140 Ubiquitin fusion degradation Ubiquitin fusion degradation Homo sapiens protein 1 homolog protein 1 homolog
193751 FLDKNDHSL 171 179 Citron Rho-interacting kinase Citron Rho-interacting kinase Homo sapiens
193752 FLDKQGFYV 67 75 Epidermal growth factor Epidermal growth factor Homo sapiens receptor substrate 15-like 1 receptor substrate 15-like 1
193753 FLDNERHEV 452 460 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase N1 kinase N1
193754 FLDPGGPMMKL 86 96 Sphingomyelin Sphingomyelin Homo sapiens phosphodiesterase 4 phosphodiesterase 4
193755 FLDPNNIPKA 305 314 Probable dolichyl Probable dolichyl Homo sapiens pyrophosphate pyrophosphate
Glc1 Man9GlcNAc2 alpha- Glc1 Man9GlcNAc2 alpha- 1 ,3-glucosyltransferase 1 ,3-glucosyltransferase
193756 FLDPRPLTV 190 198 Cytochrome P450 1 B1 Cytochrome P450 1 B1 Homo sapiens
193757 FLDPRPLTVV 190 199 Cytochrome P450 1 B1 Cytochrome P450 1 B1 Homo sapiens
193758 FLDQHGHNL 1734 1742 UniProt:F8W8Q1 Homo sapiens
193759 FLDSGTIRGV 65 74 Tyrosine-protein kinase Fgr Tyrosine-protein kinase Fgr Homo sapiens
193760 FLDVNSHKI 53 61 Gamma-tubulin complex Gamma-tubulin complex Homo sapiens component s component 5
193761 FLEEKIPSI 268 276 Elongation factor G, Elongation factor G, Homo sapiens mitochondrial mitochondrial
193762 FLEPVNPRL 1818 1826 Bromodomain adjacent to Bromodomain adjacent to Homo sapiens zinc finger domain protein 2A zinc finger domain protein 2A
193763 FLFDRPMHV 297 305 Myelin expression factor 2 Myelin expression factor 2 Homo sapiens
193764 FLFEPVVKA 578 586 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 3A subunit 3A
193765 FLFNKVVNL 43 51 Protein yippee-like 5 Protein yippee-like 5 Homo sapiens
193766 FLFQEPRSI 98 106 Protein TASOR Protein TASOR Homo sapiens
193767 FLGEINDRL 198 206 Zinc finger and SCAN Zinc finger and SCAN Homo sapiens domain-containing protein 16 domain-containing protein 16
193768 FLGEKIASV 139 147 Protein FAM177A1 Protein FAM177A1 Homo sapiens
193769 FLGSFIDHV 880 888 Meckelin Meckelin Homo sapiens
193770 FLHDDNMNFRV 410 420 UPF0668 protein C10orf76 UPF0668 protein C10orf76 Homo sapiens
193771 FLHDHQAEL 85 93 Natural cytotoxicity triggering Natural cytotoxicity triggering Homo sapiens receptor 3 receptor 3
193772 FLHSLNIEM 370 378 Histone lysine demethylase Histone lysine demethylase Homo sapiens
PHF8 (UniProt:Q9UPP1 ) PHF8
193773 FUEEQKIVV 95 104 60S ribosomal protein L34 60S ribosomal protein L34 Homo sapiens
193774 FUEGTISRA 214 223 TBCC domain-containing TBCC domain-containing Homo sapiens protein 1 protein 1
193775 FUEPEHVNTV 168 178 Deubiquitinating protein Deubiquitinating protein Homo sapiens
VCIP135 VCIP135 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
193809 FLQLAVDKV 777 785 MMS19 nucleotide excision MMS19 nucleotide excision Homo sapiens repair protein homolog repair protein homolog
193810 FLQPELVKL 772 780 Proteasome activator Proteasome activator Homo sapiens complex subunit 4 complex subunit 4
19381 1 FLQPHLDAV 745 753 Syndetin Syndetin Homo sapiens
193812 FLREYFERL 49 57 cAMP-dependent protein cAMP-dependent protein Homo sapiens kinase type l-alpha kinase type l-alpha
regulatory subunit regulatory subunit
193813 FLSEEGGHVAV 83 93 6-phosphofructo-2- 6-phosphofructo-2- Homo sapiens kinase/fructose-2,6- kinase/fructose-2,6- bisphosphatase 4 bisphosphatase 4
193814 FLSEHPNVTL 107 116 DNA dC->dU-editing enzyme DNA dC->dU-editing enzyme Homo sapiens
APOBEC-3B APOBEC-3B
(UniProt:Q9UH17)
193815 FLTDSNNIKEV 557 567 Lysine-tRNA ligase Lysine-tRNA ligase Homo sapiens
193816 FLTKQEILL 21 29 Calcium and integrin-binding Calcium and integrin-binding Homo sapiens protein 1 protein 1
193817 FLVDGPRVQL 95 104 Zinc finger SWIM domain- Zinc finger SWIM domain- Homo sapiens containing protein 1 containing protein 1
193818 FLVEHNLVL 88 96 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
3A 3A
193819 FLVEHVLTL 184 192 Zinc transporter ZIP6 Zinc transporter ZIP6 Homo sapiens
193820 FLWPKEVEL 19 27 Leucine-rich repeat- Leucine-rich repeat- Homo sapiens containing protein 16C containing protein 16C
193821 FLYAGHIFL 73 81 DDB1 - and CUL4-associated DDB1- and CUL4-associated Homo sapiens factor 15 factor 15
193822 FLYDDNQRV 327 335 DNA topoisomerase 2-alpha DNA topoisomerase 2-alpha Homo sapiens
193823 FLYDTHQNL 1215 1223 1-phosphatidylinositol 4,5- 1-phosphatidylinositol 4,5- Homo sapiens bisphosphate bisphosphate
phosphodiesterase gamma-2 phosphodiesterase gamma-2
193824 FLYFEDHGL 41 1 419 WD repeat-containing protein WD repeat-containing protein Homo sapiens
41 41
193825 FLYQRLVVGA 208 217 Cation-dependent mannose- Cation-dependent mannose- Homo sapiens
6-phosphate receptor 6-phosphate receptor
193826 FMDPQKMPYL 206 215 Alpha-ketogluta rate- Alpha-ketoglutarate- Homo sapiens dependent dioxygenase FTO dependent dioxygenase FTO
193827 FMFDEKLVTV 224 233 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 6 catalytic phosphatase 6 catalytic
subunit subunit
193828 FMFGQKLNV 443 451 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein L ribonucleoprotein L
193829 FMIDASVHPTL 326 336 Vacuolar fusion protein Vacuolar fusion protein Homo sapiens
CCZ1 homolog CCZ1 homolog
193830 FMLETVDSVKL 112 122 Proline synthase co- Proline synthase co- Homo sapiens transcribed bacterial transcribed bacterial
homolog protein homolog protein
193831 FMMPRIVNV 208 216 MAX gene-associated MAX gene-associated Homo sapiens protein protein
193832 FMNDAIEKA 195 203 U4/U6 small nuclear U4/U6 small nuclear Homo sapiens ribonucleoprotein Prp3 ribonucleoprotein Prp3
193833 FMVDRLESL 183 191 Maspardin Maspardin Homo sapiens
193834 FTFNIKDIHSV 193 203 Multiple C2 and Multiple C2 and Homo sapiens transmembrane domain- transmembrane domain- containing protein 1 containing protein 1
193835 FVDERPEEV 83 91 BUD13 homolog BUD13 homolog Homo sapiens
193836 FVDGLTFKV 35 43 Putative helicase MOV-10 Putative helicase MOV-10 Homo sapiens
193837 FVLATGDFV 287 295 Envelope glycoprotein B Envelope glycoprotein B Herpes simplex virus (type 1 / strain 17)
193838 FVMEGEPPKL 72 81 Flap endonuclease GEN Flap endonuclease GEN Homo sapiens homolog 1 homolog 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
193840 GIFEDRAPV 184 192 Envelope glycoprotein B Envelope glycoprotein B Herpes simplex virus (type 1 / strain 17)
193841 GIFGGHIRSV 604 613 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 10 hydrolase 10
193842 GILSHINTV 199 207 Guanylate cyclase soluble Guanylate cyclase soluble Homo sapiens subunit beta-1 subunit beta-1
193843 GILTKELLHSV 103 113 Other Homo sapiens Myotu bularin-related protein Homo sapiens
(human) protein 6
193844 GLADKVYFL 445 453 CAD protein CAD protein Homo sapiens
193845 GLADNTVIAKV 112 122 Threonine-tRNA ligase, Threonine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
193846 GLAPHLEQI 464 472 lmportin-4 lmportin-4 Homo sapiens
193847 GLAPLEVRV 1451 1459 Filamin-B (UniProt:075369) Filamin-B Homo sapiens
193848 GLDDIKDLKV 451 460 Putative helicase MOV-10 Putative helicase MOV-10 Homo sapiens
193849 GLDHYVYKV 341 349 Probable helicase with zinc Probable helicase with zinc Homo sapiens finger domain finger domain
193850 GLDIDGIYRV 684 693 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 12 protein 12
193851 GLDPNKPPEL 188 197 Proline-rich protein 12 Proline-rich protein 12 Homo sapiens
193852 GLDPQGDRSFL 424 434 Protein LCHN Protein LCHN Homo sapiens
193853 GLDPSGARLV 189 198 WD repeat-containing protein WD repeat-containing protein Homo sapiens
70 70
193854 GLDRLNVTV 564 572 Hexokinase-1 Hexokinase-1 Homo sapiens
193855 GLDRNAPSV 229 237 Cleavage stimulation factor Cleavage stimulation factor Homo sapiens subunit 3 subunit 3
193856 GLDVDGIYRV 74 83 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 15 protein 15
193857 GLFDQHFRL 1238 1246 Nischarin Nischarin Homo sapiens
193858 GLFQGKTPL 53 61 Targeting protein for Xklp2 Targeting protein for Xklp2 Homo sapiens
193859 GLFSNDIPHV 21 30 WD repeat-containing protein WD repeat-containing protein Homo sapiens
36 36
193860 GLGPPGRSV 93 101 Protein SPT2 homolog Protein SPT2 homolog Homo sapiens
193861 GLGPTFKL 494 501 Bardet-Biedl syndrome 1 Bardet-Biedl syndrome 1 Homo sapiens protein (UniProt:Q8NFJ9) protein
193862 GLHFWPSV 158 166 Transcription initiation factor Transcription initiation factor Homo sapiens
TFIID subunit 2 TFIID subunit 2
193863 GUDRQVTV 195 203 Microtubule-actin cross- Microtubule-actin cross- Homo sapiens linking factor 1 , isoforms linking factor 1 , isoforms
1/2/3/5 (UniProt:H3BQK9) 1/2/3/5
193864 GLIDVKPLGV 225 234 Ubiquitin-like domain- Ubiquitin-like domain- Homo sapiens containing CTD phosphatase containing CTD phosphatase
1 1
193865 GUEILKKV 91 99 Programmed cell death Programmed cell death Homo sapiens protein 5 (UniProt:014737) protein 5
193866 GLLAGDRLVEV 52 62 Na(+)/H(+) exchange Na(+)/H(+) exchange Homo sapiens regulatory cofactor NHE-RF1 regulatory cofactor NHE-RF1
193867 GLLENIPRV 685 693 Trifunctional purine Trifunctional purine Homo sapiens biosynthetic protein biosynthetic protein
adenosine-3 adenosine-3
193868 GLLETTVQKV 649 658 Horn s 1 Horn s 1 Homo sapiens
193869 GLLREQVAQL 315 324 Transcription factorjun-B Transcription factor jun-B Homo sapiens
193870 GLMDEKLLHNV 793 803 Microtubule-actin cross- Microtubule-actin cross- Homo sapiens linking factor 1 , isoforms linking factor 1 , isoforms
1/2/3/5 (UniProt:H3BQK9) 1/2/3/5
193871 GLMDNEIKV 362 370 Tumor necrosis factor Tumor necrosis factor Homo sapiens receptor superfamily member receptor superfamily member
10B 10B
193872 GLMDTVKKV 312 320 Glucocorticoid modulatory Glucocorticoid modulatory Homo sapiens element-binding protein 1 element-binding protein 1
193873 GLMGAGIAQV 144 153 Trifunctional enzyme subunit Trifunctional enzyme subunit Homo sapiens alpha, mitochondrial alpha, mitochondrial Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
193874 GLMKKAYEL 27 35 Myocyte-specific enhancer Myocyte-specific enhancer Homo sapiens factor 2D factor 2D
193875 GLMKYIGEV 110 118 Transient receptor potential Transient receptor potential Homo sapiens cation channel subfamily M cation channel subfamily M
member 8 (UniProt:Q7Z2W7) member 8
193876 GLMQEKIYI 395 403 DNA (cytosine-5)- DNA (cytosine-5)- Homo sapiens methyltransferase 1 methyltransferase 1
193877 GLNEEIARV 330 338 Kinetochore protein NDC80 Kinetochore protein NDC80 Homo sapiens homolog homolog
193878 GLPRFGIEMV 808 817 Zinc finger protein 106 Zinc finger protein 106 Homo sapiens
193879 GLQEGTHEL 170 178 Signal recognition particle Signal recognition particle Homo sapiens subunit SRP72 subunit SRP72
193880 GLRRVDDFKKA 225 235 Polymerase I and transcript Polymerase I and transcript Homo sapiens release factor release factor
193881 GLSNHIAAL 430 438 ATPase family AAA domain- ATPase family AAA domain- Homo sapiens containing protein 2 containing protein 2
193882 GLSTEGIYRV 1276 1285 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 35 protein 35
193883 GLTGQRLLGV 209 218 Probable RNA-binding Probable RNA-binding Homo sapiens protein 23 protein 23
193884 GLVDKLQAL 27 35 Anamorsin (UniProt:Q6FI81 ) Anamorsin Homo sapiens
193885 GLVGALMHV 465 473 Wiskott-Aldrich syndrome Wiskott-Aldrich syndrome Homo sapiens protein protein
193886 GLVGSLQEV 56 64 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 1 complex subunit 1
193887 GLWEDGRSTLL 433 443 Cyclic AMP-responsive Cyclic AMP-responsive Homo sapiens element-binding protein 3- element-binding protein 3- like protein 1 like protein 1
193888 GLWEEAYRV 410 418 Intraflagellar transport protein Intraflagellar transport protein Homo sapiens
172 homolog 172 homolog
193889 GLWGPEEEPHL 1324 1334 Protein PRRC2B Protein PRRC2B Homo sapiens
193890 GLWGPVHEL 327 335 TRPM8 channel-associated TRPM8 channel-associated Homo sapiens factor 1 factor 1
193891 GLWSGPLPRV 946 955 Ribonucleases P/MRP Ribonucleases P/MRP Homo sapiens protein subunit POP1 protein subunit POP1
193892 GLYDGPVHEV 337 346 Dihydropyrimidinase-related Dihydropyrimidinase-related Homo sapiens protein 4 (UniProt:Q5T0Q6) protein 4
193893 GLYDSQNPPTV 498 508 Formin-binding protein 1 Formin-binding protein 1 Homo sapiens
193894 GLYEFPLNKV 253 262 tRNA (adenine(58)-N(1 ))- tRNA (adenine(58)-N(1 ))- Homo sapiens methyltransferase non- methyltransferase non- catalytic subunit TRM6 catalytic subunit TRM6
193895 GMAERIPEL 310 318 Long-chain-fa tt -acid-CoA Long-chain-fa tty-acid-CoA Homo sapiens ligase 3 ligase 3
193896 GMYGKIAVMEL 56 66 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
193897 GMYIFLHTV 59 67 ORMMike protein 3 ORMMike protein 3 Homo sapiens
193899 GVAESIHLWEV 99 109 WD repeat-containing protein WD repeat-containing protein Homo sapiens
18 18
193900 GVAGGSILKGV 277 287 Putative eukaryotic Putative eukaryotic Homo sapiens translation initiation factor 2 translation initiation factor 2
subunit 3-like protein subunit 3-like protein
193903 HLAEALHQA 21 1 219 Chitinase domain-containing Chitinase domain-containing Homo sapiens protein 1 protein 1
193904 HLAEVLERV 291 299 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
BRE1A BRE1A
193905 HLAIKLEQV 425 433 Protein VPRBP Protein VPRBP Homo sapiens
193906 HLANIVERV 73 81 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIM22 TRIM22
193907 HLAVKVANQA 591 600 Arf-GAP with SH3 domain, Arf-GAP with SH3 domain, Homo sapiens
ANK repeat and PH domain- ANK repeat and PH domain- containing protein 3 containing protein 3
193908 HLDATKLLL 671 679 Tetratricopeptide repeat Tetratricopeptide repeat Homo sapiens protein 17 protein 17 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
193909 HLDPTEMEKV 728 737 Heat shock 70 kDa protein Heat shock 70 kDa protein Homo sapiens
4L 4L
193910 HLFDLTPAKV 91 100 Integrin-alpha FG-GAP Integrin-alpha FG-GAP Homo sapiens repeat-containing protein 2 repeat-containing protein 2
19391 1 HUDTNKIQL 1004 1013 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 10 protein 10
193912 HUHAPPEV 1431 1439 Phosphatidylinositol 4- Phosphatidylinositol 4- Homo sapiens phosphate 3-kinase C2 phosphate 3-kinase C2
domain-containing subunit domain-containing subunit
beta beta
193913 HLLEHSVEL 291 299 Focadhesin Focadhesin Homo sapiens
193914 HLLERVDQV 404 412 Ninein (UniProt:Q8N4C6) Ninein Homo sapiens
193915 HLLSKLISV 2078 2086 Protein furry homolog-like Protein furry homolog-like Homo sapiens
193916 HLMEIQVNGGTV 27 38 60S ribosomal protein L3 60S ribosomal protein L3 Homo sapiens
193917 HLSELNTKL 1695 1703 Golgin subfamily A member Golgin subfamily A member Homo sapiens
4 (UniProt:Q13439) 4
193918 HLTDITLKV 120 128 Lysine-tRNA ligase Lysine-tRNA ligase Homo sapiens
193920 HLWRGIVSI 466 474 Multiple C2 and Multiple C2 and Homo sapiens transmembrane domain- transmembrane domain- containing protein 1 containing protein 1
193921 HLYARQLTL 107 115 Protein syndesmos Protein syndesmos Homo sapiens
(UniProt:Q9BRJ7)
193922 HLYDIHVTV 348 356 Nucleoside diphosphate- Nucleoside diphosphate- Homo sapiens linked moiety X motif 19 linked moiety X motif 19
193923 HLYSEVKEV 435 443 Probable helicase senataxin Probable helicase senataxin Homo sapiens
193925 lAAQDLLLAV 33 42 lmportin-9 lmportin-9 Homo sapiens
193926 IALNEKLVNL 348 357 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit F initiation factor 3 subunit F
(UniProt:O00303)
193927 IIADMDKWTV 1050 1059 Folliculin-interacting protein 1 Folliculin-interacting protein 1 Homo sapiens
193928 IIAVSLAVNL 202 211 Solute carrier family 46 Solute carrier family 46 Homo sapiens member 3 member 3
193929 IILEEGKEILV 47 57 Cofilin-1 (UniProt:P23528) Cofilin-1 Homo sapiens
193930 IINFSLLLV 207 215 Olfactory receptor 4C15 Olfactory receptor 4C 15 Homo sapiens
193931 ILAAHVPTL 69 77 ATP synthase subunit delta, ATP synthase subunit delta, Homo sapiens mitochondrial mitochondrial
193932 ILAAVETRL 142 150 F-box only protein 28 F-box only protein 28 Homo sapiens
193933 ILAPWKEI 1071 1079 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
193934 ILDAGGHNV 736 744 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 1 ATPase regulatory subunit 1
193935 ILDAGGHNVTI 736 746 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 1 ATPase regulatory subunit 1
193936 ILDDSPKEI 76 84 F-box only protein 8 F-box only protein 8 Homo sapiens
(UniProt:Q9NRD0)
193937 ILDDTAKNLRV 1278 1288 Melanoma inhibitory activity Melanoma inhibitory activity Homo sapiens protein 3 protein 3
193938 ILDEAIYKV 55 63 IQ domain-containing protein IQ domain-containing protein Homo sapiens
D D
193939 ILDEHVQRV 508 516 Axin-1 Axin-1 Homo sapiens
193940 ILDEMSHKLRL 106 116 Dihydroxyacetone phosphate Dihydroxyacetone phosphate Homo sapiens acyltransferase acyltransferase
(UniProt:015228)
193941 ILDGNQLHI 379 387 Cold shock domain- Cold shock domain- Homo sapiens containing protein E1 containing protein E1
193942 ILDISEHTL 461 469 Protein DBF4 homolog A Protein DBF4 homolog A Homo sapiens
193943 ILDKIVQKV 151 159 F-box only protein 25 F-box only protein 25 Homo sapiens
193944 ILDSGIYRI 446 454 Hermansky-Pudlak Hermansky-Pudlak Homo sapiens syndrome 5 protein syndrome 5 protein
193945 ILDSRGNPTV 11 20 Gamma-enolase Gamma-enolase Homo sapiens
193946 ILEEGKEILV 48 57 Cofilin-1 (UniProt:P23528) Cofilin-1 Homo sapiens
193947 ILEKKVEKV 578 586 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens alpha alpha Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
193948 ILFGHENRV 320 328 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein subunit beta-5 protein subunit beta-5
193949 ILFNRVLGV 399 407 Cytosolic phospholipase A2 Cytosolic phospholipase A2 Homo sapiens
193950 ILGDRFSWNV 636 645 Translational activator GCN1 Translational activator GCN1 Homo sapiens
193951 ILHDDEVTV 15 23 Other Homo sapiens 60S acidic ribosomal protein Homo sapiens
(human) protein P1
193952 ILHDRLYYL 330 338 Prenylcysteine oxidase 1 Prenylcysteine oxidase 1 Homo sapiens
193953 ILHHKVYDL 29 37 Cytochrome b5 Cytochrome b5 Homo sapiens
193954 ILIEKEYLERV 347 357 Cullin-1 Cullin-1 Homo sapiens
193955 IUNDAGEVRL 143 153 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase kinase kinase kinase kinase kinase kinase kinase
1 1
193956 IURPLVSV 26 34 ATP-binding cassette subATP-binding cassette subHomo sapiens family B member 7, family B member 7,
mitochondrial mitochondrial
(UniProt:O75027)
193957 ILLDDHGHIRI 317 327 G protein-coupled receptor G protein-coupled receptor Homo sapiens kinase 6 kinase 6
193958 ILLDERGQIKL 148 158 Dual specificity mitogen- Dual specificity mitogen- Homo sapiens activated protein kinase activated protein kinase
kinase 7 kinase 7
193959 ILLDNDHYAM 337 346 Lon protease homolog 2, Lon protease homolog 2, Homo sapiens peroxisomal peroxisomal
193960 ILLDQTVRV 536 544 Protein virilizer homolog Protein virilizer homolog Homo sapiens
193961 ILLEHNYAL 58 66 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase SETD1A methyltransferase SETD1A
193962 ILLNNSGQIKL 153 163 Cyclin-dependent kinase 12 Cyclin-dependent kinase 12 Homo sapiens
193963 ILLPDNVHYV 271 280 Superkiller viralicidic activity Superkiller viralicidic activity Homo sapiens
2-like 2 2-like 2
193964 ILLPEPSIRSV 32 42 Beta-adrenergic receptor Beta-adrenergic receptor Homo sapiens kinase 1 kinase 1
193965 ILLPYVSKV 218 226 Endosomal/lysomomal Endosomal/lysomomal Homo sapiens potassium channel potassium channel
TMEM175 TMEM175
193966 ILLQGRLYL 48 56 GRAM domain-containing GRAM domain-containing Homo sapiens protein 1A (UniProt:Q96CP6) protein 1A
193967 ILLRDLPTL 81 89 Membrane protein FAM174B Membrane protein FAM174B Homo sapiens
193968 ILLSEPGLVKL 157 167 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase TA02 kinase TA02
193969 ILMEHIHKLKA 137 147 60S ribosomal protein L19 60S ribosomal protein L19 Homo sapiens
193970 ILMGVLKEV 271 279 Pre-mRNA-splicing factor Pre-mRNA-splicing factor Homo sapiens
ATP-dependent RNA ATP-dependent RNA
helicase DHX15 helicase DHX15
193971 ILMHHPPQV 145 153 BTB/POZ domain-containing BTB/POZ domain-containing Homo sapiens protein KCTD20 protein KCTD20
(UniProt:Q7Z5Y7)
193972 ILMIFSHQI 794 802 Cohesin subunit SA-2 Cohesin subunit SA-2 Homo sapiens
193973 ILNKQEFFV 67 75 Epidermal growth factor Epidermal growth factor Homo sapiens receptor substrate 15 receptor substrate 15
193974 ILNNKIPEA 696 704 Spatacsin Spatacsin Homo sapiens
193975 ILQDRLNQV 354 362 Cell division control protein 6 Cell division control protein 6 Homo sapiens homolog homolog
193976 ILQEKLQEI 1235 1243 AT-rich interactive domain- AT-rich interactive domain- Homo sapiens containing protein 4B containing protein 4B
193977 ILQEREYRL 366 374 Transcription activator BRG1 Transcription activator BRG1 Homo sapiens
193978 ILQNKIDLV 187 195 Putative eukaryotic Putative eukaryotic Homo sapiens translation initiation factor 2 translation initiation factor 2
subunit 3-like protein subunit 3-like protein
193979 ILQQHIATV 124 132 Ankyrin repeat and SOCS Ankyrin repeat and SOCS Homo sapiens box protein 3 box protein 3
193980 ILQSTRLPLI 654 663 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
193981 ILSEVQQAV 712 720 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 1 polymerase 1
193982 ILSGVIRSV 14 22 Syntaxin-binding protein 2 Syntaxin-binding protein 2 Homo sapiens
193983 ILTEAIKAA 442 450 Ribonucleases P/MRP Ribonucleases P/MRP Homo sapiens protein subunit POP1 protein subunit POP1
193984 ILTESEIKL 86 94 Translin-associated protein X Translin-associated protein X Homo sapiens
193985 ILTNVVPKM 316 324 Phosphotriesterase-related Phosphotriesterase-related Homo sapiens protein protein
193986 ILWDLDHLTHV 143 153 WD repeat- and FYVE WD repeat- and FYVE Homo sapiens domain-containing protein 4 domain-containing protein 4
(UniProt:Q6ZS81 )
193987 ILYDKLEKI 186 194 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta
193988 ILYEHQLGQA 2521 2530 Protein PRRC2C Protein PRRC2C Homo sapiens
193989 ILYGEVEKL 158 166 Methionine Methionine Homo sapiens adenosyltransferase 2 adenosyltransferase 2
subunit beta subunit beta
(UniProt:Q9NZL9)
193990 ILYGKIIHL 58 66 Chromosome transmission Chromosome transmission Homo sapiens fidelity protein 8 homolog fidelity protein 8 homolog
193991 IMAQLPQEQKA 672 682 Catenin alpha-1 Catenin alpha-1 Homo sapiens
193992 IMDDKSLNI 1079 1087 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
193993 IMLSEKHUSV 359 369 SH3KBP1 -binding protein 1 SH3KBP1-binding protein 1 Homo sapiens
(UniProt:Q8TBC3)
193994 IQDITQRL 83 90 Moesin Moesin Homo sapiens
193995 ITAKQLETL 141 149 LIM/homeobox protein Lhx4 LIM/homeobox protein Lhx4 Homo sapiens
193997 ITDDLHFYV 665 673 Staphylococcal nuclease Staphylococcal nuclease Homo sapiens domain-containing protein 1 domain-containing protein 1
193998 IVDKTASFV 52 60 Splicing factor 3A subunit 1 Splicing factor 3A subunit 1 Homo sapiens
(UniProt:Q15459)
193999 IVLPAGALHQV 2458 2468 Probable JmjC domain- Probable JmjC domain- Homo sapiens containing histone containing histone
demethylation protein 2C demethylation protein 2C
194000 IVMEHVVFL 796 804 Anoctamin-5 Anoctamin-5 Homo sapiens
194002 KIADFGWSV 174 182 Aurora kinase B Aurora kinase B Homo sapiens
194003 KIFDEILVNA 83 92 DNA topoisomerase 2-alpha DNA topoisomerase 2-alpha Homo sapiens
194004 KIFSGVFVKV 114 123 60S ribosomal protein L7-like 60S ribosomal protein L7-like Homo sapiens
1 1
194005 KIFTEDLPEV 471 480 Vam6/Vps39-like protein Vam6/Vps39-like protein Homo sapiens
194006 KIGDFGLATV 483 492 RAF proto-oncogene RAF proto-oncogene Homo sapiens serine/threonine-protein serine/threonine-protein
kinase kinase
194007 KIIDFIYTA 105 113 Kelch-like protein 9 Kelch-like protein 9 Homo sapiens
194008 KILDLETQL 743 751 Outer dense fiber protein 2 Outer dense fiber protein 2 Homo sapiens
(UniProt:Q5BJF6)
194009 KILDYEVTL 362 370 lnterleukin-6 receptor subunit lnterleukin-6 receptor subunit Homo sapiens beta beta
194010 KILEDVVGV 326 334 Targeting protein for Xklp2 Targeting protein for Xklp2 Homo sapiens
19401 1 KILEELQKV 748 756 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 17 containing protein 17
(UniProt:075179)
194012 KILNGKGILPT 132 142 Ataxin-7-like protein 1 Ataxin-7-like protein 1 Homo sapiens
(UniProt:Q9ULK2)
194013 KILQELPSV 117 125 Protein IWS1 homolog Protein IWS1 homolog Homo sapiens
194014 KILSELFTV 105 113 G2/M phase-specific E3 G2/M phase-specific E3 Homo sapiens ubiquitin-protein ligase ubiquitin-protein ligase
194015 KIMDQVQQA 1462 1470 Adenomatous polyposis coli Adenomatous polyposis coli Homo sapiens protein protein
194016 KIMEKIRNV 61 1 619 Schlafen family member 13 Schlafen family member 13 Homo sapiens
194017 KIMESLPQI 3877 3885 Nesprin-2 Nesprin-2 Homo sapiens
(UniProt:Q8WXH0)
194018 KIMTEKELLAV 76 86 Flotillin-2 Flotillin-2 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194054 KUPQLPTL 115 123 Ras-related GTP-binding Ras-related GTP-binding Homo sapiens protein C protein C
194055 KUQNVFEI 274 282 Exocyst complex component Exocyst complex component Homo sapiens
5 5
194056 KLLAVIHEL 649 657 DNA repair and DNA repair and Homo sapiens recombination protein recombination protein
RAD54B RAD54B
194058 KLLDIRSYL 204 212 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 7 ATPase regulatory subunit 7
194059 KLLDISELDMV 255 265 Negative elongation factor A Negative elongation factor A Homo sapiens
194061 KLLDLMPRL 154 162 Integrator complex subunit 4 Integrator complex subunit 4 Homo sapiens
194062 KLLDLQVRV 568 576 Nesprin-3 Nesprin-3 Homo sapiens
194063 KLLDLSDSTSV 1093 1103 Rho-associated protein Rho-associated protein Homo sapiens kinase 1 kinase 1
194064 KLLDQMPSL 297 305 E3 ISG15--protein ligase E3 ISG15— protein ligase Homo sapiens
HERC5 HERC5
194065 KLLDWHPA 67 75 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta
194066 KLLEATSAV 69 77 Renal cancer differentiation Renal cancer differentiation Homo sapiens gene 1 protein gene 1 protein
194067 KLLEEQGIFL 3242 3251 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
194068 KLLEIDIDGV 1034 1043 DNA polymerase alpha DNA polymerase alpha Homo sapiens catalytic subunit catalytic subunit
194069 KLLEKAFSI 117 125 25-hydroxycholesterol 7- 25-hydroxycholesterol 7- Homo sapiens alpha-hydroxylase alpha-hydroxylase
194070 KLLELDPEHQRA 230 241 Prolyl 4-hydroxylase subunit Prolyl 4-hydroxylase subunit Homo sapiens alpha-1 alpha-1
194071 KLLELEKHIRV 315 325 3-keto-steroid reductase 3-keto-steroid reductase Homo sapiens
(UniProt:P56937)
194072 KLLEPVPVSV 69 78 Archaemetzincin-2 Homo sapiens
194073 KLLERLPEA 269 277 DNA polymerase zeta DNA polymerase zeta Homo sapiens catalytic subunit catalytic subunit
194074 KLLERVSAI 72 80 Negative elongation factor B Negative elongation factor B Homo sapiens
194075 KLLEVQPQV 684 692 EH domain-binding protein 1 EH domain-binding protein 1 Homo sapiens
194076 KLLEVYEQL 350 358 FYVE, RhoGEF and PH FYVE, RhoGEF and PH Homo sapiens domain-containing protein 3 domain-containing protein 3
194077 KLLEYIEEI 233 241 Hyaluronan mediated motility Hyaluronan mediated motility Homo sapiens receptor receptor
194078 KLLGYDVHV 217 225 Caspase-2 Caspase-2 Homo sapiens
194079 KLLKDLPEL 80 88 Programmed cell death Programmed cell death Homo sapiens protein 4 protein 4
194080 KLLTEVHAA 642 650 Disintegrin and Disintegrin and Homo sapiens metalloproteinase domain- metalloproteinase domain- containing protein 8 containing protein 8
194081 KLMDEVAGI 252 260 Cytosolic acyl coenzyme A Cytosolic acyl coenzyme A Homo sapiens thioester hydrolase thioester hydrolase
194082 KLMDHIYAV 336 344 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 5 complex subunit 5
194083 KLMDKVVRL 61 69 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
CBL CBL
194084 KLMDLDVEQL 117 126 Proliferating cell nuclear Proliferating cell nuclear Homo sapiens antigen antigen
194085 KLMDQLEAL 63 71 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein VTA1 associated protein VTA1
homolog homolog
194086 KLNPQQFEV 289 297 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- diphosphooligosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit STT3A subunit STT3A
194087 KLPEKWESV 240 248 Ribosomal L1 domain- Ribosomal L1 domain- Homo sapiens containing protein 1 containing protein 1
(UniProt:A5YKK6) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194124 KVMDEVEKA 153 161 Putative RNA-binding protein Putative RNA-binding protein Homo sapiens
Luc7-like 2 Luc7-like 2
194125 KVMELLVHL 57 65 Proteasome-associated Proteasome-associated Homo sapiens protein ECM29 homolog protein ECM29 homolog
194127 KVVLTQANKLGV 1170 1181 Protein transport protein Protein transport protein Homo sapiens
Sec31A (UniProt:094979) Sec31A
194128 LADETLLKV 184 192 Lamin-B1 Lamin-B1 Homo sapiens
194130 LIEECGGLEKI 212 222 Importin subunit alpha-3 Importin subunit alpha-3 Homo sapiens
194131 LIGQVHEV 30 37 Protein furry homolog Protein furry homolog Homo sapiens
194132 LIRGPAETEAT 240 250 Twinfilin-1 Twinfilin-1 Homo sapiens
194133 LLAAWTARA 9 17 Amyloid beta A4 protein Amyloid beta A4 protein Homo sapiens
194134 LLADLLHNV 142 150 DNA fragmentation factor DNA fragmentation factor Homo sapiens subunit beta subunit beta
194135 LLADRSWLL 700 708 Uncharacterized protein Uncharacterized protein Homo sapiens
C1 orf1 12 C1 orf1 12
194136 LLAEAKYYL 108 116 BTB/POZ domain-containing BTB/POZ domain-containing Homo sapiens adapterfor CUL3-mediated adapterfor CUL3-mediated
RhoA degradation protein 3 RhoA degradation protein 3
(UniProt:Q9H3F6)
194137 LLAEKIYKI 67 75 CREB-binding protein CREB-binding protein Homo sapiens
194138 LLAETHYQL 243 251 Nuclear autoantigenic sperm Nuclear autoantigenic sperm Homo sapiens protein (UniProt:Q5T624) protein
194139 LLAILPEAARA 156 166 SCAN domain-containing SCAN domain-containing Homo sapiens protein 1 protein 1
194140 LLAKEVQLV 52 60 Ectopic P granules protein 5 Ectopic P granules protein 5 Homo sapiens homolog homolog
194141 LLAPRPVAV 103 111 Cyclin-dependent kinase Cyclin-dependent kinase Homo sapiens inhibitor 1C inhibitor 1C
194142 LLDATQHTL 97 105 Arf-GAP with coiled-coil, Arf-GAP with coiled-coil, Homo sapiens
ANK repeat and PH domain- ANK repeat and PH domain- containing protein 1 containing protein 1
194143 LLDEEISRV 44 52 Protein quaking Protein quaking Homo sapiens
194144 LLDIIKSTV 234 242 Polyphosphoinositide Polyphosphoinositide Homo sapiens phosphatase phosphatase
194145 LLDKKIGV 219 226 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens beta (UniProt:P78371) beta
194146 LLDPNVKSIFV 233 243 ERI1 exoribonuclease 3 ERI1 exoribonuclease 3 Homo sapiens
194147 LLDQTKTLA 1761 1769 Talin-1 Talin-1 Homo sapiens
194148 LLDRFLATV 72 80 Other Homo sapiens Homo sapiens
(human) protein
194149 LLDSQSHHL 1039 1047 Uncharacterized protein Uncharacterized protein Homo sapiens
C15orf39 C15orf39
194150 LLDVTPKAV 821 829 Tight junction protein ZO-2 Tightjunction protein ZO-2 Homo sapiens
194151 LLFDKFNAV 8 16 Exocyst complex component Exocyst complex component Homo sapiens
4 4
194152 LLFDRPMHV 268 276 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein M ribonucleoprotein M
(UniProt:P52272)
194153 LLFEGEKITI 11 20 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit polymerase II subunit
RPB1 1 -b2 (UniProt:Q9H1A7) RPB11 -b2
194154 LLFEGIARI 274 282 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 4 complex subunit 4
(UniProt:Q9H9E3)
194155 LLFSGNIQEA 529 538 Intraflagellar transport protein Intraflagellar transport protein Homo sapiens
80 homolog 80 homolog
194156 LLGPPPVGV 58 66 Cip1 -interacting zinc finger Cip1 -interacting zinc finger Homo sapiens protein protein
194157 LLGRVYDV 59 66 Neuferricin Neuferricin Homo sapiens
194158 LLIASGANLLA 155 165 Protein phosphatase 1 Protein phosphatase 1 Homo sapiens regulatory subunit 16A regulatory subunit 16A
194159 LUDDKGTIKL 134 144 Cyclin-dependent kinase 1 Cyclin-dependent kinase 1 Homo sapiens
(UniProt:P06493)
6(UniProt:Q8TAG9) 6 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194191 LMLAGGQITGL 10 20 POU domain, class 2, POU domain, class 2, Homo sapiens transcription factor 1 transcription factor 1
(UniProt:P14859)
194192 LMQTEVHHV 109 117 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 18 exchange factor 18
194193 LMVDHVTEV 183 191 Steroid receptor RNA Steroid receptor RNA Homo sapiens activator 1 activator 1
194195 LTAAQLLDTL 814 823 Protein FAM83H Protein FAM83H Homo sapiens
194196 LVIDVIHEV 116 124 Arginyl aminopeptidase-like 1 Arginyl aminopeptidase-like 1 Homo sapiens
194197 LVKGHAYSI 255 263 Calpain-12 Calpain-12 Homo sapiens
194198 LVQPRVEFIL 789 798 Importin subunit beta-1 Importin subunit beta-1 Homo sapiens
194199 LVRPGTAL 1163 1170 Desmoplakin Desmoplakin Homo sapiens
194200 LVRPGTALEL 1163 1172 Desmoplakin Desmoplakin Homo sapiens
194201 LWRHQLLKT 54 63 Cytochrome c oxidase Cytochrome c oxidase Homo sapiens subunit 7C, mitochondrial subunit 7C, mitochondrial
194203 MAELKGYNL 565 573 Dynein heavy chain 3, Dynein heavy chain 3, Homo sapiens axonemal axonemal
194204 MLANDIARL 385 393 EH domain-containing EH domain-containing Homo sapiens protein 1 protein 1
194205 MLATRVFSL 1 9 Cytochrome c oxidase Cytochrome c oxidase Homo sapiens subunit 4 isoform 1 , subunit 4 isoform 1 ,
mitochondrial mitochondrial
(UniProt:P13073)
194206 MLFGHPLLV 61 1 619 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 11 hydrolase 1 1
194207 MLKEAHIEL 452 460 Ethanolamine-phosphate Ethanolamine-phosphate Homo sapiens phospho-lyase phospho-lyase
194208 MLLDTVQKV 504 512 Condensin-2 complex Condensin-2 complex Homo sapiens subunit G2 subunit G2
194209 MLLEGLREL 137 145 Protein UXT Protein UXT Homo sapiens
194210 MLLEKLPQV 18 26 Flotillin-1 (UniProt:075955) Flotillin-1 Homo sapiens
19421 1 MLNEHDFEV 219 227 Breast cancer type 1 Breast cancer type 1 Homo sapiens susceptibility protein susceptibility protein
(UniProt:P38398)
194212 MLQDSIHW 330 338 Origin recognition complex Origin recognition complex Homo sapiens subunit 2 subunit 2
194213 MLQEKLKEL 212 220 Trafficking kinesin-binding Trafficking kinesin-binding Homo sapiens protein 2 protein 2
194218 NILEKGGDPL 514 523 Protein SCAF1 1 Protein SCAF1 1 Homo sapiens
194219 NIVEKLREV 75 83 Tripartite motif-containing Tripartite motif-containing Homo sapiens protein 5 protein 5
194220 NIVERVKEV 76 84 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIM22 TRIM22
194221 NLAEKLIGV 190 198 Ral GTPase-activating Ral GTPase-activating Homo sapiens protein subunit beta protein subunit beta
(UniProt:Q86X10)
194222 NLAEVVERV 24 32 F-box only protein 22 F-box only protein 22 Homo sapiens
194223 NLASRIPAA 2227 2235 Serine/arginine repetitive Serine/arginine repetitive Homo sapiens matrix protein 2 matrix protein 2
194224 NLFNRYPAL 369 377 Plastin-2 Plastin-2 Homo sapiens
194225 NLLEIAPHL 146 154 Glycerol-3-phosphate Glycerol-3-phosphate Homo sapiens dehydrogenase, dehydrogenase,
mitochondrial mitochondrial
194226 NLLSFTYKL 210 218 Centromere protein O Centromere protein O Homo sapiens
194227 NLLTTPKFT 343 351 Envelope glycoprotein B Envelope glycoprotein B Herpes simplex virus (type 1 / strain 17)
194228 NLMDDIERA 383 391 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens theta theta
194229 NLVEKTPAL 7 15 ATP synthase subunit g, ATP synthase subunit g, Homo sapiens mitochondrial mitochondrial
194230 NMLGGKYQGTIL 454 465 Desmoglein-1 Desmoglein-1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194278 RLLDYVVNI 662 670 KN motif and ankyrin repeat KN motif and ankyrin repeat Homo sapiens domain-containing protein 2 domain-containing protein 2
194279 RLLEEGVLRQI 630 640 Pyridoxal-dependent Pyridoxal-dependent Homo sapiens decarboxylase domain- decarboxylase domain- containing protein 1 containing protein 1
194280 RLLEGYEIYV 105 114 Mediator of DNA damage Mediator of DNA damage Homo sapiens checkpoint protein 1 checkpoint protein 1
(UniProt:Q14676)
194281 RLLEIDPYL 30 38 1 ,4-alpha-glucan-branching 1 ,4-alpha-glucan-branching Homo sapiens enzyme enzyme
194282 RLLEQKVEL 207 215 Pinin Pinin Homo sapiens
194283 RLLEQLQEI 400 408 GRIP1-associated protein 1 GRIP1-associated protein 1 Homo sapiens
194284 RLLEWTSI 277 285 ADP-dependent glucokinase ADP-dependent glucokinase Homo sapiens
(UniProt:Q9BRR6)
194285 RLLQEQHQL 4648 4656 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF213 RNF213
194286 RLMGSILGV 1804 1812 Thyroid receptor-interacting Thyroid receptor-interacting Homo sapiens protein 11 protein 1 1
194287 RLMNLPLHSV 395 404 Protein Niban Protein Niban Homo sapiens
194288 RLNEKNYEL 382 390 V-type proton ATPase V-type proton ATPase Homo sapiens subunit H subunit H
194289 RLQDAIAKV 639 647 Cytospin-A Cytospin-A Homo sapiens
194290 RLQEDPPAGV 15 24 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 A enzyme E2 A
194291 RLQEDPPVGV 15 24 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 B enzyme E2 B
194292 RLQEEINEV 121 129 Inhibitor of nuclear factor Inhibitor of nuclear factor Homo sapiens kappa-B kinase-interacting kappa-B kinase-interacting
protein protein
194293 RLQESVMEA 450 458 Double-strand-break repair Double-strand-break repair Homo sapiens protein rad21 homolog protein rad21 homolog
194294 RLSDVQIYV 109 117 Interferon-induced protein Interferon-induced protein Homo sapiens with tetratricopeptide repeats with tetratricopeptide repeats
2 2
194295 RLSELGITQA 632 641 SHC SH2 domain-binding SHC SH2 domain-binding Homo sapiens protein 1 protein 1
194296 RLTDYISKV 178 186 PRA1 family protein 3 PRA1 family protein 3 Homo sapiens
194297 RLTPKLMEV 168 176 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit H initiation factor 3 subunit H
194298 RLVEIQYEL 218 226 ARF GTPase-activating ARF GTPase-activating Homo sapiens protein GIT2 protein GIT2
(UniProt:Q14161)
194299 RLVQGSILKKV 5 15 Proliferating cell nuclear Proliferating cell nuclear Homo sapiens antigen antigen
194300 RLWNETVEL 15 23 DEP domain-containing DEP domain-containing Homo sapiens protein 1 B protein 1 B
194301 RLYDGLFKV 133 141 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
194302 RLYDPASGTISL 542 553 ATP-binding cassette subATP-binding cassette subHomo sapiens family B member 10, family B member 10,
mitochondrial mitochondrial
194303 RMFDGKFVV 392 400 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase Kist kinase Kist
194304 RMFDGKFVVA 392 401 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase Kist kinase Kist
194305 RMLDSVEKL 523 531 Nck-associated protein 1-like Nck-associated protein Mike Homo sapiens
194309 RVITEEEKNFKA 167 178 60S ribosomal protein L13 60S ribosomal protein L13 Homo sapiens
194310 RVLEVGALQAV 125 135 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA1 polymerase I subunit RPA1
19431 1 RVLPPSALQSV 360 370 Aurora kinase B Aurora kinase B Homo sapiens
194312 RVPPPPQSV 469 477 SHC-transforming protein 1 SHC-transforming protein 1 Homo sapiens
(UniProt:P29353)
194313 RVVGPISGADL 867 877 Desmoglein-1 Desmoglein-1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194314 SIIQRLLEV 11 19 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase PP1-gamma phosphatase PP1-gamma
catalytic subunit catalytic subunit
194315 SILRHVAEV 110 118 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 2 subunit 1 initiation factor 2 subunit 1
194316 SLADLYFRA 242 250 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 7 complex subunit 7
194317 SI-ADVHIEV 314 322 TATA-binding protein- TATA-binding protein- Homo sapiens associated factor 172 associated factor 172
194318 SLAEGLRTV 247 255 2'-5'-oligoadenylate synthase 2'-5'-oligoadenylate synthase Homo sapiens
3 3
194319 SLAEGRLYL 400 408 LisH domain-containing LisH domain-containing Homo sapiens protein ARMC9 protein ARMC9
194320 SLAEKIQAL 353 361 Ankyrin repeat and SOCS Ankyrin repeat and SOCS Homo sapiens box protein 6 box protein 6
194321 SLAELKGFEV 964 973 DNA polymerase epsilon DNA polymerase epsilon Homo sapiens catalytic subunit A catalytic subunit A
194322 SI-AELVHAV 195 203 Sestrin-1 Sestrin-1 Homo sapiens
194323 SLAETDKITL 500 509 V-type proton ATPase V-type proton ATPase Homo sapiens catalytic subunit A catalytic subunit A
194324 SI-AHELWKV 1150 1158 Trinucleotide repeat- Trinucleotide repeat- Homo sapiens containing gene 6A protein containing gene 6A protein
194325 SLANETHQL 146 154 TNFAIP3-interacting protein TNFAIP3-interacting protein Homo sapiens
2 (UniProt:Q8NFZ5) 2
194326 SLAPIIVHV 326 334 Voltage-dependent L-type Voltage-dependent L-type Homo sapiens calcium channel subunit calcium channel subunit
beta-4 (UniProt:O00305) beta-4
194327 SLAQYNPKL 190 198 Phosphatidylinositol 3-kinase Phosphatidylinositol 3-kinase Homo sapiens regulatory subunit gamma regulatory subunit gamma
(UniProt:F6TDL0)
194328 SI-ASIHVPL 458 466 ADP-ribosylation factor- ADP-ribosylation factor- Homo sapiens binding protein GGA3 binding protein GGA3
194329 SI-ASLLAKV 1258 1266 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 6 containing protein 6
194330 SI-ATSLPRL 380 388 TEL02-interacting protein 1 TEL02-interacting protein 1 Homo sapiens homolog homolog
194331 SLDESGEHMGV 91 101 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 41 associated protein 41
homolog homolog
194332 SLDNRINEV 1103 1111 ATP-binding cassette subATP-binding cassette subHomo sapiens family A member 10 family A member 10
194333 SLDSTLHAV 37 45 Leucine-rich repeat and Leucine-rich repeat and Homo sapiens coiled-coil domain-containing coiled-coil domain-containing protein 1 protein 1
194334 SLFAGGMLRV 130 139 Transmembrane emp24 Transmembrane emp24 Homo sapiens domain-containing protein 9 domain-containing protein 9
194335 SLFDLDGPKV 136 145 PHD finger protein 23 PHD finger protein 23 Homo sapiens
(UniProt:Q9BUL5)
194336 SLFEKGLKNV 73 82 F-box/LRR-repeat protein 5 F-box/LRR-repeat protein 5 Homo sapiens
194337 SLFERLVKV 1054 1062 NFX1 -type zinc finger- NFX1 -type zinc finger- Homo sapiens containing protein 1 containing protein 1
194338 SLFGGSVKL 103 111 Programmed cell death 6- Programmed cell death 6- Homo sapiens interacting protein interacting protein
194339 SLFPHNPQFI 265 274 Ribosome production factor 1 Ribosome production factor 1 Homo sapiens
194340 SLFQSRISL 178 186 F-BAR and double SH3 F-BAR and double SH3 Homo sapiens domains protein 2 domains protein 2
194341 SLFRVITEV 468 476 Exostosin-2 Exostosin-2 Homo sapiens
194342 SLGKVFGV 1228 1235 Bloom syndrome protein Bloom syndrome protein Homo sapiens
194343 SLGRFEITV 287 295 AP-3 complex subunit mu-2 AP-3 complex subunit mu-2 Homo sapiens
194344 SLGSALRPST 39 48 Vimentin Vimentin Homo sapiens
194345 SUAGVIRV 29 37 TBC1 domain family member TBC1 domain family member Homo sapiens
17 17 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194346 SUDKTTAA 48 56 U1 small nuclear U1 small nuclear Homo sapiens ribonucleoprotein C ribonucleoprotein C
194347 SUEKIPTA 632 640 RNA-binding protein 25 RNA-binding protein 25 Homo sapiens
194348 SUEKLWQT 374 382 Transcription factor RFX3 Transcription factor RFX3 Homo sapiens
194349 SUEKYFSV 490 498 Importin subunit alpha-1 Importin subunit alpha-1 Homo sapiens
194350 SUGNLHLA 569 577 RNA polymerase-associated RNA polymerase-associated Homo sapiens protein CTR9 homolog protein CTR9 homolog
194351 SUQRLMSV 1442 1450 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 34 hydrolase 34
194352 SLKNRIESV 469 477 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 11 A protein 1 1 A
194353 SLLDKIIGA 56 64 Polymerase I and transcript Polymerase I and transcript Homo sapiens release factor release factor
194354 SLLEDKGLAEV 170 180 Retinoid-inducible serine Retinoid-inducible serine Homo sapiens carboxypeptidase carboxypeptidase
194355 SLLEHLSHV 71 79 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 2-alpha initiation factor 2-alpha
kinase 1 kinase 1
194356 SLLEKELESV 157 166 Developmentally-regulated Developmentally-regulated Homo sapiens
GTP-binding protein 2 GTP-binding protein 2
194357 SLLEKQQIYL 484 493 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 18 exchange factor 18
194358 SLLENIAKA 1224 1232 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 12 II transcription subunit 12
194359 SLLENLEKI 196 204 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein C-like 1 ribonucleoprotein C-like 1
194360 SLLESVQKL 549 557 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ATR kinase ATR
194361 SLLGGDVVSVKL 23 34 TSC22 domain family protein TSC22 domain family protein Homo sapiens
3 3
194362 SLLKEPQKVQL 354 364 Neurochondrin Neurochondrin Homo sapiens
194363 SLLKRDFGA 520 528 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX5 RNA helicase DDX5
(UniProt:P17844)
194364 SLLPTEQPRL 210 219 Adrenocortical dysplasia Adrenocortical dysplasia Homo sapiens protein homolog protein homolog
194365 SLLQKQIML 793 801 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13B associated protein 13B
194366 SLLQTLYKV 579 587 Ran GTPase-activating Ran GTPase-activating Homo sapiens protein 1 protein 1
194367 SLLQTQHAL 156 164 Arfaptin-2 Arfaptin-2 Homo sapiens
194368 SLLRVGWSV 194 202 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein U-like ribonucleoprotein U-like
protein 2 protein 2
194369 SLLTSTVQV 215 223 Sp110 nuclear body protein Homo sapiens
194370 SLMEKISKL 230 238 Dynamin-binding protein Dynamin-binding protein Homo sapiens
194371 SLMEKVRNMAL 150 160 Other Homo sapiens Homo sapiens
(human) protein
194372 SLMGPWHEV 1754 1763 Pericentrin Pericentrin Homo sapiens
194373 SLNGLEVHL 578 586 Hermansky-Pudlak Hermansky-Pudlak Homo sapiens syndrome 4 protein syndrome 4 protein
194374 SLNKHVEAV 92 100 Small glutamine-rich Small glutamine-rich Homo sapiens tetratricopeptide repeat- tetratricopeptide repeat- containing protein alpha containing protein alpha
194375 SLPDHLPSV 86 94 Choline/ethanolamine kinase Choline/ethanolamine kinase Homo sapiens
194376 SLPDIKVYL 338 346 Regulator of G-protein Regulator of G-protein Homo sapiens signaling 14 signaling 14
194377 SLPKKLALL 72 80 Leydig cell tumor 10 kDa Leydig cell tumor 10 kDa Homo sapiens protein homolog protein homolog
194378 SLQDEIQRV 348 356 WD repeat-containing protein WD repeat-containing protein Homo sapiens
3 3
194379 SLQEKLWAI 59 67 Peroxisomal membrane Peroxisomal membrane Homo sapiens protein 4 protein 4 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194380 SLREACETV 115 123 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase kinase kinase 5 kinase kinase kinase 5
194381 SLSDKTPSV 543 551 HMG domain-containing HMG domain-containing Homo sapiens protein 3 protein 3
194382 SLSDTVEKL 114 122 Dynactin subunit 1 Dynactin subunit 1 Homo sapiens
(UniProt:Q14203)
194383 SLSFMNPRL 219 227 AP-3 complex subunit mu-1 AP-3 complex subunit mu-1 Homo sapiens
194384 SLSSFLHGV 696 704 Alsin Alsin Homo sapiens
194385 SLVENIERLKV 73 83 Tripartite motif-containing Tripartite motif-containing Homo sapiens protein 26 protein 26
194386 SLVNQVPKI 310 318 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit F initiation factor 3 subunit F
(UniProt:O00303)
194387 SLWANPKYV 215 223 Branched-chain-amino-acid Branched-chain-amino-acid Homo sapiens aminotransferase, cytosolic aminotransferase, cytosolic
194388 SLYDWNVKL 83 91 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 Q1 enzyme E2 Q1
194389 SLYEMVSRV 309 317 FACT complex subunit FACT complex subunit Homo sapiens
SSRP1 SSRP1
194390 SLYGYLRGA 281 289 Ribosome biogenesis protein Ribosome biogenesis protein Homo sapiens
BMS1 homolog BMS1 homolog
194391 SLYSQVHQI 1349 1357 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 12 II transcription subunit 12
194393 SMLDDLRNV 138 146 Integrin beta-2 Integrin beta-2 Homo sapiens
194394 SMLEDVQRA 53 61 RNA-binding protein 28 RNA-binding protein 28 Homo sapiens
194395 SMLNRILAV 1077 1085 Zinc finger MYM-type protein Zinc finger MYM-type protein Homo sapiens
3 3
194396 SMLQKTWLL 1333 1341 RNA polymerase II- RNA polymerase II- Homo sapiens associated protein 1 associated protein 1
194397 SMMDRMFAL 241 249 Isochorismatase domain- Isochorismatase domain- Homo sapiens containing protein 1 containing protein 1
194398 SMYDKVLML 144 152 General transcription factor General transcription factor Homo sapiens
3C polypeptide 5 3C polypeptide 5
194399 SVLGKIWKL 479 487 EH domain-containing EH domain-containing Homo sapiens protein 3 protein 3
194401 TLAAAVPKI 227 235 Huntingtin Huntingtin Homo sapiens
194402 TLADVLYHV 479 487 Set1/Ash2 histone Set1/Ash2 histone Homo sapiens methyltransferase complex methyltransferase complex
subunit ASH2 subunit ASH2
(UniProt:Q9UBL3)
194403 TLAEIAKVEL 31 40 Non-POU domain-containing Non-POU domain-containing Homo sapiens octamer-binding protein octamer-binding protein
194404 TLAQRVKEV 208 216 Ancient ubiquitous protein 1 Ancient ubiquitous protein 1 Homo sapiens
194405 TLDAGNIKL 170 178 Pre-mRNA-processing factor Pre-mRNA-processing factor Homo sapiens
40 homolog A 40 homolog A
194406 TLDDKKVYL 524 532 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 93 containing protein 93
194407 TLDEKIEKV 116 124 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX27 RNA helicase DDX27
194408 TLDEYTTRV 118 126 Nuclear respiratory factor 1 Nuclear respiratory factor 1 Homo sapiens
194409 TLDITPHTV 847 855 Fanconi anemia group D2 Fanconi anemia group D2 Homo sapiens protein protein
194410 TLFDYEVRL 57 65 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UHRF1 UHRF1
19441 1 TLFTKELVL 582 590 Staphylococcal nuclease Staphylococcal nuclease Homo sapiens domain-containing protein 1 domain-containing protein 1
194412 TLHRETFYL 157 165 G1/S-specific cyclin-E2 G1/S-specific cyclin-E2 Homo sapiens
194413 TUDLPGITKV 133 143 Dynamin-3 Dynamin-3 Homo sapiens
194414 TUEELKTL 254 262 Cyclic AMP-dependent Cyclic AMP-dependent Homo sapiens transcription factor ATF-1 transcription factor ATF-1
194415 TUTDGMRSV 348 357 Cleavage and Cleavage and Homo sapiens polyadenylation specificity polyadenylation specificity
factor subunit 1 factor subunit 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194416 TLLDRMVHL 495 503 Negative elongation factor Negative elongation factor Homo sapiens
C/D C/D
194417 TLLDSPYARV 1135 1144 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 5B protein 5B
194418 TLLEDGTFKV 23 32 NmrA-like family domain- NmrA-like family domain- Homo sapiens containing protein 1 containing protein 1
194419 TLLERAFSL 31 1 319 Tetratricopeptide repeat Tetratricopeptide repeat Homo sapiens protein 21 B protein 21 B
194420 TLLGHEFVL 544 552 Cell division cycle protein 27 Cell division cycle protein 27 Homo sapiens homolog homolog
194421 TLLGHLDYI 88 96 Coatomer subunit alpha Coatomer subunit alpha Homo sapiens
194422 TLUQVPRI 26 34 Protein kintoun Protein kintoun Homo sapiens
194423 TLLNVIKSV 2434 2442 Inositol 1 ,4,5-trisphosphate Inositol 1 ,4,5-trisphosphate Homo sapiens receptor type 1 receptor type 1
194424 TLLSNIQGV 327 335 Perilipin-2 Perilipin-2 Homo sapiens
194425 TLLVVVPKL 149 157 V-type proton ATPase V-type proton ATPase Homo sapiens subunit C 1 subunit C 1
194426 TLMERTVSL 254 262 Protein NOXP20 Protein NOXP20 Homo sapiens
194427 TLNDREYQL 565 573 CAD protein CAD protein Homo sapiens
194428 TLNEKLFLL 45 53 Short transient receptor Short transient receptor Homo sapiens potential channel 1 potential channel 1
194429 TLQEQLEKA 7 15 Pinin Pinin Homo sapiens
194430 TLQKEGVIGV 514 523 SUN domain-containing SUN domain-containing Homo sapiens protein 2 protein 2
194432 TLSERLWGL 43 51 Mitochondrial import receptor Mitochondrial import receptor Homo sapiens subunit TOM22 homolog subunit TOM22 homolog
194433 TLSFMNPRL 219 227 AP-3 complex subunit mu-2 AP-3 complex subunit mu-2 Homo sapiens
194434 TLVQSTLTLQL 159 169 Olfactory receptor 2G2 Olfactory receptor 2G2 Homo sapiens
194435 TLVYHVVGV 165 173 Splicing factor 3B subunit 3 Splicing factor 3B subunit 3 Homo sapiens
194436 TLYDIAHTPGV 54 64 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens mitochondrial mitochondrial
(UniProt:P40926)
194437 TLYEAVREV 9 17 60S ribosomal protein L10a 60S ribosomal protein L10a Homo sapiens
194438 TMAKESSIIGV 122 132 Quinone oxidoreductase Quinone oxidoreductase Homo sapiens
194439 TMVDRIEEV 1153 1161 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5A 5A
194440 TMYYKDVTV 162 170 Envelope glycoprotein B Envelope glycoprotein B Herpes simplex virus (type 1 / strain 17)
194444 TTGAGNPVGDKL 28 39 Catalase Catalase Homo sapiens
194445 TVADKIHSV 92 100 Dual specificity protein Dual specificity protein Homo sapiens phosphatase 14 phosphatase 14
194446 TVLGKIWKL 479 487 EH domain-containing EH domain-containing Homo sapiens protein 1 protein 1
194447 TVMDEIHTV 1088 1096 Cell division cycle and Cell division cycle and Homo sapiens apoptosis regulator protein 1 apoptosis regulator protein 1
194451 VIDKFGSDII 54 63 Acyloxyacyl hydrolase Acyloxyacyl hydrolase Homo sapiens
194452 VIIEKTYSL 381 389 Protein PAT1 homolog 1 Protein PAT1 homolog 1 Homo sapiens
194453 VIIPLLHTV 72 80 Phosphoinositide 3-kinase Phosphoinositide 3-kinase Homo sapiens regulatory subunit 6 regulatory subunit 6
194454 VILEGELERA 17 26 Tropomyosin alpha-4 chain Tropomyosin alpha-4 chain Homo sapiens
(UniProt:P67936)
194455 VIMDRAPSV 865 873 Zinc finger protein 106 Zinc finger protein 106 Homo sapiens
194456 VIMKSSPEV 26 34 Chromatin accessibility Chromatin accessibility Homo sapiens complex protein 1 complex protein 1
194457 VIWGKVTRA 69 77 60S ribosomal protein L35a 60S ribosomal protein L35a Homo sapiens
194458 VLADALKSI 6 14 40S ribosomal protein S15a 40S ribosomal protein S15a Homo sapiens
194459 VLADLKVQL 107 115 Prefoldin subunit 4 Prefoldin subunit 4 Homo sapiens
194460 VLADQEVRL 361 369 Regulator of G-protein Regulator of G-protein Homo sapiens signaling 14 signaling 14
194461 VLAEQLHQA 65 73 Neurobeachin-like protein 2 Neurobeachin-like protein 2 Homo sapiens
(UniProt:Q6ZNJ1 )
194462 VLAHTILGV 403 411 Ufm1 -specific protease 2 Ufm1 -specific protease 2 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194463 VLAPLPLHGV 74 83 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF130 RNF130
194464 VLDASVKEV 1001 1009 Calmodulin-regulated Calmodulin-regulated Homo sapiens spectrin-associated protein 1 spectrin-associated protein 1
194465 VLDNVKMNL 656 664 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 3 protein 3
194466 VLDSVDVRL 172 180 Carbohydrate Carbohydrate Homo sapiens sulfotransferase 14 sulfotransferase 14
194467 VLFEGRTVQL 592 601 Cytosolic carboxypeptidase 1 Cytosolic carboxypeptidase 1 Homo sapiens
194468 VLFGVETHV 206 214 Isochorismatase domain- Isochorismatase domain- Homo sapiens containing protein 1 containing protein 1
194469 VLFHNLPSL 42 50 Leukocyte surface antigen Leukocyte surface antigen Homo sapiens
CD53 CD53
194470 VLFNKLTYL 129 137 Rab GTPase-activating Rab GTPase-activating Homo sapiens protein 1-like protein Mike
(UniProt:Q5R372)
194471 VLFTGVKEV 197 205 Sorting nexin-5 Sorting nexin-5 Homo sapiens
(UniProt:Q9Y5X3)
194472 VLGGKAFLEHL 112 122 Centrosomal protein of 76 Centrosomal protein of 76 Homo sapiens kDa kDa
194473 VLHKELPEV 244 252 Monoglyceride lipase Monoglyceride lipase Homo sapiens
(UniProt:E7EWX8)
194474 VUDYQRNV 784 792 Exportin-1 (UniProt:O14980) Exportin-1 Homo sapiens
194475 VUGHSYGV 247 255 Abhydrolase domain- Abhydrolase domain- Homo sapiens containing protein 8 containing protein 8
194476 VUPKLPQL 134 142 ORMMike protein 3 ORMMike protein 3 Homo sapiens
194477 VLLDGIHRV 51 1 519 von Willebrand factor A von Willebrand factor A Homo sapiens domain-containing protein 8 domain-containing protein 8
194478 VLLDTANKKVFL 124 135 Asparagine synthetase Asparagine synthetase Homo sapiens
[glutamine-hydrolyzing] [glutamine-hydrolyzing]
194479 VLLELQQHL 488 496 Cyclic AMP-responsive Cyclic AMP-responsive Homo sapiens element-binding protein 3- element-binding protein 3- like protein 2 like protein 2
(UniProt:Q70SY1 )
194481 VLLGHIFYV 503 511 MAU2 chromatid cohesion MAU2 chromatid cohesion Homo sapiens factor homolog factor homolog
194482 VLLGKVYVV 404 412 Kelch-like protein 24 Kelch-like protein 24 Homo sapiens
194483 VLLKARLVPA 19 28 Protein FAM171 B Protein FAM171 B Homo sapiens
194484 VLLSDSNLHDA 98 108 Anamorsin (UniProt:Q6FI81 ) Anamorsin Homo sapiens
194485 VLLSIYPRV 520 528 Antigen peptide transporter 1 Antigen peptide transporter 1 Homo sapiens
194486 VLLSTIHEL 169 177 THO complex subunit 7 THO complex subunit 7 Homo sapiens homolog homolog
194487 VLLTGLHAV 66 74 Protein yippee-like 1 Protein yippee-like 1 Homo sapiens
194488 VLLTRLENV 72 80 Bromo adjacent homology Bromo adjacent homology Homo sapiens domain-containing 1 protein domain-containing 1 protein
194489 VLMDHILNL 302 310 Inhibitor of nuclear factor Inhibitor of nuclear factor Homo sapiens kappa-B kinase subunit kappa-B kinase subunit
alpha alpha
194490 VLMDRLPSL 1317 1325 Nucleolar pre-ribosomal- Nucleolar pre-ribosomal- Homo sapiens associated protein 1 associated protein 1
194491 VLMEKPDVV 130 138 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX56 RNA helicase DDX56
194492 VLMEMSYRL 666 674 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RFWD3 RFWD3
194493 VLMEYIRSL 325 333 Uncharacterized protein Uncharacterized protein Homo sapiens
C18orf8 C18orf8
194494 VLMKDVQEI 39 47 Protein LLP homolog Protein LLP homolog Homo sapiens
194495 VLMQDSRLYL 69 78 Cyclin-dependent kinase 1 Cyclin-dependent kinase 1 Homo sapiens
(UniProt:P06493)
194496 VLNEYFHNV 90 98 AP-2 complex subunit sigma AP-2 complex subunit sigma Homo sapiens
194497 VLNNWIHL 909 917 Huntingtin Huntingtin Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194498 VLQEKVPEI 290 298 Maestro heat-like repeat- Maestro heat-like repeat- Homo sapiens containing protein family containing protein family
member 1 member 1
194499 VLQGRLPAV 44 52 Transferrin receptor protein 2 Transferrin receptor protein 2 Homo sapiens
194500 VLQNLKGQYV 544 553 Nucleolar protein 9 Nucleolar protein 9 Homo sapiens
194501 VLQQHLETL 280 288 High mobility group protein High mobility group protein Homo sapiens
20A 20A
194502 VLSELAARL 2 10 Uncharacterized protein Uncharacterized protein Homo sapiens
CXorf38 CXorf38
194504 VLSPADKTNVKA 2 13 Hemoglobin subunit alpha Hemoglobin subunit alpha Homo sapiens
194505 VLSSRLAFA 2 10 HLA class II HLA class II Homo sapiens histocompatibility antigen, histocompatibility antigen,
DR beta 3 chain DR beta 3 chain
194506 VLTEFTREV 169 177 lmportin-9 lmportin-9 Homo sapiens
194507 VLTEHSEEL 196 204 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 7 exchange factor 7
194508 VLTSEVHSV 229 237 Protein asunder homolog Protein asunder homolog Homo sapiens
(UniProt:Q9NVM9)
194509 VLVDDDGIKVV 11 1 121 Transmembrane protein Homo sapiens
106C
194510 VLVDQTTGL 137 145 ELAV-like protein 1 ELAV-like protein 1 Homo sapiens
(UniProt:Q15717)
19451 1 VLVDRTIYI 25 33 Ribonuclease UK114 Ribonuclease UK1 14 Homo sapiens
194512 VLVEDSNNHHL 374 384 Zinc finger BED domain- Zinc finger BED domain- Homo sapiens containing protein 1 containing protein 1
194513 VLVESEHQV 1009 1017 Tyrosine-protein kinase JAK1 Tyrosine-protein kinase JAK1 Homo sapiens
194514 VLVPGHLQSV 98 107 POU domain, class 2, POU domain, class 2, Homo sapiens transcription factor 3 transcription factor 3
194515 VLWDRTFSL 300 308 Signal transducer and Signal transducer and Homo sapiens activator of transcription 1 - activator of transcription 1 - alpha/beta alpha/beta
194516 VLWGETVHL 197 205 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase kinase kinase 8 kinase kinase kinase 8
(UniProt:P41279)
194517 VLYDQPRHV 724 732 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 12 II transcription subunit 12
194518 VLYDRPLKI 239 247 Putative RNA-binding protein Putative RNA-binding protein Homo sapiens
15 15
194519 VLYEKDIQL 200 208 AKT-interacting protein AKT-interacting protein Homo sapiens
(UniProt:Q9H8T0)
194520 VLYENKVAV 605 613 WD repeat-containing protein WD repeat-containing protein Homo sapiens mio mio
194521 VLYGKLVEA 565 573 Werner syndrome ATP- Werner syndrome ATP- Homo sapiens dependent helicase dependent helicase
194522 VLYGPKIDRA 396 405 Intercellular adhesion Intercellular adhesion Homo sapiens molecule 3 (UniProt:P32942) molecule 3
194523 VLYHVETEV 13 21 Set1/Ash2 histone Set1/Ash2 histone Homo sapiens methyltransferase complex methyltransferase complex
subunit ASH2 subunit ASH2
(UniProt:H0YAQ0)
194524 VLYPHEPTAV 499 508 Protein downstream neighbor Protein downstream neighbor Homo sapiens of Son of Son
194525 VLYTGDFRL 131 139 Other Homo sapiens Protein artemis Homo sapiens
(human) protein
194526 VLYTGWRV 498 506 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 1 complex subunit 1
194527 VMFGGKQVVV 277 286 Adenosylhomocysteinase 2 Adenosylhomocysteinase 2 Homo sapiens
194528 VMFNGKVYL 358 366 Ligand-dependent nuclear Ligand-dependent nuclear Homo sapiens receptor-interacting factor 1 receptor-interacting factor 1
194529 VMFRTPLASV 319 328 F-box only protein 5 F-box only protein 5 Homo sapiens
194530 VMGKIFAV 201 208 Kelch-like protein 8 Kelch-like protein 8 Homo sapiens
(UniProt:Q9P2G9)
194531 VMIAGKVAVV 21 1 220 Adenosylhomocysteinase Adenosylhomocysteinase Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194532 VMLEYVERA 25 33 Cullin-2 Cullin-2 Homo sapiens
194533 VMYGKVYRI 55 63 DNA-directed RNA DNA-directed RNA Homo sapiens polymerases I, II, and III polymerases I, II, and III
subunit RPABC3 subunit RPABC3
(UniProt:P52434)
194536 VTLNKPQGL 91 99 RNA pseudouridylate RNA pseudouridylate Homo sapiens synthase domain-containing synthase domain-containing
protein 3 protein 3
194537 VTSLEKSU 538 546 Polycystic kidney disease Polycystic kidney disease Homo sapiens protein Mike 3 protein Mike 3
194538 WLAEKLPTL 887 895 Cytoskeleton-associated Cytoskeleton-associated Homo sapiens protein 5 protein 5
194539 WLEENVHEV 392 400 Transcription factor 25 Transcription factor 25 Homo sapiens
(UniProt:Q9BQ70)
194540 WUEDGKWTV 233 243 Nuclear migration protein Nuclear migration protein Homo sapiens nudC nudC
194541 WLVDHVYAI 450 458 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2A 65 kDa phosphatase 2A 65 kDa
regulatory subunit A alpha regulatory subunit A alpha
isoform isoform
194555 WQWEHIPPA 1281 1289 Major tegument protein Major tegument protein Human
gammaherpesviru s 4
194556 YALNHTLSV 245 253 POU domain class 2- POU domain class 2- Homo sapiens associating factor 1 associating factor 1
194557 YAYEKPHVV 3865 3873 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HERC1 ligase HERC1
194558 YGVKAGPGV 454 462 Phostensin Phostensin Homo sapiens
194559 YIAKITEGV 28 36 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 variant 3 enzyme E2 variant 3
194560 YIFDNVAKV 115 123 Reticulocalbin-1 Reticulocalbin-1 Homo sapiens
194561 YIMDNKLAQI 121 130 Helicase-like transcription Helicase-like transcription Homo sapiens factor factor
194562 YIMSYISRV 124 132 Unconventional myosin-le Unconventional myosin-le Homo sapiens
194563 YIWDRHYNI 358 366 F-box/WD repeat-containing F-box/WD repeat-containing Homo sapiens protein 5 protein 5
194564 YLADPAKFPEA 222 232 39S ribosomal protein L15, 39S ribosomal protein L15, Homo sapiens mitochondrial mitochondrial
194565 YLAHAIHQV 420 428 Aspartate aminotransferase, Aspartate aminotransferase, Homo sapiens mitochondrial mitochondrial
194566 YLAKHIENI 439 447 Zinc finger and BTB domain- Zinc finger and BTB domain- Homo sapiens containing protein 1 containing protein 1
194567 YLANGGFU 442 450 Envelope glycoprotein B Envelope glycoprotein B Herpes simplex virus (type 1 / strain 17)
194568 YLAPFLRNV 2074 2082 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 1 complex subunit 1
(UniProt:A5YKK6)
194569 YLAPHVRTL 341 349 COP9 signalosome complex COP9 signalosome complex Homo sapiens subunit 1 (UniProt:Q13098) subunit 1
194570 YLASURSV 261 269 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 7 ATPase regulatory subunit 7
194571 YLDEIVKEV 422 430 Nucleoprotein TPR Nucleoprotein TPR Homo sapiens
194572 YLDEYIARM 190 198 Tuberin (UniProt:P49815) Tuberin Homo sapiens
194573 YLDFTNPKV 478 486 Neutral alpha-glucosidase C Neutral alpha-glucosidase C Homo sapiens
(UniProt:Q8TET4)
194574 YLDLSENRL 155 163 Protein flightless-1 homolog Protein flightless-1 homolog Homo sapiens
194575 YLDLSNNRL 100 108 Toll-like receptor 10 Toll-like receptor 10 Homo sapiens
194576 YLDPAQRGV 21 29 UPF0585 protein C16orf13 UPF0585 protein C16orf13 Homo sapiens
(UniProt:H3BS73)
194577 YLDRFLAGV 83 91 G1/S-specific cyclin-D2 G1/S-specific cyclin-D2 Homo sapiens
194578 YLDVSVGKIVA 301 311 WD repeat-containing protein WD repeat-containing protein Homo sapiens
46 46 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
194579 YLDWTIERV 67 75 BTB/POZ domain-containing BTB/POZ domain-containing Homo sapiens protein KCTD3 protein KCTD3
194580 YLEDKSYKL 1397 1405 DBF4-type zinc finger- DBF4-type zinc finger- Homo sapiens containing protein 2 containing protein 2
194581 YLEEYKFQV 18 26 Suppressor of cytokine Suppressor of cytokine Homo sapiens signaling 2 signaling 2
194582 YLEPYLKEV 90 98 Cytochrome b-d complex Cytochrome b-d complex Homo sapiens subunit 7 (UniProt:P14927) subunit 7
194583 YLFAHAVDFV 252 261 Pre-rRNA-processing protein Pre-rRNA-processing protein Homo sapiens
TSR1 homolog TSR1 homolog
194584 YLFERTFNL 63 71 Heparan-sulfate 6-0- Heparan-sulfate 6-0- Homo sapiens sulfotransferase 1 sulfotransferase 1
194585 YLFREPATI 74 82 NADH dehydrogenase NADH dehydrogenase Homo sapiens
[ubiquinone] iron-sulfur [ubiquinone] iron-sulfur
protein 8, mitochondrial protein 8, mitochondrial
(UniProt:O00217)
194586 YLFTSPQRV 55 63 Protein unc-50 homolog Protein unc-50 homolog Homo sapiens
194587 YLGPHIASV 137 145 Vacuole membrane protein 1 Vacuole membrane protein 1 Homo sapiens
194588 YLGQVTTI 144 151 SUMO-activating enzyme SUMO-activating enzyme Homo sapiens subunit 2 subunit 2
194589 YLHNQGIGV 141 149 Mitotic checkpoint Mitotic checkpoint Homo sapiens serine/threonine-protein serine/threonine-protein
kinase BUB1 beta kinase BUB1 beta
194590 YLHRQVAAV 576 584 Antigen peptide transporter 1 Antigen peptide transporter 1 Homo sapiens
194591 YUDGTHKI 62 70 Glutathione S-transferase Mu Glutathione S-transferase Mu Homo sapiens
2 2
194592 YUSQVEGHQV 121 131 EKC/KEOPS complex EKC/KEOPS complex Homo sapiens subunit TPRKB subunit TPRKB
194593 YUTHPLAV 63 71 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 7 protein 7
194594 YLLDHAPPEI 819 828 Diacylglycerol kinase zeta Diacylglycerol kinase zeta Homo sapiens
194595 YLLDKETLRL 27 36 Protein zer-1 homolog Protein zer-1 homolog Homo sapiens
194596 YLLDQHIU 836 844 Phosphatidylinositol 3,4,5- Phosphatidylinositol 3,4,5- Homo sapiens trisphosphate 5-phosphatase trisphosphate 5-phosphatase
1 1
194597 YLLEKSRAV 69 77 UniProt:F8W6L6 Homo sapiens
194598 YLLEKSRVI 184 192 Unconventional myosin-ld Unconventional myosin-ld Homo sapiens
194599 YLLESVNKL 121 129 Plasminogen activator Plasminogen activator Homo sapiens inhibitor 2 inhibitor 2
194600 YLLGHDIRI 309 317 Alpha-1 ,6- Alpha-1 ,6- Homo sapiens mannosylglycoprotein 6- mannosylglycoprotein 6- beta-N- beta-N- acetylglucosaminyltransferas acetylglucosaminyltransferas e A e A
194601 YLLHEKLNL 36 44 PCNA-interacting partner PCNA-interacting partner Homo sapiens
(UniProt:Q9NWS1 )
194602 YLLLKGVEAV 451 460 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX41 RNA helicase DDX41
194603 YLLLKTHQL 134 142 PCI domain-containing PCI domain-containing Homo sapiens protein 2 protein 2
194604 YLLPFSKSI 186 194 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 27 containing protein 27
194605 YLLPKDQGITL 104 114 Cyclin-D1 -binding protein 1 Cyclin-D1 -binding protein 1 Homo sapiens
194606 YLLQEPPRTV 215 224 PRKC apoptosis WT1 PRKC apoptosis WT1 Homo sapiens regulator protein regulator protein
194607 YLLQRAVEV 286 294 Probable methyltransferase Probable methyltransferase Homo sapiens
TARBP1 TARBP1
194608 YLLRSLDYV 125 133 LanC-like protein 2 LanC-like protein 2 Homo sapiens
194609 YLLTESSKL 67 75 COMM domain-containing COMM domain-containing Homo sapiens protein 2 protein 2
194610 YLLTHPPPIM 384 393 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
19461 1 YLLTRNPHL 16 24 NADP-dependent malic NADP-dependent malic Homo sapiens enzyme enzyme
194612 YLMEGSYNKV 235 244 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 8 ATPase regulatory subunit 8
(UniProt:P48556)
194613 YLMEQNVTKL 518 527 SET domain-containing SET domain-containing Homo sapiens protein 5 protein 5
194614 YLMEVTHDL 210 218 Leucine-tRNA ligase, Leucine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
194615 YLMVENIRL 266 274 Striatin-interacting protein 2 Striatin-interacting protein 2 Homo sapiens
194616 YLNDFTHEI 21 1 219 Zinc finger protein Pegasus Zinc finger protein Pegasus Homo sapiens
194617 YLNDUHSV 504 512 A-kinase anchor protein 10, A-kinase anchor protein 10, Homo sapiens mitochondrial mitochondrial
(UniProt:043572)
194618 YLNDRVDEL 248 256 Cytosolic 5'-nucleotidase 3A Cytosolic 5'-nucleotidase 3A Homo sapiens
194619 YLNKEIEEA 61 1 619 RNA polymerase II subunit A RNA polymerase II subunit A Homo sapiens
C-terminal domain C-terminal domain
phosphatase phosphatase
194620 YLNQHIEHV 696 704 Protein BIVM-ERCC5 Protein BIVM-ERCC5 Homo sapiens
194621 YLNTRLFTV 108 116 Alpha-ketogluta rate- Al ph a- ketogl u ta rate- Homo sapiens dependent dioxygenase FTO dependent dioxygenase FTO
194622 YLPDIIKDQKA 74 84 Protein phosphatase 1 G Protein phosphatase 1 G Homo sapiens
194623 YLPEDFIRV 381 389 lnterleukin-1 receptor- lnterleukin-1 receptor- Homo sapiens associated kinase-like 2 associated kinase-like 2
194624 YLPSQVSRV 761 769 Coatomer subunit beta' Coatomer subunit beta' Homo sapiens
(UniProt:P35606)
194625 YLPYPIHQV 259 267 Dual specificity protein Dual specificity protein Homo sapiens kinase CLK2 kinase CLK2
194626 YLQAHTQSV 313 321 ETS domain-containing ETS domain-containing Homo sapiens transcription factor ERF transcription factor ERF
194627 YLQEHAQEV 353 361 Pumilio homolog 3 Pumilio homolog 3 Homo sapiens
194628 YLQEKLHAL 399 407 Centrosomal protein of 290 Centrosomal protein of 290 Homo sapiens kDa (UniProt:O15078) kDa
194629 YLQPKLLGI 183 191 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ATR kinase ATR
194630 YLQQVNHKL 37 45 Sterol regulatory element- Sterol regulatory element- Homo sapiens binding protein 2 binding protein 2
194631 YLRSVGDGETV 99 109 Nuclease-sensitive element- Nuclease-sensitive element- Homo sapiens binding protein 1 binding protein 1
194632 YLSAVRATL 8 16 Actin-related protein 2/3 Actin-related protein 2/3 Homo sapiens complex subunit 4 complex subunit 4
194633 YLSDIPLHDA 319 328 Guanylate cyclase soluble Guanylate cyclase soluble Homo sapiens subunit beta-1 subunit beta-1
194634 YLSDNVHLV 174 182 Hsp90 co-chaperone Cdc37 Hsp90 co-chaperone Cdc37 Homo sapiens
(UniProt:Q16543)
194635 YLSKIIPAL 157 165 Replication factor C subunit 5 Replication factor C subunit 5 Homo sapiens
194636 YLSPDLSKV 673 681 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase B-raf kinase B-raf
194637 YLSPKLWAL 8 16 La-related protein 6 La-related protein 6 Homo sapiens
194638 YLSSLQPRL 225 233 THO complex subunit 5 THO complex subunit 5 Homo sapiens homolog homolog
194639 YLSVKVWDL 31 1 319 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2A 55 kDa phosphatase 2A 55 kDa
regulatory subunit B delta regulatory subunit B delta
isoform isoform
194640 YLTDRVMTV 183 191 Histone deacetylase 3 Histone deacetylase 3 Homo sapiens
194641 YLTNEGIQYL 70 79 40S ribosomal protein S10 40S ribosomal protein S10 Homo sapiens
(UniProt:P46783)
194642 YLVAEKVTV 142 150 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens alpha A2 alpha A2
194643 YLVDFTQKI 110 118 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 174 containing protein 174
(UniProt:P01106) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
213234 KUNSQISL 11 1 119 Phosphatidylinositol 4,5- Phosphatidylinositol 4,5- Homo sapiens bisphosphate 3-kinase bisphosphate 3-kinase
catalytic subunit delta catalytic subunit delta
isoform (UniProt:O00329) isoform
213280 KLPLPLPPRL 6 15 Hematopoietic SH2 domain- Hematopoietic SH2 domain- Homo sapiens containing protein containing protein
213334 KMAEVIGSKL 592 601 Midasin Midasin Homo sapiens
213671 KVCNPIITKL 601 610 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniPro P11142) protein
213707 KVLDTIMATKL 115 125 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 14 polymerase 14
217951 RLAEWKATKL 78 87 Phosducin-like protein 3 Phosducin-like protein 3 Homo sapiens
218426 RSIEKSNSV 207 215 Lymphocyte-specific protein Lymphocyte-specific protein Homo sapiens
1 1
220150 TLNEKLTAL 49 57 Protein BRICK1 Protein BRICK1 Homo sapiens
220571 VATEGSREL 482 490 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DHX58 RNA helicase DHX58
221577 YANYYTREV 761 769 Splicing factor 3B subunit 1 Splicing factor 3B subunit 1 Homo sapiens
222143 AIYDHINEGV 42 51 Other Homo sapiens Cytochrome b-d complex Homo sapiens
(human) protein subunit 9
222144 AIYDHVNEGV Cytochrome b-d complex Cytochrome b-d complex Homo sapiens subunit 6, mitochondrial subunit 6, mitochondrial
222148 ALAPAPAEV 659 667 Nischarin Nischarin Homo sapiens
222149 ALAPAPVEV 582 590 Nischarin Nischarin Homo sapiens
222172 ASEAIKGAVVG 47 57 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
222178 ATIGVLLDL 645 653 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIM9 TRIM9
222219 DTAPPRDSW 29 37 Nuclear fragile X mental Nuclear fragile X mental Homo sapiens retardation-interacting protein retardation-interacting protein
1 1
222371 FVAGTQEVFV Unidentified protein unidentified
222586 GLLGQEGLVEI 393 403 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 10 polymerase 10
222587 GLPGQEGLVEI 397 407 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 10 polymerase 10
222594 GQSELASRLTL 165 175 Maspardin Maspardin Homo sapiens
222774 IAVGYVDDTQF 47 57 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, A-2 alpha chain antigen, A-2 alpha chain
222895 ILFPDIIARA 112 121 Melanoma-associated Melanoma-associated Homo sapiens antigen F1 antigen F1
223378 LRVAPEEHPVL 84 94 Actin, cytoplasmic 2 Actin, cytoplasmic 2 Homo sapiens
223423 MLAPEAVILVM 1 11 Other Homo sapiens Homo sapiens
(human) protein
223425 MLDPLEVHL 1868 1876 Pre-mRNA-processing- Pre-m RNA-processi ng- Homo sapiens spl icing factor 8 splicing factor 8
223431 MVLTRIIAI 21 1 219 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ATR kinase ATR
223510 PELLLLPL 904 911 Protein SFI1 homolog Protein SFI1 homolog Homo sapiens
223526 PLLLLLLGL 10 18 Ribonuclease 8 Ribonuclease 8 Homo sapiens
224056 SLPKHSVTI 1068 1076 Zinc finger protein 40 Zinc finger protein 40 Homo sapiens
224064 SQYPFPVTL 162 170 Rab GTPase-activating Rab GTPase-activating Homo sapiens protein 1 -like protein Mike
(UniProt:Q5R372)
224073 SVAEGRALMSV 119 129 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX41 RNA helicase DDX41
224079 TAALFIILL 1234 1242 Probable phospholipid- Probable phospholipid- Homo sapiens transporting ATPase VD transporting ATPase VD
224210 TEWIKAIQM 336 344 Pleckstrin Pleckstrin Homo sapiens
224219 TFLKIIPML Unidentified protein unidentified
224227 TLLKQLKEA 186 194 Asparagine synthetase Asparagine synthetase Homo sapiens
[glutamine-hydrolyzing] [glutamine-hydrolyzing]
224238 TQIHSMVNL Unidentified protein unidentified Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
22441 1 VLDELVRP 219 226 Hepatocyte nuclear factor 4- Hepatocyte nuclear factor 4- Homo sapiens gamma gamma
224543 YTLILKTIL 216 224 Olfactory receptor 6C65 Olfactory receptor 6C65 Homo sapiens
224725 FLPEAPAEL 238 246 DNA replication licensing DNA replication licensing Homo sapiens factor MCM2 factor MCM2
(UniProt:P49736)
224741 FYDERIVVV 854 862 Disco-interacting protein 2 Disco-interacting protein 2 Homo sapiens homolog B homolog B
224861 LSDHHIYL 79 86 Fructose-bisphosphate Fructose-bisphosphate Homo sapiens aldolase A aldolase A
224889 MVDGKPVNL 45 53 Ras-related C3 botulinum Ras-related C3 botulinum Homo sapiens toxin substrate 1 toxin substrate 1
224962 SFDGIIAMM 56 64 Transcription elongation Transcription elongation Homo sapiens factor SPT4 factor SPT4
225063 VFDEAIRAV 124 132 Ras-related C3 botulinum Ras-related C3 botulinum Homo sapiens toxin substrate 1 toxin substrate 1
225064 VFDEAIRAVL 124 133 Ras-related C3 botulinum Ras-related C3 botulinum Homo sapiens toxin substrate 1 toxin substrate 1
225075 VFDPVPVGV 697 705 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase A helicase A
225092 VLDDKDYFLF 51 60 10 kDa heat shock protein, 10 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
225161 YVQDYEDFM 250 258 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit J initiation factor 3 subunit J
(UniProt:075822)
225231 ALYVDSLFFL 300 309 Melanoma antigen Melanoma antigen Homo sapiens preferentially expressed in preferentially expressed in
tumors tumors
226326 AKKLHFSTA 173 181 Tegument protein VP22 Tegument protein VP22 Human
alphaherpesvirus 2
226340 FASPADPKV 242 250 Tegument protein UL47 Tegument protein UL47 Human
alphaherpesvirus 2
226342 FVLVILARL 428 436 mRNA export factor mRNA export factor Human
alphaherpesvirus 2
226396 TLVAHGPSL 314 322 mRNA export factor mRNA export factor Human
alphaherpesvirus 2
226561 AAGNVNIAI 70 78 Lipoprotein LpqH Lipoprotein LpqH Mycobacterium
(UniProt:P9WK61) tuberculosis
226562 AAMAAQLQA 81 89 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226563 AAM AS AS LV 21 29 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226565 AAQFNASPV 56 64 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226570 ALNATDPGA 47 55 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226571 ALSAGVGAV 7 15 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226572 AMAAQLQAV 82 90 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226573 AMASASLVT 22 30 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226577 APPPQRAAM 75 83 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226580 AQFNASPVA 57 65 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226581 AQLQAVPGA 85 93 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226582 AQSYLRNFL 65 73 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
226583 ASPPSTAM 52 60 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226593 GAAQYIGLV 92 100 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226594 GAASGPKW 45 53 Lipoprotein LpqH Lipoprotein LpqH Mycobacterium
(UniProt:P9WK61) tuberculosis
226597 GLGNVNGVT 101 109 Lipoprotein LpqH Lipoprotein LpqH Mycobacterium
(UniProt:P9WK61) tuberculosis
226607 GWVESDAAH 127 135 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226608 GYTSGTGQG 11 1 119 Lipoprotein LpqH Lipoprotein LpqH Mycobacterium
(UniProt:P9WK61) tuberculosis
226620 ILLLSLNPV Other Homo sapiens Homo sapiens
(human) protein
226626 LAAPPPQRA 73 81 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226627 LAESIRPLV 279 287 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226628 LAIAAMASA 18 26 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226638 LLMPTISLI Other Homo sapiens Homo sapiens
(human) protein
226640 LTDGNPPEV 89 97 Lipoprotein LpqH Lipoprotein LpqH Mycobacterium
(UniProt:P9WK61) tuberculosis
226642 MASASLVTV 23 31 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226643 MLTTLILTL Other Homo sapiens Homo sapiens
(human) protein
226645 MSLTVGAGV 17 25 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226646 NAPPPPVIA 96 104 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226648 PLLIPTSKL Other Homo sapiens Homo sapiens
(human) protein
226650 PNAPPPPVI 95 103 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226664 RLDQKLYAS 169 177 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226665 RLSLTALSA 2 10 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226667 SASLVTVAV 25 33 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226673 SLNPWPPCL Other Homo sapiens Homo sapiens
(human) protein
226676 SLTALSAGV 4 12 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226685 TTGDPPFPG 146 154 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226687 VAPPPPAAA 68 76 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226691 VTGSWCTT 61 69 Lipoprotein LpqH Lipoprotein LpqH Mycobacterium
(UniProt:P9WK61) tuberculosis
226692 VTLGYTSGT 108 116 Lipoprotein LpqH Lipoprotein LpqH Mycobacterium
(UniProt:P9WK61 ) tuberculosis
226693 WLGTANNPV 263 271 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis
226695 YLFTLLVPL 94 102 PTS glucose transporter PTS glucose transporter Bacillus pumilus subunit IIA subunit IIA
226696 YLRNFLAAP 68 76 Low molecular weight T-cell Low molecular weight T-cell Mycobacterium antigen antigen tuberculosis
226698 YMPYPGTRI 197 205 Alanine and proline-rich Alanine and proline-rich Mycobacterium secreted protein Apa secreted protein Apa tuberculosis Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
226700 YVFTLLVPL Other Homo sapiens Homo sapiens
(human) protein
226701 YVFTLLVSL 212 220 ATP synthase subunit a ATP synthase subunit a Homo sapiens
226770 FLMSSWWPNL 1135 1144 Histone demethylase UTY Histone demethylase UTY Homo sapiens
226778 KLCKVRKITV 122 131 40S ribosomal protein S4, Y 40S ribosomal protein S4, Y Homo sapiens isoform 1 isoform 1
226782 LLLHCPSKTV 1321 mo Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
226790 NLLDSLEQYI 1751 1760 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
226805 VLLRHSKNV 2077 2085 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
226806 VLTSESMHV 135 143 Zinc finger Y-chromosomal Zinc finger Y-chromosomal Homo sapiens protein protein
226807 VVPEDYWGV 11 15 1123 Histone demethylase UTY Histone demethylase UTY Homo sapiens
226808 WLDEVKQAL 917 925 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5D 5D
226853 IUEGIFFV 156 164 Ribonucleoside-diphosphate Ribonucleoside-diphosphate Human
reductase small chain reductase small chain alphaherpesvirus
3
226854 IUEGVFFA 106 114 Ribonucleoside-diphosphate Ribonucleoside-diphosphate Human
reductase small chain reductase small chain alphaherpesvirus
2
226871 MIUEGIFFV 155 164 Ribonucleoside-diphosphate Ribonucleoside-diphosphate Human
reductase small chain reductase small chain alphaherpesvirus
3
227918 FLGGPPVCL 2 10 Large envelope protein Large envelope protein Hepatitis B virus
227919 FLKQQYMNL 652 660 Protein P Protein P Hepatitis B virus
227920 FLSKQYMDL 652 660 Protein P Protein P Hepatitis B virus
227923 GGPNLDNIL 364 372 Large envelope protein Large envelope protein Hepatitis B virus
227924 ILRSFIPLL 208 216 Large envelope protein Large envelope protein Hepatitis B virus
227927 LTFGRETVLEN 72 82 Capsid protein Capsid protein Hepatitis B virus
227928 LTTVPAASLLA 130 140 Large envelope protein Large envelope protein Hepatitis B virus
227932 TVSTKLCKI 307 315 Protein P Protein P Hepatitis B virus
229895 FAYDGKDYLTL 137 147 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, alpha chain E antigen, alpha chain E
229905 IMAKNEVFCV 2558 2567 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
229918 MLVCGDDLV 2733 2741 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
229935 SVIDCNTCV 1450 1458 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
229947 YLFNWAVRT 2944 2952 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
229948 YVGDLCGSV 276 284 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
231332 QLSGLGINAV 1408 1417 Genome polyprotein Genome polyprotein Hepatitis C virus subtype 1 b
231463 SMSMILVGV 759 767 Genome polyprotein Genome polyprotein Yellow fever virus
17D
231872 FLDGNELTL 167 175 Chloride intracellular channel Chloride intracellular channel Homo sapiens protein 1 protein 1
231873 FLDPASIAA 1777 1785 Genome polyprotein Genome polyprotein Yellow fever virus
17D
231877 FLLQDTVEL 296 304 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 2 initiation factor 4 gamma 2
231949 HUDYLVTS 95 103 Carboxypeptidase M Carboxypeptidase M Homo sapiens
231950 HLSTAFARV 254 262 Carbonic anhydrase 9 Carbonic anhydrase 9 Homo sapiens
231980 ILNDSGETV 2060 2068 Genome polyprotein Genome polyprotein Yellow fever virus
17D
232010 KLLEPVLLL 49 57 40S ribosomal protein S16 40S ribosomal protein S16 Homo sapiens
(UniProt:P62249)
232050 LUENVASL 40 48 Glutathione peroxidase 1 Glutathione peroxidase 1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
232293 SMQKTIPLV 1317 1325 Genome polyprotein Genome polyprotein Yellow fever virus
17D
232294 SMSADVPLV 228 236 Proliferating cell nuclear Proliferating cell nuclear Homo sapiens antigen antigen
234850 GIGTDEKML 33 41 Annexin A3 Annexin A3 Homo sapiens
234875 GLSEFTEYL 225 233 Microtubule-associated Microtubule-associated Homo sapiens protein 1 B protein 1 B
235248 LLHYLLDAV 297 305 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 45 hydrolase 45
235429 NLVKCQVEL 89 97 39S ribosomal protein L20, 39S ribosomal protein L20, Homo sapiens mitochondrial mitochondrial
235721 SLKYFHTSV 25 33 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, alpha chain E antigen, alpha chain E
235764 SVLGRIWKL 484 492 EH domain-containing EH domain-containing Homo sapiens protein 2 protein 2
236420 AAPAYSRAL 69 77 Heat shock protein beta-1 Heat shock protein beta-1 Homo sapiens
236427 HLPETKFSEL 942 951 Absent in melanoma 1 Absent in melanoma 1 Homo sapiens protein protein
236681 AAANIIRTL 983 991 Ras-specific guanine Ras-specific guanine Homo sapiens nucleotide-releasing factor 1 nucleotide-releasing factor 1
236682 AADTERLAL 73 81 Cytoskeleton-associated Cytoskeleton-associated Homo sapiens protein 4 protein 4
236685 AAVRIGSVL 41 49 RNA polymerase II subunit A RNA polymerase II subunit A Homo sapiens
C-terminal domain C-terminal domain
phosphatase phosphatase
236774 AVGLVLPAKL 14 23 Short-chain Short-chain Homo sapiens dehydrogenase/reductase 3 dehydrogenase/reductase 3
236775 AVKKNPGIAA 230 239 A-kinase anchor protein 2 A-kinase anchor protein 2 Homo sapiens
236808 DIELQAENI 2231 2239 Fibrocystin-L Fibrocystin-L Homo sapiens
236816 DLDVKKMPL 210 218 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 3 polymerase 3
236879 ELNKLLEEI 1003 1011 NACHT, LRR and PYD NACHT, LRR and PYD Homo sapiens domains-containing protein 2 domains-containing protein 2
236916 FLDPDIGGVAV 1854 1864 Methylcytosine dioxygenase Methylcytosine dioxygenase Homo sapiens
TET2 (UniProt:Q6N021) TET2
236917 FLKDLVASV 82 90 Dr1 -associated corepressor Dr1 -associated corepressor Homo sapiens
236918 FMYDRPLRL 1393 1401 Collagen alpha-3(VI) chain Collagen alpha-3(VI) chain Homo sapiens
(UniProt:P121 1 1)
236921 FSITKSVEL 345 353 Transcription regulator Transcription regulator Homo sapiens protein BACH2 protein BACH2
236922 FSTPHGLEV 172 180 Zinc finger protein Gfi-1 b Zinc finger protein Gfi-1 b Homo sapiens
236926 GAAVRIGSVL 40 49 RNA polymerase II subunit A RNA polymerase II subunit A Homo sapiens
C-terminal domain C-terminal domain
phosphatase phosphatase
236991 GVIDGHIYAV 39 48 Kelch-like ECH-associated Kelch-like ECH-associated Homo sapiens protein 1 protein 1
237036 ILDEKPVII 1270 1278 ATP-binding cassette subATP-binding cassette subHomo sapiens family A member 6 family A member 6
237055 ISMKILNSL 331 339 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX46 RNA helicase DDX46
237083 KIASQLSKL 6469 6477 Fibrous sheath-interacting Fibrous sheath-interacting Homo sapiens protein 2 protein 2
237087 KITVPASQKL 6 15 B-cell linker protein B-cell linker protein Homo sapiens
(UniProt:Q8WV28)
237088 KLDNQVSKV 355 363 Afadin- and alpha-actinin- Afadin- and alpha-actinin- Homo sapiens binding protein binding protein
237134 LIYSVGLLLA 540 549 Sodium/potassium/calcium Sodium/potassium/calcium Homo sapiens exchanger 3 exchanger 3
237184 LSEQTSVPL 2001 2009 DmX-like protein 1 DmX-like protein 1 Homo sapiens
237188 LTLGEFLKL 96 104 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 5 containing protein 5 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
237196 MIFRSGSU 94 102 UDP-xylose and UDP-N- UDP-xylose and UDP-N- Homo sapiens acetylglucosamine acetylglucosamine
transporter transporter
237250 NVSSRFEEEI 202 211 EF-hand domain-containing EF-hand domain-containing Homo sapiens protein D2 (UniProt:Q96C19) protein D2
237265 QLLDQVEQI 162 170 Transmembrane emp24 Transmembrane emp24 Homo sapiens domain-containing protein 4 domain-containing protein 4
(UniProt:Q7Z7H5)
237293 RISEVLQKL 199 207 Cytoskeleton-associated Cytoskeleton-associated Homo sapiens protein 4 protein 4
237357 SIEPAKETTTNV 509 520 Solute carrier family 2, Solute carrier family 2, Homo sapiens facilitated glucose transporter facilitated glucose transporter
member 14 member 14
237360 SILEDPPSI 394 402 Protein asunder homolog Protein asunder homolog Homo sapiens
(UniProt:Q9NVM9)
237367 SMTSLAQKI 1285 1293 DmX-like protein 1 DmX-like protein 1 Homo sapiens
237443 TLGEFLKL 97 104 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 5 containing protein 5
237482 TVIYRIQAL 9 17 Vitamin K-dependent protein Vitamin K-dependent protein Homo sapiens
S S
237523 VLFGGKVSGA 83 92 Major facilitator superfamily Major facilitator superfamily Homo sapiens domain-containing protein 2B domain-containing protein 2B
(UniProt:A6NFX1)
237527 VLYENALKL 328 336 FH1/FH2 domain-containing FH1/FH2 domain-containing Homo sapiens protein 1 protein 1
237529 VMLDVPIRL 848 856 Ras GTPase-activating Ras GTPase-activating Homo sapiens protein nGAP protein nGAP
237725 GALNSVLTL + 248 256 uncharacterized protein Uncharacterized protein Homo sapiens
MCM(G1 , A2, L9) KIAA1551 KIAA1551
237747 GVAGIGILTG + 26 35 Melanoma antigen Melanoma antigen Homo sapiens
MCM(G1 , V2, G10) recognized by T-cells 1 recognized by T-cells 1
237748 GVLNSVLTL + 248 256 uncharacterized protein Uncharacterized protein Homo sapiens
MCM(G1 , V2, L9) KIAA1551 KIAA1551
237825 LLFGLAUEV 191 200 Melanoma-associated Melanoma-associated Homo sapiens antigen C2 antigen C2
237921 SAAGIGILTV + 26 35 Melanoma antigen Melanoma antigen Homo sapiens
MCM(S1 , A2) recognized by T-cells 1 recognized by T-cells 1
237938 SLLNSVLTL + 248 256 uncharacterized protein Uncharacterized protein Homo sapiens
MCM(S1 , L9) KIAA1551 KIAA1551
238379 FLVGQLFTF 285 293 Genome polyprotein Genome polyprotein Hepatitis C virus subtype 1 a
239382 ALADLDELURA 1484 1495 Basement membrane- Basement membrane- Homo sapiens specific heparan sulfate specific heparan sulfate
proteoglycan core protein proteoglycan core protein
239383 ALADUEKELSV 414 425 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 4 complex subunit 4
239386 ALFDGHGGPAAA 122 133 Protein phosphatase 1 M Protein phosphatase 1 M Homo sapiens
(UniProt:B7XGB9)
239387 ALFDQTRHSLAL 1244 1255 Nucleoporin NUP188 Nucleoporin NUP188 Homo sapiens homolog homolog
239390 AUDEGETDWKL 91 102 UniProt:E2QRM6 Homo sapiens
239391 AUSLGEGUTA 135 146 Ran GTPase-activating Ran GTPase-activating Homo sapiens protein 1 protein 1
239395 ALLDQALSNARL 1137 1148 UniProt:F8W8Q1 Homo sapiens
239398 ALLEDLGKASGL 153 164 UPF0585 protein C16orf13 UPF0585 protein C16orf13 Homo sapiens
(UniProt:Q96S19)
239399 ALLETPQRLFAL 85 96 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX47 RNA helicase DDX47
(UniProt:Q9H0S4)
239402 ALMDSLGPEWRL 131 142 Mitochondrial import receptor Mitochondrial import receptor Homo sapiens subunit TOM34 subunit TOM34
239403 ALMDVGNMGQSV 17 28 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 11 complex subunit 11 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
239408 ALWDIETGQQTT 67 78 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein G(I)/G(S)/G(T) protein G(I)/G(S)/G(T)
subunit beta-1 subunit beta-1
239410 ALWDLAADKQTL 76 87 26S protease regulatory 26S protease regulatory Homo sapiens subunit 7 subunit 7
239413 ALYDVGDIVHSV 730 741 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
3A 3A
239415 AMIDEGETDWKV 141 152 Inorganic pyrophosphatase Inorganic pyrophosphatase Homo sapiens
239417 AMLPDLQPLEKL 23 34 Telomerase protein Telomerase protein Homo sapiens component 1 component 1
(UniProt:Q99973)
239419 AMVNIPEEMLRV 725 736 MHC class II regulatory MHC class II regulatory Homo sapiens factor RFX1 factor RFX1
239509 CINGVVWTV 1073 1081 polyprotein Genome polyprotein Hepatitis C virus
239647 FILDISPVAHRV 221 232 Membrane progestin Membrane progestin Homo sapiens receptor beta receptor beta
239648 FIMDDPAGNSYL 352 363 Zinc finger protein ZPR1 Zinc finger protein ZPR1 Homo sapiens
239650 FLADPDTVNHLL 285 296 Sorting nexin-14 Sorting nexin-14 Homo sapiens
239653 FLDELEDEAKAA 84 95 Cytochrome c oxidase Cytochrome c oxidase Homo sapiens assembly factor 3 homolog, assembly factor 3 homolog,
mitochondrial mitochondrial
239654 FLDSMASGTLHL 769 780 WD repeat- and FYVE WD repeat- and FYVE Homo sapiens domain-containing protein 4 domain-containing protein 4
(UniProt:Q6ZS81 )
239655 FLFQAGSGIYHV 178 189 Dipeptidyl peptidase 8 Homo sapiens
(UniProt:Q6V1X1 )
239659 FUEEQKIVVKV 95 106 60S ribosomal protein L34 60S ribosomal protein L34 Homo sapiens
239661 FLLQDSGRILQL 59 70 WD repeat-containing protein WD repeat-containing protein Homo sapiens
6 6
239663 FLNLMEKLNENI 194 205 Cytochrome P450 2C9 Cytochrome P450 2C9 Homo sapiens
239667 FLWAGGRASYGV 318 329 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein U ribonucleoprotein U
239668 FLYDEIEAEVNL 686 697 Cytoplasmic FMR1- Cytoplasmic FMR1 - Homo sapiens interacting protein 1 interacting protein 1
239670 FLYQQQGRLDKL 70 81 HLA class II HLA class II Homo sapiens histocompatibility antigen histocompatibility antigen
gamma chain gamma chain
(UniProt:P04233)
239685 FVILRKNPNYDL 897 908 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 2 ATPase regulatory subunit 2
239721 GLAPAEVVVATV 425 436 MKL/myocardin-like protein 1 MKL/myocardin-like protein 1 Homo sapiens
239723 GLFGGSSKIEEA 30 41 Alpha-soluble NSF Alpha-soluble NSF Homo sapiens attachment protein attachment protein
239727 GLLDPNVKSIFV 154 165 ERI1 exoribonuclease 3 ERI1 exoribonuclease 3 Homo sapiens
239728 GLLDQDTGLVLL 1569 1580 Microtubule-actin cross- Microtubule-actin cross- Homo sapiens linking factor 1 , isoforms linking factor 1 , isoforms
1/2/3/5 (UniProt:Q9UPN3) 1/2/3/5
239734 GLVDDFEKKFNA 65 76 ATP synthase subunit d, ATP synthase subunit d, Homo sapiens mitochondrial mitochondrial
239781 HLWEVDVQGSKA 29 40 Argininosuccinate lyase Argininosuccinate lyase Homo sapiens
239803 ILFSEDSTKLFV 443 454 Cirhin Cirhin Homo sapiens
239805 ILLDGDKGKFLL 312 323 4-hyd roxyphenyl pyruvate 4-hydroxyphenylpyruvate Homo sapiens dioxygenase-like protein dioxygenase-like protein
239809 ILMKDLADELAL 39 50 L-lactate dehydrogenase L-lactate dehydrogenase Homo sapiens
239872 KIFDIDEAEEGV 87 98 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 2 subunit 2 initiation factor 2 subunit 2
239880 KLADEVITRNEL 800 811 DDB1 - and CUL4-associated DDB1- and CUL4-associated Homo sapiens factor 6 factor 6
239887 KLFVDTDADTRL 152 163 Uridine-cytidine kinase 2 Uridine-cytidine kinase 2 Homo sapiens
239888 KUDDQDISISL 140 151 Spatacsin Spatacsin Homo sapiens
239890 KUDLSQVMYLV + 336 347 Metastasis-associated in Metastasis-associated in Homo sapiens
OX(M9) colon cancer protein 1 colon cancer protein 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
418945 ALTEMDYFI 133 141 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
418947 AMPPELNTA 5 13 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
418964 ELTARLNSL 44 52 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
418967 FIRMWNQAAL 140 149 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
418975 GINTIPIAL 126 134 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
418997 KLEPMASIL 166 174 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
419002 LIEKPVAPSV 299 308 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
419006 LLRAESLPGA 277 286 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
419031 QLPPAATQTL 200 209 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
419045 SLPEIAANHI 105 114 Uncharacterized PPE family Uncharacterized PPE family Mycobacterium immunogenic protein PPE68 immunogenic protein PPE68 tuberculosis
H37Ra
419259 LQTGIHVRV 32 40 65 kDa phosphoprotein 65 kDa phosphoprotein Human
betaherpesvirus 5
419325 RLGPVQNEV 1628 1636 Genome polyprotein Genome polyprotein Hepatitis C virus
419410 WLGNIIMFA 2828 2836 Genome polyprotein Genome polyprotein Hepatitis C virus
419494 ALKRQGRTLYG 90 100 Histone H4 Histone H4 Homo sapiens
419764 ILQKNVPIL 213 221 Catenin alpha-1 Catenin alpha-1 Homo sapiens
419980 MRYVASYLL 1 9 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P2 P2
420129 RVAPEEHPV 95 103 Actin, cytoplasmic 1 Actin, cytoplasmic 1 Homo sapiens
420245 TADPLDYRL 1516 1524 Nuclear pore complex protein Nuclear pore complex protein Homo sapiens
Nup98-Nup96 Nup98-Nup96
(UniProt:P52948)
420302 VIDEPVRL 75 82 Antigen KI-67 Antigen KI-67 Homo sapiens
420412 YVDRVTEFL 429 437 CDK5 regulatory subunit- CDK5 regulatory subunit- Homo sapiens associated protein 3 associated protein 3
420444 AMLERQFTV 185 193 Protein N-lysine Protein N-lysine Homo sapiens methyltransferase methyltransferase
METTL21A METTL21A
420470 FLSSANEHL 75 83 Glutaredoxin-3 Glutaredoxin-3 Homo sapiens
420488 KMMYMCYRNI 203 212 55 kDa immediate-early 55 kDa immediate-early Human
protein 1 protein 1 betaherpesvirus 5
420490 KQMWQARLTV 144 153 65 kDa phosphoprotein 65 kDa phosphoprotein Human
betaherpesvirus 5
420503 MMYKDILLL 189 197 Hepatocyte nuclear factor 4- Hepatocyte nuclear factor 4- Homo sapiens gamma gamma
420519 RLLEAIIRL 855 863 Unconventional myosin-XIX Unconventional myosin-XIX Homo sapiens
420531 SLAAYIPRL Citrate lyase subunit betaCitrate lyase subunit betaHomo sapiens like protein, mitochondrial like protein, mitochondrial
420535 SLQEKVAKA 480 488 Hyaluronan mediated motility Hyaluronan mediated motility Homo sapiens receptor receptor
420553 VLQNVAFSV 36 44 Bcl-2-related protein A1 Bcl-2-related protein A1 Homo sapiens
420621 KLVAAGINAV 33 42 NS3 Genome polyprotein Hepatitis C virus
420622 KLVACGINAV 33 42 NS3 Genome polyprotein Hepatitis C virus Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
423062 SSVSTALAEL 2338 2347 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
423068 VLFGLMALTL 13 22 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
423069 VLTESSVSTA 2334 2343 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
423075 VVLFGLMAL 12 20 Genome polyprotein Genome polyprotein Hepatitis C virus genotype 1
423341 HLAVERGKV 532 540 Ankyrin repeat and protein Ankyrin repeat and protein Homo sapiens kinase domain-containing kinase domain-containing
protein 1 protein 1
423409 LLMEHTMVAF Unidentified protein unidentified
423492 RLASYLDRV 90 98 Keratin, type I cytoskeletal 18 Keratin, type I cytoskeletal 18 Homo sapiens
423545 TLFPGKVHSL 406 415 WD repeat-containing protein WD repeat-containing protein Homo sapiens
6 6
423774 VLFDKATYDKL 40 50 Other Toxoplasma gondii Toxoplasma protein gondii ME49
424547 FLMPFPVNY 834 842 Presequence protease, Presequence protease, Homo sapiens mitochondrial mitochondrial
42491 1 GKADGAEAKPAE 1949 1960 Myosin-9 Myosin-9 Homo sapiens
424958 GLWGHALLL 1463 1471 Protein transport protein Protein transport protein Homo sapiens
Sec16A Sec16A
425218 HAVYRDDLKKL 50 60 Other Homo sapiens Protein S100-A8 Homo sapiens
(human) protein
425798 KIYDREQTRY 94 103 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
425980 LDTNADKQLS 66 75 Protein S100-A9 Protein S100-A9 Homo sapiens
427001 RMYELVHRM 133 141 Nucleoporin GLE1 Nucleoporin GLE1 Homo sapiens
427313 SLADAINTEF 66 75 Vimentin Vimentin Homo sapiens
427385 SLYEGIDFY 286 294 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniPro P11142) protein
428678 YLLDHFLSM 1039 1047 Kinesin-like protein KIF21A Kinesin-like protein KIF21A Homo sapiens
430167 FTDEEGYGRYL 77 87 UniProt:E7EUT8 Homo sapiens
431871 QLERPGGLDTLY 23 34 PH domain leucine-rich PH domain leucine-rich Homo sapiens repeat-containing protein repeat-containing protein
phosphatase 2 phosphatase 2
433761 ALMELFPKL 626 634 Small subunit processome Small subunit processome Homo sapiens component 20 homolog component 20 homolog
433904 FILPDSLPLDTL 68 79 Small nuclear Small nuclear Homo sapiens ribonucleoprotein Sm D1 ribonucleoprotein Sm D1
433964 GLIDSLVHYV 581 590 Plakophilin-2 Plakophilin-2 Homo sapiens
434126 LUDDEYKV 640 648 ER membrane protein ER membrane protein Homo sapiens complex subunit 1 complex subunit 1
434254 SLADDSVLERL 1471 1481 Midasin Midasin Homo sapiens
434256 SLLDLHTKV 299 307 Small subunit processome Small subunit processome Homo sapiens component 20 homolog component 20 homolog
434307 TIAEVGKWLQA 980 990 Glycogen debranching Glycogen debranching Homo sapiens enzyme enzyme
434310 TLFNVIKSV 2354 2362 Inositol 1 ,4,5-trisphosphate Inositol 1 ,4,5-trisphosphate Homo sapiens receptor type 3 receptor type 3
434384 WQVKSGTIFDNF 319 330 Calreticulin Calreticulin Homo sapiens
434418 YYLNDLERI 155 163 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein G(i) subunit alpha-2 protein G(i) subunit alpha-2
434647 QARLTVSGLA 148 157 65 kDa phosphoprotein 65 kDa phosphoprotein Human
betaherpesvirus 5
435521 RQFPTPFQL 365 373 Zinc finger protein 280D Zinc finger protein 280D Homo sapiens
(UniProt:Q6N043)
435791 VREIAQDF 72 79 Histone H3.3 Histone H3.3 Homo sapiens
436278 AGFAGDDAPR 19 28 Actin, cytoplasmic 1 Actin, cytoplasmic 1 Homo sapiens
436284 AGLAPYKLRPV 42 52 Lactotransferrin Lactotransferrin Homo sapiens
436297 AILEKSDFTM 296 305 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
FANCL (UniProt:Q9NW38) FANCL
436298 AILEKVFTA 81 89 Ceramide synthase 6 Ceramide synthase 6 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
436303 AIQDKLFQV 96 104 MICOS complex subunit MICOS complex subunit Homo sapiens
MIC25 MIC25
436320 ALAEEVEQV 101 109 Apolipoprotein 12 Apolipoprotein L2 Homo sapiens
436324 ALAPGVRAV 70 78 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF1 14 RNF114
436326 ALDEVFTKV 124 132 Neudesin Neudesin Homo sapiens
436329 ALEEPDDQNRI 281 291 Low affinity immunoglobulin Low affinity immunoglobulin Homo sapiens gamma Fc region receptor II- gamma Fc region receptor II- b b
436330 ALFDEQHREEM 1231 1241 Transcription initiation factor Transcription initiation factor Homo sapiens
TFIID subunit 1 TFIID subunit 1
436331 ALFKEAYSL 123 131 Uncharacterized protein Uncharacterized protein Homo sapiens
C1 orf1 12 C1 orf1 12
436332 ALFQHITAL 102 110 JNK1/MAPK8-associated JNK1/MAPK8-associated Homo sapiens membrane protein membrane protein
436335 ALGFVYKL 440 447 Interferon-induced protein Interferon-induced protein Homo sapiens with tetratricopeptide repeats with tetratricopeptide repeats
5 5
436336 ALGHRLDIV 133 141 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 6 ATPase regulatory subunit 6
436338 ALHDHLATI 83 91 Guanylate cyclase soluble Guanylate cyclase soluble Homo sapiens subunit beta-1 subunit beta-1
436339 ALHDRAPQL 290 298 Set1/Ash2 histone Set1/Ash2 histone Homo sapiens methyltransferase complex methyltransferase complex
subunit ASH2 subunit ASH2
(UniProt:Q9UBL3)
436340 AUEDEHNL 725 733 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 14 containing protein 14
436343 ALKDFVASI 79 87 DNA replication licensing DNA replication licensing Homo sapiens factor MCM3 factor MCM3
436351 ALLDNNIGL 826 834 Clustered mitochondria Clustered mitochondria Homo sapiens protein homolog protein homolog
436352 ALLEKGITEA 683 692 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5C 5C
436354 ALLETNPYL 348 356 Cleft lip and palate Cleft lip and palate Homo sapiens transmembrane protein 1 transmembrane protein 1
436356 ALLPLLERV 894 902 Neurobeachin-like protein 2 Neurobeachin-like protein 2 Homo sapiens
(UniProt:Q6ZNJ1)
436357 ALMAHAMEEV 242 251 KH domain-containing, RNA- KH domain-containing, RNA- Homo sapiens binding, signal transduction- binding, signal transduction- associated protein 1 associated protein 1
436358 ALMDQVHHM 349 357 S1 OOP-binding protein S1 OOP-binding protein Homo sapiens
436359 ALMEAVSHA 869 877 Brefeldin A-inhibited guanine Brefeldin A-inhibited guanine Homo sapiens nucleotide-exchange protein nucleotide-exchange protein
2 2
436360 ALMPVLNQV 214 222 Exosome complex Exosome complex Homo sapiens component MTR3 component MTR3
436362 ALNPVANFHL 415 424 Malonyl-CoA decarboxylase, Malonyl-CoA decarboxylase, Homo sapiens mitochondrial mitochondrial
436365 ALPENPPAI 44 52 ATP synthase subunit d, ATP synthase subunit d, Homo sapiens mitochondrial mitochondrial
436366 ALPGDNVGFNV 302 312 Elongation factor 1 -alpha 1 Elongation factor 1 -alpha 1 Homo sapiens
(UniProt:P68104)
436369 ALQDRVPLA 53 61 Ubiquitin-like protein ISG15 Ubiquitin-like protein ISG15 Homo sapiens
436376 ALSDHHVYL 250 258 Fructose-bisphosphate Fructose-bisphosphate Homo sapiens aldolase C aldolase C
436378 ALSDSIHTV 284 292 PR domain zinc finger PR domain zinc finger Homo sapiens protein 4 protein 4
436379 ALSGHLETV 90 98 Annexin A2 Annexin A2 Homo sapiens
436382 ALTDFVRSV 89 97 Protein CutA Protein CutA Homo sapiens
436385 ALVDQRELYL 49 58 Trafficking protein particle Trafficking protein particle Homo sapiens complex subunit 2-like complex subunit 2-like
protein (UniProt:Q9UL33) protein Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
436389 ALYEQSLHI 216 224 COP9 signalosome complex COP9 signalosome complex Homo sapiens subunit 2 subunit 2
436390 ALYSAEHGL 1528 1536 DNA polymerase epsilon DNA polymerase epsilon Homo sapiens catalytic subunit A catalytic subunit A
436391 AMAFITDHV 1128 1136 Leucine-rich repeat Leucine-rich repeat Homo sapiens serine/threonine-protein serine/threonine-protein
kinase 1 kinase 1
436392 AMFDQSQIQEFK 24 35 Myosin regulatory light chain Myosin regulatory light chain Homo sapiens
12B 12B
436606 ATDPTIHTV 450 458 Alpha-1 ,2- Alpha-1 ,2- Homo sapiens mannosyltransferase ALG9 mannosyltransferase ALG9
436704 AVMLHSFTL 84 92 Pre-mRNA-processing factor Pre-mRNA-processing factor Homo sapiens
19 19
436943 DTNADKQLSF 67 76 Protein S100-A9 Protein S100-A9 Homo sapiens
437255 FFISEPLFKLSL 35 46 Secretoglobin family 1 D Secretoglobin family 1 D Homo sapiens member 2 member 2
437271 FIAQKILAL 559 567 Poly [ADP-ri ose] Poly [ADP-ribose] Homo sapiens polymerase 14 polymerase 14
437277 FILEKEGYV 243 251 Hedgehog-interacting protein Hedgehog-interacting protein Homo sapiens
437278 FILPKEIAV 627 635 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 1 complex subunit 1
437279 FIMDRAQAL 199 207 Transportin-2 Transportin-2 Homo sapiens
437302 FLADIVQKL 89 97 Sacsin Sacsin Homo sapiens
437303 FLADNHHQV 1077 1085 Serine-protein kinase ATM Serine-protein kinase ATM Homo sapiens
437304 FLAEDALNTV 885 894 Epithelial discoidin domain- Epithelial discoidin domain- Homo sapiens containing receptor 1 containing receptor 1
437306 FLAKUAQA 178 186 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens theta theta
437307 FLALLAGAHA 8 17 Phospholipid transfer protein Phospholipid transfer protein Homo sapiens
437309 FLDEKTHEL 140 148 Pseudouridylate synthase 7 Pseudouridylate synthase 7 Homo sapiens homolog-like protein homolog-like protein
437310 FLDESRSTQYM 433 443 RuvB-like 2 RuvB-like 2 Homo sapiens
(UniProt:Q9Y230)
437312 FLFDEEMEQM 530 539 La-related protein 1 La-related protein 1 Homo sapiens
437313 FLFNTENKL 57 65 Isopentenyl-diphosphate Isopentenyl-diphosphate Homo sapiens
Delta-isomerase 1 Delta-isomerase 1
437314 FLGPWPAAS 22 30 Alpha-2-macroglobulin Alpha-2-macroglobulin Homo sapiens receptor-associated protein receptor-associated protein
437315 FLGSNTPHV 2686 2694 Inositol 1 ,4,5-trisphosphate Inositol 1 ,4,5-trisphosphate Homo sapiens receptor type 2 receptor type 2
437316 FLHEATVRL 1033 1041 Sterol regulatory element- Sterol regulatory element- Homo sapiens binding protein 2 binding protein 2
437318 FUQEIKTL 1420 1428 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
437320 FLLDGFPRTV 96 105 Adenylate kinase 2, Adenylate kinase 2, Homo sapiens mitochondrial mitochondrial
437321 FLLDKPQDLSI 425 435 Metastasis-associated in Metastasis-associated in Homo sapiens colon cancer protein 1 colon cancer protein 1
437322 FLLEQEKTQAL 164 174 ATR-interacting protein ATR-interacting protein Homo sapiens
437326 FLMELEQPA 202 210 Interferon regulatory factor 7 Interferon regulatory factor 7 Homo sapiens
437327 FLNPDEVHAI 89 98 Protein FAM83D Protein FAM83D Homo sapiens
437331 FLPDPSALQNL 92 102 Other Homo sapiens BRCA1 -A com plex subunit Homo sapiens
(human) protein BRE
437332 FLQELNEKM 438 446 Interferon-induced protein Interferon-induced protein Homo sapiens with tetratricopeptide repeats with tetratricopeptide repeats
2 2
437334 FLSKTEEL 308 315 Keratin, type I cytoskeletal 16 Keratin, type I cytoskeletal 16 Homo sapiens
437335 FLSTSIAQL 28 36 Prefoldin subunit 5 Prefoldin subunit 5 Homo sapiens
437336 FLTDTSHLL 5715 5723 Nesprin-2 Nesprin-2 Homo sapiens
(UniProt:Q8WXH0)
437337 FLWNGSGPQGL 495 505 ETS translocation variant 3 ETS translocation variant 3 Homo sapiens
437339 FLYDTHQDL Unidentified protein unidentified Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
438214 IMQLLRDNLTL 289 299 14-3-3 protein 14-3-3 protein Toxoplasma gondii ME49
438216 IMYDQNHLL 124 132 RNA polymerase-associated RNA polymerase-associated Homo sapiens protein CTR9 homolog protein CTR9 homolog
438217 INDPFIDLNY 33 42 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
438293 IQDNHDGTYTV 1596 1606 Filamin-A Filamin-A Homo sapiens
438308 IQSSHNFQL 83 91 Golgi membrane protein 1 Golgi membrane protein 1 Homo sapiens
438315 IQVTKVTQV 393 401 Coatomer subunit delta Coatomer subunit delta Homo sapiens
438321 IRKLPFQRL 63 71 Histone H3.3 Histone H3.3 Homo sapiens
438371 IVDRPVTLV 34 42 NADH dehydrogenase NADH dehydrogenase Homo sapiens
[ubiquinone] 1 beta [ubiquinone] 1 beta
subcomplex subunit 10 subcomplex subunit 10
438593 KFWESPETV 41 49 SWI/SNF complex subunit SWI/SNF complex subunit Homo sapiens
SMARCC1 SMARCC1
438602 KIAPNTPQL 392 400 Nodal modulator 2 Nodal modulator 2 Homo sapiens
438618 KILPTLEAV 127 135 Interleukin enhancer-binding Interleukin enhancer-binding Homo sapiens factor 2 factor 2
438621 KIQEILTQV 552 560 Insulin-like growth factor 2 Insulin-like growth factor 2 Homo sapiens mRNA-binding protein 3 mRNA-binding protein 3
438629 KIWDVSVNSV 259 268 WD repeat-containing protein WD repeat-containing protein Homo sapiens
1 1
438630 KIYEKTFTL 81 89 Zinc finger protein 567 Zinc finger protein 567 Homo sapiens
438633 KLADAKIFL 42 50 Nuclear prelamin A Nuclear prelamin A Homo sapiens recognition factor recognition factor
438634 KLADQYPHL 1 9 Transcription factor SOX-8 Transcription factor SOX-8 Homo sapiens
438640 KLDAFVEGV 25 33 V-type proton ATPase V-type proton ATPase Homo sapiens subunit C 1 subunit C 1
438643 KLFGETTLV 1298 1306 Kinetochore-associated Kinetochore-associated Homo sapiens protein 1 protein 1
438645 KLFIGGLNV 8 16 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein AO ribonucleoprotein AO
438650 KLGDFGLATV 533 542 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase DCLK2 kinase DCLK2
438652 KLGNAPAEV 44 52 Pre-mRNA-splicing factor Pre-mRNA-splicing factor Homo sapiens
SLU7 SLU7
438655 KLGSVPVTV 623 631 TRPM8 channel-associated TRPM8 channel-associated Homo sapiens factor 1 factor 1
438658 KLHYVVTEV 91 1 919 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
438659 KUDETQDMLL 1375 1385 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
438660 KUEEVHAV 30 38 AP-2 complex subunit sigma AP-2 complex subunit sigma Homo sapiens
438662 KUESTSTM 179 187 SWI/SNF-related matrix- SWI/SNF-related matrix- Homo sapiens associated actin-dependent associated actin-dependent
regulator of chromatin regulator of chromatin
subfamily A containing subfamily A containing
DEAD/H box 1 DEAD/H box 1
438663 KUKSLEAA 19 27 Eukaryotic peptide chain Eukaryotic peptide chain Homo sapiens release factor subunit 1 release factor subunit 1
438668 KLLDPEDISV 249 258 Spectrin beta chain, non- Spectrin beta chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
438669 KLLGELHTL 412 420 Pericentriolar material 1 Pericentriolar material 1 Homo sapiens protein protein
438670 KLLGKVTIA 96 104 Histone H2A type 2-A Histone H2A type 2-A Homo sapiens
438671 KLLGNIKNV 42 50 Peptidyl-prolyl cis-trans Peptidyl-prolyl cis-trans Homo sapiens isomerase FKBP3 isomerase FKBP3
438673 KLLQFYPSL 79 87 Linker for activation of T-cells Linker for activation of T-cells Homo sapiens family member 2 family member 2
438674 KLLSKTPEL 166 174 Calnexin Calnexin Homo sapiens
438677 KLMGQIHQL 484 492 Golgin subfamily A member Golgin subfamily A member Homo sapiens
5 5 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
438680 KLNPGIAYV 39 47 TBC1 domain family member TBC1 domain family member Homo sapiens
13 13
438688 KLQARVVEV 856 864 Tudor domain-containing Tudor domain-containing Homo sapiens protein 1 protein 1
438690 KLQEFLQTL 16 24 Fanconi anemia group I Fanconi anemia group I Homo sapiens protein (UniProt:Q9NVI1 ) protein
438691 KLQELEARV 843 851 Nesprin-3 Nesprin-3 Homo sapiens
438695 KLSEIPLTL 677 685 Tyrosine-protein kinase Tyrosine-protein kinase Homo sapiens
BAZ1 B BAZ1 B
438697 KLVEYIVKA 574 582 PWWP domain-containing PWWP domain-containing Homo sapiens protein MUM1 protein MUM1
438704 KLYHNEVEI 227 235 Structural maintenance of Structural maintenance of Homo sapiens chromosomes protein 1A chromosomes protein 1A
438706 KLYQTPLEL 148 156 Nuclear pore complex protein Nuclear pore complex protein Homo sapiens
Nup98-Nup96 Nup98-Nup96
(UniProt:H7C3P6)
438707 KLYSISSQV 986 994 Pro-interleukin-16 Pro-interleukin-16 Homo sapiens
438708 KLYTTAHHL 246 254 Zinc finger protein 143 Zinc finger protein 143 Homo sapiens
438709 KMADIEYRL 304 312 Replication factor C subunit 5 Replication factor C subunit 5 Homo sapiens
438713 KMLERIPEA 1236 1244 Ninein (UniProt:Q8N4C6) Ninein Homo sapiens
438716 KMVGDVTGAQAY 87 98 Interferon-induced Interferon-induced Homo sapiens transmembrane protein 2 transmembrane protein 2
438717 KMWDPHNDPNA 87 97 U1 small nuclear U1 small nuclear Homo sapiens ribonucleoprotein 70 kDa ribonucleoprotein 70 kDa
438768 KQHGVNVSV 939 947 Ubiquitin-associated protein Ubiquitin-associated protein Homo sapiens
2-like (UniProt:Q14157) 2-like
438774 KQISQAYEV 46 54 DnaJ homolog subfamily A DnaJ homolog subfamily A Homo sapiens member 1 member 1
438791 KQMEQISQFL 88 97 Other Homo sapiens Homo sapiens
(human) protein
438805 KQYGNEVFL 171 179 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens theta theta
438845 KTWGGWTA 274 282 Putative sodium-coupled Putative sodium-coupled Homo sapiens neutral amino acid neutral amino acid
transporter 7 transporter 7
(UniProt:Q9NVC3)
438850 KVAPAPAVV 11 19 60S ribosomal protein L7a 60S ribosomal protein L7a Homo sapiens
438857 KVFGNEIKL 71 79 Nucleolin (UniProt:P19338) Nucleolin Homo sapiens
438867 KVIDEIYRV 172 180 F-box only protein 28 F-box only protein 28 Homo sapiens
438868 KVIDGLETL 120 128 Peptidyl-prolyl cis-trans Peptidyl-prolyl cis-trans Homo sapiens isomerase-like 3 isomerase-like 3
438877 KVKVNKDDIQK 64 74 Myosin-9 Myosin-9 Homo sapiens
438879 KVLGALLFV 81 89 Trafficking protein particle Trafficking protein particle Homo sapiens complex subunit 5 complex subunit 5
438882 KVMDLSIVRL 183 192 Nuclear factor NF-kappa-B Nuclear factor NF-kappa-B Homo sapiens p100 subunit p100 subunit
438891 KVTHAVVTV 146 154 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
438893 KVVALVHAV 179 187 lnterleukin-32 lnterleukin-32 Homo sapiens
(UniProt:P24001)
438944 LDTNADKQL 66 74 Protein S100-A9 Protein S100-A9 Homo sapiens
439015 LIMGFLVLGL 554 563 Desmoglein-1 Desmoglein-1 Homo sapiens
439018 LIRKLPFQRL 62 71 Histone H3.2 Histone H3.2 Homo sapiens
439028 LLADIGGDPFA 225 235 Arf-GAP domain and FG Arf-GAP domain and FG Homo sapiens repeat-containing protein 2 repeat-containing protein 2
439029 LLANKVPAA 102 110 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0 (UniProt:Q3B7A4) P0
439030 LLAPWKEI 984 992 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP2 protein IQGAP2
439033 LLDPSVFHV 333 341 Nucleolar complex protein 4 Nucleolar complex protein 4 Homo sapiens homolog homolog
439034 LLEPFVHQV 18 26 Inositol hexakisphosphate Inositol hexakisphosphate Homo sapiens kinase 2 (UniProt:Q9UHH9) kinase 2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
439035 LLFDQAYQM 515 523 ATPase family AAA domain- ATPase family AAA domain- Homo sapiens containing protein 2 containing protein 2
439036 LLFPESIRV 21 1 219 TBC1 domain family member TBC1 domain family member Homo sapiens
9B 9B
439037 LLFSAFSRA 22 30 Dol-P- Dol-P- Homo sapiens
Glc:Glc(2)Man(9)GlcNAc(2)- Glc:Glc(2)Man(9)GlcNAc(2)- PP-Dol alpha-1 ,2- PP-Dol alpha-1 ,2- glucosyltransferase glucosyltransferase
439040 LLKEVDNLYNI 46 56 Borealin Borealin Homo sapiens
439042 LLLAAPAQA 15 23 Ganglioside GM2 activator Ganglioside GM2 activator Homo sapiens
439043 LLLAQLSDA 25 33 Transmembrane protein 9B Transmembrane protein 9B Homo sapiens
439044 LLLDMQNRL 1049 1057 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
439046 LLNDNIFHM 476 484 Retinoblastoma-associated Retinoblastoma-associated Homo sapiens protein protein
439055 LLWVPGCFA 9 17 CMRF35-like molecule 8 CMRF35-like molecule 8 Homo sapiens
439056 LLYDDKGVGL 432 441 RNA-binding protein 12B RNA-binding protein 12B Homo sapiens
439058 LLYGSIPKA 90 98 Tricarboxylate transport Tricarboxylate transport Homo sapiens protein, mitochondrial protein, mitochondrial
439059 LLYQEGAKMAV 131 141 Junction plakoglobin Junction plakoglobin Homo sapiens
439064 LMISRTPEV 36 44 Immunoglobulin Ig gamma-1 chain C region Homo sapiens
439065 LMLDVEEDRL 361 370 Receptor-type tyrosine- Receptor-type tyrosine- Homo sapiens protein phosphatase R protein phosphatase R
439188 LQFDGIHVV 547 555 F-box/WD repeat-containing F-box/WD repeat-containing Homo sapiens protein 7 protein 7
439231 LTEAPLNPKANR 105 116 Actin, cytoplasmic 1 Actin, cytoplasmic 1 Homo sapiens
439334 MLLDVMHTV 289 297 Poly(A)-specific ribonuclease Poly(A)-specific ribonuclease Homo sapiens
PARN PARN
439335 MLLGNPGLVFS 12 22 Granulysin Granulysin Homo sapiens
439339 MLPPPPLTA 362 370 DNA ligase 1 DNA ligase 1 Homo sapiens
439340 MLTELEKALNSI 1 12 Protein S100-A8 Protein S100-A8 Homo sapiens
439392 MQWGQLLDHDL 253 263 Myeloperoxidase Myeloperoxidase Homo sapiens
439401 MTFLRHRLFL 456 465 Protein FAM214B Protein FAM214B Homo sapiens
439409 MVFKLAQA 77 84 Filaggrin Filaggrin Homo sapiens
439484 NIIEKLQDV 1601 1609 Inositol 1 ,4,5-trisphosphate Inositol 1 ,4,5-trisphosphate Homo sapiens receptor type 2 receptor type 2
439496 NLFGGEPLSYT 11 21 Transferrin receptor protein 1 Transferrin receptor protein 1 Homo sapiens
439497 NLQVTQPTV 116 124 40S ribosomal protein S17 40S ribosomal protein S17 Homo sapiens
439500 NMLEAVHTI 630 638 Dual specificity protein Dual specificity protein Homo sapiens kinase TTK kinase TTK
439553 NSIIDVYHKYSL 33 44 Other Homo sapiens Protein S100-A8 Homo sapiens
(human) protein
439607 PEVAECFDE 642 650 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein U ribonucleoprotein U
439732 QUEKITQV 519 527 Forkhead-associated Forkhead-associated Homo sapiens domain-containing protein 1 domain-containing protein 1
439980 RISDVHFSV 91 99 Chromobox protein homolog Chromobox protein homolog Homo sapiens
6 6
439996 RLASTLVHL 1226 1234 Clathrin heavy chain 1 Clathrin heavy chain 1 Homo sapiens
440002 RLFESSQYL 752 760 Protein MON2 homolog Protein MON2 homolog Homo sapiens
440012 RUQESPTL 293 301 Lysophospholipid Lysophospholipid Homo sapiens acyltransferase 5 acyltransferase 5
440024 RLQDELVTL 476 484 UniProt:F8W8Q1 Homo sapiens
440025 RLQEFIDEV 326 334 Gamma-tubulin complex Gamma-tubulin complex Homo sapiens component s component 5
440026 RLQEKVESA 675 683 Nuclear cap-binding protein Nuclear cap-binding protein Homo sapiens subunit 1 subunit 1
440029 RLQEVTHSV 181 189 Integrin beta-7 Integrin beta-7 Homo sapiens
440036 RLSSVNAEV 779 787 Adhesion G protein-coupled Adhesion G protein-coupled Homo sapiens receptor E1 receptor E1
440037 RLTQTVAHL 99 107 Ubiquitin-like protein ISG15 Ubiquitin-like protein ISG15 Homo sapiens
440043 RLYDKFAEA 109 117 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 30 protein 30 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
440044 RLYGPSSVSF 132 141 Serpin H1 Serpin H1 Homo sapiens
440047 RLYQGINQL 340 348 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Msh2 Msh2
440050 RMIDIQTRM 31 39 Probable 18S rRNA Probable 18S rRNA Homo sapiens
(guanine-N(7))- (guanine-N(7))- methyltransferase methyltransferase
(UniProt:O43709)
440060 RMWEDPMGA 199 207 A-kinase anchor protein 8- A-kinase anchor protein 8- Homo sapiens like like
440257 RVAPEEHPVLLT 85 96 Actin, cytoplasmic 2 Actin, cytoplasmic 2 Homo sapiens
440261 RVDKNAPTV 69 77 Coronin-1A Coronin-1A Homo sapiens
440265 RVFENIVAV 195 203 TNF receptor-associated TNF receptor-associated Homo sapiens factor 1 factor 1
440276 RVIGTLEEV 205 213 Ran GTPase-activating Ran GTPase-activating Homo sapiens protein 1 protein 1
440522 SIAAVLPKV 251 259 Serine incorporator 2 Serine incorporator 2 Homo sapiens
440561 SLAQYUNV 315 323 Poly(rC)-binding protein 2 Poly(rC)-binding protein 2 Homo sapiens
(UniProt:Q15366)
440562 SLASHIQSL 859 867 WD repeat- and FYVE WD repeat- and FYVE Homo sapiens domain-containing protein 4 domain-containing protein 4
(UniProt:Q6ZS81 )
440563 SLASPSRAASQL 292 303 Ubiquitin conjugation factor Ubiquitin conjugation factor Homo sapiens
E4 B E4 B
440564 SLDAKEIYL 287 295 DnaJ homolog subfamily C DnaJ homolog subfamily C Homo sapiens member 10 member 10
440565 SLDQPTQTV 246 254 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit C initiation factor 3 subunit C
440569 SLIEQTTAL 28 36 FGFR1 oncogene partner 2 FGFR1 oncogene partner 2 Homo sapiens
440570 SUKQIPRI 115 123 60S ribosomal protein L10a 60S ribosomal protein L10a Homo sapiens
440574 SLLDDLHSA 362 370 Protein zyg-1 1 homolog B Protein zyg-1 1 homolog B Homo sapiens
440575 SLLESNKDLLL 390 400 4F2 cell-surface antigen 4F2 cell-surface antigen Homo sapiens heavy chain heavy chain
(UniProt:P08195)
440577 SLLPEGPPAI 379 388 Homocysteine-responsive Homocysteine-responsive Homo sapiens endoplasmic reticulum- endoplasmic reticulum- resident ubiquitin-like domain resident ubiquitin-like domain member 1 protein member 1 protein
440578 SLLPTSPRL 248 256 Bromodomain-containing Bromodomain-containing Homo sapiens protein 8 (UniProt:H7C127) protein 8
440579 SLLQDGEFSM 77 86 Profilin-1 Profilin-1 Homo sapiens
440580 SLLSELQHA 565 573 Guanylate-binding protein 5 Guanylate-binding protein 5 Homo sapiens
440582 SLLSQQPFL 1320 1328 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 12-like II transcription subunit 12-like protein (UniProt:F8WAE6) protein
440583 SLMQAPLUA 3 12 Ganglioside GM2 activator Ganglioside GM2 activator Homo sapiens
440584 SLNHFTHSV 826 834 Terminal uridylyltransferase Terminal uridylyltransferase Homo sapiens
7 7
440588 SLSPIYPAA 850 858 DNA ligase 1 DNA ligase 1 Homo sapiens
440589 SLTGRLDEV 146 154 Signal transducer and Signal transducer and Homo sapiens activator of transcription 6 activator of transcription 6
440590 SLVEQLTMV 262 270 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 24 II transcription subunit 24
(UniProt:075448)
440591 SLVSSLYKV 36 44 Hyccin (UniProt:Q9BYI3) Hyccin Homo sapiens
440592 SLWPSPEQL 74 82 Growth arrest and DNA Growth arrest and DNA Homo sapiens damage-inducible proteins- damage-inducible proteins- interacting protein 1 interacting protein 1
440594 SLYEGIDFYT 288 297 Heat shock 70 kDa protein 1 - Heat shock 70 kDa protein 1 - Homo sapiens like like
440605 SMFDQSQIQEFK 45 56 Myosin regulatory light chain Myosin regulatory light chain Homo sapiens
10 10
440608 SMMQTLLTV 25 33 Melanoma-associated Melanoma-associated Homo sapiens antigen D2 antigen D2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
440742 SQTFVNPHV 34 42 Inactive serine/threonine- Inactive serine/threonine- Homo sapiens protein kinase VRK3 protein kinase VRK3
440744 SQWDSPMRV 2961 2969 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13B associated protein 13B
440927 TADEVHYFL 92 100 Pleckstrin Pleckstrin Homo sapiens
441071 TLAETLVNL 603 611 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 6 regulatory phosphatase 6 regulatory
ankyrin repeat subunit C ankyrin repeat subunit C
441072 TLASIIKEV 685 693 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
441073 TLASSLHTL 19 27 Leucine-rich repeat- Leucine-rich repeat- Homo sapiens containing protein 41 containing protein 41
441074 TLFPSKIGV 98 106 MOB kinase activator 1A MOB kinase activator 1A Homo sapiens
441076 TLGSTVFRV 1555 1563 A-kinase anchor protein 11 A-kinase anchor protein 1 1 Homo sapiens
441077 TLISRLPAV 339 347 Regulator of chromosome Regu lator of ch romosome Homo sapiens condensation condensation
441082 TLMAEMHVV 142 150 Nucleosome-remodeling Nucleosome-remodeling Homo sapiens factor subunit BPTF factor subunit BPTF
(UniProt:E7ETD6)
441083 TLMDILPRI 1360 1363 WD repeat-containing protein WD repeat-containing protein Homo sapiens
81 81
441084 TLMEALHYM 56 64 Exportin-1 (UniProt:O14980) Exportin-1 Homo sapiens
441085 TLPEVAECF 640 648 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein U ribonucleoprotein U
441086 TLQEQIEAI 521 529 Splicing factor 3A subunit 1 Splicing factor 3A subunit 1 Homo sapiens
(UniProt:Q15459)
441090 TLVDEVFRI 18 26 Replication protein A 32 kDa Replication protein A 32 kDa Homo sapiens subunit subunit
441091 TLVDFDNHL 182 190 ER membrane protein ER membrane protein Homo sapiens complex subunit 8 complex subunit 8
441092 TLWPEVQKL 555 563 Elongator complex protein 2 Elongator complex protein 2 Homo sapiens
441093 TLYDHVDEV 168 176 Cleavage stimulation factor Cleavage stimulation factor Homo sapiens subunit 1 subunit 1
441094 TLYRIFNNK 108 116 Exosome complex Exosome complex Homo sapiens component RRP42 component RRP42
441 192 TVAEKVDAV 3 11 Lys-63-specific Lys-63-specific Homo sapiens deubiquitinase BRCC36 deubiquitinase BRCC36
441 199 TVFEHTFHV 587 595 Glycine— tRNA ligase Glycine-tRNA ligase Homo sapiens
441210 TVLEKVYEL 169 177 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
441306 VELDDLGKDEL 41 1 421 Protein disulfide-isomerase Protein disulfide-isomerase Homo sapiens
A6 A6
441359 VIAEILRGV 117 125 Nucleolar protein 56 Nucleolar protein 56 Homo sapiens
441361 VIDGHIYAV 420 428 Kelch-like ECH-associated Kelch-like ECH-associated Homo sapiens protein 1 protein 1
441362 VIDQKVYEI 83 91 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit L initiation factor 3 subunit L
(UniProt:Q9Y262)
441385 VIYPARISL 254 262 DnaJ homolog subfamily B DnaJ homolog subfamily B Homo sapiens member 1 member 1
441400 VKVNKDDIQK 65 74 Myosin-9 Myosin-9 Homo sapiens
441401 VLAEKLAAI 1820 1828 Plectin Plectin Homo sapiens
441402 VLDDSTAKL 854 862 Protein Daple Protein Daple Homo sapiens
441404 VLEGKELEFYL 189 199 40S ribosomal protein S8 40S ribosomal protein S8 Homo sapiens
441405 VLHEGTNFV 99 107 Integrin-linked protein kinase Integrin-linked protein kinase Homo sapiens
(UniProt:Q13418)
44141 1 VLLAAGPSAA 15 24 Nuclear pore membrane Nuclear pore membrane Homo sapiens glycoprotein 210 glycoprotein 210
441413 VLLDHLSLA 14 22 lnterleukin-12 subunit alpha lnterleukin-12 subunit alpha Homo sapiens
(UniProt:P29459)
441414 VLLEQEKTFFT 5 15 Tumor necrosis factor Tumor necrosis factor Homo sapiens receptor superfamily member receptor superfamily member
19 19 Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
441415 VLLEQPTWQL 210 219 Protein CNPPD1 Protein CNPPD1 Homo sapiens
441417 VLLFIEHSV 33 41 Lysosomal-associated Lysosomal-associated Homo sapiens transmembrane protein 5 transmembrane protein 5
441423 VLTEHVAAA 52 60 2'-deoxynucleoside 5'- 2'-deoxynucleoside 5'- Homo sapiens phosphate N-hydrolase 1 phosphate N-hydrolase 1
441426 VLVEPDAGAGV 47 57 Enoyl-CoA delta isomerase Enoyl-CoA delta isomerase Homo sapiens
1 , mitochondrial 1 , mitochondrial
441430 VLYPASPHGV 56 65 Docking protein 1 Docking protein 1 Homo sapiens
441431 VLYSIAEKV 44 52 Thioredoxin-like protein 4A Thioredoxin-like protein 4A Homo sapiens
441436 VMLQINPKL 51 59 Girdin Girdin Homo sapiens
441437 VMQDIVYKL 91 99 Polycomb group RING finger Polycomb group RING finger Homo sapiens protein 1 protein 1
441438 VMQDPEFLQSV 259 269 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 4 ATPase regulatory subunit 4
441445 VNLPINGNGKQ 200 210 Glutathione S-transferase P Glutathione S-transferase P Homo sapiens
(UniProt:P0921 1)
441598 VVDAGKVTL 15 23 Schlafen family member 5 Schlafen family member 5 Homo sapiens
441620 VVLSYVKEI 207 215 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 41 associated protein 41
homolog homolog
441621 VVMNVVHQL 157 165 WASH complex subunit 7 WASH complex subunit 7 Homo sapiens
441624 VVNDRSWKV 118 126 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 58 containing protein 58
441636 VVVEYLRAV 328 336 Exocyst complex component Exocyst complex component Homo sapiens
3 (UniProt:O60645) 3
441671 WLTKVSQPA 525 533 AF4/FMR2 family member 1 AF4/FMR2 family member 1 Homo sapiens
(UniProt:P51825)
441693 YALPHAILRL 169 178 Actin, cytoplasmic 1 Actin, cytoplasmic 1 Homo sapiens
441701 YAYDGKDYLA 140 149 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, alpha chain G antigen, alpha chain G
441702 YAYDGKDYLAL 140 150 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, alpha chain G antigen, alpha chain G
441802 YGAEALERMFL 25 35 Hemoglobin subunit alpha Hemoglobin subunit alpha Homo sapiens
441822 YIFPLDDKAAV 657 667 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 4 polymerase 4
441857 YLLEQTPEQQA 377 387 Interferon regulatory factor 9 Interferon regulatory factor 9 Homo sapiens
441858 YLLTHLPAV 17 25 Kelch-like protein 33 Kelch-like protein 33 Homo sapiens
441859 YLQDYTDRV 192 200 Splicing factor 3A subunit 3 Splicing factor 3A subunit 3 Homo sapiens
441860 YLQEIQTQL 563 571 Sentrin-specific protease 7 Sentrin-specific protease 7 Homo sapiens
441862 YLRPPNTSL 4 12 Serine/arginine-rich splicing Serine/arginine-rich splicing Homo sapiens factor 10 factor 10
441865 YLYESGETEKL 48 58 Regulator of microtubule Regulator of microtubule Homo sapiens dynamics protein 1 dynamics protein 1
(UniProt:Q96DB5)
441959 YQSKYEEL 373 380 Keratin, type II cytoskeletal 1 Keratin, type II cytoskeletal 1 Homo sapiens
441964 YQTKYEEL 356 363 Horn s 5 Horn s 5 Homo sapiens
441976 YSDDIPHAL 62 70 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit E initiation factor 3 subunit E
44201 1 YVFENTVATV 497 506 Alanine-tRNA ligase, Alanine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
442065 AAAPVVPAV 100 108 Tankyrase-1 Tankyrase-1 Homo sapiens
442078 AALPNVYEV 326 334 DNA replication licensing DNA replication licensing Homo sapiens factor MCM5 factor MCM5
442239 AIAPIIAAV 176 184 Zinc phosphodiesterase Zinc phosphodiesterase Homo sapiens
ELAC protein 2 ELAC protein 2
442240 AIDPHLLLSV 274 283 Sister chromatid cohesion Sister chromatid cohesion Homo sapiens protein PDS5 homolog A protein PDS5 homolog A
442241 AIIESTPEL 343 351 C-Jun-amino-terminal C-Jun-amino-terminal Homo sapiens kinase-interacting protein 4 kinase-interacting protein 4
(UniProt:O60271)
442242 AIIEYMPLL 422 430 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2A 65 kDa phosphatase 2A 65 kDa Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
regulatory subunit A alpha regulatory subunit A alpha
isoform isoform
442243 AIISELVSI 650 658 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 2 initiation factor 4 gamma 2
442246 AILGPTFTL 162 170 3-hydroxy-3-methylglutaryl- 3-hydroxy-3-methylglutaryl- Homo sapiens coenzyme A reductase coenzyme A reductase
442248 AILTTUHL 622 630 lmportin-1 1 lmportin-1 1 Homo sapiens
442250 AINPKLLQL 466 474 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX5 RNA helicase DDX5
(UniProt:P17844)
442258 ALAEALKEV 43 51 Protein SHQ1 homolog Protein SHQ1 homolog Homo sapiens
442259 ALAUYNEAL 79 88 Protein S100-A6 Protein S100-A6 Homo sapiens
442260 ALANQIPTV 789 797 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Msh2 Msh2
442261 ALAPSTMKIKI 319 329 Actin, cytoplasmic 1 Actin, cytoplasmic 1 Homo sapiens
442263 ALASHUEA 507 515 EH domain-containing EH domain-containing Homo sapiens protein 2 protein 2
442264 ALASURSV 199 207 Carboxypeptidase Q Carboxypeptidase Q Homo sapiens
442265 ALASVIMGL 334 342 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2A 65 kDa phosphatase 2A 65 kDa
regulatory subunit A alpha regulatory subunit A alpha
isoform isoform
442267 ALDEKLLNI 195 203 Cleavage and Cleavage and Homo sapiens polyadenylation specificity polyadenylation specificity
factor subunit 1 factor subunit 1
442268 ALDESHNQNL 901 910 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase 10 kinase 10
442269 ALDFEQEMATAA 220 231 Actin, cytoplasmic 1 Actin, cytoplasmic 1 Homo sapiens
442270 ALDPAAQAFL 166 175 Protein phosphatase 1 Protein phosphatase 1 Homo sapiens regulatory subunit 15B regulatory subunit 15B
442271 ALDPLADKIU 167 177 Cardiolipin synthase (CMP- Cardiolipin synthase (CMP- Homo sapiens forming) forming)
442272 ALDPNIATL 152 160 Other Homo sapiens Splicing regulatory Homo sapiens
(human) protein glutamine/lysine-rich protein
1
442274 ALDSTNVEA 155 163 Ras-related protein Rab-11A Ras-related protein Rab-1 1A Homo sapiens
(UniProt:P62491)
442275 ALDTINILL 1687 1695 AT-rich interactive domain- AT-rich interactive domain- Homo sapiens containing protein 1A containing protein 1A
442277 ALDTNQVLL 433 441 Neurotrophin receptor- Neurotrophin receptor- Homo sapiens interacting factor homolog interacting factor homolog
442278 ALFARPDLLLL 341 351 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 3 family F member 3
442280 ALFEEVPEL 510 518 Bifunctional purine Bifunctional purine Homo sapiens biosynthesis protein PURH biosynthesis protein PURH
442281 ALFEQKGPVYV 75 85 Sodium/potassium- Sodium/potassium- Homo sapiens transporting ATPase subunit transporting ATPase subunit beta-3 beta-3
442282 ALFGTILEL 256 264 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein subunit alpha-15 protein subunit alpha-15
442285 ALFPAPLAQI 467 476 RING finger protein 214 RING finger protein 214 Homo sapiens
442286 ALFPGVALL 7 15 Protein disulfide-isomerase Protein disulfide-isomerase Homo sapiens
A3 A3
442287 ALFPHLLQPVL 684 694 Exportin-2 Exportin-2 Homo sapiens
442288 ALFPLLPKV 596 604 Zinc finger BED domain- Zinc finger BED domain- Homo sapiens containing protein 1 containing protein 1
442289 ALFTKVLENV 1466 1475 Phosphatidylinositol 3,4,5- Phosphatidylinositol 3,4,5- Homo sapiens trisphosphate-dependent trisphosphate-dependent
Rac exchanger 1 protein Rac exchanger 1 protein
442292 ALHDQLFYL 314 322 Prenylcysteine oxidase-like Prenylcysteine oxidase-like Homo sapiens
442293 ALHSVEVEL 1084 1092 Diacylglycerol kinase eta Diacylglycerol kinase eta Homo sapiens
(UniProt:Q9BRA0) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
442743 AQGGVLPNIQAV 104 115 Histone H2A type 1 -B/E Histone H2A type 1 -B/E Homo sapiens
442749 AQYEHDLEVA 195 204 GTP-binding nuclear protein GTP-binding nuclear protein Homo sapiens
Ran Ran
442918 ASVDKVLEL 200 208 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein D-like ribonucleoprotein D-like
442934 ATIGELAQV 800 808 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase mTOR kinase mTOR
442946 ATMPVVPSV 36 44 Endophilin-B2 Endophilin-B2 Homo sapiens
442965 AVAASKERSGV 47 57 Histone H 1.4 Histone H 1.4 Homo sapiens
442968 AVANIVNSV 305 3i3 Apoptosis-inducing factor 2 Apoptosis-inducing factor 2 Homo sapiens
442978 AVGPYIQV 345 352 Apoptosis-stimulating of p53 Apoptosis-stimulating of p53 Homo sapiens protein 1 protein 1
442985 AVLGPLGLQEV 108 118 Thiamine-triphosphatase Thiamine-triphosphatase Homo sapiens
442986 AVLSKEYGFVL 2 12 Microsomal glutathione S- Microsomal glutathione S- Homo sapiens transferase 3 transferase 3
(UniProt:O14880)
442987 AVMEQIPEI 11 13 1121 Exportin-5 Exportin-5 Homo sapiens
443008 AVTGILVQL 1151 1159 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF123 RNF123
443207 DMYEQFQNI 331 339 Signal recognition particle 54 Signal recognition particle 54 Homo sapiens kDa protein kDa protein
443727 FAIDPHLLLSV 273 283 Sister chromatid cohesion Sister chromatid cohesion Homo sapiens protein PDS5 homolog A protein PDS5 homolog A
443728 FAIPMIHAV 247 255 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX24 helicase DDX24
443730 FAMPYFIQV 1594 1602 Clathrin heavy chain 1 Clathrin heavy chain 1 Homo sapiens
443787 FGSAFATPFL 45 54 Cytochrome c oxidase Cytochrome c oxidase Homo sapiens subunit 7C, mitochondrial subunit 7C, mitochondrial
443856 FIFPASNVYL 1466 1475 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-X terminal hydrolase FAF-X
443857 FIIANIPLP 793 801 Sodium/potassium- Sodium/potassium- Homo sapiens transporting ATPase subunit transporting ATPase subunit alpha-1 alpha-1
443858 FIISDFESV 249 257 Endoplasmic reticulum Endoplasmic reticulum Homo sapiens aminopeptidase 1 aminopeptidase 1
443859 FILPFIIAA 183 191 Cytochrome b Cytochrome b Homo sapiens
443860 FILPFVSV 142 149 DNA polymerase theta DNA polymerase theta Homo sapiens
443861 FILPSSLYL 431 439 Sodium-coupled neutral Sodium-coupled neutral Homo sapiens amino acid transporter 1 amino acid transporter 1
443862 FIPVALFV 89 96 NADH-ubiquinone NADH-ubiquinone Homo sapiens oxidoreductase chain 5 oxidoreductase chain 5
443863 FIWKSGGDLTL 698 708 WD repeat-containing protein Homo sapiens
48
443864 FIWPMUHI 307 315 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX42 helicase DDX42
443865 FIYPSNMQTML 472 482 Nuclear fragile X mental Nuclear fragile X mental Homo sapiens retardation-interacting protein retardation-interacting protein
2 2
443867 FIYTGTLNL 79 87 Myoneurin Myoneurin Homo sapiens
443873 FLADAKWIL 213 221 Protein kinase C-binding Protein kinase C-binding Homo sapiens protein 1 (UniProt:Q9ULU4) protein 1
443874 FLADLLHSV 185 193 ER-retrevial receptor Ter1 p, ER-retrevial receptor Ter1 p, Toxoplasma putative putative gondii
443875 FLADPSAFVA 268 277 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0-like P0-like
443876 FLAELPGSLSL 362 372 Zinc finger protein PLAGL2 Homo sapiens
443877 FLAPARAILSL 172 182 Solute carrier family 23 Solute carrier family 23 Homo sapiens member 2 member 2
443878 FLDGNELT 167 174 Chloride intracellular channel Chloride intracellular channel Homo sapiens protein 1 protein 1
443879 FLDHVMYTI 429 437 DNA-binding protein Ikaros DNA-binding protein Ikaros Homo sapiens
443881 FLDLGPPGI 77 85 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF216 RNF216 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
443882 FLDNLHINL 97 105 UDP-glucose:glycoprotein UDP-glucose:glycoprotein Homo sapiens glucosyltransferase 2 glucosyltransferase 2
443883 FLDRALLTL 27 35 CGI-141 protein homolog, CGI-141 protein homolog, Toxoplasma putative putative gondii
443884 FLDSTSPLL 801 809 Proteasome-associated Proteasome-associated Homo sapiens protein ECM29 homolog protein ECM29 homolog
443885 FLDTLKVLV 86 94 Cyclin-dependent kinase 4 Cyclin-dependent kinase 4 Homo sapiens inhibitor D inhibitor D
443886 FLFDHLLT 218 225 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit M initiation factor 3 subunit M
443887 FLFDHLLTL 218 226 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit M initiation factor 3 subunit M
443888 FLFDKVVIV 428 436 Guanine nucleotide Guanine nucleotide Homo sapiens exchange factor VAV2 exchange factor VAV2
443889 FLFDNDFPAL 93 102 Galactose-1 -phosphate Galactose-1-phosphate Homo sapiens uridylyltransferase uridylyltransferase
443890 FLFDTQHFI 2003 2011 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 1 (UniProt:Q9H583) protein 1
443891 FLFPVYPLI 371 379 Alpha-1 ,2- Alpha-1 ,2- Homo sapiens mannosyltransferase ALG9 mannosyltransferase ALG9
443892 FLGASLKDEVL 97 107 40S ribosomal protein S2 40S ribosomal protein S2 Homo sapiens
(UniProt:P15880)
443893 FLGENISNFL 257 266 Apolipoprotein L1 Apolipoprotein L1 Homo sapiens
443894 FLHDHVDLQV 819 828 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 2 initiation factor 4 gamma 2
443895 FLHEVLWEL 56 64 Probable helicase senataxin Probable helicase senataxin Homo sapiens
443896 FUAQLPKL 1046 1054 WASH complex subunit WASH complex subunit Homo sapiens strumpellin strumpellin
443897 FUETGPRGV 1527 1536 Tensin-1 Tensin-1 Homo sapiens
443898 FUKVNTEN 575 583 NudC domain-containing NudC domain-containing Homo sapiens protein 1 protein 1
443899 FUNFIHTL 395 403 Plexin-B2 Plexin-B2 Homo sapiens
443900 FUNTNSEL 376 384 cAMP-specific 3',5'-cyclic cAMP-specific 3',5'-cyclic Homo sapiens phosphodiesterase 4B phosphodiesterase 4B
443901 FUPAVEU 173 181 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX18 helicase DDX18
443902 FUPFVITV 202 210 P2Y purinoceptor 8 P2Y purinoceptor 8 Homo sapiens
443903 FLIQQKLVEA 507 516 FERM domain-containing FERM domain-containing Homo sapiens protein 4B protein 4B
443904 FURNIPVI 154 162 Mitochondrial Mitochondrial Homo sapiens sodium/hydrogen exchanger sodium/hydrogen exchanger
9B2 (UniProt:Q86UD5) 9B2
443905 FUTQLKML 21 29 ATP synthase protein 8 ATP synthase protein 8 Homo sapiens
443907 FLKEYLHFV 424 432 Enhancer of filamentation 1 Enhancer of filamentation 1 Homo sapiens
443908 FLKNELDNV 78 86 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRAIP TRAIP
443909 FLLALEPEL 69 77 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide-- diphosphooligosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit 1 (UniProt:P04843) subunit 1
443910 FLLDGKVLSL 327 336 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase 11 -interacting protein kinase 11 -interacting protein
44391 1 FLLDKALU 428 436 Proto-oncogene vav Proto-oncogene vav Homo sapiens
443912 FLLDPYKYMTL 291 301 Tyrosine-protein kinase Tyrosine-protein kinase Homo sapiens
BAZ1 B BAZ1 B
443913 FLLDSAPLNV 660 669 WD repeat-containing protein WD repeat-containing protein Homo sapiens
36 36
443914 FLLEPGNLEV 1152 1161 Neurobeachin-like protein 2 Neurobeachin-like protein 2 Homo sapiens
(UniProt:Q6ZNJ1)
443915 FLLGPRLVLA 31 40 Transmembrane emp24 Transmembrane emp24 Homo sapiens domain-containing protein 10 domain-containing protein 10
(UniProt:G3V2K7) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
443916 FLLPAGWIL 51 59 Cytochrome c oxidase Cytochrome c oxidase Homo sapiens subunit 8A, mitochondrial subunit 8A, mitochondrial
443917 FLLPDVIRI 329 337 TBC1 domain family member TBC1 domain family member Homo sapiens
13 13
443918 FLLPHPGLQV 263 272 Atlastin-3 Atlastin-3 Homo sapiens
443919 FLLPKVQSIQL 206 216 Transmembrane protein 131 - Transmembrane protein 131 - Homo sapiens like (UniProt:A2VDJ0) like
443920 FLLPLRIAL 174 182 Glycerol-3-phosphate Glycerol-3-phosphate Homo sapiens acyltransferase 4 acyltransferase 4
443921 FLLPPVFNI 331 339 Interferon alpha/beta Interferon alpha/beta Homo sapiens receptor 1 receptor 1
443922 FLLPSEVPAL 113 122 Rotatin Rotatin Homo sapiens
443923 FLLPTGVYL 24 32 Phosphatidylinositol 4,5- Phosphatidylinositol 4,5- Homo sapiens bisphosphate 3-kinase bisphosphate 3-kinase
catalytic subunit delta catalytic subunit delta
isoform (UniProt:O00329) isoform
443924 FLLPVAVKL 223 231 LETM1 and EF-hand LETM1 and EF-hand Homo sapiens domain-containing protein 1 , domain-containing protein 1 , mitochondrial mitochondrial
443925 FLLPVINEM 27 35 MORF4 family-associated MORF4 family-associated Homo sapiens protein 1 -like 1 protein Mike 1
443926 FLMPATVFM 166 174 Transmembrane protein 33 Transmembrane protein 33 Homo sapiens
443927 FLMPGLAAL 330 338 Solute carrier family 22 Solute carrier family 22 Homo sapiens member 23 member 23
443928 FLMQYPGRSL 582 591 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX24 helicase DDX24
443929 FLNDEVWNL 284 292 Quinone oxidoreductase-like Quinone oxidoreductase-like Homo sapiens protein 1 (UniProt:095825) protein 1
443931 FLNGLEIL 3773 3780 Midasin Midasin Homo sapiens
443932 FLNGLEILL 3773 3781 Midasin Midasin Homo sapiens
443933 FLNNQEYVL 1184 1192 Spectrin beta chain, non- Spectrin beta chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
443934 FLNQAQIEV 196 204 Dual specificity tyrosine- Dual specificity tyrosine- Homo sapiens phosphorylation-regulated phosphorylation-regulated
kinase 1A kinase 1A
443935 FLNVTSVHL 45 53 Coagulation factor XI II A Coagulation factor XIII A Homo sapiens chain chain
443936 FLPESVAVV 86 94 Sodium/hydrogen exchanger Sodium/hydrogen exchanger Homo sapiens
8 8
443937 FLPUVNTV 2634 2642 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13C associated protein 13C
443938 FLPPLPTSV 96 104 Bifunctional coenzyme A Bifunctional coenzyme A Homo sapiens synthase synthase
443939 FLPPPFPPP 550 558 RNA-binding protein EWS RNA-binding protein EWS Homo sapiens
(UniProt:Q01844)
443940 FLPPSFPIV 87 95 Arginyl aminopeptidase-like 1 Arginyl aminopeptidase-like 1 Homo sapiens
443941 FLPPYTFQI 66 74 snRNA-activating protein snRNA-activating protein Homo sapiens complex subunit 1 complex subunit 1
443942 FLQDIPDGLFL 286 296 Phosphatidylinositol 4- Phosphatidylinositol 4- Homo sapiens phosphate 5-kinase type-1 phosphate 5-kinase type-1
alpha alpha
443943 FLQEGDLISA 134 143 Exosome complex Exosome complex Homo sapiens component RRP4 component RRP4
443944 FLQEYGLSV 464 472 NEDD8-activating enzyme NEDD8-activating enzyme Homo sapiens
E1 regulatory subunit E1 regulatory subunit
(UniProt:Q13564)
443947 FLSDGTIISV 203 212 Cirhin Cirhin Homo sapiens
443948 FLSEKLERI 154 162 15 kDa selenoprotein 15 kDa selenoprotein Homo sapiens
(UniProt:O60613)
443949 FLSESVLAV 212 220 p21-activated protein kinase- p21 -activated protein kinase- Homo sapiens interacting protein 1 interacting protein 1
443950 FLSPFNMIL 60 68 PRA1 family protein 3 PRA1 family protein 3 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
443951 FLSSVIQNL 260 268 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 1 ATPase regulatory subunit 1
443952 FLSTINVGL 46 54 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member A (UniProt:P39687) member A
443953 FLSTLHEVYL 561 570 mRNA-decapping enzyme mRNA-decapping enzyme Homo sapiens
1A (UniProt:Q9NPI6) 1A
443954 FLTEIENL 797 804 Histone H2A deubiquitinase Histone H2A deubiquitinase Homo sapiens
MYSM1 MYSM1
443955 FLTHVNPRL 1186 1194 CST complex subunit CTC1 CST complex subunit CTC1 Homo sapiens
443956 FLVDSQFM 138 145 GPN-loop GTPase 3 GPN-loop GTPase 3 Homo sapiens
443957 FLVPVLEAL 123 131 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX10 RNA helicase DDX10
(UniProt:Q13206)
443958 FLWDEGFHQL 448 457 Mannosyl-oligosaccharide Mannosyl-oligosaccharide Homo sapiens glucosidase glucosidase
443959 FLWDVPSNWTL 1632 1642 Fatty acid synthase Fatty acid synthase Homo sapiens
443960 FLWERPTLL 246 254 rRNA methyltransferase 1 , rRNA methyltransferase 1 , Homo sapiens mitochondrial mitochondrial
443961 FLWERPTLLV 246 255 rRNA methyltransferase 1 , rRNA methyltransferase 1 , Homo sapiens mitochondrial mitochondrial
443962 FLWPGLNVPL 139 148 28S ribosomal protein S5, 28S ribosomal protein S5, Homo sapiens mitochondrial mitochondrial
443963 FLWQEGHSAFA 1167 1177 Bifunctional Bifunctional Homo sapiens glutamate/proline-tRNA glutamate/proline-tRNA
ligase ligase
443964 FLYPFLHTV 103 111 Cell differentiation protein Cell differentiation protein Homo sapiens
RCD1 homolog RCD1 homolog
443965 FLYPFPLA 141 148 Transmembrane protein 41 B Transmembrane protein 41 B Homo sapiens
443967 FLYQYSTRL 78 86 Derlin-1 Derlin-1 Homo sapiens
443968 FLYSDEVQI 135 143 BTB/POZ domain-containing BTB/POZ domain-containing Homo sapiens protein 1 protein 1
443969 FLYSGEPTYL 260 269 Ceroid-lipofuscinosis Ceroid-lipofuscinosis Homo sapiens neuronal protein 5 neuronal protein 5
443970 FMAPKAWTV 605 613 Bifunctional 3'- Bifunctional 3'- Homo sapiens phosphoadenosine 5'- phosphoadenosine 5'- phosphosulfate synthase 1 phosphosulfate synthase 1
443971 FMAQALQEYNN 342 352 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit H initiation factor 3 subunit H
443972 FMLPDPQNI 159 167 tRNA-splicing endonuclease tRNA-splicing endonuclease Homo sapiens subunit Sen15 subunit Sen15
443973 FMLPDPQNISL 159 169 tRNA-splicing endonuclease tRNA-splicing endonuclease Homo sapiens subunit Sen15 subunit Sen15
443974 FMNPHUSV 435 443 Intraflagellar transport protein Intraflagellar transport protein Homo sapiens
172 homolog 172 homolog
443975 FMQDPMEIFV 242 251 Spliceosome RNA helicase Spliceosome RNA helicase Homo sapiens
DDX39B DDX39B
443976 FMVDKAIYL 187 195 Ecto-NOX disulfide-thiol Ecto-NOX disulfide-thiol Homo sapiens exchanger 1 exchanger 1
443977 FMYPVVLQV 371 379 Cadherin-like and PC- Cadherin-like and PC- Homo sapiens esterase domain-containing esterase domain-containing
protein 1 protein 1
444038 FQAEIAQLM 17 25 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens beta beta
444039 FQDPVPLTV 924 932 Transcription intermediary Transcription intermediary Homo sapiens factor 1 -alpha factor 1 -alpha
444041 FQIGPVAGV 816 824 Adhesion G protein-coupled Adhesion G protein-coupled Homo sapiens receptor E1 receptor E1
444046 FQTDLIYNL 756 764 Leucyl-cystinyl Leucyl-cystinyl Homo sapiens aminopeptidase aminopeptidase
444047 FQVPWLESV 342 350 Nicotinate Nicotinate Homo sapiens phosphoribosyltransferase phosphoribosyltransferase
(UniProt:Q8NB78)
r ose poymerase r ose poymerase Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
445091 ILLSGIYNV 151 159 PH domain leucine-rich PH domain leucine-rich Homo sapiens repeat-containing protein repeat-containing protein
phosphatase 2 phosphatase 2
445092 ILLSVPLLV 1032 1040 Coatomer subunit alpha Coatomer subunit alpha Homo sapiens
445093 ILLSVPLLVV 1032 1041 Coatomer subunit alpha Coatomer subunit alpha Homo sapiens
445095 ILMDPSPEYA 487 496 DNA (cytosine-5)- DNA (cytosine-5)- Homo sapiens methyltransferase 1 methyltransferase 1
445097 ILMSYDHVEL 21 30 WW domain-binding protein WW domain-binding protein Homo sapiens
2 (UniProt:Q969T9) 2
445099 ILNPDNSFEIL 241 251 Calnexin Calnexin Homo sapiens
445100 ILNPEVVTV 898 906 Protein TASOR Protein TASOR Homo sapiens
445101 ILNPLLTLL 207 215 Importin subunit alpha-7 Importin subunit alpha-7 Homo sapiens
445103 ILPVPAFNV 84 92 Alpha-enolase Alpha-enolase Homo sapiens
445104 ILQDLQPFLV 746 755 Werner syndrome ATP- Werner syndrome ATP- Homo sapiens dependent helicase dependent helicase
445105 ILQNGLETL 46 54 Kelch-like protein 6 Kelch-like protein 6 Homo sapiens
445106 ILSETELHV 846 854 FRAS1 -related extracellular FRAS1 -related extracellular Homo sapiens matrix protein 2 matrix protein 2
445108 ILSGIGVSQV 416 425 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- diphosphooligosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit STT3A subunit STT3A
445109 ILSKDGVLYV 57 66 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 1 complex subunit 1
445110 ILSMQIPFV 303 311 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- diphosphooligosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit STT3B subunit STT3B
44511 1 ILSPLNVFV 858 866 Uncharacterized protein Uncharacterized protein Homo sapiens
KIAA1 109 KIAA1109
445112 ILSQYITFV 181 189 Uridine-cytidine kinase 2 Uridine-cytidine kinase 2 Homo sapiens
445113 ILTETINTV 277 285 General vesicular transport General vesicular transport Homo sapiens factor p115 factor p1 5
445114 ILTLKYPI 66 73 Actin, aortic smooth muscle Actin, aortic smooth muscle Homo sapiens
445115 ILVDTVWAL 258 266 Importin subunit alpha-4 Importin subunit alpha-4 Homo sapiens
445116 ILVGLLHMV 28 36 ORMUike protein 2 ORMMike protein 2 Homo sapiens
445117 ILVQVIPVV 390 398 Interferon regulatory factor 6 Interferon regulatory factor 6 Homo sapiens
445118 ILWEHLEIL 124 132 Protein C-ets-1 Protein C-ets-1 Homo sapiens
(UniProt:P14921)
445119 ILWETVPSM 621 629 Fibronectin type III domain- Fibronectin type III domain- Homo sapiens containing protein 3B containing protein 3B
445120 ILWKDVTEA 630 638 Transducin beta-like protein Transducin beta-like protein Homo sapiens
3 3
445121 ILYDIPDIRL 286 295 Phenylalanine-tRNA ligase, Phenylalanine-tRNA ligase, Homo sapiens mitochondrial mitochondrial
445123 ILYPKTLFL 138 146 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2B catalytic phosphatase 2B catalytic
subunit alpha isoform subunit alpha isoform
445124 ILYPSTLFL 147 155 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2B catalytic phosphatase 2B catalytic
subunit beta isoform subunit beta isoform
445125 ILYSKTEHL 152 160 Proteasome activator Proteasome activator Homo sapiens complex subunit 4 complex subunit 4
445219 IQHDUFSL 346 354 Hypoxia-inducible factor 1- Hypoxia-inducible factor 1 - Homo sapiens alpha alpha
445221 IQTAVRLLL 91 99 Histone H2B Histone H2B Toxoplasma gondii ME49
445284 ITTDVLYTI 206 214 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein L ribonucleoprotein L
445313 KAFTYTVAA 342 350 Gamma-adducin Gamma-adducin Homo sapiens
445331 KAMEKLESV 1026 1034 Structural maintenance of Structural maintenance of Homo sapiens chromosomes protein 1A chromosomes protein 1A
445437 KIAQFLESV 3076 3084 Midasin Midasin Homo sapiens
y roase y roase Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
445514 KLFTQIFGV 238 246 DNA-directed DNA/RNA DNA-directed DNA/RNA Homo sapiens polymerase mu polymerase mu
(UniProt:Q6P5X8)
445519 KLGDFGLL 248 255 Membrane-associated Membrane-associated Homo sapiens tyrosine- and threonine- tyrosine- and threonine- specific cdc2-inhibitory specific cdc2-inhibitory
kinase (UniProt:Q99640) kinase
445520 KLGEFAKVLEL 200 210 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2A 65 kDa phosphatase 2A 65 kDa
regulatory subunit A beta regulatory subunit A beta
isoform isoform
445521 KLGEIVTTI 38 46 ADP-ribosylation factor 5 ADP-ribosylation factor 5 Homo sapiens
445522 KLGIAPQI 158 165 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP2 protein IQGAP2
445524 KLHEAVRAV 65 73 Cullin-4A Cullin-4A Homo sapiens
445525 KUANNTTV 379 387 Actin-like protein 6A Actin-like protein 6A Homo sapiens
445526 KUAQNLEL 890 898 Kinesin-like protein KIF1 1 Kinesin-like protein KIF11 Homo sapiens
445527 KUDETQDML 4282 4291 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
445528 KUDFGSGALL 274 284 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase pim-1 kinase pim-1
445530 KUDKLDSL 1109 1117 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 4 protein 4
445531 KUDLEHLL 428 436 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF168 RNF168
445532 KUDLSQVMYL 336 346 Metastasis-associated in Metastasis-associated in Homo sapiens colon cancer protein 1 colon cancer protein 1
445534 KLIGDTPIDT 440 449 Retinoic acid receptor RXR- Retinoic acid receptor RXR- Homo sapiens alpha alpha
445535 KUGEVFNI 813 821 DmX-like protein 2 DmX-like protein 2 Homo sapiens
445536 KUGQVHEV 2847 2855 Protein furry homolog Protein furry homolog Homo sapiens
445537 KUNDSVFFL 96 105 Tubulin-specific chaperone C Tubulin-specific chaperone C Homo sapiens
445538 KUPLLLQL 1179 1187 Nodal modulator 3 Nodal modulator 3 Homo sapiens
445539 KLIQLPVVYV 172 181 Nucleolar pre-ribosomal- Nucleolar pre-ribosomal- Homo sapiens associated protein 1 associated protein 1
445540 KUSELQKL 232 240 Telomere-associated protein Telomere-associated protein Homo sapiens
RIF1 RIF1
445542 KLKPGDLVGV 109 118 26S protease regulatory 26S protease regulatory Homo sapiens subunit 6A subunit 6A
445543 KLLDDEQPLRL 262 272 Ras association domain- Ras association domain- Homo sapiens containing protein 1 containing protein 1
445545 KLLDIPGLEV 39 48 Phosphopantothenoylcystein Ph os ph opan toth e n oyl cystei n Homo sapiens e decarboxylase e decarboxylase
445546 KLLDKISEL 794 802 Neurabin-2 Neurabin-2 Homo sapiens
445547 KLLDPEDVAVQ 226 236 Utrophin Utrophin Homo sapiens
445548 KLLDRETIS 3396 3404 Protocadherin Fat 1 Protocadherin Fat 1 Homo sapiens
445550 KLLEPVLL 50 57 40S ribosomal protein S16 40S ribosomal protein S16 Homo sapiens
(UniProt:P62249)
445551 KLLEVNGVAL 779 788 Protein scribble homolog Protein scribble homolog Homo sapiens
445552 KLLFWVTEV 318 326 Nucleoporin Nup37 Nucleoporin Nup37 Homo sapiens
445554 KLLGSMEQV 94 102 UniProt:Q2T9F4 Homo sapiens
445556 KLLNKIYEA 395 403 Nucleolar pre-ribosomal- Nucleolar pre-ribosomal- Homo sapiens associated protein 1 associated protein 1
445557 KLLPADALVNC 1259 1269 TBC1 domain family member TBC1 domain family member Homo sapiens
4 (UniProt:O60343) 4
445558 KLLPQLTYL 137 145 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member A (UniProt:P39687) member A
445559 KLLPSVTEL 221 229 Transcription initiation factor Transcription initiation factor Homo sapiens
TFIID subunit 1 TFIID subunit 1
445562 KLLSDPNYGV 99 108 Transmembrane protein 43 Transmembrane protein 43 Homo sapiens
445563 KLLSENTNL 209 217 C-Maf-inducing protein C-Maf-inducing protein Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
44561 1 KLWDISEVMV 323 332 Retinol dehydrogenase 14 Retinol dehydrogenase 14 Homo sapiens
445612 KLWDLEQQV 82 90 UBX domain-containing UBX domain-containing Homo sapiens protein 11 protein 1 1
445613 KLWDLLYKL 643 651 Pecanex-like protein 3 Pecanex-like protein 3 Homo sapiens
445614 KLWDNELQYV 214 223 Protein Protein Homo sapiens farnesyltransferase/geranylg farnesyltransferase/geranylg eranyltransferase type-1 eranyltransferase type-1
subunit alpha subunit alpha
(UniProt:P49354)
445615 KLWEGLTEL 271 279 RAS guanyl-releasing protein RAS guanyl-releasing protein Homo sapiens
2 2
445616 KLWEMDNML 56 64 MORF4 family-associated MORF4 family-associated Homo sapiens protein 1-like 1 protein Mike 1
445617 KLWEMDNMU 56 65 MORF4 family-associated MORF4 family-associated Homo sapiens protein 1-like 1 protein Mike 1
445618 KLWEMDNMUQ 56 66 MORF4 family-associated MORF4 family-associated Homo sapiens protein 1 protein 1
445619 KLWKENPGL 171 179 Translational activator GCN1 Translational activator GCN1 Homo sapiens
445620 KLWNGLVKV 263 271 N- N- Homo sapiens acetylgalactosaminyltransfer acetylgalactosaminyltransfer ase 7 ase 7
445621 KLWQTPLHV 105 113 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 6 regulatory phosphatase 6 regulatory
ankyrin repeat subunit C ankyrin repeat subunit C
445622 KLWSETFDV 134 142 Rho guanine nucleotide Homo sapiens exchange factor 3
(UniProt:E9PG37)
445623 KLYAGAILEV 84 93 Other Homo sapiens 15 kDa selenoprotein Homo sapiens
(human) protein
445624 KLYEAVPQL 46 54 Cell division cycle 7-related Cell division cycle 7-related Homo sapiens protein kinase protein kinase
445626 KLYESLLPFA 56 65 Condensin-2 complex Condensin-2 complex Homo sapiens subunit D3 subunit D3
445627 KLYGKPIRV 81 89 Splicing factor 3B subunit 4 Splicing factor 3B subunit 4 Homo sapiens
445629 KLYKNLLYL 11 19 LYR motif-containing protein LYR motif-containing protein Homo sapiens
5 5
445630 KLYNPENIYL 84 93 Tubulin gamma-1 chain Tubulin gamma-1 chain Homo sapiens
445635 KMADEDALRKI 694 704 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
BRE1A BRE1A
445636 KMAELVHFL 112 120 Melanoma-associated Melanoma-associated Homo sapiens antigen 12 antigen 12
445637 KMDDPDYWRTV 175 185 Ribosome biogenesis protein Ribosome biogenesis protein Homo sapiens
BOP1 BOP1
445638 KMDESKHEI 535 543 Talin-1 Talin-1 Homo sapiens
445641 KMFSDEILL 215 223 KDEL motif-containing KDEL motif-containing Homo sapiens protein 2 (UniProt:Q7Z4H8) protein 2
445643 KMHARDFTV 292 300 Eukaryotic initiation factor Eukaryotic initiation factor Homo sapiens
4A-II 4A-II
445644 KMIEDLQNEL 378 387 Structural maintenance of Structural maintenance of Homo sapiens chromosomes protein 5 chromosomes protein 5
445648 KMSELRVTL 4930 4938 Microtubule-actin cross- Microtubule-actin cross- Homo sapiens linking factor 1 , isoforms linking factor 1 , isoforms
1/2/3/5 (UniProt:Q9UPN3) 1/2/3/5
445649 KMVEDUSV 682 690 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 1 (UniProt:Q9H583) protein 1
445650 KMWEELPEW 259 268 D-beta-hyd roxybutyrate D-beta-hydroxybutyrate Homo sapiens dehydrogenase, dehydrogenase,
mitochondrial mitochondrial
445861 KQFTTVVA 19 26 Transaldolase Transaldolase Homo sapiens
445864 KQVDFLNWEV 14 23 U3 small nucleolar U3 small nucleolar Homo sapiens ribonucleoprotein protein ribonucleoprotein protein
IMP3 IMP3 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
446261 LLVSGFWGV 381 389 7-dehydrocholesterol 7-dehydrocholesterol Homo sapiens reductase (UniProt:Q9UBM7) reductase
446262 LLWDYVYQ 225 232 Transcription factor ETV7 Transcription factor ETV7 Homo sapiens
446263 LLWDYVYQL 225 233 Transcription factor ETV7 Transcription factor ETV7 Homo sapiens
446264 LLWERVEKL 663 671 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase kinase kinase kinase kinase kinase kinase kinase
4 4
446265 LLWGNLPEI 94 102 Protein FAM72B Homo sapiens
446266 LLWPGAALLV 7 16 Linker for activation of T-cells Linker for activation of T-cells Homo sapiens family member 2 family member 2
446268 LLYTGDLEAL 784 793 Neuronal PAS domain- Neuronal PAS domain- Homo sapiens containing protein 3 containing protein 3
446269 LLYYQTNYL 40 48 PRA1 family protein 3 PRA1 family protein 3 Homo sapiens
446270 LMAPYTPFL 768 776 Isoleucine-tRNA ligase, Isoleucine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
(UniProt:P41252)
446271 LMDHTIPEV 290 298 Syntenin-1 (UniProt:O00560) Syntenin-1 Homo sapiens
446273 LMYPYIFHV 411 419 Constitutive coactivator of Constitutive coactivator of Homo sapiens
PPAR-gamma-like protein 1 PPAR-gamma-like protein 1
446497 LSLENLEKI 667 675 Phosphatidylinositide Phosphatidylinositide Homo sapiens phosphatase SAC2 phosphatase SAC2
446499 LSLMLVSTV 121 129 Membrane-spanning 4- Membrane-spanning 4- Homo sapiens domains subfamily A domains subfamily A
member 6E member 6E
446505 LTIEDGIFEV 213 222 Heat shock-related 70 kDa Heat shock-related 70 kDa Homo sapiens protein 2 protein 2
446522 MALLFSUL 1 9 CD5 antigen-like CD5 antigen-like Homo sapiens
446608 MIAQTVTAV 215 223 ADP/ATP translocase 3 ADP/ATP translocase 3 Homo sapiens
446611 MISELEVRL 1035 1043 Myosin-11 Myosin-1 1 Homo sapiens
446612 MITPFLPVV 565 573 Male-specific lethal 1 Male-specific lethal 1 Homo sapiens homolog homolog
446623 MLAEKLPNL 89 97 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
446625 MLDMSVPAV 160 168 Lon protease homolog 2, Lon protease homolog 2, Homo sapiens peroxisomal peroxisomal
446626 MLDSLRIYL 1806 1814 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
446627 MLEVALTU 70 78 ER membrane protein ER membrane protein Homo sapiens complex subunit 8 complex subunit 8
446628 MLFGHPLLVSV 568 578 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 1 1 hydrolase 11
446629 MLGVNQGEGL 401 410 Neuroligin-1 Neuroligin-1 Homo sapiens
446630 MLHSVTLFL 157 165 Secretory carrier-associated Secretory carrier-associated Homo sapiens membrane protein 2 membrane protein 2
446632 MUGEIFEL 62 70 Autophagy-related protein 9A Autophagy-related protein 9A Homo sapiens
446634 MLLATLLLLLL 1 11 Low-density lipoprotein Low-density lipoprotein Homo sapiens receptor-related protein 10 receptor-related protein 10
446635 MLLENIIL 271 278 XK-related protein 5 XK-related protein 5 Homo sapiens
446636 MLLPASDPLL 1 10 Coiled-coil domain-containing Coiled-coil domain-containing Homo sapiens protein 159 protein 159
446637 MLLPGPLHSL 5390 5399 Nesprin-2 (UniProt:G3V5X4) Nesprin-2 Homo sapiens
446639 MLYDIVPW 231 239 Protein MB21 D2 Protein MB21 D2 Homo sapiens
446642 MMDQARSAFSNL 1 12 Transferrin receptor protein 1 Transferrin receptor protein 1 Homo sapiens
446643 MMHFKSGLEL 1 10 Sodium-coupled neutral Sodium-coupled neutral Homo sapiens amino acid transporter 1 amino acid transporter 1
446645 MMPTPVIL 1 8 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta
446646 MMPTPVILL 1 9 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta
446647 MMTAKAVDKI 1 10 E3 SUMO-protein ligase E3 SUMO-protein ligase Homo sapiens
EGR2 EGR2
10 protein 10 protein Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
447423 RLISKFDTV 30 38 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4E initiation factor 4E
(UniProt:P06730)
447429 RLLDLENIQI 697 706 Engulfment and cell motility Engulfment and cell motility Homo sapiens protein 1 protein 1
447430 RLLDLENSL 302 310 PX domain-containing protein PX domain-containing protein Homo sapiens kinase-like protein kinase-like protein
447432 RLLDRKVLL 100 108 Golgi phosphoprotein 3-like Golgi phosphoprotein 3-like Homo sapiens
447434 RLLDYVATV 2177 2185 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 6 containing protein 6
447435 RLLEATSYL 384 392 Lysine-specific histone Lysine-specific histone Homo sapiens demethylase 1A demethylase 1A
447436 RLLETVIDV 456 464 Gem-associated protein 4 Gem-associated protein 4 Homo sapiens
447437 RLLEVPVML 49 57 Isochorismatase domain- Isochorismatase domain- Homo sapiens containing protein 2 containing protein 2
447439 RLLGYVATL 518 526 Cold shock domain- Cold shock domain- Homo sapiens containing protein E1 containing protein E1
447440 RLLHEMILV 93 101 Coatomer subunit beta Coatomer subunit beta Homo sapiens
(UniProt:P53618)
447441 RLLLPGELA 100 108 Histone H2B type 1-K Histone H2B type 1 -K Homo sapiens
447443 RLLLPGELAKHA 100 111 Histone H2B type 1-K Histone H2B type 1 -K Homo sapiens
447445 RLLPPGAWAV 46 56 Cytoplasmic tRNA 2- Cytoplasmic tRNA 2- Homo sapiens thiolation protein 1 thiolation protein 1
447446 RLLPQVDSV 1 13 121 Zinc finger CCHC domain- Zinc finger CCHC domain- Homo sapiens containing protein 2 containing protein 2
(UniProt:K7EKB8)
447447 RLLPVIFLV 198 206 Sideroflexin-4 Sideroflexin-4 Homo sapiens
447448 RLLQDSVDFSL 78 88 Vimentin Vimentin Homo sapiens
447449 RLLQTLPQL 2980 2988 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
447451 RLMDNSTSV 1819 1827 Nipped-B-like protein Nipped-B-like protein Homo sapiens
447452 RLMNDMTAV 183 191 Heat shock protein 105 kDa Heat shock protein 105 kDa Homo sapiens
447453 RLMNETTAV 169 177 Heat shock 70 kDa protein 4 Heat shock 70 kDa protein 4 Homo sapiens
447454 RLMNETTAVAL 169 179 Heat shock 70 kDa protein Heat shock 70 kDa protein Homo sapiens
4L 4L
447455 RLNEAAVTV 55 63 Cyclin-D1-binding protein 1 Cyclin-D1-binding protein 1 Homo sapiens
447457 RLPDDDPTAV 708 717 Coatomer subunit gamma-2 Coatomer subunit gamma-2 Homo sapiens
447458 RLPDUIFL 188 196 28S ribosomal protein S2, 28S ribosomal protein S2, Homo sapiens mitochondrial mitochondrial
447459 RLPEAIEEV 125 133 Glyoxylate Glyoxylate Homo sapiens reductase/hydroxypyruvate red uctase/hyd roxypyruvate
reductase reductase
447461 RLPEIYIQL 337 345 EH domain-containing EH domain-containing Homo sapiens protein 4 protein 4
447463 RLPPPFPGL 13 21 Sorting nexin-1 Sorting nexin-1 Homo sapiens
447468 RLQEDLQSV 791 799 Diacylglycerol kinase iota Diacylglycerol kinase iota Homo sapiens
447469 RLQEEVHLL 84 92 Kazrin Kazrin Homo sapiens
447470 RLQEGDKILSV 58 68 Synaptojanin-2-binding Synaptojanin-2-binding Homo sapiens protein protein
447475 RLSDAQIYV 109 117 Interferon-induced protein Interferon-induced protein Homo sapiens with tetratricopeptide repeats with tetratricopeptide repeats
3 3
447476 RLSEAIVTV 181 189 Transmembrane protein 69 Transmembrane protein 69 Homo sapiens
447477 RLSEFIPAVF 31 40 WASH complex subunit WASH complex subunit Homo sapiens strumpellin strumpellin
447478 RLSEVQASL 365 373 DnaJ homolog subfamily B DnaJ homolog subfamily B Homo sapiens member 12 member 12
447481 RLTDYVAFL 203 211 COP9 signalosome complex COP9 signalosome complex Homo sapiens subunit 8 (UniProt:Q99627) subunit 8
447482 RLVPFLVEL 1624 1632 Piezo-type mechanosensitive Piezo-type mechanosensitive Homo sapiens ion channel component 1 ion channel component 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
447483 RLVPFLVFV 208 216 LETM1 and EF-hand LETM1 and EF-hand Homo sapiens domain-containing protein 1 , domain-containing protein 1 , mitochondrial mitochondrial
447485 RLWDHATMTEV 167 177 Serine-threonine kinase Serine-threonine kinase Homo sapiens receptor-associated protein receptor-associated protein
447486 RLWGEPVNL 1497 1505 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-X terminal hydrolase FAF-X
447488 RLWNMPENNGL 301 311 Lariat debranching enzyme Lariat debranching enzyme Homo sapiens
447489 RLWPKIQGL 184 192 DNA damage-inducible DNA damage-inducible Homo sapiens transcript 4 protein transcript 4 protein
447493 RLYHELVGL 848 856 Minor histocompatibility Minor histocompatibility Homo sapiens protein HA-1 protein HA-1
447496 RLYSGISGLEL 839 849 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA2 polymerase I subunit RPA2
(UniProt:Q9H9Y6)
447498 RMFGIPWV 746 754 C-1-tetrahydrofolate C-1 -tetrahydrofolate Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
(UniProt:P1 1586)
447910 RQLEEEGITFV 168 178 SEC14-like protein 1 SEC14-like protein 1 Homo sapiens
447915 RQYPWGVVQV 246 255 Septin-10 Homo sapiens
447999 RTIGVITKL 199 207 Dynamin-2 Dynamin-2 Homo sapiens
448050 RVMPSSFFL 173 181 TIP41 -like protein TIP41-like protein Homo sapiens
448056 RVPPVPPNV 349 357 Metal-response element- Metal-response element- Homo sapiens binding transcription factor 2 binding transcription factor 2
448070 RVSDINFT 582 589 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 6 regulatory phosphatase 6 regulatory
subunit 3 (UniProt:Q5H9R7) subunit 3
448078 RVWDISTVSSV 456 466 Periodic tryptophan protein 1 Periodic tryptophan protein 1 Homo sapiens homolog (UniProt:Q13610) homolog
448082 RVYERLLYV 2469 2477 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
448097 SAFPFPVTV 53 61 Solute carrier family 35 Solute carrier family 35 Homo sapiens member E1 member E1
(UniProt:Q96K37)
448271 SIIEYLPTL 1793 1801 ATPase family AAA domain- ATPase family AAA domain- Homo sapiens containing protein 5 containing protein 5
448272 SIISNUTV 346 354 Exportin-4 Exportin-4 Homo sapiens
448275 SILEAVPQV 1 15 123 GMP reductase 1 GMP reductase 1 Homo sapiens
448276 SILEHQIQV 252 260 DNA replication licensing DNA replication licensing Homo sapiens factor MCM4 factor MCM4
448277 SILHDVVEV 79 87 Sperm-associated antigen 7 Sperm-associated antigen 7 Homo sapiens
(UniProt:075391 )
448280 SILSSLTSV 458 466 Regulation of nuclear pre- Regulation of nuclear pre- Homo sapiens mRNA domain-containing mRNA domain-containing
protein 2 protein 2
448283 SIRDFLVTL 565 573 Receptor-type tyrosine- Receptor-type tyrosine- Homo sapiens protein phosphatase epsilon protein phosphatase epsilon
448285 SISPIVLYL 103 111 ORMI-like protein 2 ORMI -like protein 2 Homo sapiens
448288 SIYGGFLLGV 403 412 Coatomer subunit beta' Coatomer subunit beta' Homo sapiens
(UniProt:P35606)
448290 SIYPSPTGV 1693 1701 Pre-mRNA-processing- Pre-mRNA-processing- Homo sapiens splicing factor 8 splicing factor 8
448291 SLAADIPRL 24 32 Citrate lyase subunit beta-like Citrate lyase subunit beta-like Homo sapiens protein, mitochondrial protein, mitochondrial
448292 SLAALKKA 58 65 Histone H1.4 Histone H 1.4 Homo sapiens
448294 SLAALKKALA 61 70 Histone H1.1 Histone H 1.1 Homo sapiens
448295 SLAALKKALAA 58 68 Histone H1.4 Histone H 1.4 Homo sapiens
448296 SLAALKKALAAA 58 69 Histone H1.4 Histone H 1.4 Homo sapiens
448297 SLADLQNDEV 70 79 40S ribosomal protein S3a 40S ribosomal protein S3a Homo sapiens
(UniProt:P61247)
448299 SLAEVLQQL 241 249 All-trans-retinol 13,14- All-trans-retinol 13,14- Homo sapiens reductase (UniProt:Q6NUM9) reductase
448300 SLAGDVALQQL 928 938 Condensin complex subunit 1 Condensin complex subunit 1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
448302 SLAPLFFKL 220 228 AP-3 complex subunit delta-1 AP-3 complex subunit delta-1 Homo sapiens
448303 SLAQYLINA 337 345 Poly(rC)-binding protein 1 Poly(rC)-binding protein 1 Homo sapiens
448304 SLAWDVPAA 839 847 Fatty acid synthase Fatty acid synthase Homo sapiens
448305 SLDAAAGMLYL 665 675 Tyrosine-protein kinase Fer Tyrosine-protein kinase Fer Homo sapiens
448306 SLDDLQPWHS 614 623 Amyloid beta A4 protein Amyloid beta A4 protein Homo sapiens
448307 SLDKFLASV 124 132 Hemoglobin subunit alpha Hemoglobin subunit alpha Homo sapiens
448308 SLDKFLASVST 125 135 Hemoglobin subunit alpha Hemoglobin subunit alpha Homo sapiens
448309 SLDKTSHSV 1056 1064 General transcription factor General transcription factor Homo sapiens
3C polypeptide 1 3C polypeptide 1
448310 SLFERLVVL 683 691 Regulator of nonsense Regulator of nonsense Homo sapiens transcripts 1 transcripts 1
448313 SLFNKLVEL 802 810 Selenocysteine insertion Selenocysteine insertion Homo sapiens sequence-binding protein 2- sequence-binding protein 2- like like
448315 SLFPGKLEVV 1009 1018 Protein flightless- 1 homolog Protein flightless-1 homolog Homo sapiens
448317 SLHDAIMIV 184 192 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta
448318 SLHPDLIYNV 200 209 Coronin (UniProt:F5H390) Coronin Homo sapiens
448319 SUAKVATA 75 83 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens zeta-2 zeta-2
448320 SLIDADPYL 170 178 Cyclin-A2 Cyclin-A2 Homo sapiens
448321 SLIDGYYRL 367 375 Tyrosine-protein kinase JAK2 Tyrosine-protein kinase JAK2 Homo sapiens
448322 SUDIVTEI 412 420 Inositol hexakisphosphate Inositol hexakisphosphate Homo sapiens kinase 2 (UniProt:Q9UHH9) kinase 2
448324 SUNVGUSV 55 64 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
448325 SLIPTSPQV 15 23 Protein Smaug homolog 2 Protein Smaug homolog 2 Homo sapiens
448326 SLIRNLEQL 436 444 Syntaxin-binding protein 2 Syntaxin-binding protein 2 Homo sapiens
448327 SLISTILEV 727 735 Phospholipase A-2-activating Phospholipase A-2-activating Homo sapiens protein protein
448328 SUSVIHU 122 130 CDP-diacylglycerol— inositol CDP-diacylglycerol— inositol Homo sapiens
3-phosphatidyltransferase 3-phosphatidyltransferase
(UniProt:014735)
448329 SLITRLLEV 10 18 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase PP1 -beta phosphatase PP1 -beta
catalytic subunit catalytic subunit
448330 SLKEEVGEEA 45 54 Myosin-9 Myosin-9 Homo sapiens
448331 SLKEEVGEEAI 45 55 Myosin-9 Myosin-9 Homo sapiens
448335 SLLASLHTL 197 205 Proline-, glutamic acid- and Proline-, glutamic acid- and Homo sapiens leucine-rich protein 1 leucine-rich protein 1
(UniProt:Q8IZL8)
448336 SLLDEFYKL 184 192 Caprin-1 Caprin-1 Homo sapiens
448337 SLLDGVVEKL 58 67 Macrophage erythroblast Macrophage erythroblast Homo sapiens attacher (UniProt:D6RDW4) attacher
448338 SLLDRFLA 71 78 Cyclin-I (UniProt:Q14094) Cyclin-I Homo sapiens
448339 SLLDRFLAT 69 77 Cyclin-I (UniProt:Q14094) Cyclin-I Homo sapiens
448340 SLLDRFLATV 71 80 Cyclin-I (UniProt:Q14094) Cyclin-I Homo sapiens
448341 SLLDSCTKL 1 15 123 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens delta delta
448342 SLLEPFVYL 100 108 UniProt:C9JPP2 Homo sapiens
448343 SLLGDDALVQV 509 519 Splicing factor 3B subunit 3 Splicing factor 3B subunit 3 Homo sapiens
448344 SLLGHLMIV 72 80 Histidine triad nucleotide- Histidine triad nucleotide- Homo sapiens binding protein 1 binding protein 1
(UniProt:P49773)
448345 SLLHLGALYGI 78 88 Acyl-CoA desaturase Acyl-CoA desaturase Homo sapiens
448346 SLLPFLKAV 643 651 Splicing factor 3B subunit 1 Splicing factor 3B subunit 1 Homo sapiens
448347 SLLPVKPVEI 156 165 DNA repair protein DNA repair protein Homo sapiens complementing XP-C cells complementing XP-C cells
448348 SLLPYLPML 819 827 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
448349 SLLRSIFTV 320 328 Histone acetyltransferase Histone acetyltransferase Homo sapiens
KAT2A KAT2A Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
448350 SLLSHVEQL 1 14 122 Mitotic spindle assembly Mitotic spindle assembly Homo sapiens checkpoint protein MAD2B checkpoint protein MAD2B
448351 SLLSNDLKL 27 35 Gamma-interferon-inducible Gamma-interferon-inducible Homo sapiens protein 16 protein 16
448352 SLLYNVPAV 415 423 Gamma-secretase C-terminal Gamma-secretase C-terminal Homo sapiens fragment 59 fragment 59
448353 SLMDHTIPEV 289 298 Syntenin-1 (UniProt:O00560) Syntenin-1 Homo sapiens
448354 SLMEPPAVLLL 454 464 Cyclin-A1 Cyclin-A1 Homo sapiens
448355 SLMMTIINL 763 771 DNA topoisomerase 2-alpha DNA topoisomerase 2-alpha Homo sapiens
448356 SLMSHAIEL 682 690 Phospholipase A-2-activating Phospholipase A-2-activating Homo sapiens protein protein
448362 SLPDFGISYV 549 558 Fermitin family homolog 3 Fermitin family homolog 3 Homo sapiens
448364 SLPSARPLSL 276 285 Forkhead box protein C1 Forkhead box protein C1 Homo sapiens
448367 SLQERQVFL 450 458 Protein-glutamine gamma- Protein-glutamine gamma- Homo sapiens glutamyltransferase 5 glutamyltransferase 5
448368 SLQSTILGV 51 59 Lon protease homolog 2, Lon protease homolog 2, Homo sapiens peroxisomal peroxisomal
448373 SLSEKQYFL 516 524 Up-regulator of cell Up-regulator of cell Homo sapiens proliferation proliferation
448375 SLTGHISTV 232 240 Pleiotropic regulator 1 Pleiotropic regulator 1 Homo sapiens
448376 SLVAILQSV 66 74 Interferon alpha-inducible Interferon alpha-inducible Homo sapiens protein 27-like protein 1 protein 27-like protein 1
448377 SLVATLQSL 83 91 Interferon alpha-inducible Interferon alpha-inducible Homo sapiens protein 27, mitochondrial protein 27, mitochondrial
448378 SLVDGYFRL 405 413 Tyrosine-protein kinase JAK1 Tyrosine-protein kinase JAK1 Homo sapiens
448379 SLVDTVYAL 707 715 CDNA FU56152, highly cDNA FLJ56152, highly Homo sapiens similar to Rho guanine similar to Rho guanine
nucleotide exchange factor 7 nucleotide exchange factor 7
448380 SLVSKGTLV 86 94 Histone H1.4 Histone H 1.4 Homo sapiens
448381 SLVSKGTLVQT 86 96 Histone H1.4 Histone H 1.4 Homo sapiens
448382 SLVSPASYENV 83 93 Ras-related C3 botulinum Ras-related C3 botulinum Homo sapiens toxin substrate 2 toxin substrate 2
448384 SLWFKPEEL 130 138 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase B kinase B
448385 SLWHLPLLL 415 423 Protoheme IX Homo sapiens farnesyltransferase,
mitochondrial
448386 SLWPMTFGL 23 31 NADH dehydrogenase NADH dehydrogenase Homo sapiens
[ubiquinone] iron-sulfur [ubiquinone] iron-sulfur
protein 7, mitochondrial protein 7, mitochondrial
448387 SLYASGRTT 141 149 Actin, cytoplasmic 1 Actin, cytoplasmic 1 Homo sapiens
448388 SLYDYNPNL 381 389 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit C initiation factor 3 subunit C
448390 SLYKGLLSV 618 626 DNA repair and DNA repair and Homo sapiens recombination protein recombination protein
RAD54B RAD54B
448393 SLYREILFL 1608 1616 DENN domain-containing DENN domain-containing Homo sapiens protein 4C (UniProt:Q5VZ89) protein 4C
448397 SMADIPLGFGV 135 145 60S ribosome subunit 60S ribosome subunit Homo sapiens biogenesis protein NIP7 biogenesis protein NIP7
homolog homolog
448402 SMTLVNVLV 223 231 Armadillo repeat-containing Armadillo repeat-containing Homo sapiens protein 8 protein 8
448404 SNIDKSLYV 462 470 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX6 RNA helicase DDX6
448736 SQDPGTHVV 348 356 Nucleolar protein 11 Nucleolar protein 1 1 Homo sapiens
448742 SQLPFKVEA 443 451 NEDD4-binding protein 1 NEDD4-binding protein 1 Homo sapiens
448974 SVALLMNL 479 486 LisH domain-containing LisH domain-containing Homo sapiens protein ARMC9 protein ARMC9
448975 SVDWPESSL 370 378 Protein ecdysoneless Protein ecdysoneless Homo sapiens homolog homolog
448983 SVIEQIVYV 460 468 Nuclear factor NF-kappa-B Nuclear factor NF-kappa-B Homo sapiens p100 subunit p100 subunit Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
4491 16 TEVLKTHGLLV 193 203 60S ribosomal protein L13a 60S ribosomal protein L13a Homo sapiens
449256 TILPKVMQV 372 380 Microfibrillar-associated Microfibrillar-associated Homo sapiens protein 1 protein 1
449260 TLADIIARL 1487 1495 Protein NYNRIN Protein NYNRIN Homo sapiens
449262 TLDDUAAV 995 1003 Ankyrin repeat and KH Ankyrin repeat and KH Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:Q8IWZ3)
449263 TLDEATPTL 426 434 TGF-beta-activated kinase 1 TGF-beta-activated kinase 1 Homo sapiens and MAP3K7-binding protein and MAP3K7-binding protein
1 1
449267 TLFPVRLLV 52 60 Lysophosphatidylcholine Lysophosphatidylcholine Homo sapiens acyltransferase 1 acyltransferase 1
449268 TLGNVLVTV 635 643 Exocyst complex component Exocyst complex component Homo sapiens
1 1
449269 TLHGLQQYYV 257 266 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX39A helicase DDX39A
449271 TLIDSLDTL 106 114 ER degradation-enhancing ER degradation-enhancing Homo sapiens alpha-mannosidase-like alpha-mannosidase-like
protein 3 protein 3
449272 TUEDILGV 209 217 Short transient receptor Short transient receptor Homo sapiens potential channel 4- potential channel 4- associated protein associated protein
449273 TUPYYISV 872 880 Multimerin-1 Multimerin-1 Homo sapiens
449274 TUSDIEAV 256 264 Tetraspanin-14 Tetraspanin-14 Homo sapiens
449275 TLISELVQA 302 310 Cullin-7 Cullin-7 Homo sapiens
449276 TLLAAEFLKQV 98 108 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta
449277 TLLDPNEKYLL 39 49 NADH-cytochrome b5 NADH-cytochrome b5 Homo sapiens reductase 1 reductase 1
449278 TLLEKDYFL 875 883 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 1 subunit 1
449280 TLLKKVWKV 279 287 Centrosomal protein POC5 Centrosomal protein POC5 Homo sapiens
449281 TLLNSTLFL 206 214 Protrudin Protrudin Homo sapiens
449282 TLLPLRVFL 128 136 Transmembrane anterior Transmembrane anterior Homo sapiens posterior transformation posterior transformation
protein 1 homolog protein 1 homolog
449283 TLLRLLYEA 163 171 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit M initiation factor 3 subunit M
449284 TLMGHMLYL 275 283 HBSMike protein HBSMike protein Homo sapiens
(UniProt:Q9Y450)
449285 TLNNLEIFL 739 747 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Msh6 Msh6
449287 TLQEVHFLL 1 163 1171 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 14 polymerase 14
449288 TLSDIMVSL 436 444 Testis-expressed sequence Testis-expressed sequence Homo sapiens
10 protein 10 protein
449289 TLSDIVVTL 89 97 Other Homo sapiens Transcription initiation factor Homo sapiens
(human) protein TFIID subunit 8
449291 TLSEVTNQL 484 492 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase SIK2 kinase SIK2
449293 TLVDFPLHL 291 299 MAP kinase-activating death MAP kinase-activating death Homo sapiens domain protein domain protein
449294 TLVGSLPLL 153 161 NADH-ubiquinone NADH-ubiquinone Homo sapiens oxidoreductase chain 4 oxidoreductase chain 4
449298 TLYNTEVLL 180 188 Friend leukemia integration 1 Friend leukemia integration 1 Homo sapiens transcription factor transcription factor
449299 TMLARLASA 21 29 Chondroitin sulfate Chondroitin sulfate Homo sapiens proteoglycan 4 proteoglycan 4
449504 TTAEREIV 204 211 Actin, aortic smooth muscle Actin, aortic smooth muscle Homo sapiens
449507 TTFKNLQTV 1 12 120 60S ribosomal protein L31 60S ribosomal protein L31 Homo sapiens
(UniProt:P62899) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
449664 VLLDYHLNYL 415 424 Fragile X mental retardation Fragile X mental retardation Homo sapiens protein 1 protein 1
449665 VLLESEQFL 2 10 Signal recognition particle 14 Signal recognition particle 14 Homo sapiens kDa protein kDa protein
449666 VLLESEQFLTEL 2 13 Signal recognition particle 14 Signal recognition particle 14 Homo sapiens kDa protein kDa protein
449668 VLLGHIFY 503 510 MAU2 chromatid cohesion MAU2 chromatid cohesion Homo sapiens factor homolog factor homolog
449670 VLLQIVHFL 327 335 28S ribosomal protein S30, 28S ribosomal protein S30, Homo sapiens mitochondrial mitochondrial
449672 VLLSHLSYL 186 194 Friend leukemia integration 1 Friend leukemia integration 1 Homo sapiens transcription factor transcription factor
449673 VLLSIPFVSV 36 45 ORM1-like protein 3 ORM 1 -like protein 3 Homo sapiens
449674 VLMDRLPSLL 1340 1349 Nucleolar pre-ribosomal- Nucleolar pre-ribosomal- Homo sapiens associated protein 1 associated protein 1
449675 VLMEKPDVVV 130 139 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX56 RNA helicase DDX56
449676 VLMENIVYL 1019 1027 Leucine-tRNA ligase, Leucine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
449677 VLMGSLVYL 233 241 Protein RMD5 homolog A Protein RMD5 homolog A Homo sapiens
449678 VLMLQEPLL 433 441 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- d iphosphool igosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit 1 (UniProt:P04843) subunit 1
449679 VLMPWIHEL 1 16 124 NACHT, LRR and PYD NACHT, LRR and PYD Homo sapiens domains-containing protein 1 domains-containing protein 1
449681 VLPNFLPYNV 230 239 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
MARCH6 MARCH6
449682 VLQDIQVM 120 127 DNA replication licensing DNA replication licensing Homo sapiens factor MCM5 factor MCM5
449683 VLQDIQVML 120 128 DNA replication licensing DNA replication licensing Homo sapiens factor MCM5 factor MCM5
449684 VLQEKIEVV 140 148 Sarcolemmal membrane- Sarcolemmal membrane- Homo sapiens associated protein associated protein
449685 VLQGKLAEV 4190 4198 Microtubule-actin cross- Microtubule-actin cross- Homo sapiens linking factor 1 , isoforms linking factor 1 , isoforms
1/2/3/5 (UniProt:Q9UPN3) 1/2/3/5
449686 VLSDIIQNL 440 448 Nck-associated protein Mike Nck-associated protein Mike Homo sapiens
449687 VLSDIIQNLSV 440 450 Nck-associated protein Mike Nck-associated protein Mike Homo sapiens
449689 VLSGGTTMYPG 998 1008 POTE ankyrin domain family POTE ankyrin domain family Homo sapiens member F member F
449690 VLSNVEVTL 1781 1789 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
449693 VLTGILEQV 242 250 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 35 associated protein 35
449694 VLTGLSIRL 501 509 Atherin Atherin Homo sapiens
449695 VLTSVTEAL 427 435 C-myc promoter-binding C-myc promoter-binding Homo sapiens protein protein
449696 VLVPYEPPQV 107 116 Tumor protein 63 Homo sapiens
449697 VLWAGTPMV 936 944 UDP-N-acetylglucosamine- UDP-N-acetylglucosamine- Homo sapiens peptide N- peptide N- acetylglucosaminyltransferas acetylglucosaminyl transferee e 1 10 kDa subunit e 110 kDa subunit
449698 VLWDRTFS 300 307 Signal transducer and Signal transducer and Homo sapiens activator of transcription 1 - activator of transcription 1 - alpha/beta alpha/beta
449699 VLWDRTFSLF 300 309 Signal transducer and Signal transducer and Homo sapiens activator of transcription 1 - activator of transcription 1 - alpha/beta alpha/beta
449700 VLWFKPVEL 678 686 Pre-rRNA-processing protein Pre-rRNA-processing protein Homo sapiens
TSR1 homolog TSR1 homolog
449701 VLWKEILFL 396 404 Protein GPR108 Protein GPR108 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
450174 YLADIFTKL 476 484 Zinc finger BED domain- Zinc finger BED domain- Homo sapiens containing protein 5 containing protein 5
450175 YLADLYHFV 145 153 SH3 domain-binding protein SH3 domain-binding protein Homo sapiens
1 1
450176 YLADTVQKL 108 116 Other Homo sapiens Spermatogenesis- and Homo sapiens
(human) protein oogenesis-specific basic
helix-loop-helix-containing
protein 2
450177 YLADVTNAL 1602 1610 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
450178 YLAEKYEWDV 634 643 Elongation factor 2 Elongation factor 2 Homo sapiens
450179 YLAELVTPIL 1300 1309 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 1 initiation factor 4 gamma 1
(UniProt:Q04637)
450180 YLAHFIEGL 318 326 Exportin-4 Exportin-4 Homo sapiens
450181 YLDAIKLLL 501 509 Inversin Inversin Homo sapiens
450182 YLDASUTV 756 764 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DHX8 helicase DHX8
450183 YLDNGVVFV 185 193 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
450184 YLDPSVLSGV 61 70 ADP-ribosylation factor-like ADP-ribosylation factor-like Homo sapiens protein 6-interacting protein 1 protein 6-interacting protein 1
450185 YLDQTVVPILL 56 66 Protein dpy-30 homolog Protein dpy-30 homolog Homo sapiens
450186 YLEELPEKLKL 127 137 Glutathione S-transferase Mu Glutathione S-transferase Mu Homo sapiens
1 1
450187 YLFDRNGVCL 7 16 Trafficking protein particle Trafficking protein particle Homo sapiens complex subunit 1 complex subunit 1
450188 YLFGERLL 109 116 MKI67 FHA domain- MKI67 FHA domain- Homo sapiens interacting nucleolar interacting nucleolar
phosphoprotein phosphoprotein
450189 YLFHVQEV 372 379 Sphingomyelin Sphingomyelin Homo sapiens phosphodiesterase 2 phosphodiesterase 2
450190 YLFNSVVNV 49 57 Protein yippee-like 1 Protein yippee-like 1 Homo sapiens
450191 YLFPATVVGV 958 967 Adhesion G protein-coupled Adhesion G protein-coupled Homo sapiens receptor L2 receptor L2
450192 YLFPGIPEL 252 260 FAD synthase FAD synthase Homo sapiens
(UniProt:Q8NFF5)
450193 YLFPGIPELL 252 261 FAD synthase FAD synthase Homo sapiens
(UniProt:Q8NFF5)
450194 YLGDVSERV 738 746 Coatomer subunit alpha Coatomer subunit alpha Homo sapiens
450195 YLGEGPRMV 239 247 26S protease regulatory 26S protease regulatory Homo sapiens subunit 6B subunit 6B
450196 YLGNINPQM 277 285 U2 snRNP-associated SURP U2 snRNP-associated SURP Homo sapiens motif-containing protein motif-containing protein
450197 YLHDFLKYL 290 298 Other Homo sapiens Mortality factor 4-like protein Homo sapiens
(human) protein 1
450198 YLHDQNPDAAL 127 137 Coatomer subunit epsilon Coatomer subunit epsilon Homo sapiens
450199 YLHSQVVSV 541 549 Antigen peptide transporter 2 Antigen peptide transporter 2 Homo sapiens
450200 YLHSYLTYI 347 355 Signal recognition particle Signal recognition particle Homo sapiens subunit SRP68 subunit SRP68
450201 YLIDEPSAYL 128 137 ATP-binding cassette subATP-binding cassette subHomo sapiens family E member 1 family E member 1
450202 YUEUDRV 250 258 Disintegrin and Disintegrin and Homo sapiens metalloproteinase domain- metalloproteinase domain- containing protein 17 containing protein 17
450203 YLIEPDVEL 306 314 Armadillo repeat-containing Armadillo repeat-containing Homo sapiens protein 8 protein 8
450204 YUKYIAIV 528 536 RNA polymerase II RNA polymerase II Homo sapiens elongation factor ELL2 elongation factor ELL2
450205 YUPDIDLKL 171 180 SWI/SNF complex subunit SWI/SNF complex subunit Homo sapiens
SMARCC1 SMARCC1
450206 YLIPLLER 150 157 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX6 RNA helicase DDX6 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
450239 YLVSHPNEV 474 482 Lamin-B receptor Lamin-B receptor Homo sapiens
450240 YLVSNVIEL 53 61 26S protease regulatory 26S protease regulatory Homo sapiens subunit 6A subunit 6A
450241 YLVVKIEKV 344 352 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 8 protein 8
450242 YLYGQTTTYL 684 693 DNA topoisomerase 2-alpha DNA topoisomerase 2-alpha Homo sapiens
450244 YLYNEGLSV 1 10 118 Cyclin-F Cyclin-F Homo sapiens
450245 YLYTDTVDL 427 435 RCC1 and BTB domain- RCC1 and BTB domain- Homo sapiens containing protein 1 containing protein 1
450247 YMIDNVILL 104 112 V-type proton ATPase V-type proton ATPase Homo sapiens subunit d 1 subunit d 1
450249 YMYHHPTSA 476 484 Plexin domain-containing Plexin domain-containing Homo sapiens protein 2 protein 2
450309 YQKFLPLTQV 173 182 Dynactin subunit 5 Dynactin subunit 5 Homo sapiens
450310 YQLELRTTL 1 15 123 HLA class II HLA class II Homo sapiens histocompatibility antigen, histocompatibility antigen,
DQ beta 1 chain DQ beta 1 chain
(UniProt:P01920)
450312 YQTEIGQTL 231 239 Farnesyl pyrophosphate Farnesyl pyrophosphate Homo sapiens synthase synthase
450313 YQVGQLYSV 18 26 Phosphatidylinositol transfer Phosphatidylinositol transfer Homo sapiens protein alpha isoform protein alpha isoform
450315 YQYPRPLLI 87 95 Protein orai-2 Protein orai-2 Homo sapiens
450375 YTSPVNPAV 9 17 Transmembrane protein 258 Transmembrane protein 258 Homo sapiens
450379 YVINDLTAV 255 263 Spermine synthase Spermine synthase Homo sapiens
450381 YVLPVVSYI 508 516 Negative elongation factor Negative elongation factor Homo sapiens
C/D C/D
450385 YVPRAILV 59 66 Tubulin beta-2A chain Tubulin beta-2A chain Homo sapiens
450389 YVSDLELSA 84 92 C-C motif chemokine 3 C-C motif chemokine 3 Homo sapiens
450390 YVYEYLLHV 25 33 Single-stranded DNA-binding Single-stranded DNA-binding Homo sapiens protein 2 protein 2
451342 KASEKIFYV 41 49 Protein SSX2 Protein SSX2 Homo sapiens
451563 AAAUIHHV 790 798 Paired amphipathic helix Paired amphipathic helix Homo sapiens protein Sin3a protein Sin3a
451594 AAMAAQGEPQV 19 29 GTP-binding nuclear protein GTP-binding nuclear protein Homo sapiens
Ran Ran
451595 AAMVYNEFIL 717 726 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase WNK4 kinase WNK4
452174 AIIDGKIFCV 154 163 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 catalytic phosphatase 4 catalytic
subunit subunit
452180 AILEKMPLV 580 588 AP-1 complex subunit AP-1 complex subunit Homo sapiens gamma-like 2 gamma-like 2
452183 AIMDIVIKV 304 312 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 2-alpha initiation factor 2-alpha
kinase 3 kinase 3
452184 AIMDLLLRL 161 169 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 6 regulatory phosphatase 6 regulatory
subunit 3 (UniProt:Q5H9R7) subunit 3
452210 ALAAPDIVPAL 22 32 Caspase activity and Caspase activity and Homo sapiens apoptosis inhibitor 1 apoptosis inhibitor 1
452211 ALAASALPAL 127 136 60S ribosomal protein L4 60S ribosomal protein L4 Homo sapiens
(UniProt:P36578)
452212 ALAATNPAV 762 770 Cytoskeleton-associated Cytoskeleton-associated Homo sapiens protein 5 protein 5
452213 ALADFAELLRA 134 144 Dipeptidyl peptidase 2 Dipeptidyl peptidase 2 Homo sapiens
452214 ALADFLPVM 388 396 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 23 II transcription subunit 23
452215 ALADGVTMQV 844 853 Coatomer subunit gamma-2 Coatomer subunit gamma-2 Homo sapiens
452216 ALADGVVSQA 94 103 G patch domain and KOW G patch domain and KOW Homo sapiens motifs-containing protein motifs-containing protein
452217 ALADIAQSQL 121 130 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 21 II transcription subunit 21 Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
452218 ALADVATVL 479 487 Nicastrin (UniProt:Q92542) Nicastrin Homo sapiens
452219 ALADVMSQL 69 77 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX27 RNA helicase DDX27
452220 ALADVPELARL 21 31 1 ,4-alpha-glucan-branching 1 ,4-alpha-glucan-branching Homo sapiens enzyme enzyme
452221 ALAEDPQEL 466 474 Cell division cycle and Cell division cycle and Homo sapiens apoptosis regulator protein 1 apoptosis regulator protein 1
452222 ALAEGLDIKL 459 468 Lysine-specific histone Lysine-specific histone Homo sapiens demethylase 1A demethylase 1A
452223 ALAEGQLRL 178 186 Lysophosphatidylcholine Lysophosphatidylcholine Homo sapiens acyltransferase 1 acyltransferase 1
452224 ALAEIPGVRSV 132 142 Isochorismatase domain- Isochorismatase domain- Homo sapiens containing protein 1 containing protein 1
452225 ALAEKLDRL 448 456 UniProt:H7C501 Homo sapiens
452226 ALAELIDNSL 144 153 Structural maintenance of Structural maintenance of Homo sapiens chromosomes flexible hinge chromosomes flexible hinge
domain-containing protein 1 domain-containing protein 1
452227 ALAEQVQKA 58 66 Uncharacterized protein Uncharacterized protein Homo sapiens
C1orf50 C1orf50
452228 ALAERLDIV 169 177 Biogenesis of lysosome- Biogenesis of lysosome- Homo sapiens related organelles complex 1 related organelles complex 1 subunit 3 subunit 3
452229 ALAEVAAMENV 179 189 HMG box transcription factor HMG box transcription factor Homo sapiens
BBX (UniProt:A2RRM7) BBX
452230 ALAGDQPSV 1740 1748 Filamin-A Filamin-A Homo sapiens
452231 ALAGGITMV 39 47 CAD protein CAD protein Homo sapiens
452232 ALAGIVTNV 185 193 Heat shock factor 2-binding Heat shock factor 2-binding Homo sapiens protein protein
452233 ALAGPEVEAHL 186 196 N-glycosylase/DNA lyase N-glycosylase/DNA lyase Homo sapiens
452234 ALAGVNPQL 532 540 Ubiquilin-1 Ubiquilin-1 Homo sapiens
452235 ALAKDMALA 259 267 Microtubule-associated Microtubule-associated Homo sapiens protein 4 (UniProt:P27816) protein 4
452236 ALAKGEVTEM 334 343 Minor histocompatibility Minor histocompatibility Homo sapiens antigen H13 antigen H13
452237 ALAKPPVVSV 910 919 E1 A-binding protein p400 E1 A-binding protein p400 Homo sapiens
452238 ALALTQTW 16 23 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, A-23 alpha chain antigen, A-23 alpha chain
452239 ALAPAPPQV 272 280 Transcription factor p65 Transcription factor p65 Homo sapiens
(UniProt:E9PKV4)
452240 ALAPASTQSPA 1548 1558 Helicase SRCAP Helicase SRCAP Homo sapiens
452241 ALAPDLAQAP 19 28 Other Homo sapiens Homo sapiens
(human) protein
452242 ALAPGRGPS 195 203 Carcinoembryonic antigen- Carcinoembryonic antigen- Homo sapiens related cell adhesion related cell adhesion
molecule 3 molecule 3
452243 ALAPHLDDA 159 167 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 2 protein 2
452244 ALAPPPPAA 378 386 Proline and serine-rich Proline and serine-rich Homo sapiens protein 3 protein 3
452245 ALAPSPAAA 146 154 Proline-rich nuclear receptor Proline-rich nuclear receptor Homo sapiens coactivator 1 coactivator 1
452246 ALAPSSPL 270 277 Forkhead box protein 06 Forkhead box protein 06 Homo sapiens
452247 ALAPTPSAV 80 88 Inactive phospholipase C-like Inactive phospholipase C-like Homo sapiens protein 2 protein 2
452248 ALAQADRLI 650 658 Protein CIP2A Protein CIP2A Homo sapiens
452249 ALARSILPA Unidentified protein unidentified
452250 ALARTALAL Unidentified protein unidentified
452251 ALASHILTA 236 244 DNA fragmentation factor DNA fragmentation factor Homo sapiens subunit alpha subunit alpha
452252 ALASISHVA 103 111 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Mlh1 Mlh1
452253 ALASVAYQV 57 65 ABI gene family member 3 ABI gene family member 3 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
452254 ALASVIKEL 503 511 Intraflagellar transport protein Intraflagellar transport protein Homo sapiens
81 homolog 81 homolog
452255 ALATHILSL 1201 1209 A-kinase anchor protein 1 1 A-kinase anchor protein 11 Homo sapiens
452256 ALATKLLSL 60 68 Probable tRNA Probable tRNA Homo sapiens pseudouridine synthase 1 pseudouridine synthase 1
452257 ALATLYAL 141 148 Probable G-protein coupled Probable G-protein coupled Homo sapiens receptor 146 receptor 146
452258 ALAVNISAA 19 27 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens zeta zeta
452259 ALCEENMRGV 191 200 Elongation factor 2 Elongation factor 2 Homo sapiens
452260 ALCTMGIQEL Unidentified protein unidentified
452261 ALDEAGQRSTM 218 228 Cytochrome b reductase 1 Cytochrome b reductase 1 Homo sapiens
452262 ALDEGDIALL 24 33 26S protease regulatory 26S protease regulatory Homo sapiens subunit 7 subunit 7
452263 ALDEPTTNL 1521 1529 Other Toxoplasma gondii Toxoplasma protein gondii ME49
452264 ALDHMVEYV 400 408 Perilipin-3 Perilipin-3 Homo sapiens
452265 ALDIMIPMV 371 379 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase kinase kinase 5 kinase kinase kinase 5
452266 ALDSGASLLHL 482 492 Receptor-interacting Receptor-interacting Homo sapiens serine/threonine-protein serine/threonine-protein
kinase 4 kinase 4
452267 ALEARVAQL 28 36 Autophagy-related protein Autophagy-related protein Homo sapiens
16-2 16-2
452268 ALEDRVWEL 76 84 Coiled-coil domain-containing Coiled-coil domain-containing Homo sapiens protein 141 protein 141
(UniProt:H7C0P1 )
452269 ALEHRVYEV 617 625 Centrosomal protein of 104 Centrosomal protein of 104 Homo sapiens kDa (UniProt:O60308) kDa
452270 ALEKKQGQL 408 416 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase SETDB1 methyltransferase SETDB1
452271 ALEPIDITV 33 41 Double-strand-break repair Double-strand-break repair Homo sapiens protein rad21 homolog protein rad21 homolog
452272 ALFDAQAQV 75 83 Non-receptor tyrosine-protein Non-receptor tyrosine-protein Homo sapiens kinase TYK2 kinase TYK2
452273 ALFEAAREVTL 2163 2173 Huntingtin Huntingtin Homo sapiens
452274 ALFEESGURI 863 873 Cadherin EGF LAG seven- Cadherin EGF LAG seven- Homo sapiens pass G-type receptor 3 pass G-type receptor 3
452275 ALFEGVVRQI 242 251 GTP-binding protein RAD GTP-binding protein RAD Homo sapiens
452276 ALFISPALI 6 14 ATP synthase F(0) complex ATP synthase F(0) complex Homo sapiens subunit C1 , mitochondrial subunit C1 , mitochondrial
452277 ALFKDAWLL 103 111 F-box only protein 42 F-box only protein 42 Homo sapiens
452278 ALFPERITV 9 17 Alpha-tubulin N- Alpha-tubulin N- Homo sapiens acetyltransferase 1 acetyltransferase 1
452279 ALFPVAEDISL 369 379 Activating signal cointegrator Activating signal cointegrator Homo sapiens
1 complex subunit 2 1 complex subunit 2
452280 ALGAPPPPA 24 32 SWI/SNF-related matrix- SWI/SNF-related matrix- Homo sapiens associated actin-dependent associated actin-dependent
regulator of chromatin regulator of chromatin
subfamily D member 2 subfamily D member 2
452281 ALGDKFLLRV 136 145 Myosin-binding protein H Myosin-binding protein H Homo sapiens
452282 ALGDQILFV 184 192 Transcription initiation factor Transcription initiation factor Homo sapiens
HE subunit beta HE subunit beta
452283 ALGEEALLRYV 357 367 SEC14-like protein 1 SEC14-like protein 1 Homo sapiens
452284 ALGFYPAEITL 229 239 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, Cw-5 alpha chain antigen, Cw-5 alpha chain
452285 ALGGAPYQV 50 58 Sodium-dependent Sodium-dependent Homo sapiens
^phosphatidylcholine ^phosphatidylcholine
sym porter 1 symporter 1
(UniProt:Q8NA29)
452286 ALGHVIVLL 512 520 Integrator complex subunit Integrator complex subunit Homo sapiens
10 10 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
452287 ALGPVPPEA 511 519 AT-rich interactive domain- AT-rich interactive domain- Homo sapiens containing protein 5A containing protein 5A
452288 ALGPVWML 5 13 Complement C1q tumor Complement C1 q tumor Homo sapiens necrosis factor-related necrosis factor-related
protein 6 protein 6
452289 ALGQMPISP 1225 1233 Coagulation factor V Coagulation factor V Homo sapiens
452290 ALGSFIYHL 213 221 Integral membrane protein Integral membrane protein Homo sapiens
2C 2C
452291 ALGVDLKEV 159 167 Melanoma-associated Melanoma-associated Homo sapiens antigen B18 antigen B18
452292 ALHAAVIAI 213 221 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP2 protein IQGAP2
452293 ALHARMETV 557 565 RNA polymerase II RNA polymerase II Homo sapiens elongation factor ELL2 elongation factor ELL2
452294 ALHHAVIFL 238 246 Endoplasmic reticulum Endoplasmic reticulum Homo sapiens metallopeptidase 1 metallopeptidase 1
452295 ALHLRSWLL 30 38 Protein SC02 homolog, Protein SC02 homolog, Homo sapiens mitochondrial mitochondrial
452296 ALHQILVLL 1640 1648 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HERC1 ligase HERC1
452297 ALHWFLNQV 877 885 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 34 hydrolase 34
452298 ALIENLTHQI 680 689 Inositol hexakisphosphate Inositol hexakisphosphate Homo sapiens and diphosphoinositol- and diphosphoinositol- pentakisphosphate kinase 1 pentakisphosphate kinase 1
(UniProt:Q6PFW1 )
452299 ALIEQKLNEA 3724 3733 Dystonin (UniProt:Q03001 ) Dystonin Homo sapiens
452300 ALIEQKVEL 221 229 RILP-like protein 1 RILP-like protein 1 Homo sapiens
452301 ALIEVPDGFTA 193 203 Aminopeptidase B Aminopeptidase B Homo sapiens
452302 ALIGMSPQV 461 469 Anoctamin-10 Anoctamin-10 Homo sapiens
452303 AULEPSLYTV 3 13 Coatomer subunit zeta-1 Coatomer subunit zeta-1 Homo sapiens
452304 ALINKLDFA 822 830 Phosphatidylinositol 4-kinase Phosphatidylinositol 4-kinase Homo sapiens alpha alpha
452305 AUNNIVEI 696 704 Anoctamin-5 Anoctamin-5 Homo sapiens
452306 AUNNIVEIRV 697 707 Anoctamin-5 Homo sapiens
452307 ALINTQALL 3345 3353 Breast cancer type 2 Breast cancer type 2 Homo sapiens susceptibility protein susceptibility protein
452308 AUPETTTLTV 98 108 Chemokine-like factor Chemokine-like factor Homo sapiens
452309 AUQQATTV 159 167 60S ribosomal protein L9 60S ribosomal protein L9 Homo sapiens
(UniProt:P32969)
452310 AURLDDLFL 151 160 RNA-binding protein PN01 RNA-binding protein PN01 Homo sapiens
452311 ALISEKLETL 727 736 DnaJ homolog subfamily C DnaJ homolog subfamily C Homo sapiens member 10 member 10
452312 ALISRGLEWV 516 525 Fanconi anemia group G Fanconi anemia group G Homo sapiens protein protein
452313 ALITAALY 1 122 1129 Integrin alpha-M Integrin alpha-M Homo sapiens
452314 ALITDPDEMRM 362 372 Protein fem-1 homolog A Protein fem-1 homolog A Homo sapiens
452315 ALITEWRL 598 606 C2 domain-containing protein C2 domain-containing protein Homo sapiens
3 3
452316 ALITTILHL 226 234 Rapamycin-insensitive Rapamycin-insensitive Homo sapiens companion of mTOR companion of mTOR
452317 ALKPDLVNV 520 528 DNA polymerase alpha DNA polymerase alpha Homo sapiens catalytic subunit catalytic subunit
452318 ALLAYTLGV 137 145 Putative elongation factor 1- Putative elongation factor 1 - Homo sapiens alpha-like 3 alpha-like 3
452319 ALLDGRLQV 370 378 Fatty acid synthase Fatty acid synthase Homo sapiens
452320 ALLDGRVQL 1405 1413 Agrin Agrin Homo sapiens
452321 ALLDGTVFEI 54 63 Protein DGCR6L Protein DGCR6L Homo sapiens
452322 ALLDKDLQIEV 2757 2767 Nucleosome-remodeling Nucleosome-remodeling Homo sapiens factor subunit BPTF factor subunit BPTF
(UniProt:Q12830)
452323 ALLDQALSNA 3432 3441 UniProt:F8W8Q1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
452324 ALLDQLHTLL 1052 1061 Nuclear receptor coactivator Nuclear receptor coactivator Homo sapiens
3 3
452325 ALLDQTKTL 1760 1768 Talin-1 Talin-1 Homo sapiens
452326 ALLEADVNIKL 38 48 Signal recognition particle 54 Signal recognition particle 54 Homo sapiens kDa protein kDa protein
452327 ALLEDSVIRQA 19 29 GPI ethanolamine phosphate GPI ethanolamine phosphate Homo sapiens transferase 2 transferase 2
(UniProt:Q5H8A4)
452328 ALLEENSTPQL 587 597 Histone deacetylase 10 Histone deacetylase 10 Homo sapiens
452329 ALLEEVKAL 41 49 KIF1 -binding protein KIF1 -binding protein Homo sapiens
452330 ALLEEVKALL 41 50 KIF1 -binding protein KIF1 -binding protein Homo sapiens
452331 ALLEKLTEL 147 155 DnaJ homolog subfamily C DnaJ homolog subfamily C Homo sapiens member 13 member 13
452332 ALLEKPGELSL 338 348 S1 RNA-binding domain- S1 RNA-binding domain- Homo sapiens containing protein 1 containing protein 1
452333 ALLELLHEL 268 276 LEM domain-containing LEM domain-containing Homo sapiens protein 2 protein 2
452334 ALLELVPWRA 5785 5794 Dystonin (UniProt:Q03001 ) Dystonin Homo sapiens
452335 ALLENGIIHHV 469 479 Phosphatidylinositol 3,4,5- Phosphatidylinositol 3,4,5- Homo sapiens trisphosphate-dependent Rac trisphosphate-dependent Rac exchanger 1 protein exchanger 1 protein
452336 ALLEPEFILKA 281 291 Telomerase protein Telomerase protein Homo sapiens component 1 component 1
(UniProt:Q99973)
452337 ALLEPGGVLTI 2257 2267 Midasin Midasin Homo sapiens
452338 ALLEQTGDMSL 1498 1508 Centromere protein F Centromere protein F Homo sapiens
452340 ALLESVLRHV 1391 1400 DENN domain-containing DENN domain-containing Homo sapiens protein 4B protein 4B
452341 ALLGELARL 468 476 Transmembrane protein 102 Transmembrane protein 102 Homo sapiens
452342 ALLGHNVGD 556 564 Mesothelin-like protein Mesothelin-like protein Homo sapiens
(UniProt:Q96KJ4)
452343 ALLGKLDAI 154 162 Geranylgeranyl transferase Geranylgeranyl transferase Homo sapiens type-2 subunit beta type-2 subunit beta
452344 ALLGKLDAINV 154 164 Geranylgeranyl transferase Geranylgeranyl transferase Homo sapiens type-2 subunit beta type-2 subunit beta
452345 ALLGRLAEL 1303 1311 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5C 5C
452346 ALLHKTIQL 663 671 SH2 domain-containing SH2 domain-containing Homo sapiens protein 3C protein 3C
452347 ALLHTVTSI 108 116 UniProt:C9J2T4 Homo sapiens
452348 ALLKDSIVQL 29 38 cAMP-dependent protein cAMP-dependent protein Homo sapiens kinase type l-alpha regulatory kinase type l-alpha regulatory subunit subunit
452349 ALLKHLEGI 194 202 Bisphosphoglycerate mutase Bisphosphoglycerate mutase Homo sapiens
452350 ALLKQIQEA 39 47 Inhibitor of growth protein 4 Inhibitor of growth protein 4 Homo sapiens
452351 ALLKVNQEL 277 285 Sorting and assembly Sorting and assembly Homo sapiens machinery component 50 machinery component 50
homolog homolog
452352 ALLKYIETL 638 646 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase A helicase A
452353 ALLLPPVTLA 7 16 Nicotinate-nucleotide Nicotinate-nucleotide Homo sapiens pyrophosphorylase pyrophosphorylase
[carboxylating] [carboxylating]
(UniProt:Q15274)
452354 ALLMLGGGLL 172 181 Claudin-9 Claudin-9 Homo sapiens
452355 ALLNAILHSA 404 413 Nucleolar protein 11 Nucleolar protein 1 1 Homo sapiens
452356 ALLNEAKEV 91 99 Rapamycin-insensitive Rapamycin-insensitive Homo sapiens companion of mTOR companion of mTOR
452357 ALLNTINYL 1002 1010 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13A associated protein 13A
452358 ALLPASGQIAL 188 198 Exosome complex Exosome complex Homo sapiens component RRP41 component RRP41 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
452359 ALLPEPNHVML 153 163 5'-AMP-activated protein 5'-AMP-activated protein Homo sapiens kinase subunit beta-2 kinase subunit beta-2
452360 ALLPGSPVEA 370 379 Zinc finger protein 862 Zinc finger protein 862 Homo sapiens
452361 ALLPHLYTL 501 509 Lysosomal alpha-glucosidase Lysosomal alpha-glucosidase Homo sapiens
452362 ALLPVASRLLL 26 36 Protein CutA Protein CutA Homo sapiens
452363 ALLQDLHKA 146 154 Other Homo sapiens Homo sapiens
(human) protein
452364 ALLQEIVNI 50 58 Cell differentiation protein Cell differentiation protein Homo sapiens
RCD1 homolog RCD1 homolog
452365 ALLQEVYKL 4622 4630 Nesprin-2 (UniProt:G3V5X4) Nesprin-2 Homo sapiens
452366 ALLQGAIESV 309 318 Puratrophin-1 Puratrophin-1 Homo sapiens
452367 ALLQKLQQL 159 167 Phospholipase D4 Phospholipase D4 Homo sapiens
452368 ALLQQMEELKL 219 229 Trichoplein keratin filament- Trichoplein keratin filament- Homo sapiens binding protein binding protein
452369 ALLQRLEAL 125 133 GSK3-beta interaction GSK3-beta interaction Homo sapiens protein protein
452370 ALLRDGIELV 193 202 Protein phosphatase 1 K, Protein phosphatase 1 K, Homo sapiens mitochondrial mitochondrial
452371 ALLRVTPFI 36 44 Mitochondrial import receptor Mitochondrial import receptor Homo sapiens subunit TOM5 homolog subunit TOM5 homolog
(UniProt:Q8N4H5)
452372 ALLSALQAL 219 227 Transmembrane channel-like Transmembrane channel-like Homo sapiens protein 6 protein 6
452373 ALLSAVTRL 129 137 Catenin alpha-2 Catenin alpha-2 Homo sapiens
452374 ALLSHAPRL 407 415 Cyclin-dependent kinase 16 Cyclin-dependent kinase 16 Homo sapiens
452375 ALLSIIATV 42 50 Endosomal/lysomomal Endosomal/lysomomal Homo sapiens potassium channel potassium channel
TMEM175 TMEM175
452376 ALLSLDPAAV 2867 2876 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
452377 ALLSQTSPL 77 85 Transcription factor LBX1 Transcription factor LBX1 Homo sapiens
452378 ALLSSLARC 26 34 Multiple inositol Multiple inositol Homo sapiens polyphosphate phosphatase polyphosphate phosphatase
1 1
452379 ALLTRVQEI 77 85 Centriolar coiled-coil protein Centriolar coiled-coil protein Homo sapiens of HO kDa of 110 kDa
452380 ALLTTIEEMHL 394 404 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 6 complex subunit 6
452381 ALLTYLEQV 613 621 Probable carboxypeptidase Probable carboxypeptidase Homo sapiens
X1 X1
452382 ALLVRLQEV 177 185 Integrin beta-7 Integrin beta-7 Homo sapiens
452383 ALMAQEQKL 343 351 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA1 polymerase I subunit RPA1
452384 ALMDHGVKV 85 93 Amyloid protein-binding Amyloid protein-binding Homo sapiens protein 2 protein 2
452385 ALMDSNLPRL 41 50 Huntingtin Huntingtin Homo sapiens
452386 ALMDSSSSL 627 635 Meckelin Meckelin Homo sapiens
452387 ALMEALVLI 647 655 Exportin-5 Exportin-5 Homo sapiens
452388 ALMEAVSHV 402 410 Brefeldin A-inhibited guanine Brefeldin A-inhibited guanine Homo sapiens nucleotide-exchange protein nucleotide-exchange protein
1 1
452389 ALMEDAEIRL 463 472 Protein EFR3 homolog B Protein EFR3 homolog B Homo sapiens
452390 ALMEEILKL 669 677 Protein bicaudal D homolog 1 Protein bicaudal D homolog 1 Homo sapiens
452391 ALMEGQMAQL 585 594 Uncharacterized protein Uncharacterized protein Homo sapiens
KIAA1467 KIAA1467
452392 ALMEQIAHQAV 211 221 Hsp90 co-chaperone Cdc37- Hsp90 co-chaperone Cdc37- Homo sapiens like 1 like 1
452393 ALMERMQQL 260 268 Sestrin-2 Sestrin-2 Homo sapiens
452394 ALMERNSEL 832 840 Myomegalin Myomegalin Homo sapiens
(UniProt:E9PL24)
452395 ALMERTGYSMV 37 47 RNA-binding protein 47 RNA-binding protein 47 Homo sapiens
(UniProt:A0AV96) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
452430 ALQLVVLL 147 154 Probable Probable Homo sapiens palmitoyltransferase palmitoyltransferase
ZDHHC12 ZDHHC12
452431 ALQNLEQLL 775 783 Nuclear factor NF-kappa-B Nuclear factor NF-kappa-B Homo sapiens p100 subunit p100 subunit
452432 ALQPEPIKV 56 64 Sortilin-related receptor Sortilin-related receptor Homo sapiens
452433 ALQPPPAP 48 55 Other Homo sapiens Dapper homolog 2 Homo sapiens
(human) protein
452434 ALQQQLQAV 247 255 SWI/SNF-related matrix- SWI/SNF-related matrix- Homo sapiens associated actin-dependent associated actin-dependent
regulator of chromatin regulator of chromatin
subfamily E member 1 - subfamily E member 1 - related related
452435 ALQSGNSQESV 156 166 Immunoglobulin Ig kappa chain C region Homo sapiens
452436 ALQSQLSI 536 543 Neurofibromin Neurofibromin Homo sapiens
452437 ALQTDPAAV 1749 1757 Unconventional myosin-IXb Unconventional myosin-IXb Homo sapiens
452438 ALQWVWEV 381 389 Nuclear transcription factor Y Nuclear transcription factor Y Homo sapiens subunit gamma subunit gamma
452439 ALRASRAPML 24 33 Heparan sulfate glucosamine Heparan sulfate glucosamine Homo sapiens
3-O-sulfotransferase 6 3-O-sulfotransferase 6
452440 ALREASELL 804 812 Unconventional myosin-lc Unconventional myosin-lc Homo sapiens
452442 ALRETVVEV 91 99 Transitional endoplasmic Transitional endoplasmic Homo sapiens reticulum ATPase reticulum ATPase
452443 ALRQQLEEV 343 351 RUN and FYVE domain- RUN and FYVE domain- Homo sapiens containing protein 1 containing protein 1
452444 ALSALAVNEI Unidentified protein unidentified
452445 ALSALTARL 5 13 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- d iphosphool igosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit 2 (UniProt:P04844) subunit 2
452446 ALSASLARV 278 286 Pescadillo homolog Pescadillo homolog Homo sapiens
452447 ALSDGVHKI 45 53 Other Homo sapiens Fas apoptotic inhibitory Homo sapiens
(human) protein molecule 1
452448 ALSDLALHFL 308 317 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens delta delta
452449 ALSEKIVSV 85 93 Coiled-coil domain-containing Coiled-coil domain-containing Homo sapiens protein 93 protein 93
452450 ALSELATAV 182 190 Uncharacterized protein Uncharacterized protein Homo sapiens
C1orf43 C1orf43
452451 ALSEUILT 197 205 Lanosterol 14-alpha Lanosterol 14-alpha Homo sapiens demethylase demethylase
452452 ALSELLQQV 1083 1091 Unhealthy ribosome Unhealthy ribosome Homo sapiens biogenesis protein 2 homolog biogenesis protein 2 homolog
452453 ALSEMVEYI 39 47 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2A 56 kDa phosphatase 2A 56 kDa
regulatory subunit gamma regulatory subunit gamma
isoform isoform
452454 ALSERAVAV 135 143 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit ATPase regulatory subunit
14 14
452455 ALSGHVSTV 365 373 Inversin Inversin Homo sapiens
452456 ALSGLAVRL 21 29 Small integral membrane Small integral membrane Homo sapiens protein 10 protein 10
452457 ALSIQNYHL 954 962 Spectrin beta chain, non- Spectrin beta chain, non- Homo sapiens erythrocytic 1 eryth racy tic 1
452458 ALSNHLNAV 91 99 Kinesin light chain 1 Kinesin light chain 1 Homo sapiens
(UniProt:Q07866)
452459 ALSPINIQL 248 256 WD repeat-containing and WD repeat-containing and Homo sapiens planar cell polarity effector planar cell polarity effector
protein fritz homolog protein fritz homolog
452460 ALSPTVFAL 629 637 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase SMG1 kinase SMG1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
452461 ALSPVIPU 4156 4164 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase 2D methyltransferase 2D
452462 ALSPVPSHW 5 13 B-cell antigen receptor B-cell antigen receptor Homo sapiens complex-associated protein complex-associated protein
beta chain beta chain
452463 ALSQFHAAV 56 64 DnaJ homolog subfamily C DnaJ homolog subfamily C Homo sapiens member 3 member 3
452464 ALSRVSVNV 406 414 tRNA-splicing endonuclease tRNA-splicing endonuclease Homo sapiens subunit Sen2 subunit Sen2
452466 ALTAVSSQL 394 402 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
452467 ALTGYLHTI 485 493 FAST kinase domain- FAST kinase domain- Homo sapiens containing protein 2 containing protein 2
452469 ALTRALALA 16 24 Putative phospholipase B-like Putative phospholipase B-like Homo sapiens
2 2
452470 ALTRELAII 609 617 NFX1-type zinc finger- NFX1-type zinc finger- Homo sapiens containing protein 1 containing protein 1
452471 ALTSLLKTV 331 339 AP-1 complex subunit AP-1 complex subunit Homo sapiens gamma-1 gamma-1
452472 ALVAIFTHL 356 364 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
452473 ALVAVPLGMTV 630 640 Nuclear pore membrane Nuclear pore membrane Homo sapiens glycoprotein 210 glycoprotein 210
452474 ALVDGYFRL 343 351 Tyrosine-protein kinase JAK3 Tyrosine-protein kinase JAK3 Homo sapiens
452475 ALVEALAAA 820 828 Coiled-coil domain-containing Coiled-coil domain-containing Homo sapiens protein 88B protein 88B
452476 ALVESLITV 5 13 Uncharacterized protein Uncharacterized protein Homo sapiens
C10orf12 C10orf12
452477 ALVFELHYV 454 462 WD repeat- and FYVE WD repeat- and FYVE Homo sapiens domain-containing protein 4 domain-containing protein 4
(UniProt:Q6ZS81)
452478 ALVGVVKEA 208 216 GrpE protein homolog 1 , GrpE protein homolog 1 , Homo sapiens mitochondrial mitochondrial
452479 ALVHHSFAL 227 235 DNA polymerase alpha DNA polymerase alpha Homo sapiens catalytic subunit catalytic subunit
452480 ALVLLLTEV 449 457 Exportin-6 Exportin-6 Homo sapiens
452481 ALVNAIVLV 184 192 Ubiquitin-like protein 7 Ubiquitin-like protein 7 Homo sapiens
452482 ALVNELYSL 159 167 AP-4 complex subunit beta-1 AP-4 complex subunit beta-1 Homo sapiens
(UniProt:Q9Y6B7)
452483 ALVNIIAV 684 691 Exocyst complex component Exocyst complex component Homo sapiens
2 2
452484 ALVPGYNGTSN 231 241 Fidgetin Fidgetin Homo sapiens
452485 ALVSAALLL Unidentified protein unidentified
452486 ALVSGGVAQA 46 55 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RFWD2 RFWD2
452487 ALVSLILNNV 14 23 Transmembrane protein 204 Transmembrane protein 204 Homo sapiens
452488 ALVSYLIRL 4882 4890 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF213 RNF213
452489 ALWEKWLSL 3479 3487 Nesprin-2 (UniProt:G3V5X4) Nesprin-2 Homo sapiens
452490 ALWENPESGEL 651 661 Bromo adjacent homology Bromo adjacent homology Homo sapiens domain-containing 1 protein domain-containing 1 protein
452491 ALWETEVYI 727 735 Other Homo sapiens 85/88 kDa calcium- Homo sapiens
(human) protein independent phospholipase
A2
452492 ALWFRADEL 147 155 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase 3 kinase 3
452493 ALWGHLKEL 213 221 Nuclear pore complex protein Nuclear pore complex protein Homo sapiens
Nup98-Nup96 Nup98-Nup96
(UniProt:H7C3P6)
452494 ALWKGVQSL 412 420 Integrin alpha-X Integrin alpha-X Homo sapiens
452495 ALWKQLLEL 1826 1834 Helicase with zinc finger Helicase with zinc finger Homo sapiens domain 2 domain 2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
452496 ALWLHVNQL 230 238 Proline-serine-threonine Proline-serine-threonine Homo sapiens phosphatase-i nteracti ng phosphatase-interacting
protein 2 protein 2
452497 ALWREVASL 167 175 Heat shock factor protein 1 Heat shock factor protein 1 Homo sapiens
452498 ALWTEKLQV 647 655 Golgin subfamily A member 4 Golgin subfamily A member 4 Homo sapiens
(UniProt:Q13439)
452499 ALWTGMHTI 638 646 Rabankyrin-5 Rabankyrin-5 Homo sapiens
452500 ALYDNVPEC 10 18 Enhancer of filamentation 1 Enhancer of filamentation 1 Homo sapiens
452501 ALYDVRTILL 124 133 Ubiquitin-conjugating enzyme Ubiquitin-conjugating enzyme Homo sapiens
E2 C E2 C
452502 ALYEGYATV 641 649 Dipeptidyl peptidase 3 Dipeptidyl peptidase 3 Homo sapiens
(UniProt:Q9NY33)
452503 ALYEKDNTYL 102 111 CDK5 regulatory subunit- CDK5 regulatory subunit- Homo sapiens associated protein 3 associated protein 3
452504 ALYERKLLSL 540 549 Tubulin polyglutamylase Tubulin polyglutamylase Homo sapiens
TTLL5 TTLL5
452505 ALYHEQLAL 799 807 Small subunit processome Small subunit processome Homo sapiens component 20 homolog component 20 homolog
452506 ALYLGAKAIQL 324 334 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 7 complex subunit 7
452507 ALYLYDVEV 400 408 WD repeat-containing protein WD repeat-containing protein Homo sapiens
6 6
452508 ALYNVDAGHRA 26 36 Prohibitin Prohibitin Homo sapiens
452509 ALYPGQLVQL 401 410 Rho GTPase-activating Homo sapiens protein 9 (UniProt:Q9BRR9)
452510 ALYPHLPPEA 361 370 Sequestosome-1 Sequestosome-1 Homo sapiens
452511 ALYQFSNLL 382 390 Plexin-B2 Plexin-B2 Homo sapiens
452512 ALYQSLPTL 354 362 Huntingtin Huntingtin Homo sapiens
452513 ALYTGDPNL 1 100 1108 SH3 domain and SH3 domain and Homo sapiens tetratricopeptide repeat- tetratricopeptide repeat- containing protein 1 containing protein 1
452514 ALYTVIETV 46 54 Receptor expression- Receptor expression- Homo sapiens enhancing protein 3 enhancing protein 3
452515 ALYVAVVNV 140 148 Other Homo sapiens Transmembrane protein 147 Homo sapiens
(human) protein
452516 AMAARPHSI 78 86 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoproteins A2/B1 ribonucleoproteins A2/B1
452521 AMAHVAGFTV 178 187 Fumarylacetoacetate Fumarylacetoacetate Homo sapiens hydrolase domain-containing hydrolase domain-containing protein 2B protein 2B
452523 AMAQVIGDRV 63 72 N-acylethanolamine- N-acylethanolamine- Homo sapiens hydrolyzing acid amidase hydrolyzing acid amidase
452526 AMELCLALLL 207 216 Zinc transporter ZIP1 Zinc transporter ZIP1 Homo sapiens
452528 AMFENFVSV 147 155 Nuclear cap-binding protein Nuclear cap-binding protein Homo sapiens subunit 1 subunit 1
452532 AMGIAPPKV 237 245 U4/U6 small nuclear U4/U6 small nuclear Homo sapiens ribonucleoprotein Prp3 ribonucleoprotein Prp3
452535 AMIDQVLEL 36 44 Other Homo sapiens Homo sapiens
(human) protein
452536 AMIEGEIESL 22 31 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 25 hydrolase 25
452537 AMIELVERL 233 241 Tripartite motif-containing Tripartite motif-containing Homo sapiens protein 44 protein 44
452545 AMLEKNYKL 593 601 Intraflagellar transport protein Intraflagellar transport protein Homo sapiens
172 homolog 172 homolog
452547 AMLNEPWAV 159 167 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF31 RNF31
452551 AMNDILAQV 266 274 AP-1 complex subunit AP-1 complex subunit Homo sapiens gamma-1 gamma-1
452554 AMQEFLTRL 2788 2796 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 6 containing protein 6 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
452555 AMSNLVPPVEL 95 105 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein G(s) subunit alpha protein G(s) subunit alpha
isoforms short isoforms short
452556 AMTKDNNLL 450 458 Heat shock protein 70 Heat shock protein 70 Toxoplasma gondii GT1
452884 AQFGYYFRV 517 525 DNA mismatch repair protein Homo sapiens
Msh2
452887 AQIGADIAL 67 75 Tryptase beta-2 Tryptase beta-2 Homo sapiens
452888 AQIGSYVHV 102 110 Dynactin subunit 5 Dynactin subunit 5 Homo sapiens
452889 AQIRYLTQV 65 73 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 1 1 II transcription subunit 11
452892 AQLEAEVKL 173 181 Golgi-associated PDZ and Golgi-associated PDZ and Homo sapiens coiled-coil motif-containing coiled-coil motif-containing
protein protein
452894 AQLISLDQV 330 338 Bcl-2/adenovirus E1 B 19 Bcl-2/adenovirus E1 B 19 Homo sapiens kDa-interacting protein 2-like kDa-interacting protein 2-like protein protein
452899 AQNPSLLAL 238 246 Other Homo sapiens Homo sapiens
(human) protein
452932 ATIEALDAGAV 504 514 CytosolidO- CytosolidO- Homo sapiens form yltetra hyd rof olate formyltetrahydrofolate
dehydrogenase dehydrogenase
452953 AVGPASILKEV 138 148 Zinc finger Ran-binding Zinc finger Ran-binding Homo sapiens domain-containing protein 2 domain-containing protein 2
452960 AVLQGKLAEV 2087 2096 UniProt:F8W8Q1 Homo sapiens
452963 AVMESIQGV 739 747 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 28 hydrolase 28
(UniProt:Q96RU2)
452966 AVQAAAAQAAV 429 439 AT-rich interactive domain- AT-rich interactive domain- Homo sapiens containing protein 3A containing protein 3A
452976 AVWAAVQAV 187 195 Zinc finger protein 777 Zinc finger protein 777 Homo sapiens
452989 CLADELINA 172 180 40S ribosomal protein S5 40S ribosomal protein S5 Homo sapiens
452990 CLCMAEAILL 7 16 Cytochrome b561 domain- Cytochrome b561 domain- Homo sapiens containing protein 1 containing protein 1
453049 DFDGDEIFHV 50 59 HLA class II HLA class II Homo sapiens histocompatibility antigen, histocompatibility antigen,
DR alpha chain DR alpha chain
453071 DIETGQQTV 170 178 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein G(I)/G(S)/G(T) protein G(I)/G(S)/G(T)
subunit beta-2 subunit beta-2
453092 DLAGLKEL 1833 1840 Antigen KI-67 Antigen KI-67 Homo sapiens
453094 DLATULNM 1042 1050 DnaJ homolog subfamily C DnaJ homolog subfamily C Homo sapiens member 13 member 13
453095 DLEHKVLL 968 975 Chromodomain-helicase- Chromodomain-helicase- Homo sapiens
DNA-binding protein 8 DNA-binding protein 8
453096 DLEKTRQY 863 870 Sperm-associated antigen 5 Sperm-associated antigen 5 Homo sapiens
453097 DLENENMMRV 414 423 Formin-like protein 3 Formin-like protein 3 Homo sapiens
453098 DLETERILL 852 860 Golgin subfamily A member 4 Golgin subfamily A member 4 Homo sapiens
(UniProt:Q13439)
453099 DLGSKDLK 284 291 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 1 protein 1
453100 DUHEIYTV 189 197 60S ribosomal protein L7 60S ribosomal protein L7 Homo sapiens
453101 DLKPTLTI 6 13 Protein C-ets-1 Protein C-ets-1 Homo sapiens
(UniProt:P14921 )
453102 DLLLRLEP 622 629 Laminin subunit beta-2 Laminin subunit beta-2 Homo sapiens
453103 DLMTLHPIEI 773 782 Son of sevenless homolog 2 Son of sevenless homolog 2 Homo sapiens
453104 DLNWLVKNSY 129 138 Trimethyllysine dioxygenase, Trimethyllysine dioxygenase, Homo sapiens mitochondrial mitochondrial
453105 DLPLGVKL 50 57 Fibrous sheath-interacting Fibrous sheath-interacting Homo sapiens protein 2 protein 2
453106 DLQATALDLEW 40 50 Inactive N-acetylated-alpha- Inactive N-acetylated-alpha- Homo sapiens linked acidic dipeptidase-like linked acidic dipeptidase-like protein 2 protein 2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
453107 DLRLLSSL 2004 2011 Cation-independent Cation-independent Homo sapiens mannose-6-phosphate mannose-6-phosphate
receptor receptor
453108 DLSDNTGKMEV 283 293 Interferon-inducible protein Interferon-inducible protein Homo sapiens
AIM2 AIM2
453109 DLSPEVPSN 94 102 Magnesium transporter Magnesium transporter Homo sapiens
NIPA4 NIPA4
4531 10 DLTLAGRVI 143 151 Aspartyl aminopeptidase Aspartyl aminopeptidase Homo sapiens
4531 11 DLTLAGRVIV 143 152 Aspartyl aminopeptidase Aspartyl aminopeptidase Homo sapiens
4531 12 DLVLQTLPL 655 663 Zinc finger protein 407 Zinc finger protein 407 Homo sapiens
453499 ELAEELLRI 40 48 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens theta theta
453500 ELAKELPQV 55 63 Glutaredoxin-3 Glutaredoxin-3 Homo sapiens
453501 ELANKVGAAEI 839 849 Splicing factor 3B subunit 1 Splicing factor 3B subunit 1 Homo sapiens
453502 ELANLEKW 87 94 Epithelial-stromal interaction Epithelial-stromal interaction Homo sapiens protein 1 protein 1
453503 ELAQLESIL 261 269 Protein furry homolog-like Protein furry homolog-like Homo sapiens
453504 ELDPEHQRA 74 82 Prolyl 4-hydroxylase subunit Prolyl 4-hydroxylase subunit Homo sapiens alpha-1 alpha-1
453505 ELEARLDAA 25 33 Vimentin-type intermediate Vimentin-type intermediate Homo sapiens filament-associated coiled- filament-associated coiled- coil protein coil protein
453506 ELEEIARRVQ 137 146 Potassium voltage-gated Potassium voltage-gated Homo sapiens channel subfamily F member channel subfamily F member
1 1
453507 ELERESEFW 90 98 Polycomb group RING finger Polycomb group RING finger Homo sapiens protein 5 protein 5
453508 ELETLLAKL 236 244 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
Midline-1 Midline-1
453509 ELFPTPALLQV 1082 1092 Zinc finger and BTB domain- Zinc finger and BTB domain- Homo sapiens containing protein 40 containing protein 40
(UniProt:Q9NUA8)
453510 ELFSSPPAV 953 961 Nuclear factor of activated T- Nuclear factor of activated T- Homo sapiens cells 5 cells 5
453511 ELGLGRWEN 10 19 Other Homo sapiens Homo sapiens
(human) protein
453512 EUSKAIEI 532 540 Mitochondrial import receptor Mitochondrial import receptor Homo sapiens subunit TOM70 subunit TOM70
453513 ELIVCSHEI 902 910 Huntingtin-interacting protein Huntingtin-interacting protein Homo sapiens
1 -related protein 1 -related protein
453514 ELKDLLKKN 451 459 DNA-binding protein RFX6 DNA-binding protein RFX6 Homo sapiens
453515 ELKIEEYV 369 376 Protein RRNAD1 Protein RRNAD1 Homo sapiens
(UniProt:Q96FB5)
453516 ELKKENQQII 1016 1025 RB1-inducible coiled-coil RB1-inducible coiled-coil Homo sapiens protein 1 protein 1
453517 ELKKINQN 210 217 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 6 containing protein 6
453518 ELKLQLQEL 535 543 EVI5-like protein EVI5-like protein Homo sapiens
453519 ELLGAGIEKV 98 107 Fizzy-related protein Fizzy-related protein Homo sapiens homolog homolog
453520 ELLKILQEL 636 644 Protein IWS1 homolog Protein IWS1 homolog Homo sapiens
453521 ELLLLQPEL 149 157 Phostensin Phostensin Homo sapiens
453522 ELMEQVPHI 88 96 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 1 subunit 1
453523 ELMMVIAQEN 102 111 Putative malate Putative malate Homo sapiens dehydrogenase 1 B dehydrogenase 1 B
453524 ELNILSLDI 2018 2026 Cubilin Cubilin Homo sapiens
453525 ELNISSLQI 266 274 Ankyrin repeat and death Ankyrin repeat and death Homo sapiens domain-containing protein 1 B domain-containing protein 1 B
453526 ELNLRSNEL 60 68 Ribonuclease inhibitor Ribonuclease inhibitor Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
453527 ELQALYALQAL 1482 1492 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 1 initiation factor 4 gamma 1
(UniProt:Q04637)
453528 ELQAVLSYI 254 262 All-trans-retinol 13,14- All-trans-retinol 13,14- Homo sapiens reductase (UniProt:Q6NUM9) reductase
453529 ELQDCALPLLK 56 66 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens cytoplasmic cytoplasmic
453530 ELQKKIQEL 1967 1975 Centromere-associated Centromere-associated Homo sapiens protein E protein E
453531 ELQLLEKV 10 17 Protein phosphatase 1 Protein phosphatase 1 Homo sapiens regulatory inhibitor subunit regulatory inhibitor subunit
16B 16B
453532 ELRKGDQILSV 48 58 Disks large homolog 4 Disks large homolog 4 Homo sapiens
453534 ELSYHNLEL 1614 1622 Protein GREB1 Protein GREB1 Homo sapiens
453535 ELTDKLLIF 198 206 Vesicle transport protein Vesicle transport protein Homo sapiens
SEC20 SEC20
453536 ELTLELADIL 538 547 Ephexin-1 Ephexin-1 Homo sapiens
453537 ELVGGNQVKN 428 437 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 5 ATPase regulatory subunit 5
453538 ELVLSGTRAL 60 69 Other Homo sapiens Homo sapiens
(human) protein
453539 ELVVSIVLL 1 136 1144 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HERC2 HERC2
453540 ELYLDCIQV 142 150 Thrombospondin-4 Thrombospondin-4 Homo sapiens
453598 FAAPMDITL 1 1 19 C4b-binding protein alpha C4b-binding protein alpha Homo sapiens chain chain
453600 FAIPLIEKL 240 248 Nucleolar RNA helicase 2 Nucleolar RNA helicase 2 Homo sapiens
453632 FIDDANYSV 4 12 Antizyme inhibitor 1 Antizyme inhibitor 1 Homo sapiens
453633 FIDEYVETV 390 398 Phosphoinositide 3-kinase Phosphoinositide 3-kinase Homo sapiens adapter protein 1 adapter protein 1
453635 FIFEKILQL 86 94 Ral GTPase-activating Homo sapiens protein subunit alpha-1
453637 FILEKIEYL 76 84 Switch-associated protein 70 Switch-associated protein 70 Homo sapiens
(UniProt:E7EMB1 )
453640 FILPHISTA 102 110 Cytosolic Fe-S cluster Cytosolic Fe-S cluster Homo sapiens assembly factor NARFL assembly factor NARFL
453641 FILPYIHKA 361 369 Lysophospholipid Lysophospholipid Homo sapiens acyltransferase 5 acyltransferase 5
453642 FINSRIITV 105 113 tRNA (cytosine(34)-C(5))- tRNA (cytosine(34)-C(5))- Homo sapiens methyltransferase methyltransferase
453646 FIREHIEEL 342 350 COP9 signalosome complex COP9 signalosome complex Homo sapiens subunit 2 subunit 2
453650 FIWDFIEKV 292 300 DENN domain-containing DENN domain-containing Homo sapiens protein 5B protein 5B
453657 FLAAFTLPALL 1368 1378 snRNA-activating protein snRNA-activating protein Homo sapiens complex subunit 4 complex subunit 4
453658 FLADDLGGL 155 163 Other Homo sapiens Caspase recruitment domain- Homo sapiens
(human) protein containing protein 19
453659 FLADPVSNMAM 55 65 Protein YIF1 B Protein YIF1 B Homo sapiens
453660 FLAEEKHLHV 1 14 123 Retinol dehydrogenase 11 Retinol dehydrogenase 11 Homo sapiens
453661 FLAEEKHLHVL 1 14 124 Retinol dehydrogenase 11 Retinol dehydrogenase 11 Homo sapiens
453662 FLAENDWEM 46 54 Tyrosyl-DNA Tyrosyl-DNA Homo sapiens phosphodiesterase 2 phosphodiesterase 2
453663 FLAERLYAEV 26 35 Cell division cycle protein 27 Cell division cycle protein 27 Homo sapiens homolog homolog
453664 FLAFILHRL 160 168 G1/S-specific cyclin-D3 G1/S-specific cyclin-D3 Homo sapiens
(UniProt:P30281 )
453665 FLAGEGMTV 109 117 Modulator of apoptosis 1 Modulator of apoptosis 1 Homo sapiens
453666 FLAHIYTEL 227 235 Cell division cycle protein 23 Cell division cycle protein 23 Homo sapiens homolog homolog
453667 FLAKDFNFL 30 38 Interferon-induced GTP- Interferon-induced GTP- Homo sapiens binding protein Mx2 binding protein Mx2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
453668 FLAKDFNFLTL 30 40 Interferon-induced GTP- Interferon-induced GTP- Homo sapiens binding protein Mx2 binding protein Mx2
453669 FLANLHITA 199 207 Dual specificity protein Dual specificity protein Homo sapiens phosphatase 5 phosphatase 5
453670 FLAPASKMII 23 32 Probable G-protein coupled Probable G-protein coupled Homo sapiens receptor 33 receptor 33
453671 FLAQRAVEL 363 371 CDK5 regulatory subunit- CDK5 regulatory subunit- Homo sapiens associated protein 3 associated protein 3
453672 FLASVVDPRV 701 710 SWI/SNF complex subunit SWI/SNF complex subunit Homo sapiens
SMARCC1 SMARCC1
453673 FLDEEVKLI 134 142 Ferritin light chain Ferritin light chain Homo sapiens
453674 FLDEKTHELL 128 137 Pseudouridylate synthase 7 Pseudouridylate synthase 7 Homo sapiens homolog-like protein homolog-like protein
453675 FLDEQAEKHNI 103 113 Plexin-B2 Plexin-B2 Homo sapiens
453676 FLDESRST 433 440 RuvB-like 2 RuvB-like 2 Homo sapiens
(UniProt:Q9Y230)
453677 FLDEYIFLA 281 289 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX3X helicase DDX3X
453678 FLDFIGHILT 397 406 Phosphatidylinositol 5- Phosphatidylinositol 5- Homo sapiens phosphate 4-kinase type-2 phosphate 4-kinase type-2
alpha alpha
453679 FLDGNELTLA 136 145 Chloride intracellular channel Chloride intracellular channel Homo sapiens protein 1 protein 1
453680 FLDIILKTV 482 490 Glycerophosphocholine Glycerophosphocholine Homo sapiens phosphodiesterase GPCPD1 phosphodiesterase GPCPD1
453681 FLDKELKEC 39 47 Integrator complex subunit 9 Integrator complex subunit 9 Homo sapiens
453682 FLDKFKQVF 213 221 Protein-lysine Protein-lysine Homo sapiens methyltransferase methyltransferase
METTL21 C METTL21 C
453683 FLDKILVKL 147 155 1 -phosphatidylinositol 4,5- 1 -phosphatidylinositol 4,5- Homo sapiens bisphosphate bisphosphate
phosphodiesterase beta-2 phosphodiesterase beta-2
453684 FLDMTNWNL 47 55 Uncharacterized protein Uncharacterized protein Homo sapiens
C6orf106 C6orf106
453685 FLDNAIMIV 130 138 Transmembrane protein 65 Transmembrane protein 65 Homo sapiens
453686 FLDNGPKTI 315 323 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 2 initiation factor 4 gamma 2
453687 FLDNSFEKV 576 584 Centriolar coiled-coil protein Centriolar coiled-coil protein Homo sapiens of HO kDa of 1 0 kDa
453688 FLDNSLDTV 253 261 Spartin Spartin Homo sapiens
453689 FLDPHTTQTFV 215 225 UniProt:F5H3G3 Homo sapiens
453690 FLDPKELMEL 275 284 Lymphoid-specific helicase Lymphoid-specific helicase Homo sapiens
(UniProt:Q9NRZ9)
453691 FLDQVAHKL 175 183 39S ribosomal protein L16, 39S ribosomal protein L16, Homo sapiens mitochondrial mitochondrial
453692 FLDSAYFRL 808 816 Phospholipase DDHD1 Homo sapiens
453693 FLDSEVSEL 699 707 Condensin complex subunit 3 Condensin complex subunit 3 Homo sapiens
453694 FLDSKFYLL 32 40 Microtubule-associated Microtubule-associated Homo sapiens protein 1 B protein 1 B
453695 FLDTSNQHL 456 464 CD180 antigen CD180 antigen Homo sapiens
453696 FLDVFLPRV 906 914 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
453697 FLENETWEL 463 471 Syndetin Syndetin Homo sapiens
453698 FLETNVPLL 392 400 Catenin alpha-2 Catenin alpha-2 Homo sapiens
453699 FLFASTILHL 97 106 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- diphosphooligosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit DAD1 subunit DAD1
453700 FLFDKTLU 321 329 Pleckstrin homology domain- Pleckstrin homology domain- Homo sapiens containing family G member containing family G member
3 3
453701 FLFDPKKLSV 1 112 1121 Protein diaphanous homolog Protein diaphanous homolog Homo sapiens
1 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
453702 FLFDTKPUV 139 148 Calnexin Calnexin Homo sapiens
453703 FLFELPSRL 106 114 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 51 associated protein 51
homolog homolog
453704 FLFEYDTPRM 12 21 P2X purinoceptor 1 P2X purinoceptor 1 Homo sapiens
453705 FLFGEEPSKL 825 834 Ankyrin repeat and LEM Ankyrin repeat and LEM Homo sapiens domain-containing protein 2 domain-containing protein 2
453706 FLFGGLAGMGA 25 35 Mitochondrial 2- Mitochondrial 2- Homo sapiens oxoglutarate/malate carrier oxoglutarate/malate carrier
protein protein
453707 FLFLDRTYV 289 297 Cullin-4B Cullin-4B Homo sapiens
453708 FLFNTENKLLL 76 86 Isopentenyl-diphosphate Isopentenyl-diphosphate Homo sapiens
Delta-isomerase 1 Delta-isomerase 1
453709 FLFNYDYTL 1550 1558 DnaJ homolog subfamily C DnaJ homolog subfamily C Homo sapiens member 13 member 13
453710 FLFPHSVLV 105 113 Transmembrane protein Transmembrane protein Homo sapiens
106C 106C
453711 FLFSKFIEL 87 95 Elongation of very long chain Elongation of very long chain Homo sapiens fatty acids protein 1 fatty acids protein 1
453713 FLGIVAEV 148 155 Basigin (UniProt:P35613) Basigin Homo sapiens
453714 FLGKIYQI 3470 3477 Sacsin Sacsin Homo sapiens
453715 FLGTFILKV 221 229 UDP-N-acetylglucosamine- UDP-N-acetylglucosamine- Homo sapiens dolichyl-phosphate N- dolichyl-phosphate N- acetylglucosaminephosphotr acetylglucosaminephosphotr ansferase ansferase
453716 FLGVEMEKVQL 1525 1535 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP2 protein IQGAP2
453717 FLHDNMVEI 616 624 DNA ligase 3 DNA ligase 3 Homo sapiens
453718 FLHEESILERV 316 326 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Mlh1 Mlh1
453719 FLHLKEFYL 255 263 Gamma-pa rvin Gamma-pa rvin Homo sapiens
453720 FLHWYTGEGM 414 423 Tubulin beta chain Tubulin beta chain Homo sapiens
(UniProt:P07437)
453721 FLIAEKVSL 299 307 Solute carrier family 12 Solute carrier family 12 Homo sapiens member 8 member 8
453722 FLIAQLPKLQY 1046 1056 WASH complex subunit WASH complex subunit Homo sapiens strumpellin strumpellin
453723 FLIDRVFGI 150 158 Major facilitator superfamily Major facilitator superfamily Homo sapiens domain-containing protein 1 domain-containing protein 1
453724 FLIEYGPAQL 468 477 Protein VPRBP Protein VPRBP Homo sapiens
453725 FUILPKELQA 99 109 Zinc finger and SCAN Zinc finger and SCAN Homo sapiens domain-containing protein 26 domain-containing protein 26
453726 FUIPLHSL 519 527 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DHX36 helicase DHX36
453727 FLILPDAEAQL 14 24 Transmembrane protein 128 Transmembrane protein 128 Homo sapiens
453728 FLILPDMLKNA 70 80 Small nuclear Small nuclear Homo sapiens ribonucleoprotein Sm D3 ribonucleoprotein Sm D3
453729 FLINGKPFYF 1 17 126 Beta-glucuronidase Beta-glucuronidase Homo sapiens
(UniProt:P08236)
453730 FLIPFETRQL 687 696 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HECTD1 HECTD1
453731 FLIQNVLRL 662 670 Isoleucine-tRNA ligase, Isoleucine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
(UniProt:P41252)
453732 FLISRLIKL 846 854 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:P55786)
453733 FLISSHFLL 184 192 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 4 polymerase 4
453734 FLITILDHL 121 129 Myotubularin-related protein Myotubularin-related protein Homo sapiens
2 2
453735 FLITSNLEL 515 523 La-related protein 4B La-related protein 4B Homo sapiens
453736 FLKGFLTEV 298 306 Putative protein PLEKHA9 Putative protein PLEKHA9 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
453737 FLLDEVDKL 395 403 Lon protease homolog 2, Lon protease homolog 2, Homo sapiens peroxisomal peroxisomal
453738 FLLDFHSHL 280 288 MPN domain-containing MPN domain-containing Homo sapiens protein protein
453739 FLLDKPQDL 425 433 Metastasis-associated in Metastasis-associated in Homo sapiens colon cancer protein 1 colon cancer protein 1
453740 FLLDMHWNPSL 1084 1094 Transcription termination Transcription termination Homo sapiens factor 2 factor 2
453741 FLLDTADVAL 102 111 Pleckstrin homology domain- Pleckstrin homology domain- Homo sapiens containing family M member containing family M member
2 2
453742 FLLEDLSQKL 967 976 Fanconi anemia group D2 Fanconi anemia group D2 Homo sapiens protein protein
453743 FLLEGIRSLV 359 368 Nck-associated protein Mike Nck-associated protein Mike Homo sapiens
453744 FLLEHIRIL 232 240 Nischarin Nischarin Homo sapiens
453745 FLLFINHRL 258 266 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Mlh1 Mlh1
453746 FLLGEHLLL 771 779 von Willebrand factor A von Willebrand factor A Homo sapiens domain-containing protein 8 domain-containing protein 8
453747 FLLGFIPAKA 192 201 Regulator of nonsense Regulator of nonsense Homo sapiens transcripts 1 transcripts 1
453748 FLLGSWLEQA 616 625 Alpha-N- Alpha-N- Homo sapiens acetylglucosaminidase acetylglucosaminidase
453749 FLLHVQQQI 1288 1296 Protein transport protein Protein transport protein Homo sapiens
Sec24B Sec24B
453750 FLLKDLSSL 1 13 121 Src kinase-associated Src kinase-associated Homo sapiens phosphoprotein 1 phosphoprotein 1
453751 FLLKQIEFL 39 47 Double-stranded RNA- Double-stranded RNA- Homo sapiens specific adenosine specific adenosine
deaminase deaminase
453752 FLLLQSIKL 1 165 1173 Erythroid differentiation- Erythroid differentiation- Homo sapiens related factor 1 related factor 1
453753 FLLNQADEVKL 586 596 Zinc finger protein 438 Zinc finger protein 438 Homo sapiens
453754 FLLPDGLVRL 74 83 Neuroblastoma-amplified Neuroblastoma-amplified Homo sapiens sequence sequence
453755 FLLPEVGRG 19 27 5-hydroxytryptamine receptor 5-hydroxytryptamine receptor Homo sapiens
7 7
453756 FLLPHLKDI 418 426 Nucleolar protein 11 Nucleolar protein 1 1 Homo sapiens
453757 FLLPLUEKV 258 267 Other Homo sapiens Homo sapiens
(human) protein
453758 FLLPMFERL 133 141 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX54 helicase DDX54
453759 FLLPVIMRA 257 265 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX59 RNA helicase DDX59
453760 FLLQLQEEL 304 312 FACT complex subunit FACT complex subunit Homo sapiens
SPT16 SPT16
453761 FLLQRVHSL 281 289 Secretory carrier-associated Secretory carrier-associated Homo sapiens membrane protein 2 membrane protein 2
453762 FLLSIGMLFL Unidentified protein unidentified
453763 FLLSLRGAGA 22 31 HLA class II HLA class II Homo sapiens histocompatibility antigen, DP histocompatibility antigen, DP alpha 1 chain alpha 1 chain
(UniProt:P20036)
453764 FLLTPVPLRS 934 943 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase LMTK1 kinase LMTK1
453765 FLMEMGFRM 1 17 125 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 18 II transcription subunit 18
453766 FLMENGSITSI 214 224 Translation initiation factor Translation initiation factor Homo sapiens elF-2B subunit gamma elF-2B subunit gamma
453767 FLMKQQSLL 285 293 Cytoplasmic dynein 1 light Cytoplasmic dynein 1 light Homo sapiens intermediate chain 2 intermediate chain 2
(UniProt:B4DZP4) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
453768 FLMRVMDIPYL 377 387 Poly(A)-specific ribonuclease Poly(A)-specific ribonuclease Homo sapiens
PARN PARN
453769 FLMSLLLKN 2320 2328 Dynein heavy chain 14, Dynein heavy chain 14, Homo sapiens axonemal (UniProt:H9KV43) axonemal
453770 FLNDIFERI 66 74 Putative histone H2B type 2- Putative histone H2B type 2- Homo sapiens
C C
453771 FLNEDLNQL 767 775 Nucleolar complex protein 3 Nucleolar complex protein 3 Homo sapiens homolog homolog
453772 FLNEDLNQLIK 767 777 Nucleolar complex protein 3 Nucleolar complex protein 3 Homo sapiens homolog homolog
453773 FLNEEVKSL 956 964 A-kinase anchor protein 9 A-kinase anchor protein 9 Homo sapiens
453774 FLNEHLQEA 199 207 Activating signal cointegrator Activating signal cointegrator Homo sapiens
1 complex subunit 3 1 complex subunit 3
(UniProt:Q8N3C0)
453775 FLNEIQQSI 383 391 Tetratricopeptide repeat Tetratricopeptide repeat Homo sapiens protein 21 B protein 21 B
453776 FLNKLVILV 393 401 Phosphatidylinositol 3,4,5- Phosphatidylinositol 3,4,5- Homo sapiens trisphosphate 5-phosphatase trisphosphate 5-phosphatase
1 1
453777 FLNKNQELL 808 816 Alsin Alsin Homo sapiens
453778 FLNLFNHTL 171 179 Osteopetrosis-associated Osteopetrosis-associated Homo sapiens transmembrane protein 1 transmembrane protein 1
453779 FLNQFHFGV 43 51 V-type proton ATPase V-type proton ATPase Homo sapiens subunit d 1 subunit d 1
453780 FLNQVLAEI 536 544 Exocyst complex component Exocyst complex component Homo sapiens
4 4
453781 FLNSEIHQV 10 18 TBC1 domain family member TBC1 domain family member Homo sapiens
2A 2A
453782 FLPFLTTEV 44 52 Sugar transporter SWEET1 Sugar transporter SWEET1 Homo sapiens
(UniProt:Q9BRV3)
453783 FLPHELPLL 2012 2020 DNA polymerase theta DNA polymerase theta Homo sapiens
453784 FLPLLLVLL 213 221 Olfactory receptor 2AT4 Olfactory receptor 2AT4 Homo sapiens
453785 FLQDLKELKV 237 246 Acidic fibroblast growth factor Acidic fibroblast growth factor Homo sapiens intracellular-binding protein intracellular-binding protein
(UniProt:043427)
453786 FLQDLSLEL 218 226 Carbonic anhydrase-related Carbonic anhydrase-related Homo sapiens protein 1 1 protein 1 1
453787 FLQEATLYL 718 726 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 24 hydrolase 24
453788 FLQEEPGQLL 220 229 Structure-specific Structure-specific Homo sapiens endonuclease subunit SLX1 endonuclease subunit SLX1
453789 FLQEKSPAVA 434 443 Ubiquitin-associated protein Ubiquitin-associated protein Homo sapiens
2-like (UniProt:Q14157) 2-like
453790 FLQEQLVEL 1 174 1182 Golgin subfamily A member 4 Golgin subfamily A member 4 Homo sapiens
(UniProt:Q13439)
453791 FLQEWEVYA 53 61 Succinate dehydrogenase Succinate dehydrogenase Homo sapiens assembly factor 3, assembly factor 3,
mitochondrial mitochondrial
(UniProt:Q9NRP4)
453792 FLQEYVANL 973 981 Exportin-1 (UniProt:O14980) Exportin-1 Homo sapiens
453793 FLQGQNFFL 350 358 Alpha-mannosidase 2C1 Alpha-mannosidase 2C1 Homo sapiens
453794 FLQKSIEDMTV 928 938 CAP-Gly domain-containing CAP-Gly domain-containing Homo sapiens linker protein 1 linker protein 1
453795 FLQPGGYHVL 166 175 Squalene monooxygenase Squalene monooxygenase Homo sapiens
453796 FLQVTSPEENI 990 1000 Protein ZGRF1 Protein ZGRF1 Homo sapiens
453797 FLREGSEFL 384 392 WD repeat-containing protein WD repeat-containing protein Homo sapiens
25 25
453798 FLRNINEYL 134 142 FAD-dependent FAD-dependent Homo sapiens oxidoreductase domain- oxidoreductase domain- containing protein 1 containing protein 1
453799 FLSDAIPGL 262 270 TBC1 domain family member TBC1 domain family member Homo sapiens
15 15 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
453800 FLSELQYYL 42 50 Endoplasmic reticulum-Golgi Endoplasmic reticulum-Golgi Homo sapiens intermediate compartment intermediate compartment
protein 3 protein 3
453801 FLSEVFAQL 312 320 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 3B subunit 3B
453802 FLSFMNTEL 39 47 Protein S100-A1 1 Protein S100-A1 1 Homo sapiens
453803 FLSGAKIWL 219 227 Myotubularin-related protein Myotubularin-related protein Homo sapiens
10 (UniProt:H3BUS9) 10
453804 FLSHLSTLEI 61 70 Olfactory receptor 9A2 Olfactory receptor 9A2 Homo sapiens
453805 FLSNDTVQL 56 64 B-cell receptor CD22 B-cell receptor CD22 Homo sapiens
(UniProt:P20273)
453806 FLSNIFQAL 404 412 Protein SAAL1 Protein SAAL1 Homo sapiens
453807 FLSNVLQEL 31 39 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 6 containing protein 6
453808 FLSPWPPAV 450 458 Sphingomyelin Sphingomyelin Homo sapiens phosphodiesterase 4 phosphodiesterase 4
453809 FLSQSIHLL 383 391 Protein O-linked-mannose Protein O-linked-mannose Homo sapiens beta-1 ,2-N- beta-1 ,2-N- acetylglucosaminyltransferas acetylglucosaminyltransferas e 1 (UniProt:Q8WZA1 ) e 1
453810 FLSSKVLEL 184 192 Leukocyte cell-derived Leukocyte cell-derived Homo sapiens chemotaxin 1 chemotaxin 1
453811 FLSTLEHHL 262 270 Nicalin Nicalin Homo sapiens
453812 FLTAVAHRL 362 370 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein-like 3-like protein protein-like 3-like protein
453813 FLTDLEDLTL 63 72 N-acetyltransferase 9 N-acetyltransferase 9 Homo sapiens
453814 FLTEHNSNV 19 27 Uncharacterized protein Uncharacterized protein Homo sapiens
KIAA1109 KIAA1109
453815 FLTEINSTV 533 541 Zinc finger BED domain- Zinc finger BED domain- Homo sapiens containing protein 5 containing protein 5
453816 FLTELAERV 303 311 Condensin complex subunit 1 Condensin complex subunit 1 Homo sapiens
453817 FLTELTRLF 9 17 Signal recognition particle 14 Signal recognition particle 14 Homo sapiens kDa protein kDa protein
453818 FLTEMVHFI 292 300 Short-chain Short-chain Homo sapiens dehydrogenase/reductase dehydrogenase/reductase
family 42E member 1 family 42E member 1
453819 FLTFPIYKV 43 51 Solute carrier family 25 Solute carrier family 25 Homo sapiens member 53 member 53
453820 FLTGTLQN 3997 4004 Dynein heavy chain 6, Dynein heavy chain 6, Homo sapiens axonemal axonemal
453821 FLTRIISQL 200 208 EF-hand calcium-binding EF-hand calcium-binding Homo sapiens domain-containing protein 4B domain-containing protein 4B
453822 FLTRLQVHL 2792 2800 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 6 containing protein 6
453823 FLTSWELI 120 128 Other Homo sapiens Connector enhancer of Homo sapiens
(human) protein kinase suppressor of ras 3
453824 FLVDIMEHL 383 391 EPM2A-interacting protein 1 EPM2A-interacting protein 1 Homo sapiens
453825 FLVDMTMHL 755 763 General transcription factor General transcription factor Homo sapiens
ll-l repeat domain-containing ll-l repeat domain-containing protein 2B protein 2B
453826 FLVEGLFMRV 198 207 Atrial natriuretic peptide Atrial natriuretic peptide Homo sapiens receptor 1 receptor 1
453827 FLVEKQPPQV 163 172 Signal transducer and Signal transducer and Homo sapiens activator of transcription 6 activator of transcription 6
453828 FLVEPQEDTRL 167 177 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 1 1 hydrolase 11
453829 FLVERLLHI 443 451 Condensin complex subunit 3 Condensin complex subunit 3 Homo sapiens
453830 FLVPIESIERA 263 273 Endonuclease G, Endonuclease G, Homo sapiens mitochondrial mitochondrial
453831 FLVQAKTYL 97 105 N-terminal Xaa-Pro-Lys N- N-terminal Xaa-Pro-Lys N- Homo sapiens methyltransferase 1 methyltransferase 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
453938 FVWEASHYL 1024 1032 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase, mitochondrial polymerase, mitochondrial
454093 GIQSSAISV 971 979 Voltage-dependent L-type Voltage-dependent L-type Homo sapiens calcium channel subunit calcium channel subunit
alpha-I D alpha-I D
454094 GISRQGIIAV 1 15 124 Putative ATP-dependent Putative ATP-dependent Homo sapiens
RNA helicase DHX33 RNA helicase DHX33
454095 GITGLVLSI 576 584 Fc receptor-like protein 3 Fc receptor-like protein 3 Homo sapiens
454106 GLAAFLLQHV 167 176 Nucleotide-binding Nucleotide-binding Homo sapiens oligomerization domain- oligomerization domain- containing protein 2 containing protein 2
454107 GLAAKLMEL 75 83 N-alpha-acetyltransferase 20 N-alpha-acetyltransferase 20 Homo sapiens
454108 GLAALAVHL 783 791 Fanconi anemia group A Fanconi anemia group A Homo sapiens protein protein
454109 GLAAQPPAA 16 24 SAYSvFN domain-containing SAYSvFN domain-containing Homo sapiens protein 1 protein 1
4541 10 GLAAVFDTV 161 169 Phosphatidylinositol N- Phosphatidylinositol N- Homo sapiens acetylglucosaminyltransferas acetylglucosaminyl transferee e subunit Q e subunit Q
4541 11 GLADITQQL 1 103 1111 Cyclin-dependent kinase 12 Cyclin-dependent kinase 12 Homo sapiens
4541 12 GLADLSELQL 1271 1280 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HERC1 ligase HERC1
4541 13 GLADPAPVAV 68 77 Other Homo sapiens Homo sapiens
(human) protein
4541 14 GLADPSALTQA 548 558 ATPase WRNIP1 ATPase WRNIP1 Homo sapiens
4541 15 GLAEDIDKGEV 1 12 122 Elongation factor 2 Elongation factor 2 Homo sapiens
4541 16 GLAEFQENV 193 201 Kinetochore protein Spc25 Kinetochore protein Spc25 Homo sapiens
4541 17 GLAELRHLNL 203 212 Negative regulator of reactive Negative regulator of reactive Homo sapiens oxygen species oxygen species
4541 18 GLAGIVGYHTV 506 516 NAD(P) transhydrogenase, NAD(P) transhydrogenase, Homo sapiens mitochondrial mitochondrial
4541 19 GLAGYVEAL 172 180 Transmembrane protein 65 Transmembrane protein 65 Homo sapiens
454120 GLAKLIADV 4 12 Flap endonuclease 1 Flap endonuclease 1 Homo sapiens
454121 GLAMVEAISYV 391 401 Adenylate cyclase type 3 Adenylate cyclase type 3 Homo sapiens
454122 GLAPLHIQL 141 149 P3 protein P3 protein Homo sapiens
454123 GLAPTSPHL 232 240 Nuclear receptor subfamily 4 Nuclear receptor subfamily 4 Homo sapiens group A member 1 group A member 1
454124 GLAPTVPQT 726 734 MKL/myocardin-like protein 2 MKL/myocardin-like protein 2 Homo sapiens
454125 GLAVKEWLL 161 169 Methylated-DNA-protein- Methylated-DNA-protein- Homo sapiens cysteine methyltransferase cysteine methyltransferase
454126 GLAVLAVVV 314 322 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, B-15 alpha chain antigen, B-15 alpha chain
454127 GLDELFVQV 234 242 GPN-loop GTPase 1 GPN-loop GTPase 1 Homo sapiens
454128 GLDIEGVKTV 526 535 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX27 RNA helicase DDX27
454129 GLDNAVSLFQV 107 117 U3 small nucleolar RNA- U3 small nucleolar RNA- Homo sapiens associated protein 18 associated protein 18
homolog homolog
454130 GLDNQIQEI 189 197 26S protease regulatory 26S protease regulatory Homo sapiens subunit 4 subunit 4
454131 GLDPGKQIKL 438 447 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Msh2 Msh2
454132 GLDPSTPAQV 130 139 Phosphatidate phosphatase Phosphatidate phosphatase Homo sapiens
LPIN1 LPIN1
454133 GLDPTGTVILL 707 717 Helicase SKI2W Helicase SKI2W Homo sapiens
454134 GLDSGFHSV 194 202 Leucine-rich repeat and Leucine-rich repeat and Homo sapiens calponin homology domain- calponin homology domain- containing protein 4 containing protein 4
454135 GLELTRVTV 157 165 Putative exonuclease GOR Putative exonuclease GOR Homo sapiens
454136 GLFAPVHKV 97 105 CAP-Gly domain-containing CAP-Gly domain-containing Homo sapiens linker protein 1 linker protein 1
454137 GLFPTSHSV 385 393 Tetratricopeptide repeat Tetratricopeptide repeat Homo sapiens protein 7A protein 7A Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
454173 GLLESHGIQKV 2340 2350 Centrosomal protein of 192 Centrosomal protein of 192 Homo sapiens kDa (UniProt:E9PF99) kDa
454174 GLLESRLDPYL 1 16 126 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 2 complex subunit 2
454175 GLLGEUL 191 198 Dynamin-like 120 kDa Dynamin-like 120 kDa Homo sapiens protein, mitochondrial protein, mitochondrial
454176 GLLGYLHFV 75 83 Phosphatidylinositol N- Phosphatidylinositol N- Homo sapiens acetylglucosaminyltransferas acetylglucosaminyl transferee e subunit H e subunit H
454177 GLLHLTLLL 13 21 Nuclear factor erythroid 2- Nuclear factor erythroid 2- Homo sapiens related factor 3 related factor 3
454178 GLLHVFVRV 1259 1267 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 3 initiation factor 4 gamma 3
(UniProt:043432)
454179 GLLKLPEDALV 1 16 126 Homeobox protein MSX-1 Homeobox protein MSX-1 Homo sapiens
454180 GLLKPSETLSL 10 20 Immunoglobulin Ig gamma-1 chain C region Homo sapiens
454181 GLLLLGGGLL 172 181 Claudin-6 Claudin-6 Homo sapiens
454182 GLLNSQNPFL 149 158 Uncharacterized protein Uncharacterized protein Homo sapiens
C3orf38 C3orf38
454183 GLLPAVKVFL 653 662 Protein SMG5 Protein SMG5 Homo sapiens
454184 GLLPSPLAV 326 334 Zinc finger protein 385A Zinc finger protein 385A Homo sapiens
454185 GLLPSPLAVA 326 335 Zinc finger protein 385A Zinc finger protein 385A Homo sapiens
454186 GLLQEVARI 28 36 Protein nepro homolog Protein nepro homolog Homo sapiens
454187 GLLQQPSALML 37 47 Other Homo sapiens 39S ribosomal protein L2, Homo sapiens
(human) protein mitochondrial
454188 GLLRDEALAEV 326 336 Putative ATP-dependent Putative ATP-dependent Homo sapiens
RNA helicase DDX11 -like RNA helicase DDX1 1-like
protein 8 protein 8
454189 GLLSDPEL 579 586 Non-receptor tyrosine-protein Non-receptor tyrosine-protein Homo sapiens kinase TNK1 kinase TNK1
454190 GLLSIFTKV 229 237 Thyroid adenoma-associated Thyroid adenoma-associated Homo sapiens protein protein
454191 GLLSNPQAHV 508 517 Tectonic-3 Tectonic-3 Homo sapiens
454192 GLLSNVSHV 691 699 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DHX29 helicase DHX29
454193 GLLTGILETV 185 194 Exportin-6 Exportin-6 Homo sapiens
454194 GLLWQVIKI 169 177 Plastin-2 Plastin-2 Homo sapiens
454195 GLLYPTEDYKV 29 39 Trafficking protein particle Trafficking protein particle Homo sapiens complex subunit 2-like complex subunit 2-like
protein (UniProt:Q9UL33) protein
454196 GLMDGSPHFL 1455 1464 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13B associated protein 13B
454197 GLMEDPMKV 313 321 Nuclear receptor corepressor Nuclear receptor corepressor Homo sapiens
1 1
454198 GLMGEGLAPHL 459 469 lmportin-4 lmportin-4 Homo sapiens
454199 GLMGISSTL 448 456 NF-kappa-B inhibitor epsilon NF-kappa-B inhibitor epsilon Homo sapiens
454200 GLMKIVKEA 72 80 Thymocyte nuclear protein 1 Thymocyte nuclear protein 1 Homo sapiens
454201 GLMLQHITL 170 178 Dihydroxyacetone phosphate Dihydroxyacetone phosphate Homo sapiens acyltransferase acyltransferase
(UniProt:015228)
454202 GLMNLPPSI 204 212 Myelin expression factor 2 Myelin expression factor 2 Homo sapiens
454203 GLMNRRDAIA 144 153 Fatty-acid amide hydrolase 2 Fatty-acid amide hydrolase 2 Homo sapiens
454204 GLMTSLVAV 454 462 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 4 complex subunit 4
(UniProt:Q9H9E3)
454205 GLNSLTYQV 233 241 Beta-1 ,4- Beta-1 ,4- Homo sapiens galactosyltransferase 1 galactosyltransferase 1
454206 GLQEKLKQLEP 167 177 Coiled-coil domain-containing Coiled-coil domain-containing Homo sapiens protein 1 15 protein 1 15
(UniProt:Q96NT0)
454207 GLRESEEKL 51 59 Pre-mRNA-splicing regulator Pre-mRNA-splicing regulator Homo sapiens
WTAP WTAP Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
454208 GLSAFLHAL 793 801 V-type proton ATPase 1 16 V-type proton ATPase 1 16 Homo sapiens kDa subunit a isoform 3 kDa subunit a isoform 3
454209 GLSEKLLAYV 510 519 Gem-associated protein 4 Gem-associated protein 4 Homo sapiens
454210 GLSEQIREL 151 159 26S protease regulatory 26S protease regulatory Homo sapiens subunit 10B subunit 10B
(UniProt:P62333)
454211 GLSGIIPTL 286 294 Adiponectin receptor protein Adiponectin receptor protein Homo sapiens
2 2
454212 GLSIADQITL 16 25 Retinoic acid receptor Retinoic acid receptor Homo sapiens gamma gamma
454213 GLSPLSPTV 411 419 Centrosomal protein of 97 Centrosomal protein of 97 Homo sapiens kDa kDa
454214 GLSSLSIHL 39 47 Calcium/calmodulin- Calcium/calmodulin- Homo sapiens dependent protein kinase dependent protein kinase
kinase 2 kinase 2
454215 GLTETGLYRI 39 48 Rac GTPase-activating Rac GTPase-activating Homo sapiens protein 1 protein 1
454216 GLTEVTQSL 205 213 Taxi -binding protein 1 Tax1-binding protein 1 Homo sapiens
454217 GLTHTAVVPL 75 84 Phosphate carrier protein, Phosphate carrier protein, Homo sapiens mitochondrial mitochondrial
454218 GLTIVIAGM 145 153 Feline leukemia virus Feline leukemia virus Homo sapiens subgroup C receptor-related subgroup C receptor-related
protein 2 protein 2
454219 GLTSGRWFL 221 229 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 39 exchange factor 39
454220 GLTVKIGDFG 168 177 RAF proto-oncogene RAF proto-oncogene Homo sapiens serine/threonine-protein serine/threonine-protein
kinase kinase
454221 GLVATVKEA 1403 1411 Nuclear receptor corepressor Nuclear receptor corepressor Homo sapiens
2 2
454222 GLVDKFPHL 934 942 Phosphatidylinositol 4-kinase Phosphatidylinositol 4-kinase Homo sapiens alpha alpha
454223 GLVEQLYDL 521 529 Nucleolar complex protein 2 Nucleolar complex protein 2 Homo sapiens homolog homolog
454224 GLVNDLARV 2220 2228 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
454225 GLVNYQISV 242 250 Beta-glucuronidase Homo sapiens
(UniProt:P08236)
454226 GLVRPPPGL 363 371 Other Homo sapiens Homo sapiens
(human) protein
454227 GLVVVNHYL 57 65 Protein TEX261 Protein TEX261 Homo sapiens
454228 GLWEGALYEI 89 98 Transmembrane channel-like Transmembrane channel-like Homo sapiens protein 8 protein 8
454229 GLWHGVLTSV 562 571 Disco-interacting protein 2 Disco-interacting protein 2 Homo sapiens homolog A homolog A
454230 GLWKDSLFL 398 406 Protein GPR107 Protein GPR107 Homo sapiens
454231 GLYDGPVCEV 497 506 Dihydropyrimidinase-related Dihydropyrimidinase-related Homo sapiens protein 2 protein 2
454232 GLYEKMEQV 174 182 TPR and ankyrin repeat- TPR and ankyrin repeat- Homo sapiens containing protein 1 containing protein 1
454233 GLYEQAFQL 276 284 Tumor necrosis factor Tumor necrosis factor Homo sapiens receptor type 1 -associated receptor type 1 -associated
DEATH domain protein DEATH domain protein
454234 GLYERPTAA 209 217 Zinc finger protein Gfi-1 Zinc finger protein Gfi-1 Homo sapiens
454235 GLYETVNEV 250 258 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 8 protein 8
454236 GLYHTSPSL 100 108 Sterile alpha motif domain- Sterile alpha motif domain- Homo sapiens containing protein 10 containing protein 10
454245 GMLDPLEVHL 2069 2078 Pre-mRNA processing Pre-mRNA processing Toxoplasma splicing factor PRP8 splicing factor PRP8 gondii ME49
454252 GMWNPNAPVFL 367 377 Rab GTPase-activating Rab GTPase-activating Homo sapiens protein 1 -like protein Mike
(UniProt:Q5R372) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
454253 GMYETPLFL 2178 2186 Nucleoprotein TPR Nucleoprotein TPR Homo sapiens
454318 GQVERFETV 883 891 lnterieukin-6 receptor subunit lnterleukin-6 receptor subunit Homo sapiens beta beta
454329 GSLGLIFAL 125 133 Protein lifeguard 4 Protein lifeguard 4 Homo sapiens
(UniProt:G3XAA5)
454345 GVIAEILRGV 1 16 125 Nucleolar protein 56 Nucleolar protein 56 Homo sapiens
454346 GVIKVFNDMKV 10 20 Cofilin-1 (UniProt:E9PP50) Cofilin-1 Homo sapiens
454348 GVLEMERLHYI 426 436 Solute carrier family 15 Solute carrier family 15 Homo sapiens member 3 (UniProt:Q8IY34) member 3
454349 GVMAGDIYSV 347 356 Perilipin-2 Perilipin-2 Homo sapiens
454350 GVMESVIAL 422 430 Protein unc-45 homolog A Protein unc-45 homolog A Homo sapiens
454413 HILEEKGLSQV 744 754 Leucine-rich repeat and Leucine-rich repeat and Homo sapiens calponin homology domain- calponin homology domain- containing protein 3 containing protein 3
454418 HLADLADFAL 1013 1022 Adenylate cyclase type 3 Adenylate cyclase type 3 Homo sapiens
454419 HLADLPVEPHL 831 841 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase YTHDC2 RNA helicase YTHDC2
454420 HLAEFHQIEGV 365 375 Phenylalanine-tRNA ligase Phenylalanine-tRNA ligase Homo sapiens alpha subunit alpha subunit
454421 HLAEVSAEV 166 174 ZW10 interactor ZW10 interactor Homo sapiens
454422 HLAKLVSLV 306 314 Thioredoxin domain- Thioredoxin domain- Homo sapiens containing protein 11 containing protein 11
454423 HLANIVERL 427 435 Protein TRIM6-TRIM34 Protein TRIM6-TRIM34 Homo sapiens
454424 HLANTYISV 155 163 Gamma-adducin Gamma-adducin Homo sapiens
454425 HLAPNTFNV 376 384 T-box transcription factor T-box transcription factor Homo sapiens
TBX15 (UniProt:Q96SF7) TBX15
454426 HLDEAIHVL 396 404 Transcription factor E2-alpha Transcription factor E2-alpha Homo sapiens
(UniProt:P15923)
454427 HLDKKTQTP 66 74 C-C motif chemokine 7 C-C motif chemokine 7 Homo sapiens
454428 HLDLPSNNNL 1346 1355 Protein SON Protein SON Homo sapiens
(UniProt:H7C1 M2)
454429 HLDPAVKEV 71 79 Pre-mRNA-processing factor Pre-mRNA-processing factor Homo sapiens
17 17
454430 HLDRLVPLV 241 249 Cullin-associated NEDD8- Cullin-associated NEDD8- Homo sapiens dissociated protein 2 dissociated protein 2
454431 HLDTVPPSV 559 567 Leucine-rich repeat Leucine-rich repeat Homo sapiens serine/threonine-protein serine/threonine-protein
kinase 1 kinase 1
454432 HLDVKPANI 162 170 Membrane-associated Membrane-associated Homo sapiens tyrosine- and threonine- tyrosine- and threonine- specific cdc2-inhibitory specific cdc2-inhibitory
kinase (UniProt:Q99640) kinase
454433 HLFDAFVSV 141 149 DEP domain-containing DEP domain-containing Homo sapiens protein 1 B protein 1 B
454434 HLFDTLHAL 652 660 Exocyst complex component Exocyst complex component Homo sapiens
5 5
454435 HLFEDAYLLTL 104 114 Histone H3-like centromeric Histone H3-like centromeric Homo sapiens protein A protein A
454436 HLFEGSNTSL 468 477 Leucine-rich repeat Leucine-rich repeat Homo sapiens serine/threonine-protein serine/threonine-protein
kinase 2 kinase 2
454437 HLFENLLRL 856 864 Nesprin-3 Nesprin-3 Homo sapiens
454438 HLFEYYHRL 293 301 Galectin-9 (UniProt:O00182) Galectin-9 Homo sapiens
454439 HLFGALVLL 1226 1234 RNA polymerase II- RNA polymerase II- Homo sapiens associated protein 1 associated protein 1
454440 HLFKDKVVL 75 83 Protein arginine N- Protein arginine N- Homo sapiens methyltransferase 1 methyltransferase 1
(UniProt:Q99873)
454441 HLFRDVAEV 85 93 Adenine DNA glycosylase Adenine DNA glycosylase Homo sapiens
454442 HLFTATINL 883 891 Tight junction protein ZO-2 Tight junction protein ZO-2 Homo sapiens
454443 HLGDRPIPV 187 195 TraB domain-containing TraB domain-containing Homo sapiens protein protein
454444 HLGEYQAAV 1233 1241 Clathrin heavy chain 1 Clathrin heavy chain 1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
454445 HLIEAVEAI 1380 1388 Rab3 GTPase-activating Rab3 GTPase-activating Homo sapiens protein non-catalytic subunit protein non-catalytic subunit
454446 HLIEESVKL 646 654 Helicase ARIP4 Helicase ARIP4 Homo sapiens
454447 HLIEQDFPGM 77 86 EH domain-containing EH domain-containing Homo sapiens protein 1 protein 1
454448 HLIHEVTKV 77 85 Neutral alpha-glucosidase Neutral alpha-glucosidase Homo sapiens
AB (UniProt:Q14697) AB
454449 HLINVEGVGV 269 278 Actin-related protein 2 Actin-related protein 2 Homo sapiens
454450 HUSTINTV 166 174 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX31 RNA helicase DDX31
454451 HLKEDQTEYL 92 101 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens beta beta
454452 HLLDHLSIVYV 279 289 Transmembrane protein 131 - Transmembrane protein 131 - Homo sapiens like (UniProt:A2VDJ0) like
454453 HLLDNTERL 1 17 125 Vesicle transport through Vesicle transport through Homo sapiens interaction with t-SNAREs interaction with t-SNAREs
homolog 1A homolog 1A
454454 HLLEADIKL 259 267 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 28 exchange factor 28
454455 HLLEGQNASV 1 14 123 Kinesin-like protein KIF22 Kinesin-like protein KIF22 Homo sapiens
454456 HLLERSWYA 76 84 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens synoviolin synoviolin
454457 HLLGRLAAI 14 22 60S ribosomal protein L13a 60S ribosomal protein L13a Homo sapiens
454458 HLLGSEQQSSV 286 296 Sortilin-related receptor Sortilin-related receptor Homo sapiens
454459 HLLPHVLQV 131 139 WD repeat-containing protein WD repeat-containing protein Homo sapiens
81 81
454460 HLLPTQLEV 567 575 Other Homo sapiens Transcription factor ETV6 Homo sapiens
(human) protein
454461 HLLQELSQV 600 608 Centrosomal protein of 72 Centrosomal protein of 72 Homo sapiens kDa kDa
454462 HLLRFLEAV 273 281 Protein lifeguard 4 Protein lifeguard 4 Homo sapiens
(UniProt:G3XAA5)
454463 HLLTHIQAV 608 616 Zinc finger protein 335 Zinc finger protein 335 Homo sapiens
454464 HLMHTSYFL 269 277 Transmembrane protein 248 Transmembrane protein 248 Homo sapiens
454465 HLMPHLLTL 848 856 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 1 subunit 1
454466 HLMQTSFQL 287 295 TATA element modulatory TATA element modulatory Homo sapiens factor factor
454467 HLMTKVEEL 532 540 FK506-binding protein 15 FK506-binding protein 15 Homo sapiens
454468 HLPPTFHAV 60 68 Ras GTPase-activating Ras GTPase-activating Homo sapiens protein 4 protein 4
454469 HLQEKLQSL 2031 2039 Other Homo sapiens Centromere protein F Homo sapiens
(human) protein
454470 HLSDAIVEV 517 525 Late secretory pathway Late secretory pathway Homo sapiens protein AVL9 homolog protein AVL9 homolog
(UniProt:Q8NBF6)
454471 HLSDHLSEL 1780 1788 U5 small nuclear U5 small nuclear Homo sapiens ribonucleoprotein 200 kDa ribonucleoprotein 200 kDa
helicase helicase
454472 HLSDLALTL 85 93 N6-adenosine- N6-adenosine- Homo sapiens methyltransferase 70 kDa methyltransferase 70 kDa
subunit subunit
454473 HLSSIEVLI 330 338 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX27 RNA helicase DDX27
454474 HLTEDTPKV 17 25 Sterol-4-alpha-carboxylate 3- Sterol-4-alpha-carboxylate 3- Homo sapiens dehydrogenase, dehydrogenase,
decarboxylating decarboxylating
454475 HLTEMQAKV 104 112 Leupaxin (UniProt:O6071 1 ) Leupaxin Homo sapiens
454476 HLTEVLTLV 278 286 GDH/6PGL endoplasmic GDH/6PGL endoplasmic Homo sapiens bifunctional protein bifunctional protein
454477 HLTLVEAIK 47 55 Dual specificity protein Dual specificity protein Homo sapiens phosphatase 26 phosphatase 26 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
454704 ILDESHERV 16 24 U6 snRNA-associated Sm- U6 snRNA-associated Sm- Homo sapiens like protein LSm8 like protein LSm8
454705 ILDEVIFKL 210 218 IQ calmodulin-binding motif- IQ calmodulin-binding motif- Homo sapiens containing protein 1 containing protein 1
454706 ILDKATEYI 54 62 Protein max Protein max Homo sapiens
(UniProt:P61244)
454707 ILDQSRETV 307 315 Coiled-coil domain-containing Coiled-coil domain-containing Homo sapiens protein 66 protein 66
454708 ILDQTNVSA 458 466 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein U ribonucleoprotein U
454709 ILDRLTTKV 40 48 Synaptosomal-associated Synaptosomal-associated Homo sapiens protein 29 protein 29
454710 ILDRMLPEL 1 13 121 Lymphoid-specific helicase Lymphoid-specific helicase Homo sapiens
(UniProt:Q9NRZ9)
454711 ILDSGATHTT 127 136 Actin-like protein 6A Actin-like protein 6A Homo sapiens
454712 ILDSVLHHL 133 141 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HECTD3 HECTD3
454713 ILEENIPVL 92 100 Breast carcinoma-amplified Breast carcinoma-amplified Homo sapiens sequence 4 sequence 4
454714 ILEEQPMDMLL 312 322 Protein DDI1 homolog 2 Protein DDI1 homolog 2 Homo sapiens
454715 ILFELLKSLEA 1 11 121 Gem-associated protein 4 Gem-associated protein 4 Homo sapiens
454716 ILFGUKDV 531 539 Putative pre-mRNA-splicing Putative pre-mRNA-splicing Homo sapiens factor ATP-dependent RNA factor ATP-dependent RNA
helicase DHX16 helicase DHX16
454717 ILFNKLWEL 1442 1450 Pecanex-like protein 1 Pecanex-like protein 1 Homo sapiens
(UniProt:Q96RV3)
454718 ILFPIKQPITV 565 575 Protein arginine N- Protein arginine N- Homo sapiens methyltransferase 5 methyltransferase 5
454720 ILGDFLVAV 514 522 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 7 complex subunit 7
454721 ILGDILLSA 3212 3220 Dynein heavy chain 14, Dynein heavy chain 14, Homo sapiens axonemal (UniProt:H9KV43) axonemal
454722 ILGGLFPVHA 47 56 Metabotropic glutamate Metabotropic glutamate Homo sapiens receptor 8 receptor 8
454723 ILGGPGTVQGV 9 19 Copper chaperone for Copper chaperone for Homo sapiens superoxide dismutase superoxide dismutase
454724 ILGPKPQGV 444 452 Major facilitator superfamily Major facilitator superfamily Homo sapiens domain-containing protein 8 domain-containing protein 8
(UniProt:Q8NHS3)
454725 ILGPPPPSFHL 355 365 Matrin-3 (UniProt:P43243) Matrin-3 Homo sapiens
454726 ILGTEDUVEV 26 36 Alpha- and gamma-adaptin- Alpha- and gamma-adaptin- Homo sapiens binding protein p34 binding protein p34
454727 ILGTHNITV 849 857 Integrator complex subunit 7 Integrator complex subunit 7 Homo sapiens
454728 ILHENFTTV 245 253 Cytoplasmic dynein 1 light Cytoplasmic dynein 1 light Homo sapiens intermediate chain 2 intermediate chain 2
(UniProt:B4DZP4)
454729 ILHGLVAAV 122 130 Protein asunder homolog Protein asunder homolog Homo sapiens
(UniProt:Q9NVM9)
454730 ILHHVNIGL 886 894 Activating signal cointegrator Activating signal cointegrator Homo sapiens
1 complex subunit 3 1 complex subunit 3
(UniProt:Q8N3C0)
454731 ILHSVTTNL 144 152 Protein NEDD1 Protein NEDD1 Homo sapiens
454732 ILHTLLTLV 183 191 Neurofibromin Neurofibromin Homo sapiens
454733 IUDEVDKI 590 598 Lon protease homolog, Lon protease homolog, Homo sapiens mitochondrial mitochondrial
454734 IUDKSGKLEL 417 427 Immunoglobulin superfamily Immunoglobulin superfamily Homo sapiens member 10 member 10
454735 IUKGLAKL 281 289 Exocyst complex component Exocyst complex component Homo sapiens
4 4
454736 IUPNVETI 337 345 Putative sodium-coupled Putative sodium-coupled Homo sapiens neutral amino acid neutral amino acid
transporter 10 transporter 10 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
454737 ILKDVIPPLE 67 76 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 15 protein 15
454738 ILKETIEIL 463 471 Superkiller viralicidic activity Superkiller viralicidic activity Homo sapiens
2-like 2 2-like 2
454739 ILKQLQIIL 60 68 Arf-GAP with Rho-GAP Arf-GAP with Rho-GAP Homo sapiens domain, ANK repeat and PH domain, ANK repeat and PH
domain-containing protein 2 domain-containing protein 2
454740 ILKSALQVE 272 280 Arf-GAP with SH3 domain, Arf-GAP with SH3 domain, Homo sapiens
ANK repeat and PH domain- ANK repeat and PH domain- containing protein 2 containing protein 2
454741 ILLAEGRLVNL 339 349 Adenosylhomocysteinase Adenosylhomocysteinase Homo sapiens
454742 ILLAEVDKV 409 417 Protein angel homolog 1 Protein angel homolog 1 Homo sapiens
454743 ILLDDNMQIRL 159 169 Phosphorylase b kinase Phosphorylase b kinase Homo sapiens gamma catalytic chain, gamma catalytic chain,
liver/testis isoform liver/testis isoform
454744 ILLDDQFQPKL 238 248 lnterleukin-1 receptor- lnterleukin-1 receptor- Homo sapiens associated kinase 3 associated kinase 3
454745 ILLDEEGHIKI 92 102 Ribosomal protein S6 kinase Ribosomal protein S6 kinase Homo sapiens alpha-2 alpha-2
454746 ILLDEEGHIKL 198 208 Ribosomal protein S6 kinase Ribosomal protein S6 kinase Homo sapiens alpha-3 alpha-3
454747 ILLDHEKEWKL 564 574 Arginine— tRNA ligase, Arginine— tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
454748 ILLDKLURL 791 800 Chromodomain-helicase- Chromodomain-helicase- Homo sapiens
DNA-binding protein 1 DNA-binding protein 1
454749 ILLEELDLEKL 1341 1351 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 17 containing protein 17
(UniProt:075179)
454750 ILLEGTMNL 248 256 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 24 II transcription subunit 24
(UniProt:075448)
454751 ILLEHIIMC 146 154 UniProt:G8JL95 Homo sapiens
454752 ILLEHKVVL 316 324 MAP kinase-activating death MAP kinase-activating death Homo sapiens domain protein domain protein
454753 ILLEMIHSI 55 63 BAG family molecular BAG family molecular Homo sapiens chaperone regulator 2 chaperone regulator 2
454754 ILLESHMVMI 541 550 Protein O-mannosyl- Protein O-mannosyl- Homo sapiens transferase 2 transferase 2
454755 ILLGRIKDLEL 275 285 Ubiquitin conjugation factor Ubiquitin conjugation factor Homo sapiens
E4 A E4 A
454756 ILLGVNSY Unidentified protein unidentified
454757 ILLHQVEAL 33 41 Mannose-1 -phosphate Mannose-1 -phosphate Homo sapiens guanyltransferase beta guanyltransferase beta
454758 ILLKALTNL 69 77 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit K initiation factor 3 subunit K
454759 ILLKEIILV 215 223 Polypeptide N- Polypeptide N- Homo sapiens acetylgalactosaminyltransfer acetylgalactosaminyltransfer ase 3 ase 3
454760 ILLNEDDLVTI 579 589 Ectopic P granules protein 5 Ectopic P granules protein 5 Homo sapiens homolog homolog
454761 ILLNIIERL 360 368 Tuberin (UniProt:P49815) Tuberin Homo sapiens
454762 ILLPEEQQLLL 521 531 tRNA wybutosine- tRNA wybutosine- Homo sapiens synthesizing protein 4 synthesizing protein 4
454763 ILLPFTEQL Unidentified protein unidentified
454764 ILLPRIIEA 871 879 Sodium bicarbonate Sodium bicarbonate Homo sapiens transporter-like protein 11 transporter-like protein 1 1
454765 ILLPRPPQV 170 178 Protein ARV1 Protein ARV1 Homo sapiens
(UniProt:H7C0E7)
454766 ILLQQQQQL 68 76 Interferon regulatory factor 2- Interferon regulatory factor 2- Homo sapiens binding protein 2 binding protein 2
454767 ILLQVAALKYI 170 180 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 2 (UniProt:E5RFJ0) protein 2 Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
454768 ILLSGASPFL 209 218 Death-associated protein Death-associated protein Homo sapiens kinase 1 (UniProt:P53355) kinase 1
454769 ILLTEPGQVKL 153 163 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase TA03 kinase TA03
454770 ILMDERTFL 46 54 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 34 hydrolase 34
454771 ILMEHIHK 1 18 125 60S ribosomal protein L19 60S ribosomal protein L19 Homo sapiens
454772 ILMEKYLKL 129 137 Integrator complex subunit 3 Integrator complex subunit 3 Homo sapiens
454773 ILMGHSLYM 1339 1347 Protein TALPID3 Protein TALPID3 Homo sapiens
454775 ILMHSPPSA 60 68 Transmembrane protein 116 Transmembrane protein 116 Homo sapiens
454776 ILMPNGAVAAV 176 186 Polyhomeotic-like protein 1 Polyhomeotic-like protein 1 Homo sapiens
454777 ILMQNIETV 1655 1663 PHD finger protein 3 PHD finger protein 3 Homo sapiens
454778 ILMSPNSYIKL 536 546 Nuclear pore membrane Nuclear pore membrane Homo sapiens glycoprotein 210 glycoprotein 210
454779 ILNDPSQSEVM 1 17 127 Proteasome maturation Proteasome maturation Homo sapiens protein protein
454780 ILNEFPGHGL 877 886 DNA repair protein DNA repair protein Homo sapiens complementing XP-G cells complementing XP-G cells
454781 ILNEIVNFV 336 344 lmportin-5 lmportin-5 Homo sapiens
454782 ILNEQAAKV 688 696 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Msh3 Msh3
454783 ILNETGKILL 151 160 UPF0553 protein C9orf64 UPF0553 protein C9orf64 Homo sapiens
454784 ILNEVDISV 1341 1349 Protein furry homolog-like Protein furry homolog-like Homo sapiens
454785 ILNNHTWNL 74 82 Calcium homeostasis Calcium homeostasis Homo sapiens modulator protein 2 modulator protein 2
454786 ILNPHVHVI 389 397 Calcium/calmodulin- Calcium/calmodulin- Homo sapiens dependent protein kinase dependent protein kinase
type II subunit gamma type II subunit gamma
454787 ILNSTTIEI 915 923 DNA topoisomerase 2-alpha DNA topoisomerase 2-alpha Homo sapiens
454788 ILNTLNITV 156 164 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- d iphosphool igosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit STT3B subunit STT3B
454789 ILNYVLVRV 45 53 Meiotic recombination protein Meiotic recombination protein Homo sapiens
REC8 homolog REC8 homolog
454790 ILPGSLTASL 225 234 Other Homo sapiens APC membrane recruitment Homo sapiens
(human) protein protein 2
454791 ILQDLQPFL 746 754 Werner syndrome ATP- Werner syndrome ATP- Homo sapiens dependent helicase dependent helicase
454792 ILQDLTFVHL 1006 1015 Rap guanine nucleotide Rap guanine nucleotide Homo sapiens exchange factor 1 exchange factor 1
(UniProt:Q13905)
454793 ILQEFESKL 1450 1458 DNA excision repair protein DNA excision repair protein Homo sapiens
ERCC-6 (UniProt:Q03468) ERCC-6
454794 ILQENLKDIML 311 321 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein subunit alpha-12 protein subunit alpha-12
(UniProt:B3KXS2)
454795 ILQESUKL 273 281 Myotubularin-related protein Myotubularin-related protein Homo sapiens
9 9
454796 ILQLSLAL 410 417 Thymic stromal cotransporter Thymic stromal cotransporter Homo sapiens homolog homolog
454797 ILQPMDIHV 737 745 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13C associated protein 13C
454798 ILQSKEPAYV 614 623 Unconventional myosin-lc Unconventional myosin-lc Homo sapiens
454799 ILQTIESGGL 3351 3360 Hydrocephalus-inducing Hydrocephalus-inducing Homo sapiens protein homolog protein homolog
454800 ILRAILEVL 565 573 Triokinase/FMN cyclase Triokinase/FMN cyclase Homo sapiens
454801 ILRDTSEDL 273 281 Tektin-4 Tektin-4 Homo sapiens
454802 ILSEFSSKL 936 944 Cohesin subunit SA-2 Cohesin subunit SA-2 Homo sapiens
454803 ILSEIKEAV 434 442 Transcription factor 25 Transcription factor 25 Homo sapiens
(UniProt:Q9BQ70)
454804 ILSELLSNL 85 93 Other Homo sapiens Dynamin-1 Homo sapiens
(human) protein
conanng proen conanng proen Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
455296 KITEYLERV 56 64 Calpain-7 Calpain-7 Homo sapiens
455299 KIVPIAIQL 320 328 Arachidonate 5-lipoxygenase Arachidonate 5-lipoxygenase Homo sapiens
455300 KIWDLKERTNV 375 385 Pre-mRNA-processing factor Pre-mRNA-processing factor Homo sapiens
19 19
455310 KLADFGLARI 160 169 Cyclin-dependent kinase 4 Cyclin-dependent kinase 4 Homo sapiens
455311 KLADLSLRI 51 59 WASH complex subunit WASH complex subunit Homo sapiens
CCDC53 CCDC53
455312 KLADMNQEYQL 1545 1555 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX60 RNA helicase DDX60
455313 KLADSIKAI 906 914 TPR and ankyrin repeat- TPR and ankyrin repeat- Homo sapiens containing protein 1 containing protein 1
455314 KLAEENPDL 105 113 Ganglioside-induced Ganglioside-induced Homo sapiens differentiation-associated differentiation-associated
protein 1 protein 1
455315 KLAEFIDFL 332 340 Alpha-(1 ,3)- Alpha-(1 ,3)- Homo sapiens fucosyltransferase 1 1 fucosyltransferase 1 1
455316 KLAEGLDIQL 539 548 Lysine-specific histone Lysine-specific histone Homo sapiens demethylase 1 B demethylase 1 B
(UniProt:Q8NB78)
455317 KLAEGSAYEEV 465 475 1 -phosphatidylinositol 4,5- 1 -phosphatidylinositol 4,5- Homo sapiens bisphosphate bisphosphate
phosphodiesterase gamma-1 phosphodiesterase gamma-1
455318 KLAEGVQLL 1062 1070 WD repeat-containing protein WD repeat-containing protein Homo sapiens
1 1 1 1
455319 KLAELHGNMFV 128 138 NAD-dependent protein NAD-dependent protein Homo sapiens deacetylase sirtuin-6 deacetylase sirtuin-6
(UniProt:Q8N6T7)
455320 KLAENEITL 94 102 Peptide chain release factor Peptide chain release factor Homo sapiens
Mike, mitochondrial Mike, mitochondrial
455321 KLAERLWSM 864 872 Translational activator GCN1 Translational activator GCN1 Homo sapiens
455322 KLAEVLEAV 679 687 Ubiquitin conjugation factor Ubiquitin conjugation factor Homo sapiens
E4 A E4 A
455323 KLAEVSQNI 447 455 Formin-binding protein 1 Formin-binding protein 1 Homo sapiens
455324 KLAEVTKVV 465 473 Ribonucleoside-diphosphate Ribonucleoside-diphosphate Homo sapiens reductase large subunit reductase large subunit
455325 KLAEVTKVVV 465 474 Ribonucleoside-diphosphate Ribonucleoside-diphosphate Homo sapiens reductase large subunit reductase large subunit
455326 KLAMLTGVLL 153 162 Basic leucine zipper and W2 Basic leucine zipper and W2 Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:Q7L1 Q6)
455327 KLAPPSSTL 21 29 KAT8 regulatory NSL KAT8 regulatory NSL Homo sapiens complex subunit 1 complex subunit 1
455328 KLAQALHEM 241 249 Lamin-B1 Lamin-B1 Homo sapiens
455329 KLAQANGWGV 59 68 Alpha-enolase Alpha-enolase Homo sapiens
455330 KLAQWLWGL 3 11 Dolichol-phosphate Dolichol-phosphate Homo sapiens mannosyltransferase subunit mannosyltransferase subunit
3 3
455331 KLDDIVQHI 1 160 1168 Sperm-associated antigen 5 Sperm-associated antigen 5 Homo sapiens
455332 KLDDTYIKA 312 320 DnaJ homolog subfamily C DnaJ homolog subfamily C Homo sapiens member 7 member 7
455333 KLDEDVKMI 53 61 Nuclear transcription factor Y Nuclear transcription factor Y Homo sapiens subunit gamma subunit gamma
455334 KLDEILKEI 440 448 Coronin-1C Coronin-1C Homo sapiens
455335 KLDHINMNL 759 767 Protein LAP2 Protein LAP2 Homo sapiens
455336 KLDHTLSQI 88 96 Protein NPAT Protein NPAT Homo sapiens
455337 KLDVDAPRL 60 68 SEC14-like protein 1 SEC14-like protein 1 Homo sapiens
455339 KLEEIIHQI 828 836 Rab3 GTPase-activating Rab3 GTPase-activating Homo sapiens protein catalytic subunit protein catalytic subunit
455340 KLEEQLEKI 106 114 Citron Rho-interacting kinase Citron Rho-interacting kinase Homo sapiens
455341 KLENTLQDV Unidentified protein unidentified
455342 KLEPHIYAV 185 193 Unconventional myosin-IXa Unconventional myosin-IXa Homo sapiens
(UniProt:B2RTY4)
455343 KLESIKEI 1 151 1158 Early endosome antigen 1 Early endosome antigen 1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
455344 KLFDASHSL 1328 1336 Bromodomain adjacent to Bromodomain adjacent to Homo sapiens zinc finger domain protein 2B zinc finger domain protein 2B
455345 KLFDIFSQQV 323 332 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 35 associated protein 35
455346 KLFDLDEKLML 210 220 Protein SAAL1 Protein SAAL1 Homo sapiens
455347 KLFDNTVGA 189 197 Transmembrane protein 223 Transmembrane protein 223 Homo sapiens
455348 KLFDTQHRV 32 40 tRNA wybutosine- tRNA wybutosine- Homo sapiens synthesizing protein 2 synthesizing protein 2
homolog homolog
455349 KLFEDTKYTTL 65 75 Testin Testin Homo sapiens
455350 KLFEEIREI 131 139 T-complex protein 11 -like T-complex protein 11 -like Homo sapiens protein 2 protein 2
455351 KLFEEIREILL 131 141 T-complex protein 1 1 -like T-complex protein 11 -like Homo sapiens protein 2 protein 2
455352 KLFEFMHET 568 576 Exportin-1 (UniProt:O14980) Exportin-1 Homo sapiens
455353 KLFEGLKFFL 320 329 Pescadillo homolog Pescadillo homolog Homo sapiens
455354 KLFEKKYSV 567 575 TATA box-binding protein- TATA box-binding protein- Homo sapiens associated factor RNA associated factor RNA
polymerase I subunit B polymerase I subunit B
455355 KLFENFLVDI 1443 1452 Inositol 1 ,4,5-trisphosphate Inositol 1 ,4,5-trisphosphate Homo sapiens receptor type 1 receptor type 1
455356 KLFGLQEAMKV 1841 1851 Retinoic acid-induced protein Retinoic acid-induced protein Homo sapiens
1 1
455357 KLFGLVMAL 437 445 Solute carrier family 43 Solute carrier family 43 Homo sapiens member 3 member 3
455358 KLFLPDGMEA 5 14 Sarcolemmal membrane- Sarcolemmal membrane- Homo sapiens associated protein associated protein
455359 KLFLQKINE 1 14 122 Bromodomain-containing Bromodomain-containing Homo sapiens protein 4 protein 4
455360 KLFNDAIRL 178 186 Rab-like protein 2B Rab-like protein 2B Homo sapiens
455361 KLFNDAIRLAV 178 188 Rab-like protein 2B Rab-like protein 2B Homo sapiens
455362 KLFNEFIQL 837 845 WD repeat-containing protein WD repeat-containing protein Homo sapiens
3 3
455363 KLFPFYFHI 52 60 Transmembrane protein 205 Transmembrane protein 205 Homo sapiens
455364 KLFPGFEIETV 221 231 Asparagine synthetase Asparagine synthetase Homo sapiens
[glutamine-hydrolyzingl [glutamine-hydrolyzingl
455365 KLFPQETLFL 477 486 FAS-associated factor 1 FAS-associated factor 1 Homo sapiens
(UniProt:B1ANM7)
455366 KLFQLPTPPL 34 43 Choline/ethanolaminephosph Choline/ethanolaminephosph Homo sapiens otransferase 1 otransferase 1
455367 KLFSAKLEQL 1653 1662 Kinesin-like protein KIF26B Kinesin-like protein KIF26B Homo sapiens
455368 KLFSDLREI 26 34 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase TA02 kinase TA02
455369 KLFSGVLMDL 183 192 PWWP domain-containing PWWP domain-containing Homo sapiens protein 2A protein 2A
455370 KLFSLEHFL 368 376 Interferon regulatory factor 5 Homo sapiens
(UniProt:Q13568)
455371 KLGAVFNQV 769 777 Splicing factor 3B subunit 3 Splicing factor 3B subunit 3 Homo sapiens
455372 KLGDFGLLV 179 187 Membrane-associated Membrane-associated Homo sapiens tyrosine- and threonine- tyrosine- and threonine- specific cdc2-inhibitory specific cdc2-inhibitory
kinase (UniProt:Q99640) kinase
455373 KLGDFGLLVEL 248 258 Membrane-associated Membrane-associated Homo sapiens tyrosine- and threonine- tyrosine- and threonine- specific cdc2-inhibitory specific cdc2-inhibitory
kinase (UniProt:Q99640) kinase
455374 KLGDFPYVSI 190 199 UBX domain-containing UBX domain-containing Homo sapiens protein 7 protein 7
455375 KLGDIMGV 474 481 Pre-mRNA-splicing factor Pre-mRNA-splicing factor Homo sapiens
ATP-dependent RNA ATP-dependent RNA
helicase PRP16 helicase PRP16
455376 KLGDLFFRV 272 280 Inactive ubiquitin carboxyl- Inactive ubiquitin carboxyl- Homo sapiens terminal hydrolase 54 terminal hydrolase 54 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
455377 KLGDLMVLL 851 859 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DHX37 RNA helicase DHX37
455378 KLGEILANL 198 206 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 24 II transcription subunit 24
(UniProt:075448)
455379 KLGFTVTV 465 472 Tri peptid yl-peptidase 2 Tripeptidyl-peptidase 2 Homo sapiens
455380 KLGLAPQI 161 168 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
455381 KLGPEGELL 45 53 Neutral amino acid Neutral amino acid Homo sapiens transporter B(0) transporter B(0)
455382 KLGVSIQN 896 903 ATP-binding cassette subATP-binding cassette subHomo sapiens family A member 1 family A member 1
455383 KLHAVVETL 325 333 Sorting nexin-1 Sorting nexin-1 Homo sapiens
455384 KLHDEDLLL 215 223 Bifunctional UDP-N- Bifunctional UDP-N- Homo sapiens acetylglucosamine 2- acetylglucosamine 2- epimerase/N- epimerase/N- acetylmannosamine kinase acetylmannosamine kinase
455385 KLHDFGYRGV 189 198 Nicotinamide Nicotinamide Homo sapiens phosphoribosyltransferase phosphoribosyltransferase
455386 KLHDINAQM 147 155 AP-2 complex subunit beta AP-2 complex subunit beta Homo sapiens
455387 KLHDRLAQL 532 540 Inner nuclear membrane Inner nuclear membrane Homo sapiens protein Man1 protein Man1
455388 KLHDSVVMV 35 43 UPF0687 protein C20orf27 UPF0687 protein C20orf27 Homo sapiens
455389 KLHGGIDILV 4 13 Dehydrogenase/reductase Dehydrogenase/reductase Homo sapiens
SDR family member 4 SDR family member 4
455390 KLHULDYV 94 102 Ribosomal protein S6 kinase Ribosomal protein S6 kinase Homo sapiens alpha-4 alpha-4
455391 KLHPGLLEV 239 247 Torsin-3A Tors in -3 A Homo sapiens
455392 KLHRETFYL 145 153 G1/S-specific cyclin-E1 G1/S-specific cyclin-E1 Homo sapiens
455393 KLHSEDIEL 300 308 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 24 hydrolase 24
455394 KLIAVLESI 525 533 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HECTD1 HECTD1
455395 KLIDFSAQI 356 364 Tyrosine-protein kinase HCK Tyrosine-protein kinase HCK Homo sapiens
455396 KLIDHQGLYL 630 639 Zinc finger and SCAN Zinc finger and SCAN Homo sapiens domain-containing protein 20 domain-containing protein 20
455397 KLIDLEHLLF 428 437 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF168 RNF168
455398 KLIDRENFV 74 82 Cytochrome c oxidase Cytochrome c oxidase Homo sapiens assembly factor 1 homolog assembly factor 1 homolog
(UniProt:Q9GZY4)
455399 KLIEFLLKA 43 51 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 6 regulatory phosphatase 6 regulatory
subunit 3 (UniProt:Q5H9R7) subunit 3
455400 KLIEGLPEKV 127 136 39S ribosomal protein L37, 39S ribosomal protein L37, Homo sapiens mitochondrial mitochondrial
(UniProt:Q9BZE1)
455401 KLIEILEQL 304 312 Dehydrogenase/reductase Dehydrogenase/reductase Homo sapiens
SDR family member 12 SDR family member 12
455402 KLIEKNYFL 443 451 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX18 helicase DDX18
455403 KLIETELLQL 476 485 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
LRSAM1 LRSAM1
455404 KLIEVDDERKL 12 22 40S ribosomal protein S6 40S ribosomal protein S6 Homo sapiens
455405 KLIGEELAQL 190 199 Ataxin-3 (UniProt:P54252) Ataxin-3 Homo sapiens
455406 KUHPDEDISL 362 372 BUB3-interacting and GLEBS BUB3-interacting and GLEBS Homo sapiens motif-containing protein motif-containing protein
ZNF207 (UniProt:O43670) ZNF207
455407 KUIKPDIQ 106 114 T-cell receptor T-cell receptor alpha chain C Homo sapiens region
455408 KLIKTSPEL 79 87 Tubulin-tyrosine ligase Tubulin-tyrosine ligase Homo sapiens
455409 KLINQVNTI 241 249 Protein furry homolog-like Protein furry homolog-like Homo sapiens
455410 KLIQELKTA 1075 1083 Early endosome antigen 1 Early endosome antigen 1 Homo sapiens
TET2 (UniProt:E7EPB1) TET2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
455449 KLLEELSHQL 559 568 Inhibitor of nuclear factor Inhibitor of nuclear factor Homo sapiens kappa-B kinase subunit kappa-B kinase subunit
epsilon epsilon
455450 KLLEFDQLQL 512 521 Synaptojanin-2 Synaptojanin-2 Homo sapiens
455451 KLLEFQLAL 453 461 Stress-induced- Stress-induced- Homo sapiens phosphoprotein 1 phosphoprotein 1
455452 KLLEGQVIQL 27 36 Zinc finger protein 76 Zinc finger protein 76 Homo sapiens
455453 KLLEGTIVNV 386 395 ATP-dependent CIp protease ATP-dependent CIp protease Homo sapiens
ATP-binding subunit clpX- ATP-binding subunit clpX- like, mitochondrial like, mitochondrial
455454 KLLEIMTRI 553 561 Interferon-induced helicase C Interferon-induced helicase C Homo sapiens domain-containing protein 1 domain-containing protein 1
455455 KLLEPDDKLFI 935 945 Probable phospholipid- Probable phospholipid- Homo sapiens transporting ATPase VD transporting ATPase VD
455456 KLLEQVNRI 336 344 Glypican-5 Glypican-5 Homo sapiens
455457 KLLESWLTL 404 412 Exportin-4 Exportin-4 Homo sapiens
455458 KLLETELLQEI 386 396 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
DTX3L DTX3L
455459 KLLETESFQM 596 605 Acetyl-CoA carboxylase 1 Acetyl-CoA carboxylase 1 Homo sapiens
455460 KLLETMQHL 246 254 Coiled-coil alpha-helical rod Coiled-coil alpha-helical rod Homo sapiens protein 1 protein 1
455461 KLLEVQILE 1083 1091 GRIP and coiled-coil domain- GRIP and coiled-coil domain- Homo sapiens containing protein 2 containing protein 2
455462 KLLEVQILEV 1083 1092 GRIP and coiled-coil domain- GRIP and coiled-coil domain- Homo sapiens containing protein 2 containing protein 2
455463 KLLEVSDDPQV 396 406 V-type proton ATPase V-type proton ATPase Homo sapiens subunit H subunit H
455464 KLLGALLLL 325 333 DnaJ homolog subfamily C DnaJ homolog subfamily C Homo sapiens member 14 member 14
455465 KLLGKVETA 122 130 TEL02-i nteracti ng protein 2 TEL02-interacting protein 2 Homo sapiens
455466 KLLGPKINFV 409 418 TEL02-i nteracti ng protein 1 TEL02-interacting protein 1 Homo sapiens homolog homolog
455467 KLLGTVVAL 38 46 Protein-L-isoaspartate O- Protein-L-isoaspartate O- Homo sapiens methyltransferase methyltransferase
455468 KLLHSENYV 208 216 Calcium-binding protein 39 Calcium-binding protein 39 Homo sapiens
455469 KLLKYLEAV 224 232 60 kDa SS-A Ro 60 kDa SS-A/Ro Homo sapiens ribonucleoprotein ribonucleoprotein
455470 KLLLRLPAL 209 217 Retinoic acid receptor RXR- Retinoic acid receptor RXR- Homo sapiens alpha alpha
455471 KLLLRLPSL 192 200 COUP transcription factor 2 COUP transcription factor 2 Homo sapiens
455472 KLLNHVTQL 205 213 Sister chromatid cohesion Sister chromatid cohesion Homo sapiens protein DCC1 protein DCC1
455473 KLLNLISKL 41 49 Phorbol-12-myristate-13- Phorbol-12-myristate-13- Homo sapiens acetate-induced protein 1 acetate-induced protein 1
455474 KLLPDTILEKL 1 12 122 Nucleolar protein 7 Nucleolar protein 7 Homo sapiens
455475 KLLPETVTI 133 141 Protein Njmu-RI Protein Njmu-R1 Homo sapiens
455476 KLLPFNPQL 256 264 Endonuclease domain- Endonuclease domain- Homo sapiens containing 1 protein containing 1 protein
455477 KLLPLAGLYL 4 13 Major facilitator superfamily Major facilitator superfamily Homo sapiens domain-containing protein 3 domain-containing protein 3
455478 KLLQDLHEA 529 537 Bromodomain-containing Bromodomain-containing Homo sapiens protein 9 protein 9
455479 KLLQEHDIEL 201 210 Small G protein signaling Small G protein signaling Homo sapiens modulator 3 modulator 3
455480 KLLQELYKL 239 247 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 4 complex subunit 4
455481 KLLQESYKL 831 839 Kinetochore-associated Kinetochore-associated Homo sapiens protein 1 protein 1
455482 KLLQLDKEFQL 28 38 Putative tRNA Putative tRNA Homo sapiens
(cytidine(32)/guanosine(34)- (cytidine(32)/guanosine(34)-
2'-0)-methyltransferase 2'-0)-methyltransferase
455483 KLLSAVDI 20 27 Werner syndrome ATP- Werner syndrome ATP- Homo sapiens dependent helicase dependent helicase Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
455484 KLLSEALEL 137 145 Transcription elongation Transcription elongation Homo sapiens factor A N-terminal and factor A N-terminal and
central domain-containing central domain-containing
protein 2 protein 2
455485 KLLSFTHKL 634 642 von Willebrand factor A von Willebrand factor A Homo sapiens domain-containing protein 8 domain-containing protein 8
455486 KLLSRYLTL 4 12 Cytoplasmic FMR1 - Cytoplasmic FMR1- Homo sapiens interacting protein 1 interacting protein 1
455487 KLLSSVKEI 1 116 1124 Tyrosine-protein kinase ABL1 Tyrosine-protein kinase ABL1 Homo sapiens
455488 KLLVELKVI 743 751 Structural maintenance of Structural maintenance of Homo sapiens chromosomes flexible hinge chromosomes flexible hinge
domain-containing protein 1 domain-containing protein 1
455489 KLLWGDIMEL 4 13 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX50 helicase DDX50
455490 KLMALGPIRL 3679 3688 UniProt:F8W8Q1 Homo sapiens
455491 KLMDEVIKSM 264 273 Exosome complex Exosome complex Homo sapiens component RRP43 component RRP43
455492 KLMDLRNEYL 230 239 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF14 RNF14
455493 KLMDPGSLPPL 38 48 ETS translocation variant 4 ETS translocation variant 4 Homo sapiens
455494 KLMDYIDEL 443 451 Leucine-rich repeat and Leucine-rich repeat and Homo sapiens coiled-coil domain-containing coiled-coil domain-containing protein 1 protein 1
455495 KLMDYSLLVGI 270 280 Phosphatidylinositol 5- Phosphatidylinositol 5- Homo sapiens phosphate 4-kinase type-2 phosphate 4-kinase type-2
alpha alpha
455496 KLMEEIREL 468 476 Zinc finger protein 644 Zinc finger protein 644 Homo sapiens
455497 KLMEKEEKL 1662 1670 Inositol 1 ,4,5-trisphosphate Inositol 1 ,4,5-trisphosphate Homo sapiens receptor type 2 receptor type 2
455498 KLMELYERL 1 15 123 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 2 family F member 2
455499 KLMENPPREA 41 50 Thyrotroph embryonic factor Thyrotroph embryonic factor Homo sapiens
(UniProt:Q10587)
455500 KLMGVETVV 474 482 Dual specificity protein Dual specificity protein Homo sapiens phosphatase 10 phosphatase 10
455501 KLMKKLLEA 242 250 Alpha-soluble NSF Alpha-soluble NSF Homo sapiens attachment protein attachment protein
455502 KLMNDDTLVNV 1 10 120 FAST kinase domain- FAST kinase domain- Homo sapiens containing protein 1 containing protein 1
455503 KLMNVDPDSV 45 54 Growth arrest and DNA Growth arrest and DNA Homo sapiens damage-inducible protein damage-inducible protein
GADD45 beta GADD45 beta
455504 KLMPVIMII 279 287 Glutamine--fructose-6- Glutamine--fructose-6- Homo sapiens phosphate aminotransferase phosphate aminotransferase
[isomerizing] 1 [isomerizing] 1
455505 KLMSDLQKL 17 25 Pumilio homolog 3 Pumilio homolog 3 Homo sapiens
455506 KLMSEVQTL 296 304 Taxi -binding protein 1 Tax1-binding protein 1 Homo sapiens
455507 KLMSLGDIRL 5850 5859 Dystonin (UniProt:Q03001 ) Dystonin Homo sapiens
455508 KLNAKLAEL 159 167 S-adenosylmethionine S-adenosylmethionine Homo sapiens synthase isoform type-2 synthase isoform type-2
455509 KLNDLIQRL 1002 1010 Coatomer subunit alpha Coatomer subunit alpha Homo sapiens
455510 KLNEVYEAV 40 48 Protein polybromo-1 Protein polybromo-1 Homo sapiens
455511 KLNNFNSYL 940 948 Rap guanine nucleotide Rap guanine nucleotide Homo sapiens exchange factor 1 exchange factor 1
(UniProt:Q13905)
455512 KLNPAANHRL 136 145 Glycerophosphodiester Glycerophosphodiester Homo sapiens phosphodiesterase 1 phosphodiesterase 1
455513 KLNSWIQGV 109 117 Fanconi anemia group C Fanconi anemia group C Homo sapiens protein protein
455514 KLPDGTWNL 294 302 Dual specificity tyrosine- Dual specificity tyrosine- Homo sapiens phosphorylation-regulated phosphorylation-regulated
kinase 1A kinase 1A Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
455515 KLPIAPLI 252 259 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 1 II transcription subunit 1
455516 KLPSETIFVGC 307 317 Gem-associated protein 4 Gem-associated protein 4 Homo sapiens
455517 KLPSFLANV 372 380 N-acetylgalactosamine N-acetylgalactosamine Homo sapiens kinase kinase
455518 KLQAQDPQI 823 831 Dynein heavy chain 6, Dynein heavy chain 6, Homo sapiens axonemal axonemal
455519 KLQDASAEV 86 94 Bone marrow stromal antigen Bone marrow stromal antigen Homo sapiens
2 2
455520 KLQDELKLL 166 174 Probable guanine nucleotide Probable guanine nucleotide Homo sapiens exchange factor MCF2L2 exchange factor MCF2L2
455521 KLQDGLLHI 88 96 Metalloproteinase inhibitor 1 Metalloproteinase inhibitor 1 Homo sapiens
(UniProt:P01033)
455522 KLQDUEEI 7 15 AP-1 complex subunit AP-1 complex subunit Homo sapiens gamma-like 2 gamma-like 2
455523 KLQDNLRQL 77 85 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 30 II transcription subunit 30
455524 KLQEANAQL 684 692 Lethal(2) giant larvae protein Lethal(2) giant larvae protein Homo sapiens homolog 1 homolog 1
455525 KLQEEIEKI 194 202 GRIP and coiled-coil domain- GRIP and coiled-coil domain- Homo sapiens containing protein 2 containing protein 2
455526 KLQEELERL 720 728 RING finger protein unkempt RING finger protein unkempt Homo sapiens homolog homolog
455527 KLQEEVKDLRA 138 148 Poly(A) polymerase alpha Poly(A) polymerase alpha Homo sapiens
455528 KLQEFELPYV 178 187 Sorting nexin-17 Sorting nexin-17 Homo sapiens
455529 KLQEIENAI 56 64 FERM domain-containing FERM domain-containing Homo sapiens protein 4B protein 4B
455530 KLQEKLDEL 389 397 THAP domain-containing THAP domain-containing Homo sapiens protein 4 protein 4
455531 KLQEKVELL 194 202 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
BRE1A BRE1A
455532 KLQEQLAQL 529 537 DNA topoisomerase I, DNA topoisomerase I, Homo sapiens mitochondrial mitochondrial
455533 KLQEQLEATV 278 287 Spindle assembly abnormal Spindle assembly abnormal Homo sapiens protein 6 homolog protein 6 homolog
455534 KLQEQLPEL 522 530 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 2 complex subunit 2
455535 KLQEVHPLLTL 8 18 UniProt:G8JL95 Homo sapiens
455536 KLQEVLDYL 352 360 NEDD8-activating enzyme NEDD8-activating enzyme Homo sapiens
E1 catalytic subunit E1 catalytic subunit
455537 KLQGKLPEL 25 33 Phosphoribosylformylglycina Phosphoribosylformylglycina Homo sapiens midine synthase midine synthase
455538 KLQKLLILL 399 407 NEDD4-binding protein 2-like NEDD4-binding protein 2-like Homo sapiens
2 (UniProt:Q92802) 2
455539 KLQLLLEEL 75 83 Centrosomal protein of 83 Centrosomal protein of 83 Homo sapiens kDa kDa
455540 KLQPTPGIQKV 535 545 Ectopic P granules protein 5 Ectopic P granules protein 5 Homo sapiens homolog homolog
455541 KLQQKVDEL 403 411 Formin-binding protein 1 Formin-binding protein 1 Homo sapiens
455542 KLQQLFIQL 406 414 Unconventional myosin-ld Unconventional myosin-ld Homo sapiens
455543 KLQQTLEEV 916 924 Centromere-associated Centromere-associated Homo sapiens protein E protein E
455544 KLRDSLELL 155 163 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX56 RNA helicase DDX56
455545 KLRELVETL 149 157 Spermatogenesis-associated Spermatogenesis-associated Homo sapiens protein 2 protein 2
455546 KLRSELEMV 174 182 Target of Myb protein 1 Target of Myb protein 1 Homo sapiens
455547 KLSDNILKL 948 956 Nesprin-2 (UniProt:G3V5X4) Nesprin-2 Homo sapiens
455548 KLSDTLHSL 244 252 Chromosome transmission Chromosome transmission Homo sapiens fidelity protein 18 homolog fidelity protein 18 homolog
(UniProt:Q8WVB6) Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
455549 KLSDVWKEL 104 112 Mixed lineage kinase Mixed lineage kinase Homo sapiens domain-like protein domain-like protein
(UniProt:l3L2T9)
455550 KLSDYEPKV 258 266 Other Homo sapiens Inhibitor of nuclear factor Homo sapiens
(human) protein kappa-B kinase-interacting
protein
455551 KLSEEIMEI 55 63 Centromere protein R Centromere protein R Homo sapiens
455552 KLSEELSGGRL 297 307 Actin-related protein 3 Actin-related protein 3 Homo sapiens
455553 KLSEFDVEM 89 97 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens
455554 KLSELQLRV 139 147 Transmembrane emp24 Transmembrane emp24 Homo sapiens domain-containing protein 9 domain-containing protein 9
455555 KLSEQGLKEV 261 270 CDK5 regulatory subunit- CDK5 regulatory subunit- Homo sapiens associated protein 1 associated protein 1
(UniProt:Q96SZ6)
455556 KLSESQLEL 164 172 Cytokine receptor common Cytokine receptor common Homo sapiens subunit gamma subunit gamma
455557 KLSETHGYGV 1409 1418 Nesprin-2 (UniProt:G3V5X4) Nesprin-2 Homo sapiens
455558 KLSEVAEAI 1031 1039 Zinc finger and BTB domain- Zinc finger and BTB domain- Homo sapiens containing protein 11 containing protein 11
455559 KLSEVNKRL 218 226 NFATC2-interacting protein NFATC2-interacting protein Homo sapiens
455560 KLSEYEMSI 68 76 ATPase family AAA domain- ATPase family AAA domain- Homo sapiens containing protein 1 containing protein 1
455561 KLSQVLNEL 142 150 X-linked retinitis pigmentosa X-linked retinitis pigmentosa Homo sapiens
GTPase regulator-interacting GTPase regulator-interacting protein 1 (UniProt:G3V236) protein 1
455562 KLSQYUQL 626 634 Phosphatidylinositol 4,5- Phosphatidylinositol 4,5- Homo sapiens bisphosphate 3-kinase bisphosphate 3-kinase
catalytic subunit alpha catalytic subunit alpha
isoform isoform
455563 KLSSUILM 262 270 Serpin H1 Serpin H1 Homo sapiens
455564 KLTAATFTV 253 261 Peroxisomal membrane Peroxisomal membrane Homo sapiens protein PMP34 protein PMP34
455565 KLTDFLPKL 1004 1012 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 25 hydrolase 25
455566 KLTDHGLEEI 378 387 STAM-binding protein STAM-binding protein Homo sapiens
455567 KLTDVGIATL 2087 2096 Alpha-protein kinase 2 Alpha-protein kinase 2 Homo sapiens
455568 KLTEGQYVL 39 47 PHD finger protein 19 PHD finger protein 19 Homo sapiens
(UniProt:Q5T6S3)
455569 KLTEILELL 26 34 Coiled-coil domain-containing Coiled-coil domain-containing Homo sapiens protein 93 protein 93
455570 KLTEMRGIYA 103 112 Breast carcinoma-amplified Breast carcinoma-amplified Homo sapiens sequence 4 sequence 4
455571 KLTENLVAL 212 220 Cyclin-dependent kinase 17 Cyclin-dependent kinase 17 Homo sapiens
455572 KLTEVHEEL 556 564 Protein Hook homolog 1 Protein Hook homolog 1 Homo sapiens
455573 KLTEYVDKV 204 212 Polypeptide N- Polypeptide N- Homo sapiens acetylgalactosaminyltransfer acetylgalactosaminyltransfer ase 18 ase 18
455574 KLTGILQEV 839 847 Kinesin-like protein KIF1C Kinesin-like protein KIF1 C Homo sapiens
455575 KLTPLSHEV 26 34 Putative eukaryotic Putative eukaryotic Homo sapiens translation initiation factor 2 translation initiation factor 2
subunit 3-like protein subunit 3-like protein
455576 KLTVVLEAV 105 113 Gamma-pa rvin Gamma-pa rvin Homo sapiens
455577 KLVAHLEMI 1900 1908 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13D associated protein 13D
455578 KLVDFVIHF 130 138 Actin-related protein 2/3 Actin-related protein 2/3 Homo sapiens complex subunit 4 complex subunit 4
455579 KLVDPERDMSL 191 201 Caprin-1 Caprin-1 Homo sapiens
455580 KLVDPLYSI 264 272 Glucosamine-6-phosphate Glucosamine-6-phosphate Homo sapiens isomerase 1 isomerase 1
455581 KLVDRTWTL 196 204 Putative serine/threonine- Putative serine/threonine- Homo sapiens protein kinase PRKY protein kinase PRKY
455582 KLVEIPTKMRV 283 293 Regulator of G-protein Regulator of G-protein Homo sapiens signaling 9 signaling 9 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
455614 KLYNIWIRL 386 394 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA1 polymerase I subunit RPA1
455615 KLYNKELYA 270 278 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
455616 KLYPQLSSV 522 530 DENN domain-containing DENN domain-containing Homo sapiens protein 4C (UniProt:R4GN35) protein 4C
455617 KLYQEVEIASV 816 826 Regulator of nonsense Regulator of nonsense Homo sapiens transcripts 1 transcripts 1
455618 KLYSSSGPEL 126 135 FH1/FH2 domain-containing FH1/FH2 domain-containing Homo sapiens protein 1 protein 1
455619 KLYSVVSQL 2228 2236 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-Y terminal hydrolase FAF-Y
455620 KLYTGLEYDL 736 745 Proteasome activator Proteasome activator Homo sapiens complex subunit 4 complex subunit 4
455624 KMAPPPKEV 16 24 Nucleolin (UniProt:H7BY16) Nucleolin Homo sapiens
455632 KMFEFYERV 209 217 NADH dehydrogenase NADH dehydrogenase Homo sapiens
[ubiquinone] iron-sulfur [ubiquinone] iron-sulfur
protein 2, mitochondrial protein 2, mitochondrial
455635 KMFESFIESV 250 259 cAMP-dependent protein cAMP-dependent protein Homo sapiens kinase type ll-alpha kinase type ll-alpha
regulatory subunit regulatory subunit
455640 KMHDYDGNNL 25 34 Multiple coagulation factor Multiple coagulation factor Homo sapiens deficiency protein 2 deficiency protein 2
455644 KMISMDIEQV 245 254 3-hydroxy-3-methylglutaryl- 3-hydroxy-3-methylglutaryl- Homo sapiens coenzyme A reductase coenzyme A reductase
455645 KMKQELEAEYL 128 138 Sorting nexin-6 Sorting nexin-6 Homo sapiens
455647 KMLDEILLQL 277 286 DNA polymerase delta DNA polymerase delta Homo sapiens subunit 2 subunit 2
455649 KMLDHPHIIKL 72 82 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase SIK2 kinase SIK2
455652 KMLEIDPQKV 333 342 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
455679 KMVSIQITL 849 857 AP-3 complex subunit beta-1 AP-3 complex subunit beta-1 Homo sapiens
455684 KMYEKIDLTLL 983 993 Pre-mRNA-processing- Pre-mRNA-processing- Homo sapiens splicing factor 8 splicing factor 8
455847 KQFEGTVEI 1 180 1188 Breast cancer type 2 Breast cancer type 2 Homo sapiens susceptibility protein susceptibility protein
455854 KQISTLESV 402 410 E3 UFM1-protein ligase 1 E3 UFM1 -protein ligase 1 Homo sapiens
455855 KQLNHFWEI 669 677 X-ray repair cross- X-ray repair cross- Homo sapiens complementing protein 5 complementing protein 5
455857 KQTDLEITV 669 677 Phosphoinositide 3-kinase Phosphoinositide 3-kinase Homo sapiens adapter protein 1 adapter protein 1
455858 KQTDVAAEV 525 533 Zinc finger protein 217 Zinc finger protein 217 Homo sapiens
455878 KVADLVLML 40 48 Arf-GAP with GTPase, ANK Homo sapiens repeat and PH domain- containing protein 9
455879 KVADTILFL 151 159 Pre-rRNA-processing protein Pre-rRNA-processing protein Homo sapiens
TSR1 homolog TSR1 homolog
455882 KVASLLHQV 330 338 TNFAIP3-interacting protein TNFAIP3-interacting protein Homo sapiens
2 (UniProt:Q8NFZ5) 2
455889 KVFSGALQEA 36 45 Protein BTG2 Protein BTG2 Homo sapiens
455890 KVHEYNVLL 182 190 Alpha-2-macroglobulin Alpha-2-macroglobulin Homo sapiens receptor-associated protein receptor-associated protein
455895 KVLDVLWEL 550 558 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 24 hydrolase 24
455898 KVLGKIEKV 136 144 Lipopolysaccharide- Lipopolysaccharide- Homo sapiens responsive and beige-like responsive and beige-like
anchor protein anchor protein
455899 KVLSKEFHL 126 134 Protein SET Protein SET Homo sapiens
455902 KVMGFGLYL 299 307 Cytoplasmic FMR1 - Cytoplasmic FMR1- Homo sapiens interacting protein 1 interacting protein 1
455906 KVQEQIFNL 521 529 Protein Jade-1 Protein Jade-1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
455911 KVSEEAKSILL 3249 3259 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF213 RNF213
455927 KYPHYFPLL 220 228 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens
456002 LDKKVEKV 444 451 Putative heat shock protein Putative heat shock protein Homo sapiens
HSP 90-beta-3 HSP 90-beta-3
456150 LIDQYLYYL 437 445 Capsid protein VP1 Capsid protein VP1 Adeno-associated virus - 2
456151 UDTSRHYL 157 165 Beta-hexosaminidase subunit Beta-hexosaminidase subunit Homo sapiens beta beta
456155 UHKVWMEL 1 12 120 TATA-binding protein- TATA-binding protein- Homo sapiens associated factor 172 associated factor 172
456169 UQKULL 3884 3891 Dynein heavy chain 1 1 , Dynein heavy chain 11 , Homo sapiens axonemal axonemal
456170 UQSLVSI 370 377 BTB/POZ domain-containing BTB/POZ domain-containing Homo sapiens protein 8 protein 8
456176 UYSGKLLL 54 62 Homocysteine-responsive Homocysteine-responsive Homo sapiens endoplasmic reticulum- endoplasmic reticulum- resident ubiquitin-like domain resident ubiquitin-like domain
member 1 protein member 1 protein
456198 LLADELITV 86 94 Endophilin-B2 Endophilin-B2 Homo sapiens
456199 LLADHTVHV 180 188 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 1 1A protein 1 1 A
456200 LLADVETFV 20 28 Src kinase-associated Src kinase-associated Homo sapiens phosphoprotein 2 phosphoprotein 2
456201 LLAEDDELHL 22 31 3-keto-steroid reductase 3-keto-steroid reductase Homo sapiens
(UniProt:P56937)
456202 LLAEIGAVTL 59 68 tRNA-splicing endonuclease tRNA-splicing endonuclease Homo sapiens subunit Sen34 subunit Sen34
456203 LLAEIGAVTLV 59 69 tRNA-splicing endonuclease tRNA-splicing endonuclease Homo sapiens subunit Sen34 subunit Sen34
456204 LLAEKVEEI 1206 1214 Ubiquitin conjugation factor Ubiquitin conjugation factor Homo sapiens
E4 B E4 B
456205 LLAELLTHL 203 211 Protein TBRG4 Protein TBRG4 Homo sapiens
456206 LLAELPASV 398 406 Flotillin-2 Flotillin-2 Homo sapiens
456207 LLAELPASVHA 379 389 Flotillin-2 Flotillin-2 Homo sapiens
456208 LLAELREYNL 1 191 1200 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
456209 LLAERDLYL 576 584 Protein-glutamine gamma- Protein-glutamine gamma- Homo sapiens glutamyltransferase 2 glutamyltransferase 2
456210 LLAESVTEV 1716 1724 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
456211 LLAEVIENL 261 269 m7GpppX diphosphatase m7GpppX diphosphatase Homo sapiens
456212 LLAGLHVLL 617 625 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR2 UBR2
456213 LLANTAAHI 224 232 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 28 protein 28
456214 LLAPAPAQA 6 14 Sin3 histone deacetylase Sin3 histone deacetylase Homo sapiens corepressor complex corepressor complex
component SDS3 component SDS3
456215 LLAPPPPSA 244 252 YLP motif-containing protein YLP motif-containing protein Homo sapiens
1 (UniProt:P49750) 1
456216 LLAPTPYIIGV 367 377 MAP kinase-activating death MAP kinase-activating death Homo sapiens domain protein domain protein
456217 LLAQGVAAA 61 69 Putative uncharacterized Putative uncharacterized Homo sapiens protein FLJ31958 protein FLJ31958
456218 LLASKAVGV 154 162 PHD finger protein 20-like PHD finger protein 20-like Homo sapiens protein 1 protein 1
456219 LLASYVHYV 779 787 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 8 protein 8
456220 LLATEWTV 556 564 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
456221 LLAVPVPGV 841 849 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
MYCBP2 MYCBP2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
456222 LLCRPPPGALP 173 183 Putative protein FRMPD2- Putative protein FRMPD2- Homo sapiens like like
456223 LLDANLNIKI 195 204 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase SIK3 kinase SIK3
(UniProt:H0Y494)
456224 LLDDLPPRV Unidentified protein unidentified
456225 LLDDSLLPLA 352 361 Transcription factor EB Transcription factor EB Homo sapiens
(UniProt:B1AKB5)
456226 LLDDSLVSI 164 172 Peroxiredoxin-5, Peroxiredoxin-5, Homo sapiens mitochondrial mitochondrial
456227 LLDDTTVTL 312 320 TBC domain-containing TBC domain-containing Homo sapiens protein kinase-like protein protein kinase-like protein
456228 LLDEAIQAV 15 23 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 35 associated protein 35
456229 LLDEFTTKLLA 36 46 Syntaxin-binding protein 3 Syntaxin-binding protein 3 Homo sapiens
456230 LLDEHGHVRI 324 333 Beta-adrenergic receptor Beta-adrenergic receptor Homo sapiens kinase 1 kinase 1
456231 LLDEIENIKQV 127 137 Exocyst complex component Exocyst complex component Homo sapiens
4 4
456232 LLDELPQSV 149 157 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase VRK2 kinase VRK2
456233 LLDERLVTL 65 73 Cytokine receptor-like factor Cytokine receptor-like factor Homo sapiens
3 (UniProt:Q8IUI8) 3
456235 LLDLHSYLL 515 523 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
MARCH6 MARCH6
456236 LLDLIGAPNP 246 255 Glutaminyl-peptide Glutaminyl-peptide Homo sapiens cyclotransferase cyclotransferase
456237 LLDLLGAPNP 215 224 Glutaminyl-peptide Glutaminyl-peptide Homo sapiens cyclotransferase-like protein cyclotransferase-like protein
456238 LLDLRPSIL 971 979 Potassium voltage-gated Potassium voltage-gated Homo sapiens channel subfamily H member channel subfamily H member
4 4
456239 LLDNTDIHL 722 730 Lon protease homolog 2, Homo sapiens peroxisomal
456240 LLDPTNPSA 378 386 Protein kinase C-binding Protein kinase C-binding Homo sapiens protein 1 (UniProt:Q9ULU4) protein 1
456241 LLDPTNVFI 49 57 Sideroflexin-4 Sideroflexin-4 Homo sapiens
456242 LLDPVPPVLV 212 221 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase SIK2 kinase SIK2
456243 LLDSIQLLP 223 231 Zinc finger protein ZFPM2 Zinc finger protein ZFPM2 Homo sapiens
456244 LLDSPGKVLL 24 33 Multifunctional protein ADE2 Multifunctional protein ADE2 Homo sapiens
456245 LLDTVTMQV 249 257 Coatomer subunit gamma-1 Coatomer subunit gamma-1 Homo sapiens
456246 LLEEINHFL 1590 1598 Serine-protein kinase ATM Serine-protein kinase ATM Homo sapiens
456248 LLELGDSLM 550 558 Ankyrin repeat and IBR Ankyrin repeat and IBR Homo sapiens domain-containing protein 1 domain-containing protein 1
456249 LLETHSHFL 310 318 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 18 exchange factor 18
456250 LLFDEYHKL 106 114 Maternal embryonic leucine Homo sapiens zipper kinase
456251 LLFDHLEPIEL 146 156 Ras guanyl-releasing protein Ras guanyl-releasing protein Homo sapiens
3 3
456252 LLFDVHTTL 505 513 Uncharacterized protein Uncharacterized protein Homo sapiens
C5orf42 C5orf42
456253 LLFEGEKKITI 1 1 21 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit polymerase II subunit
RPB1 1-a RPB1 1-a
456254 LLFGGSLARI 192 201 Mannose-P-dolichol Mannose-P-dolichol Homo sapiens utilization defect 1 protein utilization defect 1 protein
(UniProt:075352)
456255 LLFHHPNILEL 217 227 lnterleukin-1 receptor- Homo sapiens associated kinase 3
456256 LLFKEGVMV 14 22 40S ribosomal protein S10 40S ribosomal protein S10 Homo sapiens
(UniProt:P46783) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
456293 LLLDENGVLKL 143 153 Cyclin-dependent kinase 7 Cyclin-dependent kinase 7 Homo sapiens
456294 LLLDGNMDIKL 155 165 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase SIK1 kinase SIK1
456295 LLLDKULL 683 691 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 7 protein 7
456296 LLLDKPETV 474 482 Tetratricopeptide repeat Tetratricopeptide repeat Homo sapiens protein 39C protein 39C
456297 LLLDLGHLKV 671 680 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13A associated protein 13A
456298 LLLDTVTMQV 248 257 Coatomer subunit gamma-1 Coatomer subunit gamma-1 Homo sapiens
456299 LLLEAVWHL 177 185 Fanconi anemia group A Fanconi anemia group A Homo sapiens protein protein
456300 LLLEEGGLVQV 102 112 Ubiquitin fusion degradation Ubiquitin fusion degradation Homo sapiens protein 1 homolog protein 1 homolog
456301 LLLESDPKV 246 254 SCL-interrupting locus SCL-interrupting locus Homo sapiens protein protein
456302 LLLEVVKQV 1845 1853 Neurobeachin-like protein 1 Neurobeachin-like protein 1 Homo sapiens
456303 LLLGQLVEV 150 158 ATP-binding cassette subATP-binding cassette subHomo sapiens family B member 8, family B member 8,
mitochondrial mitochondrial
456304 LLLKSLTYV 203 211 Solute carrier family 25 Solute carrier family 25 Homo sapiens member 46 member46
(UniProt:B4DTA3)
456305 LLLKYTEKL 392 400 Cleavage and Cleavage and Homo sapiens polyadenylation specificity polyadenylation specificity
factor subunit 1 factor subunit 1
456306 LLLLAHIIA 103 111 Fatty acid desatu rase 2 Fatty acid desaturase 2 Homo sapiens
(UniProt:095864)
456307 LLLLDTVTMQV 247 257 Coatomer subunit gamma-1 Coatomer subunit gamma-1 Homo sapiens
456308 LLLLLQSCMS 84 93 Coiled-coil domain-containing Coiled-coil domain-containing Homo sapiens protein 157 protein 157
456309 LLLNEDPLN 554 562 Peroxisome assembly factor Peroxisome assembly factor Homo sapiens
2 2
456310 LLLNEEALAQI 7 17 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 5B protein 5B
456311 LLLNYAVRL 133 141 Polyribonucleotide 5'- Polyribonucleotide 5'- Homo sapiens hydroxyl-kinase Clp1 hydroxyl-kinase Clp1
456312 LLLPDAPLV 319 327 Immunity-related GTPase Immunity-related GTPase Homo sapiens family Q protein family Q protein
456313 LLLPDQPPYHL 40 50 U biq u itin/ISG 15-conj ugati ng Ubiquitin/ISG15- conjugating Homo sapiens enzyme E2 L6 enzyme E2 L6
456314 LLLPGSHYL 649 657 Pecanex-like protein 4 Pecanex-like protein 4 Homo sapiens
456315 LLLPGVIKTV 309 318 DNA ligase 3 DNA ligase 3 Homo sapiens
456316 LLLPLPLLL 2 10 Chymase Chymase Homo sapiens
456317 LLLQKETEL 915 923 Centrosomal protein of 152 Centrosomal protein of 152 Homo sapiens kDa kDa
456318 LLLQTTVHA Unidentified protein unidentified
456319 LLLSDLPGV 183 191 ATP synthase subunit s, ATP synthase subunit s, Homo sapiens mitochondrial mitochondrial
456320 LLLSGGLAL 1 1 19 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, Cw-7 alpha chain antigen, Cw-7 alpha chain
456321 LLLSHLPLL 82 90 Protein Smaug homolog 2 Protein Smaug homolog 2 Homo sapiens
456322 LLLTEGTQV Unidentified protein unidentified
456323 LLLTENGIL 939 947 Receptor-type tyrosine- Receptor-type tyrosine- Homo sapiens protein phosphatase beta protein phosphatase beta
(UniProt:J3QT52)
456324 LLLTKPTEA 428 436 1 -phosphatidylinositol 4,5- 1 -phosphatidylinositol 4,5- Homo sapiens bisphosphate bisphosphate
phosphodiesterase gamma-2 phosphodiesterase gamma-2
456325 LLLTQRLPV 105 113 Other Homo sapiens Integrin alpha-X Homo sapiens
(human) protein
456326 LLLTTIPQI 250 258 S-methyl-5'-thioadenosine S-methyl-5'-thioadenosine Homo sapiens phosphorylase phosphorylase Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
456327 LLMDMLEKL 872 880 Kinase suppressor of Ras 1 Kinase suppressor of Ras 1 Homo sapiens
456328 LLMENAERV 146 154 Protein asunder homolog Protein asunder homolog Homo sapiens
(UniProt:Q9NVM9)
456329 LLMIIGALTL 190 199 Sodium/myo-inositol Sodium/myo-inositol Homo sapiens cotransporter cotransporter
456330 LLMPIPEGLTL 105 115 Quinone oxidoreductase Quinone oxidoreductase Homo sapiens
PIG3 PIG3
456331 LLMPSSEDLLL 646 656 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens listerin listerin
456332 LLMQPLSSIHV 319 329 Telomere-associated protein Telomere-associated protein Homo sapiens
RIF1 RIF1
456333 LLMQQVHTI 126 134 Pleckstrin homology domain- Pleckstrin homology domain- Homo sapiens containing family A member containing family A member
3 3
456334 LLMTDTHML 1451 1459 DmX-like protein 1 DmX-like protein 1 Homo sapiens
456335 LLNDHIYVV 470 478 Kelch-like protein 12 Kelch-like protein 12 Homo sapiens
456336 LLNDRKVFV 75 83 Polyadenylate-binding Polyadenylate-binding Homo sapiens protein 1 protein 1
456337 LLNLAIVHA 78 86 Other Homo sapiens C-X-C chemokine receptor Homo sapiens
(human) protein type 1
456338 LLNSGVYL 321 328 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 4 subunit 4
456339 LLNSLFLIL 414 422 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
456340 LLNVEPAGA 16 24 Other Homo sapiens Napsin-A Homo sapiens
(human) protein
456341 LLPDYYLVTV 187 196 Staphylococcal nuclease Staphylococcal nuclease Homo sapiens domain-containing protein 1 domain-containing protein 1
456342 LLPEIMPGL 1217 1225 CLIP-associating protein 2 CLIP-associating protein 2 Homo sapiens
(UniProt:075122)
456343 LLPELRDWGV 450 459 tRNA-dihydrouridine(47) tRNA-dihydrouridine(47) Homo sapiens synthase [NAD(P)(+)l-like synthase [NAD(P)(+)l-like
456344 LLPEYLPYA 810 818 Activating molecule in Activating molecule in Homo sapiens
BECN1-regulated autophagy BECN1 -regulated autophagy protein 1 protein 1
456345 LLPHILPLL 394 402 Transportin-1 Transportin-1 Homo sapiens
456346 LLPLKLLQL 1138 1146 Putative stereocilin-like Putative stereocilin-like Homo sapiens protein protein
456347 LLPPAPPHA 504 512 Transcription factor RelB Transcription factor RelB Homo sapiens
456348 LLPPAPPSV 67 75 Other Homo sapiens Nurim Homo sapiens
(human) protein
456349 LLPPPPTSA 845 853 Angiomotin-like protein 1 Angiomotin-like protein 1 Homo sapiens
456350 LLQDGLKDL 8 16 Kelch-like protein 41 Kelch-like protein 41 Homo sapiens
456351 LLQDHPWLL 43 51 ATP-citrate synthase ATP-citrate synthase Homo sapiens
456352 LLQDIKLLENV 4007 4017 Nesprin-2 (UniProt:G3V5X4) Nesprin-2 Homo sapiens
456353 LLQDRLVSV 400 408 Pleckstrin homology domain- Pleckstrin homology domain- Homo sapiens containing family A member containing family A member
4 4
456354 LLQEAGIKTA 67 76 Multifunctional protein ADE2 Multifunctional protein ADE2 Homo sapiens
456355 LLQEDLVHI 752 760 Pleckstrin homology domain- Pleckstrin homology domain- Homo sapiens containing family A member containing family A member
7 (UniProt:Q6IQ23) 7
456356 LLQEHDIEL 202 210 Small G protein signaling Small G protein signaling Homo sapiens modulator 3 modulator 3
456357 LLQESLAQA 99 107 DNA damage-inducible DNA damage-inducible Homo sapiens transcript 4 protein transcript 4 protein
456358 LLQGAELLL 303 311 Tetraspanin-10 Tetraspanin-10 Homo sapiens
456359 LLQHVLLL 256 263 Histone deacetylase 5 Histone deacetylase 5 Homo sapiens
456360 LLQLLKDNV 29 37 Other Homo sapiens Actin, gamma-enteric smooth Homo sapiens
(human) protein muscle
456361 LLQNGADPQLL 78 88 Ankyrin repeat family A Ankyrin repeat family A Homo sapiens protein 2 protein 2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
456395 LLTEQIHSL 798 806 Golgin subfamily B member Golgin subfamily B member Homo sapiens
1 1
456396 LLTKDLPAI 514 522 Regulator of G-protein Regulator of G-protein Homo sapiens signaling 3 (UniProt:P49796) signaling 3
456397 LLTNVLETL 219 227 Cleavage and Cleavage and Homo sapiens polyadenylation specificity polyadenylation specificity
factor subunit 2 factor subunit 2
456398 LLVDEFLKV 273 281 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase kinase kinase 5 kinase kinase kinase 5
456399 LLVDERSVAHV 1013 1023 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 1 complex subunit 1
(UniProt:A5YKK6)
456400 LLVDKEFKI 276 284 Phospholipase D1 Phospholipase D1 Homo sapiens
456401 LLVGFPLTV 420 428 Transmembrane 9 Transmembrane 9 Homo sapiens superfamily member 1 superfamily member 1
456402 LLVGFVHYL 325 333 SID1 transmembrane family SID1 transmembrane family Homo sapiens member 1 member 1
456403 LLVKYGADI 82 90 Protein phosphatase 1 Protein phosphatase 1 Homo sapiens regulatory subunit 27 regulatory subunit 27
456404 LLVLSALPALL 108 118 Transmembrane protein 239 Transmembrane protein 239 Homo sapiens
456405 LLVNTLYTV 1713 1721 Sortilin-related receptor Sortilin-related receptor Homo sapiens
456406 LLWAGPVNA 13 21 T-cell receptor T-cell receptor beta-2 chain Homo sapiens
C region
456407 LLWDKIHKL 351 359 5'-nucleotidase domain- 5'-nucleotidase domain- Homo sapiens containing protein 3 containing protein 3
456408 LLWDVPAPSL 49 58 Cyclic AMP-dependent Cyclic AMP-dependent Homo sapiens transcription factor ATF-6 transcription factor ATF-6
beta beta
456409 LLWSPPDHMYL 525 535 Protein KIAA0100 Protein KIAA0100 Homo sapiens
456410 LLWWLQPRL 291 299 Metallophosphoesterase 1 Metallophosphoesterase 1 Homo sapiens
45641 1 LLYDQPLQV 918 926 Protein LAP2 Protein LAP2 Homo sapiens
456412 LLYEDIPDKV 141 150 Kinesin-associated protein 3 Kinesin-associated protein 3 Homo sapiens
456413 LLYEEGLRW 269 278 Tyrosyl-DNA Tyrosyl-DNA Homo sapiens phosphodiesterase 1 phosphodiesterase 1
456414 LLYEHQNNL 22 30 Growth arrest-specific protein Growth arrest-specific protein Homo sapiens
8 8
456415 LLYGGDLHSA 149 158 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DHX29 helicase DHX29
456416 LLYLLTHYL 219 227 Dephospho-CoA kinase Dephospho-CoA kinase Homo sapiens domain-containing protein domain-containing protein
(UniProt:Q8WVC6)
456417 LLYNSTDPTL 546 555 Unconventional myosin-lg Unconventional myosin-lg Homo sapiens
456423 LMGPVVHEV 1755 1763 Pericentrin Pericentrin Homo sapiens
456434 LMNAVVQTV 825 833 Catenin alpha-1 Catenin alpha-1 Homo sapiens
456439 LMTDVLVFL 468 476 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 2 exchange factor 2
456607 LQDYIILPTI 79 88 Beta-defensin 128 Beta-defensin 128 Homo sapiens
456614 LQHEGIFRV 536 544 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 4 protein 4
456616 LQISAIIL 558 565 Inactive serine protease Inactive serine protease Homo sapiens
PAMR1 PAMR1
456639 LQWDKVLRL 249 257 N-acetylgalactosamine N-acetylgalactosamine Homo sapiens kinase kinase
456676 LSLDKLEAA 407 415 ATP-binding cassette subATP-binding cassette subHomo sapiens family A member 7 family A member 7
456713 LTINKIYVI Unidentified protein unidentified
456722 LVDDNYFYL 249 257 Pre-mRNA-processing- Pre-mRNA-processing- Homo sapiens spl icing factor 8 splicing factor 8
456880 MITDVVPEV 540 548 TOX high mobility group box TOX high mobility group box Homo sapiens family member 4 family member 4
456884 MIWKGUVL 46 54 Signal peptidase complex Signal peptidase complex Homo sapiens catalytic subunit SEC1 1 C catalytic subunit SEC11 C Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
456902 MLADIPVTI 387 395 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HERC4 ligase HERC4
456903 MLADTVATL 44 52 Cytohesin-interacting protein Cytohesin-interacting protein Homo sapiens
456904 MLAEDAIKAA 94 103 Iron-sulfur cluster assembly Iron-sulfur cluster assembly Homo sapiens enzyme ISCU, mitochondrial enzyme ISCU, mitochondrial
(UniProt:Q9H1 K1 )
456905 MLAEIEVLR 54 62 Leucine zipper protein 1 Leucine zipper protein 1 Homo sapiens
456906 MLAKHVITL 531 539 DNA replication licensing DNA replication licensing Homo sapiens factor MCM5 factor MCM5
456907 MLALTSTLNKL 297 307 Protein OS-9 Protein OS-9 Homo sapiens
456908 MLAQETLQL 69 77 Putative WASP homolog- Putative WASP homolog- Homo sapiens associated protein with actin, associated protein with actin, membranes and membranes and
microtubules-like protein 1 microtubules-like protein 1
456909 MLAWINESL 20 28 Microtubule-associated Microtubule-associated Homo sapiens protein RP/EB family protein RP/EB family
member 1 member 1
456910 MLDDNNHU 28 36 Protein SSXT Protein SSXT Homo sapiens
45691 1 MLDDRAYLV 296 304 Nucleoporin NUP188 Nucleoporin NUP188 Homo sapiens homolog homolog
456912 MLDKYSHYL 244 252 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 11 protein 1 1
456913 MLEIYSNLL 37 45 Zinc finger protein 432 Zinc finger protein 432 Homo sapiens
456914 MLENMGIGIRN 1 11 Muskelin Muskelin Homo sapiens
456915 MLENYSLLL 66 74 Putative zinc finger protein Putative zinc finger protein Homo sapiens
487 487
456916 MLEQVPAL Unidentified protein unidentified
456917 MLFDKFRSV 517 525 Nitrogen permease regulator Nitrogen permease regulator Homo sapiens
3-like protein 3-like protein
456918 MLFEEAFVHL 423 432 U3 small nucleolar RNA- U3 small nucleolar RNA- Homo sapiens associated protein 6 homolog associated protein 6 homolog
456919 MLFENMGAY 270 278 Ornithine decarboxylase Ornithine decarboxylase Homo sapiens
456920 MLFENMGAYTV 375 385 Ornithine decarboxylase Ornithine decarboxylase Homo sapiens
456921 MLFLGLHNV 477 485 Aspartate-tRNA ligase, Aspartate-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
456922 MLFSDSPFL 379 387 GRAM domain-containing GRAM domain-containing Homo sapiens protein 1A (UniProt:Q96CP6) protein 1A
456923 MLFTGGYGL 674 682 Eukaryotic elongation factor Eukaryotic elongation factor Homo sapiens
2 kinase 2 kinase
456924 MLIEEGGLQHL 424 434 Protein zyg-1 1 homolog B Protein zyg-1 1 homolog B Homo sapiens
456925 MUEKDPSL 299 307 Periphilin-1 Periphilin-1 Homo sapiens
(UniProt:Q8NEY8)
456926 MUEVIEKL 138 146 AP-3 complex subunit beta-1 AP-3 complex subunit beta-1 Homo sapiens
456927 MLKEEQEVAM 21 30 Interferon-induced Interferon-induced Homo sapiens transmembrane protein 2 transmembrane protein 2
456928 MLKEEQEVAML 21 31 Interferon-induced Interferon-induced Homo sapiens transmembrane protein 2 transmembrane protein 2
456929 MLKEIEEIL 240 248 DNA helicase B DNA helicase B Homo sapiens
456930 MLKLYNGLSE 418 427 Other Homo sapiens Homo sapiens
(human) protein
456931 MLLCPDPAVS 103 112 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
456932 MLLDFIQHI 67 75 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ATR kinase ATR
456933 MLLEGGPTTA 480 489 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIM37 TRIM37
456934 MLLEHGITL 763 771 1-phosphatidylinositol 3- 1-phosphatidylinositol 3- Homo sapiens phosphate 5-kinase phosphate 5-kinase
456935 MLLEIPYMAA 366 375 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit C- initiation factor 3 subunit C- like protein like protein
456936 MLLEKSFEL 62 70 Unconventional myosin-Vc Unconventional myosin-Vc Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
456937 MLUEDMTK 2365 2373 Other Homo sapiens Titin Homo sapiens
(human) protein
456938 MLUQGLQIN 543 552 Ral GTPase-activating Ral GTPase-activating Homo sapiens protein subunit beta protein subunit beta
(UniProt:Q86X10)
456939 MLLKGEILL 485 493 Piwi-like protein 2 Piwi-like protein 2 Homo sapiens
456940 MLLKTVLLL 1 9 Other Homo sapiens Homo sapiens
(human) protein
456941 MLLMLFIFI 732 740 Voltage-dependent T-type Voltage-dependent T-type Homo sapiens calcium channel subunit calcium channel subunit
alpha-11 alpha-11
456942 MLLQTAVLQG 13 22 HFE protein HFE protein Homo sapiens
456943 MLLSKVEKL 48 56 Centromere protein R Centromere protein R Homo sapiens
456944 MLLTAVQLL 154 162 Nucleolar pre-ribosomal- Nucleolar pre-ribosomal- Homo sapiens associated protein 1 associated protein 1
456945 MLLTKLPTI 121 129 Mitochondrial import receptor Mitochondrial import receptor Homo sapiens subunit TOM20 homolog subunit TOM20 homolog
456946 MLMVVLLV 299 306 Orexin receptor type 1 Orexin receptor type 1 Homo sapiens
456947 MLNFNVPHI 1 9 Sec1 family domain- Sec1 family domain- Homo sapiens containing protein 1 containing protein 1
456948 MLNGQEVRL 451 459 Beta-2-syntrophin Beta-2-syntrophin Homo sapiens
456949 MLNIVKNEL 1506 1514 Pre-mRNA cleavage Pre-mRNA cleavage Homo sapiens complex 2 protein Pcf1 1 complex 2 protein Pcf11
(UniProt:094913)
456950 MLPISNEPI 596 604 Leucine-rich repeat Leucine-rich repeat Homo sapiens transmembrane protein transmembrane protein
FLRT3 FLRT3
456951 MLPPCTTT 455 462 Runt-related transcription Runt-related transcription Homo sapiens factor 2 factor 2
456952 MLQDSLEHVQL 332 342 Dual specificity protein Dual specificity protein Homo sapiens kinase CLK3 kinase CLK3
456953 MLQFDELFK 209 217 Alpha-N- Alpha-N- Homo sapiens acetylgalactosaminide alpha- acetylgalactosaminide alpha- 2,6-sialyltransferase 5 2,6-sialyltransferase 5
456954 MLSEHTSKL 583 591 Midasin Midasin Homo sapiens
456955 MLSEKHLISV 437 446 SH3KBP1 -binding protein 1 SH3KBP1-binding protein 1 Homo sapiens
(UniProt:Q8TBC3)
456956 MLSPFISSV 13 21 BRCA1-A complex subunit BRCA1 -A complex subunit Homo sapiens
BRE BRE
456957 MLSQDAPTV 313 321 Nibrin Nibrin Homo sapiens
456958 MLTDLNTYL 231 239 PRKCA-binding protein PRKCA-binding protein Homo sapiens
456959 MLTDPJPVW 683 691 Tyrosine-protein kinase JAK3 Tyrosine-protein kinase JAK3 Homo sapiens
456960 MLTEIEHKV 4298 4306 Nesprin-2 (UniProt:G3V5X4) Nesprin-2 Homo sapiens
456961 MLTGISPFL 256 264 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase 17A kinase 17A
456962 MLVLCASTEL Unidentified protein unidentified
456963 MLVNAVFYL 331 339 Raftlin Raftlin Homo sapiens
456964 MLVQGNWVV 283 291 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase III subunit RPC5 polymerase III subunit RPC5
456965 MLWKATIVL 50 58 Glycerophosphocholine Glycerophosphocholine Homo sapiens phosphodiesterase GPCPD1 phosphodiesterase GPCPD1
456966 MLYEKLLTA 1198 1206 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HECW2 HECW2
456967 MLYPEVIQQV 2025 2034 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 6 containing protein 6
456968 MLYPGSVYLLQ 187 197 Abhydrolase domain- Abhydrolase domain- Homo sapiens containing protein 16A containing protein 16A
456969 MLYPKLISL 459 467 Cytosolic carboxypeptidase- Cytosolic carboxypeptidase- Homo sapiens like protein 5 like protein 5
456970 MLYQTINSL 61 69 Chitinase-3-like protein 2 Chitinase-3-like protein 2 Homo sapiens
456976 MMLDDLLQL 172 180 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta
457031 MQAPRAALVFA 1 11 Transmembrane protein 154 Transmembrane protein 154 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
457044 MSAELSWL 230 237 Potassium voltage-gated Potassium voltage-gated Homo sapiens channel subfamily V member channel subfamily V member
1 1
457063 MTAQAMSLSL 921 930 Unconventional myosin-XVB Unconventional myosin-XVB Homo sapiens
457066 MVDSKPVNL 33 41 Ras-related C3 botulinum Ras-related C3 botulinum Homo sapiens toxin substrate 2 toxin substrate 2
457072 MVWVLGVII 7 15 Toll-like receptor 2 Toll-like receptor 2 Homo sapiens
457155 NIFPNPEATFV 585 595 FACT complex subunit FACT complex subunit Homo sapiens
SPT16 SPT16
457159 NILLGGLNLL 127 136 Other Homo sapiens Homo sapiens
(human) protein
457160 NIMDFKLFL 148 156 Nuclear envelope integral Nuclear envelope integral Homo sapiens membrane protein 2 membrane protein 2
457161 NIMDIKIGL 896 904 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP3 protein IQGAP3
457169 NIWNINLQL 31 39 Glutathione S-transferase Homo sapiens kappa 1
457178 NLAGVYSEV 83 91 Developmentally-regulated Developmentally-regulated Homo sapiens
GTP-binding protein 1 GTP-binding protein 1
457179 NLAIIITDV 221 229 Cadherin-23 Cadherin-23 Homo sapiens
457180 NLAPTDVLEAL 1154 1164 Midasin Midasin Homo sapiens
457181 NLARALQQV 880 888 Nuclear mitotic apparatus Nuclear mitotic apparatus Homo sapiens protein 1 protein 1
457182 NLDFNPPHV 137 145 Adenylate kinase 4, Adenylate kinase 4, Homo sapiens mitochondrial mitochondrial
(UniProt:P27144)
457183 NLDNPIQTV 667 675 Nodal modulator 3 Nodal modulator 3 Homo sapiens
457184 NLDPAALTL 310 318 Growth arrest-specific protein Growth arrest-specific protein Homo sapiens
8 8
457185 NLFAQTYGL 770 778 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 1 activating enzyme 1
(UniProt:P22314)
457186 NLFDISQSAQT 91 101 Origin recognition complex Origin recognition complex Homo sapiens subunit 4 subunit 4
457187 NLFEWHFTV 44 52 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 J1 enzyme E2 J1
457188 NLFKKVYLL 322 330 PCI domain-containing PCI domain-containing Homo sapiens protein 2 protein 2
457189 NLFRAPIYL 169 177 Transcription initiation factor Transcription initiation factor Homo sapiens
TFIID subunit 1 TFIID subunit 1
457190 NLGILSTLL 658 666 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:P55786)
457191 NUANVLYL 118 126 Lysosomal protective protein Lysosomal protective protein Homo sapiens
457192 NUDLDDL 162 169 THO complex subunit 2 THO complex subunit 2 Homo sapiens
457193 NUEVNEEV 460 468 Vacuolar fusion protein Vacuolar fusion protein Homo sapiens
CCZ1 homolog CCZ1 homolog
457194 NUKELARV 112 120 Protein hinderin Protein hinderin Homo sapiens
457195 NUPILKTV 300 308 Non-receptor tyrosine-protein Non-receptor tyrosine-protein Homo sapiens kinase TYK2 kinase TYK2
457196 NLLAHIWAL 31 1 319 Epidermal growth factor Epidermal growth factor Homo sapiens receptor substrate 15-like 1 receptor substrate 15-like 1
457197 NLLDLNQKLQL 4 14 Protein KIAA0100 Protein KIAA0100 Homo sapiens
457198 NLLDSKINTLL 430 440 Neurofibromin Neurofibromin Homo sapiens
457199 NLLDSNAVHHI 64 74 Methionine Methionine Homo sapiens adenosyltransferase 2 adenosyltransferase 2
subunit beta subunit beta
(UniProt:Q9NZL9)
457200 NLLETKLQL 692 700 Protein PAT1 homolog 1 Protein PAT1 homolog 1 Homo sapiens
457202 NLLLTVQI 137 144 Taste receptor type 2 Taste receptor type 2 Homo sapiens member 5 member 5
457203 NLLPHAINL 52 60 Proto-oncogene vav Proto-oncogene vav Homo sapiens
chromosome X chromosome X
(human) protein phosphatase 6 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
457765 QLLDFSQKL 15 23 Exportin-1 (UniProt:O14980) Exportin-1 Homo sapiens
457766 QLLDGFMITL 39 48 Circadian clock protein Circadian clock protein Homo sapiens
PASD1 PASD1
457767 QLLEALLFRV 1476 1485 Zinc finger C3H1 domain- Zinc finger C3H1 domain- Homo sapiens containing protein containing protein
457768 QLLEEKDLL 378 386 Centromere-associated Centromere-associated Homo sapiens protein E protein E
457769 QLLELRKIL 75 83 ATP-binding cassette subATP-binding cassette subHomo sapiens family D member 2 family D member 2
457770 QLLERQPLL 404 412 Probable cysteine-tRNA Probable cysteine-tRNA Homo sapiens ligase, mitochondrial ligase, mitochondrial
457771 QLLKDAAAFLL 463 473 Clustered mitochondria Clustered mitochondria Homo sapiens protein homolog protein homolog
457772 QLLLTLLG Unidentified protein unidentified
457773 QLLPLLEKV 720 728 Transport and Golgi Transport and Golgi Homo sapiens organization protein 6 organization protein 6
homolog homolog
457774 QLLQFETQV 303 311 Dual specificity protein Dual specificity protein Homo sapiens phosphatase 2 phosphatase 2
457775 QLLQGSLPLE 11 10 1119 Putative Polycomb group Putative Polycomb group Homo sapiens protein ASXL1 protein ASXL1
457776 QLLQYVYNL 518 526 DNA replication licensing DNA replication licensing Homo sapiens factor MCM4 factor MCM4
457777 QLLSHLHTL 622 630 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 23 II transcription subunit 23
457778 QLLTAIVKL 483 491 AP-1 complex subunit beta-1 AP-1 complex subunit beta-1 Homo sapiens
457779 QLLTGSPEL 60 68 m7GpppX diphosphatase m7GpppX diphosphatase Homo sapiens
457780 QLLTQIHLL 177 185 YY1 -associated protein 1 YY1 -associated protein 1 Homo sapiens
457781 QLNDVAHLV 198 206 tRNA (guanine(26)-N(2))- tRNA (guanine(26)-N(2))- Homo sapiens dimethyltransferase dimethyltransferase
457782 QLNEQLVTL 690 698 WD repeat-containing protein WD repeat-containing protein Homo sapiens
36 36
457783 QLPNFAFSV 414 422 Transcription factor 25 Transcription factor 25 Homo sapiens
(UniProt:Q9BQ70)
457784 QLPSASTGI 605 613 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase WNK1 kinase WNK1
(UniProt:Q9H4A3)
457785 QLPTLLIAEC 190 199 Leucine carboxyl Leucine carboxyl Homo sapiens methyltransferase 1 methyltransferase 1
457786 QLPYSLALL 259 267 C-C chemokine receptor type C-C chemokine receptor type Homo sapiens
10 10
457787 QLQDFDWQV 116 124 COMM domain-containing COMM domain-containing Homo sapiens protein 8 protein 8
457788 QLQDRVYAL 238 246 Transmembrane and coiled- Transmembrane and coiled- Homo sapiens coil domain-containing coil domain-containing
protein 6 protein 6
457789 QLQDVHLLQSV 402 412 CST complex subunit CTC1 CST complex subunit CTC1 Homo sapiens
457790 QLQEELHQL 1241 1249 Thyroid receptor-interacting Thyroid receptor-interacting Homo sapiens protein 11 protein 1 1
457791 QLQEENFRL 247 255 Protein Hook homolog 2 Protein Hook homolog 2 Homo sapiens
457792 QLQEETFRL 253 261 Protein Hook homolog 3 Protein Hook homolog 3 Homo sapiens
457793 QLQEKIKLE 351 359 A-kinase anchor protein 17A A-kinase anchor protein 17A Homo sapiens
457794 QLQKMVHDI 17 25 B-cell linker protein B-cell linker protein Homo sapiens
(UniProt:Q8WV28)
457795 QLRLPGQQL 195 203 Sorting nexin-17 Sorting nexin-17 Homo sapiens
457796 QLSEVFIQL 1446 1454 Transcription activator BRG1 Transcription activator BRG1 Homo sapiens
457797 QLSLLVEAQ 152 160 Serine-tRNA ligase, Serine-tRNA ligase, Homo sapiens mitochondrial mitochondrial
457798 QLSLSSRLQL 93 102 Prostaglandin E synthase 2 Prostaglandin E synthase 2 Homo sapiens
457799 QLTALLAA 9 16 Thioredoxin-related Thioredoxin-related Homo sapiens transmembrane protein 4 transmembrane protein 4
457800 QLTDLNVQL 1397 1405 Golgin subfamily A member Golgin subfamily A member Homo sapiens
4 (UniProt:Q13439) 4 Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
457801 QLTEIKPLL 8 16 Protein NDRG3 Protein NDRG3 Homo sapiens
(UniProt:Q9UGV2)
457802 QLTRMAGAI 159 167 Quinone oxidoreductase Quinone oxidoreductase Homo sapiens
PIG3 PIG3
457803 QLTSNLAQV 93 101 Zinc finger and BTB domain- Zinc finger and BTB domain- Homo sapiens containing protein 2 containing protein 2
457804 QLVAVEALIHA 438 448 Protein unc-45 homolog B Protein unc-45 homolog B Homo sapiens
457805 QLVDFQWKL 18 26 COMM domain-containing COMM domain-containing Homo sapiens protein 6 protein 6
457806 QLVDTTVEL 832 840 Splicing factor 3B subunit 1 Splicing factor 3B subunit 1 Homo sapiens
457807 QLVEELLKI 28 36 Breast cancer type 1 Breast cancer type 1 Homo sapiens susceptibility protein susceptibility protein
(UniProt:E7ENB7)
457808 QLVEQVEQI 170 178 Transmembrane emp24 Transmembrane emp24 Homo sapiens domain-containing protein 9 domain-containing protein 9
457809 QLVPALAKV 439 447 Eyes absent homolog 3 Eyes absent homolog 3 Homo sapiens
457810 QLVPVDIIESV 20 30 Ankyrin repeat and IBR Ankyrin repeat and IBR Homo sapiens domain-containing protein 1 domain-containing protein 1
45781 1 QLVRDLLEV 557 565 Nuclear factor NF-kappa-B Nuclear factor NF-kappa-B Homo sapiens p105 subunit p105 subunit
457812 QLWNIFNQV 319 327 General transcription factor General transcription factor Homo sapiens
3C polypeptide 3 3C polypeptide 3
457813 QLYEFDIKV 259 267 N-acetylglucosamine-6- N-acetylglucosamine-6- Homo sapiens sulfatase (UniProt:P15586) sulfatase
457814 QLYQLFHYL 140 148 Ketosamine-3-kinase Ketosamine-3-kinase Homo sapiens
457815 QLYQRSGDMGL 223 233 Thymidylate synthase Thymidylate synthase Homo sapiens
457816 QLYRGLGGQL 666 675 Tubulin-specific chaperone D Tubulin-specific chaperone D Homo sapiens
457822 QMLEUTRL 843 851 Endoribonuclease Dicer Endoribonuclease Dicer Homo sapiens
457823 QMLENQMEV 1423 1431 Spectrin beta chain, non- Spectrin beta chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
457825 QMLPLNTNIRL 296 306 Exportin-1 (UniProt:O14980) Exportin-1 Homo sapiens
457827 QMPETTETV 216 224 HLA class II HLA class II Homo sapiens histocompatibility antigen, histocompatibility antigen,
DP alpha 1 chain DP alpha 1 chain
(UniProt:P20036)
457829 QMPTLPPPSV 216 225 Transcription activator BRG1 Transcription activator BRG1 Homo sapiens
457830 QMVKELQEI 44 52 NF-kappa-B inhibitor alpha NF-kappa-B inhibitor alpha Homo sapiens
(UniProt:P25963)
457875 QQLDSKFLEQV 8 18 Signal transducer and Signal transducer and Homo sapiens activator of transcription 1 - activator of transcription 1 - alpha/beta alpha/beta
457893 QTMSHLPQV 246 254 RNA-binding protein 4B RNA-binding protein 4B Homo sapiens
457918 RALPSIILL 108 116 C5a anaphylatoxin C5a anaphylatoxin Homo sapiens chemotactic receptor 2 chemotactic receptor 2
458069 RIASWLPSFSV 77 87 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
AMFR (UniProt:Q9UKV5) AMFR
458072 RIMEAIENV 412 420 Pseudouridylate synthase 7 Pseudouridylate synthase 7 Homo sapiens homolog-like protein homolog-like protein
458085 RLADALQEL 240 248 Prelamin-A/C Prelamin-A/C Homo sapiens
458086 RLADDLNEKI 85 94 Phosphatase and actin Phosphatase and actin Homo sapiens regulator (UniProt:l3L2S3) regulator
458087 RLADLEALKV 56 65 Ribonuclease H2 subunit A Ribonuclease H2 subunit A Homo sapiens
458088 RLAEETEKL 1365 1373 Kinesin-like protein KIF15 Kinesin-like protein KIF15 Homo sapiens
458089 RLAELEEFI 1182 1190 Clathrin heavy chain 1 Clathrin heavy chain 1 Homo sapiens
458090 RLAELGLHL 393 401 Calcium-binding and coiled- Calcium-binding and coiled- Homo sapiens coil domain-containing coil domain-containing
protein 1 protein 1
458091 RLAELLVSV 45 53 Synembryn-A Synembryn-A Homo sapiens
458092 RLAELQEQL 510 518 Bromodomain-containing Bromodomain-containing Homo sapiens protein 4 protein 4
458093 RLAETLAQIYL 79 89 Dimethyladenosine Dimethyladenosine Homo sapiens transferase 2, mitochondrial transferase 2, mitochondrial Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
458168 RLLEEEGVSL 177 186 Cytosolic Fe-S cluster Cytosolic Fe-S cluster Homo sapiens assembly factor NARFL assembly factor NARFL
458169 RLLEELQRL 715 723 Myotubularin-related protein Myotubularin-related protein Homo sapiens
5 5
458170 RLLEEREVLL 544 553 Cytosolic carboxypeptidase 2 Cytosolic carboxypeptidase 2 Homo sapiens
458171 RLLEFELAQL 819 828 Rho-associated protein Rho-associated protein Homo sapiens kinase 1 kinase 1
458172 RLLEIPAVSHV 112 122 Zinc finger and BTB domain- Zinc finger and BTB domain- Homo sapiens containing protein 7A containing protein 7A
458173 RLLELLTKL 88 96 Myeloid differentiation Myeloid differentiation Homo sapiens primary response protein primary response protein
MyD88 (UniProt:Q99836) MyD88
458174 RLLENMTEV 603 611 Pyridoxal-dependent Pyridoxal-dependent Homo sapiens decarboxylase domain- decarboxylase domain- containing protein 1 containing protein 1
458175 RLLENMTEVV 603 612 Pyridoxal-dependent Pyridoxal-dependent Homo sapiens decarboxylase domain- decarboxylase domain- containing protein 1 containing protein 1
458176 RLLEPAQVQQL 295 305 Xyloside xylosyltransferase 1 Xyloside xylosyltransferase 1 Homo sapiens
458177 RLLESLDQLEL 27 37 BAG family molecular BAG family molecular Homo sapiens chaperone regulator 2 chaperone regulator 2
458178 RLLESLIRL 567 575 DNA helicase MCM9 DNA helicase MCM9 Homo sapiens
458179 RLLGEEVVRV 186 195 Telomere length regulation Telomere length regulation Homo sapiens protein TEL2 homolog protein TEL2 homolog
458180 RLLGKLPEL 554 562 Nuclear receptor subfamily 4 Nuclear receptor subfamily 4 Homo sapiens group A member 1 group A member 1
458181 RLLHEVQEL 107 115 Dynactin subunit 2 Dynactin subunit 2 Homo sapiens
458182 RLLLLVPLL 2 10 Papilin Papilin Homo sapiens
458183 RLLNFDTEL 4660 4668 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF213 RNF213
458184 RLLNILMQL 385 393 Probable global transcription Probable global transcription Homo sapiens activator SNF2L1 activator SNF2L1
458185 RLLPDIRGV 181 189 Biogenesis of lysosome- Biogenesis of lysosome- Homo sapiens related organelles complex 1 related organelles complex 1 subunit 3 subunit 3
458186 RLLPEKLTIY 58 67 Nuclear cap-binding protein Nuclear cap-binding protein Homo sapiens subunit 1 subunit 1
458187 RLLPELRDWGV 449 459 tRNA-dihydrouridine(47) tRNA-dihydrouridine(47) Homo sapiens synthase [NAD(P)(+)]-like synthase [NAD(P)(+)]-like
458188 RLLPGDIILKV 317 327 E3 ubiquitin-protein ligase Homo sapiens
LNX
458189 RLLPKVQEV 285 293 Suppressor APC domain- Suppressor APC domain- Homo sapiens containing protein 2 containing protein 2
458190 RLLPPELLRQL 48 58 Pre-miRNA 5'- Pre-miRNA 5'- Homo sapiens monophosphate monophosphate
methyltransferase methyltransferase
458192 RLLSFVVLA 2 10 Translocon-associated Translocon-associated Homo sapiens protein subunit beta protein subunit beta
(UniProt:P43308)
458193 RLMDDTSIAAA 805 815 Trafficking protein particle Trafficking protein particle Homo sapiens complex subunit 11 complex subunit 11
458194 RLMEAMSEV 607 615 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 33B associated protein 33B
458195 RLMEDVEAEKL 351 361 Probable inactive Probable inactive Homo sapiens glycosyltransferase 25 family glycosyltransferase 25 family member 3 member 3
458196 RLMEPIYLVEI 239 249 Elongation factor 2 Elongation factor 2 Homo sapiens
458197 RLMEPYYFVEV 826 836 116 kDa U5 small nuclear 116 kDa U5 small nuclear Homo sapiens ribonucleoprotein component ribonucleoprotein component
458198 RLMEQQGALL 285 294 Outer dense fiber protein 2 Outer dense fiber protein 2 Homo sapiens
(UniProt:Q5BJF6)
458199 RLMGLLSDPEL 780 790 MMS19 nucleotide excision MMS19 nucleotide excision Homo sapiens repair protein homolog repair protein homolog Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
458200 RLMKELEEI 6 14 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 L3 enzyme E2 L3
458201 RLMKGEITL 52 60 Bifunctional epoxide Bifunctional epoxide Homo sapiens hydrolase 2 hydrolase 2
458202 RLMQGDEICL 355 364 Regulator of nonsense Regulator of nonsense Homo sapiens transcripts 1 transcripts 1
458203 RLNEIEAAL 934 942 Protein-methionine sulfoxide Protein-methionine sulfoxide Homo sapiens oxidase MICAL1 oxidase MICAL1
458204 RLNEQASEEIL 33 43 Protein SET Protein SET Homo sapiens
458205 RLNPINTTL 181 189 Protein NDRG3 Protein NDRG3 Homo sapiens
(UniProt:Q9UGV2)
458206 RLNPLVLLL 623 631 RelA-associated inhibitor RelA-associated inhibitor Homo sapiens
458207 RLPMSIIIVGV 461 471 Copine-6 Homo sapiens
458208 RLPPEGILHNV 667 677 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13D associated protein 13D
458209 RLPPPFPGLEP 13 23 Sorting nexin-1 Sorting nexin-1 Homo sapiens
458210 RLQDLQQQV 653 661 SET and MYND domain- SET and MYND domain- Homo sapiens containing protein 4 containing protein 4
45821 1 RLQEELEKL 1324 1332 Ribosome-binding protein 1 Ribosome-binding protein 1 Homo sapiens
458212 RLQEGDLPNA 366 375 Peroxisomal targeting signal Peroxisomal targeting signal Homo sapiens
1 receptor 1 receptor
458213 RLQELELQL 28 36 Zinc finger protein 292 Zinc finger protein 292 Homo sapiens
458214 RLQETEGMVAV 432 442 HMG domain-containing HMG domain-containing Homo sapiens protein 4 protein 4
458215 RLQGELQAV 287 295 Protein orai-3 Protein orai-3 Homo sapiens
458216 RLQKELAEA 192 200 Autophagy-related protein Autophagy-related protein Homo sapiens
16-1 16-1
458217 RLQQELMTL 34 42 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 C enzyme E2 C
458218 RLQQTQAQV 33 41 Vesicle-associated Vesicle-associated Homo sapiens membrane protein 1 membrane protein 1
458219 RLRATCTLSG 50 59 Mitochondrial antiviral- Mitochondrial antiviral- Homo sapiens signaling protein signaling protein
458220 RLSDFTESL 581 589 Spastin Spastin Homo sapiens
458221 RLSDQVLFV 153 161 Thioredoxin domain- Thioredoxin domain- Homo sapiens containing protein 1 1 containing protein 1 1
458222 RLSEEASQALI 701 711 DNA replication licensing DNA replication licensing Homo sapiens factor MCM4 factor MCM4
458223 RLSETDFKV 9 17 Pre-mRNA-splicing regulator Pre-mRNA-splicing regulator Homo sapiens
WTAP WTAP
458224 RLSPYLEDV 11 10 1118 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HECTD4 ligase HECTD4
(UniProt:Q9Y4D8)
458225 RLSSLLALL 2 10 Chondroitin sulfate Chondroitin sulfate Homo sapiens glucuronyltransferase glucuronyltransferase
458226 RLSSQLILL 486 494 ER membrane protein ER membrane protein Homo sapiens complex subunit 1 complex subunit 1
458227 RLTELETAV 230 238 Dynactin subunit 2 Dynactin subunit 2 Homo sapiens
458228 RLTSLGVIGA 121 130 Cell differentiation protein Cell differentiation protein Homo sapiens
RCD1 homolog RCD1 homolog
458229 RLTSLVPFV 454 462 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit A initiation factor 3 subunit A
458230 RLVESKVEL 107 115 GTP-binding protein SAR1a GTP-binding protein SAR1a Homo sapiens
458231 RLVEVNGENV 58 67 Na(+)/H(+) exchange Na(+)/H(+) exchange Homo sapiens regulatory cofactor NHE-RF1 regulatory cofactor NHE-RF1
458232 RLVGDGVYGVP 466 476 Glutamate receptor Glutamate receptor Homo sapiens ionotropic, kainate 4 ionotropic, kainate 4
458233 RLVGIMLLL 166 174 Type II inositol 1 ,4,5- Type II inositol 1 ,4,5- Homo sapiens trisphosphate 5-phosphatase trisphosphate 5-phosphatase
458234 RLVNYQISV 17 25 Putative inactive beta- Putative inactive beta- Homo sapiens glucuronidase-like protein glucuronidase-like protein
SMA3 SMA3 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
458598 RVIDYILDLQV 72 82 DNA-binding protein inhibitor DNA-binding protein inhibitor Homo sapiens
ID-3 ID-3
458604 RVLGPKIEAV 549 558 Hepatoma-derived growth Hepatoma-derived growth Homo sapiens factor-related protein 2 factor-related protein 2
458605 RVMEELPLMLL 1759 1769 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF213 RNF213
458607 RVMELFFTV 272 280 Exportin-4 Exportin-4 Homo sapiens
458646 SAIQILLTLL 267 276 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 6 regulatory phosphatase 6 regulatory
subunit 3 (UniProt:Q5H9R7) subunit 3
458925 SIFEFVHAL 335 343 lmportin-9 lmportin-9 Homo sapiens
458926 SIFGEDALANV 249 259 Coatomer subunit beta Coatomer subunit beta Homo sapiens
(UniProt:P53618)
458927 SIFKAWAV 55 62 Interferon regulatory factor 8 Interferon regulatory factor 8 Homo sapiens
458929 SIHDVTFQV 562 570 Inhibitor of Bruton tyrosine Inhibitor of Bruton tyrosine Homo sapiens kinase (UniProt:Q9P2D0) kinase
458931 SIKADEVLAEV 3316 3326 Dynein heavy chain 8, Dynein heavy chain 8, Homo sapiens axonemal axonemal
458935 SILDRDDIFV 289 298 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 11 hydrolase 1 1
458936 SILGNIENLKL 169 179 tRNA:m(4)X modification tRNA:m(4)X modification Homo sapiens enzyme TRM13 homolog enzyme TRM13 homolog
458937 SILKKVLEA 10 18 Proliferating cell nuclear Proliferating cell nuclear Homo sapiens antigen antigen
458948 SISLLLNFL 107 115 Dystrobrevin alpha Dystrobrevin alpha Homo sapiens
(UniProt:A8K541 )
458952 SIYEYYHAL 274 282 Hypoxia-inducible factor 1- Hypoxia-inducible factor 1 - Homo sapiens alpha alpha
458961 SLAAEESELR 426 435 Janus kinase and Janus kinase and Homo sapiens microtubule-interacting microtubule-interacting
protein 2 protein 2
458963 SLAAVEVLV 263 271 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 13 II transcription subunit 13
458964 SLAAVSQQL 1679 1687 Talin-1 Talin-1 Homo sapiens
458965 SLADFMQEV 254 262 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 1 complex subunit 1
(UniProt:A5YKK6)
458966 SLADVESQV 1444 1452 Golgin subfamily B member Golgin subfamily B member Homo sapiens
1 1
458967 SLADVEVW 401 409 Lymphocyte antigen 75 Lymphocyte antigen 75 Homo sapiens
458968 SLADYITAA 576 584 DNA replication licensing DNA replication licensing Homo sapiens factor MCM7 factor MCM7
458969 SLAEEHEGL 168 176 Cleavage and Cleavage and Homo sapiens polyadenylation specificity polyadenylation specificity
factor subunit 1 factor subunit 1
458970 SLAEFVQSL 502 510 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 7 hydrolase 7
458971 SLAEGSVTSV 580 589 X-ray repair cross- X-ray repair cross- Homo sapiens complementing protein 5 complementing protein 5
458972 SLAELDEKISA 312 322 MAP3K12-binding inhibitory MAP3K12-binding inhibitory Homo sapiens protein 1 protein 1
458973 SLAESLDQA 720 728 Exosome complex Exosome complex Homo sapiens exonuclease RRP44 exonuclease RRP44
458974 SLAEVAGLQV 655 664 Phosphatidylinositol 3,4,5- Phosphatidylinositol 3,4,5- Homo sapiens trisphosphate-dependent trisphosphate-dependent
Rac exchanger 1 protein Rac exchanger 1 protein
458975 SLAEVNTQL 112 120 Centrosome-associated Centrosome-associated Homo sapiens protein CEP250 protein CEP250
(UniProt:H7C0P0)
458976 SLAEYIDMI 235 243 Intraflagellar transport protein Intraflagellar transport protein Homo sapiens
46 homolog 46 homolog
458977 SLAGNTYQL 249 257 Apolipoprotein L1 Apolipoprotein L1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
458978 SLAGSLRSV 740 748 SH3 domain and SH3 domain and Homo sapiens tetratricopeptide repeat- tetratricopeptide repeat- containing protein 1 containing protein 1
458979 SLAIIAANLS 253 262 Phosphoglucomutase-like Phosphoglucomutase-like Homo sapiens protein 5 protein 5
458980 SLAMLLRLY 47 55 Intermediate conductance Intermediate conductance Homo sapiens calcium-activated potassium calcium-activated potassium
channel protein 4 channel protein 4
458981 SLAPAGIADA 308 317 Centromere protein N Centromere protein N Homo sapiens
458982 SLAPATPEV 15 23 CD83 antigen CD83 antigen Homo sapiens
458983 SLAPGDVVRQV 18 28 Other Homo sapiens Homo sapiens
(human) protein
458984 SLAPPVTAV 413 421 Sodium/glucose Sodium/glucose Homo sapiens cotransporter 5 cotransporter 5
458985 SLAPSITNV 788 796 Phosphorylase b kinase Phosphorylase b kinase Homo sapiens regulatory subunit beta regulatory subunit beta
458986 SLAQFEQKW 4953 4961 Nesprin-2 (UniProt:G3V5X4) Nesprin-2 Homo sapiens
458987 SLAQVVMKV 1126 1134 Integrin alpha-L Integrin alpha-L Homo sapiens
458988 SLASQWKL 8 16 Synphilin-1 Synphilin-1 Homo sapiens
458989 SLATPVVSV 290 298 Myocyte-specific enhancer Myocyte-specific enhancer Homo sapiens factor 2C factor 2C
458990 SLAVLGGKLYV 506 516 Kelch-like protein 21 Kelch-like protein 21 Homo sapiens
458991 SLCHVLPDL 44 52 Transcription intermediary Transcription intermediary Homo sapiens factor 1 -beta factor 1 -beta
458992 SLDDLTNLVV 222 231 Insulin-degrading enzyme Insulin-degrading enzyme Homo sapiens
458993 SLDDSISAA 2 10 Echinoderm microtubule- Echinoderm microtubule- Homo sapiens associated protein-like 4 associated protein-like 4
458994 SLDEGIEQV 156 164 MIT domain-containing Homo sapiens protein 1
458995 SLDERPVAV 33 41 Bone morphogenetic protein Bone morphogenetic protein Homo sapiens receptor type-2 receptor type-2
458996 SLDHKLAEV 443 451 Formin-binding protein 1 Formin-binding protein 1 Homo sapiens
458997 SLDPHAQVAV 835 844 Glycogen debranching Glycogen debranching Homo sapiens enzyme enzyme
458998 SLDQHVAAV 676 684 Cullin-9 Cullin-9 Homo sapiens
458999 SLDQKTPEA 1678 1686 Kinesin-like protein KIF1 B Kinesin-like protein KIF1 B Homo sapiens
459000 SLDRPHTVL 561 569 Transducin beta-like protein Transducin beta-like protein Homo sapiens
3 3
459001 SLEELLHYV 28 36 Protein RMD5 homolog B Protein RMD5 homolog B Homo sapiens
459002 SLFDARVHL 83 91 28S ribosomal protein S2, 28S ribosomal protein S2, Homo sapiens mitochondrial mitochondrial
459003 SLFDLNFQA 224 232 NAD(P)H dehydrogenase NAD(P)H dehydrogenase Homo sapiens
[quinonel 1 (UniProt:P15559) [quinone] 1
459004 SLFDWNVKL 35 43 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2Q-like protein 1 enzyme E2Q-like protein 1
459005 SLFEDSDLLHA 8 18 Other Homo sapiens Zinc finger protein 514 Homo sapiens
(human) protein
459006 SLFEEMLQV 200 208 Signal recognition particle 54 Signal recognition particle 54 Homo sapiens kDa protein kDa protein
459007 SLFEGKALGL 471 480 Actin-related protein 8 Actin-related protein 8 Homo sapiens
(UniProt:Q9H981 )
459008 SLFGNIKGATI 231 241 Mannosyl-oligosaccharide Mannosyl-oligosaccharide Homo sapiens
1 ,2-alpha-mannosidase IA 1 ,2-alpha-mannosidase IA
(UniProt:P33908)
459009 SLFGQDVKAV 454 463 Zinc finger protein 451 Zinc finger protein 451 Homo sapiens
(UniProt:D6RAS1 )
459010 SLFGSPPTSV 676 685 WASH complex subunit WASH complex subunit Homo sapiens
FAM21 C FAM21 C
45901 1 SLFKDQMEL 243 251 lmportin-8 lmportin-8 Homo sapiens
459012 SLFKELQEA 302 310 Optineurin Optineurin Homo sapiens
459013 SLFKIWLV 394 401 Kelch domain-containing Kelch domain-containing Homo sapiens protein 10 protein 10 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
459014 SLFKUVKV 802 810 Telomere-associated protein Telomere-associated protein Homo sapiens
RIF1 RIF1
459015 SLFPAELAL 309 317 Probable tRNA Probable tRNA Homo sapiens pseudouridine synthase 1 pseudouridine synthase 1
459016 SLFPGQVVI 295 303 DNA polymerase alpha DNA polymerase alpha Homo sapiens subunit B subunit B
459017 SLFQGVEFHYV 312 322 Lamin-B receptor Lamin-B receptor Homo sapiens
459018 SLFQLAFLV 156 164 Olfactory receptor Olfactory receptor Homo sapiens
4F3/4F16/4F29 4F3/4F16/4F29
459019 SLFSDKQMIKL 344 354 DNA replication licensing DNA replication licensing Homo sapiens factor MCM4 factor MCM4
459020 SLFSEETPVVL 39 49 Renin receptor Renin receptor Homo sapiens
459021 SLFSHSUSI 505 514 Ubiquitin-protein ligase E3C Ubiquitin-protein ligase E3C Homo sapiens
459022 SLFSMLHQA 2457 2465 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
459023 SLFSSPPEI 63 71 Syntaxin-binding protein 4 Syntaxin-binding protein 4 Homo sapiens
459024 SLFSVIVRV 689 697 Protein FAM160B1 Protein FAM160B1 Homo sapiens
459025 SLFSVLVRV 370 378 Protein FAM160B2 Protein FAM160B2 Homo sapiens
459026 SLGEEQFSV 339 347 N-acetyltransferase ESC02 N-acetyltransferase ESC02 Homo sapiens
459027 SLGEFHVRL 1493 1501 Midasin Midasin Homo sapiens
459028 SLGPSLATDKS 270 280 Thioredoxin-related Thioredoxin-related Homo sapiens transmembrane protein 1 transmembrane protein 1
459029 SLHDISTEM 89 97 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens rififylin rififylin
459030 SLHDRIYVI 364 372 Kelch-like protein 12 Kelch-like protein 12 Homo sapiens
459031 SLHEFLVNL 53 61 Other Homo sapiens Cytochrome P450 20A1 Homo sapiens
(human) protein
459032 SLHLHVPSV 2099 2107 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 13 II transcription subunit 13
459034 SLHSVIIQL 837 845 Ectopic P granules protein 5 Ectopic P granules protein 5 Homo sapiens homolog homolog
459035 SUDDNNEINL 208 218 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase 33 kinase 33
459036 SUDKLYNI 382 390 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA1 polymerase I subunit RPA1
459037 SUDMRGIETV 601 611 Structural maintenance of Structural maintenance of Homo sapiens chromosomes protein 6 chromosomes protein 6
459038 SUDRTIKM 11 19 Transmembrane protein 209 Transmembrane protein 209 Homo sapiens
459039 SUEHLQGL 27 35 Cation channel sperm- Cation channel sperm- Homo sapiens associated protein 2 associated protein 2
(UniProt:B8ZZQ9)
459040 SUEKPPIL 146 154 Mediator of RNA polymerase Homo sapiens
II transcription subunit 19
459041 SUEKVTQL 434 442 Kinesin-like protein KIF15 Kinesin-like protein KIF15 Homo sapiens
459042 SUERDLKL 1986 1994 Nucleolar pre-ribosomal- Nucleolar pre-ribosomal- Homo sapiens associated protein 1 associated protein 1
459043 SUERLYEI 252 260 Transcription termination Transcription termination Homo sapiens factor 1 factor 1
459044 SUFKLEEL 128 136 Solute carrier family 35 Solute carrier family 35 Homo sapiens member C2 member C2
459045 SUKQSAQL 207 215 Synapse-associated protein Synapse-associated protein Homo sapiens
1 1
459046 SUNFRVLL 1332 1340 Nucleolar pre-ribosomal- Nucleolar pre-ribosomal- Homo sapiens associated protein 1 associated protein 1
459047 SUNVNDLSFV 232 242 WD repeat-containing protein WD repeat-containing protein Homo sapiens
41 41
459048 SUPIISGV 168 176 Solute carrier family 35 Solute carrier family 35 Homo sapiens member E1 member E1
(UniProt:Q96K37)
459049 SUQHLEEI 213 221 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX60-like RNA helicase DDX60-like
459050 SUQKVDMV 5038 5046 Dystonin (UniProt:Q03001) Dystonin Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
459051 SURIVPVV 158 166 Putative Polycomb group Putative Polycomb group Homo sapiens protein ASXL2 protein ASXL2
(UniProt:E7EWD6)
459052 SUSNPPAM 179 187 Nck-associated protein 1-like Nck-associated protein Mike Homo sapiens
459053 SUTDLQTI 1957 1965 C2 domain-containing protein C2 domain-containing protein Homo sapiens
3 3
459054 SUTUEKV 372 380 Carboxypeptidase D Carboxypeptidase D Homo sapiens
459055 SLKTPGTSL 925 933 Putative Polycomb group Putative Polycomb group Homo sapiens protein ASXL2 protein ASXL2
(UniProt:Q76L83)
459056 SLLAELEAI 995 1003 Transcription termination Transcription termination Homo sapiens factor 2 factor 2
459057 SLLASDHHL 543 551 Trafficking protein particle Trafficking protein particle Homo sapiens complex subunit 10 complex subunit 10
459058 SLLDADIHSA 250 259 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR5 UBR5
459059 SLLDCTFRL 704 712 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 14 II transcription subunit 14
459060 SLLDDSSLHLW 92 102 Lethal(2) giant larvae protein Lethal(2) giant larvae protein Homo sapiens homolog 1 homolog 1
459061 SLLDEAIEAV 307 316 PHD and RING finger PHD and RING finger Homo sapiens domain-containing protein 1 domain-containing protein 1
459062 SLLDEVLNV 241 249 Cdc42 effector protein 3 Cdc42 effector protein 3 Homo sapiens
459063 SLLDFERSL 25 33 Hermansky-Pudlak Hermansky-Pudlak Homo sapiens syndrome 3 protein syndrome 3 protein
(UniProt:Q969F9)
459064 SLLDIIEKVMA 526 536 Tuberin (UniProt:P49815) Tuberin Homo sapiens
459065 SLLDLEQKL 201 209 Peroxisomal biogenesis Peroxisomal biogenesis Homo sapiens factor 3 factor 3
459066 SLLDLGEVAL 456 465 Protein NLRC5 Protein NLRC5 Homo sapiens
459067 SLLDLPLSL 193 201 N-acetylglucosaminyl- N-acetylglucosaminyl- Homo sapiens phosphatidylinositol de-N- phosphatidylinositol de-N- acetylase acetylase
459068 SLLDMSLVKL 36 45 Cell division cycle-associated Cell division cycle-associated Homo sapiens protein 4 protein 4
459069 SLLDPLPTA 383 391 Transcription factor NIB 90 Transcription factor NIB 90 Homo sapiens kDa subunit kDa subunit
459070 SLLDQIPEM 272 280 Protein transport protein Protein transport protein Homo sapiens
Sec24C Sec24C
459071 SLLDVAVHM 280 288 Zinc finger BED domain- Zinc finger BED domain- Homo sapiens containing protein 1 containing protein 1
459072 SLLEALDTI 199 207 Elongation factor 1 -alpha 2 Elongation factor 1 -alpha 2 Homo sapiens
459073 SLLEDLSHI 117 125 SERTA domain-containing SERTA domain-containing Homo sapiens protein 1 protein 1
459074 SLLEEKLLPVL 98 108 Metaxin-1 Metaxin-1 Homo sapiens
459075 SLLEEKLVL 902 910 Biorientation of Biorientation of Homo sapiens chromosomes in cell division chromosomes in cell division protein 1-like 1 protein Mike 1
459076 SLLEILNSA 2839 2847 UniProt:F8W8Q1 Homo sapiens
459077 SLLEKAGPEL 886 895 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 14 polymerase 14
459078 SLLEKLSAL 470 478 Kinesin-like protein KIF3A Kinesin-like protein KIF3A Homo sapiens
459079 SLLEQLALE 189 197 5' exonuclease Apollo 5' exonuclease Apollo Homo sapiens
459080 SLLERGLEAA 124 133 Vitamin K epoxide reductase Vitamin K epoxide reductase Homo sapiens complex subunit 1 -I ike complex subunit Mike
protein 1 (UniProt:E7ETM5) protein 1
459081 SLLERLEKI 2486 2494 Pericentrin Pericentrin Homo sapiens
459082 SLLESSRSQEL 495 505 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 13A containing protein 13A
459083 SLLETGSDLLL 643 653 Valine-tRNA ligase, Valine-tRNA ligase, Homo sapiens mitochondrial mitochondrial
459084 SLLEYQMLV 321 329 Nucleoporin NUP188 Nucleoporin NUP188 Homo sapiens homolog homolog Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
459085 SLLGDMEWRL 956 965 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF213 RNF213
459086 SLLGFVYKL 441 449 Interferon-induced protein Interferon-induced protein Homo sapiens with tetratricopeptide repeats with tetratricopeptide repeats
1 1
459087 SLLGHVIRL 91 99 Other Homo sapiens Hamartin Homo sapiens
(human) protein
459088 SLLGPPPVGV 158 167 Cip1 -interacting zinc finger Cip1 -interacting zinc finger Homo sapiens protein protein
459089 SLLGRSLEL 201 209 Striatin-4 Striatin-4 Homo sapiens
459090 SLLHVEQEV 235 243 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 3 family F member 3
459091 SLLKDLAEI 557 565 Kinesin-1 heavy chain Kinesin-1 heavy chain Homo sapiens
459092 SLLKEGYQL 541 549 Probable helicase senataxin Probable helicase senataxin Homo sapiens
459093 SLLUPIHL 326 334 Sentrin-specific protease 5 Sentrin-specific protease 5 Homo sapiens
459094 SLLMSIHNI 312 320 Phosphatidylinositol 4- Phosphatidylinositol 4- Homo sapiens phosphate 5-kinase type-1 phosphate 5-kinase type-1
alpha alpha
459095 SLLNEIESI 748 756 Paired amphipathic helix Paired amphipathic helix Homo sapiens protein Sin3a protein Sin3a
459096 SLLNEIESV 181 189 Paired amphipathic helix Paired amphipathic helix Homo sapiens protein Sin3b protein Sin3b
459097 SLLNFVMPHM 239 248 SWI/SNF-related matrix- SWI/SNF-related matrix- Homo sapiens associated actin-dependent associated actin-dependent
regulator of chromatin regulator of chromatin
subfamily A containing subfamily A containing
DEAD/H box 1 DEAD/H box 1
459098 SLLNHLPYL 155 163 Very-long-chain (3R)-3- Very-long-chain (3R)-3- Homo sapiens hydroxyacyl-CoA hydroxyacyl-CoA
dehydratase 2 dehydratase 2
459099 SLLNPPETLNL 252 262 Cyclin-A2 Cyclin-A2 Homo sapiens
459100 SLLNQDLHWSL 1228 1238 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 8 homolog associated protein 8 homolog
459101 SLLNQPKAV 1254 1262 Claspin Claspin Homo sapiens
459102 SLLNTLAQI 899 907 RNA polymerase II- RNA polymerase II- Homo sapiens associated protein 1 associated protein 1
459103 SLLPASLASI 7 16 Nuclear factor of activated T- Nuclear factor of activated T- Homo sapiens cells, cytoplasmic 4 cells, cytoplasmic 4
459104 SLLPEYVVPYM 36 46 Sister chromatid cohesion Sister chromatid cohesion Homo sapiens protein PDS5 homolog A protein PDS5 homolog A
459105 SLLPGKLPTL 560 569 WASH complex subunit WASH complex subunit Homo sapiens
FAM21A (UniProt:Q641Q2) FAM21A
459106 SLLPGNLVEKV 244 254 DnaJ homolog subfamily C DnaJ homolog subfamily C Homo sapiens member 16 member 16
459107 SLLPLASDPLL 356 366 Transcription factor EB Transcription factor EB Homo sapiens
(UniProt:B1AKB5)
459108 SLLPLDDIVRV 1393 1403 Inositol 1 ,4,5-trisphosphate Inositol 1 ,4,5-trisphosphate Homo sapiens receptor type 1 receptor type 1
459109 SLLPLSHLV 763 771 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF213 RNF213
459110 SLLPLVWKI 78 86 Lysosomal-trafficking Lysosomal-trafficking Homo sapiens regulator regulator
45911 1 SLLPQLTGA 893 901 Nck-associated protein 1-like Nck-associated protein Mike Homo sapiens
459112 SLLPVDIRQYL 25 35 Signal transducer and Signal transducer and Homo sapiens activator of transcription 2 activator of transcription 2
459113 SLLQALNEV 91 99 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
459114 SLLQHUGL 425 433 Melanoma antigen Melanoma antigen Homo sapiens preferentially expressed in preferentially expressed in
tumors tumors
459115 SLLQHVLLL 443 451 Histone deacetylase 5 Histone deacetylase 5 Homo sapiens
459116 SLLQQGEQL 1034 1042 Ninein (UniProt:Q8N4C6) Ninein Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
459117 SLLQQLENV 379 387 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIM33 TRIM33
459118 SLLSGALAGAL 36 46 Mitochondrial coenzyme A Mitochondrial coenzyme A Homo sapiens transporter SLC25A42 transporter SLC25A42
459119 SLLSGLVRL 505 513 TIR domain-containing TIR domain-containing Homo sapiens adapter molecule 1 adapter molecule 1
459120 SLLSGRISTL 47 56 SH3KBP1 -binding protein 1 SH3KBP1-binding protein 1 Homo sapiens
(UniProt:Q8TBC3)
459121 SLLSHDPRL 101 109 FAD-dependent FAD-dependent Homo sapiens oxidoreductase domain- oxidoreductase domain- containing protein 2 containing protein 2
459122 SLLSSVFKL 567 575 Uncharacterized aarF Uncharacterized aarF Homo sapiens domain-containing protein domain-containing protein
kinase 2 kinase 2
459123 SLLSTDALPSA 172 182 Histone chaperone ASF1A Histone chaperone ASF1A Homo sapiens
459124 SLLSVSHAL 745 753 WD repeat-containing protein WD repeat-containing protein Homo sapiens
24 24
459125 SLLTAIHMV 515 523 RUN domain-containing RUN domain-containing Homo sapiens protein 1 protein 1
459126 SLLTHIQNL 89 97 Transportin-3 Transportin-3 Homo sapiens
459127 SLLTSPPKA 938 946 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIP12 TRIP12
459128 SLLTVIEKL 45 53 Zinc finger protein 507 Zinc finger protein 507 Homo sapiens
459129 SLLVHNVSV 338 346 F-box only protein 33 F-box only protein 33 Homo sapiens
459130 SLLYKVPYV 263 271 UniProt:F5GZY0 Homo sapiens
459131 SLMDDYLGL 162 170 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit RPB7 polymerase II subunit RPB7
459132 SLMDLQERL 261 269 Stromal interaction molecule Stromal interaction molecule Homo sapiens
2 2
459133 SLMDPDTKL 7 15 Actin-related protein 2/3 Actin-related protein 2/3 Homo sapiens complex subunit 3 complex subunit 3
459134 SLMDPPGTAL 60 69 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 24 II transcription subunit 24
(UniProt:075448)
459135 SLMEDQVLQL 600 609 Werner syndrome ATP- Werner syndrome ATP- Homo sapiens dependent helicase dependent helicase
459136 SLMEEHGATL 712 721 Limbin Limbin Homo sapiens
459137 SLMEESGICKV 330 340 Geranylgeranyl transferase Geranylgeranyl transferase Homo sapiens type-1 subunit beta type-1 subunit beta
459138 SLMEKNQSL 387 395 Chromosome-associated Ch romosome-associated Homo sapiens kinesin KIF4A kinesin KIF4A
459139 SLMEQLRGEAL 243 253 Glutamine-tRNA ligase Glutamine-tRNA ligase Homo sapiens
459140 SLMHVPPSL 223 231 TIP41 -like protein TIP41 -like protein Homo sapiens
459141 SLMNQNAQL 11 19 1127 Girdin Girdin Homo sapiens
459142 SLMPHFKSMYL 322 332 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 6 exchange factor 6
459143 SLNELRVLL 873 881 CAP-Gly domain-containing CAP-Gly domain-containing Homo sapiens linker protein 2 linker protein 2
459144 SLNEYQPKL 1153 1161 Nesprin-1 (UniProt:Q8NF91 ) Nesprin-1 Homo sapiens
459145 SLNHLLNYV 197 205 Splicing factor 3B subunit 1 Splicing factor 3B subunit 1 Homo sapiens
459146 SLNKQIETV 754 762 Protein CIP2A Protein CIP2A Homo sapiens
459147 SLNKWIFTV 65 73 Solute carrier family 35 Solute carrier family 35 Homo sapiens member E4 member E4
459148 SLNLAPPTV 12 20 39S ribosomal protein 12, 39S ribosomal protein 12, Homo sapiens mitochondrial mitochondrial
459149 SLPELVHAV 47 55 Sestrin-3 Sestrin-3 Homo sapiens
459150 SLPENTVQV 356 364 Leucine-rich repeat flightless- Leucine-rich repeat flightless- Homo sapiens interacting protein 1 interacting protein 1
459151 SLPESTLLQAV 133 143 Crossoverjunction Crossoverjunction Homo sapiens endonuclease MUS81 endonuclease MUS81
459152 SLPGHAPGLSL 207 217 Synaptopodin Synaptopodin Homo sapiens
459153 SLPQNFANV 200 208 Solute carrier family 25 Solute carrier family 25 Homo sapiens member 43 member 43 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
459190 SLSVEGRRGP 430 439 G protein-regulated inducer G protein-regulated inducer Homo sapiens of neurite outgrowth 2 of neurite outgrowth 2
459191 SLSWGQRKKL 126 135 Something about silencing Something about silencing Homo sapiens protein 10 protein 10
459192 SLTEQVHSL 706 714 Centrosomal protein of 97 Centrosomal protein of 97 Homo sapiens kDa kDa
459193 SLTEYIHHL 3302 3310 Pericentrin Pericentrin Homo sapiens
459194 SLTGVQQQL 333 341 Spectrin beta chain, Spectrin beta chain, Homo sapiens erythrocytic erythrocytic
459195 SLTRHQFYL 441 449 FERM and PDZ domain- FERM and PDZ domain- Homo sapiens containing protein 2 containing protein 2
459196 SLTVDGIMFV 81 1 820 Pre-mRNA-splicing factor Pre-mRNA-splicing factor Homo sapiens
ATP-dependent RNA ATP-dependent RNA
helicase PRP16 helicase PRP16
459197 SLVAVELEKV 458 467 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 4 complex subunit 4
(UniProt:Q9H9E3)
459198 SLVDALLEQV 62 71 TNFAIP3-interacting protein TNFAIP3-interacting protein Homo sapiens
2 (UniProt:Q8NFZ5) 2
459199 SLVDQSAAL 28 36 Suppressor of IKBKE 1 Suppressor of IKBKE 1 Homo sapiens
459200 SLVEFHLKEL 168 177 Phospholipase A1 member A Phospholipase A1 member A Homo sapiens
459201 SLVEIILHV 75 83 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit ATPase regulatory subunit
13 (UniProt:Q9UNM6) 13
459202 SLVENIERL 73 81 Tripartite motif-containing Tripartite motif-containing Homo sapiens protein 26 protein 26
459203 SLVGILHL 306 313 B-lymphocyte antigen CD19 B-lymphocyte antigen CD19 Homo sapiens
459204 SLVINIAA 3536 3543 Dynein heavy chain 2, Dynein heavy chain 2, Homo sapiens axonemal axonemal
459205 SLVKSTSQL 28 36 ATP synthase F(0) complex ATP synthase F(0) complex Homo sapiens subunit C2, mitochondrial subunit C2, mitochondrial
459206 SLVNVVPKL 247 255 Cyclin-dependent-like kinase Homo sapiens
5
459207 SLVPNRGIL 34 42 Other Homo sapiens Homo sapiens
(human) protein
459208 SLVQANPEV 2306 2314 Acetyl-CoA carboxylase 1 Acetyl-CoA carboxylase 1 Homo sapiens
459209 SLVQELKAV 153 161 Serine dehydratase-like Serine dehydratase-like Homo sapiens
459210 SLVQGELVTA 2 11 Alpha-adducin Alpha-adducin Homo sapiens
45921 1 SLVQIVTTL 91 99 UniProt:F8WBA8 Homo sapiens
459212 SLVQRVETI 640 648 Protein ECT2 Protein ECT2 Homo sapiens
459213 SLVTKVTAV 587 595 Protocadherin gamma-C5 Protocadherin gamma-C5 Homo sapiens
459214 SLWEISKQIEG 41 1 421 NADH dehydrogenase NADH dehydrogenase Homo sapiens
[ubiquinone] flavoprotein 1 , [ubiquinone] flavoprotein 1 ,
mitochondrial mitochondrial
459215 SLWEKALKL 13 21 Mitochondrial enolase Mitochondrial enolase Homo sapiens superfamily member 1 superfamily member 1
459216 SLWERVSTHV 642 651 Dynamin-like 120 kDa Dynamin-like 120 kDa Homo sapiens protein, mitochondrial protein, mitochondrial
459217 SLWETVARA 278 286 BRCA1 -associated ATM BRCA1 -associated ATM Homo sapiens activator 1 activator 1
459218 SLWKEVSEL 156 164 Heat shock factor protein 2 Heat shock factor protein 2 Homo sapiens
459219 SLWSLTHLTAL 46 56 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 6 complex subunit 6
459220 SLWSLYPRA 319 327 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein subunit beta-like protein subunit beta-like
protein 1 protein 1
459221 SLYASPSMV 292 300 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase/endoribonuclease kinase/endoribonuclease
IRE1 IRE1
459222 SLYDVSRMYV 751 760 1-phosphatidylinositol 4,5- 1-phosphatidylinositol 4,5- Homo sapiens bisphosphate bisphosphate
phosphodiesterase gamma-2 phosphodiesterase gamma-2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
459223 SLYEENNKL 689 697 GRIP and coiled-coil domain- GRIP and coiled-coil domain- Homo sapiens containing protein 2 containing protein 2
459224 SLYGYGSTVRL 88 98 Mesoderm induction early Mesoderm induction early Homo sapiens response protein 1 response protein 1
459225 SLYNALQSL 2127 2135 Serine-protein kinase ATM Serine-protein kinase ATM Homo sapiens
459226 SLYNSLETA 244 252 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 1 17 containing protein 1 17
(UniProt:Q8IWD4)
459227 SLYPSAPFLA 207 216 Phospholipase ABHD3 Phospholipase ABHD3 Homo sapiens
(UniProt:Q8WU67)
459228 SLYPSIMMA 605 613 DNA polymerase delta DNA polymerase delta Homo sapiens catalytic subunit catalytic subunit
459229 SLYSALQQA 1184 1192 Centrosome-associated Centrosome-associated Homo sapiens protein CEP250 protein CEP250
(UniProt:Q9BV73)
459230 SLYSGLLERL 25 34 Leucine-rich repeat- Leucine-rich repeat- Homo sapiens containing protein 32 containing protein 32
459231 SLYTRTLYL 140 148 Alkaline ceramidase 3 Alkaline ceramidase 3 Homo sapiens
459233 SMAELDIKL 115 123 RAD50-interacting protein 1 Homo sapiens
459234 SMAEVDAAMAA 19 29 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoproteins A2/B1 ribonucleoproteins A2/B1
459235 SMAKAITGV 413 421 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase TBK1 kinase TBK1
459237 SMAPYVLNV 98 106 lnterleukin-27 subunit beta lnterleukin-27 subunit beta Homo sapiens
459238 SMAVVIPEA 203 211 SEC14-like protein 1 SEC14-like protein 1 Homo sapiens
459240 SMISKLKQA 79 87 Cullin-1 Cullin-1 Homo sapiens
459247 SMLPVPPAV 344 352 E3 ubiquitin-protein ligase Homo sapiens
RNF38
459254 SMVDVVMLL 757 765 Large proline-rich protein Large proline-rich protein Homo sapiens
BAG6 (UniProt:P46379) BAG6
459256 SMWDDINNV 114 122 Dehyd rogenase/ red uctase Dehydrogenase/reductase Homo sapiens
(SDR family) member 1 , (SDR family) member 1 ,
isoform CRA b isoform CRA b
459258 SMYGVDLHHA 402 411 Band 4.1 -like protein 2 Band 4.1 -like protein 2 Homo sapiens
(UniProt.043491)
459700 STAPPVHNV 950 958 Mucin-1 Mucin-1 Homo sapiens
459701 STFDHPELVKL 286 296 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens beta (UniProt:P78371 ) beta
459710 SVAGSVERV 55 63 Exosome complex Exosome complex Homo sapiens component RRP4 component RRP4
459716 SVIDHIHU 164 172 PDZ domain-containing PDZ domain-containing Homo sapiens protein GIPC1 protein GIPC1
459717 SVIDHIHUSV 164 174 PDZ domain-containing PDZ domain-containing Homo sapiens protein GIPC1 protein GIPC1
459719 SVIGFRILL 162 170 T-cell receptor T-cell receptor alpha chain C Homo sapiens region
459721 SVLDQKILL 1313 1321 Nucleolar pre-ribosomal- Nucleolar pre-ribosomal- Homo sapiens associated protein 1 associated protein 1
459724 SVLVSPPAV 254 262 Krueppel-like factor 10 Krueppel-like factor 10 Homo sapiens
459727 SVMKVKAEL 474 482 Adenylosuccinate lyase Adenylosuccinate lyase Homo sapiens
459728 SVMSILPKI 244 252 Serine incorporator 1 Serine incorporator 1 Homo sapiens
459890 TILPEQLEIL 718 727 Zinc finger homeobox protein Zinc finger homeobox protein Homo sapiens
2 2
459897 TLADYLHLL 151 159 Phosphopantothenate- Ph os ph opan toth e n ate- Homo sapiens cysteine ligase cysteine ligase
(UniProt:Q9HAB8)
459898 TLAEIAKAEL 128 137 Paraspeckle component 1 Paraspeckle component 1 Homo sapiens
459899 TLAEINQKWNL 210 220 BRCA1 -associated RING BRCA1 -associated RING Homo sapiens domain protein 1 domain protein 1
459900 TLAEKIQTI 83 91 Tumor necrosis factor Tumor necrosis factor Homo sapiens receptor superfamily member receptor superfamily member
6 6 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
459901 TLAEKIQTIIL 83 93 Tumor necrosis factor Tumor necrosis factor Homo sapiens receptor superfamily member receptor superfamily member
6 6
459902 TLAELQNNMV 788 797 Kinesin-like protein KIF20A Kinesin-like protein KIF20A Homo sapiens
459903 TLAGDVHIV 57 65 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 29 associated protein 29
459904 TLAGLVVQL 76 84 SWI/SNF complex subunit SWI/SNF complex subunit Homo sapiens
SMARCC1 SMARCC1
459905 TLANIFAGV 90 98 GTP-binding protein GEM GTP-binding protein GEM Homo sapiens
459906 TLAPGEVLRSV 175 185 Lethal(2) giant larvae protein Lethal(2) giant larvae protein Homo sapiens homolog 1 homolog 1
459907 TLAPQPSSV 215 223 Lysosome-associated Lysosome-associated Homo sapiens membrane glycoprotein 3 membrane glycoprotein 3
459908 TLAQQPTAV 147 155 Nuclear transcription factor Y Nuclear transcription factor Y Homo sapiens subunit gamma subunit gamma
459909 TLASNAIIU 39 48 Olfactory receptor 10J4 Olfactory receptor 10J4 Homo sapiens
459910 TLATDILMGV 7 16 Pre-mRNA-splicing factor Pre-mRNA-splicing factor Homo sapiens
ATP-dependent RNA ATP-dependent RNA
helicase DHX15 helicase DHX15
45991 1 TLDDLLLYI 308 316 Olfactomedin-4 Olfactomedin-4 Homo sapiens
459912 TLDENHPSI 388 396 Spermatogenesis-associated Spermatogenesis-associated Homo sapiens protein 7 protein 7
459913 TLDPNVTGV 499 507 V-type proton ATPase 1 16 V-type proton ATPase 1 16 Homo sapiens kDa subunit a isoform 3 kDa subunit a isoform 3
459914 TLDPVEKAL 313 321 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniPro P11142) protein
459915 TLDQKIERV 41 1 419 EMIUN-2 EMIUN-2 Homo sapiens
459916 TLFDYDVGL 64 72 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UHRF2 (UniProt:B1AL33) UHRF2
459917 TLFGDVAMV 605 613 Tyrosine-protein kinase Tyrosine-protein kinase Homo sapiens
BAZ1 B BAZ1 B
459918 TLFLWKIEV 867 875 Adenylate cyclase type 3 Adenylate cyclase type 3 Homo sapiens
459919 TLFQGIKTV 252 260 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 33 hydrolase 33
459920 TLFYSLREV 601 609 Fanconi anemia core Fanconi anemia core Homo sapiens complex-associated protein complex-associated protein
100 100
459921 TLGVIPESV 991 999 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 48 hydrolase 48
459922 TLHSIIISL 551 559 Protein fem-1 homolog B Protein fem-1 homolog B Homo sapiens
459923 TLIAGPVVEI 76 85 Condensin-2 complex Condensin-2 complex Homo sapiens subunit G2 subunit G2
459924 TUEELKAL 213 221 Cyclic AMP-responsive Cyclic AMP-responsive Homo sapiens element-binding protein 1 element-binding protein 1
(UniProt:E7EWP8)
459925 TUEESAKV 99 107 Multidrug resistance- Multidrug resistance- Homo sapiens associated protein 4 associated protein 4
(UniProt:015439)
459926 TUEFLLHRA 53 62 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 14 II transcription subunit 14
459927 TUEKVQEA 517 525 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase 2B methyltransferase 2B
459928 TUGEDVNPLI 338 348 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Msh3 Msh3
459929 TUGGLLLHV 43 52 Putative vertebrate vrg4-like Putative vertebrate vrg4-like Homo sapiens nucleotide-sugar transporter nucleotide-sugar transporter truncated variant2 truncated variant2
459930 TUKGKIEEV 245 254 Protein arginine N- Protein arginine N- Homo sapiens methyltransferase 3 methyltransferase 3
459931 TULANIL 192 199 Exosome complex Exosome complex Homo sapiens component RRP40 component RRP40
459932 TUNLLLKV 255 263 UDP-N-acetylglucosamine-- UDP-N-acetylgl ucosam i ne~ Homo sapiens dolichyl-phosphate N- dolichyl-phosphate N- Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
acetylglucosaminephosphotr acetylglucosaminephosphotr ansferase ansferase
459933 TUQFTVKL 246 254 Signal transducer and Signal transducer and Homo sapiens activator of transcription 4 activator of transcription 4
459934 TLIQRTYGL 109 117 RNA-binding protein 38 RNA-binding protein 38 Homo sapiens
459935 TUQYIRPVFV 26 36 Lysophosphatidylcholine Lysophosphatidylcholine Homo sapiens acyltransferase 1 acyltransferase 1
459936 TLIRSDAVALV 597 607 Peroxisomal acyl -coenzyme Peroxisomal acyl-coenzyme Homo sapiens
A oxidase 1 A oxidase 1
459937 TLISTAHTL 363 371 Other Homo sapiens Epithelial-stromal interaction Homo sapiens
(human) protein protein 1
459938 TLLADQGEIRV 139 149 Metastasis-associated Metastasis-associated Homo sapiens protein MTA2 protein MTA2
459939 TLLAFLVEL 526 534 Neurobeachin Neurobeachin Homo sapiens
459940 TLLDFINAV 967 975 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 6 activating enzyme 6
459941 TLLDGKLVLL 141 150 RAS protein activator like-3 Homo sapiens
459942 TLLDNTDTISI 51 61 Zinc finger and BTB domain- Homo sapiens containing protein 40
(UniProt:F8WAI8)
459943 TLLEADILNTV 315 325 UBX domain-containing UBX domain-containing Homo sapiens protein 2B protein 2B
459944 TLLEEIKAL 508 516 Coronin (UniProt:J3KSS5) Coronin Homo sapiens
459945 TLLEEIRDL 952 960 DIS3-like exonuclease 1 DIS3-like exonuclease 1 Homo sapiens
459946 TLLEEIRDLAL 975 985 DIS3-like exonuclease 1 Homo sapiens
459947 TLLETEMLL 284 292 Centrosomal protein of 44 Centrosomal protein of 44 Homo sapiens kDa kDa
459948 TLLGDVVRL 365 373 Signal-induced proliferation- Signal-induced proliferation- Homo sapiens associated protein 1 associated protein 1
459949 TLLGKVVAL 155 163 Telomere length regulation Telomere length regulation Homo sapiens protein TEL2 homolog protein TEL2 homolog
459950 TLLGNIHAV 238 246 2-hydroxyacyl-CoA lyase 1 2-hydroxyacyl-CoA lyase 1 Homo sapiens
(UniProt:B4DXI5)
459951 TLLHFLAEL 994 1002 Protein diaphanous homolog Protein diaphanous homolog Homo sapiens
1 1
459952 TLLHRFWNL 31 1 319 Protein SFI1 homolog Protein SFI1 homolog Homo sapiens
459953 TLUGSPLSL 807 816 Pecanex-like protein 1 Pecanex-like protein 1 Homo sapiens
(UniProt:Q96RV3)
459954 TLLKQLPCI 223 231 Calmodulin-regulated Calmodulin-regulated Homo sapiens spectrin-associated protein 2 spectrin-associated protein 2
459955 TLLKSIPLV 394 402 DDB1 - and CUL4-associated DDB1- and CUL4-associated Homo sapiens factor 17 (UniProt:F5H7W1) factor 17
459956 TLLLHTWLL 30 38 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 2 (UniProt:Q92608) protein 2
459957 TLLNKLYVI 490 498 Kelch-like protein 22 Kelch-like protein 22 Homo sapiens
459958 TLLTAIVKL 88 96 AP-2 complex subunit beta AP-2 complex subunit beta Homo sapiens
459959 TLLTDPPTA 901 909 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 1 1 associated protein 11
homolog homolog
459960 TLLTFFHEL 1140 1148 Fanconi anemia group I Fanconi anemia group I Homo sapiens protein (UniProt:Q9NVI1 ) protein
459961 TLLTKPVEI 436 444 1-phosphatidylinositol 4,5- 1-phosphatidylinositol 4,5- Homo sapiens bisphosphate bisphosphate
phosphodiesterase gamma-1 phosphodiesterase gamma-1
459962 TLLYLDLNL 79 87 Other Homo sapiens Homo sapiens
(human) protein
459963 TLMAFHVFL 81 89 Folylpolyglutamate synthase, Folylpolyglutamate synthase, Homo sapiens mitochondrial mitochondrial
459964 TLMDMRLSQV 249 258 Pre-mRNA-processing factor Pre-mRNA-processing factor Homo sapiens
6 6
459965 TLMEQAVAAV 501 510 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DHX58 RNA helicase DHX58 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
459966 TLMEQPLTTL 224 233 Thioredoxin domain- Thioredoxin domain- Homo sapiens containing protein 16 containing protein 16
459967 TLMESNKLETI 222 232 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 90B, containing protein 90B,
mitochondrial mitochondrial
459968 TLMEVMPKI 145 153 Cytoplasmic FMR1- Cytoplasmic FMR1 - Homo sapiens interacting protein 1 interacting protein 1
459969 TLMNLGGLAV 120 129 Transgelin-2 Transgelin-2 Homo sapiens
459970 TLMNLHVYI 101 109 Cleft lip and palate Cleft lip and palate Homo sapiens transmembrane protein 1 transmembrane protein 1
459971 TLNNIKQF 302 309 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX1 helicase DDX1
459972 TLNSAAVTV 525 533 Nuclear receptor-binding Nuclear receptor-binding Homo sapiens protein protein
459973 TLPGPPKITL 295 304 Tesmin Tesmin Homo sapiens
459974 TLQAAMPQV 38 46 Paraneoplastic antigen Ma1 Paraneoplastic antigen Ma1 Homo sapiens
459975 TLQALVSSV 8 16 Other Homo sapiens Homo sapiens
(human) protein
459976 TLQDIVYKL 74 82 Polycomb complex protein Polycomb complex protein Homo sapiens
BMI-1 BMI-1
459977 TLQEFLERI 77 85 SAM domain-containing SAM domain-containing Homo sapiens protein SAMSN-1 protein SAMSN-1
459978 TLQEVVTGV 127 135 Acylglycerol kinase, Acylglycerol kinase, Homo sapiens mitochondrial mitochondrial
(UniProt:Q53H12)
459979 TLQHIVTLL 453 461 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 7 complex subunit 7
459980 TLQTVPLTTV 442 451 ETS-related transcription ETS-related transcription Homo sapiens factor Elf-1 factor Elf-1
459981 TLRLWDVLIL 65 74 UniProt:A8MV28 Homo sapiens
459982 TLSDVLDRV 3837 3845 Baculoviral IAP repeat- Baculoviral IAP repeat- Homo sapiens containing protein 6 containing protein 6
459983 TLSQAIVKV 410 418 U2 snRNP-associated SURP U2 snRNP-associated SURP Homo sapiens motif-containing protein motif-containing protein
459984 TLTELRAFL 849 857 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5C 5C
459985 TLTGNLFIII 39 48 Olfactory receptor 2J2 Olfactory receptor 2J2 Homo sapiens
459986 TLTKVLALV 440 448 Phosphoinositide 3-kinase Phosphoinositide 3-kinase Homo sapiens regulatory subunit 4 regulatory subunit 4
459987 TLTSKLYSL 5 13 Cytochrome b-d complex Cytochrome b-d complex Homo sapiens subunit 9 subunit 9
459988 TLVDNISTMAL 62 72 Acyl-coenzyme A Acyl-coenzyme A Homo sapiens thioesterase 13 thioesterase 13
459989 TLVDNTINL 803 811 Probable helicase senataxin Probable helicase senataxin Homo sapiens
459990 TLVEAIKQV 131 139 Putative helicase MOV-10 Putative helicase MOV-10 Homo sapiens
459991 TLVESLLTI 196 204 Protein-associating with the Protein-associating with the Homo sapiens carboxyl-terminal domain of carboxyl-terminal domain of
ezrin ezrin
459992 TLVVFAINL 4402 4410 Uncharacterized protein Uncharacterized protein Homo sapiens
KIAA1 109 KIAA1109
459993 TLWEIAKAEV 5 14 Cytoplasmic dynein 2 light Cytoplasmic dynein 2 light Homo sapiens intermediate chain 1 intermediate chain 1
459994 TLWGGLLRL 3 11 Transmembrane protein 9B Transmembrane protein 9B Homo sapiens
459995 TLWNEIERL 105 113 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase 16 kinase 16
459996 TLWNQELYI 316 324 G patch domain and KOW G patch domain and KOW Homo sapiens motifs-containing protein motifs-containing protein
459997 TLWVDPYE 95 102 Protein BTG2 Protein BTG2 Homo sapiens
459998 TLWYRSPEV 166 174 Cyclin-dependent kinase 1 Cyclin-dependent kinase 1 Homo sapiens
(UniProt:P06493)
459999 TLYDIRAEL 999 1007 Transcription elongation Transcription elongation Homo sapiens factor SPT6 factor SPT6 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
460000 TLYDSRLFV 207 215 Trafficking protein particle Trafficking protein particle Homo sapiens complex subunit 9 complex subunit 9
460001 TLYEGEKFQL 58 67 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 W enzyme E2 W
460002 TLYEQSVWI 115 123 NHL repeat-containing NHL repeat-containing Homo sapiens protein 3 protein 3
460003 TLYERGFENI 58 67 Transmembrane protein 214 Transmembrane protein 214 Homo sapiens
(UniProt:Q6NUQ4)
460004 TLYGSQIKL 594 602 Exporti n-6 Exportin-6 Homo sapiens
460005 TLYHLRLLV 290 298 NADH dehydrogenase NADH dehydrogenase Homo sapiens
[ubiquinone] 1 alpha [ubiquinone] 1 alpha
subcomplex subunit 10, subcomplex subunit 10,
mitochondrial mitochondrial
460006 TLYILALEN 770 778 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 50 containing protein 50
460007 TLYKDVRDLLA 60 70 Ankyrin repeat and zinc Ankyrin repeat and zinc Homo sapiens finger domain-containing finger domain-containing
protein 1 protein 1
460008 TLYNPERTITV 319 329 Insulin-like growth factor 2 Insulin-like growth factor 2 Homo sapiens mRNA-binding protein 1 mRNA-binding protein 1
460009 TLYPLHILFV 827 836 AP-1 complex subunit beta-1 AP-1 complex subunit beta-1 Homo sapiens
460010 TMADQIVTV 176 184 Syntaxin-binding protein 3 Syntaxin-binding protein 3 Homo sapiens
460012 TMFEFAFHL 426 434 Other Homo sapiens StAR-related lipid transfer Homo sapiens
(human) protein protein 3
460013 TMIDDEALKEV 288 298 5'-AMP-activated protein 5'-AMP-activated protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
alpha-1 alpha-1
460019 TMLGVSHW 279 287 Actin-like protein 6A Actin-like protein 6A Homo sapiens
460020 TMLHLTDIQL 103 112 Phosphatidylinositide Phosphatidylinositide Homo sapiens phosphatase SAC1 phosphatase SAC1
460100 TQILSVPKV 528 536 Lamina-associated Lamina-associated Homo sapiens polypeptide 2, isoform alpha polypeptide 2, isoform alpha
460121 TTFDKEFLL 396 404 Intron-binding protein Intron-binding protein Homo sapiens aquarius aquarius
460123 TTLEQPPSV 338 346 Nuclear factor of activated T- Nuclear factor of activated T- Homo sapiens cells, cytoplasmic 1 cells, cytoplasmic 1
460156 TWNIVGV 153 160 Transcription factor RFX4 Transcription factor RFX4 Homo sapiens
460272 VIDKLVVHL 494 502 Nucleolar protein 14 Nucleolar protein 14 Homo sapiens
460275 VIFQKWNV 972 980 AP-3 complex subunit beta-1 AP-3 complex subunit beta-1 Homo sapiens
460278 VIHNLATYV 54 62 ORMMike protein 2 ORMMike protein 2 Homo sapiens
460280 VIINQIYEA 479 487 Arf-GAP with coiled-coil, Arf-GAP with coiled-coil, Homo sapiens
ANK repeat and PH domain- ANK repeat and PH domain- containing protein 1 containing protein 1
460286 VIMERLQQV 553 561 Importin subunit beta-1 Importin subunit beta-1 Homo sapiens
460288 VINNVLATI 794 802 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase mTOR kinase mTOR
460292 VITETVVEV 80 88 ETS-related transcription ETS-related transcription Homo sapiens factor Elf-2 factor Elf-2
460304 VLADSVHLA 88 96 Protein Mis18-beta Protein Mis18-beta Homo sapiens
460305 VLADVKVHI 203 211 RNA-binding protein PN01 RNA-binding protein PN01 Homo sapiens
460306 VLADVMDDQL 1517 1526 Protein virilizer homolog Protein virilizer homolog Homo sapiens
460307 VLAEDEEMNRM 233 243 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein G(i) subunit alpha-1 protein G(i) subunit alpha-1
460308 VLAELKEYA 354 362 AP-2 complex subunit beta AP-2 complex subunit beta Homo sapiens
460309 VLAELVAKL 908 916 Toll-like receptor 7 Toll-like receptor 7 Homo sapiens
460310 VLAFENPQV 214 222 Armadillo repeat containing Armadillo repeat containing Homo sapiens
8, isoform CRA_g 8, isoform CRA_g
46031 1 VLAFLVHEL 972 980 Bromodomain adjacent to Bromodomain adjacent to Homo sapiens zinc finger domain protein 2A zinc finger domain protein 2A
460312 VLAKEIGLL 377 385 Monofunctional C1 - Monofunctional C1- Homo sapiens tetrahydrofolate synthase, tetrahydrofolate synthase,
mitochondrial mitochondrial
460313 VLAPGHAVPPA 86 96 Plexin-B2 Plexin-B2 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
460314 VLAPVPTHSTV 360 370 Dual specificity protein Dual specificity protein Homo sapiens phosphatase 5 phosphatase 5
460315 VLAQPEAISTI 194 204 Disheveled-associated Disheveled-associated Homo sapiens activator of morphogenesis 2 activator of morphogenesis 2
460316 VLAQQIATL 168 176 Syntaxin-binding protein 2 Syntaxin-binding protein 2 Homo sapiens
460317 VLAQVFTEL 2255 2263 Midasin Midasin Homo sapiens
460318 VLASUIRL 1207 1215 DNA repair protein RAD50 DNA repair protein RAD50 Homo sapiens
460319 VLATFVHML 326 334 Sedoheptulokinase Sedoheptulokinase Homo sapiens
460320 VLAVGIDGAN 943 952 Collagen alpha-6(VI) chain Collagen alpha-6(VI) chain Homo sapiens
460321 VLDDNKLLTL 2318 2327 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
460322 VLDELKNMKC 170 179 Cytoplasmic FMR1- Cytoplasmic FMR1 - Homo sapiens interacting protein 2 interacting protein 2
460323 VLDITRLLL 444 452 Inositol hexakisphosphate Inositol hexakisphosphate Homo sapiens and diphosphoinositol- and diphosphoinositol- pentakisphosphate kinase 1 pentakisphosphate kinase 1
(UniProt:Q6PFW1)
460324 VLDKLLLYL 161 169 Serrate RNA effector Serrate RNA effector Homo sapiens molecule homolog molecule homolog
460325 VLDMAKVLL 28 36 Retinol-binding protein 3 Retinol-binding protein 3 Homo sapiens
460326 VLDPRDII 696 703 Valine-tRNA ligase, Valine-tRNA ligase, Homo sapiens mitochondrial mitochondrial
460327 VLDTLSQLLKV 434 444 Unconventional myosin-IXb Unconventional myosin-IXb Homo sapiens
460328 VLDTLTKVLV 23 32 C-Myc-binding protein C-Myc-binding protein Homo sapiens
460329 VLDTPPDPA 163 171 Phosphatidylinositol 4,5- Phosphatidylinositol 4,5- Homo sapiens bisphosphate 3-kinase bisphosphate 3-kinase
catalytic subunit gamma catalytic subunit gamma
isoform isoform
460330 VLEDPVHAV 354 362 Protein transport protein Protein transport protein Homo sapiens
Sec61 subunit alpha isoform Sec61 subunit alpha isoform
1 1
460331 VLEHFALLL 848 856 Anoctamin-8 Anoctamin-8 Homo sapiens
460332 VLELDSPGSLV Unidentified protein unidentified
460333 VLESSNPKM 915 923 Kinase suppressor of Ras 1 Kinase suppressor of Ras 1 Homo sapiens
460334 VLFDVTGQVRL 73 83 Major vault protein Major vault protein Homo sapiens
460335 VLFESEFVHV 1033 1042 Probable phospholipid- Probable phospholipid- Homo sapiens transporting ATPase IIB transporting ATPase IIB
460336 VLFGAVITGA 316 325 HLA class I histocompatibility Homo sapiens antigen, A-68 alpha chain
460337 VLFPLLTKL 281 289 Golgi-specific brefeldin A- Golgi-specific brefeldin A- Homo sapiens resistance guanine resistance guanine
nucleotide exchange factor 1 nucleotide exchange factor 1
460338 VLFPLPTPL 649 657 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase kinase kinase kinase kinase kinase kinase kinase
1 1
460339 VLFPSAEVALL 873 883 UHRF1-binding protein 1 UHRF1 -binding protein 1 Homo sapiens
460340 VLFQEALWHV 743 752 Fatty acid synthase Fatty acid synthase Homo sapiens
460341 VLFSSPPQM 67 75 DNA replication licensing DNA replication licensing Homo sapiens factor MCM4 factor MCM4
460342 VLGEFLKEI 32 40 Protein VAC 14 homolog Protein VAC14 homolog Homo sapiens
460343 VLGELVPRL 1355 1363 Proteasome-associated Proteasome-associated Homo sapiens protein ECM29 homolog protein ECM29 homolog
460344 VLGIVVGV 129 136 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 1 complex subunit 1
(UniProt:A5YKK6)
460345 VLGPGPPPL 38 46 Probable Probable Homo sapiens palmitoyltransferase palmitoyltransferase
ZDHHC24 ZDHHC24
460346 VLHDRIVSV 1216 1224 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 23 II transcription subunit 23
460347 VLHGQEISV 11 16 1124 Zinc finger C3H1 domain- Zinc finger C3H1 domain- Homo sapiens containing protein containing protein Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
460348 VLHHTLTNV 1014 1022 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 2-alpha initiation factor 2-alpha
kinase 4 kinase 4
460349 VLHPGLLAQV 312 321 Uncharacterized aarF Uncharacterized aarF Homo sapiens domain-containing protein domain-containing protein
kinase 2 kinase 2
460350 VLHRNLIYL 53 61 SS18-like protein 2 SS18-like protein 2 Homo sapiens
460351 VUDDLTTL 410 418 Protein MT01 homolog, Protein MT01 homolog, Homo sapiens mitochondrial mitochondrial
460352 VUDELHGLLL 169 179 Protein MMS22-like Protein MMS22-like Homo sapiens
460353 VUDEVESL 249 257 Pachytene checkpoint Pachytene checkpoint Homo sapiens protein 2 homolog protein 2 homolog
460354 VUDKLLPKL 1136 1145 Chromodomain-helicase- Chromodomain-helicase- Homo sapiens
DNA-binding protein 8 DNA-binding protein 8
460355 VUDTPGQIEV 107 117 GPN-loop GTPase 1 GPN-loop GTPase 1 Homo sapiens
460356 VUDVGTGYYV 95 105 Prefoldin subunit 5 Prefoldin subunit 5 Homo sapiens
460357 VUETLVTL 34 42 Adenosylhomocysteinase Adenosylhomocysteinase Homo sapiens
460358 VUEVNPQT 11 1 119 Ribosomal RNA small Ribosomal RNA small Homo sapiens subunit methyltransferase subunit methyltransferase
NEP1 NEP1
460359 VUGEGVLTKL 35 45 Pleckstrin homology domain- Pleckstrin homology domain- Homo sapiens containing family F member containing family F member
2 2
460360 VUGENEKA 791 799 Double-stranded RNA- Double-stranded RNA- Homo sapiens specific adenosine specific adenosine
deaminase deaminase
460361 VUGTFIAHV 8 17 Transmembrane protein 64 Transmembrane protein 64 Homo sapiens
460362 VUGVGKLLRV 959 969 Splicing factor 3B subunit 3 Splicing factor 3B subunit 3 Homo sapiens
460363 VUHELAEA 138 146 Chitinase-3-like protein 2 Chitinase-3-like protein 2 Homo sapiens
460364 VUKDLFHI 423 431 Apoptosis inhibitor 5 Apoptosis inhibitor 5 Homo sapiens
(UniProt:Q9BZZ5)
460365 VUKEGGVQL 97 106 Septin-7 Septin-7 Homo sapiens
460366 VUKNLUSV 6672 6681 Dystonin (UniProt:Q03001) Dystonin Homo sapiens
460367 VUKWFPEV 109 117 Rho-related GTP-binding Rho-related GTP-binding Homo sapiens protein RhoF protein RhoF
460368 VUNRIDLV 2159 2167 Chromodomain-helicase- Chromodomain-helicase- Homo sapiens
DNA-binding protein 8 DNA-binding protein 8
460369 VUNTSVTL 701 709 Zinc finger protein 292 Zinc finger protein 292 Homo sapiens
460370 VUPDQKY 396 403 F-box/LRR-repeat protein 3 F-box/LRR-repeat protein 3 Homo sapiens
460371 VURDLNFEV 454 463 ATP-binding cassette subATP-binding cassette subHomo sapiens family D member 3 family D member 3
460372 VURELWNT 277 285 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 74A containing protein 74A
460373 VUSGWHEI 164 173 Membrane-bound Membrane-bound Homo sapiens transcription factor site-2 transcription factor site-2
protease protease
460374 VUSTLQEL 169 177 Cytochrome P450 1A1 Cytochrome P450 1A1 Homo sapiens
460375 VLISVLQAI 505 513 Cytoplasmic FMR1- Cytoplasmic FMR1 - Homo sapiens interacting protein 2 interacting protein 2
460376 VUTTUTA 216 224 Putative helicase MOV-10 Putative helicase MOV-10 Homo sapiens
460377 VLKAALADV 35 43 Echinoderm microtubule- Echinoderm microtubule- Homo sapiens associated protein-like 4 associated protein-like 4
460378 VLKAEALAL 10 18 Metallophosphoesterase Metallophosphoesterase Homo sapiens domain-containing protein 1 domain-containing protein 1
460379 VLLDADGHIKL 382 392 Protein kinase C zeta type Protein kinase C zeta type Homo sapiens
460380 VLLDENLLKMV 453 463 1-phosphatidylinositol 3- 1-phosphatidylinositol 3- Homo sapiens phosphate 5-kinase phosphate 5-kinase
460381 VLLDITPMM 39 47 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens cytoplasmic cytoplasmic
460382 VLLDSEGHIVL 151 161 Ribosomal protein S6 kinase Ribosomal protein S6 kinase Homo sapiens alpha-4 alpha-4
460383 VLLEALALRNV 115 125 COP9 signalosome complex COP9 signalosome complex Homo sapiens subunit 7a subunit 7a Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
460384 VLLEAQDMAV 114 123 39S ribosomal protein L22, 39S ribosomal protein L22, Homo sapiens mitochondrial mitochondrial
460385 VLLEDGVLNHV 264 274 Rap guanine nucleotide Rap guanine nucleotide Homo sapiens exchange factor 4 exchange factor 4
460386 VLLEEGEAQRL 77 87 Ubiquitin-like protein 4A Ubiquitin-like protein 4A Homo sapiens
460387 VLLELLPRL 345 353 Acetylcholine receptor Acetylcholine receptor Homo sapiens subunit epsilon subunit epsilon
460388 VLLEPFIHQV 24 33 Inositol hexakisphosphate Inositol hexakisphosphate Homo sapiens kinase 1 kinase 1
460389 VLLEPFVHQV 17 26 Inositol hexakisphosphate Inositol hexakisphosphate Homo sapiens kinase 2 (UniProt:Q9UHH9) kinase 2
460390 VLLESKILL 412 420 DENN domain-containing DENN domain-containing Homo sapiens protein 4C (UniProt:R4GN35) protein 4C
460391 VLLFEADTITL 153 163 Nuclear receptor coactivator Nuclear receptor coactivator Homo sapiens
4 4
460392 VLLGHLLMEL 333 342 Fc receptor-like A Fc receptor-like A Homo sapiens
(UniProt:Q7L513)
460393 VLLHLLHNV 309 317 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX54 helicase DDX54
460394 VLLKIVEQI 45 53 Fermitin family homolog 3 Fermitin family homolog 3 Homo sapiens
460395 VLLLNPVEV 163 171 Phosphoinositide 3-kinase Phosphoinositide 3-kinase Homo sapiens regulatory subunit 5 regulatory subunit 5
460396 VLLLQPKIP 267 275 Protein angel homolog 2 Protein angel homolog 2 Homo sapiens
460397 VLLNEILEQV 869 878 Condensin complex subunit Condensin complex subunit Homo sapiens
3 3
460398 VLLNNKLYV 172 180 TGF-beta-activated kinase 1 TGF-beta-activated kinase 1 Homo sapiens and MAP3K7-binding protein and MAP3K7-binding protein
1 1
460399 VLLNPEKY 342 349 Alpha-adducin Alpha-adducin Homo sapiens
460400 VLLPDERTISL 368 378 Cleavage stimulation factor Cleavage stimulation factor Homo sapiens subunit 1 subunit 1
460401 VLLPEHSLV 27 35 Receptor-transporting protein Receptor-transporting protein Homo sapiens
5 5
460402 VLLPELPTL 863 871 MMS19 nucleotide excision MMS19 nucleotide excision Homo sapiens repair protein homolog repair protein homolog
460403 VLLPLRVTL 155 163 Glycerol-3-phosphate Glycerol-3-phosphate Homo sapiens acyltransferase 3 acyltransferase 3
460404 VLLSEILHL 1354 1362 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 3 initiation factor 4 gamma 3
(UniProt:043432)
460405 VLLSEQGDVKL 148 158 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase 25 kinase 25
460406 VLLSHPDPLHL 58 68 Cleavage and Cleavage and Homo sapiens polyadenylation specificity polyadenylation specificity
factor subunit 2 factor subunit 2
460407 VLLSPVPEL 552 560 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 1 complex subunit 1
460408 VLLTMIARV 2 10 Vesicle-trafficking protein Vesicle-trafficking protein Homo sapiens
SEC22b SEC22b
460409 VLLTVLERV 42 50 Uncharacterized protein Uncharacterized protein Homo sapiens
C2orf54 C2orf54
460410 VLLTWKYLL 63 71 PCNA-interacting partner PCNA-interacting partner Homo sapiens
(UniProt:Q9NWS1 )
46041 1 VLLVEHALSKV 302 312 Staphylococcal nuclease Staphylococcal nuclease Homo sapiens domain-containing protein 1 domain-containing protein 1
460412 VLMDEGAVLTL 235 245 UNE-1 type transposase UNE-1 type transposase Homo sapiens domain-containing protein 1 domain-containing protein 1
460413 VLMDGSVKL 723 731 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase kinase kinase kinase kinase kinase kinase kinase
1 1
460414 VLMDGSVKLV 723 732 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase kinase kinase kinase kinase kinase kinase kinase
1 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
460415 VLMDLKALL 543 551 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX41 RNA helicase DDX41
460416 VLMDLKALLL 543 552 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX41 RNA helicase DDX41
460417 VLMEGVKTEV 412 421 Sterol regulatory element- Sterol regulatory element- Homo sapiens binding protein 1 binding protein 1
460418 VLMKALEYL 1259 1267 Cytoskeleton-associated Cytoskeleton-associated Homo sapiens protein 5 protein 5
460419 VLMNQPPQI 163 111 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 1 initiation factor 4 gamma 1
(UniProt:Q04637)
460420 VLMNSLERL 73 81 Exostosin-like 3 Exostosin-like 3 Homo sapiens
(UniProt:E7ET85)
460421 VLMPMERQMSV 161 111 Cyclic AMP-responsive Cyclic AMP-responsive Homo sapiens element-binding protein 5 element-binding protein 5
460422 VLMQDLAFL 222 230 N-acetylglucosamine-1 - N-acetylglucosamine-1- Homo sapiens phosphotransferase subunits phosphotransferase subunits alpha/ beta alpha/beta
460423 VLMWEIYSL 194 202 Tyrosine-protein kinase BTK Tyrosine-protein kinase BTK Homo sapiens
460424 VLNKEAVEV 175 183 WD repeat-containing protein WD repeat-containing protein Homo sapiens
44 44
460425 VLPPDTDPA 83 91 Nicotinate Nicotinate Homo sapiens phosphoribosyltransferase phosphoribosyltransferase
460426 VLPSSUSI 81 89 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
FANCL (UniProt:B5MCZ6) FANCL
460427 VLQDKDLFSV 159 168 Ubiquitin-like protein 7 Ubiquitin-like protein 7 Homo sapiens
460428 VLQDTVEQL 379 381 Methionine-tRNA ligase, Methionine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
(UniProt:P56192)
460429 VLQDYIILPT 78 81 Beta-defensin 128 Beta-defensin 128 Homo sapiens
460430 VLQGLEIEL 339 341 Keratin, type I cytoskeletal 16 Keratin, type I cytoskeletal 16 Homo sapiens
460431 VLQHGAAAA 543 551 lnterleukin-4 receptor subunit lnterleukin-4 receptor subunit Homo sapiens alpha alpha
460432 VLQQKLEAI 210 218 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 14 hydrolase 14
460433 VLQTVLQEV 90 98 Exosome complex Exosome complex Homo sapiens exonuclease RRP44 exonuclease RRP44
460434 VLQTVLSL 426 433 UMP-CMP kinase 2, UMP-CMP kinase 2, Homo sapiens mitochondrial mitochondrial
460435 VLSEENFKV 112 120 Zinc finger CCCH-type Zinc finger CCCH-type Homo sapiens antiviral protein 1 antiviral protein 1
(UniProt:C9J6P4)
460436 VLSELLWQV 2142 2150 Probable ubiquitin carboxyl- Probable ubiquitin carboxyl- Homo sapiens terminal hydrolase FAF-X terminal hydrolase FAF-X
460437 VLSSLNIKL 2011 2019 DBF4-type zinc finger- DBF4-type zinc finger- Homo sapiens containing protein 2 containing protein 2
460438 VLSWEHLLEL 5 14 Other Homo sapiens Coiled-coil domain- Homo sapiens
(human) protein containing protein 144A
460439 VLTEUNLHL 757 166 Probable methyltransferase Probable methyltransferase Homo sapiens
TARBP1 TARBP1
460440 VLTESPPSL 113 121 Exonuclease mut-7 homolog Exonuclease mut-7 homolog Homo sapiens
460441 VLTNKLLTV 165 113 Phosphatidylinositol N- Phosphatidylinositol N- Homo sapiens acetylglucosaminyltransferas acetylglucosaminyltransferas e subunit A e subunit A
460442 VLTSLVALR 97 105 Regulator of microtubule Regulator of microtubule Homo sapiens dynamics protein 3 dynamics protein 3
460443 VLTVDGEQV 559 561 Sphingosine kinase 2 Sphingosine kinase 2 Homo sapiens
460444 VLVEDLTQV 122 130 Zinc finger and SCAN Zinc finger and SCAN Homo sapiens domain-containing protein 22 domain-containing protein 22
460445 VLVEHVKNV 57 65 Bis(5'-adenosyl)- Bis(5'-adenosyl)- Homo sapiens triphosphatase ENPP4 triphosphatase ENPP4
460446 VLVQLIHSV 670 618 UPF0505 protein C16orf62 UPF0505 protein C16orf62 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
460447 VLVQVSPSL 170 178 Exosome complex Exosome complex Homo sapiens component RRP4 component RRP4
460448 VLVSQTNEL 546 554 Transcription factor 20 Transcription factor 20 Homo sapiens
460449 VLVTAGEVHL 612 621 Elongation factor Tu GTP- Elongation factor Tu GTP- Homo sapiens binding domain-containing binding domain-containing
protein 1 protein 1
460450 VLVTLAGIIV 668 677 Disintegrin and Disintegrin and Homo sapiens metalloproteinase domain- metalloproteinase domain- containing protein 8 containing protein 8
460451 VLWAMVMRI 749 757 V-type proton ATPase 1 16 V-type proton ATPase 1 16 Homo sapiens kDa subunit a isoform 3 kDa subunit a isoform 3
460452 VLWDLVDRI 365 373 Acetoacetyl-CoA synthetase Acetoacetyl-CoA synthetase Homo sapiens
460453 VLWDQYHNL 623 631 Membrane-bound Membrane-bound Homo sapiens transcription factor site-1 transcription factor site-1
protease protease
460454 VLWELAHLPTL 554 564 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 24 hydrolase 24
460455 VLWKDIQHA 82 90 PHD finger protein 19 PHD finger protein 19 Homo sapiens
(UniProt:Q5T6S3)
460456 VLWMAPDGLYA 315 325 Interferon regulatory factor 4 Interferon regulatory factor 4 Homo sapiens
460457 VLWTMVIHI 754 762 V-type proton ATPase 1 16 V-type proton ATPase 1 16 Homo sapiens kDa subunit a isoform 1 kDa subunit a isoform 1
460458 VLYDAKIVDV 29 38 Male-specific lethal 3 Male-specific lethal 3 Homo sapiens homolog homolog
460459 VLYDRLLKL 3 11 N-acetylgalactosamine N-acetylgalactosamine Homo sapiens kinase kinase
460460 VLYDWKERL 105 113 C-myc promoter-binding C-myc promoter-binding Homo sapiens protein protein
460461 VLYGGLLEHL 84 93 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 84 containing protein 84
460462 VLYKWTNYL 12 20 Pleckstrin homology domain- Pleckstrin homology domain- Homo sapiens containing family A member containing family A member
3 3
460463 VLYNQRVEEI 231 240 Signal recognition particle Signal recognition particle Homo sapiens subunit SRP68 subunit SRP68
460464 VLYPHPPLA 134 142 Dystrophia myotonica WD Dystrophia myotonica WD Homo sapiens repeat-containing protein repeat-containing protein
460465 VLYPSLKEI 97 105 Peroxisomal biogenesis Peroxisomal biogenesis Homo sapiens factor 19 factor 19
460466 VMAEAPPGV 183 191 IST1 homolog IST1 homolog Homo sapiens
460471 VMFEDGVLMRL 327 337 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ATR kinase ATR
460581 VQDDIKESV 1212 1220 Proteasome-associated Proteasome-associated Homo sapiens protein ECM29 homolog protein ECM29 homolog
460583 VQDENVRGV 6 14 Phosphatidylglycerophosphat Phosphatidylglycerophosphat Homo sapiens ase and protein-tyrosine ase and protein-tyrosine
phosphatase 1 phosphatase 1
(UniProt:Q8WUK0)
460584 VQDPNTGFSV 413 422 Inter-alpha-trypsin inhibitor Inter-alpha-trypsin inhibitor Homo sapiens heavy chain H1 heavy chain H1
460591 VQTAELTKV 108 116 Glia maturation factor Glia maturation factor Homo sapiens gamma gamma
460631 VTIVETPPMV 71 80 60S ribosomal protein L3 60S ribosomal protein L3 Homo sapiens
460641 VVAEELENV 87 95 F-box only protein 22 F-box only protein 22 Homo sapiens
460643 VVDAWTQV 84 92 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit RPB7 polymerase II subunit RPB7
460652 VVIEKTSPPV 840 849 Latent-transforming growth Latent-transforming growth Homo sapiens factor beta-binding protein 1 factor beta-binding protein 1
460663 VVSGPPPAV 151 159 Other Homo sapiens Homo sapiens
(human) protein
460668 VVWGTVIRV 1295 1303 Other Homo sapiens Protein SZT2 Homo sapiens
(human) protein Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
460694 WLAGYVFLVLL 58 68 Other Homo sapiens Homo sapiens
(human) protein
460695 WLAHAIQTV 429 437 Exocyst complex component Exocyst complex component Homo sapiens
2 2
460696 WLAQQAAKAM 251 260 39S ribosomal protein L9, 39S ribosomal protein L9, Homo sapiens mitochondrial mitochondrial
(UniProt:Q9BYD2)
460697 WLKNGAALVL 351 360 Contacti n-3 Contactin-3 Homo sapiens
460698 WLLQTHWTL 72 80 Fermitin family homolog 3 Fermitin family homolog 3 Homo sapiens
460699 WLQLQIPRI 134 142 Proteasome activator Proteasome activator Homo sapiens complex subunit 1 complex subunit 1
(UniProt:H0YNE3)
460700 WLRYQGVPVEE 351 361 Putative sodium-coupled Putative sodium-coupled Homo sapiens neutral amino acid neutral amino acid
transporter 7 transporter 7
(UniProt:Q9NVC3)
460701 WLYGEDHQI 259 267 Branched-chain-amino-acid Branched-chain-amino-acid Homo sapiens aminotransferase, cytosolic aminotransferase, cytosolic
460713 WVDETLSSV 446 454 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR5 UBR5
460714 WVLSQVQL 9 16 Immunoglobulin Ig heavy chain V-ll region Homo sapiens
ARH-77
460726 YCAEIAHNV 95 103 60S ribosomal protein L32 60S ribosomal protein L32 Homo sapiens
460727 YCYDNIHFM 348 356 Basic leucine zipper and W2 Basic leucine zipper and W2 Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:Q7L1Q6)
460750 YGLPVWKL 489 497 Catenin beta-1 Catenin beta-1 Homo sapiens
460760 YILEGEPGKV 333 342 Signal recognition particle Signal recognition particle Homo sapiens subunit SRP68 subunit SRP68
460761 YILGKFFAL 772 780 Protein timeless homolog Protein timeless homolog Homo sapiens
460762 YILKIVPTV 187 195 Endoplasmic reticulum-Golgi Endoplasmic reticulum-Golgi Homo sapiens intermediate compartment intermediate compartment
protein 1 protein 1
460766 YISFQPPGV 144 152 Galectin-9 (UniProt:O00182) Galectin-9 Homo sapiens
460768 YITLTGVHQV 90 99 Calcyclin-binding protein Calcyclin-binding protein Homo sapiens
460772 YIYHGTVKL 102 110 Kelch repeat and BTB Kelch repeat and BTB Homo sapiens domain-containing protein 4 domain-containing protein 4
460776 YLADLLMPHL 93 102 Zinc transporter ZIP1 1 Zinc transporter ZIP11 Homo sapiens
460777 YLADQNNQV 122 130 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 1 subunit 1
460778 YLAHLAHHL 206 214 Nucleolar protein 6 Nucleolar protein 6 Homo sapiens
460779 YLAKVKSLL 78 86 DNA (cytosine-5)- DNA (cytosine-5)- Homo sapiens methyltransferase 1 methyltransferase 1
460780 YLARIQGFQV 470 479 Double-stranded RNA- Double-stranded RNA- Homo sapiens binding protein Staufen binding protein Staufen
homolog 2 homolog 2
460781 YLASDEITTV 772 781 Dynamin-like 120 kDa Dynamin-like 120 kDa Homo sapiens protein, mitochondrial protein, mitochondrial
460782 YLAVESPFL 666 674 Carnitine O- Carnitine O- Homo sapiens palmitoyltransferase 1 , liver palmitoyltransferase 1 , liver
isoform isoform
460783 YLCYEVERL 14 22 DNA dC->dU-editing enzyme DNA dC->dU-editing enzyme Homo sapiens
APOBEC-3A APOBEC-3A
460784 YLDGHLITTV 302 311 NAD kinase NAD kinase Homo sapiens
460785 YLDHTADVQL 45 54 Protein archease Protein archease Homo sapiens
(UniProt:H7C3R6)
460786 YLDIARYLL 146 154 Protein phosphatase 1 Protein phosphatase 1 Homo sapiens regulatory subunit 12C regulatory subunit 12C
460787 YLDIKGLLDV 109 118 S-phase kinase-associated S-phase kinase-associated Homo sapiens protein 1 (UniProt:P63208) protein 1
460788 YLDKMNNNI 13 21 Transcription cofactor Transcription cofactor Homo sapiens vestigial-like protein 4 vestigial-like protein 4 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
460789 YLDPRLAFTV 38 47 WW domain-containing WW domain-containing Homo sapiens oxidoreductase oxidoreductase
460790 YLDPVQRDL 43 51 Zinc finger protein 655 Zinc finger protein 655 Homo sapiens
(UniProt:C9J9R2)
460791 YLDQGTQIFL 41 50 Methyltransferase-like Methyltransferase-like Homo sapiens protein 9 protein 9
460792 YLDQRELLL 335 343 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 3 complex subunit 3
460793 YLDTINRSV 107 115 U4/U6.U5 tri-snRNP- U4/U6.U5 tri-snRNP- Homo sapiens associated protein 2 associated protein 2
(UniProt:Q53GS9)
460794 YLDVVQSNV 39 47 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 variant 3 enzyme E2 variant 3
460795 YLEDTDRNL 299 307 Nuclear factor erythroid 2- Nuclear factor erythroid 2- Homo sapiens related factor 3 related factor 3
460796 YLFAVNIKL 459 467 Cap-specific mRNA Cap-specific mRNA Homo sapiens
(nucleoside-2'-0-)- (nucleoside-2'-0-)- methyltransferase 1 methyltransferase 1
(UniProt:Q8N1 G2)
460797 YLFDLPLKV 175 183 Leucine-rich repeat and Leucine-rich repeat and Homo sapiens calponin homology domain- calponin homology domain- containing protein 2 containing protein 2
460798 YLFEEIAKI 34 42 AP-4 complex accessory AP-4 complex accessory Homo sapiens subunit tepsin subunit tepsin
460799 YLFGERLLE 43 51 MKI67 FHA domain- MKI67 FHA domain- Homo sapiens interacting nucleolar interacting nucleolar
phosphoprotein phosphoprotein
460800 YLFHIAGAYLL 203 213 Translocating chain- Translocating chain- Homo sapiens associated membrane associated membrane
protein 1 protein 1
460801 YLFHREVQAV 258 267 Protein BANP Protein BANP Homo sapiens
460802 YLFPRQLU 172 180 LETM1 domain-containing LETM1 domain-containing Homo sapiens protein 1 (UniProt:Q6P1 Q0) protein 1
460803 YLFSEALNAA 365 374 Lipopolysaccharide- Lipopolysaccharide- Homo sapiens responsive and beige-like responsive and beige-like
anchor protein anchor protein
460804 YLGDLLETC 104 112 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit K initiation factor 3 subunit K
460805 YLGLDGFVERI 347 357 Pyridoxal-dependent Pyridoxal-dependent Homo sapiens decarboxylase domain- decarboxylase domain- containing protein 1 containing protein 1
460806 YLGLLENVRV 612 621 Unconventional myosin-ld Unconventional myosin-ld Homo sapiens
460807 YLGPVSPSL 136 144 Muscleblind-like protein 1 Muscleblind-like protein 1 Homo sapiens
(UniProt:Q9NR56)
460808 YLGRLAHEV 137 145 60S ribosomal protein L13a 60S ribosomal protein L13a Homo sapiens
460809 YLHEFLTSA 165 173 Ubiquitin-like domain- Ubiquitin-like domain- Homo sapiens containing CTD phosphatase containing CTD phosphatase
1 1
460810 YLHNPSSEETI 53 63 Transmembrane protein 131 Transmembrane protein 131 Homo sapiens
46081 1 YLHREVVEL 272 280 Xylosyltransferase 2 Xylosyltransferase 2 Homo sapiens
460812 YLHSGQVAL 725 733 UPF0505 protein C16orf62 UPF0505 protein C16orf62 Homo sapiens
460813 YLHTNVALV 368 376 Vam6/Vps39-like protein Vam6/Vps39-like protein Homo sapiens
460814 YLHTTIFGL 227 235 GTP-binding protein 2 GTP-binding protein 2 Homo sapiens
460815 YLHWGHFEM 96 104 39S ribosomal protein L16, 39S ribosomal protein L16, Homo sapiens mitochondrial mitochondrial
460816 YLHWLLTNI 119 127 39S ribosomal protein L38, 39S ribosomal protein L38, Homo sapiens mitochondrial mitochondrial
(UniProt:B3KN96)
460817 YUAHLPRL 322 330 Tubulin-specific chaperone E Tubulin-specific chaperone E Homo sapiens
(UniProt:B7Z3P1 )
460818 YUARVMLL 267 275 Small conductance calcium- Small conductance calcium- Homo sapiens activated potassium channel activated potassium channel protein 2 protein 2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
460819 YUEKSRVV 185 193 Unconventional myosin-lh Unconventional myosin-lh Homo sapiens
460820 YUGQHVTAAL 364 374 F-box only protein 21 F-box only protein 21 Homo sapiens
460821 YUGVHASL 221 229 DENN domain-containing DENN domain-containing Homo sapiens protein 1C protein 1C
460822 YUHLLQEL 786 794 Centrosomal protein of 290 Centrosomal protein of 290 Homo sapiens kDa (UniProt:O15078) kDa
460823 YUKFLAKL 377 385 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 17 protein 17
460824 YUKGKAPEEI Unidentified protein unidentified
460825 YULHUST 29 37 Mini-chromosome Mini-chromosome Homo sapiens maintenance complex- maintenance complex- binding protein binding protein
460826 YUNSPVVRA 626 635 Isoleucine-tRNA ligase, Isoleucine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
(UniProt:P41252)
460827 YLITSVELL 159 167 Long-chain-fatty-acid-CoA Long-chain-fatty-acid-CoA Homo sapiens ligase 4 ligase 4
460828 YLKDEIEEL 227 235 Other Homo sapiens Protein SOGA1 Homo sapiens
(human) protein
460829 YLKDFFSNV 353 361 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX58 RNA helicase DDX58
460830 YLKDGPYITA 794 803 Pre-mRNA-processing- Pre-m RNA-processi ng- Homo sapiens spl icing factor 8 splicing factor 8
460831 YLKEILEQL 9 17 Protein polybromo-1 Protein polybromo-1 Homo sapiens
460832 YLKIQPGAVPG 443 453 Other Homo sapiens Homo sapiens
(human) protein
460833 YLLASKAYL 884 892 Integrator complex subunit 2 Integrator complex subunit 2 Homo sapiens
460834 YLLDDGTLW 37 46 Cell division cycle protein Cell division cycle protein Homo sapiens
123 homolog 123 homolog
460835 YLLDHLHLEL 98 107 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 3 hydrolase 3
460836 YLLDLHSYLL 514 523 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
MARCH6 MARCH6
460837 YLLDLLRLP 135 143 Transmembrane protein 164 Transmembrane protein 164 Homo sapiens
460838 YLLDLPNPVI 86 95 Phosphatidylinositol 3-kinase Phosphatidylinositol 3-kinase Homo sapiens regulatory subunit alpha regulatory subunit alpha
460839 YLLDPKIADLV 187 197 TFIIH basal transcription TFIIH basal transcription Homo sapiens factor complex helicase XPD factor complex helicase XPD
subunit (UniProt:P18074) subunit
460840 YLLDRLPEM 692 700 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
460841 YLLEEKIASL 2104 2113 Ninein (UniProt:Q8N4C6) Homo sapiens
460842 YLLEENKIKL 975 984 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 11 protein 1 1
460843 YLLEKSRLV 318 326 Unconventional myosin-IXb Unconventional myosin-IXb Homo sapiens
460844 YLLEKSRVL 184 192 Unconventional myosin-lg Unconventional myosin-lg Homo sapiens
460845 YLLEKSRVV 242 250 Unconventional myosin-Va Unconventional myosin-Va Homo sapiens
(UniProt:Q9Y4M )
460846 YLLEQDFPGM 80 89 EH domain-containing EH domain-containing Homo sapiens protein 4 protein 4
460847 YLLEQGAQV 168 176 Protein fem-1 homolog A Protein fem-1 homolog A Homo sapiens
460848 YLLEQIKUEV 116 126 Endoplasmic reticulum Endoplasmic reticulum Homo sapiens metallopeptidase 1 metallopeptidase 1
460849 YLLKFEQIYL 84 93 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit RPB2 polymerase II subunit RPB2
460850 YLLNDASUSV 47 57 Coiled-coil-helix-coiled-coil- Coiled-coil-helix-coiled-coil- Homo sapiens helix domain-containing helix domain-containing
protein 7 (UniProt:E5RJ15) protein 7
460851 YLLPFISKL 170 178 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens listerin listerin
460852 YLLPLLQRL 182 190 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX28 RNA helicase DDX28
protein 1 protein 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
462000 FILPDSLPLDT 68 78 LSM domain-containing LSM domain-containing Toxoplasma protein protein gondii ME49
462001 FLPQKIIYL 35 43 Proteasome activator Proteasome activator Homo sapiens complex subunit 2 complex subunit 2
462007 FRSPLSTGVKDL 156 167 Protein FAM208B Protein FAM208B Homo sapiens
462048 IAAEGIHTGQF 31 41 60S ribosomal protein L8 60S ribosomal protein L8 Homo sapiens
(UniProt:P62917)
462050 IAFLSPKVDPSL 80 91 Protein RER1 Protein RER1 Homo sapiens
(UniProt:015258)
462054 IIVSNPVDIL 183 192 L-lactate dehydrogenase A- L-lactate dehydrogenase A- Homo sapiens like 6B like 6B
462064 IVSNPVDILT 135 144 L-lactate dehydrogenase A L-lactate dehydrogenase A Homo sapiens chain chain
462071 KIIDNTEQL 204 212 Matrix protein Matrix protein Measles virus strain Edmonston- B
462072 KIPSRVHGSLE 191 201 PWWP domain-containing PWWP domain-containing Homo sapiens protein 2B protein 2B
462076 KUDGFFPA 263 271 RNA-directed RNA RNA-directed RNA Measles virus polymerase L polymerase L strain Edmonston- B
462083 KNNACGIANLAS 314 325 Cathepsin K Cathepsin K Homo sapiens
(UniProt:P43235)
462091 KVIPELNGKLTG 219 230 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
462093 KVSPYLFTV 477 485 Hemagglutinin glycoprotein Hemagglutinin glycoprotein Measles virus strain Edmonston- B
462095 LALGQDRIL 89 97 D-dopachrome D-dopachrome Homo sapiens decarboxylase decarboxylase
462096 LARDYAAIVFF 169 179 Acidic fibroblast growth factor Acidic fibroblast growth factor Homo sapiens intracellular-binding protein intracellular-binding protein
(UniProt:043427)
462103 ULAPTRELA 110 119 Eukaryotic initiation factor Eukaryotic initiation factor Homo sapiens
4A-III 4A-III
462106 LLERCIHPADI 295 305 Threonine synthase-like 1 Threonine synthase-like 1 Homo sapiens
46211 1 LLSGGLPRKC 20 29 Beta-1 ,4- Beta-1 ,4- Homo sapiens galactosyltransferase 7 galactosyltransferase 7
462121 LSVADLAESIMK 254 265 L-lactate dehydrogenase A L-lactate dehydrogenase A Homo sapiens chain chain
462122 LTKAPVDLL 1202 1210 Complement C4-A Complement C4-A Homo sapiens
462123 LYWSLPEKPNGL 3700 3711 Usherin Usherin Homo sapiens
462132 NAISRIPKGQV Endoplasmic reticulum Endoplasmic reticulum Homo sapiens aminopeptidase 2 aminopeptidase 2
462137 NLEPRTGFL 779 787 Cartilage intermediate layer Cartilage intermediate layer Homo sapiens protein 1 protein 1
462138 NLPTGIPIV 209 217 Probable phosphoglycerate Probable phosphoglycerate Homo sapiens mutase 4 mutase 4
462163 QLDGLSVSLGR 4192 4202 Polycystin-1 Polycystin-1 Homo sapiens
462166 QLYEEEIRELQ 226 236 Keratin, type II cytoskeletal 8 Keratin, type II cytoskeletal 8 Homo sapiens
462176 RGTINLSTAHI 60 70 Oxysterol-binding protein 2 Oxysterol-binding protein 2 Homo sapiens
462185 RQAGQEMILAV 165 175 Fusion glycoprotein F0 Fusion glycoprotein F0 Measles virus strain Edmonston- B
462201 SLDMDSIIAEVK 253 264 Keratin, type II cytoskeletal 8 Keratin, type II cytoskeletal 8 Homo sapiens
462202 SLHTRTRSLDFR 541 552 Rabenosyn-5 Rabenosyn-5 Homo sapiens
462203 SLMPEETLHQV 971 981 RNA-directed RNA RNA-directed RNA Measles virus polymerase L polymerase L strain Edmonston- B
462204 SMAGNRLAFLPL 186 197 Leucine-rich repeat- Leucine-rich repeat- Homo sapiens containing protein 28 containing protein 28 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
462965 ALAELFGLLV 1062 1071 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
462966 ALAELSTAMHQV 669 680 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens hairless hairless
462967 ALAELYEDEV 30 39 UBX domain-containing UBX domain-containing Homo sapiens protein 2B protein 2B
462968 ALAENSGVKA 451 460 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens theta theta
462969 ALAEPUQNV 269 278 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
462970 ALAEQHAVQEL 573 583 Rho-related BTB domain- Rho-related BTB domain- Homo sapiens containing protein 1 containing protein 1
462971 ALAFDLSKV 104 112 Protein PAXX Protein PAXX Homo sapiens
462972 ALAGAPYQA 426 434 D-3-phosphoglycerate D-3-phosphoglycerate Homo sapiens dehydrogenase dehydrogenase
462974 ALAGVSFEI 459 467 Nodal modulator 3 Nodal modulator 3 Homo sapiens
462975 ALALPAPAL 427 435 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
462976 ALANQKLYSV 1405 1414 Midasin Midasin Homo sapiens
462977 ALANVNIGS 50 58 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P1 P1
462978 ALAPLAIPS 277 285 Polypyrimidine tract-binding Polypyrimidine tract-binding Homo sapiens protein 1 (UniProt:P26599) protein 1
462979 ALAPLAIPSA 277 286 Polypyrimidine tract-binding Polypyrimidine tract-binding Homo sapiens protein 1 (UniProt:P26599) protein 1
462981 ALAQKNVKL 87 95 Mesothelin Mesothelin Homo sapiens
462982 ALASLKKYGV 121 130 Serine palmitoyltransferase 1 Serine palmitoyltransferase 1 Homo sapiens
462983 ALDASILNV 220 228 Regulator of G-protein Regulator of G-protein Homo sapiens signaling 12 signaling 12
462985 ALDDFSIS 542 549 WD repeat-containing protein WD repeat-containing protein Homo sapiens
36 36
462986 ALDDFSISV 542 550 WD repeat-containing protein WD repeat-containing protein Homo sapiens
36 36
462987 ALDDIEWFV 262 270 Epidermal growth factor Epidermal growth factor Homo sapiens receptor kinase substrate 8- receptor kinase substrate 8- like protein 2 like protein 2
462988 ALDDISESI 164 172 Oligoribonuclease, Oligoribonuclease, Homo sapiens mitochondrial mitochondrial
462991 ALDEAQGVGL 24 33 Splicing factor 3B subunit 1 Splicing factor 3B subunit 1 Homo sapiens
462992 ALDEEYLKV 171 179 Tyrosine-tRNA ligase, Tyrosine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
462993 ALDELASLQV 376 385 PC4 and SFRS1-interacting PC4 and SFRS1-interacting Homo sapiens protein protein
462995 ALDEVIFSL 240 248 Asparagine synthetase Asparagine synthetase Homo sapiens
[glutamine-hydrolyzing] [glutamine-hydrolyzing]
462996 ALDFEQEMA 219 227 Actin, cytoplasmic 1 Actin, cytoplasmic 1 Homo sapiens
462998 ALDGAAGTVYL 63 73 Plexin-D1 Plexin-D1 Homo sapiens
463000 ALDIAENEM 21 29 Adenosylhomocysteinase Adenosylhomocysteinase Homo sapiens
463002 ALDLAPSSL 97 105 V-type proton ATPase V-type proton ATPase Homo sapiens subunit SI (UniProt:A6QRJ1) subunit SI
463004 ALDNFLDKL 850 858 Elongation factor 2 Elongation factor 2 Homo sapiens
463005 ALDPMSVLL 419 427 Lysosomal Pro-X Lysosomal Pro-X Homo sapiens carboxypeptidase carboxypeptidase
463007 ALDSASILL 313 321 Mannose-6-phosphate Mannose-6-phosphate Homo sapiens isomerase (UniProt:P34949) isomerase
463009 ALDTKGPEI 110 118 Pyruvate kinase PKM Pyruvate kinase PKM Homo sapiens
463010 ALDTSNVMV 131 139 Inverted formin-2 Inverted formin-2 Homo sapiens
46301 1 ALEEKLENV 77 85 Centromere protein O Centromere protein O Homo sapiens
463012 ALEELGTLQV 499 508 Hepatoma-derived growth Hepatoma-derived growth Homo sapiens factor-related protein 2 factor-related protein 2
463013 ALEKLLPHI 74 82 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0 (UniProt:P05388) P0 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
463015 ALFAPRDPIPYL 11 22 U1 small nuclear U1 small nuclear Homo sapiens ribonucleoprotein 70 kDa ribonucleoprotein 70 kDa
463017 ALFASGLIHRV 108 118 Other Homo sapiens Keratinocyte-associated Homo sapiens
(human) protein protein 2
463019 ALFEDGPEA 169 111 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
463020 ALFEDGPEAEAV 169 180 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
463022 ALFEEVPELL 451 460 Bifunctional purine Bifunctional purine Homo sapiens biosynthesis protein PURH biosynthesis protein PURH
463023 ALFEEVPELLT 451 461 Bifunctional purine Bifunctional purine Homo sapiens biosynthesis protein PURH biosynthesis protein PURH
463025 ALFGVVFPHV 786 195 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 5B protein 5B
463026 ALFILPFVSV 140 149 DNA polymerase theta DNA polymerase theta Homo sapiens
463028 ALFNRLVPSV 474 483 C-1 -tetrahydrofolate C-1-tetrahydrofolate Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
(UniProt:P11586)
463031 ALFPGVAL 7 14 Protein disulfide-isomerase Protein disulfide-isomerase Homo sapiens
A3 A3
463032 ALFPHLLQPV 373 382 Exportin-2 Exportin-2 Homo sapiens
463033 ALFPHLLQPVLW 628 639 Exportin-2 Exportin-2 Homo sapiens
463034 ALFQRPPL 179 186 H/ACA ribonucleoprotein H/ACA ribonucleoprotein Homo sapiens complex subunit 4 complex subunit 4
463035 ALFTFSPLT 121 129 Round spermatid basic Round spermatid basic Homo sapiens protein 1 protein 1
463036 ALFTFSPLTV 169 118 Round spermatid basic Round spermatid basic Homo sapiens protein 1 protein 1
463038 ALGDGALFYFGL 474 485 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
463040 ALGETFIRYFV 475 485 Lengsin Lengsin Homo sapiens
463041 ALGIANPLL 1925 1933 Protein transport protein Protein transport protein Homo sapiens
Sec16A Sec16A
463042 ALGTVTNV 903 910 Activating signal cointegrator Activating signal cointegrator Homo sapiens
1 complex subunit 3 1 complex subunit 3
(UniProt:Q8N3C0)
463043 ALHDILTEI 191 199 Replication factor C subunit 5 Replication factor C subunit 5 Homo sapiens
463044 ALHHKDIAL 334 342 Inhibitor of Bruton tyrosine Inhibitor of Bruton tyrosine Homo sapiens kinase (UniProt:Q9P2D0) kinase
463045 ALIAAQYSGAQV 18 29 Elongation factor 1-gamma Elongation factor 1 -gamma Homo sapiens
(UniProt:P26641)
463046 AUEGVGIL 124 132 Mitochondrial import inner Mitochondrial import inner Homo sapiens membrane translocase membrane translocase
subunit Tim17-B subunit Tim17-B
(UniProt:O60830)
463048 AUEVLQPL 352 360 Tryptophan-tRNA ligase, Tryptophan-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
463049 AUEVLQPU 252 261 Tryptophan-tRNA ligase, Tryptophan-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
463050 AUEVLQPUA 352 362 Tryptophan-tRNA ligase, Tryptophan-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
463051 AUEVLQPU AE 252 263 Tryptophan-tRNA ligase, Tryptophan-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
463055 AUEVPDGFTAV 193 204 Aminopeptidase B Aminopeptidase B Homo sapiens
463056 ALIKAAGVNV 30 39 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P1 P1
463057 AUKQLFEA 365 313 Suppressor APC domain- Suppressor APC domain- Homo sapiens containing protein 2 containing protein 2
463058 AULHDDEVTV 13 23 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P1 P1
463059 ALKEEIGNVQL 303 313 Kinectin Kinectin Homo sapiens
463061 ALLADEUTV 85 94 Endophilin-B2 Endophilin-B2 Homo sapiens
(UniProt:B4DF96) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
463147 ALQEISFW 271 278 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
463148 ALQEISFWL 271 279 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
463149 ALQEVLKTA 17 25 Other Homo sapiens 40S ribosomal protein S12 Homo sapiens
(human) protein
463150 ALQEVLKTALI 17 27 Other Homo sapiens 40S ribosomal protein S12 Homo sapiens
(human) protein
463151 ALQFLEEVKV 85 94 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens zeta zeta
463152 ALQGAHAWILQV 485 496 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
463153 ALQGIIHSI 172 180 Anthrax toxin receptor 1 Anthrax toxin receptor 1 Homo sapiens
463154 ALQLQDFYQEV 435 445 Inter-alpha-trypsin inhibitor Inter-alpha-trypsin inhibitor Homo sapiens heavy chain H4 heavy chain H4
463155 ALQWVIPYI 76 84 Protein FAM127B Protein FAM127B Homo sapiens
463157 ALRESPLHPA 372 381 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
463159 ALSDETKNNWEV 804 815 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
463160 ALSDLEIT 349 356 Fermitin family homolog 2 Fermitin family homolog 2 Homo sapiens
463161 ALSEALTEL 164 172 Serine Serine Homo sapiens hydroxymethyltransferase, hydroxymethyltransferase,
cytosolic cytosolic
463162 ALSEFGSKIIL 37 47 Cytoskeleton-associated Cytoskeleton-associated Homo sapiens protein 5 protein 5
463163 ALSEGNPGI 212 220 Fermitin family homolog 2 Fermitin family homolog 2 Homo sapiens
463165 ALSGHLGEVLI 54 64 Small nuclear Small nuclear Homo sapiens ribonucleoprotein F ribonucleoprotein F
463166 ALSGLDMVGV 108 117 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX5 RNA helicase DDX5
(UniProt:P17844)
463167 ALSGTLSGV 651 659 DNA replication licensing DNA replication licensing Homo sapiens factor MCM5 factor MCM5
463168 ALSKQEMASA 181 190 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein A1 ribonucleoprotein A1
(UniProt:P09651)
463169 ALSNVIHKV 314 322 Serpin B5 Serpin B5 Homo sapiens
463170 ALSPNNHEV 24 32 Actin-related protein 2/3 Actin-related protein 2/3 Homo sapiens complex subunit 1A complex subunit 1A
463171 ALSRQEMQEV 135 144 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoproteins A2/B1 ribonucleoproteins A2/B1
463174 ALSTATATV 490 498 Epiplakin Epiplakin Homo sapiens
463175 ALTEIQEFI 3134 3142 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
463176 ALTELGYNV 118 126 Transmembrane protein 60 Transmembrane protein 60 Homo sapiens
463178 ALTGHLEEV 59 67 Annexin A1 Annexin A1 Homo sapiens
463179 ALTGIPLPLI 69 78 Cyclin-dependent kinase 2 Cyclin-dependent kinase 2 Homo sapiens
(UniProt:E7ESI2)
463180 ALTGRIQEA 183 191 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens mitochondrial mitochondrial
(UniProt:E9PDB2)
463181 ALTLATETV 462 470 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens delta delta
463182 ALTNVDTPL 344 352 Cell division cycle 5-like Cell division cycle 5-like Homo sapiens protein protein
463183 ALTQTGGPHV 1284 1293 Filamin-A Filamin-A Homo sapiens
463184 ALTSLELEL 141 149 Cbp/p300-interacting Cbp/p300-interacting Homo sapiens transactivator 4 transactivator 4
463186 ALVLGPLKSV 278 287 Nodal modulator 3 Nodal modulator 3 Homo sapiens
463187 ALVSKGLATV 428 437 Staphylococcal nuclease Staphylococcal nuclease Homo sapiens domain-containing protein 1 domain-containing protein 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
463241 AMNFHEVLA 502 510 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
463242 AMNGKSFSV 535 543 Probable cation-transporting Probable cation-transporting Homo sapiens
ATPase 13A3 ATPase 13A3
463243 AMNYEGSPIKV 64 74 Retinoic acid receptor alpha Retinoic acid receptor alpha Homo sapiens
(UniProt:A8MUP8)
463244 AMQEFMILPVGA 163 174 Alpha-enolase Alpha-enolase Homo sapiens
463246 AMRPSEEHV 127 135 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 13D containing protein 13D
463247 AMSPTAAAV 377 385 Nucleoprotein TPR Nucleoprotein TPR Homo sapiens
463248 AMSSKFFL 20 27 Protein Wnt-5a Protein Wnt-5a Homo sapiens
463249 AMSSKFFLV 20 28 Protein Wnt-5a Protein Wnt-5a Homo sapiens
463251 AMVEMADGYAV 390 400 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein L ribonucleoprotein L
463252 AMVWEGLNW 74 83 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase B kinase B
463253 AMWEVNEAFS 316 325 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
463254 AMWEVNEAFSL 316 326 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
463255 AMWEVNEAFSLV 316 327 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
463256 AMYESELERA 176 185 Kinesin-like protein KIFC3 Kinesin-like protein KIFC3 Homo sapiens
463258 AMYSVEITV 33 41 Paralemmin-1 Paralemmin-1 Homo sapiens
463649 AQANGWGVMV 300 309 Alpha-enolase Alpha-enolase Homo sapiens
463653 AQHLGESTV 100 108 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
463654 AQLSEIQTQI 398 407 Keratin, type I cytoskeletal 24 Keratin, type I cytoskeletal 24 Homo sapiens
463656 AQSELDIYL 416 424 Structural maintenance of Structural maintenance of Homo sapiens chromosomes protein 4 chromosomes protein 4
463657 AQVEAVHKV 36 44 Band 4.1 -like protein 5 Band 4.1 -like protein 5 Homo sapiens
463658 AQYSGAQVRV 21 30 Elongation factor 1-gamma Elongation factor 1 -gamma Homo sapiens
(UniProt:P26641)
463753 AVDAVIAEL 138 146 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
463761 AVFGEEGLTL 314 323 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
463762 AVFGEEGLTLNL 314 325 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
463763 AVFGKYGRIVEV 26 37 RNA-binding motif protein, X RNA-binding motif protein, X Homo sapiens chromosome chromosome
(UniProt:P38159)
463764 AVFPFQPGSV 76 85 Galectin-1 (UniProt:P09382) Galectin-1 Homo sapiens
463765 AVIGAVVDV 65 73 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
463767 AVLDNPYPV 338 346 Glutathione synthetase Glutathione synthetase Homo sapiens
(UniProt:P48637)
463769 AVLPFSPAL 26 34 Cell cycle checkpoint control Cell cycle checkpoint control Homo sapiens protein RAD9A protein RAD9A
463770 AVMGIVSEV 1039 1047 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
463774 AVSEEQQPAL 5 14 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 1 family F member 1
463777 AVWSGVNVAGV 199 209 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
463778 AVYEGHVSCV 75 84 Myotrophin Myotrophin Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
463779 AVYETDVFV 48 56 General transcription factor General transcription factor Homo sapiens
ll-l repeat domain-containing ll-l repeat domain-containing protein 2A protein 2A
463951 CLYGNVEKV 372 380 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein L ribonucleoprotein L
464060 DLATYINMI 110 118 Multidrug resistance- Multidrug resistance- Homo sapiens associated protein 1 associated protein 1
464208 EAFDLDPAQWGV 95 106 Serine Serine Homo sapiens hydroxymethyltransferase, hydroxymethyltransferase,
mitochondrial mitochondrial
(UniProt:P34897)
464272 ELLEGKVLPGV 400 410 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
464488 FAPEEISAMV 117 126 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
464489 FAPEEISAMVL 117 127 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
464491 FAPSPTPAV 428 436 AP-2 complex subunit beta AP-2 complex subunit beta Homo sapiens
464498 FAVQFHPEV 372 380 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
464533 FGAEAKLEV 53 61 Serine protease 23 Serine protease 23 Homo sapiens
(UniProt:O95084)
464535 FGANAILGV 46 54 Alpha-enolase Alpha-enolase Homo sapiens
464539 FGIGGDGTQHV 70 80 Platelet-activating factor Platelet-activating factor Homo sapiens acetylhydrolase IB subunit acetylhydrolase IB subunit
gamma gamma
464541 FGNEVIPVTV 199 208 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
464544 FGVTIDFDTV 614 623 Glycine-tRNA ligase Glycine-tRNA ligase Homo sapiens
464548 FIADLVVGL 81 89 Alpha-enolase Alpha-enolase Homo sapiens
464549 FIADVVEKI 15 23 Serine protease HTRA1 Serine protease HTRA1 Homo sapiens
464550 FIADVVEKT 149 157 Serine protease HTRA2, Serine protease HTRA2, Homo sapiens mitochondrial mitochondrial
464552 FIASVNTLV 110 118 Arfaptin-1 Arfaptin-1 Homo sapiens
464554 FIDEEVKU 89 97 Other Homo sapiens Ferritin light chain Homo sapiens
(human) protein
464555 FIDEGVNIGL 417 426 Serine Serine Homo sapiens hydroxymethyltransferase, hydroxymethyltransferase,
mitochondrial mitochondrial
(UniProt:P34897)
464556 FIDEGVNIGLEV 417 428 Serine Serine Homo sapiens hydroxymethyltransferase, hydroxymethyltransferase,
mitochondrial mitochondrial
(UniProt:P34897)
464557 FIDGDUESFL 957 967 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
464559 FIDKKPTSA 392 400 UniProt:E9PGM5 Homo sapiens
464560 FIDLNYMV 37 44 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
464562 FIDLNYMVYM 37 46 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
464567 FIDSNPNQPL 848 857 Alanine-tRNA ligase, Alanine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
464568 FIDSNPNQPLV 848 858 Alanine-tRNA ligase, Alanine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
464571 FIEALLPHV 23 31 Nuclear factor 1 X-type Nuclear factor 1 X-type Homo sapiens
464575 FIEKLVPLL 85 93 6-phosphogluconate 6-phosphogluconate Homo sapiens dehydrogenase, dehydrogenase,
decarboxylating decarboxylating
464579 FIFWAPESA 101 109 Cofilin-1 (UniProt:P23528) Cofilin-1 Homo sapiens
464580 FIFWAPESAPL 101 111 Cofilin-1 (UniProt:P23528) Cofilin-1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
464581 FIGEGEPHV 50 58 DnaJ homolog subfamily B DnaJ homolog subfamily B Homo sapiens member 1 1 member 11
464582 FIGKVVNPT 399 407 Alpha- 1 -antitrypsin Alpha-1-antitrypsin Homo sapiens
464583 FIGNGVVIHL 73 82 Adenylosuccinate synthetase Adenylosuccinate synthetase Homo sapiens isozyme 2 isozyme 2
464584 FIGNLPHEV 343 351 Ras GTPase-activating Ras GTPase-activating Homo sapiens protein-binding protein 1 protein-binding protein 1
464586 FIGYPITL 335 342 Other Homo sapiens Heat shock protein HSP 90- Homo sapiens
(human) protein alpha
464587 FIHDIDREL 297 305 Pigment epithelium-derived Pigment epithelium-derived Homo sapiens factor factor
464591 FILEEAITGDFA 109 120 Succinyl-CoA:3-ketoacid Succinyl-CoA:3-ketoacid Homo sapiens coenzyme A transferase 1 , coenzyme A transferase 1 ,
mitochondrial mitochondrial
464592 FILKHTGPGI 155 164 Peptidyl-prolyl cis-trans Peptidyl-prolyl cis-trans Homo sapiens isomerase (UniProt:F8WE65) isomerase
464593 FILKHTGPGL 88 97 Peptidyl-prolyl cis-trans Peptidyl-prolyl cis-trans Homo sapiens isomerase E isomerase E
464596 FIMEELDKV 80 88 Pannexin-1 Pannexin-1 Homo sapiens
464597 FIMEGGAMV 427 435 DNA replication licensing DNA replication licensing Homo sapiens factor MCM5 factor MCM5
464598 FIMEGGAMVL 427 436 DNA replication licensing DNA replication licensing Homo sapiens factor MCM5 factor MCM5
464599 FIMEGGAMVLA 427 437 DNA replication licensing DNA replication licensing Homo sapiens factor MCM5 factor MCM5
464601 FININSLRL 372 380 Argininosuccinate synthase Argininosuccinate synthase Homo sapiens
(UniProt:P00966)
464603 FIQSIISTV 39 47 Phosphoglucomutase-1 Phosphoglucomutase-1 Homo sapiens
464604 FIREUSNA 82 90 Heat shock protein 75 kDa, Heat shock protein 75 kDa, Homo sapiens mitochondrial mitochondrial
464605 FISGDKVNV 213 221 Eukaryotic peptide chain Eukaryotic peptide chain Homo sapiens release factor subunit 1 release factor subunit 1
464606 FISVQSPPTV 272 281 Activating transcription factor Activating transcription factor Homo sapiens
7-interacting protein 1 7-interacting protein 1
464607 FIVNTNVPRA 3 12 Macrophage migration Macrophage migration Homo sapiens inhibitory factor inhibitory factor
464608 FIVSEDGUVT 51 61 Serine protease HTRA1 Serine protease HTRA1 Homo sapiens
464609 FIWPAIQSSAL 72 82 Argininosuccinate synthase Argininosuccinate synthase Homo sapiens
(UniProt:P00966)
464610 FIYPAQNPEL 154 163 NAD(P) transhydrogenase, NAD(P) transhydrogenase, Homo sapiens mitochondrial mitochondrial
464612 FLAALPPAI 3021 3029 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
464613 FLADGKVFT 228 236 UniProt:E7EW44 Homo sapiens
464614 FLADGKVFTT 228 237 UniProt:E7EW44 Homo sapiens
464615 FLADGKVFTTG 228 238 UniProt:E7EW44 Homo sapiens
464616 FLADGKVFTTGF 255 266 Coronin (UniProt:F5H390) Coronin Homo sapiens
464619 FLADLLVPT 382 390 LanC-like protein 1 LanC-like protein 1 Homo sapiens
464620 FLADLLVPTKA 382 392 LanC-like protein 1 LanC-like protein 1 Homo sapiens
464621 FLADLMDNSEL 83 93 116 kDa U5 small nuclear 116 kDa U5 small nuclear Homo sapiens ribonucleoprotein component ribonucleoprotein component
464622 FLADPSAF 268 275 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0 (UniProt:P05388) P0
464623 FLADPSAFV 268 276 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0 (UniProt:P05388) P0
464624 FLADPSAFVAAA 268 279 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0 (UniProt:P05388) P0
464627 FLAEAELLNL 89 98 Transketolase Transketolase Homo sapiens
464628 FLAEDGGTGGGS 20 31 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4B initiation factor 4B
(UniProt:P23588)
464632 FLAEEMSKL 72 80 Kinesin-like protein KIF13A Kinesin-like protein KIF13A Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
464633 FLAEGIVNGHTL 102 113 Elongation protein 4 homolog Elongation protein 4 homolog Homo sapiens
(S. cerevisiae), isoform (S. cerevisiae), isoform
CRA_b CRA_b
464636 FLAEGTAIKDL 65 75 UDP-glucose 6- UDP-glucose 6- Homo sapiens dehydrogenase dehydrogenase
464637 FLAEGTAIKDLK 162 173 UDP-glucose 6- UDP-glucose 6- Homo sapiens dehydrogenase dehydrogenase
464638 FLAENVKQV 12 20 Proton-coupled amino acid Proton -coupled amino acid Homo sapiens transporter 4 transporter 4
(UniProt:E9PID7)
464639 FLAFPSPEKL 473 482 Ran GTPase-activating Ran GTPase-activating Homo sapiens protein 1 protein 1
464640 FLAFTTHPSQFL 81 92 Exportin-5 Exportin-5 Homo sapiens
464641 FLAFVEKV 293 300 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
3B 3B
464643 FLAIDAKLT 67 75 Protein phosphatase 1 G Protein phosphatase 1 G Homo sapiens
464644 FLANEAKGTKV 42 52 6-phosphogluconate 6-phosphogluconate Homo sapiens dehydrogenase, dehydrogenase,
decarboxylating decarboxylating
464645 FLANIGTSVQNV 225 236 DCC-interacting protein 13- DCC-interacting protein 13- Homo sapiens alpha alpha
464646 FLAPELPAV 192 200 Trifunctional enzyme subunit Trifunctional enzyme subunit Homo sapiens beta, mitochondrial beta, mitochondrial
(UniProt:P55084)
464647 FLAPELPAVS 192 201 Trifunctional enzyme subunit Trifunctional enzyme subunit Homo sapiens beta, mitochondrial beta, mitochondrial
(UniProt:P55084)
464648 FLAPELPAVSE 207 217 Trifunctional enzyme subunit Trifunctional enzyme subunit Homo sapiens beta, mitochondrial beta, mitochondrial
(UniProt:P55084)
464649 FLAPELPAVSEF 192 203 Trifunctional enzyme subunit Trifunctional enzyme subunit Homo sapiens beta, mitochondrial beta, mitochondrial
(UniProt:P55084)
464650 FLAPGFTL 78 85 A disintegrin and A disintegrin and Homo sapiens metalloproteinase with metalloproteinase with
thrombospondin motifs 1 thrombospondin motifs 1
464651 FLAPGFTLQNV 78 88 A disintegrin and A disintegrin and Homo sapiens metalloproteinase with metalloproteinase with
thrombospondin motifs 1 thrombospondin motifs 1
464652 FLAPGFTLQNVG 78 89 A disintegrin and A disintegrin and Homo sapiens metalloproteinase with metalloproteinase with
thrombospondin motifs 1 thrombospondin motifs 1
464654 FLAPKPAPVL 239 248 AP-3 complex subunit beta-2 AP-3 complex subunit beta-2 Homo sapiens
464655 FLAPLKPVAI 30 39 Probable RNA-binding Probable RNA-binding Homo sapiens protein 19 protein 19
464657 FLAQAEVYKEL 984 994 Fatty acid synthase Fatty acid synthase Homo sapiens
464658 FLAQGTLRPDL 363 373 GMP synthase [glutamine- GMP synthase [glutamine- Homo sapiens hydrolyzing] hydrolyzing]
464659 FLAQKPAPL 549 557 AP-3 complex subunit beta-1 AP-3 complex subunit beta-1 Homo sapiens
464660 FLAQKPAPLL 598 607 AP-3 complex subunit beta-1 AP-3 complex subunit beta-1 Homo sapiens
464661 FLAQRISSI 131 139 UDP-glucose 6- UDP-glucose 6- Homo sapiens dehydrogenase dehydrogenase
464663 FLASLDGEKL 319 328 Protein NOXP20 Protein NOXP20 Homo sapiens
464664 FLASLNPKT 259 267 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIP12 TRIP12
464665 FLASPEYVNL 174 183 Glutathione S-transferase P Glutathione S-transferase P Homo sapiens
(UniProt:P0921 1)
464666 FLASVSTV 128 135 Hemoglobin subunit alpha Hemoglobin subunit alpha Homo sapiens
464667 FLASVSTVL 128 136 Hemoglobin subunit alpha Hemoglobin subunit alpha Homo sapiens
464668 FLASVSTVLT 128 137 Hemoglobin subunit alpha Hemoglobin subunit alpha Homo sapiens
464670 FLATEGDHL 262 270 Palmitoyl-protein Palmitoyl-protein Homo sapiens thioesterase 1 thioesterase 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
464671 FLATEGDHLQL 262 272 Palmitoyl-protein Palmitoyl-protein Homo sapiens thioesterase 1 thioesterase 1
464672 FLATKFSTV 191 199 Probable 2-oxoglutarate Probable 2-oxoglutarate Homo sapiens dehydrogenase E1 dehydrogenase E1
component DHKTD1 , component DHKTD1 ,
mitochondrial mitochondrial
464673 FLAVKPHII 21 29 Pyrroline-5-carboxylate Pyrrol i n e-5-carboxyl ate Homo sapiens reductase 1 , mitochondrial reductase 1 , mitochondrial
464676 FLDATLTSV 475 483 Membrane-bound Membrane-bound Homo sapiens transcription factor site-2 transcription factor site-2
protease protease
464677 FLDAYAEHKL 133 142 Glucosylceramidase Glucosylceramidase Homo sapiens
(UniProt:P04062)
464679 FLDDFIACVP 2201 2210 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
MYCBP2 MYCBP2
464681 FLDDGNQMLL 42 51 Cytoplasmic dynein 2 heavy Cytoplasmic dynein 2 heavy Homo sapiens chain 1 chain 1
464682 FLDDLGNAKSHL 124 135 BAG family molecular BAG family molecular Homo sapiens chaperone regulator 2 chaperone regulator 2
464684 FLDDLSQKL 318 326 Neurolysin, mitochondrial Neurolysin, mitochondrial Homo sapiens
464685 FLDDNQIITS 151 160 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein G(I)/G(S)/G(T) protein G(I)/G(S)/G(T)
subunit beta-2 subunit beta-2
464686 FLDDNQIVTS 51 60 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein G(I)/G(S)/G(T) protein G(I)/G(S)/G(T)
subunit beta-1 subunit beta-1
464687 FLDDSTLRFV 54 63 U4/U6 small nuclear U4/U6 small nuclear Homo sapiens ribonucleoprotein Prp3 ribonucleoprotein Prp3
464688 FLDEAAARL 239 247 6-phosphogluconolactonase 6-phosphogluconolactonase Homo sapiens
464689 FLDEAAARLL 239 248 6-phosphogluconolactonase 6-phosphogluconolactonase Homo sapiens
464690 FLDEAAARLLT 239 249 6-phosphogluconolactonase 6-phosphogluconolactonase Homo sapiens
464691 FLDEAAARLLTV 239 250 6-phosphogluconolactonase 6-phosphogluconolactonase Homo sapiens
464693 FLDEDLKVA 180 188 Roquin-1 Roquin-1 Homo sapiens
464694 FLDEHHSVNF 1756 1765 Telomere-associated protein Telomere-associated protein Homo sapiens
RIF1 RIF1
464695 FLDELAQKL 196 204 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens
464696 FLDELEDEA 84 92 Cytochrome c oxidase Cytochrome c oxidase Homo sapiens assembly factor 3 homolog, assembly factor 3 homolog,
mitochondrial mitochondrial
464697 FLDELEDEAKA 84 94 Cytochrome c oxidase Cytochrome c oxidase Homo sapiens assembly factor 3 homolog, assembly factor 3 homolog,
mitochondrial mitochondrial
464698 FLDELGFLE 257 265 Lysine-tRNA ligase Lysine-tRNA ligase Homo sapiens
464699 FLDELGFLEI 189 198 Lysine-tRNA ligase Lysine-tRNA ligase Homo sapiens
464700 FLDELGFLEIE 257 267 Lysine-tRNA ligase Lysine-tRNA ligase Homo sapiens
464701 FLDELGFLEIET 257 268 Lysine-tRNA ligase Lysine-tRNA ligase Homo sapiens
464702 FLDENVHFFHT 509 519 Dipeptidyl peptidase 9 Dipeptidyl peptidase 9 Homo sapiens
464703 FLDEQELEA 260 268 Nucleobindin-2 Nucleobindin-2 Homo sapiens
464704 FLDEQELEAL 260 269 Nucleobindin-2 Nucleobindin-2 Homo sapiens
464705 FLDEQELEALF 260 270 Nucleobindin-2 Nucleobindin-2 Homo sapiens
464706 FLDEQELEALFT 260 271 Nucleobindin-2 Nucleobindin-2 Homo sapiens
464707 FLDEVLFIE 56 64 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein U-like ribonucleoprotein U-like
protein 1 protein 1
464708 FLDEVSRQQEL 135 145 Protein FAM192A Protein FAM192A Homo sapiens
(UniProt:H3BMX9)
464709 FLDFIGHIL 257 265 Phosphatidylinositol 5- Phosphatidylinositol 5- Homo sapiens phosphate 4-kinase type-2 phosphate 4-kinase type-2
alpha alpha
464710 FLDGNELTLAD 136 146 Chloride intracellular channel Chloride intracellular channel Homo sapiens protein 1 protein 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
46471 1 FLDGRIVFT 416 424 Pre-mRNA-splicing factor Pre-mRNA-splicing factor Homo sapiens
ATP-dependent RNA ATP-dependent RNA
helicase PRP16 helicase PRP16
464715 FLDISRPKMQEV 966 977 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
464716 FLDKALELNM 320 329 Phosphoserine Phosphoserine Homo sapiens aminotransferase aminotransferase
464717 FLDKALELNML 320 330 Phosphoserine Phosphoserine Homo sapiens aminotransferase aminotransferase
464718 FLDKMPEANQL 729 739 UM and calponin homology UM and calponin homology Homo sapiens domains-containing protein 1 domains-containing protein 1
(UniProt:Q9UPQ0)
464720 FLDKPEDVLL 496 505 Band 4.1 -like protein 1 Band 4.1 -like protein 1 Homo sapiens
464721 FLDKVLVAA 32 40 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 5B protein 5B
464723 FLDLGPWA 456 463 Regulatory-associated Regulatory-associated Homo sapiens protein of mTOR protein of mTOR
(UniProt:Q8N122)
464724 FLDLGPWAV 456 464 Regulatory-associated Regulatory-associated Homo sapiens protein of mTOR protein of mTOR
(UniProt:Q8N122)
464725 FLDLWNKFL 192 200 DCN1-like protein 1 DCNUike protein 1 Homo sapiens
464727 FLDPDRHFL 50 58 Protein FAM83H Protein FAM83H Homo sapiens
464728 FLDPKVAQRVL 838 848 RRP12-like protein RRP12-like protein Homo sapiens
464729 FLDPLAGAVTKT 133 144 WAS protein family homolog WAS protein family homolog Homo sapiens
2 2
464730 FLDPNARPL 150 158 CAD protein CAD protein Homo sapiens
464731 FLDPNARPLV 150 159 CAD protein CAD protein Homo sapiens
464732 FLDPNARPLVPE 150 161 CAD protein CAD protein Homo sapiens
464736 FLDPNTLERL 175 184 Epiplakin Epiplakin Homo sapiens
464741 FLDTISDFHLL 339 349 cDNA FLJ57969, highly cDNA FLJ57969, highly Homo sapiens similar to Nuclear protein similar to Nuclear protein
localization protein 4 localization protein 4
homolog homolog
464744 FLDVLFPLVVD 1028 1038 UDP-glucose:glycoprotein UDP-glucose:glycoprotein Homo sapiens glucosyltransferase 1 glucosyltransferase 1
464745 FLDVRNIIL 803 811 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 2 ATPase regulatory subunit 2
464752 FLDYGENLV 645 653 Separin Separin Homo sapiens
464753 FLEANVPHA 219 227 Mannose-6-phosphate Mannose-6-phosphate Homo sapiens isomerase (UniProt:P34949) isomerase
464754 FLEDDDKLEQI 225 235 Tryptophan-tRNA ligase, Tryptophan-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
464755 FLEDDDVAAV 275 284 Glutamine-fructose-6- Glutamine-fructose-6- Homo sapiens phosphate aminotransferase phosphate aminotransferase
[isomerizing] 1 [isomerizing] 1
464756 FLEEDFIPFA 198 207 Mitochondrial-processing Mitochondrial-processing Homo sapiens peptidase subunit alpha peptidase subunit alpha
(UniProt:Q10713)
464757 FLEEEVYPL 435 443 Adenylosuccinate lyase Adenylosuccinate lyase Homo sapiens
464759 FLEEFITPI 509 517 DNA topoisomerase 2-beta DNA topoisomerase 2-beta Homo sapiens
464760 FLEEFITPIVKA 509 520 DNA topoisomerase 2-beta DNA topoisomerase 2-beta Homo sapiens
464761 FLEEFITPIVKV 139 150 DNA topoisomerase 2-alpha DNA topoisomerase 2-alpha Homo sapiens
464763 FLEEKIPSISDL 268 279 Elongation factor G, Elongation factor G, Homo sapiens mitochondrial mitochondrial
464765 FLEENSFSV 115 123 Histone lysine demethylase Histone lysine demethylase Homo sapiens
PHF8 (UniProt:Q9UPP1 ) PHF8
464766 FLEEREIAL 744 752 Exportin-1 (UniProt:O14980) Exportin-1 Homo sapiens
464767 FLEEVKVSREM 88 98 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens zeta zeta
464769 FLEFAEDVIQV 11 21 Fragile X mental retardation Fragile X mental retardation Homo sapiens protein 1 protein 1
464772 FLEPDSWET 327 335 Nucleobindin-2 Nucleobindin-2 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
464775 FLEQQMHPT 11 1 119 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens gamma (UniProt:P49368) gamma
464776 FLEQQNKILLA 11 21 Vimentin Vimentin Homo sapiens
464777 FLEQQNKLL 87 95 Keratin, type II cytoskeletal 7 Keratin, type II cytoskeletal 7 Homo sapiens
464780 FLETESTFM 174 182 Inter-alpha-trypsin inhibitor Inter-alpha-trypsin inhibitor Homo sapiens heavy chain H4 heavy chain H4
464781 FLETVELQI 28 36 60S ribosomal protein L10a 60S ribosomal protein L10a Homo sapiens
464782 FLETVELQISL 28 38 60S ribosomal protein L10a 60S ribosomal protein L10a Homo sapiens
464783 FLFDEEME 70 77 La-related protein 1 La-related protein 1 Homo sapiens
464784 FLFDEEMEQ 70 78 La-related protein 1 La-related protein 1 Homo sapiens
464785 FLFDEEMEQMD 70 80 La-related protein 1 La-related protein 1 Homo sapiens
464786 FLFDEEMEQMDG 70 81 La-related protein 1 La-related protein 1 Homo sapiens
464787 FLFDGSPTYVLA 2333 2344 Fatty acid synthase Fatty acid synthase Homo sapiens
464788 FLFDIPKILDL 154 164 Activating signal cointegrator Activating signal cointegrator Homo sapiens
1 complex subunit 2 1 complex subunit 2
464789 FLFDKPVS 192 199 Creatine kinase B-type Creatine kinase B-type Homo sapiens
464790 FLFDKPVSPL 192 201 Creatine kinase M-type Creatine kinase M-type Homo sapiens
464791 FLFDKPVSPLL 192 202 Creatine kinase B-type Creatine kinase B-type Homo sapiens
464792 FLFDKPVSPLLL 192 203 Creatine kinase B-type Creatine kinase B-type Homo sapiens
464796 FLFDMATGKL 209 218 WD repeat-containing protein WD repeat-containing protein Homo sapiens
13 13
464797 FLFDMATGKLT 209 219 WD repeat-containing protein WD repeat-containing protein Homo sapiens
13 13
464801 FLFDTKPLI 139 147 Calnexin Calnexin Homo sapiens
464802 FLFDTKPLIVQY 139 150 Calnexin Calnexin Homo sapiens
464804 FLFDVVSKI 110 118 Ras-related GTP-binding Ras-related GTP-binding Homo sapiens protein D protein D
464806 FLFENQTPA 430 438 U2 snRNP-associated SURP U2 snRNP-associated SURP Homo sapiens motif-containing protein motif-containing protein
464807 FLFENQTPAHV 430 440 U2 snRNP-associated SURP U2 snRNP-associated SURP Homo sapiens motif-containing protein motif-containing protein
464808 FLFEPVVKAFL 581 591 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 3A subunit 3A
464809 FLFGGVLMT 27 35 Derlin-2 (UniProt:l3L1 S8) Derlin-2 Homo sapiens
464810 FLFGSPLGL 322 330 Membrane-associated Membrane-associated Homo sapiens phosphatidylinositol transfer phosphatidylinositol transfer protein 1 protein 1
46481 1 FLFNTENKLL 65 74 Isopentenyl-diphosphate Isopentenyl-diphosphate Homo sapiens
Delta-isomerase 1 Delta-isomerase 1
464812 FLFPELRIIST 32 42 Calsyntenin-1 Calsyntenin-1 Homo sapiens
464813 FLFPGTENQEL 645 655 Nestin Nestin Homo sapiens
464814 FLFRDGDIL 89 97 10 kDa heat shock protein, 10 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
464816 FLFSSDHUEM 1005 1015 Unconventional myosin-lb Unconventional myosin-lb Homo sapiens
(UniProt:043795)
464817 FLFVDADQIVRT 1330 1341 UDP-glucose:glycoprotein UDP-glucose:glycoprotein Homo sapiens glucosyltransferase 1 glucosyltransferase 1
464818 FLGADVTHPPA 360 370 Protein argonaute-3 Protein argonaute-3 Homo sapiens
464819 FLGAVEEA 353 360 Alpha-aminoadipic Alpha-aminoadipic Homo sapiens semialdehyde semialdehyde
dehydrogenase dehydrogenase
(UniProt:P49419)
464821 FLGDDVFLREL 525 535 Glycogen phosphorylase, Glycogen phosphorylase, Homo sapiens liver form liver form
464822 FLGDEETVRKA 107 117 Phosphoglycerate mutase 1 Phosphoglycerate mutase 1 Homo sapiens
464823 FLGDGLGVPT 58 67 Intestinal-type alkaline Intestinal-type alkaline Homo sapiens phosphatase phosphatase
464824 FLGDGLGVPTV 58 68 Intestinal-type alkaline Intestinal-type alkaline Homo sapiens phosphatase phosphatase
464825 FLGDGMGV 57 64 Alkaline phosphatase, tissue- Alkaline phosphatase, tissue- Homo sapiens nonspecific isozyme nonspecific isozyme Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
464826 FLGDGMGVST 57 66 Alkaline phosphatase, tissue- Alkaline phosphatase, tissue- Homo sapiens nonspecific isozyme nonspecific isozyme
464827 FLGDGMGVSTV 57 67 Alkaline phosphatase, tissue- Alkaline phosphatase, tissue- Homo sapiens nonspecific isozyme nonspecific isozyme
464830 FLGDTDVFGAA 412 422 WASH complex subunit WASH complex subunit Homo sapiens
FAM21 C FAM21 C
464831 FLGDTDVFGAAS 412 423 WASH complex subunit WASH complex subunit Homo sapiens
FAM21 C FAM21 C
464833 FLGEIEELRL 41 50 Splicing regulatory Splicing regulatory Homo sapiens glutamine/lysine-rich protein glutamine/lysine-rich protein
1 (UniProt:E5RFV3) 1
464834 FLGEMPAEPMTI 114 125 NAD(P)H-hydrate epimerase NAD(P)H-hydrate epimerase Homo sapiens
(UniProt:Q8NCW5)
464835 FLGFFMVPA 2267 2275 Pre-mRNA-processing- Pre-m RNA-processi ng- Homo sapiens splicing factor 8 splicing factor 8
464836 FLGGDMEHT 152 160 Protein Red Protein Red Homo sapiens
464837 FLGGDMEHTHLV 152 163 Protein Red Protein Red Homo sapiens
464838 FLGGEDFDQAL 272 282 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
464839 FLGGEDFDQALL 272 283 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
464840 FLGKVVNPT 369 377 Thyroxine-binding globulin Thyroxine-binding globulin Homo sapiens
464841 FLGPEDLRV 415 423 Hypoxia up-regulated protein Hypoxia up-regulated protein Homo sapiens
1 1
464842 FLGPEPKSV 139 147 Lysosomal alpha- Lysosomal alpha- Homo sapiens glucosidase glucosidase
464843 FLGPIIKA 92 99 Ceruloplasmin Ceruloplasmin Homo sapiens
(UniProt:P00450)
464844 FLGPPPPPLLL 16 26 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:E9PLK3)
464845 FLGPPPPPLLLL 16 27 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:P55786)
464847 FLGQKLQVV 192 200 Core histone macro-H2A1 Core histone macro-H2A.1 Homo sapiens
464848 FLGSLSLLPA 23 32 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
464849 FLGTTPTL 499 506 Splicing factor 3B subunit 3 Splicing factor 3B subunit 3 Homo sapiens
464850 FLGVAEQL 1374 1381 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
464851 FLHEATARL 1036 1044 Sterol regulatory element- Sterol regulatory element- Homo sapiens binding protein 1 binding protein 1
464852 FLHELNVPFF 121 130 Sialic acid synthase Sialic acid synthase Homo sapiens
464853 FLHELNVPFFKV 121 132 Sialic acid synthase Sialic acid synthase Homo sapiens
464854 FLHNNRITHL 164 173 Peroxidasin homolog Peroxidasin homolog Homo sapiens
464855 FLHPEEFEHM 194 203 Reticulocalbin-1 Reticulocalbin-1 Homo sapiens
464856 FLHPEEFPHM 191 200 Reticulocalbin-3 Reticulocalbin-3 Homo sapiens
464857 FUAEYFEHV 86 95 S-methylmethionine- S-methylmethionine- Homo sapiens homocysteine S- homocysteine S- methyltransferase BHMT2 methyltransferase BHMT2
464858 FUAQLPKLQ 1046 1055 WASH complex subunit WASH complex subunit Homo sapiens strumpellin strumpellin
464860 FUEPFVPH 105 113 ATP-citrate synthase ATP-citrate synthase Homo sapiens
464861 FUEPFVPHS 105 114 ATP-citrate synthase ATP-citrate synthase Homo sapiens
464862 FUEPFVPHSQ 105 115 ATP-citrate synthase ATP-citrate synthase Homo sapiens
464863 FUEPFVPHSQA 105 116 ATP-citrate synthase ATP-citrate synthase Homo sapiens
464865 FUGDEAATHL 119 129 Mannose-6-phosphate Mannose-6-phosphate Homo sapiens isomerase (UniProt:P34949) isomerase
464866 FUPVLNGL 905 913 Symplekin Symplekin Homo sapiens
464867 FUPVQTQHPI 378 388 Glucose-6-phosphate Glucose-6-phosphate Homo sapiens isomerase (UniProt:P06744) isomerase
(UniProt:O95084) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
464908 FLLNYPFSTS 112 121 Serine protease 23 Serine protease 23 Homo sapiens
(UniProt:O95084)
464909 FLLNYPFSTSV 144 154 Serine protease 23 Serine protease 23 Homo sapiens
(UniProt:O95084)
46491 1 FLLPHPGLQVA 245 255 Atlastin-3 Atlastin-3 Homo sapiens
464912 FLLPILSQIYSD 234 245 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX3X helicase DDX3X
464913 FLLPKFHGV 2289 2297 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
464916 FLLPPPLPSL 192 201 Protein SERAC1 Protein SERAC1 Homo sapiens
464917 FLLSKGLQV 573 581 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens
464919 FLLTTTPRPV 436 445 Splicing factor, proline- and Splicing factor, proline- and Homo sapiens glutamine-rich glutamine-rich
464920 FLLVGTQIDL 110 119 Cell division control protein Cell division control protein Homo sapiens
42 homolog 42 homolog
464921 FLMANGQLVKM 80 90 Rab GDP dissociation Rab GDP dissociation Homo sapiens inhibitor alpha inhibitor alpha
464922 FLMDAIQTNF 1817 1826 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
464925 FLMECRNSPVT 58 68 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4E-binding initiation factor 4E-binding
protein 1 protein 1
464928 FLMKKELNY 187 195 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
464929 FLMKKELNYF 187 196 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
464930 FLMKKELNYFA 187 197 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
464931 FLMKLSHET 6 14 Small nuclear Small nuclear Homo sapiens ribonucleoprotein Sm D1 ribonucleoprotein Sm D1
464932 FLMKLSHETV 6 15 Small nuclear Small nuclear Homo sapiens ribonucleoprotein Sm D1 ribonucleoprotein Sm D1
464933 FLMPFPVNYV 263 272 Presequence protease, Presequence protease, Homo sapiens mitochondrial mitochondrial
464934 FLMSDKPLHL 190 199 Beta-arrestin-1 Beta-arrestin-1 Homo sapiens
464935 FLMSLVNQV 307 315 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit F initiation factor 3 subunit F
(UniProt:O00303)
464936 FLMTGYTPL 281 289 Tubulin gamma-1 chain Tubulin gamma-1 chain Homo sapiens
464939 FLNDTTKPVGL 168 178 cDNA FLJ54246, highly cDNA FLJ54246, highly Homo sapiens similar to Homo sapiens similar to Homo sapiens
BRCA2 and CDKN1A BRCA2 and CDKN1A
interacting protein (BCCIP), interacting protein (BCCIP),
transcript variant C, mRNA transcript variant C, mRNA
464940 FLNEDLEVKI 146 155 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase PLK1 kinase PLK1
464941 FLNEHPGGEEV 40 50 Cytochrome b5 type B Cytochrome b5 type B Homo sapiens
464942 FLNEHPGGEEVL 40 51 Cytochrome b5 type B Cytochrome b5 type B Homo sapiens
464944 FLNELIKVV 89 97 ADP-ribosylation factor- ADP-ribosylation factor- Homo sapiens binding protein GGA3 binding protein GGA3
464945 FLNENLPESI 522 531 Splicing factor 3B subunit 3 Splicing factor 3B subunit 3 Homo sapiens
464947 FLNEVLVKL 1408 1416 lntersectin-2 lntersectin-2 Homo sapiens
464948 FLNGGILNYMI 801 811 Cytoplasmic aconitate Cytoplasmic aconitate Homo sapiens hydra tase hydratase
464949 FLNGKSIGL 2276 2284 Laminin subunit alpha-1 Laminin subunit alpha-1 Homo sapiens
464950 FLNGKSVGV 710 718 CDK5 regulatory subunit- CDK5 regulatory subunit- Homo sapiens associated protein 2 associated protein 2
464951 FLNGLTGKPV 10 19 Small nuclear Small nuclear Homo sapiens ribonucleoprotein F ribonucleoprotein F
464952 FLNGLTGKPVMV 10 21 Small nuclear Small nuclear Homo sapiens ribonucleoprotein F ribonucleoprotein F
464954 FLNKQAPQTI 660 669 Cytoplasmic aconitate Cytoplasmic aconitate Homo sapiens hydra tase hydratase Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
464955 FLNPNDPYHA 83 92 Splicing factor 3A subunit 1 Splicing factor 3A subunit 1 Homo sapiens
(UniProt:E9PAW1)
464956 FLNQFVVHTV 29 38 WASH complex subunit WASH complex subunit Homo sapiens
CCDC53 CCDC53
464958 FLNYFDKIL 488 496 Protein ecdysoneless Protein ecdysoneless Homo sapiens homolog homolog
464959 FLPEAFDF 83 90 Nitrilase homolog 1 Nitrilase homolog 1 Homo sapiens
464960 FLPEAFDFI 83 91 Nitrilase homolog 1 Nitrilase homolog 1 Homo sapiens
464961 FLPEAPAELL 238 247 DNA replication licensing DNA replication licensing Homo sapiens factor MCM2 factor MCM2
(UniProt:P49736)
464964 FLPEEYPMA 55 63 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 N enzyme E2 N
464965 FLPEGSKLVPV 74 84 Nicotinate-nucleotide Nicotinate-nucleotide Homo sapiens pyrophosphorylase pyrophosphorylase
[carboxylating] [carboxylating]
(UniProt:Q15274)
464966 FLPEGSKLVPVA 74 85 Nicotinate-nucleotide Nicotinate-nucleotide Homo sapiens pyrophosphorylase pyrophosphorylase
[carboxylating] [carboxylating]
(UniProt:Q15274)
464968 FLPEMLSKV 610 618 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 2 initiation factor 4 gamma 2
464969 FLPFPFEQL 98 106 mRNA-decapping enzyme mRNA-decapping enzyme Homo sapiens
1A (UniProt:Q9NPI6) 1A
464970 FLPHFQHFA 11 19 Cystathionine gamma-lyase Cystathionine gamma-lyase Homo sapiens
464971 FLPITPHYV 452 460 CAD protein CAD protein Homo sapiens
464973 FLPITPQFV 484 492 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
464974 FLPKDVALA 2142 2150 Desmoplakin Desmoplakin Homo sapiens
464975 FLPLFDRVL 9 17 10 kDa heat shock protein, 10 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
464976 FLPLFDRVLV 9 18 10 kDa heat shock protein, 10 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
464977 FLPPAAPGGEV 33 43 UPF0469 protein KIAA0907 UPF0469 protein KIAA0907 Homo sapiens
464978 FLPPPPPPL 67 75 Lipoma-preferred partner Lipoma-preferred partner Homo sapiens
464979 FLPPPPPPLDDS 67 78 Lipoma-preferred partner Lipoma-preferred partner Homo sapiens
464981 FLPRQPPMSL 881 890 Protein flightless-1 homolog Protein flightless-1 homolog Homo sapiens
464982 FLPSFLSYI 419 427 Small subunit processome Small subunit processome Homo sapiens component 20 homolog component 20 homolog
464983 FLPSPSPPA 326 334 B-cell lymphoma 3 protein B-cell lymphoma 3 protein Homo sapiens
464986 FLQARTPTL 377 385 Nestin Nestin Homo sapiens
464987 FLQARTPTLA 377 386 Nestin Nestin Homo sapiens
464988 FLQDGEVQFL 72 81 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
464989 FLQDGTKTV 129 137 Integrin alpha-V Integrin alpha-V Homo sapiens
464991 FLQDTIEEMALK 83 94 LETM1 and EF-hand LETM1 and EF-hand Homo sapiens domain-containing protein 1 , domain-containing protein 1 , mitochondrial mitochondrial
464993 FLQEEAEKM 2402 2410 Plectin Plectin Homo sapiens
464994 FLQEETVSQQI 178 188 Olfactomedin-like protein 2B Olfactomedin-like protein 2B Homo sapiens
464995 FLQEFSQQT 46 54 WASH complex subunit WASH complex subunit Homo sapiens
FAM21 C FAM21 C
464997 FLQEHGSDSFLA 28 39 Peptidyl-prolyl cis-trans Peptidyl-prolyl cis-trans Homo sapiens isomerase FKBP3 isomerase FKBP3
464998 FLQEKGPSV 54 62 UTP--glucose-1 -phosphate UTP~glucose-1-phosphate Homo sapiens uridylyltransferase uridylyltransferase
464999 FLQEKSPAVAT 348 358 Ubiquitin-associated protein Ubiquitin-associated protein Homo sapiens
2-like (UniProt:Q14157) 2-like
465000 FLQELQLEHA 153 162 Calcium-binding Calcium-binding Homo sapiens mitochondrial carrier protein mitochondrial carrier protein
Aralarl (UniProt:075746) Aralarl Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465001 FLQENDQSL 86 94 Nucleolar complex protein 2 Nucleolar complex protein 2 Homo sapiens homolog homolog
465002 FLQENDQSLLNF 86 97 Nucleolar complex protein 2 Nucleolar complex protein 2 Homo sapiens homolog homolog
465003 FLQEQLVELK 1152 1161 Golgin subfamily A member Golgin subfamily A member Homo sapiens
4 (UniProt:Q13439) 4
465004 FLQEYVANLL 973 982 Exportin-1 (UniProt:O14980) Exportin-1 Homo sapiens
465005 FLQKAPVPST 150 159 Nuclear mitotic apparatus Nuclear mitotic apparatus Homo sapiens protein 1 protein 1
465006 FLQLDVKRV 182 190 Kelch-like protein 7 Kelch-like protein 7 Homo sapiens
465007 FLQLFEGDDHKV 183 194 Adenylosuccinate lyase Adenylosuccinate lyase Homo sapiens
465009 FLQPDLDSL 414 422 Myb-binding protein 1A Myb-binding protein 1A Homo sapiens
465010 FLQPGGYHV 166 174 Squalene monooxygenase Squalene monooxygenase Homo sapiens
46501 1 FLQPVGLGNVTL 146 157 Glioma tumor suppressor Glioma tumor suppressor Homo sapiens candidate region gene 1 candidate region gene 1
protein protein
465012 FLQPVHKIDMNL 231 242 Protein transport protein Protein transport protein Homo sapiens
Sec23B Sec23B
465013 FLQRFIDPL 169 177 DNA replication licensing DNA replication licensing Homo sapiens factor MCM4 factor MCM4
465014 FLQSVQVPEF 790 799 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 1 activating enzyme 1
(UniProt:P22314)
465015 FLQTVINKV 247 255 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 1 protein 1
465017 FLRASEEHL 155 163 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase kinase
465018 FLRDYTQINV 370 379 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX17 RNA helicase DDX17
465019 FLRELISNA 79 87 Endoplasmin Endoplasmin Homo sapiens
465020 FLRELISNSSDA 44 55 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens alpha alpha
465021 FLREPDSDTEL 516 526 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase SETD1 B methyltransferase SETD1 B
465023 FLSCPIPKLLL 309 319 Protein phosphatase Protein phosphatase Homo sapiens methylesterase 1 methylesterase 1
465024 FLSDAIPGLK 163 172 TBC1 domain family member TBC1 domain family member Homo sapiens
15 15
465025 FLSDFEMM 3 10 Protein IWS1 homolog Protein IWS1 homolog Homo sapiens
465026 FLSDFEMML 3 11 Protein IWS1 homolog Protein IWS1 homolog Homo sapiens
465027 FLSDPQVHTV 68 77 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
465028 FLSDPQVHTVLV 68 79 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
465029 FLSEEDADYA 61 70 Splicing factor 3B subunit 4 Splicing factor 3B subunit 4 Homo sapiens
465030 FLSEEDADYAI 61 71 Splicing factor 3B subunit 4 Splicing factor 3B subunit 4 Homo sapiens
465031 FLSEEDRGL 11 19 Sorting nexin-6 Sorting nexin-6 Homo sapiens
465032 FLSEEEKDLIL 9 19 Synaptotagmin-like protein 4 Synaptotagmin-like protein 4 Homo sapiens
465033 FLSEETEAS 430 438 C-Jun-amino-terminal C-Jun-amino-terminal Homo sapiens kinase-interacting protein 4 kinase-interacting protein 4
(UniProt:O60271)
465034 FLSEETEASL 430 439 C-Jun-amino-terminal C-Jun-amino-terminal Homo sapiens kinase-interacting protein 4 kinase-interacting protein 4
(UniProt:O60271)
465035 FLSEETEASLA 430 440 C-Jun-amino-terminal C-Jun-amino-terminal Homo sapiens kinase-interacting protein 4 kinase-interacting protein 4
(UniProt:O60271)
465036 FLSEETEASLAS 430 441 C-Jun-amino-terminal C-Jun-amino-terminal Homo sapiens kinase-interacting protein 4 kinase-interacting protein 4
(UniProt:O60271)
465037 FLSEKDSLL 2463 2471 Plectin Plectin Homo sapiens
465038 FLSELTQQ 18 25 Macrophage migration Macrophage migration Homo sapiens inhibitory factor inhibitory factor Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465039 FLSELTQQLAQ 19 29 Macrophage migration Macrophage migration Homo sapiens inhibitory factor inhibitory factor
465042 FLSFPTTKT 33 41 Hemoglobin subunit alpha Hemoglobin subunit alpha Homo sapiens
465043 FLSGFQW 155 162 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 1 activating enzyme 1
(UniProt:P22314)
465044 FLSGFQVW 155 163 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 1 activating enzyme 1
(UniProt:P22314)
465045 FLSGFQVWL 155 164 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 1 activating enzyme 1
(UniProt:P22314)
465047 FLSGVNIQ 307 314 Beta-enolase Beta-enolase Homo sapiens
465048 FLSGVNIQI 264 272 Beta-enolase Beta-enolase Homo sapiens
465049 FLSGVNIQIV 264 273 Beta-enolase Beta-enolase Homo sapiens
465050 FLSGVNIQIVG 264 274 Beta-enolase Beta-enolase Homo sapiens
465051 FLSGVNIQIVGD 264 275 Beta-enolase Beta-enolase Homo sapiens
465052 FLSHVVSQHQA 461 471 ATP synthase subunit alpha, ATP synthase subunit alpha, Homo sapiens mitochondrial mitochondrial
465053 FLSISSPKV 3407 3415 Neuroblast differentiation- Neuroblast differentiation- Homo sapiens associated protein AHNAK associated protein AHNAK
465054 FLSUNVGL 53 61 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
465055 FLSUNVGU 53 62 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
465056 FLSUNVGUS 53 63 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
465057 FLSUNVGUSV 53 64 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
465058 FLSPQQPPLLL 31 41 Cyclin-dependent kinase 13 Cyclin-dependent kinase 13 Homo sapiens
465059 FLSQGQVLKL 34 43 ATP synthase subunit O, ATP synthase subunit O, Homo sapiens mitochondrial mitochondrial
465061 FLSSLTETI 234 242 Other Homo sapiens Complement factor B Homo sapiens
(human) protein
465062 FLSTINVG 46 53 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member A (UniProt:H0YN26) member A
465063 FLSTINVGLT 46 55 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member A (UniProt:P39687) member A
465064 FLSTINVGLTS 46 56 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member A (UniProt:P39687) member A
465065 FLSTINVGLTSI 46 57 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member A (UniProt:P39687) member A
465069 FLSTSIAQLKV 28 38 Prefoldin subunit 5 Prefoldin subunit 5 Homo sapiens
465071 FLTDLFAQL 73 81 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 3A subunit 3A
465072 FLTDSNNIKEVL 557 568 Lysine-tRNA ligase Lysine-tRNA ligase Homo sapiens
465074 FLTDTAKQIKT 279 289 Tryptophan-tRNA ligase, Tryptophan-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
465077 FLTEFINY 212 219 DDRGK domain-containing DDRGK domain-containing Homo sapiens protein 1 protein 1
465078 FLTEFINYI 215 223 DDRGK domain-containing DDRGK domain-containing Homo sapiens protein 1 protein 1
465079 FLTEIEVLDV 361 370 Protein flightless-1 homolog Protein flightless-1 homolog Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465080 FLTELVIS 32 39 Enoyl-CoA delta isomerase Enoyl-CoA delta isomerase Homo sapiens
1 , mitochondrial 1 , mitochondrial
465081 FLTELVISL 38 46 Enoyl-CoA delta isomerase Homo sapiens
1 , mitochondrial
465082 FLTELVISLEKL 15 26 Enoyl-CoA delta isomerase Enoyl-CoA delta isomerase Homo sapiens
1 , mitochondrial 1 , mitochondrial
465084 FLTFDDLLNRL 95 105 Asparagine-tRNA ligase, Asparagine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
465086 FLVADKVIV 203 211 Endoplasmin Endoplasmin Homo sapiens
465087 FLVADKVIVT 203 212 Endoplasmin Endoplasmin Homo sapiens
465088 FLVADKVIVTS 182 192 Endoplasmin Endoplasmin Homo sapiens
465089 FLVDDSSSV 86 94 Sushi, von Willebrand factor Sushi, von Willebrand factor Homo sapiens type A, EGF and pentraxin type A, EGF and pentraxin
domain-containing protein 1 domain-containing protein 1
465090 FLVDFGKEPLG 484 494 Selenium-binding protein 1 Selenium-binding protein 1 Homo sapiens
465094 FLVDPVRNQRL 955 965 Plectin Plectin Homo sapiens
465096 FLVELSRVL 36 44 Importin subunit beta-1 Importin subunit beta-1 Homo sapiens
465097 FLVELSRVLA 36 45 Importin subunit beta-1 Importin subunit beta-1 Homo sapiens
465099 FLVGERVTL 136 144 Elongation factor 1-gamma Elongation factor 1 -gamma Homo sapiens
(UniProt:P26641)
465100 FLVHPIEGSTT 2243 2253 Fatty acid synthase Fatty acid synthase Homo sapiens
465101 FLVNPESGYNV 83 93 Actin-related protein 2/3 Actin-related protein 2/3 Homo sapiens complex subunit 2 complex subunit 2
465102 FLVSQURA 454 462 Dipeptidyl peptidase 9 Dipeptidyl peptidase 9 Homo sapiens
465103 FLVTEVENGGS 191 201 Pyruvate kinase PKM Pyruvate kinase PKM Homo sapiens
465104 FLVTEVENGGSL 191 202 Pyruvate kinase PKM Pyruvate kinase PKM Homo sapiens
465105 FLWDEGFHQLV 173 183 Mannosyl-oligosaccharide Mannosyl-oligosaccharide Homo sapiens glucosidase glucosidase
465106 FLWDEGFHQLVV 173 184 Mannosyl-oligosaccharide Mannosyl-oligosaccharide Homo sapiens glucosidase glucosidase
465107 FLWDLGSGSTRL 2178 2189 Laminin subunit alpha-1 Laminin subunit alpha-1 Homo sapiens
465108 FLWDPAKRTSV 175 185 Alpha-globin transcription Alpha-globin transcription Homo sapiens factor CP2 factor CP2
465109 FLWDVNTLTALT 33 44 WD repeat-containing protein WD repeat-containing protein Homo sapiens
48 48
465110 FLWDVPSNWT 1630 1639 Fatty acid synthase Fatty acid synthase Homo sapiens
46511 1 FLWDVPSNWTLE 1630 1641 Fatty acid synthase Fatty acid synthase Homo sapiens
465112 FLWEVGEAEA 646 655 Spectrin beta chain, non- Spectrin beta chain, non- Homo sapiens erythrocytic 2 erythrocytic 2
465113 FLWEYGDLHLF 58 68 Phospholipase D3 Phospholipase D3 Homo sapiens
465115 FLWPGFGENA 543 552 Phosphoenolpyruvate Phosphoenolpyruvate Homo sapiens carboxykinase [GTP], carboxykinase [GTP],
mitochondrial mitochondrial
465117 FLYDLVMTHA 29 38 Histone-binding protein Histone-binding protein Homo sapiens
RBBP4 RBBP4
465118 FLYDLVMTHAL 32 42 Histone-binding protein Histone-binding protein Homo sapiens
RBBP7 (UniProt:Q16576) RBBP7
465119 FLYDLVMTHALE 29 40 Histone-binding protein Histone-binding protein Homo sapiens
RBBP4 RBBP4
465121 FLYDLVMTHALQ 32 43 Histone-binding protein Histone-binding protein Homo sapiens
RBBP7 (UniProt:Q16576) RBBP7
465122 FLYEADVQV 37 45 Protein zwilch homolog Protein zwilch homolog Homo sapiens
465123 FLYGDHDGEVYA 632 643 Structural maintenance of Structural maintenance of Homo sapiens chromosomes flexible hinge chromosomes flexible hinge
domain-containing protein 1 domain-containing protein 1
465126 FLYPLVGTMST 899 909 C-1 -tetrahydrofolate C-1-tetrahydrofolate Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
(UniProt:P11586)
465128 FLYSDREIEVM 89 99 Copper homeostasis protein Copper homeostasis protein Homo sapiens cutC homolog cutC homolog
465130 FMANIPLL 171 178 Prosaposin (UniProt:P07602) Prosaposin Homo sapiens
465131 FMANIPLLL 171 179 Prosaposin (UniProt:P07602) Prosaposin Homo sapiens
465132 FMANIPLLLYP 171 181 Prosaposin (UniProt:P07602) Prosaposin Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
465133 FMANIPLLLYPQ 171 182 Prosaposin (UniProt:P07602) Prosaposin Homo sapiens
465135 FMATNDLMTEL 24 34 Cullin-associated NEDD8- Cullin-associated NEDD8- Homo sapiens dissociated protein 1 dissociated protein 1
465136 FMATVTKA 24 31 Adenosylhomocysteinase 2 Adenosylhomocysteinase 2 Homo sapiens
465137 FMDDFFHQV 28 36 Syntaxin-2 Syntaxin-2 Homo sapiens
465138 FMDKLGENL 397 405 Isocitrate dehydrogenase Isocitrate dehydrogenase Homo sapiens
[NADP] cytoplasmic [NADP] cytoplasmic
465139 FMDKLGENLKI 397 407 Isocitrate dehydrogenase Isocitrate dehydrogenase Homo sapiens
[NADP] cytoplasmic [NADP] cytoplasmic
465143 FMEAIAPPLL 686 695 Fatty acid synthase Fatty acid synthase Homo sapiens
465144 FMEDMMPKV 152 160 Ribulose-phosphate 3- Ribulose-phosphate 3- Homo sapiens epimerase (UniProt:Q96AT9) epimerase
465145 FMEEIDKEISEM 138 149 Tubulin monoglycylase Tubulin monoglycylase Homo sapiens
TTLL3 (UniProt:J3KQB2) TTLL3
465150 FMILPVGAA 167 175 Alpha-enolase Alpha-enolase Homo sapiens
465151 FMILPVGAANF 108 118 Alpha-enolase Alpha-enolase Homo sapiens
465152 FMLATQLNPLV 56 66 Replication protein A 70 kDa Replication protein A 70 kDa Homo sapiens
DNA-binding subunit DNA-binding subunit
465153 FMMEVKDPNM 198 207 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RBBP6 RBBP6
465154 FMNPFNMPNL 100 109 Stress-induced- Stress-induced- Homo sapiens phosphoprotein 1 phosphoprotein 1
465155 FMQGEIATILA 702 712 Interferon regulatory factor 2- Interferon regulatory factor 2- Homo sapiens binding protein-like binding protein-like
465157 FMVPSEAISLS 1253 1263 CD109 antigen CD109 antigen Homo sapiens
465158 FMVTRSYTV 223 231 Serpin H1 Serpin H1 Homo sapiens
465160 FMWDVAEEL 105 113 Lysosomal Pro-X Lysosomal Pro-X Homo sapiens carboxypeptidase carboxypeptidase
465161 FMWDVAEELKA 60 70 Lysosomal Pro-X Lysosomal Pro-X Homo sapiens carboxypeptidase carboxypeptidase
465162 FMWNPHLGYILT 271 282 Creatine kinase B-type Creatine kinase B-type Homo sapiens
465163 FNFGKEKFEV 117 126 Deoxyuridine 5'-tri phosphate Deoxyuridine 5'-triphosphate Homo sapiens nucleotidohydrolase, nucleotidohydrolase,
mitochondrial mitochondrial
(UniProt:P33316)
465266 FQAHKEAIREA 198 208 pre-mRNA 3' end processing pre-mRNA 3' end processing Homo sapiens protein WDR33 protein WDR33
465267 FQDEEEENEEV 109 119 PAX3- and PAX7-binding PAX3- and PAX7-binding Homo sapiens protein 1 protein 1
465268 FQKENGTVTA 239 248 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
465271 FQQKQIENV 256 264 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 2 subunit 2 initiation factor 2 subunit 2
465272 FQVGSMPPA 463 471 Talin-1 Talin-1 Homo sapiens
465273 FQYDHEAFL 56 64 Reticulocalbin-1 Reticulocalbin-1 Homo sapiens
465275 FQYTDEHGEV 161 170 Peroxiredoxin-2 Peroxiredoxin-2 Homo sapiens
465323 FSHEEIAMATV 106 116 Fructose-bisphosphate Fructose-bisphosphate Homo sapiens aldolase A aldolase A
465329 FSSEVTAALRV 11 1 121 Elongation factor 2 Elongation factor 2 Homo sapiens
465337 FTASAGIQV 306 314 Alpha-enolase Alpha-enolase Homo sapiens
465338 FTASAGIQVV 247 256 Alpha-enolase Alpha-enolase Homo sapiens
465377 FTLDDVIQTGV 51 61 Creatine kinase B-type Creatine kinase B-type Homo sapiens
465386 FTYEGNSNDIRV 31 42 Drebrin-like protein Drebrin-like protein Homo sapiens
465390 FVAAAPVAA 275 283 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0 (UniProt:P05388) P0
465391 FVAELKGLDPA 180 190 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens mitochondrial mitochondrial
(UniProt:P40926)
465393 FVAESAEVL 194 202 Mesothelin Mesothelin Homo sapiens
465394 FVAPQPVVV 1664 1672 Host cell factor 1 Host cell factor 1 Homo sapiens
465395 FVAQFKFTV 261 269 Proliferation-associated Proliferation-associated Homo sapiens protein 2G4 protein 2G4
(UniProt:Q15274)
subunit beta-2 subunit beta-2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465655 GLDSSLVAA 177 185 Asparagine synthetase Asparagine synthetase Homo sapiens
[glutamine-hydrolyzing] [glutamine-hydrolyzing]
465656 GLDVPQVSL 318 326 Eukaryotic initiation factor Eukaryotic initiation factor Homo sapiens
4A-III 4A-III
465657 GLDWGMEEV 473 481 pre-mRNA 3' end processing pre-mRNA 3' end processing Homo sapiens protein WDR33 protein WDR33
465658 GLDWLANQL 169 111 ADP-ribosylation factor 3 ADP-ribosylation factor 3 Homo sapiens
465659 GLEDEMYEV 382 390 Integrator complex subunit 4 Integrator complex subunit 4 Homo sapiens
465660 GLEEMVEEL 49 51 Drebrin-like protein Drebrin-like protein Homo sapiens
465662 GLFAPLVF 276 283 Monocarboxylate transporter Monocarboxylate transporter Homo sapiens
1 1
465663 GLFAPLVFL 276 284 Monocarboxylate transporter Monocarboxylate transporter Homo sapiens
1 1
465664 GLFDEEMNEI 4207 4216 Plectin Plectin Homo sapiens
465666 GLFDPSNVKGL 265 215 Actin-like protein 6A Actin-like protein 6A Homo sapiens
465667 GLFDSPPGSDDA 58 69 Delta-1 -pyrroline-5- De I ta- 1 - pyrrol i n e-5- Homo sapiens carboxylate synthase carboxylate synthase
465669 GLFEDPWLLRV 1195 1205 Kinesin-like protein KIF26A Kinesin-like protein KIF26A Homo sapiens
465671 GLFEGDEYA 3019 3021 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
465672 GLFEGDEYAT 3019 3028 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
465673 GLFEGDEYATL 3019 3029 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
465674 GLFEGDEYATLM 3019 3030 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
465675 GLFEPGDMKYEI 286 291 Alkaline phosphatase, Alkaline phosphatase, Homo sapiens placental-like placental-like
465676 GLFEPGDMQYEL 288 299 Alkaline phosphatase, tissue- Alkaline phosphatase, tissue- Homo sapiens nonspecific isozyme nonspecific isozyme
465677 GLFEPGDTKYEI 286 291 Intestinal-type alkaline Intestinal-type alkaline Homo sapiens phosphatase phosphatase
465678 GLFEQRVEQYL 606 616 Suppression of Suppression of Homo sapiens tumorigenicity 5 protein tumorigenicity 5 protein
465679 GLFFPGSGGVIT 3516 3521 Laminin subunit alpha-5 Laminin subunit alpha-5 Homo sapiens
465681 GLFGGAGVGKTV 139 150 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
465683 GLFGKTVPKT 25 34 Peptidyl-prolyl cis-trans Peptidyl-prolyl cis-trans Homo sapiens isomerase B isomerase B
465684 GLFHFPTPL 5 13 Probable peptide chain Probable peptide chain Homo sapiens release factor C12orf65, release factor C12orf65,
mitochondrial mitochondrial
(UniProt:F5GWJ6)
465685 GLFHLGEFVNV 865 815 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
465687 GLFPNNYVTKI 1098 1108 Unconventional myosin-le Unconventional myosin-le Homo sapiens
465688 GLFQGQNSLL 195 204 Isochorismatase domain- Isochorismatase domain- Homo sapiens containing protein 2 containing protein 2
465689 GLFTVLYTV 534 542 Frizzled-8 Frizzled-8 Homo sapiens
465690 GLGAFGFQL 119 121 3'(2'),5'-bisphosphate 3'(2'),5'-bisphosphate Homo sapiens nucleotidase 1 nucleotidase 1
(UniProt:095861)
465691 GLGELLRSL 109 111 Serpin H1 Serpin H1 Homo sapiens
465692 GLGGFGLEL 1890 1898 Fatty acid synthase Fatty acid synthase Homo sapiens
465693 GLGGFGLELA 1890 1899 Fatty acid synthase Fatty acid synthase Homo sapiens
465694 GLHEDLNRV 138 146 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 11 hydrolase 1 1
465695 GLHETQPPSV 524 533 lmportin-9 lmportin-9 Homo sapiens
465696 GLHFFNPVPVM 156 166 Hydroxyacyl-coenzyme A Hydroxyacyl-coenzyme A Homo sapiens dehydrogenase, dehydrogenase,
mitochondrial mitochondrial
465697 GLHPQIIIRA 115 124 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens eta eta Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465698 GLHRYLHLL 254 262 Leucine-rich repeat- Leucine-rich repeat- Homo sapiens containing protein 47 containing protein 47
465699 GLHSDSHSL 1875 1883 Microtubule cross-linking Microtubule cross-linking Homo sapiens factor 1 factor 1
465700 GLHSLPPEV 335 343 Volume-regulated anion Volume-regulated anion Homo sapiens channel subunit LRRC8E channel subunit LRRC8E
465702 GLIAGVVSI 933 941 Hepatocyte growth factor Hepatocyte growth factor Homo sapiens receptor receptor
465703 GLIDDGETPEA 97 107 ADP-sugar pyrophosphatase ADP-sugar pyrophosphatase Homo sapiens
465706 GLIDELNQA 60 68 Enoyl-CoA hydratase, Enoyl-CoA hydratase, Homo sapiens mitochondrial mitochondrial
465707 GUDELNQAL 60 69 Enoyl-CoA hydratase, Enoyl-CoA hydratase, Homo sapiens mitochondrial mitochondrial
465708 GUDELNQALKI 64 75 Enoyl-CoA hydratase, Enoyl-CoA hydratase, Homo sapiens mitochondrial mitochondrial
465709 GLIDENPGLQL 2509 2519 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
465710 GUDFAIQL 735 743 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 12 II transcription subunit 12
46571 1 GLIDGVVEADLV 76 87 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein L ribonucleoprotein L
465712 GLIDHQTYLEL 4298 4308 Plectin Plectin Homo sapiens
465714 GLIDWNMFVKL 1348 1358 Periplakin Periplakin Homo sapiens
465715 GLIDYNQLA 172 180 Serine Serine Homo sapiens hydroxymethyltransferase, hydroxymethyltransferase,
mitochondrial mitochondrial
(UniProt:P34897)
465716 GLIDYNQLAL 172 181 Serine Serine Homo sapiens hydroxymethyltransferase, hydroxymethyltransferase,
mitochondrial mitochondrial
(UniProt:P34897)
465717 GLIEDYEAL 738 746 CDK5 regulatory subunit- CDK5 regulatory subunit- Homo sapiens associated protein 2 associated protein 2
465718 GLIEEDDVILL 66 76 Monofunctional C1 - Monofunctional C1- Homo sapiens tetrahydrofolate synthase, tetrahydrofolate synthase,
mitochondrial mitochondrial
465719 GLIEELVDV 304 312 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
465720 GUEIISNA 1443 1451 U5 small nuclear U5 small nuclear Homo sapiens ribonucleoprotein 200 kDa ribonucleoprotein 200 kDa
helicase helicase
465721 GLIEWLENT 3800 3808 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
465722 GUEWLENTV 3706 3715 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
465723 GLIGNANMVGL 173 183 U4/U6 small nuclear U4/U6 small nuclear Homo sapiens ribonucleoprotein Prp3 ribonucleoprotein Prp3
465724 GLIGVAFVDM 1017 1026 ATP-citrate synthase ATP-citrate synthase Homo sapiens
465725 GLIGVAFVDML 1017 1027 ATP-citrate synthase ATP-citrate synthase Homo sapiens
465727 GULGMGGQTAL 503 514 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
465728 GLISFQEFV 71 79 Calcium-binding Calcium-binding Homo sapiens mitochondrial carrier protein mitochondrial carrier protein
Aralar2 Aralar2
465729 GUSILEPV 418 426 Protocadherin Fat 1 Protocadherin Fat 1 Homo sapiens
465730 GLISNSPVL 1835 1843 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 4 protein 4
465731 GLISVALTKV 247 256 UniProt:E7ET79 Homo sapiens
465732 GLISVSNLPKL 60 70 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465733 GLITAGAQLVEL 142 153 Ran GTPase-activating Ran GTPase-activating Homo sapiens protein 1 protein 1
465736 GLKELSDFL 238 246 Basic leucine zipper and W2 Basic leucine zipper and W2 Homo sapiens domain-containing protein 2 domain-containing protein 2
465737 GLKEMDNAGQL 270 280 Palmitoyl-protein Palmitoyl-protein Homo sapiens thioesterase 1 thioesterase 1
465738 GLKEMDNAGQLV 270 281 Palmitoyl-protein Palmitoyl-protein Homo sapiens thioesterase 1 thioesterase 1
465740 GLKENDVIISI 271 281 Serine protease HTRA1 Serine protease HTRA1 Homo sapiens
465741 GLKLTVEEA 41 19 4127 Plectin Plectin Homo sapiens
465742 GLKNGVPAVGL 976 986 Coatomer subunit alpha Coatomer subunit alpha Homo sapiens
465745 GLLDFLQGL 121 129 Alpha/beta hydrolase Alpha/beta hydrolase Homo sapiens domain-containing protein domain-containing protein
14B 14B
465746 GLLDIYGFEV 383 392 Unconventional myosin-lc Unconventional myosin-lc Homo sapiens
465747 GLLDMNKGLSL 159 169 ERI1 exoribonuclease 3 ERI1 exoribonuclease 3 Homo sapiens
465748 GLLDNHSSEFNV 424 435 Lon protease homolog, Lon protease homolog, Homo sapiens mitochondrial mitochondrial
465749 GLLDSILSV 432 440 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 5A protein 5A
465750 GLLDTQTSQV 1383 1392 Epiplakin Epiplakin Homo sapiens
465752 GLLEELKTV 360 368 Translational activator GCN1 Translational activator GCN1 Homo sapiens
465753 GLLEEQYFE 907 915 Rho-associated protein Rho-associated protein Homo sapiens kinase 1 kinase 1
465755 GLLEGDYEV 490 498 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX59 RNA helicase DDX59
465756 GLLEGTFPNT 275 284 Protein transport protein Protein transport protein Homo sapiens
Sec23B Sec23B
465757 GLLEIVTSV 445 453 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 5B protein 5B
465758 GLLELTQVEV 1197 1206 Protein FAM208B Protein FAM208B Homo sapiens
465759 GLLESVYEM 1796 1804 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
465760 GLLETDEATL 8 17 Ubiquitin-like-conjugating Ubiquitin-like-conjugating Homo sapiens enzyme ATG3 enzyme ATG3
465761 GLLETDEATLDT 8 19 Ubiquitin-like-conjugating Ubiquitin-like-conjugating Homo sapiens enzyme ATG3 enzyme ATG3
465763 GLLEWESKSDAL 513 524 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein L ribonucleoprotein L
465765 GLLGDAFLHU 160 170 Zinc transporter SLC39A7 Zinc transporter SLC39A7 Homo sapiens
465768 GLLGGVIMM 435 443 Zinc transporter SLC39A7 Zinc transporter SLC39A7 Homo sapiens
465769 GLLGGVIMMV 435 444 Zinc transporter SLC39A7 Zinc transporter SLC39A7 Homo sapiens
465770 GLLGGWTVL 627 635 Zinc transporter ZIP4 Zinc transporter ZIP4 Homo sapiens
(UniProt:Q6P5W5)
465771 GLLGGWTVLL 627 636 Zinc transporter ZIP4 Zinc transporter ZIP4 Homo sapiens
(UniProt:Q6P5W5)
465772 GLLGISKGGEL 227 237 Acyl-coenzyme A Acyl-coenzyme A Homo sapiens thioesterase 2, mitochondrial thioesterase 2, mitochondrial
465773 GLLGIYQEL 353 361 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens
465774 GLLGIYQELL 353 362 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens
465775 GLLGLFQGQNSL 192 203 Isochorismatase domain- Isochorismatase domain- Homo sapiens containing protein 2 containing protein 2
465776 GLLGLQNLL 610 618 CLIP-associating protein 1 CLIP-associating protein 1 Homo sapiens
465777 GLLGQPEATMV 535 545 Protein SON Protein SON Homo sapiens
(UniProt:P18583)
465778 GLLHRAFSV 56 64 Isopentenyl-diphosphate Isopentenyl-diphosphate Homo sapiens
Delta-isomerase 1 Delta-isomerase 1
465779 GLLKLNPVGA 116 125 GrpE protein homolog 1 , GrpE protein homolog 1 , Homo sapiens mitochondrial mitochondrial
465782 GLLLVTGPLV 170 179 60S ribosomal protein L6 60S ribosomal protein L6 Homo sapiens
465783 GLLLVTGPLVL 170 180 60S ribosomal protein L6 60S ribosomal protein L6 Homo sapiens
465784 GLLPATVQPFHL 7 18 Protein TSSC4 Protein TSSC4 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
465785 GLLPEELTPLI 37 47 Electron transfer flavoprotein Electron transfer flavoprotein Homo sapiens subunit alpha, mitochondrial subunit alpha, mitochondrial
(UniProt:P13804)
465786 GLLPEELTPLIL 37 48 Electron transfer flavoprotein Electron transfer flavoprotein Homo sapiens subunit alpha, mitochondrial subunit alpha, mitochondrial
(UniProt:P13804)
465788 GLLPPLRIPEL 166 176 RNA-binding protein 42 RNA-binding protein 42 Homo sapiens
465789 GLLPPLRIPELL 166 177 RNA-binding protein 42 RNA-binding protein 42 Homo sapiens
465790 GLLPQLLGV 393 401 Calcium-binding Calcium-binding Homo sapiens mitochondrial carrier protein mitochondrial carrier protein
Aralar2 Aralar2
465791 GLLPTPNPLT 139 148 Serine/arginine-rich splicing Serine/arginine-rich splicing Homo sapiens factor 1 1 factor 11
465792 GLLPTPNPLTQI 139 150 Serine/arginine-rich splicing Serine/arginine-rich splicing Homo sapiens factor 1 1 factor 11
465793 GLLPVLGQPII 249 259 Mesothelin Mesothelin Homo sapiens
465794 GLLQGKLALLSV 20 31 Ribosyldihydronicotinamide Ribosyldihydronicotinamide Homo sapiens dehydrogenase [quinone] dehydrogenase [quinone]
(UniProt:P16083)
465795 GLLRATTAA 3346 3354 Plectin Plectin Homo sapiens
465796 GLLRATTAALLL 936 947 Plectin Plectin Homo sapiens
465797 GLLSAEVARL 3681 3690 Plectin Plectin Homo sapiens
465798 GLLSAEVARLL 3681 3691 Plectin Plectin Homo sapiens
465799 GLLSAEVARLLL 1271 1282 Plectin Plectin Homo sapiens
465800 GLLSDPLSDLQL 932 943 Rab1 1 family-interacting Rab1 1 family-interacting Homo sapiens protein 1 protein 1
465801 GLLSDWPF 245 253 Trifunctional enzyme subunit Trifunctional enzyme subunit Homo sapiens beta, mitochondrial beta, mitochondrial
(UniProt:P55084)
465802 GLLSDWPFKV 245 255 Trifunctional enzyme subunit Trifunctional enzyme subunit Homo sapiens beta, mitochondrial beta, mitochondrial
(UniProt:P55084)
465803 GLLSEEVEL 395 403 C-1 -tetrahydrofolate C-1-tetrahydrofolate Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
(UniProt:F5H2F4)
465805 GLLSPHPLL 1258 1266 Fatty acid synthase Fatty acid synthase Homo sapiens
465806 GLLSPHPLLQL 1258 1268 Fatty acid synthase Fatty acid synthase Homo sapiens
465807 GLMAEEVQA 1161 1169 Spectrin alpha chain, non- Spectrin alpha chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
465808 GLMAEEVQAV 1161 1170 Spectrin alpha chain, non- Spectrin alpha chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
465810 GLMDGKGGGKDV 925 936 Alanine-tRNA ligase, Alanine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
465812 GLMDTTLEEVFL 658 669 ATP-binding cassette subATP-binding cassette subHomo sapiens family A member 2 family A member 2
465813 GLMEEMSALL 406 415 Protein enabled homolog Protein enabled homolog Homo sapiens
465814 GLMEEMSALLA 406 416 Protein enabled homolog Protein enabled homolog Homo sapiens
465815 GLMGAGIAQVSV 144 155 Trifunctional enzyme subunit Trifunctional enzyme subunit Homo sapiens alpha, mitochondrial alpha, mitochondrial
465816 GLMLQDLVSA 1517 1526 Germinal-center associated Germinal-center associated Homo sapiens nuclear protein nuclear protein
465817 GLMPPPEPKV 418 427 U4/U6 small nuclear U4/U6 small nuclear Homo sapiens ribonucleoprotein Prp3 ribonucleoprotein Prp3
465818 GLMTGSGVVGV 1177 1187 CAD protein CAD protein Homo sapiens
465819 GLMTTVHA 131 138 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
465820 GLMTTVHAIT 173 182 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
465821 GLMTTVHAITAT 173 184 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
465824 GLNEILSDPEV 312 322 Hsc70-interacting protein Hsc70-interacting protein Homo sapiens
465825 GLNEILSDPEVL 312 323 Hsc70-interacting protein Hsc70-interacting protein Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465827 GLNPISTVTEL 414 424 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens delta delta
465828 GLNQAATELV 1248 1257 Talin-1 Talin-1 Homo sapiens
465830 GLNTLSSFML 49 58 Replication protein A 70 kDa Replication protein A 70 kDa Homo sapiens
DNA-binding subunit DNA-binding subunit
465831 GLPFPFPDI 398 406 Transforming growth factor Transforming growth factor Homo sapiens beta receptor type 3 beta receptor type 3
465832 GLPPILNALEV 78 88 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
465834 GLPSGAPPGV 517 526 MTSSI-like protein MTSS1 -like protein Homo sapiens
465835 GLQDVLRTNL 29 38 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens zeta zeta
465836 GLQEAGEEDTRL 86 97 Kinetochore protein Spc24 Kinetochore protein Spc24 Homo sapiens
465837 GLQEAINDLV 357 366 Phosphoacetylgl ucosam i ne Phosphoacetylglucosamine Homo sapiens mutase mutase
465838 GLQEYVEAV 123 131 Disrupted in schizophrenia 1 Disrupted in schizophrenia 1 Homo sapiens isoform 49 isoform 49
465839 GLQEYVEAVSF 123 133 Translin-associated protein X Translin-associated protein X Homo sapiens
465840 GLQFPVGRV 23 31 Histone H2A.J Histone H2A.J Homo sapiens
465841 GLQGALLTHFL 707 717 Double-stranded RNA- Double-stranded RNA- Homo sapiens specific adenosine specific adenosine
deaminase deaminase
465842 GLQGGIPNGYL 583 593 Mesothelin Mesothelin Homo sapiens
465843 GLQGGSAGSPA 1076 1086 Filamin-A Filamin-A Homo sapiens
465844 GLQNDLFSL 537 545 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:P55786)
465845 GLQNDLFSLA 537 546 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:P55786)
465846 GLQQYYVKL 153 161 Spliceosome RNA helicase Spliceosome RNA helicase Homo sapiens
DDX39B DDX39B
465847 GLQSQIAQV 272 280 Nestin Nestin Homo sapiens
465848 GLQVVEKQNL 27 36 D-3-phosphoglycerate D-3-phosphoglycerate Homo sapiens dehydrogenase dehydrogenase
465849 GLREENEGV 18 26 Alpha-aminoadipic Alpha-aminoadipic Homo sapiens semialdehyde semialdehyde
dehydrogenase dehydrogenase
(UniProt:P49419)
465850 GLRNVQAEEMV 36 46 ATP synthase subunit alpha, ATP synthase subunit alpha, Homo sapiens mitochondrial mitochondrial
465851 GLSAAPVPT 62 70 Reticulon-4 Reticulon-4 Homo sapiens
465853 GLSEAQVM 82 89 Kinesin light chain 1 Kinesin light chain 1 Homo sapiens
(UniProt:Q07866)
465854 GLSEAQVMM 82 90 Kinesin light chain 1 Kinesin light chain 1 Homo sapiens
(UniProt:Q07866)
465855 GLSEDTTEET 358 367 Nucleolin (UniProt:H7BY16) Nucleolin Homo sapiens
465856 GLSEDTTEETL 358 368 Nucleolin (UniProt:H7BY16) Nucleolin Homo sapiens
465857 GLSEEAIMEL 74 83 Phosphoglycerate mutase 1 Phosphoglycerate mutase 1 Homo sapiens
465858 GLSESSVKV 319 327 Armadillo repeat-containing Armadillo repeat-containing Homo sapiens protein 8 protein 8
465859 GLSGPPPPNA 195 204 Protein transport protein Protein transport protein Homo sapiens
Sec24D Sec24D
465860 GLSGSGPAYA 172 181 Pyrroline-5-carboxylate Pyrrol i n e-5-carboxyl ate Homo sapiens reductase 2 reductase 2
465861 GLSKDDIENMV 552 562 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
465862 GLSKLSPST 902 910 Putative helicase MOV-10 Putative helicase MOV-10 Homo sapiens
465864 GLSPATPTPA 117 126 Negative elongation factor A Negative elongation factor A Homo sapiens
465865 GLSPGMVRA 1457 1465 Filamin-A Filamin-A Homo sapiens
465866 GLSPPVAIFF 119 128 UPF0160 protein MYG1 , UPF0160 protein MYG1 , Homo sapiens mitochondrial mitochondrial Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465867 GLSPPVAIFFV 119 129 UPF0160 protein MYG1 , UPF0160 protein MYG1 , Homo sapiens mitochondrial mitochondrial
465868 GLSSDLQQV 264 272 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit F initiation factor 3 subunit F
(UniProt:O00303)
465869 GLSSIANLPKL 53 63 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member D member D
465870 GLSSMQGWRV 25 34 Protein phosphatase 1 B Protein phosphatase 1 B Homo sapiens
465871 GLSVYQIKV 2955 2963 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
465872 GLTAEFVNL 36 44 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
465873 GLTDEFEEL 36 44 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member A (UniProt:H0YN26) member A
465874 GLTDEINFL 216 224 Keratin, type II cytoskeletal 8 Keratin, type II cytoskeletal 8 Homo sapiens
465875 GLTDQINFL 197 205 Other Homo sapiens Keratin, type II cytoskeletal 8 Homo sapiens
(human) protein
465876 GLTEAQTREL 922 931 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
465877 GLTEDMVT 1749 1756 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
465878 GLTEDMVTV 1740 1748 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
465879 GLTGKPVMV 13 21 Small nuclear Small nuclear Homo sapiens ribonucleoprotein F ribonucleoprotein F
465881 GLTSIANLPKL 53 63 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member A (UniProt:P39687) member A
465882 GLTSVINQKL 299 308 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
465883 GLTSVKINV 1964 1972 Protocadherin Fat 1 Protocadherin Fat 1 Homo sapiens
465884 GLTTRTIGV 1202 1210 Bifunctional Bifunctional Homo sapiens glutamate/proline-tRNA glutamate/proline-tRNA
ligase ligase
465885 GLTVSIPGL 550 558 Coatomer subunit gamma-1 Coatomer subunit gamma-1 Homo sapiens
465886 GLVDAEALVAL 308 318 NADH-ubiquinone NADH-ubiquinone Homo sapiens oxidoreductase 75 kDa oxidoreductase 75 kDa
subunit, mitochondrial subunit, mitochondrial
465887 GLVDFVQEV 502 510 Very long-chain acyl-CoA Very long-chain acyl-CoA Homo sapiens synthetase synthetase
465888 GLVDFVQEVNV 502 512 Very long-chain acyl-CoA Very long-chain acyl-CoA Homo sapiens synthetase synthetase
465891 GLVGLEPAT 476 484 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
465892 GLVGLEPATL 476 485 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
465893 GLVGPEFHEKL 3222 3232 Plectin Plectin Homo sapiens
465894 GLVGVDQFL 471 479 Elongation factor 2 Elongation factor 2 Homo sapiens
465895 GLVGVDQFLV 471 480 Elongation factor 2 Elongation factor 2 Homo sapiens
465896 GLVGVNLTL 70 78 ATP-citrate synthase ATP-citrate synthase Homo sapiens
465897 GLVKDSPLL 946 954 Dynactin subunit 1 Dynactin subunit 1 Homo sapiens
(UniProt:Q14203)
465898 GLVKYMNSGPW 62 73 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase B kinase B
465899 GLVQGTTPV 436 444 D-3-phosphoglycerate D-3-phosphoglycerate Homo sapiens dehydrogenase dehydrogenase
465901 GLVSTGLKV 419 427 Elongation factor 2 Elongation factor 2 Homo sapiens
465902 GLWDAFSNEEAV 176 187 Protein phosphatase 1 L Protein phosphatase 1 L Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465904 GLWEIDNNPKV 80 90 PC4 and SFRS1-interacting PC4 and SFRS1-interacting Homo sapiens protein protein
465905 GLWEIENNPT 85 94 Hepatoma-derived growth Hepatoma-derived growth Homo sapiens factor factor
465909 GLWEIQNNPHA 80 90 Hepatoma-derived growth Hepatoma-derived growth Homo sapiens factor-related protein 2 factor-related protein 2
465910 GLWFHPEEL 131 139 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase A kinase A
46591 1 GLWGHALL 1641 1648 Protein transport protein Protein transport protein Homo sapiens
Sec16A Sec16A
465912 GLWGHPVLA 831 839 DENN domain-containing DENN domain-containing Homo sapiens protein 4C (UniProt:R4GN35) protein 4C
465913 GLWGPEEEPHLL 1324 1335 Protein PRRC2B Protein PRRC2B Homo sapiens
465914 GLWLVAQQPAL 67 77 ATP-dependent (S)- ATP-dependent (S)- Homo sapiens
NAD(P)H-hydrate NAD(P)H-hydrate
dehydratase dehydratase
465915 GLWPGAGTIRL 87 97 Mannose-1 -phosphate Mannose-1 -phosphate Homo sapiens guanyltransferase alpha guanyltransferase alpha
(UniProt:Q96IJ6)
465916 GLYADYLFNA 43 52 Metal loprotease TIK11 Metalloprotease TIK11 Homo sapiens
465917 GLYALGLIHA 442 451 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 1 ATPase regulatory subunit 1
465918 GLYDWSVLRI 78 88 ICOS ligand ICOS ligand Homo sapiens
465920 GLYEGLDWLS 553 562 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIM23 TRIM23
465922 GLYGIKDDV 221 229 L-lactate dehydrogenase L-lactate dehydrogenase Homo sapiens
465923 GLYGIKDDVFLS 221 232 L-lactate dehydrogenase L-lactate dehydrogenase Homo sapiens
465926 GLYGLIVAL 99 107 V-type proton ATPase 16 V-type proton ATPase 16 Homo sapiens kDa proteolipid subunit kDa proteolipid subunit
465927 GLYGSHLYV 264 272 Selenium-binding protein 1 Selenium-binding protein 1 Homo sapiens
465930 GLYSKTMTPT 183 192 Fermitin family homolog 2 Fermitin family homolog 2 Homo sapiens
465932 GLYSRQLYV 53 61 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 1 activating enzyme 1
(UniProt:P22314)
465933 GMADYSDPSYV 428 438 Cell division cycle 5-like Cell division cycle 5-like Homo sapiens protein protein
465934 GMAFRVPTA 230 238 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
465935 GMAFTFLKV 238 246 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
465936 GMDELSEEDKLT 442 453 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
465938 GMDYDYAL 242 249 Serine protease 23 Serine protease 23 Homo sapiens
(UniProt:O95084)
465939 GMDYDYALL 242 250 Serine protease 23 Serine protease 23 Homo sapiens
(UniProt:O95084)
465940 GMESMSNVPYV 120 130 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
465941 GMFGKETYV 1632 1640 Epiplakin Epiplakin Homo sapiens
465942 GMGGITAVTV 59 68 Keratin, type II cytoskeletal 8 Keratin, type II cytoskeletal 8 Homo sapiens
465943 GMIDEEFTV 581 589 Kinesin-1 heavy chain Kinesin-1 heavy chain Homo sapiens
465944 GMLPANYVEAI 251 261 UM and SH3 domain protein UM and SH3 domain protein Homo sapiens
1 1
465945 GMMSTVTEV 1256 1264 Proteasome-associated Proteasome-associated Homo sapiens protein ECM29 homolog protein ECM29 homolog
465946 GMNDMNHEV 495 503 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 1 complex subunit 1
465947 GMNQFKPIFL 45 54 Alanine-tRNA ligase, Alanine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
465948 GMVPFVFVGT 292 301 Fragile X mental retardation Fragile X mental retardation Homo sapiens protein 1 protein 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
465949 GMWGSSVFL 185 193 DENN domain-containing DENN domain-containing Homo sapiens protein 4C protein 4C
(UniProt:R4GNB2)
465950 GMYGIENEV 279 287 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
465951 GMYGIENEVF 279 288 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
465952 GMYGIENEVFL 279 289 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
465953 GMYSLPFLTA 34 43 Alpha/beta hydrolase Alpha/beta hydrolase Homo sapiens domain-containing protein domain-containing protein
14B 14B
466066 GQAPSVFSV 1178 1186 Non-receptor tyrosine-protein Non-receptor tyrosine-protein Homo sapiens kinase TYK2 kinase TYK2
466067 GQDEMIDVIGV 60 70 60S ribosomal protein L3 60S ribosomal protein L3 Homo sapiens
466068 GQDEPUHV 69 77 Proteasome assembly Proteasome assembly Homo sapiens chaperone 3 chaperone 3
466069 GQEESQVSV 259 267 Methionine synthase Methionine synthase Homo sapiens reductase reductase
466070 GQFQGRPVSV 2620 2629 Epiplakin Epiplakin Homo sapiens
466071 GQHKDAYQV 42 50 Apoptosis inhibitor 5 Apoptosis inhibitor 5 Homo sapiens
(UniProt:Q9BZZ5)
466072 GQICRVTTV 1183 1191 Coatomer subunit alpha Coatomer subunit alpha Homo sapiens
466074 GQISGLNVLRV 195 205 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
466075 GQLAEVHSV 67 75 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX59 RNA helicase DDX59
466076 GQLEFRALL 315 323 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens beta beta
466077 GQLEILEFL 46 54 Myotrophin Myotrophin Homo sapiens
466078 GQLNGFHEA 3 11 S-adenosylmethionine S-adenosylmethionine Homo sapiens synthase isoform type-2 synthase isoform type-2
466079 GQNGISDLVKV 238 248 L-lactate dehydrogenase L-lactate dehydrogenase Homo sapiens
466080 GQNPTNAEV 40 48 Myosin light polypeptide 6 Myosin light polypeptide 6 Homo sapiens
466081 GQPAEEIFESV 316 326 Protein ERGIC-53 Protein ERGIC-53 Homo sapiens
466082 GQPAQPAPMV 333 342 Transcription activator BRG1 Transcription activator BRG1 Homo sapiens
466083 GQQELADLFV 196 205 Glycine— tRNA ligase Glycine-tRNA ligase Homo sapiens
466084 GQSEEEASI 136 144 Fructose-bisphosphate Fructose-bisphosphate Homo sapiens aldolase A aldolase A
466085 GQVEVTGDEYNV 121 132 60S ribosomal protein L5 60S ribosomal protein L5 Homo sapiens
(UniProt:P46777)
466086 GQWASVIRV 860 868 Splicing factor 3B subunit 3 Splicing factor 3B subunit 3 Homo sapiens
466087 GQWDPADPAPSA 1295 1306 Fatty acid synthase Fatty acid synthase Homo sapiens
466089 GQYEGKVSSV 852 861 lmportin-9 lmportin-9 Homo sapiens
466090 GQYGLDWQA 942 951 5-oxoprolinase 5-oxoprolinase Homo sapiens
466101 GTAENGIHPL 83 92 Paralemmin-1 Paralemmin-1 Homo sapiens
466115 GTFDISILEI 234 243 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
466117 GTFDVSILT 180 188 Heat shock 70 kDa protein Heat shock 70 kDa protein Homo sapiens
1 B 1 B
466118 GTFEWVDSML 2220 2229 Midasin Midasin Homo sapiens
466121 GTMDGANVEM 657 666 Glycogen phosphorylase, Glycogen phosphorylase, Homo sapiens liver form liver form
466124 GVAELLFNTIQA 277 288 Actin-related protein 2 Actin-related protein 2 Homo sapiens
466125 GVAGLAGLIGL 135 145 Mitochondrial fission 1 Mitochondrial fission 1 Homo sapiens protein protein
466126 GVALSNVIHKV 312 322 Serpin B5 Serpin B5 Homo sapiens
466127 GVDEEPQHV 170 178 Regulator of nonsense Regulator of nonsense Homo sapiens transcripts 1 transcripts 1
466129 GVDSUTLA 172 180 Fascin Fascin Homo sapiens
466131 GVDVTLPRV 586 594 Neuroblast differentiation- Neuroblast differentiation- Homo sapiens associated protein AHNAK associated protein AHNAK
(UniProt:P0CW18) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
466252 HLDKISDSV 72 80 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens epsilon (UniProt:P48643) epsilon
466253 HLDKSDPKV 1050 1058 Translational activator GCN1 Translational activator GCN1 Homo sapiens
466254 HLDPSLTHT 15 23 Nuclear factor NF-kappa-B Nuclear factor NF-kappa-B Homo sapiens p105 subunit p105 subunit
466255 HLDSSGSYV 490 498 Alanine-tRNA ligase, Alanine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
466256 HLFDGLDDDEPS 557 568 Nuclear pore complex protein Nuclear pore complex protein Homo sapiens
Nup98-Nup96 Nup98-Nup96
(UniProt:P52948)
466259 HLGGEDFDNRL 158 168 UniProt:E7EP94 Homo sapiens
466260 HLGGEDFDQRV 229 239 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
466261 HLGKPPEV 262 269 Coatomer subunit epsilon Coatomer subunit epsilon Homo sapiens
466262 HUHEVTKVLL 128 138 Neutral alpha-glucosidase Neutral alpha-glucosidase Homo sapiens
AB (UniProt:Q14697) AB
466264 HLLDFPNIVI 1875 1884 Pre-mRNA-processing- Pre-mRNA-processing- Homo sapiens spl icing factor 8 splicing factor 8
466265 HLLDPTVEYV 109 118 Breast cancer anti-estrogen Breast cancer anti-estrogen Homo sapiens resistance protein 3 resistance protein 3
466266 HLLGHLEQA 215 223 PR domain zinc finger PR domain zinc finger Homo sapiens protein 15 (UniProt:P57071 ) protein 15
466267 HLLLEAVPAV 51 60 Peroxidasin homolog Peroxidasin homolog Homo sapiens
466268 HLLPSGIINPNV 59 70 Adenylosuccinate synthetase Adenylosuccinate synthetase Homo sapiens isozyme 2 isozyme 2
466269 HLLSLMGIPYL 107 111 Flap endonuclease 1 Flap endonuclease 1 Homo sapiens
466271 HLNCTISQV 665 673 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX1 helicase DDX1
466272 HLPGFVEQA 62 70 Peroxiredoxin-5, Peroxiredoxin-5, Homo sapiens mitochondrial mitochondrial
466273 HLQDLMEGLTA 576 586 DNA topoisomerase 1 DNA topoisomerase 1 Homo sapiens
466275 HLQEGFGCVV 4 13 Plasminogen activator Plasminogen activator Homo sapiens inhibitor 1 RNA-binding inhibitor 1 RNA-binding
protein protein
466277 HLSNIPPSV 466 474 Polypyrimidine tract-binding Polypyrimidine tract-binding Homo sapiens protein 2 protein 2
466278 HLTDTSHGV 158 166 Integrator complex subunit 4 Integrator complex subunit 4 Homo sapiens
466279 HLTWEPPSV 1810 1818 Host cell factor 1 Host cell factor 1 Homo sapiens
466280 HLVDPIDDLFL 252 262 UPF0317 protein C14orf159, UPF0317 protein C14orf159, Homo sapiens mitochondrial mitochondrial
466281 HLWAELVFL 1356 1364 Clathrin heavy chain 1 Clathrin heavy chain 1 Homo sapiens
466283 HLYDVFGDPAYL 74 85 LanC-like protein 1 LanC-like protein 1 Homo sapiens
466284 HLYPNTPYA 238 246 DNA-(apurinic or apyrimidinic DNA-(apurinic or apyrimidinic Homo sapiens site) lyase site) lyase
466285 HLYRGIFPV 463 471 Pyruvate kinase PKM Pyruvate kinase PKM Homo sapiens
466333 HVDGFIANV 59 67 Proliferation-associated Proliferation-associated Homo sapiens protein 2G4 protein 2G4
466475 IIAEDVDGEA 264 273 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
466476 IIAEGIPEA 110 118 ATP-citrate synthase ATP-citrate synthase Homo sapiens
466477 IIAEGIPEAL 110 119 ATP-citrate synthase ATP-citrate synthase Homo sapiens
466482 IIDPGSTVTV 67 76 Vesicle-associated Vesicle-associated Homo sapiens membrane protein- membrane protein- associated protein A associated protein A
466492 IIHDFQPHV 81 89 Methionine Methionine Homo sapiens adenosyltransferase 2 adenosyltransferase 2
subunit beta subunit beta
(UniProt:Q9NZL9)
466493 IILGGVKAVTL 91 101 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 1 activating enzyme 1
(UniProt:P22314) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
466494 IIMDDEFQL 32 40 ADP-ribosylation factor-like ADP-ribosylation factor-like Homo sapiens protein 2-binding protein protein 2-binding protein
466498 IISELRNQYV 220 229 Proteasome activator Proteasome activator Homo sapiens complex subunit 3 complex subunit 3
466499 IISKFLPPV 29 37 Proteasome-associated Proteasome-associated Homo sapiens protein ECM29 homolog protein ECM29 homolog
466505 IIYGGSVTGA 206 215 Triosephosphate isomerase Triosephosphate isomerase Homo sapiens
466507 ILAAHVPTLQV 69 79 ATP synthase subunit delta, ATP synthase subunit delta, Homo sapiens mitochondrial mitochondrial
466508 ILAAHVPTLQVL 69 80 ATP synthase subunit delta, ATP synthase subunit delta, Homo sapiens mitochondrial mitochondrial
466509 ILADLNLSV 482 490 lmportin-9 lmportin-9 Homo sapiens
466510 ILADVLKVEV 128 137 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 6 initiation factor 6
46651 1 ILADWNEDIEA 61 71 ER degradation-enhancing ER degradation-enhancing Homo sapiens alpha-mannosidase-like alpha-mannosidase-like
protein 3 protein 3
466512 ILAGEIYVM 325 333 Testin Testin Homo sapiens
466513 I LAG E MLS V 99 107 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens gamma (UniProt:P49368) gamma
466514 ILAGSFETAMRL 916 927 Coatomer subunit alpha Coatomer subunit alpha Homo sapiens
466515 ILASFISGL 180 188 ATP-citrate synthase ATP-citrate synthase Homo sapiens
466516 ILASVILNV 69 77 Small integral membrane Small integral membrane Homo sapiens protein 10 protein 10
466517 ILDAAGANL 67 75 Glyoxylate Glyoxylate Homo sapiens red uctase/hyd roxypyruvate reductase/hydroxypyruvate
reductase reductase
466519 ILDDQTNKL 198 206 Disabled homolog 2 Disabled homolog 2 Homo sapiens
466520 ILDEEPIVNRGL 584 595 Horn s 1 Horn s 1 Homo sapiens
466522 ILDEIGADV 78 86 Pyrroline-5-carboxylate Pyrrol i n e-5-carboxyl ate Homo sapiens reductase 2 reductase 2
466523 ILDEIGADVQA 32 42 Other Homo sapiens Pyrrol i n e-5-carboxyl ate Homo sapiens
(human) protein reductase 2
466524 ILDELAEKL 217 225 Endophilin-A2 Endophilin-A2 Homo sapiens
466525 ILDEPTNHLDM 314 324 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 3 family F member 3
466526 ILDETLENV 104 112 m7GpppN-mRNA hydrolase m7GpppN-mRNA hydrolase Homo sapiens
466527 ILDETVNSV 404 412 Ran-binding protein 6 Ran-binding protein 6 Homo sapiens
466532 ILDKFTEEV 230 238 4- 4- Homo sapiens trimethylaminobutyraldehyde trimethylaminobutyraldehyde dehydrogenase dehydrogenase
466533 ILDKYPLAV 202 210 Aspartate-tRNA ligase, Aspartate-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
466534 ILDLIQVFV 86 94 AP-3 complex subunit sigma- AP-3 complex subunit sigma- Homo sapiens
1 1
466535 ILDMFTEIKV 344 353 Adenylosuccinate synthetase Adenylosuccinate synthetase Homo sapiens isozyme 2 isozyme 2
466536 ILDMSPFTV 698 706 H(+)/CI(-) exchange H(+)/CI(-) exchange Homo sapiens transporter 3 transporter 3
466540 ILDSGKIVQI 1364 1373 Bifunctional Bifunctional Homo sapiens glutamate/proline-tRNA glutamate/proline-tRNA
ligase ligase
466541 ILDSIIAQV 796 804 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens hairless hairless
466542 ILDVASLEV 2356 2364 Translational activator GCN1 Translational activator GCN1 Homo sapiens
466544 ILDVLTGINV 1356 1365 DNA topoisomerase 2- DNA topoisomerase 2- Homo sapiens binding protein 1 binding protein 1
466547 ILEDIQVT 1332 1339 Bifunctional Bifunctional Homo sapiens glutamate/proline-tRNA glutamate/proline-tRNA
ligase ligase
466548 ILEDIQVTL 1332 1340 Bifunctional Bifunctional Homo sapiens glutamate/proline-tRNA glutamate/proline-tRNA
ligase ligase Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
466549 ILEESENLHNA 108 118 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit C- initiation factor 3 subunit C- like protein like protein
466550 ILENKEGLELL 157 167 Alpha-enolase Alpha-enolase Homo sapiens
466551 ILENWNMFV 305 313 Reticulocalbin-1 Reticulocalbin-1 Homo sapiens
466552 ILFDFMDSV 23 31 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2A 56 kDa phosphatase 2A 56 kDa
regulatory subunit alpha regulatory subunit alpha
isoform isoform
466554 ILFEQDNEEQSV 269 280 Actin-related protein 10 Actin-related protein 10 Homo sapiens
466555 ILFESQFSV 442 450 Signal transducer and Signal transducer and Homo sapiens activator of transcription 5B activator of transcription 5B
466556 ILFGMGNPL 8 16 Adenosine kinase Adenosine kinase Homo sapiens
466557 ILFGMGNPLL 8 17 Adenosine kinase Adenosine kinase Homo sapiens
466559 ILFGVYGDVQRV 326 337 Polypyrimidine tract-binding Polypyrimidine tract-binding Homo sapiens protein 1 (UniProt:P26599) protein 1
466560 ILFLGDGLGV 56 65 Intestinal-type alkaline Intestinal-type alkaline Homo sapiens phosphatase phosphatase
466561 ILFLGDGLGVPT 56 67 Intestinal-type alkaline Intestinal-type alkaline Homo sapiens phosphatase phosphatase
466564 ILFPGGSVDL 90 99 Gamma-glutamyl hydrolase Gamma-glutamyl hydrolase Homo sapiens
466565 ILFPPPPPPNI 27 37 Other Homo sapiens Homo sapiens
(human) protein
466566 ILGATEVKL 416 424 Plasma alpha-L-fucosidase Plasma alpha-L-fucosidase Homo sapiens
(UniProt:Q9BTY2)
466567 ILGGMIVRI 51 59 ATP synthase subunit O, ATP synthase subunit O, Homo sapiens mitochondrial mitochondrial
466568 ILGGQPPNV 293 301 Protein SCAF8 Protein SCAF8 Homo sapiens
466569 ILGGSVLHL 61 69 NEDD8 NEDD8 Homo sapiens
466570 ILGITSPA 285 292 Phosphoenolpyruvate Phosphoenolpyruvate Homo sapiens carboxykinase [GTP], carboxykinase [GTP],
mitochondrial mitochondrial
466571 ILGLPQPLL 538 546 Exportin-5 Exportin-5 Homo sapiens
466572 ILGNWNMFV 302 310 Reticulocalbin-3 Reticulocalbin-3 Homo sapiens
466573 ILGSFQNIKM 163 172 RNA-binding protein PN01 RNA-binding protein PN01 Homo sapiens
466574 ILGTAQSV 132 139 60S ribosomal protein L12 60S ribosomal protein L12 Homo sapiens
466575 ILGYTEHQVV 273 282 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
466576 ILHDINSDGV 230 239 Nucleobindin-1 Nucleobindin-1 Homo sapiens
466577 ILHEHHIFL 56 64 Hepatocyte growth factor Hepatocyte growth factor Homo sapiens receptor receptor
466578 ILHHHIASV 48 56 Myotubularin-related protein Myotubularin-related protein Homo sapiens
6 6
466579 IUAGGPGNPAL 259 270 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
466580 IUDQGKDDQFL 218 229 S-formylglutathione S-formylglutathione Homo sapiens hydrolase hydrolase
466581 IUDWLVQV 204 212 G2/mitotic-specific cyclin-B1 G2/mitotic-specific cyclin-B1 Homo sapiens
466582 ILKDGIHNV 596 604 Prolow-density lipoprotein Prolow-density lipoprotein Homo sapiens receptor-related protein 1 receptor-related protein 1
466584 ILLDIHIFM 1618 1626 Cytoskeleton-associated Cytoskeleton-associated Homo sapiens protein 5 protein 5
466585 ILLDPGALPAL 374 384 Transforming growth factor Transforming growth factor Homo sapiens beta receptor type 3 beta receptor type 3
466587 ILLELEAPLKI 50 60 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase PP1-beta phosphatase PP1-beta
catalytic subunit catalytic subunit
466588 ILLENLRFHV 116 125 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
466589 ILLGATCGL 266 274 Phosphoglycolate Phosphoglycolate Homo sapiens phosphatase phosphatase
poymerase poymerase Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
467240 KLFAGINSV 1453 1461 Cytoplasmic dynein 2 heavy Cytoplasmic dynein 2 heavy Homo sapiens chain 1 chain 1
467241 KLFANIAEV 38 46 Spermatogenesis- and Spermatogenesis- and Homo sapiens oogenesis-specific basic oogenesis-specific basic
helix-loop-helix-containing helix-loop-helix-containing
protein 2 protein 2
467244 KLFDSDPITV 348 357 Clusterin Clusterin Homo sapiens
467245 KLFDSDPITVTV 348 359 Clusterin Clusterin Homo sapiens
467248 KLFSILSTV 624 632 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 2 protein 2
467249 KLFYADHPFI 379 388 Serpin H1 Serpin H1 Homo sapiens
467250 KLFYADHPFIF 379 389 Serpin H1 Serpin H1 Homo sapiens
467251 KLFYADHPFIFL 379 390 Serpin H1 Serpin H1 Homo sapiens
467253 KLGEIVTTIPTI 38 49 ADP-ribosylation factor 3 ADP-ribosylation factor 3 Homo sapiens
467254 KLGPAPKTL 48 56 Helicase-like transcription Helicase-like transcription Homo sapiens factor factor
467255 KLGPDDPNV 372 380 Kinesin light chain 1 Kinesin light chain 1 Homo sapiens
(UniProt:Q07866)
467256 KLGSYEHRI 190 198 Inter-alpha-trypsin inhibitor Inter-alpha-trypsin inhibitor Homo sapiens heavy chain H2 heavy chain H2
467257 KLHVDPENFRL 96 106 Hemoglobin subunit beta Hemoglobin subunit beta Homo sapiens
(UniProt:P68871)
467258 KUAGKIIPA 884 893 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 1 activating enzyme 1
(UniProt:P22314)
467260 KUFPYVEL 29 37 Isocitrate dehydrogenase Isocitrate dehydrogenase Homo sapiens
[NADP] cytoplasmic [NADP] cytoplasmic
467264 KUPGPLSPV 342 35f Protein PRRC2A Protein PRRC2A Homo sapiens
467265 KUPGPLSPVA 342 352 Protein PRRC2A Protein PRRC2A Homo sapiens
467266 KUPLIFEV 1029 Ϊ037 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ULK4 kinase ULK4
467268 KLKEAVKEESI 663 673 Dynamin-like 120 kDa Dynamin-like 120 kDa Homo sapiens protein, mitochondrial protein, mitochondrial
467269 KLLCGLLAERL 78 88 Macrophage migration Macrophage migration Homo sapiens inhibitory factor inhibitory factor
467270 KLLDGPPGV 1470 1478 Transforming acidic coiled- Transforming acidic coiled- Homo sapiens coil-containing protein 2 coil-containing protein 2
(UniProt:E7EMZ9)
467271 KLLDGPPGVDV 1470 1480 Transforming acidic coiled- Transforming acidic coiled- Homo sapiens coil-containing protein 2 coil-containing protein 2
(UniProt:E7EMZ9)
467272 KLLDILSYL 205 213 Mitochondrial ribonuclease P Mitochondrial ribonuclease P Homo sapiens protein 3 protein 3
467273 KLLDMVGKVQI 102 112 GTP-binding protein Rheb GTP-binding protein Rheb Homo sapiens
467274 KLLEEATISV 51 60 Dymeclin (UniProt:Q7RTS9) Dymeclin Homo sapiens
467275 KLLEEDGTIITL 361 372 Partitioning defective 6 Partitioning defective 6 Homo sapiens homolog beta homolog beta
467276 KLLEKLYKV 36 44 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HERC3 ligase HERC3
467278 KLLETKWTL 93 101 Keratin, type II cytoskeletal 7 Keratin, type II cytoskeletal 7 Homo sapiens
467279 KLLGKLPEL 227 235 Nuclear receptor subfamily 4 Nuclear receptor subfamily 4 Homo sapiens group A member 2 group A member 2
467281 KLLGQFTUGI 484 494 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
467283 KLLPGDIHQI 273 282 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 1 protein 1
467284 KLLQEEVTKV 208 217 Periostin Periostin Homo sapiens
467285 KLLTEKDAQIAM 242 253 Nuclear mitotic apparatus Nuclear mitotic apparatus Homo sapiens protein 1 protein 1
467286 KLMPGTYTL 2860 2868 Fibrillin-2 Fibrillin-2 Homo sapiens
467287 KLMQITSLHSL 398 408 GMP synthase [glutamine- GMP synthase [glutamine- Homo sapiens hydrolyzing] hydrolyzing] Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
467288 KLNDMEPSKAV 138 148 Vesicle-associated Vesicle-associated Homo sapiens membrane protein- membrane protein- associated protein A associated protein A
467289 KLNEINEKI 553 561 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
467290 KLNENYEEV 1187 1195 Centromere-associated Centromere-associated Homo sapiens protein E protein E
467291 KLNEVIRQV 387 395 Adenosylhomocysteinase 2 Adenosylhomocysteinase 2 Homo sapiens
467292 KLNNVNNQL 1549 1557 Zinc finger protein 292 Zinc finger protein 292 Homo sapiens
467297 KLPGAFILGAGA 88 99 Ester hydrolase C11 orf54 Ester hydrolase C11 orf54 Homo sapiens
(UniProt:E9PPB5)
467300 KLPPQSSGV 347 355 Breast cancer anti-estrogen Breast cancer anti-estrogen Homo sapiens resistance protein 3 resistance protein 3
467302 KLQDFKSFL 464 472 Serine Serine Homo sapiens hydroxymethyltransferase, hydroxymethyltransferase,
mitochondrial mitochondrial
(UniProt:P34897)
467303 KLQEALKTI 128 136 Proline-rich protein 1 1 Proline-rich protein 1 1 Homo sapiens
467304 KLQEESDLELA 122 132 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit J initiation factor 3 subunit J
(UniProt:B4DUI3)
467305 KLQESTQTV 461 469 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase MRCK alpha kinase MRCK alpha
467306 KLQEVGQVSV 308 317 Integrin alpha-V Integrin alpha-V Homo sapiens
467307 KLQIVEMPL 252 260 Serpin H1 Serpin H1 Homo sapiens
467308 KLQIVEMPLA 252 261 Serpin H1 Serpin H1 Homo sapiens
467309 KLQLVEMPL 251 259 Serpin H1 Serpin H1 Homo sapiens
467310 KLQLVEMPLA 251 260 Serpin H1 Serpin H1 Homo sapiens
46731 1 KLQPGSVPKI 66 75 Calponin-2 Calponin-2 Homo sapiens
467312 KLQSSEAEV 921 929 Ribosome-binding protein 1 Ribosome-binding protein 1 Homo sapiens
467313 KLSDGVAVLKV 387 397 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
467314 KLSEENRHL 188 196 Vesicle-associated Vesicle-associated Homo sapiens membrane protein- membrane protein- associated protein A associated protein A
467315 KLSELKETV 208 216 Golgin subfamily A member Golgin subfamily A member Homo sapiens
2 2
467317 KLSLVAAMLL 2 11 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
467318 KLSLVAAMLLL 2 12 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
467319 KLSSAMSAA 237 245 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens cytoplasmic cytoplasmic
467320 KLSSKLSAV 401 409 Sorting nexin-17 Sorting nexin-17 Homo sapiens
467321 KLTGMAFRV 873 881 Other Toxoplasma gondii Toxoplasma protein gondii GT1
467322 KLVDQNIFSFYL 53 64 Cathepsin D Cathepsin D Homo sapiens
467323 KLVPFATEL 59 67 Apolipoprotein A-IV Apolipoprotein A-IV Homo sapiens
467324 KLVTDLTKV 65 73 Serum albumin Serum albumin Homo sapiens
(UniProt:P02768)
467325 KLWEFFQVD 297 305 Glycogen debranching Glycogen debranching Homo sapiens enzyme enzyme
467327 KLWTLVSEQTRV 5 16 60S ribosomal protein L27a 60S ribosomal protein L27a Homo sapiens
467329 KLYSPSQIGAFV 145 156 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
467332 KMASLYNIHL 409 418 Molybdenum cofactor Molybdenum cofactor Homo sapiens sulfurase sulfurase
467333 KMDHLMTKV 529 537 FK506-binding protein 15 FK506-binding protein 15 Homo sapiens
467336 KMFAGVSSI 1656 1664 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
467338 KMMANGILKV 138 147 Adenosylhomocysteinase Adenosylhomocysteinase Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
467339 KMMDLEHKV 1122 1130 Chromodomain-helicase- Chromodomain-helicase- Homo sapiens
DNA-binding protein 7 DNA-binding protein 7
467340 KMNEKLYTV 1060 1068 Sister chromatid cohesion Sister chromatid cohesion Homo sapiens protein PDS5 homolog B protein PDS5 homolog B
467343 KMPNGSAGV 124 132 Heat shock 70 kDa protein Heat shock 70 kDa protein Homo sapiens
4L 4L
467344 KMQASIEKA 250 258 Nucleophosmin Nucleophosmin Homo sapiens
467345 KMQESNHLL 1536 1544 Laminin subunit alpha-1 Laminin subunit alpha-1 Homo sapiens
467346 KMSEITKQL 1102 1110 Unconventional myosin-Vc Unconventional myosin-Vc Homo sapiens
467347 KMSVQPTVSL 80 89 Nucleophosmin Nucleophosmin Homo sapiens
467348 KMTDVESGV 7 15 cAMP-dependent protein cAMP-dependent protein Homo sapiens kinase inhibitor beta kinase inhibitor beta
467349 KMTEEEVEMLV 119 129 Myosin light polypeptide 6 Myosin light polypeptide 6 Homo sapiens
467353 KMVVIGAGVIGV 116 127 Dihydrolipoyl Dihydrolipoyl Homo sapiens dehydrogenase, dehydrogenase,
mitochondrial mitochondrial
(UniProt:P09622)
467354 KMWEKAIKL 234 242 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 5 protein 5
467420 KQIVWNGPVGV 331 341 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
467421 KQMGFPUYV 314 323 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:E9PLK3)
467423 KQQASQVLV 29 37 Vitamin K-dependent protein Vitamin K-dependent protein Homo sapiens
S S
467424 KQQSELQSQV 75 84 UM and SH3 domain protein UM and SH3 domain protein Homo sapiens
1 1
467425 KQSNVQILV 132 140 POZ-, AT hook-, and zinc POZ-, AT hook-, and zinc Homo sapiens finger-containing protein 1 finger-containing protein 1
467428 KQVSDUSV 431 439 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX5 RNA helicase DDX5
(UniProt:P17844)
467452 KTIETSPSL 40 48 Fanconi anemia group I Fanconi anemia group I Homo sapiens protein (UniProt:H3BP78) protein
467455 KTILTLTGV 275 283 Phosphoglycolate Phosphoglycolate Homo sapiens phosphatase phosphatase
467461 KVDNDENEHQL 32 42 Retinoic acid receptor alpha Retinoic acid receptor alpha Homo sapiens
(UniProt:A8MUP8)
467463 KVGDAIPAV 15 23 Peroxiredoxin-5, Peroxiredoxin-5, Homo sapiens mitochondrial mitochondrial
467464 KVLDVSDLESV 281 291 Protein phosphatase Protein phosphatase Homo sapiens
Slingshot homolog 3 Slingshot homolog 3
467465 KVLEFLAKV 284 292 Melanoma-associated Melanoma-associated Homo sapiens antigen B4 antigen B4
467466 KVLETLVTV 1475 1483 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 5A protein 5A
467467 KVLEVTEEFGV 48 58 lmportin-9 lmportin-9 Homo sapiens
467469 KVNTPTTTV 139 147 Threonine-tRNA ligase, Threonine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
467472 KVTKDGVTV 72 80 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
467651 KYTDWTEFL 150 158 Scm-like with four MBT Scm-like with four MBT Homo sapiens domains protein 2 domains protein 2
467672 LAASALPAL 128 136 60S ribosomal protein L4 60S ribosomal protein L4 Homo sapiens
(UniProt:P36578)
467694 LAGEIYVMV 326 334 Testin Testin Homo sapiens
467715 LAQANGWGV 299 307 Alpha-enolase Alpha-enolase Homo sapiens
467753 LFQPHLINV 265 273 Actin-related protein 2 Actin-related protein 2 Homo sapiens
467762 LFYADHPFIFL 380 390 Serpin H1 Serpin H1 Homo sapiens
467774 LIDHQTYL 4299 4306 Plectin Plectin Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
467785 LIFDLGGGTFDV 198 209 Heat shock 70 kDa protein 1 - Heat shock 70 kDa protein 1 - Homo sapiens like like
467791 UMEUNNV 151 159 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
467792 UNVGUSV 56 64 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
467798 LLADAVAV 46 53 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
467799 LLAEGTITGV 252 261 DDRGK domain-containing DDRGK domain-containing Homo sapiens protein 1 protein 1
467800 LLAKQPPTA 305 313 Cytoplasmic dynein 1 light Cytoplasmic dynein 1 light Homo sapiens intermediate chain 1 intermediate chain 1
(UniProt:E9PHI6)
467801 LLASINSTV 749 757 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
467802 LLDAAGVASL 520 529 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
46781 1 LLDEQQVNV 56 64 DNA-binding protein inhibitor DNA-binding protein inhibitor Homo sapiens
ID-1 ID-1
467816 LLDGFPRTV 97 105 Adenylate kinase 2, Adenylate kinase 2, Homo sapiens mitochondrial mitochondrial
467826 LLDKVYSSV 129 137 Vacuolar fusion protein Vacuolar fusion protein Homo sapiens
CCZ1 homolog CCZ1 homolog
467829 LLDLFSPSV 268 276 Heat shock factor protein 1 Heat shock factor protein 1 Homo sapiens
467833 LLDNEKPAAV 54 63 Calcyclin-binding protein Calcyclin-binding protein Homo sapiens
467834 LLDNFKPEEL 220 229 Nicotinate-nucleotide Nicotinate-nucleotide Homo sapiens pyrophosphorylase pyrophosphorylase
[carboxylating] [carboxylating]
(UniProt:Q15274)
467851 LLDSVPPTA 514 522 Nucleolar RNA helicase 2 Nucleolar RNA helicase 2 Homo sapiens
467855 LLDTSRHYL 173 181 Beta-hexosaminidase Beta-hexosaminidase Homo sapiens subunit alpha subunit alpha
467859 LLDTWDQVF 700 708 Gelsolin Gelsolin Homo sapiens
467861 LLDVTPLS 393 400 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniProt:P1 1142) protein
467862 LLDVTPNAV 293 301 Tight junction protein ZO-1 Tightjunction protein ZO-1 Homo sapiens
467864 LLDYHLNYL 31 1 319 Fragile X mental retardation Fragile X mental retardation Homo sapiens protein 1 protein 1
467872 LLEGKVLPGV 401 410 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
467882 LLFGSIVAV 1063 1071 Chondroitin sulfate Chondroitin sulfate Homo sapiens proteoglycan 4 proteoglycan 4
467883 LLFPHPVNQV 69 78 Elongator complex protein 1 Homo sapiens
467884 LLFPPAEALQV 168 178 Enoyl-CoA delta isomerase Enoyl-CoA delta isomerase Homo sapiens
1 , mitochondrial 1 , mitochondrial
467887 LLGDALLVHPV 724 734 Neutral alpha-glucosidase Neutral alpha-glucosidase Homo sapiens
AB (UniProt:Q14697) AB
467889 LLGELPRLLL 14 23 Complement decay- Complement decay- Homo sapiens accelerating factor accelerating factor
(UniProt:P08174)
467890 LLGELPRLLLL 14 24 Complement decay- Complement decay- Homo sapiens accelerating factor accelerating factor
(UniProt:P08174)
467892 LLGKDVLFL 87 95 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
467893 LLGKVYVV 289 296 Kelch-like protein 24 Kelch-like protein 24 Homo sapiens
467894 LLGQFTUGI 485 494 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
467895 LLGRIPSAV 257 265 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
(UniProt:Q8N122) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
467942 LLSDVFPGV 2160 2168 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
467943 LLSEADVRA 174 182 Mesothelin Mesothelin Homo sapiens
467944 LLSELAPSL 113 121 COMM domain-containing COMM domain-containing Homo sapiens protein 2 protein 2
467946 LLSPLSVAT 8 16 Pigment epithelium-derived Pigment epithelium-derived Homo sapiens factor factor
467947 LLSPLVLEV 72 80 Keratin, type II cytoskeletal 8 Keratin, type II cytoskeletal 8 Homo sapiens
467948 LLSSVDQPL 39 47 F-actin-capping protein F-actin-capping protein Homo sapiens subunit beta subunit beta
(UniProt:P47756)
467950 LLTDEEDVDMAL 981 992 Nuclear pore complex protein Nuclear pore complex protein Homo sapiens
Nup98-Nup96 Nup98-Nup96
(UniProt:P52948)
467951 LLTEEEFLSFL 112 122 45 kDa calcium-binding 45 kDa calcium-binding Homo sapiens protein (UniProt:Q9BRK5) protein
467952 LLTEMIHEA 73 81 Mitochondrial-processing Mitochondrial-processing Homo sapiens peptidase subunit alpha peptidase subunit alpha
(UniProt:Q10713)
467953 LLTTAEVVV 529 537 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
467954 LLTTQSPSV 510 518 U3 small nucleolar RNA- U3 small nucleolar RNA- Homo sapiens associated protein 14 associated protein 14
homolog A homolog A
467955 LLWAGSAGL 33 41 cDNA, FLJ78849, highly cDNA, FLJ78849, highly Homo sapiens similar to 1-acyl-sn-glycerol- similar to 1-acyl-sn-glycerol- 3-phosphate acyltransferase 3-phosphate acyltransferase alpha (EC 2.3.1 .51) alpha (EC 2.3.1.51 )
467956 LLWALEPEKPLV 80 91 Acyl-coenzyme A Acyl-coenzyme A Homo sapiens thioesterase 2, mitochondrial thioesterase 2, mitochondrial
467959 LLYDRSWMV 610 618 Molybdenum cofactor Molybdenum cofactor Homo sapiens sulfurase sulfurase
467960 LLYGKYVSV 156 164 Transmembrane protein 222 Transmembrane protein 222 Homo sapiens
467962 LLYPTEITV 798 806 Integrin alpha-3 Integrin alpha-3 Homo sapiens
467963 LLYSFPVV 284 291 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens cytoplasmic cytoplasmic
467964 LLYSFPVVI 284 292 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens cytoplasmic cytoplasmic
467965 LMADVHFVV 6 14 BTB/POZ domain-containing BTB/POZ domain-containing Homo sapiens protein 6 protein 6
467966 LMAEEVQAV 1162 1170 Spectrin alpha chain, non- Spectrin alpha chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
467973 LMKLSHETV 7 15 Small nuclear Small nuclear Homo sapiens ribonucleoprotein Sm D1 ribonucleoprotein Sm D1
467974 LMNGSESRFFV 150 160 Basigin (UniProt:P35613) Basigin Homo sapiens
467975 LMNPNIASV 461 469 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
467977 LMTTVHAI 174 181 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
467978 LMTTVHAITA 174 183 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
468315 LQEMVHQV 773 780 Enhancer of filamentation 1 Enhancer of filamentation 1 Homo sapiens
468451 LTIDDGIFEV 141 150 UniProt:E7EP94 Homo sapiens
468453 LTNDWEDHLAV 216 226 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens beta beta
468455 LTPDNVANL 274 282 Symplekin Symplekin Homo sapiens
468476 LVEDFLSGFQV 151 161 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 1 activating enzyme 1
(UniProt:P22314)
468478 LVFDLGGGTFDV 221 232 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
468479 LVGTVTKPV 3010 3018 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13D associated protein 13D
468482 LVLEVDPNIQA 76 86 Keratin, type II cytoskeletal 8 Keratin, type II cytoskeletal 8 Homo sapiens
468483 LVLEVDPNIQAV 76 87 Keratin, type II cytoskeletal 8 Keratin, type II cytoskeletal 8 Homo sapiens
468702 MLAEKLPNLT 89 98 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
468703 MLAEKLPNLTHL 89 100 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
468706 MLAEVNATI 218 226 Signal transducer and Signal transducer and Homo sapiens activator of transcription 5B activator of transcription 5B
468707 MLANDIARLMV 326 336 EH domain-containing EH domain-containing Homo sapiens protein 1 protein 1
468708 MLAVDAVIAEL 136 146 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
46871 1 MLDEPTNHL 315 323 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 1 family F member 1
468715 MLDNLLDIEV 103 112 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 1 polymerase 1
468722 MLKEWEKFQEEA 203 214 Threonine-tRNA ligase, Threonine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
468723 MLLDTWDQVF 699 708 Gelsolin Gelsolin Homo sapiens
468725 MLLGASLVGV 1 10 Long-chain fatty acid Long-chain fatty acid Homo sapiens transport protein 4 transport protein 4
(UniProt:Q6P1 M0)
468727 MLMGFKPLVLL 213 223 X-ray repair cross- X-ray repair cross- Homo sapiens complementing protein 6 complementing protein 6
468731 MLQDFQIQA 356 364 V-type proton ATPase V-type proton ATPase Homo sapiens subunit SI (UniProt:Q15904) subunit SI
468732 MLQGVDLLADA 40 50 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
468733 MLSEVLQYI 239 247 Transcriptional adapter 2- Transcriptional adapter 2- Homo sapiens alpha alpha
468734 MLVSGAGDIKL 46 56 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens zeta zeta
468735 MLWGSDPYPHA 482 492 Protein PRRC2C Protein PRRC2C Homo sapiens
468736 MLYEGFYDV 242 250 Fanconi anemia group I Fanconi anemia group I Homo sapiens protein (UniProt:H3BP78) protein
468737 MLYGRIGYIYA 151 161 LanC-like protein 1 LanC-like protein 1 Homo sapiens
468738 MMDLQHGSLFL 61 71 L-lactate dehydrogenase A L-lactate dehydrogenase A Homo sapiens chain chain
468739 MMDVDHQI 5 12 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens epsilon (UniProt:P48643) epsilon
468743 MMVGDLLEV 1454 1462 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5A 5A
468857 MTADAAKRLNV 296 306 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
468886 MTLGQIYYL 183 191 Transmembrane emp24 Transmembrane emp24 Homo sapiens domain-containing protein 2 domain-containing protein 2
468990 NIGDLASILKV 26 36 Cleavage stimulation factor Cleavage stimulation factor Homo sapiens subunit 3 subunit 3
468991 NIMDIKIGLL 853 862 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP3 protein IQGAP3
468992 NIMDIKIGLLV 896 906 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP3 protein IQGAP3
468996 NISPFSFGL 179 187 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0 (UniProt:P05388) P0
468998 NLAAYVPLL 1102 1110 Tuberin (UniProt:P49815) Tuberin Homo sapiens
468999 NLAEELEGV 83 91 Nestin Nestin Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
469004 NLEFLSUNV 50 59 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
469005 NLFDISTEEGST 31 42 Protein RRP5 homolog Protein RRP5 homolog Homo sapiens
469006 NLFGRGMDIERV 237 248 Spliceosome RNA helicase Spliceosome RNA helicase Homo sapiens
DDX39B DDX39B
469007 NLFPGLKEAFVV 767 778 Coatomer subunit beta' Coatomer subunit beta' Homo sapiens
(UniProt:P35606)
469009 NUSLLEVL 43 51 Plectin Plectin Homo sapiens
469010 NLKAAQEEYV 182 191 Fructose-bisphosphate Fructose-bisphosphate Homo sapiens aldolase A aldolase A
46901 1 NLLDLLLIHEV 136 146 Glutathione S-transferase P Glutathione S-transferase P Homo sapiens
(UniProt:P0921 1)
469012 NLLDLLTEV 282 290 Protein unc-45 homolog A Protein unc-45 homolog A Homo sapiens
469013 NLLDLLTEVGV 282 292 Protein unc-45 homolog A Protein unc-45 homolog A Homo sapiens
469014 NLMDIKIGLL 339 348 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
469015 NLMDIKIGLLV 339 349 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
469016 NLPAPHIMPGV 321 331 Golgi reassembly-stacking Golgi reassembly-stacking Homo sapiens protein 2 protein 2
469018 NLWGGQGLLGV 88 98 Golgi reassembly-stacking Golgi reassembly-stacking Homo sapiens protein 2 protein 2
469019 NLYGSHPFYL 87 96 Lysosomal alpha- Lysosomal alpha- Homo sapiens glucosidase glucosidase
469020 NLYSDDIPHA 60 69 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit E initiation factor 3 subunit E
469113 NTAVVPQGWSV 182 192 UniProt:E9PGM5 Homo sapiens
469269 PLDPGGHLHLL 237 247 GDP-D-glucose GDP-D-glucose Homo sapiens phosphorylase 1 phosphorylase 1
469270 PLMSEDEUNI 88 98 Multiple coagulation factor Multiple coagulation factor Homo sapiens deficiency protein 2 deficiency protein 2
469466 QFINFPIYV 252 260 Endoplasmin Endoplasmin Homo sapiens
469491 QLADLYKSFI 274 283 Alpha-enolase Alpha-enolase Homo sapiens
469492 QLAEMLPGV 79 87 Protein NDRG1 Protein NDRG1 Homo sapiens
469502 QLEEEGITFV 169 178 SEC14-like protein 1 SEC14-like protein 1 Homo sapiens
469504 QLFDDESDPFEV 19 30 Plasminogen activator Plasminogen activator Homo sapiens inhibitor 1 RNA-binding inhibitor 1 RNA-binding
protein protein
469505 QLFEDLVYL 151 159 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ATR kinase ATR
469507 QUSKIPHI 328 336 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 5 initiation factor 5
469508 QLLAERSLAPT 591 601 Inter-alpha-trypsin inhibitor Inter-alpha-trypsin inhibitor Homo sapiens heavy chain H2 heavy chain H2
469509 QLLDNPARV 876 884 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 1 ATPase regulatory subunit 1
469510 QLLGSAHEV 1227 1235 Spectrin alpha chain, non- Spectrin alpha chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
46951 1 QLLPLVFEV 645 653 lmportin-7 lmportin-7 Homo sapiens
469514 QLMHNIRDIDV 207 217 Alkaline phosphatase, tissue- Alkaline phosphatase, tissue- Homo sapiens nonspecific isozyme nonspecific isozyme
469515 QLMSUINT 23 31 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens beta beta
469518 QLNADEISL 466 474 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 2 initiation factor 4 gamma 2
469526 QLQDFYQEV 437 445 Inter-alpha-trypsin inhibitor Inter-alpha-trypsin inhibitor Homo sapiens heavy chain H4 heavy chain H4
469528 QLSEIQTQI 399 407 Keratin, type I cytoskeletal 24 Keratin, type I cytoskeletal 24 Homo sapiens
469530 QLWNGIISI 352 360 Multiple C2 and Multiple C2 and Homo sapiens transmembrane domain- transmembrane domain- containing protein 2 containing protein 2
469531 QLYPISIF 844 851 Disks large homolog 1 Disks large homolog 1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
470172 RVFSSSQGVEQV 44 55 U6 snRNA-associated Sm- U6 snRNA-associated Sm- Homo sapiens like protein LSm8 like protein LSm8
470173 RVIISAPSA 118 126 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
470175 RVLANPGNSQV 42 52 Importin subunit beta-1 Importin subunit beta-1 Homo sapiens
470176 RVLSIGDGIARV 23 34 ATP synthase subunit alpha, ATP synthase subunit alpha, Homo sapiens mitochondrial mitochondrial
470178 RVPTANVSV 234 242 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
470376 SASLLWNFI 1533 1541 Protein transport protein Protein transport protein Homo sapiens
Sec16A Sec16A
470437 SIADLLPAL 31 1 319 Phosphoglycolate Phosphoglycolate Homo sapiens phosphatase phosphatase
470439 SIDIPSGWDV 165 174 NAD(P)H-hydrate epimerase NAD(P)H-hydrate epimerase Homo sapiens
(UniProt:Q8NCW5)
470441 SIFDGFADGLGV 551 562 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
Praja-2 Praja-2
470442 SIFGLAPSKA 392 401 Intestinal-type alkaline Intestinal-type alkaline Homo sapiens phosphatase phosphatase
470443 SIFGLGLAYA 481 490 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 2 ATPase regulatory subunit 2
470444 SIGEPTVPSTL 253 263 Hyd roxyacyl g I u tath i on e Hydroxyacylglutathione Homo sapiens hydrolase, mitochondrial hydrolase, mitochondrial
(UniProt:Q16775)
470445 SIHKFVPYL 452 460 lnosine-5'-monophosphate lnosine-5'-monophosphate Homo sapiens dehydrogenase 2 dehydrogenase 2
470446 SIIDFYPEDFA 254 264 5'-3' exoribonuclease 2 5'-3' exoribonuclease 2 Homo sapiens
470447 SIIMLEALERV 66 76 Small nuclear Small nuclear Homo sapiens ribonucleoprotein G ribonucleoprotein G
(UniProt:P62308)
470450 SILTIDDGIFEV 139 150 UniProt:E7EP94 Homo sapiens
470451 SILTIEDGIFEV 165 176 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniPro P11142) protein
470453 SIMGIGPIPA 291 300 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, cytosolic acetyltransferase, cytosolic
470454 SIQSIVPAL 244 252 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
470455 SIQSIVPALEI 244 254 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
470459 SISSTPPAV 260 268 Golgi reassembly-stacking Golgi reassembly-stacking Homo sapiens protein 2 protein 2
470463 SIYQFUAV 2 10 Flap endonuclease 1 Flap endonuclease 1 Homo sapiens
470467 SLAAFLPDL 373 381 Extracellular serine/threonine Extracellular serine/threonine Homo sapiens protein kinase FAM20C protein kinase FAM20C
470468 SLAAFLPDLSLA 373 384 Extracellular serine/threonine Extracellular serine/threonine Homo sapiens protein kinase FAM20C protein kinase FAM20C
470469 SLAANTFTI 126 134 Transcription factor BTF3 Transcription factor BTF3 Homo sapiens
470471 SLAAPTWLV 1870 1878 Protein transport protein Protein transport protein Homo sapiens
Sec16A Sec16A
470472 SLAAVSGTAA 189 198 Interferon regulatory factor 2- Interferon regulatory factor 2- Homo sapiens binding protein 2 binding protein 2
470473 SLADELALV 43 51 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
470474 SLADELALVDV 43 53 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
470475 SLADELALVDVL 43 54 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
470476 SLADLMPRV 91 99 Superkiller viralicidic activity Superkiller viralicidic activity Homo sapiens
2-like 2 2-like 2
470477 SLADLQNDEVAF 70 81 40S ribosomal protein S3a 40S ribosomal protein S3a Homo sapiens
(UniProt:P61247) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
470478 SLADVIIHEI 318 327 Aminopeptidase B Aminopeptidase B Homo sapiens
470480 SLAEKVIPA 618 626 Glycogen phosphorylase, Glycogen phosphorylase, Homo sapiens liver form liver form
470481 SLAELPAIM 346 354 Cystathionine gamma-lyase Cystathionine gamma-lyase Homo sapiens
470482 SLAEVNTQI 112 120 Centrosome-associated Centrosome-associated Homo sapiens protein CEP250 protein CEP250
(UniProt:Q9BV73)
470483 SLAGSSGPGA 426 435 Elongation factor 1 -delta Elongation factor 1 -delta Homo sapiens
(UniProt:E9PRY8)
470484 SLAPAGVIRV 81 90 T-cell leukemia homeobox T-cell leukemia homeobox Homo sapiens protein 3 protein 3
470485 SLAPIIVFV 108 116 Voltage-dependent L-type Voltage-dependent L-type Homo sapiens calcium channel subunit calcium channel subunit
beta-3 beta-3
470486 SLAPIIVYV 388 396 Voltage-dependent L-type Voltage-dependent L-type Homo sapiens calcium channel subunit calcium channel subunit
beta-2 beta-2
470487 SLAPQIKVI 134 142 Argininosuccinate synthase Argininosuccinate synthase Homo sapiens
(UniProt:P00966)
470488 SLASLPPLHV 983 992 Dynactin subunit 1 Dynactin subunit 1 Homo sapiens
(UniProt:Q14203)
470489 SLASVIFLL 26 34 7-dehydrocholesterol 7-dehydrocholesterol Homo sapiens reductase (UniProt:Q9UBM7) reductase
470490 SLAVDPNGIYL 681 691 Striatin-3 Striatin-3 Homo sapiens
470492 SLDDFQAWL 1073 1081 Spectrin beta chain, non- Spectrin beta chain, non- Homo sapiens erythrocytic 2 erythrocytic 2
470493 SLDDLLTNV 3 11 Epoxide hydrolase 1 Epoxide hydrolase 1 Homo sapiens
470494 SLDDSVDETEAV 79 90 Serrate RNA effector Serrate RNA effector Homo sapiens molecule homolog molecule homolog
470495 SLDDTELRL 46 54 Radical S-adenosyl Radical S-adenosyl Homo sapiens methionine domain- methionine domain- containing protein 1 , containing protein 1 ,
mitochondrial mitochondrial
(UniProt:B4DMW0)
470496 SLDDVEGMSV 68 77 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF34 RNF34
470498 SLDEDSEFTL 304 313 Nucleosome assembly Nucleosome assembly Homo sapiens protein 1 -like 4 protein Mike 4
470499 SLDEDSEFTLA 304 314 Nucleosome assembly Nucleosome assembly Homo sapiens protein 1 -like 4 protein Mike 4
470500 SLDEELDRV 345 353 Stomatin-like protein 2, Stomatin-like protein 2, Homo sapiens mitochondrial mitochondrial
(UniProt:Q9UJZ1)
470501 SLDEIEQVILV 373 383 Hypoxia up-regulated protein Hypoxia up-regulated protein Homo sapiens
1 1
470502 SLDESTQESKL 74 84 BR01 domain-containing BR01 domain-containing Homo sapiens protein BROX protein BROX
470504 SLDGAPIGV 550 558 Band 4.1 -like protein 2 Band 4.1 -like protein 2 Homo sapiens
(UniProt:043491)
470506 SLDGIPFTV 508 516 Lipoma-preferred partner Lipoma-preferred partner Homo sapiens
470507 SLDGKAIKV 73 81 RNA-binding motif protein, X RNA-binding motif protein, X Homo sapiens chromosome chromosome
(UniProt:P38159)
470508 SLDKFLASVSTV 124 135 Hemoglobin subunit alpha Hemoglobin subunit alpha Homo sapiens
470510 SLDKTSPEM 1126 1134 Telomere-associated protein Telomere-associated protein Homo sapiens
RIF1 RIF1
47051 1 SLDLDGIIAEV 86 96 Keratin, type II cytoskeletal 7 Keratin, type II cytoskeletal 7 Homo sapiens
470513 SLDLFNCEV 117 125 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
470514 SLDLSSPNM 2222 2230 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
470515 SLDMDSIIAEV 253 263 Keratin, type II cytoskeletal 8 Keratin, type II cytoskeletal 8 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
470620 SLLDSVVGL 1472 1480 Protein virilizer homolog Protein virilizer homolog Homo sapiens
470621 SLLDTLSPA 109 117 GSK3-beta interaction GSK3-beta interaction Homo sapiens protein protein
470623 SLLEEFDFHV 77 86 General vesicular transport General vesicular transport Homo sapiens factor p115 factor p1 15
470624 SLLEFNTTV 30 38 Cation-independent Cation-independent Homo sapiens mannose-6-phosphate mannose-6-phosphate
receptor receptor
470626 SLLEVLSGDSL 215 225 Plectin Plectin Homo sapiens
470627 SLLEVNEESTV 82 92 Gamma-interferon-inducible Gamma-interferon-inducible Homo sapiens protein 16 protein 16
470630 SLLGATVTV 230 238 BRCA1 -associated ATM BRCA1 -associated ATM Homo sapiens activator 1 activator 1
470631 SLLGGNIRLLL 439 449 Long-chain-fatty-acid-CoA Long-chain-fatty-acid-CoA Homo sapiens ligase 3 ligase 3
470632 SLLGHLMI 71 78 Histidine triad nucleotide- Histidine triad nucleotide- Homo sapiens binding protein 1 binding protein 1
(UniProt:P49773)
470633 SLLGHLMIVG 71 80 Histidine triad nucleotide- Histidine triad nucleotide- Homo sapiens binding protein 1 binding protein 1
(UniProt:P49773)
470634 SLLGKDVLF 86 94 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
470635 SLLGKDVLFL 86 95 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
470637 SLUDVITV 122 130 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein VTA1 associated protein VTA1
homolog homolog
470638 SLLPFWYT 757 764 Neutral alpha-glucosidase Neutral alpha-glucosidase Homo sapiens
AB (UniProt:Q14697) AB
470639 SLLPFWYTL 465 473 Neutral alpha-glucosidase Neutral alpha-glucosidase Homo sapiens
AB (UniProt:Q14697) AB
470640 SLLPGKLPTLV 560 570 WASH complex subunit WASH complex subunit Homo sapiens
FAM21A (UniProt:Q641Q2) FAM21A
470641 SLLPGKLPTSV 560 570 WASH complex subunit WASH complex subunit Homo sapiens
FAM21 C FAM21 C
470642 SLLPKLHIV 146 154 Chloride intracellular channel Chloride intracellular channel Homo sapiens protein 3 protein 3
470643 SLLQDGEFSMDL 75 86 Profilin-1 Profilin-1 Homo sapiens
470644 SLLSDPIPEV 606 615 Regulatory-associated Regulatory-associated Homo sapiens protein of mTOR protein of mTOR
(UniProt:Q8N122)
470645 SLLSEADVRA 173 182 Mesothelin Mesothelin Homo sapiens
470646 SLLSEADVRAL 173 183 Mesothelin Mesothelin Homo sapiens
470648 SLLSNLDEV 554 562 Programmed cell death 6- Programmed cell death 6- Homo sapiens interacting protein interacting protein
470650 SLLTHNENM 136 144 60S ribosomal protein L10a 60S ribosomal protein L10a Homo sapiens
470651 SLLTHNENMVA 136 146 60S ribosomal protein L10a 60S ribosomal protein L10a Homo sapiens
470652 SLLTIDNGVFEV 210 221 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
470654 SLLTIQEVDEFL 99 110 DNA ligase 3 DNA ligase 3 Homo sapiens
470656 SLLTTAEVVV 528 537 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
470658 SLMADLEGL 371 379 AP-3 complex subunit beta-1 AP-3 complex subunit beta-1 Homo sapiens
470659 SLMADLEGLHL 371 381 AP-3 complex subunit beta-1 AP-3 complex subunit beta-1 Homo sapiens
470661 SLMDDYLGLV 162 171 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit RPB7 polymerase II subunit RPB7
470662 SLMDGLGAKV 629 638 Protocadherin Fat 1 Protocadherin Fat 1 Homo sapiens
470663 SLMDPNKFLLL 683 693 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR1 UBR1
470667 SLMEQVSGVEA 11 10 1120 Insulin receptor substrate 2 Insulin receptor substrate 2 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
470714 SLSGPPEKV 585 593 Putative ATP-dependent Putative ATP-dependent Homo sapiens
RNA helicase DHX57 RNA helicase DHX57
470715 SLSKLGDVYV 152 161 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
470716 SLSMVNHRL 731 739 Integrin alpha-3 Integrin alpha-3 Homo sapiens
470717 SLSNESNKV 802 810 Glycogen phosphorylase, Glycogen phosphorylase, Homo sapiens liver form liver form
470718 SLSNLQVTQPTV 113 124 40S ribosomal protein S17 40S ribosomal protein S17 Homo sapiens
470719 SLSRVNTTL 2042 2050 Laminin subunit alpha-1 Laminin subunit alpha-1 Homo sapiens
470720 SLSTAAGAAEL 249 259 Interferon regulatory factor 2- Interferon regulatory factor 2- Homo sapiens binding protein 2 binding protein 2
470721 SLTEYLQNV 645 653 Kinesin-1 heavy chain Kinesin-1 heavy chain Homo sapiens
470722 SLTNDWEDHLA 215 225 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens beta beta
470723 SLTNDWEDHLAV 215 226 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens beta beta
470724 SLTSKIPAL 493 501 Ubiquitin-associated protein Ubiquitin-associated protein Homo sapiens
2-like (UniProt:Q14157) 2-like
470725 SLTSKIPALAV 407 417 Ubiquitin-associated protein Ubiquitin-associated protein Homo sapiens
2-like (UniProt:Q14157) 2-like
470726 SLTSQPHQV 110 118 Ragulator complex protein Ragulator complex protein Homo sapiens
LAMTOR1 LAMTOR1
470727 SLVEVNPAYSV 95 105 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TM129 TM129
470728 SLVGKDVVVEL 9 19 U6 snRNA-associated Sm- U6 snRNA-associated Sm- Homo sapiens like protein LSm2 like protein LSm2
470730 SLVSPASFENV 39 49 Ras-related C3 botulinum Ras-related C3 botulinum Homo sapiens toxin substrate 1 toxin substrate 1
470732 SLYDEVAAQGEV 753 764 Bifunctional Bifunctional Homo sapiens glutamate/proline-tRNA glutamate/proline-tRNA
ligase ligase
470734 SLYDILARGASV 161 172 Beta-galactosidase Beta-galactosidase Homo sapiens
(UniProt:E7EQ29)
470736 SLYEGIDFYTS 286 296 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniPro P11142) protein
470737 SLYEGIDFYTSI 286 297 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniProt:P1 1142) protein
470739 SLYGGNAVV 3 11 Renin receptor Renin receptor Homo sapiens
470740 SLYGGNAVVEL 241 251 Renin receptor Renin receptor Homo sapiens
470741 SLYGGNAVVELV 3 14 Renin receptor Renin receptor Homo sapiens
470743 SLYGGTIT 83 90 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
BRE1A BRE1A
470744 SLYIKDIWL 2196 2204 Nucleolar pre-ribosomal- Nucleolar pre-ribosomal- Homo sapiens associated protein 1 associated protein 1
470745 SLYKNKEIFL 92 101 Endoplasmin Endoplasmin Homo sapiens
470746 SLYNEELVSM 349 358 Argininosuccinate synthase Argininosuccinate synthase Homo sapiens
(UniProt:P00966)
470747 SLYNEELVSMNV 349 360 Argininosuccinate synthase Argininosuccinate synthase Homo sapiens
(UniProt:P00966)
470748 SLYPIAVLI 9 17 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2A 65 kDa phosphatase 2A 65 kDa
regulatory subunit A alpha regulatory subunit A alpha
isoform isoform
470749 SLYPLTFIQ 269 277 Beta-galactosidase Beta-galactosidase Homo sapiens
(UniProt:E7EQ29)
470750 SLYPLTFIQV 400 409 Beta-galactosidase Beta-galactosidase Homo sapiens
(UniProt:P16278)
470751 SLYPSLEDLKV 2 12 Syntenin-1 (UniProt:O00560) Syntenin-1 Homo sapiens
470752 SLYRPALEEL 69 78 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 2 ATPase regulatory subunit 2
470753 SLYSEKEVFI 74 83 Heat shock protein 75 kDa, Heat shock protein 75 kDa, Homo sapiens mitochondrial mitochondrial Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
470754 SLYTILTYI 20 28 Long-chain-fatty-acid--CoA Long-chain-fa tty-acid-CoA Homo sapiens ligase 3 ligase 3
470755 SMAEVDAAM 19 27 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoproteins A2/B1 ribonucleoproteins A2/B1
470757 SMDENLMHI 161 169 Argininosuccinate synthase Argininosuccinate synthase Homo sapiens
(UniProt:P00966)
470758 SMDEYVHQI 525 533 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX59 RNA helicase DDX59
470759 SMDNFNWGV 1199 1207 Protein furry homolog Protein furry homolog Homo sapiens
470762 SMGGKVPPA 37 45 Hsc70-interacting protein Hsc70-interacting protein Homo sapiens
470764 SMIFSIPYI 161 169 Acylpyruvase FAHD1 , Acylpyruvase FAHD1 , Homo sapiens mitochondrial mitochondrial
470765 SMLEQGKEPWTV 633 644 Zinc finger protein 729 Zinc finger protein 729 Homo sapiens
(UniProt:M0QY45)
470766 SMLNDIAAV 452 460 Fatty acid synthase Fatty acid synthase Homo sapiens
470767 SMMDPNHFL 223 231 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR2 UBR2
470768 SMMDVDHQIA 4 13 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens epsilon (UniProt:P48643) epsilon
470769 SMPDIDLNL 2580 2588 Neuroblast differentiation- Neuroblast differentiation- Homo sapiens associated protein AHNAK associated protein AHNAK
470770 SMSDIDLNL 4392 4400 Neuroblast differentiation- Neuroblast differentiation- Homo sapiens associated protein AHNAK associated protein AHNAK
470771 SMSEVDLNV 570 578 Neuroblast differentiation- Neuroblast differentiation- Homo sapiens associated protein AHNAK associated protein AHNAK
470772 SMSGPUGV 629 637 Unhealthy ribosome Unhealthy ribosome Homo sapiens biogenesis protein 2 homolog biogenesis protein 2 homolog
470773 SMSRSPPTV 52 60 NAD(P)H-hydrate epimerase NAD(P)H-hydrate epimerase Homo sapiens
(UniProt:Q8NCW5)
470774 SMVEDITGLRL 2792 2802 Desmoplakin Desmoplakin Homo sapiens
470776 SMWDDINNVGL 114 124 Dehyd rogenase/ red uctase Dehydrogenase/reductase Homo sapiens
(SDR family) member 1 , (SDR family) member 1 ,
isoform CRA_b isoform CRA_b
471255 SQADVIPAV 515 523 Molybdenum cofactor Molybdenum cofactor Homo sapiens sulfurase sulfurase
471261 SQPDLLHQL 528 536 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5A 5A
471262 SQQEIQHIV 28 36 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 1 complex subunit 1
(UniProt:A5YKK6)
471307 SSSEVISQHLV 528 538 Nucleoprotein TPR Nucleoprotein TPR Homo sapiens
471330 STFDAGAGIAL 293 303 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
471332 STHGKFHGTV 51 60 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
471337 SVADLIESM 255 263 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
471338 SVADLIESML 255 264 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
471339 SVAGEVVFNTGL 66 77 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
471349 SVFKLLPQL 141 149 Acidic leucine-rich nuclear Acidic leucine-rich nuclear Homo sapiens phosphoprotein 32 family phosphoprotein 32 family
member B member B
471350 SVFLFNTENKL 55 65 Isopentenyl-diphosphate Isopentenyl-diphosphate Homo sapiens
Delta-isomerase 1 Delta-isomerase 1
471351 SVLGAITSV 70 78 Other Homo sapiens Eukaryotic peptide chain Homo sapiens
(human) protein release factor subunit 1
471352 SVLGDILGSAM 949 959 Alpha-2-macroglobulin Alpha-2-macroglobulin Homo sapiens
471353 SVLPKPALV 408 416 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
471680 TLANGVLASLNL 390 401 Programmed cell death 6- Programmed cell death 6- Homo sapiens interacting protein interacting protein
471683 TLASDMQWKV 87 96 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 1 subunit 1
471686 TLAYLLPAI 135 143 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX17 RNA helicase DDX17
471687 TLAYLLPAIV 135 144 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX17 RNA helicase DDX17
471688 TLDAAISKV 1123 1131 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
471689 TLDDIKEWL 123 131 Lupus La protein Lupus La protein Homo sapiens
471690 TLDDVQAF 474 481 Molybdenum cofactor Molybdenum cofactor Homo sapiens sulfurase sulfurase
471691 TLDDVQAFL 474 482 Molybdenum cofactor Molybdenum cofactor Homo sapiens sulfurase sulfurase
471692 TLDEAFEEL 214 222 Tripartite motif-containing Tripartite motif-containing Homo sapiens protein 44 protein 44
471695 TLDEILDETQHL 98 109 Transcription initiation factor Transcription initiation factor Homo sapiens
HE subunit beta HE subunit beta
471696 TLDELSQGTTTV 1543 1554 Epiplakin Epiplakin Homo sapiens
471699 TLDGTISVV 340 348 Plasma alpha-L-fucosidase Plasma alpha-L-fucosidase Homo sapiens
(UniProt:Q9BTY2)
471700 TLDGVKSWL 77 85 ATP-citrate synthase ATP-citrate synthase Homo sapiens
471701 TLDHPIIPA 1295 1303 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
471702 TLDLSNNQL 26 34 Leucine-rich repeat- Leucine-rich repeat- Homo sapiens containing protein 47 containing protein 47
471703 TLDPAIVSA 384 392 Caprin-1 Caprin-1 Homo sapiens
471704 TLDPETGLLFL 2936 2946 Epiplakin Epiplakin Homo sapiens
471706 TLDPHNVDYL 277 286 Alkaline phosphatase, tissue- Alkaline phosphatase, tissue- Homo sapiens nonspecific isozyme nonspecific isozyme
471708 TLDPSLMEM 302 310 Intestinal-type alkaline Intestinal-type alkaline Homo sapiens phosphatase phosphatase
47171 1 TLDSLSIHQL 24 33 DNA-binding protein DNA-binding protein Homo sapiens
RFXANK RFXANK
471712 TLDSLSIHQLA 24 34 DNA-binding protein DNA-binding protein Homo sapiens
RFXANK RFXANK
471714 TLDVFNITI 392 400 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13A associated protein 13A
471716 TLEGTPVFV 682 690 C-1 -tetrahydrofolate C-1-tetrahydrofolate Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
(UniProt:F5H2F4)
471717 TLFATEDALEV 521 531 Unconventional myosin-lc Unconventional myosin-lc Homo sapiens
471718 TLFATGKWVGV 33 43 Dynactin subunit 1 Dynactin subunit 1 Homo sapiens
(UniProt:Q14203)
471719 TLFDILVAGGML 69 80 Basic leucine zipper and W2 Basic leucine zipper and W2 Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:C9IZ80)
471720 TLFGFLGKIDEL 51 62 Serine/arginine-rich splicing Serine/arginine-rich splicing Homo sapiens factor 1 1 factor 11
471721 TLFGGEVCKV 677 686 Lamina-associated Lamina-associated Homo sapiens polypeptide 2, isoform alpha polypeptide 2, isoform alpha
471722 TLFGMITAV 434 442 Solute carrier family 23 Solute carrier family 23 Homo sapiens member 1 member 1
471724 TLFSLGUSV 1321 1330 General transcription factor General transcription factor Homo sapiens
3C polypeptide 1 3C polypeptide 1
471725 TLGEIPTYGLA 519 529 Horn s 1 Horn s 1 Homo sapiens
471726 TLGFSVEGPSQA 608 619 Filamin-A Filamin-A Homo sapiens
471727 TLGGLEMELRL 269 279 Hypoxia up-regulated protein Hypoxia up-regulated protein Homo sapiens
1 1
ATPase IB ATPase IB Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
471764 TLLEISDLNEL 75 85 39S ribosomal protein L12, 39S ribosomal protein L12, Homo sapiens mitochondrial mitochondrial
471765 TLLEISDLNELL 75 86 39S ribosomal protein L12, 39S ribosomal protein L12, Homo sapiens mitochondrial mitochondrial
471766 TLLEKDYF 849 856 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 4 regulatory phosphatase 4 regulatory
subunit 1 subunit 1
471767 TLLEVGQIAV 5416 5425 Midasin Midasin Homo sapiens
471768 TLLGFDDFV 10 18 U6 snRNA-associated Sm- U6 snRNA-associated Sm- Homo sapiens like protein LSm5 like protein LSm5
471769 TLLGFDDFVNM 10 20 U6 snRNA-associated Sm- U6 snRNA-associated Sm- Homo sapiens like protein LSm5 like protein LSm5
471770 TLLGFDDFVNMV 10 21 U6 snRNA-associated Sm- U6 snRNA-associated Sm- Homo sapiens like protein LSm5 like protein LSm5
471772 TLUKTVET 329 337 Vimentin Vimentin Homo sapiens
471773 TLLNSEVHM 31 39 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit RPB4 polymerase II subunit RPB4
471774 TLLNSEVHMLL 31 41 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit RPB4 polymerase II subunit RPB4
471775 TLLPDUQKV 786 795 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:P55786)
471776 TLLPDUQKVLT 601 612 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:E9PLK3)
471777 TLLSEIAEL 266 274 Trinucleotide repeat- Trinucleotide repeat- Homo sapiens containing gene 18 protein containing gene 18 protein
(UniProt:H9KVB4)
471778 TLLSEIAELEL 266 276 Trinucleotide repeat- Trinucleotide repeat- Homo sapiens containing gene 18 protein containing gene 18 protein
(UniProt:H9KVB4)
471779 TLLSNLEEA 9 17 Clusterin Clusterin Homo sapiens
471780 TLLTLTGNYL 673 682 Hepatocyte growth factor Hepatocyte growth factor Homo sapiens receptor receptor
471781 TLMDLSTKA 605 613 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
471782 TLMDLSTKAFAM 605 616 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
471783 TLMEDVENSF 75 84 Palmitoyl-protein Palmitoyl-protein Homo sapiens thioesterase 1 thioesterase 1
471784 TLMEDVENSFF 75 85 Palmitoyl-protein Palmitoyl-protein Homo sapiens thioesterase 1 thioesterase 1
471785 TLMEDVENSFFL 75 86 Palmitoyl-protein Palmitoyl-protein Homo sapiens thioesterase 1 thioesterase 1
471786 TLMEQTLPVT 68 77 116 kDa U5 small nuclear 116 kDa U5 small nuclear Homo sapiens ribonucleoprotein component ribonucleoprotein component
471787 TLMEQTLPVTV 68 78 116 kDa U5 small nuclear 116 kDa U5 small nuclear Homo sapiens ribonucleoprotein component ribonucleoprotein component
471790 TLMNTIMQL 1034 1042 Transcription activator BRG1 Transcription activator BRG1 Homo sapiens
471791 TLNAHEHFV 253 261 Platelet-activating factor Platelet-activating factor Homo sapiens acetylhydrolase IB subunit acetylhydrolase IB subunit
alpha alpha
471792 TLNDELEIIEGM 197 208 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
471793 TLNDGAAALV 253 262 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
471794 TLNDGAAALVL 253 263 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
471842 TLYANGSRTET 89 99 Serine protease 23 Serine protease 23 Homo sapiens
(UniProt:O95084)
471844 TLYDIAHTPG 54 63 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens mitochondrial mitochondrial
(UniProt:E9PDB2)
471845 TLYDIAHTPGVA 54 65 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens mitochondrial mitochondrial
(UniProt:E9PDB2)
471847 TLYEVKSENL 444 453 Replication protein A 70 kDa Replication protein A 70 kDa Homo sapiens
DNA-binding subunit DNA-binding subunit
471848 TLYNNTIKV 237 245 Putative deoxyribonuclease Putative deoxyribonuclease Homo sapiens
TATDN1 TATDN1
471849 TLYSGLDEV 30 38 Cyclic AMP-dependent Cyclic AMP-dependent Homo sapiens transcription factor ATF-6 transcription factor ATF-6
beta beta
471850 TLYTYPENWRA 5 15 Elongation factor 1-gamma Elongation factor 1 -gamma Homo sapiens
(UniProt:P26641)
471852 TMDGANVEM 658 666 Glycogen phosphorylase, Glycogen phosphorylase, Homo sapiens liver form liver form
471857 TMGEGPDKA 181 189 Syntaxin-binding protein 1 Syntaxin-binding protein 1 Homo sapiens
471858 TMHDVDAESFEV 15 26 Kelch repeat and BTB Kelch repeat and BTB Homo sapiens domain-containing protein 7 domain-containing protein 7
471859 TMIKGLYGI 217 225 L-lactate dehydrogenase L-lactate dehydrogenase Homo sapiens
471860 TMLDVEGLFYL 2828 2838 Laminin subunit alpha-1 Laminin subunit alpha-1 Homo sapiens
471861 TMLFLGLHNV 289 298 Aspartate-tRNA ligase, Aspartate-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
471865 TMQEUGLYV 74 83 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 4 complex subunit 4
(UniProt:Q9H9E3)
472073 TTPEEIAQV 154 162 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
472077 TVAEINATMSV 220 230 Septin-1 1 Septin-1 1 Homo sapiens
472079 TVDDPYATFV 63 72 Cofilin-1 (UniProt:E9PP50) Cofilin-1 Homo sapiens
472082 TVDISPDTV 59 67 Programmed cell death 6- Programmed cell death 6- Homo sapiens interacting protein interacting protein
472093 TVIGELPPA 112 120 Cullin-associated NEDD8- Cullin-associated NEDD8- Homo sapiens dissociated protein 1 dissociated protein 1
472094 TVIHFNNPKV 18 27 Transcription factor BTF3 Transcription factor BTF3 Homo sapiens
472096 TVLKAQFPSV 234 243 Nicotinate-nucleotide Nicotinate-nucleotide Homo sapiens pyrophosphorylase pyrophosphorylase
[carboxylating] [carboxylating]
(UniProt:Q15274)
472099 TVMGAEIRHV 93 102 Myosin light polypeptide 6 Myosin light polypeptide 6 Homo sapiens
472100 TVMGAEIRHVLV 93 104 Myosin light polypeptide 6 Myosin light polypeptide 6 Homo sapiens
472101 TVMGAELRHV 79 88 Myosin light chain 4 Myosin light chain 4 Homo sapiens
(UniProt:P12829)
472105 TVSEAPPLL 718 726 WASH complex subunit WASH complex subunit Homo sapiens
FAM21 C FAM21 C
472108 TVTNAVVTV 138 146 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniPro P11142) protein
472112 TVYGGLMYI 442 450 Kelch-like protein 9 Kelch-like protein 9 Homo sapiens
472113 TVYGGVMYI 433 441 Kelch-like protein 13 Kelch-like protein 13 Homo sapiens
472316 VAYKNVVGA 48 56 14-3-3 protein beta/alpha 14-3-3 protein beta/alpha Homo sapiens
472438 VIDPATATSV 138 147 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens delta delta
472447 VIHDNFGIVEGL 163 174 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
472448 VIIEQSWGSPKV 62 73 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
472450 VILKILPTLEA 124 134 Interleukin enhancer-binding Interleukin enhancer-binding Homo sapiens factor 2 factor 2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
472451 VILPVPAFNV 83 92 Alpha-enolase Alpha-enolase Homo sapiens
472453 VILTGTPPGV 274 283 Fumarylacetoacetate Fumarylacetoacetate Homo sapiens hydrolase domain-containing hydrolase domain-containing protein 2A protein 2A
472455 VIMFLGDGMGV 54 64 Alkaline phosphatase, tissue- Alkaline phosphatase, tissue- Homo sapiens nonspecific isozyme nonspecific isozyme
472456 VIMSIEEKMEA 161 171 Polyadenylate-binding Polyadenylate-binding Homo sapiens protein 2 protein 2
472457 VINGNPITI 68 76 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens dehydrogenase dehydrogenase
472462 VIWGTDVNV 21 1 219 DNA replication licensing DNA replication licensing Homo sapiens factor MCM4 factor MCM4
472464 VLAAVYKAL 68 76 Fructose-bisphosphate Fructose-bisphosphate Homo sapiens aldolase A aldolase A
472465 VLADHARTITV 297 307 Alanine-tRNA ligase, Alanine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
472466 VLADLGSKTLT 508 518 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
472468 VLAEEPEAV 1856 1864 Fatty acid synthase Fatty acid synthase Homo sapiens
472469 VLAEFDTPGHTL 264 275 Beta-hexosaminidase Beta-hexosaminidase Homo sapiens subunit alpha subunit alpha
472470 VLAGDVTDV 427 435 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
472471 VLAGDVTDVLL 427 437 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
472472 VLAGDVTDVLLL 413 424 Stress-70 protein, Stress-70 protein, Homo sapiens mitochondrial mitochondrial
472475 VLANVTHLL 662 670 Laminin subunit alpha-1 Laminin subunit alpha-1 Homo sapiens
472476 VLAPGPPQA 306 314 Transcription factor p65 Transcription factor p65 Homo sapiens
(UniProt:E9PKV4)
472477 VLAPUALV 3 11 Thioredoxin domain Thioredoxin domain Homo sapiens containing 14, isoform containing 14, isoform
CRA_a CRA_a
472478 VLAPMPLAEVEL 77 88 GRIP1-associated protein 1 GRIP1-associated protein 1 Homo sapiens
472479 VLAPPPEEV 153 161 Nuclear receptor-binding Nuclear receptor-binding Homo sapiens protein 2 protein 2
472480 VLATVTKPV 87 95 60S ribosomal protein L6 60S ribosomal protein L6 Homo sapiens
472481 VLAYEPVWAIGT 161 172 Triosephosphate isomerase Triosephosphate isomerase Homo sapiens
472482 VLCNSEDIRL 647 656 Filamin-A Filamin-A Homo sapiens
472485 VLDDIQDUYF 1017 1027 Melanoma inhibitory activity Melanoma inhibitory activity Homo sapiens protein 3 protein 3
472486 VLDDKDYF 82 89 10 kDa heat shock protein, 10 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
472489 VLDEADEML 163 171 Eukaryotic initiation factor Eukaryotic initiation factor Homo sapiens
4A-III 4A-III
472490 VLDEAGSTV 272 280 Protein VPRBP Protein VPRBP Homo sapiens
472491 VLDEGKMKL 86 94 40S ribosomal protein S9 40S ribosomal protein S9 Homo sapiens
472492 VLDEGKVNM 1035 1043 Melanoma inhibitory activity Melanoma inhibitory activity Homo sapiens protein 3 protein 3
472493 VLDEGLTSV 1466 1474 Protein ELYS Protein ELYS Homo sapiens
472494 VLDEGSASV 90 98 Dual specificity protein Dual specificity protein Homo sapiens phosphatase 2 phosphatase 2
472495 VLDELDMEL 114 122 Gamma-interferon-inducible Gamma-interferon-inducible Homo sapiens lysosomal thiol reductase lysosomal thiol reductase
472496 VLDEVDQML 269 277 Nucleolar RNA helicase 2 Nucleolar RNA helicase 2 Homo sapiens
472497 VLDFEHFLPM 54 63 Myosin light polypeptide 6 Myosin light polypeptide 6 Homo sapiens
472499 VLDGADCIM 351 359 Pyruvate kinase PKM Pyruvate kinase PKM Homo sapiens
472500 VLDGVLMEL 49 57 Malate dehydrogenase, Malate dehydrogenase, Homo sapiens cytoplasmic cytoplasmic
472503 VLDLDFPAL 7 15 Rho-associated protein Rho-associated protein Homo sapiens kinase 2 kinase 2
472504 VLDLLTSYL 4162 4170 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
472505 VLDLRAFYA 206 214 Proteasome activator Proteasome activator Homo sapiens complex subunit 2 complex subunit 2
472506 VLDNLLAFV 95 103 V-type proton ATPase V-type proton ATPase Homo sapiens subunit G 1 subunit G 1
472508 VLDNPYPV 339 346 Glutathione synthetase Glutathione synthetase Homo sapiens
(UniProt:P48637)
472509 VLDPESVEL 287 295 Flap endonuclease 1 Flap endonuclease 1 Homo sapiens
47251 1 VLDPNMDLRTV 538 548 WD repeat-containing protein WD repeat-containing protein Homo sapiens
48 48
472512 VLDPSGSMNIYL 262 273 Other Homo sapiens Complement factor B Homo sapiens
(human) protein
472513 VLDPSMVILEV 409 419 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 2 complex subunit 2
472519 VLDSGAPIKIPV 61 72 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
472522 VLDTNDRFL 589 597 C-1 -tetrahydrofolate C-1-tetrahydrofolate Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
(UniProt:F5H2F4)
472523 VLDVDLQGV 99 107 Guanylate kinase Guanylate kinase Homo sapiens
(UniProt:Q16774)
472524 VLDVESGNISV 226 236 Acylamino-acid-releasing Acylamino-acid-releasing Homo sapiens enzyme enzyme
472533 VLEDGPWKTV 6 15 Protein atonal homolog 8 Protein atonal homolog 8 Homo sapiens
472535 VLEDVTGEEFV 202 212 Apoptosis inhibitor 5 Apoptosis inhibitor 5 Homo sapiens
(UniProt:Q9BZZ5)
472536 VLEDVTGEEFVL 202 213 Apoptosis inhibitor 5 Apoptosis inhibitor 5 Homo sapiens
(UniProt:Q9BZZ5)
472537 VLEEFVPEI 1553 1561 MAP kinase-activating death MAP kinase-activating death Homo sapiens domain protein domain protein
472538 VLEKLGVTV 385 393 Actin-related protein 2 Actin-related protein 2 Homo sapiens
472539 VLEKSLLNV 398 406 Protein PRRC1 Protein PRRC1 Homo sapiens
472540 VLFAVNNMFV 44 53 GSK3-beta interaction GSK3-beta interaction Homo sapiens protein protein
472543 VLFEDVYE 6 13 Peripheral plasma Peripheral plasma Homo sapiens membrane protein CASK membrane protein CASK
472544 VLFEDVYEL 6 14 Peripheral plasma Peripheral plasma Homo sapiens membrane protein CASK membrane protein CASK
472545 VLFEHAVGYALL 2 13 Nucleolar protein 56 Nucleolar protein 56 Homo sapiens
472546 VLFENTDSV 328 336 RNA-binding protein 34 RNA-binding protein 34 Homo sapiens
472548 VLFEYIPQNED 115 125 CD2-associated protein CD2-associated protein Homo sapiens
472552 VLFLGELYL 132 140 Polyadenylate-binding Polyadenylate-binding Homo sapiens protein-interacting protein 1 protein-interacting protein 1
472553 VLFLKPSTA 40 48 Acylpyruvase FAHD1 , Acylpyruvase FAHD1 , Homo sapiens mitochondrial mitochondrial
472554 VLFNVNSDTRL 168 178 Extracellular serine/threonine Extracellular serine/threonine Homo sapiens protein kinase FAM20C protein kinase FAM20C
472555 VLFSSPPVIL 233 242 Major prion protein Major prion protein Homo sapiens
472556 VLFTDEGVPKFL 88 99 Other Homo sapiens NADH dehydrogenase Homo sapiens
(human) protein [ubiquinone] flavoprotein 3,
mitochondrial
472558 VLGAITSV 71 78 Eukaryotic peptide chain Eukaryotic peptide chain Homo sapiens release factor subunit 1 release factor subunit 1
472559 VLGEGVPIL 325 333 Cullin-associated NEDD8- Cullin-associated NEDD8- Homo sapiens dissociated protein 1 dissociated protein 1
472560 VLGEHGDSSVPV 131 142 L-lactate dehydrogenase L-lactate dehydrogenase Homo sapiens
472561 VLGETQDFHSL 389 399 Nuclear protein localization Nuclear protein localization Homo sapiens protein 4 homolog protein 4 homolog
472562 VLGEVGSGFKV 246 256 Very long-chain specific acyl- Very long-chain specific acyl- Homo sapiens
CoA dehydrogenase, CoA dehydrogenase,
mitochondrial mitochondrial
472563 VLGFVKVA 269 276 4- 4- Homo sapiens trimethylaminobutyraldehyde trimethylaminobutyraldehyde dehydrogenase dehydrogenase
assocae proen assocae proen Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
472608 VLMDLKALLLEA 543 554 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX41 RNA helicase DDX41
472609 VLMDVTGGPFDL 61 72 Inositol monophosphatase 1 Inositol monophosphatase 1 Homo sapiens
472610 VLMEHGVPV 544 552 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
5A 5A
47261 1 VLMEIIAKV 2159 2167 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ATR kinase ATR
472612 VLMNEILHGA 148 157 Phosphotriesterase-related Phosphotriesterase-related Homo sapiens protein protein
472613 VLMNPNIASV 460 469 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
472614 VLMNPNIASVQT 460 471 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
472615 VLMNQPPQIAP 76 86 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 4 gamma 1 initiation factor 4 gamma 1
(UniProt:Q04637)
472616 VLMRANIQAVSL 77 88 Charged multivesicular body Charged multivesicular body Homo sapiens protein 2a (UniProt:043633) protein 2a
472617 VLMTADAAKRL 294 304 Acetyl-CoA Acetyl-CoA Homo sapiens acetyltransferase, acetyltransferase,
mitochondrial mitochondrial
472619 VLMTQQPRPV 32 41 H/ACA ribonucleoprotein H/ACA ribonucleoprotein Homo sapiens complex subunit 3 complex subunit 3
472620 VLMVEVENV 248 256 Lon protease homolog, Lon protease homolog, Homo sapiens mitochondrial mitochondrial
472621 VLNNMEIGT 246 254 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
472631 VLPGLIHKV 187 195 GDP-L-fucose synthase GDP-L-fucose synthase Homo sapiens
472635 VLPLTVAEV 530 538 Mesothelin Mesothelin Homo sapiens
472639 VLPPPPPHA 197 205 Interferon regulatory factor 2- Interferon regulatory factor 2- Homo sapiens binding protein-like binding protein-like
472644 VLPSFTPYV 336 344 Mitotic checkpoint Mitotic checkpoint Homo sapiens serine/threonine-protein serine/threonine-protein
kinase BUB1 beta kinase BUB1 beta
472648 VLQATWA 10 17 10 kDa heat shock protein, 10 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
472649 VLQATWAV 41 49 10 kDa heat shock protein, 10 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
472651 VLQEAPWEV 429 437 Epidermal growth factor Epidermal growth factor Homo sapiens receptor kinase substrate 8- receptor kinase substrate 8- like protein 2 like protein 2
472652 VLQGDLVMNV 1496 1505 Fatty acid synthase Fatty acid synthase Homo sapiens
472653 VLQGELEAV 268 276 C-Jun-amino-terminal C-Jun-amino-terminal Homo sapiens kinase-interacting protein 4 kinase-interacting protein 4
(UniProt:O60271)
472656 VLQPAPHQV 1006 1014 Nuclear receptor corepressor Nuclear receptor corepressor Homo sapiens
1 1
472657 VLQPLIAEHQA 356 366 Tryptophan-tRNA ligase, Tryptophan-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
472658 VLQVLLSQV 436 444 Regulatory-associated Regulatory-associated Homo sapiens protein of mTOR protein of mTOR
(UniProt:Q8N122)
472659 VLQVVNLPIV 5 14 Prothrombin Prothrombin Homo sapiens
472663 VLRYQDTPGV 691 700 ATP-citrate synthase ATP-citrate synthase Homo sapiens
472666 VLSDSRPAM 410 418 Coronin-1 B Coronin-1 B Homo sapiens
472667 VLSEFELRLL 49 58 Bone morphogenetic protein Bone morphogenetic protein Homo sapiens
2 2
472669 VLSEPVLFL 35 43 Acylpyruvase FAHD1 , Acylpyruvase FAHD1 , Homo sapiens mitochondrial mitochondrial
472671 VLSIGDGIARV 24 34 ATP synthase subunit alpha, ATP synthase subunit alpha, Homo sapiens mitochondrial mitochondrial Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
472955 VSTPTLVEV 229 237 Albumin, isoform CRA_k Albumin, isoform CRA_k Homo sapiens
472996 VTLNVLADSV 1787 1796 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
473004 VVADTPELQRI 100 110 UM and SH3 domain protein UM and SH3 domain protein Homo sapiens
1 1
473006 VVAMVWEGLNV 72 82 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase B kinase B
473007 VVAMVWEGLNVV 72 83 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase B kinase B
473014 VVDEGPTGV 5 13 Monocarboxylate transporter Monocarboxylate transporter Homo sapiens
4 4
473029 VVIAHDVDPIEL 155 166 60S ribosomal protein L7a 60S ribosomal protein L7a Homo sapiens
473030 VVLDDKDYFL 26 35 10 kDa heat shock protein, 10 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
473031 VVMGTVPRL 915 923 Protein diaphanous homolog Protein diaphanous homolog Homo sapiens
1 1
473038 VVYGEPITA 237 245 Dihydropyrimidinase-related Dihydropyrimidinase-related Homo sapiens protein 2 protein 2
473394 WLDEHTLVTT 549 558 WD repeat-containing protein WD repeat-containing protein Homo sapiens
1 1
473397 WLNENAVEKV 310 319 Adenosylhomocysteinase Adenosylhomocysteinase Homo sapiens
473398 WLQDVFNVPL 101 110 Tryptophan-tRNA ligase, Tryptophan-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
473399 WLYNESPVRGTV 246 257 Plasma alpha-L-fucosidase Plasma alpha-L-fucosidase Homo sapiens
(UniProt:Q9BTY2)
473400 WMDVGQGPGL 576 585 Serine protease 56 Serine protease 56 Homo sapiens
(UniProt:P0CW18)
473417 YADKDVFHM 34 42 Inorganic pyrophosphatase Inorganic pyrophosphatase Homo sapiens
473425 YAFPKSITV 34 42 Monocarboxylate transporter Monocarboxylate transporter Homo sapiens
1 1
473426 YAGGTASATKV 61 71 Calpastatin Calpastatin Homo sapiens
473490 YGIENEVFLSL 281 291 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
473491 YGIKDDVFLSV 223 233 L-lactate dehydrogenase L-lactate dehydrogenase Homo sapiens
473496 YGLSWNPNL 180 188 Histone-binding protein Histone-binding protein Homo sapiens
RBBP4 RBBP4
473497 YGPPSTWSV 233 241 Mesothelin Mesothelin Homo sapiens
473502 YIAGHPAFV 131 139 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein L ribonucleoprotein L
473513 YIDKQPEEA 394 402 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase NSD3 methyltransferase NSD3
473517 YIDTNALRV 27 35 Actin-like protein 6A Actin-like protein 6A Homo sapiens
473524 YIGPDTPAL 674 682 Arginine-glutamic acid Arginine-glutamic acid Homo sapiens dipeptide repeats protein dipeptide repeats protein
473525 YIGPVLVSV 44 52 Unconventional myosin-lc Unconventional myosin-lc Homo sapiens
473526 YIGSVVISV 47 55 Unconventional myosin-lb Unconventional myosin-lb Homo sapiens
(UniProt:043795)
473527 YIHNILYEV 228 236 DENN domain-containing DENN domain-containing Homo sapiens protein 5B protein 5B
473528 YIKDGITRV 524 532 Kinesin-like protein KIF1 B Kinesin-like protein KIF1 B Homo sapiens
473532 YILDLQVV 76 83 DNA-binding protein inhibitor DNA-binding protein inhibitor Homo sapiens
ID-3 ID-3
473533 YILDLQVVL 76 84 DNA-binding protein inhibitor DNA-binding protein inhibitor Homo sapiens
ID-3 ID-3
473535 YILPQVSFTAV 710 720 Nodal modulator 3 Nodal modulator 3 Homo sapiens
473536 YILPTLEKELFL 105 116 Caspase activity and Caspase activity and Homo sapiens apoptosis inhibitor 1 apoptosis inhibitor 1
473537 YILRELPKV 42 50 Rab-like protein 6 Rab-like protein 6 Homo sapiens
(UniProt:H0Y7H6)
473543 YIQENLELV 779 787 C-1 -tetrahydrofolate C-1-tetrahydrofolate Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
(UniProt:F5H2F4)
473546 YISPDQLADL 210 219 Alpha-enolase Alpha-enolase Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
473548 YITPFIRPV 218 226 lmportin-7 lmportin-7 Homo sapiens
473549 YIYDLLEEV 32 40 Kinesin-like protein KIF23 Kinesin-like protein KIF23 Homo sapiens
(UniProt:B4E1 K0)
473551 YLAAVDKWLGV 154 164 Beta-galactosidase Beta-galactosidase Homo sapiens
(UniProt:P16278)
473552 YLAAVLEYL 51 59 Histone H2A type 1 -H Histone H2A type 1 -H Homo sapiens
473553 YLADPMKARVVL 18 29 Signal recognition particle 9 Signal recognition particle 9 Homo sapiens kDa protein kDa protein
473554 YLADSTLSEEM 2030 2040 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
473555 YLADVVDSEA 518 527 Vigilin (UniProt:Q00341 ) Vigilin Homo sapiens
473556 YLAEARNLPPL 78 88 COP9 signalosome complex COP9 signalosome complex Homo sapiens subunit 7a subunit 7a
473557 YLAEARNLPPLT 78 89 COP9 signalosome complex COP9 signalosome complex Homo sapiens subunit 7a subunit 7a
473559 YLAEDSNMSV 43 52 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase PRP4 homolog kinase PRP4 homolog
473560 YLAEFFVNEA 267 276 Gamma-glutamyl hydrolase Gamma-glutamyl hydrolase Homo sapiens
473561 YLAEKYEWD 634 642 Elongation factor 2 Elongation factor 2 Homo sapiens
473562 YLAEKYEWDVA 634 644 Elongation factor 2 Elongation factor 2 Homo sapiens
473565 YLAKUFQM 413 421 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
473568 YLANLTQSQIAL 339 350 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit F initiation factor 3 subunit F
(UniProt:O00303)
473569 YLAPENGYLMEA 423 434 U1 small nuclear U1 small nuclear Homo sapiens ribonucleoprotein 70 kDa ribonucleoprotein 70 kDa
473570 YLAPFDWKI 126 134 Bardet-Biedl syndrome 4 Bardet-Biedl syndrome 4 Homo sapiens protein protein
473571 YLAPHPFPHPA 150 160 Genetic suppressor element Genetic suppressor element Homo sapiens
1 1
473572 YLAPKIEDEEG 250 260 Proliferating cell nuclear Proliferating cell nuclear Homo sapiens antigen antigen
473573 YLAPKIEDEEGS 250 261 Proliferating cell nuclear Proliferating cell nuclear Homo sapiens antigen antigen
473574 YLAPSGPSGTL 230 240 Fascin Fascin Homo sapiens
473576 YLASPPLVI 477 485 Cytoplasmic aconitate Cytoplasmic aconitate Homo sapiens hydra tase hydratase
473577 YLASPPLVIAYA 477 488 Cytoplasmic aconitate Cytoplasmic aconitate Homo sapiens hydra tase hydratase
473578 YLASVFHA 346 353 Serpin H1 Serpin H1 Homo sapiens
473579 YLASVFHAT 346 354 Serpin H1 Serpin H1 Homo sapiens
473581 YLASVKAMHEA 68 78 Myc box-dependent- Myc box-dependent- Homo sapiens interacting protein 1 interacting protein 1
473582 YLDDLLPKL 487 495 Ubiquitin-protein ligase E3B Ubiquitin-protein ligase E3B Homo sapiens
473583 YLDDLNEGV 112 120 WASH complex subunit WASH complex subunit Homo sapiens strumpellin strumpellin
473587 YLDDVSLHHL 759 768 Protein MON2 homolog Protein MON2 homolog Homo sapiens
473588 YLDDYGETDQGL 1217 1228 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR2 UBR2
473589 YLDEAASAPAI 44 54 Charged multivesicular body Charged multivesicular body Homo sapiens protein 5 protein 5
473590 YLDEDTIYH 235 243 S-adenosylmethionine S-adenosylmethionine Homo sapiens synthase isoform type-2 synthase isoform type-2
473591 YLDEELMV 940 947 UM domain only protein 7 UM domain only protein 7 Homo sapiens
(UniProt:E9PMS6)
473592 YLDEELMVL 940 948 UM domain only protein 7 UM domain only protein 7 Homo sapiens
(UniProt:E9PMS6)
473594 YLDEIVKEVEA 422 432 Nucleoprotein TPR Nucleoprotein TPR Homo sapiens
473595 YLDENEKW 314 322 Bone morphogenetic protein Bone morphogenetic protein Homo sapiens
2 2
473596 YLDENEKWL 314 323 Bone morphogenetic protein Bone morphogenetic protein Homo sapiens
2 2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
473597 YLDEPTVNT 379 387 N-terminal kinase-like protein N-terminal kinase-like protein Homo sapiens
473598 YLDEQIKKV 1108 1116 Kinesin-like protein KIF13A Kinesin-like protein KIF13A Homo sapiens
473600 YLDFINHYA 3176 3184 Cytoplasmic dynein 1 heavy Cytoplasmic dynein 1 heavy Homo sapiens chain 1 chain 1
473601 YLDHAGATL 51 59 Molybdenum cofactor Molybdenum cofactor Homo sapiens sulfurase sulfurase
473603 YLDIDKGHV 195 203 ATP-dependent RNA ATP-dependent RNA Homo sapiens helicase DDX1 helicase DDX1
473604 YLDINALQEL 112 121 Tetratricopeptide repeat Tetratricopeptide repeat Homo sapiens protein 39C protein 39C
473606 YLDIVKLLL 284 292 Ankyrin repeat and KH Ankyrin repeat and KH Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:Q8IWZ3)
473610 YLDKPEEWHT 11 1 120 Alpha/beta hydrolase Alpha/beta hydrolase Homo sapiens domain-containing protein domain-containing protein
14B 14B
47361 1 YLDLFGDPS 238 246 Farnesyl pyrophosphate Farnesyl pyrophosphate Homo sapiens synthase synthase
473612 YLDLFGDPSVT 140 150 Farnesyl pyrophosphate Farnesyl pyrophosphate Homo sapiens synthase synthase
473613 YLDLFGDPSVTG 140 151 Farnesyl pyrophosphate Farnesyl pyrophosphate Homo sapiens synthase synthase
473617 YLDNGNNKM 21 29 N-alpha-acetyltransferase N-alpha-acetyltransferase Homo sapiens
25, NatB auxiliary subunit 25, NatB auxiliary subunit
473618 YLDNLVKHL 421 429 lmportin-5 lmportin-5 Homo sapiens
473621 YLDPRITVA 673 681 DNA topoisomerase 1 DNA topoisomerase 1 Homo sapiens
473622 YLDQISRYYI 175 184 Proteasome activator Proteasome activator Homo sapiens complex subunit 3 complex subunit 3
473623 YLDQLNHIL 136 144 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase 3 kinase 3
473624 YLDQTVVPILLQ 12 23 Protein dpy-30 homolog Protein dpy-30 homolog Homo sapiens
473627 YLDSEQRLM 136 144 ATP-binding cassette subATP-binding cassette subHomo sapiens family E member 1 family E member 1
473633 YLDVGLWHL 381 389 Teneurin-2 Teneurin-2 Homo sapiens
473634 YLEAGGTKV 54 62 Exosome complex Exosome complex Homo sapiens component MTR3 component MTR3
473635 YLEDKPSPPPV 366 376 Exocyst complex component Exocyst complex component Homo sapiens
8 8
473636 YLEDKVYLT 101 109 Eukaryotic translation Eukaryotic translation Homo sapiens elongation factor 1 epsilon-1 elongation factor 1 epsilon-1
473637 YLEDTKEKVSI 3498 3508 Plectin Plectin Homo sapiens
473639 YLEDVRLV 559 566 Receptor tyrosine-protein Receptor tyrosine-protein Homo sapiens kinase erbB-2 kinase erbB-2
473640 YLEEDVYQL 368 376 Microtubule cross-linking Microtubule cross-linking Homo sapiens factor 1 factor 1
473641 YLEEDVYQLQEL 368 379 Microtubule cross-linking Microtubule cross-linking Homo sapiens factor 1 factor 1
473644 YLELDTIKNLV 258 268 Endoplasmin Endoplasmin Homo sapiens
473645 YLELFGDPSV 240 249 Farnesyl pyrophosphate Farnesyl pyrophosphate Homo sapiens synthase synthase
473647 YLENGTPDTA 105 114 Gamma-soluble NSF Gamma-soluble NSF Homo sapiens attachment protein attachment protein
473649 YLENMVIKL 499 507 THO complex subunit 1 THO complex subunit 1 Homo sapiens
473650 YLENYDAIRV 101 110 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase isozyme L3 hydrolase isozyme L3
473656 YLESNGIKV 120 128 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
473659 YLFDDPLSAV 463 472 Multidrug resistance- Multidrug resistance- Homo sapiens associated protein 1 associated protein 1
473660 YLFDEIDQALDA 1140 1151 Structural maintenance of Structural maintenance of Homo sapiens chromosomes protein 3 chromosomes protein 3 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
473661 YLFDSFFS 389 396 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
473662 YLFDSFFSL 389 397 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
473663 YLFDSFFSLI 389 398 Carbamoyl-phosphate Carbamoyl-phosphate Homo sapiens synthase [ammonia], synthase [ammonia],
mitochondrial mitochondrial
473664 YLFDVQRNNIA 165 175 ATP synthase F(0) complex ATP synthase F(0) complex Homo sapiens subunit B1 , mitochondrial subunit B1 , mitochondrial
473666 YLFEEGYTNKGM 136 147 Putative pre-mRNA-splicing Putative pre-mRNA-splicing Homo sapiens factor ATP-dependent RNA factor ATP-dependent RNA
helicase DHX16 helicase DHX16
473667 YLFENVDNA 187 195 Heme oxygenase 2 Heme oxygenase 2 Homo sapiens
473668 YLFEPVAKA 944 952 WD repeat-containing protein WD repeat-containing protein Homo sapiens
81 81
473669 YLFFDLPHV 158 166 WD repeat and FYVE WD repeat and FYVE Homo sapiens domain-containing protein 3 domain-containing protein 3
473670 YLFGCELKA 17 25 Nucleophosmin Nucleophosmin Homo sapiens
473671 YLFGCELKAD 17 26 Retinoic acid receptor alpha Retinoic acid receptor alpha Homo sapiens
(UniProt:A8MUP8)
473672 YLFITPPKTV 432 441 Tether containing UBX Tether containing UBX Homo sapiens domain for GLUT4 domain for GLUT4
473673 YLFNIMDTPGHV 163 174 116 kDa U5 small nuclear 116 kDa U5 small nuclear Homo sapiens ribonucleoprotein component ribonucleoprotein component
473676 YLFQYPVRPA 26 35 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase III subunit RPC5 polymerase III subunit RPC5
473677 YLFSGFQEA 391 399 UM domain-containing UM domain-containing Homo sapiens protein ajuba protein ajuba
473678 YLFYDGESV 40 48 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 26A associated protein 26A
473679 YLGDDRNIEEV 154 164 Guanine deaminase Guanine deaminase Homo sapiens
473681 YLGDFIEHYA 76 85 Transcriptional activator Transcriptional activator Homo sapiens protein Pur-alpha protein Pur-alpha
473682 YLGDFIEHYAQ 113 123 Transcriptional activator Transcriptional activator Homo sapiens protein Pur-alpha protein Pur-alpha
473683 YLGDFIEHYAQL 113 124 Transcriptional activator Transcriptional activator Homo sapiens protein Pur-alpha protein Pur-alpha
473684 YLGEEYPE 981 988 Splicing factor 3B subunit 1 Splicing factor 3B subunit 1 Homo sapiens
473685 YLGEEYPEV 981 989 Splicing factor 3B subunit 1 Splicing factor 3B subunit 1 Homo sapiens
473686 YLGEEYVKA 542 550 Serotransferrin Serotransferrin Homo sapiens
473687 YLGEEYVKAV 542 551 Serotransferrin Serotransferrin Homo sapiens
473688 YLGGLPEPMAV 3639 3649 Laminin subunit alpha-5 Laminin subunit alpha-5 Homo sapiens
473689 YLGKKVTHA 160 168 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
473690 YLGKKVTHAVV 160 170 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
473691 YLGKTVTNA 134 142 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniPro P11142) protein
473692 YLGKTVTNAW 134 144 Heat shock cognate 71 kDa Heat shock cognate 71 kDa Homo sapiens protein (UniPro P11142) protein
473693 YLGLLENLRV 613 622 Unconventional myosin-lc Unconventional myosin-lc Homo sapiens
473694 YLGLPAFL 99 106 Protein arginine N- Protein arginine N- Homo sapiens methyltransferase 5 methyltransferase 5
473695 YLGLPAFLL 99 107 Protein arginine N- Protein arginine N- Homo sapiens methyltransferase 5 methyltransferase 5
473696 YLGPDTPAL 344 352 Atrophin-1 Atrophin-1 Homo sapiens
473697 YLGQDYEQLRV 5 15 Calpain-1 catalytic subunit Calpain-1 catalytic subunit Homo sapiens
473701 YLGSRPVKL 693 701 Splicing factor 3B subunit 3 Splicing factor 3B subunit 3 Homo sapiens
473702 YLGYFLPAEFL 231 241 Ester hydrolase C11 orf54 Ester hydrolase C11 orf54 Homo sapiens
(UniProt:E9PPB5) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
473703 YLGYPVTNA 11 1 119 Heat shock 70 kDa protein Heat shock 70 kDa protein Homo sapiens
1 B 1 B
473704 YLHEEFPESWSV 21 32 Neugrin Neugrin Homo sapiens
473705 YLHESTQDELA 15 25 Cullin-1 Cullin-1 Homo sapiens
473706 YUDIKTIAI 461 470 Intraflagellar transport protein Intraflagellar transport protein Homo sapiens
172 homolog 172 homolog
473707 YUEEIGDVL 428 437 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 1 exchange factor 1
(UniProt:Q92888)
473708 YUEEIGDVLL 428 438 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 1 exchange factor 1
(UniProt:Q92888)
473709 YUEEIGDVLLA 428 439 Rho guanine nucleotide Rho guanine nucleotide Homo sapiens exchange factor 1 exchange factor 1
(UniProt:Q92888)
473710 YUEIAKNYNV 165 175 IST1 homolog IST1 homolog Homo sapiens
47371 1 YUPLLERLDL 139 149 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX6 RNA helicase DDX6
473712 YUPNATQPES 106 116 14-3-3 protein beta/alpha 14-3-3 protein beta/alpha Homo sapiens
473714 YLKEAVTTL 1019 1027 Leucine-rich PPR motif- Leucine-rich PPR motif- Homo sapiens containing protein, containing protein,
mitochondrial mitochondrial
473715 YLKEFIHIL 66 74 Actin-related protein 10 Actin-related protein 10 Homo sapiens
473716 YLKELLNLA 92 100 Putative deoxyribonuclease Putative deoxyribonuclease Homo sapiens
TATDN1 TATDN1
473717 YLKNDNPEEHL 138 148 Melanoma inhibitory activity Melanoma inhibitory activity Homo sapiens protein 3 protein 3
473718 YLKQVIDVL 57 65 Nucleobindin-2 Nucleobindin-2 Homo sapiens
473720 YLLDPSITL 248 256 Elongation factor Ts, Elongation factor Ts, Homo sapiens mitochondrial mitochondrial
473721 YLLDYPNNL 599 607 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 17 containing protein 17
(UniProt:075179)
473722 YLLDYPNNLL 599 608 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 17 containing protein 17
(UniProt:075179)
473723 YLLDYPNNVL 719 728 Ankyrin repeat and KH Ankyrin repeat and KH Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:Q8IWZ3)
473724 YLLEHLHPFL 2 11 Beta-1 ,4- Beta-1 ,4- Homo sapiens galactosyltransferase 4 galactosyltransferase 4
473725 YLLGDALLVHPV 723 734 Neutral alpha-glucosidase Neutral alpha-glucosidase Homo sapiens
AB (UniProt:Q14697) AB
473726 YLLGELGEAL 1958 1967 Fibrillin-2 Fibrillin-2 Homo sapiens
473727 YLLGELGEALRM 2892 2903 Fibrillin-2 Fibrillin-2 Homo sapiens
473728 YLLGLGPLEV 463 472 Probable dolichyl Probable dolichyl Homo sapiens pyrophosphate pyrophosphate
Glc1 Man9GlcNAc2 alpha- Glc1 Man9GlcNAc2 alpha- 1 ,3-glucosyltransferase 1 ,3-glucosyl transferase
473729 YLLGVADLTGEL 187 198 Translin-associated protein X Translin-associated protein X Homo sapiens
473731 YLLKDKGEYTL 2618 2628 Filamin-A Filamin-A Homo sapiens
473732 YLLLEETEKQAV 172 183 MTSSI-like protein MTSS1 -like protein Homo sapiens
473733 YLLLYLHSV 42 50 Major facilitator superfamily Major facilitator superfamily Homo sapiens domain-containing protein 12 domain-containing protein 12
473734 YLLPAIVH 138 145 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX17 RNA helicase DDX17
473737 YLLPESVDL 15 23 Serine/threonine/tyrosine- Serine/threonine/tyrosine- Homo sapiens interacting-like protein 1 interacting-like protein 1
(UniProt:C9J4H0)
473738 YLLPQQPPPSL 414 424 Protein scribble homolog Protein scribble homolog Homo sapiens
473739 YLLQTNPTYL 977 986 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
473740 YLLQTNPTYLA 977 987 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
473741 YLLQTQPIYL 918 927 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP3 protein IQGAP3
473742 YLLSYIQSI 370 378 Condensin complex su bun it Condensin complex subunit Homo sapiens
3 3
473743 YLMAISDKDQQL 2895 2906 Golgin subfamily B member Golgin subfamily B member Homo sapiens
1 1
473744 YLMDEGAHL 259 267 UDP-glucose 6- UDP-glucose 6- Homo sapiens dehydrogenase dehydrogenase
473745 YLMDLTHU 63 71 Neuroguidin Neuroguidin Homo sapiens
(UniProt:Q8NEJ9)
473746 YLMDLTHUL 63 72 Neuroguidin Neuroguidin Homo sapiens
(UniProt:Q8NEJ9)
473747 YLMDTSGKVV 347 356 Replication protein A 70 kDa Replication protein A 70 kDa Homo sapiens
DNA-binding subunit DNA-binding subunit
473748 YLMDTSGKVVT 347 357 Replication protein A 70 kDa Replication protein A 70 kDa Homo sapiens
DNA-binding subunit DNA-binding subunit
473750 YLMEEDEDAYK 210 220 60S ribosomal protein L5 60S ribosomal protein L5 Homo sapiens
(UniProt:P46777)
473751 YLMEEDEDAYKK 210 221 60S ribosomal protein L5 60S ribosomal protein L5 Homo sapiens
(UniProt:P46777)
473755 YLMGERLGV 171 179 L-lactate dehydrogenase A L-lactate dehydrogenase A Homo sapiens chain chain
473756 YLMGERLGVHPL 171 182 L-lactate dehydrogenase A L-lactate dehydrogenase A Homo sapiens chain chain
473758 YLMQPSLQV 227 235 LanC-like protein 1 LanC-like protein 1 Homo sapiens
473759 YLNDEPPEGSM 14 24 Transmembrane protein 263 Transmembrane protein 263 Homo sapiens
473760 YLNEIKDSVV 671 680 Elongation factor 2 Elongation factor 2 Homo sapiens
473761 YLNENPLRA 459 467 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase PAK 3 kinase PAK 3
473762 YLNEQGDRVYTL 6 17 H/ACA ribonucleoprotein H/ACA ribonucleoprotein Homo sapiens complex subunit 3 complex subunit 3
473763 YLNEVAGKHGV 234 244 Argininosuccinate synthase Argininosuccinate synthase Homo sapiens
(UniProt:P00966)
473764 YLNFFTKAT 21 1 219 Proliferating cell nuclear Proliferating cell nuclear Homo sapiens antigen antigen
473765 YLNHLEPPV 151 159 Nuclear protein localization Nuclear protein localization Homo sapiens protein 4 homolog protein 4 homolog
473766 YLNKHIQKV 548 556 POZ-, AT hook-, and zinc POZ-, AT hook-, and zinc Homo sapiens finger-containing protein 1 finger-containing protein 1
473767 YLNSILQHA 474 482 Transcription activator BRG1 Transcription activator BRG1 Homo sapiens
473768 YLNTFEFMDKL 391 401 Isocitrate dehydrogenase Isocitrate dehydrogenase Homo sapiens
[NADP] cytoplasmic [NADP] cytoplasmic
473770 YLNVQVKEL 748 756 Structural maintenance of Structural maintenance of Homo sapiens chromosomes protein 4 chromosomes protein 4
473772 YLPDFRFTPF 292 301 GDP-L-fucose synthase GDP-L-fucose synthase Homo sapiens
473773 YLPEELAAL 47 55 Protein flightless-1 homolog Protein flightless-1 homolog Homo sapiens
473776 YLPFVLQEI 569 577 Cullin-associated NEDD8- Cullin-associated NEDD8- Homo sapiens dissociated protein 1 dissociated protein 1
473777 YLPHYIPGVDP 157 167 Protein transport protein Protein transport protein Homo sapiens
Sec16A Sec16A
473782 YLPLPTPKV 25 33 Heat shock 70 kDa protein Heat shock 70 kDa protein Homo sapiens
13 13
473787 YLPTKLAAV 108 116 HEAT repeat-containing HEAT repeat-containing Homo sapiens protein 5A protein 5A
473790 YLQAAIVRI 679 687 Cullin-2 Cullin-2 Homo sapiens
473791 YLQDGDLDVV 2139 2148 Cation-independent Cation-independent Homo sapiens mannose-6-phosphate mannose-6-phosphate
receptor receptor
473792 YLQDLVEGMDF 376 386 Interferon regulatory factor 3 Interferon regulatory factor 3 Homo sapiens
(UniProt:Q14653)
473793 YLQEHAQEVV 353 362 Pumilio homolog 3 Pumilio homolog 3 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
473794 YLQEHAQEVVL 353 363 Pumilio homolog 3 Pumilio homolog 3 Homo sapiens
473796 YLQETYSKQVT 165 175 Ubiquitin-conjugating Ubiquitin-conjugating Homo sapiens enzyme E2 C enzyme E2 C
473797 YLQEVIDVL 54 62 Nucleobindin-1 Nucleobindin-1 Homo sapiens
473798 YLQEVIDVLE 54 63 Nucleobindin-1 Nucleobindin-1 Homo sapiens
473799 YLQEVIDVLET 54 64 Nucleobindin-1 Nucleobindin-1 Homo sapiens
473800 YLQEVIDVLETD 54 65 Nucleobindin-1 Nucleobindin-1 Homo sapiens
473803 YLQGSSVQL 408 416 Other Homo sapiens Vasorin Homo sapiens
(human) protein
473804 YLQHVQIRL 301 309 Tubulin polyglutamylase Tubulin polyglutamylase Homo sapiens
TTLL5 TTLL5
473805 YLQPLVAVQV 169 178 Sodium/potassium- Sodium/potassium- Homo sapiens transporting ATPase subunit transporting ATPase subunit beta-3 beta-3
473809 YLRPETAQGIFL 241 252 Glycine— tRNA ligase Glycine-tRNA ligase Homo sapiens
473810 YLSDNIFTHFV 349 359 Uncharacterized protein Uncharacterized protein Homo sapiens
(UniProt:B4DLN1)
47381 1 YLSEDVFQHA 164 173 Leucyl-cystinyl Leucyl-cystinyl Homo sapiens aminopeptidase aminopeptidase
473817 YLSEVGDTQVV 351 361 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens theta theta
473818 YLSGIAHFL 105 113 Mitochondrial-processing M itochond rial-processi ng Homo sapiens peptidase subunit alpha peptidase subunit alpha
(UniProt:Q10713)
473819 YLSGYGVEL 216 224 UDP-glucose:glycoprotein UDP-glucose:glycoprotein Homo sapiens glucosyltransferase 1 glucosyltransferase 1
473820 YLSGYGVELA 216 225 UDP-glucose:glycoprotein UDP-glucose:glycoprotein Homo sapiens glucosyltransferase 1 glucosyltransferase 1
473821 YLSKUPHA 77 85 Uncharacterized protein Uncharacterized protein Homo sapiens
KIAA1522 KIAA1522
473822 YLSSHIANV 409 417 Gelsolin Gelsolin Homo sapiens
473823 YLSTEDVPLA 54 63 lmportin-4 lmportin-4 Homo sapiens
473824 YLSTKNTIL 208 216 Isocitrate dehydrogenase Isocitrate dehydrogenase Homo sapiens
[NADP] cytoplasmic [NADP] cytoplasmic
473825 YLTAEILELA 50 59 Core histone macro-H2A1 Core histone macro-H2A.1 Homo sapiens
473826 YLTDDLEFLRA 299 309 Transforming acidic coiled- Transforming acidic coiled- Homo sapiens coil-containing protein 2 coil-containing protein 2
(UniProt:095359)
473827 YLTGYNFTL 107 115 Eukaryotic translation Eukaryotic translation Homo sapiens elongation factor 1 epsilon-1 elongation factor 1 epsilon-1
473828 YLTKEDLRV 24 32 Protein S100-A10 Protein S100-A10 Homo sapiens
473829 YLTNEGIAHL 73 82 Plectin Plectin Homo sapiens
473831 YLTQMDVKL 62 70 Flap endonuclease GEN Flap endonuclease GEN Homo sapiens homolog 1 homolog 1
473832 YLTRVEVTEF 119 128 Protein SET Protein SET Homo sapiens
473833 YLVAEKVVVIT 127 137 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens beta beta
473834 YLVDDSFSQAL 79 89 Mitochondrial carrier Mitochondrial carrier Homo sapiens homolog 1 homolog 1
473835 YLVDLAGSEKV 228 238 Kinesin-1 heavy chain Kinesin-1 heavy chain Homo sapiens
473836 YLVGDELWVV 329 338 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase PAK 3 kinase PAK 3
473838 YLVSVDGYMNM 32 42 Small nuclear Small nuclear Homo sapiens ribonucleoprotein F ribonucleoprotein F
473839 YLWCIEQTL 82 90 Adenosylhomocysteinase Adenosylhomocysteinase Homo sapiens
473840 YLWDLDHGFAG 108 118 F-actin-capping protein F-actin-capping protein Homo sapiens subunit beta subunit beta
(UniProt:P47756)
473844 YLWSEVFS 636 643 Neurolysin, mitochondrial Neurolysin, mitochondrial Homo sapiens
473845 YLWSEVFSM 636 644 Neurolysin, mitochondrial Neurolysin, mitochondrial Homo sapiens
473846 YLWSEVFSMD 636 645 Neurolysin, mitochondrial Neurolysin, mitochondrial Homo sapiens
473847 YLWSEVYS 597 604 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens
473848 YLWSEVYSM 597 605 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
473849 YLWSEVYSMD 597 606 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens
473850 YLWSEVYSMDM 597 607 Thimet oligopeptidase Thimet oligopeptidase Homo sapiens
473852 YLYGDDRIEPYI 620 631 Kinesin-associated protein 3 Kinesin-associated protein 3 Homo sapiens
473853 YLYGTGSVAGV 3653 3663 Plectin Plectin Homo sapiens
473855 YLYKQPAEHLQL 87 98 DNA replication licensing DNA replication licensing Homo sapiens factor MCM5 factor MCM5
473856 YLYNNLPHHV 318 327 Pre-mRNA-processing- Pre-m RNA-processi ng- Homo sapiens spl icing factor 8 splicing factor 8
473857 YLYQEGNNGPHL 538 549 SWI/SNF-related matrix- SWI/SNF-related matrix- Homo sapiens associated actin-dependent associated actin-dependent
regulator of chromatin regulator of chromatin
subfamily A containing subfamily A containing
DEAD/H box 1 DEAD/H box 1
473858 YMAGIDGEKEHA 208 219 Farnesyl pyrophosphate Farnesyl pyrophosphate Homo sapiens synthase synthase
473861 YMDENRNIT 14 22 Microtubule-associated Microtubule-associated Homo sapiens protein 4 (UniProt:B5MEG9) protein 4
473862 YMDENRNITF 14 23 Microtubule-associated Microtubule-associated Homo sapiens protein 4 (UniProt:B5MEG9) protein 4
473864 YMDNDYAKL 261 269 Gamma-soluble NSF Gamma-soluble NSF Homo sapiens attachment protein attachment protein
473868 YMEEVKEEV 231 239 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX46 RNA helicase DDX46
473871 YMFEEHEMI 768 776 Protein unc-45 homolog A Protein unc-45 homolog A Homo sapiens
473872 YMFGKGIYFA 868 877 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 1 polymerase 1
473875 YMGEEHLFSV 105 114 Heat shock protein 105 kDa Heat shock protein 105 kDa Homo sapiens
473877 YMHSGPWA 67 75 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase kinase
473878 YMHSGPWAM 67 76 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase kinase
473879 YMINFIHKL 245 253 Transcriptional enhancer Transcriptional enhancer Homo sapiens factor TEF-5 factor TEF-5
473880 YMNGHSDVV 213 221 Cystathionine gamma-lyase Cystathionine gamma-lyase Homo sapiens
473881 YMNGHSDVVM 213 222 Cystathionine gamma-lyase Cystathionine gamma-lyase Homo sapiens
473882 YMNSGPWA 182 190 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase kinase
473883 YMNSGPWAM 182 191 Nucleoside diphosphate Nucleoside diphosphate Homo sapiens kinase kinase
473884 YMSSTDAKV 130 138 Protein unc-45 homolog A Protein unc-45 homolog A Homo sapiens
473885 YMVGPIEEA 508 516 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
474035 YQDELTALLRL 276 286 UM domain-containing UM domain-containing Homo sapiens protein ajuba protein ajuba
474038 YQDPHSTAV 1072 1080 Epidermal growth factor Epidermal growth factor Homo sapiens receptor receptor
474039 YQDPLDPTRSV 703 713 InaD-like protein InaD-like protein Homo sapiens
474040 YQEFTDHLV 52 60 40S ribosomal protein S2 40S ribosomal protein S2 Homo sapiens
(UniProt:P15880)
474041 YQIAEQFRV 84 92 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX49 RNA helicase DDX49
(UniProt:Q9Y6V7)
474042 YQIKGLEWLV 756 765 Transcription activator BRG1 Transcription activator BRG1 Homo sapiens
474043 YQLEIPENFTT 977 987 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Msh6 Msh6
474044 YQNEDEKVTL 109 118 Puromycin-sensitive Puromycin-sensitive Homo sapiens aminopeptidase aminopeptidase
(UniProt:P55786)
474045 YQQCINEAQRV 31 41 Coatomer subunit epsilon Coatomer subunit epsilon Homo sapiens
474052 YSATEETLQEV 275 285 Nucleolin (UniProt:H7BY16) Nucleolin Homo sapiens
474070 YSDNEMPPEA 187 196 Alkaline phosphatase, tissue- Alkaline phosphatase, tissue- Homo sapiens nonspecific isozyme nonspecific isozyme Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
474125 YTDDANQEV 268 276 Formin-binding protein Mike Formin-binding protein 1 -I ike Homo sapiens
(UniProt:S4R347)
474132 YTDKWIGM 176 184 Alpha-enolase Alpha-enolase Homo sapiens
474133 YTDKWIGMDV 176 186 Alpha-enolase Alpha-enolase Homo sapiens
474175 YTLGVKQLI 141 149 Elongation factor 1 -alpha 1 Elongation factor 1 -alpha 1 Homo sapiens
(UniProt:P68104)
474191 YTSNIPIIL 285 293 Protein transport protein Protein transport protein Homo sapiens
Sec61 subunit alpha isoform Sec61 subunit alpha isoform
2 2
474195 YTYEELLNRV 55 64 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 2 subunit 2 initiation factor 2 subunit 2
474201 YVDDGUSLQV 174 184 Pyruvate kinase PKM Pyruvate kinase PKM Homo sapiens
474202 YVDDTPAEQM 218 227 Bifunctional Bifunctional Homo sapiens glutamate/proline-tRNA glutamate/proline-tRNA
ligase ligase
474208 YVDGDPHFI 303 311 Inter-alpha-trypsin inhibitor Inter-alpha-trypsin inhibitor Homo sapiens heavy chain H3 heavy chain H3
474210 YVDPVITSI 654 662 Hepatocyte growth factor Hepatocyte growth factor Homo sapiens receptor receptor
474221 YVFDGKPPQL 47 56 Flap endonuclease 1 Flap endonuclease 1 Homo sapiens
474222 YVFENTVAT 497 505 Alanine-tRNA ligase, Alanine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
474225 YVIEDDVNMA 776 785 DNA replication licensing DNA replication licensing Homo sapiens factor MCM2 factor MCM2
(UniProt:P49736)
474226 YVIEDDVNMAI 776 786 DNA replication licensing DNA replication licensing Homo sapiens factor MCM2 factor MCM2
(UniProt:P49736)
474229 YVINLDPAVHEV 51 62 GPN-loop GTPase 1 GPN-loop GTPase 1 Homo sapiens
474230 YVIYKVPQV 135 143 Small nuclear Small nuclear Homo sapiens ribonucleoprotein polypeptide ribonucleoprotein polypeptide
A, isoform CRA_a A, isoform CRA_a
474233 YVQELLEKA 69 77 Proline synthase co- Proline synthase co- Homo sapiens transcribed bacterial transcribed bacterial
homolog protein homolog protein
474236 YVVDLDDEYA 239 248 Protein Red Protein Red Homo sapiens
474239 YVYGEDMTPTLL 210 221 Negative elongation factor E Negative elongation factor E Homo sapiens
475645 AISESNINL 317 325 Transketolase Transketolase Homo sapiens
475676 ALDNGLFTL 72 80 Protein FRG1 Protein FRG1 Homo sapiens
475697 ALGGHPLLGV 20 29 Dickkopf-related protein 1 Dickkopf-related protein 1 Homo sapiens
475750 ALQDIGKNIYTI 19 30 RNA-binding protein NOB1 RNA-binding protein NOB1 Homo sapiens
475757 ALSEELVQL 666 674 Other Homo sapiens Kinesin-1 heavy chain Homo sapiens
(human) protein
475766 ALSSLAVVV 963 971 Focadhesin Focadhesin Homo sapiens
475777 ALWKEPGSNV 184 193 Galectin-3-binding protein Galectin-3-binding protein Homo sapiens
(UniProt:Q08380)
475947 AQHKFLVAV 259 267 Transcription factor 25 Transcription factor 25 Homo sapiens
(UniProt:Q9BQ70)
475999 AQYUNVRL 347 355 Poly(rC)-binding protein 2 Poly(rC)-binding protein 2 Homo sapiens
(UniProt:Q15366)
476000 AQYLLQNSV 447 455 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein K ribonucleoprotein K
476508 AVGLAVLNV 318 326 5-phosphohydroxy-L-lysine 5-phosphohydroxy-L-lysine Homo sapiens phospho-lyase phospho-lyase
476623 AVSNHVFHL 584 592 Zinc finger MIZ domain- Zinc finger MIZ domain- Homo sapiens containing protein 1 containing protein 1
477029 DNIQGITKPAIR 25 36 Histone H4 Histone H4 Toxoplasma gondii ME49
477738 ELFPHSLLSV 477 486 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA2 polymerase I subunit RPA2
(UniProt:F8W898)
477928 EVISKLYAV 462 470 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens theta theta
(UniProt:P56192) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
480826 KLPDLPQNSV 448 457 Protein TALPID3 Protein TALPID3 Homo sapiens
480834 KLPTPTSSV 290 298 WW domain-containing WW domain-containing Homo sapiens adapter protein with coiled- adapter protein with coiled- coil coil
480857 KLREDLERL 106 114 40S ribosomal protein S18 40S ribosomal protein S18 Homo sapiens
480898 KLYEKKLLKL 140 149 Lamina-associated Lamina-associated Homo sapiens polypeptide 2, isoforms polypeptide 2, isoforms
beta/gamma beta/gamma
480908 KLYSSEQLLI 220 229 DNA damage-inducible DNA damage-inducible Homo sapiens transcript 4 protein transcript 4 protein
480915 KMAPALRKV 74 82 NADH dehydrogenase NADH dehydrogenase Homo sapiens
[ubiquinone] iron-sulfur [ubiquinone] iron-sulfur
protein 7, mitochondrial protein 7, mitochondrial
481247 KTKDGVREV 26 34 Transforming protein RhoA Transforming protein RhoA Homo sapiens
(UniProt:P61586)
481289 KTLQPSSQNTK 467 477 Chromatin assembly factor 1 Chromatin assembly factor 1 Homo sapiens subunit B subunit B
481414 KVIDTQQKV 19 27 Prefoldin subunit 1 Prefoldin subunit 1 Homo sapiens
481472 KVLRESGLKYV 137 147 Flavin reductase (NADPH) Flavin reductase (NADPH) Homo sapiens
481872 LLDEPTNML 350 358 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 3 family F member 3
481889 LLHSFVDSV 843 851 Sterol regulatory element- Sterol regulatory element- Homo sapiens binding protein 2 binding protein 2
481894 LLLAAARLAAA 14 24 Protein disulfide-isomerase Protein disulfide-isomerase Homo sapiens
A3 A3
481897 LLLPGLETV 964 972 Telomere-associated protein Telomere-associated protein Homo sapiens
RIF1 RIF1
481898 LLLPGPSAA 25 33 Peptidyl-prolyl cis-trans Peptidyl-prolyl cis-trans Homo sapiens isomerase B isomerase B
481899 LLLPPPPCPA 19 28 Plasma alpha-L-fucosidase Plasma alpha-L-fucosidase Homo sapiens
(UniProt:Q9BTY2)
481902 LLPSHPLEL 42 50 Proteasome maturation Proteasome maturation Homo sapiens protein protein
481916 LLYGHTVTV 112 120 Adenosine 3'-phospho 5'- Adenosine 3'-phospho 5'- Homo sapiens phosphosulfate transporter 1 phosphosulfate transporter 1
482104 LQLDKEFQL 30 38 Putative tRNA Putative tRNA Homo sapiens
(cytidine(32)/guanosine(34)- (cytidine(32)/guanosine(34)-
2'-0)-methyltransferase 2'-0)-methyltransferase
482225 LVTDIQPVL 857 865 Structural maintenance of Structural maintenance of Homo sapiens chromosomes flexible hinge chromosomes flexible hinge
domain-containing protein 1 domain-containing protein 1
482247 LYPEVFEKF 447 455 ATPase family AAA domain- ATPase family AAA domain- Homo sapiens containing protein 2 containing protein 2
482674 NLAGENILNPL 83 93 Epimerase family protein Homo sapiens
SDR39U1
483387 QLDETNALL 563 571 Rho-associated protein Rho-associated protein Homo sapiens kinase 2 kinase 2
483404 QLHAGSLVSV 172 181 Mitofusin-2 Mitofusin-2 Homo sapiens
483408 QLIEKNWLL 1210 1218 Kinesin-like protein KIF15 Kinesin-like protein KIF15 Homo sapiens
483422 QLNEKVAQL 218 226 Lanosterol 14-alpha Lanosterol 14-alpha Homo sapiens demethylase demethylase
483434 QLTEMLPSI 142 150 Transcription factor BTF3 Transcription factor BTF3 Homo sapiens
484055 RIAGIRGIQGV 165 175 Protein EFR3 homolog A Protein EFR3 homolog A Homo sapiens
484168 RLAEALPKQSV 164 174 Transcription factor BTF3 Transcription factor BTF3 Homo sapiens
484241 RUGELAKEIRK 77 88 Protein S100-A13 Protein S100-A13 Homo sapiens
484309 RLLSKIHNV 820 828 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Msh6 Msh6
484325 RLNKVIKSV 813 821 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
484361 RLQSKTIKV 85 93 ELAV-like protein 1 ELAV-like protein 1 Homo sapiens
(UniProt:Q15717)
484415 RLYDGLFKVI 134 143 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
484451 RMVDMPANNK 168 177 UPF0585 protein C16orf13 UPF0585 protein C16orf13 Homo sapiens
(UniProt:Q96S19)
484883 RVIDDSLVVGV 481 491 Fanconi anemia group B Fanconi anemia group B Homo sapiens protein protein
485095 RYLDEINLL 366 374 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein subunit alpha-15 protein subunit alpha-15
485267 SAVGHVFSL 810 818 Protein virilizer homolog Protein virilizer homolog Homo sapiens
486043 SISDVIAQV 165 173 Progressive ankylosis protein Progressive ankylosis protein Homo sapiens homolog homolog
486067 SLADLNSRL 220 228 Mitochondrial amidoxime- Mitochondrial amidoxime- Homo sapiens reducing component 1 reducing component 1
486070 SLADVDPMQL 410 419 ATPase family AAA domain- ATPase family AAA domain- Homo sapiens containing protein 2 containing protein 2
486072 SLAERVDRL 67 75 Wiskott-Aldrich syndrome Wiskott-Aldrich syndrome Homo sapiens protein family member 2 protein family member 2
486092 SLDTQPKKV 165 173 Transcription factor E2-alpha Transcription factor E2-alpha Homo sapiens
(UniProt:P15923)
486095 SLEGIPLAQV 177 186 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HERC6 ligase HERC6
486132 SUTPLQAV 2789 2797 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
486145 SLLAANNLL 306 314 Glyoxylate Glyoxylate Homo sapiens red uctase/hyd roxypyruvate reductase/hydroxypyruvate
reductase reductase
486149 SLLEQGLVEA 177 186 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase NSD2 methyltransferase NSD2
486151 SLLGTENASV 28 37 Other Homo sapiens TSC22 domain family protein Homo sapiens
(human) protein 1
486156 SLLPAQYNL 945 953 Zinc finger protein 609 Zinc finger protein 609 Homo sapiens
486160 SLLPSVPAL 2544 2552 Ankyrin repeat and KH Ankyrin repeat and KH Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:Q8IWZ3)
486193 SLSAFTPAL 218 226 Germinal-center associated Germinal-center associated Homo sapiens nuclear protein nuclear protein
486197 SLSFVSPSL 349 357 PR domain zinc finger PR domain zinc finger Homo sapiens protein 4 protein 4
486210 SLVATLQSV 58 66 Interferon alpha-inducible Interferon alpha-inducible Homo sapiens protein 27-like protein 2 protein 27-like protein 2
486215 SLYDQAEKLVS 262 272 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 3 ATPase regulatory subunit 3
486241 SMNTHLKAV 35 43 Small nuclear Small nuclear Homo sapiens ribonucleoprotein Sm D1 ribonucleoprotein Sm D1
486864 SVASTITGV 129 137 Perilipin-2 Perilipin-2 Homo sapiens
486960 SVLKSIQEV 758 766 Superkiller viralicidic activity Superkiller viralicidic activity Homo sapiens
2-like 2 2-like 2
487049 SVYGKLRKV 599 607 Glutamine-dependent Glutamine-dependent Homo sapiens
NAD(+) synthetase NAD(+) synthetase
487551 TLAFVSPSL 226 234 Transcriptional repressor Transcriptional repressor Homo sapiens p66-alpha p66-alpha
487570 TLKDTITSV 271 279 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 5 complex subunit 5
487581 TLSDGVVVQV 85 94 Ras GTPase-activating Ras GTPase-activating Homo sapiens protein-binding protein 2 protein-binding protein 2
487583 TLSQVIPMV 953 961 Zinc finger BED domain- Zinc finger BED domain- Homo sapiens containing protein 4 containing protein 4
487586 TLTGKTITL 7 15 Ubiquitin-60S ribosomal Ubiquitin-60S ribosomal Homo sapiens protein L40 protein L40
487587 TLTNIIHNL 50 58 ORMMike protein 1 ORMMike protein 1 Homo sapiens
487588 TLTSNIPEI 225 233 Sodium/potassium- Sodium/potassium- Homo sapiens transporting ATPase subunit transporting ATPase subunit alpha-3 alpha-3
487852 TVPPVFVSV 254 262 Calcium-activated potassium Homo sapiens channel subunit alpha-1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
transporter 1 transporter 1
489170 FLFDHQLVSC 477 486 Spermatogenesis-associated Spermatogenesis-associated Homo sapiens protein 13 (UniProt:Q96N96) protein 13
489171 FLFSDVCRV 2499 2507 Inositol 1 ,4,5-trisphosphate Inositol 1 ,4,5-trisphosphate Homo sapiens receptor type 1 receptor type 1
489172 FLHQQPANC 319 327 Cyclin-A2 Cyclin-A2 Homo sapiens
489173 FLHRLPILL 13 21 AP-4 complex accessory AP-4 complex accessory Homo sapiens subunit tepsin subunit tepsin
489174 FLLHQKIAL 284 292 Abhydrolase domain- Abhydrolase domain- Homo sapiens containing protein 15 containing protein 15
489175 FLLNLQNCHL 176 185 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 10 containing protein 10
489176 FLLQQLPPV 137 145 Protein FAM13B Protein FAM13B Homo sapiens
489177 FLLTIENEL 890 898 Kinesin-like protein KIF20B Kinesin-like protein KIF20B Homo sapiens
489178 FLMKLQSLL 375 383 Cytoplasmic dynein 1 light Cytoplasmic dynein 1 light Homo sapiens intermediate chain 1 intermediate chain 1
(UniProt:Q9Y6G9)
489179 FLQDTIEEMAL 263 273 LETM1 and EF-hand LETM1 and EF-hand Homo sapiens domain-containing protein 1 , domain-containing protein 1 , mitochondrial mitochondrial
489180 FLQRKLASL 472 480 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 18 associated protein 18
homolog homolog
489181 FLTDMPDILL 326 335 Cholinesterase Cholinesterase Homo sapiens
489182 FLYKEKLVSV 104 113 Deoxyribonuclease gamma Deoxyribonuclease gamma Homo sapiens
489183 FMDVKCPGC 32 40 40S ribosomal protein S27- 40S ribosomal protein S27- Homo sapiens like like
489185 FMIKFPWKL 653 661 Spatacsin Spatacsin Homo sapiens
489187 FMSSHIKSV 564 572 Transcriptional regulator Transcriptional regulator Homo sapiens
Kaiso Kaiso
489192 FVARMIPKV 41 49 Multifunctional Multifunctional Homo sapiens methyltransferase subunit methyltransferase subunit
TRM112-like protein TRM1 12-like protein
(UniProt:Q9UI30)
489196 GIKEDTEEHHL 118 128 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoproteins A2/B1 ribonucleoproteins A2/B1
489197 GLADRCPAL 160 168 F-box/LRR-repeat protein 15 F-box/LRR-repeat protein 15 Homo sapiens
489198 GLAEKIRAC 173 181 Rho-related GTP-binding Rho-related GTP-binding Homo sapiens protein RhoV protein RhoV
489199 GLAKRVWSL 127 135 Protein PAXX Protein PAXX Homo sapiens
489200 GLCERLVSL 1523 1531 DNA-dependent protein DNA-dependent protein Homo sapiens kinase catalytic subunit kinase catalytic subunit
489201 GLCPHVVVL 689 697 C-1 -tetrahydrofolate C-1-tetrahydrofolate Homo sapiens synthase, cytoplasmic synthase, cytoplasmic
(UniProt:P11586)
489202 GLLDAAHFCYL 1556 1566 Protein transport protein Protein transport protein Homo sapiens
Sec16A Sec16A
489203 GLLDRIMQL 513 521 Phenylalanine-tRNA ligase Phenylalanine-tRNA ligase Homo sapiens beta subunit beta subunit
489204 GLLEHILYC 559 567 Short transient receptor Short transient receptor Homo sapiens potential channel 4- potential channel 4- associated protein associated protein
489205 GLLGDIAIHL 3807 3816 G-protein coupled receptor G-protein coupled receptor Homo sapiens
98 98
489206 GLLRLAIRL 1202 1210 Golgi-specific brefeldin A- Golgi-specific brefeldin A- Homo sapiens resistance guanine resistance guanine
nucleotide exchange factor 1 nucleotide exchange factor 1
489207 GLLTRLLQV 513 521 Short transient receptor Short transient receptor Homo sapiens potential channel 4- potential channel 4- associated protein associated protein
489208 GLRTLGPAL 55 63 Polycystin-1 Polycystin-1 Homo sapiens
489210 GMMKELHKV 564 572 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HERC6 ligase HERC6
(UniProt:P40926) Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
hydrolase 18 hydrolase 18
489333 QLYNSLIFL 239 247 RING finger and RING finger and Homo sapiens transmembrane domain- transmembrane domain- containing protein 2 containing protein 2
(UniProt:Q96EX2)
489334 QMCGLHIW 1270 1278 Clathrin heavy chain 1 Clathrin heavy chain 1 Homo sapiens
489335 QVCAIIERV 478 486 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit C initiation factor 3 subunit C
489336 QVMPGNIVFV 260 269 Neutrophil cytosol factor 2 Neutrophil cytosol factor 2 Homo sapiens
489337 QVVAIVHAV 177 185 Potassium channel subfamily Potassium channel subfamily Homo sapiens
K member 1 K member 1
489339 RIYKYIHKV 33 41 Methylsterol monooxygenase Methylsterol monooxygenase Homo sapiens
1 1
489340 RLCGLKVEV 272 280 SWI/SNF-related matrix- SWI/SNF-related matrix- Homo sapiens associated actin-dependent associated actin-dependent
regulator of chromatin regulator of chromatin
subfamily E member 1 subfamily E member 1
489342 RLFRVFVHV 158 166 MOB kinase activator 3A MOB kinase activator 3A Homo sapiens
489343 RLKDEIAEV 36 44 Cytohesin-1 Cytohesin-1 Homo sapiens
489344 RLMKHDVNL 1141 1149 Pre-mRNA-processing- Pre-m RNA-processi ng- Homo sapiens spl icing factor 8 splicing factor 8
489345 RLVDLDWRV 122 130 COMM domain-containing COMM domain-containing Homo sapiens protein 9 protein 9
489346 RMFPGEVAL 752 760 Phosphatidylinositol N- Phosphatidylinositol N- Homo sapiens acetylglucosaminyltransferas acetylglucosaminyltransferas e subunit Q e subunit Q
489350 RMLDVLEYI 149 157 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase VRK2 kinase VRK2
489351 RMLHFLTAV 122 130 Ataxin-2-like protein Ataxin-2-like protein Homo sapiens
489352 RMLIKLLEV 86 94 Spectrin beta chain, non- Spectrin beta chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
489353 RMVHILTSV 56 64 Ataxin-2 Ataxin-2 Homo sapiens
489356 SIAELVPKC 121 129 V-type proton ATPase V-type proton ATPase Homo sapiens subunit d 1 subunit d 1
489358 SILRGIFSV 435 443 Guanylate-binding protein 4 Guanylate-binding protein 4 Homo sapiens
489359 SIQQSIERLLV 118 128 NHP2-like protein 1 NHP2-like protein 1 Homo sapiens
489360 SLADCIPLL 803 811 Huntingtin Huntingtin Homo sapiens
489361 SLAKHGIVAL 304 313 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens zeta-2 zeta-2
489362 SLFPHAICL 17 25 Integrin-alpha FG-GAP Integrin-alpha FG-GAP Homo sapiens repeat-containing protein 2 repeat-containing protein 2
489363 SLFSAVHKI 18 26 Erlin-2 (UniProt:O94905) Erlin-2 Homo sapiens
489364 SLGSFICKL 25 33 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 8 II transcription subunit 8
489365 SLHSKLFRV 403 411 Protein FAM214A Protein FAM214A Homo sapiens
489366 SUKHKIML 160 168 V-type proton ATPase V-type proton ATPase Homo sapiens catalytic subunit A catalytic subunit A
489367 SLLACEFLL 619 627 Arf-GAP with coiled-coil, Arf-GAP with coiled-coil, Homo sapiens
ANK repeat and PH domain- ANK repeat and PH domain- containing protein 1 containing protein 1
489368 SLLDHLLTEC 485 494 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 14 polymerase 14
489369 SLLHMPFTI 296 304 Antigen peptide transporter 2 Antigen peptide transporter 2 Homo sapiens
489370 SLLRALERL 1242 1250 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ULK4 kinase ULK4
489371 SLLRHLEKV 253 261 Synaptopodin Synaptopodin Homo sapiens
489372 SLLRKIYEI 168 176 Trafficking protein particle Trafficking protein particle Homo sapiens complex subunit 4 complex subunit 4
(UniProt:Q9Y296)
489374 SLSLLCIPAI 15 24 Glycosyltransferase-like Glycosyltransferase-like Homo sapiens protein LARGE 1 protein LARGE 1
489375 SLSSLVVQL 48 56 SWI/SNF complex subunit SWI/SNF complex subunit Homo sapiens
SMARCC2 SMARCC2 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
489484 AVAVVAMAAI 10 19 Immunogenic protein MPT63 Immunogenic protein MPT63 Mycobacterium tuberculosis
489812 TMIKTAVAVV 5 14 Immunogenic protein MPT63 Immunogenic protein MPT63 Mycobacterium tuberculosis
490098 ALLAFTLGV 137 145 Elongation factor 1 -alpha Elongation factor 1 -alpha Leishmania major
490102 ALRERRMKV 404 412 Putative proteasome Putative proteasome Leishmania major regulatory ATPase subunit 2 regulatory ATPase subunit 2
490745 CLAUAWRV 385 393 Other Leishmania major Leishmania major protein
491066 FMEVFGMLV 77 85 Other Leishmania major Leishmania major protein
491072 FQNIRPLFI 272 280 Nucleolar GTP-binding Nucleolar GTP-binding Homo sapiens protein 1 protein 1
491245 GLEQQIQEI 187 195 Putative proteasome Putative proteasome Leishmania major regulatory ATPase subunit 2 regulatory ATPase subunit 2
492656 KIYQIGRSV 286 294 Putative ribosomal protein L3 Putative ribosomal protein L3 Leishmania major
492663 KLVRELFRV 263 271 Putative proteasome Putative proteasome Leishmania major regulatory ATPase subunit 2 regulatory ATPase subunit 2
492999 LLHDRQHSI 149 157 Putative proteasome Putative proteasome Leishmania major regulatory ATPase subunit 2 regulatory ATPase subunit 2
493004 LLPAPLVSV 320 328 Similar to leishmania major. Similar to leishmania major. Leishmania major
141 1.4- like protein 1411.4-like protein
493314 MLLWTAVAV 575 583 Similar to leishmania major. Similar to leishmania major. Leishmania major
141 1.4-like protein 1411.4-like protein
493317 MLQTNSLAL 150 158 Other Leishmania major Leishmania major protein
493318 MLVQSCTSI 83 91 Other Leishmania major Leishmania major protein
493470 MVLNAMAWL 92 100 Other Leishmania major Leishmania major protein
493612 PLSPATRRL 143 151 Other Leishmania major Leishmania major protein
493644 QLNKKIYQI 282 290 Putative ribosomal protein L3 Putative ribosomal protein L3 Leishmania major
494095 RLAGFLAGL 336 344 Other Leishmania major Leishmania major protein
494748 SLQFSAFLL 24 32 Other Leishmania major Leishmania major protein
494764 SQYPFHVPLL 140 149 Lymphotoxin-alpha Lymphotoxin-alpha Homo sapiens
495464 TLGVKQMVV 142 150 Elongation factor 1 -alpha Elongation factor 1 -alpha Leishmania major
495466 TLLDALGML 215 223 Elongation factor 1 -alpha Elongation factor 1 -alpha Leishmania major
495467 TMLELLTQL 306 314 Putative proteasome Putative proteasome Leishmania major regulatory ATPase subunit 2 regulatory ATPase subunit 2
495976 VVAGMLRWV 69 77 Other Leishmania major Leishmania major protein
495978 VVSVLTHSV 110 118 Other Leishmania major Leishmania major protein
495981 WIPPVVSVL 106 114 Other Leishmania major Leishmania major protein
496041 YLRTFPAAL 135 143 Similar to leishmania major. Similar to leishmania major. Leishmania major
141 1.4-like protein 1411.4-like protein
496318 AIAQALAGEV 144 153 WD40 repeat-containing WD40 repeat-containing Homo sapiens protein SMU1 protein SMU1
496320 AIIGGVIAW 154 163 Contacti n-associated proteinContactin-associated proteinHomo sapiens like 2 (UniProt:B7Z1Y6) like 2
496321 AILGIHNEV 567 575 Alpha-actinin-1 Alpha-actinin-1 Homo sapiens
(UniProt:P12814)
496322 AINPKLLQLV 466 475 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX5 RNA helicase DDX5
(UniProt:P17844)
496323 AIQEQITRV 462 470 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 1 complex subunit 1
(UniProt:A5YKK6)
496324 ALDVQGIYRV 553 562 GEM-interacting protein GEM-interacting protein Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
496325 ALFAGGKLRV 63 72 Transmembrane emp24 Transmembrane emp24 Homo sapiens domain-containing protein 4 domain-containing protein 4
(UniProt:Q7Z7H5)
496326 ALFPGDVDRL 417 426 Glycogen phosphorylase, Glycogen phosphorylase, Homo sapiens brain form brain form
496328 ALGTLVSHV 636 644 Translational activator GCN1 Translational activator GCN1 Homo sapiens
496330 ALLEEAEQL 115 123 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens epsilon (UniProt:P48643) epsilon
496331 ALLEQAEQL 114 122 T-complex protein 1 subunit T-complex protein 1 subunit Homo sapiens theta-like 2 theta-like 2
496332 ALLETEFSL 123 131 A-kinase anchor protein 6 A-kinase anchor protein 6 Homo sapiens
496333 ALLPQASNV 173 181 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase SIK2 kinase SIK2
496334 ALLSDVQLL 1809 1817 Unconventional myosin- Unconventional myosin- Homo sapiens
XVIIIb XVIIIb
496335 ALNAVRLLV 152 160 Other Homo sapiens Na(+)/H(+) exchange Homo sapiens
(human) protein regulatory cofactor NHE-RF1
496336 ALQGELKIAV 977 986 Early endosome antigen 1 Early endosome antigen 1 Homo sapiens
496337 ALVEKGEFAL 2095 2104 Other Homo sapiens Centromere protein F Homo sapiens
(human) protein
496338 AMKTRQAFYL 12 21 Metastasis-associated Metastasis-associated Homo sapiens protein MTA1 protein MTA1
(UniProt:Q13330)
496361 AVDDFIEKL 80 88 6-phosphogluconate 6-phosphogluconate Homo sapiens dehydrogenase, dehydrogenase,
decarboxylating decarboxylating
496383 DIEGASKIL 91 99 Leucine-rich PPR motif- Leucine-rich PPR motif- Homo sapiens containing protein, containing protein,
mitochondrial mitochondrial
496384 DIKDGVSDKV 1094 1103 Microtubule-actin cross- Microtubule-actin cross- Homo sapiens linking factor 1 , isoforms linking factor 1 , isoforms
1/2/3/5 (UniProt:H3BQK9) 1/2/3/5
496385 DILGLSKAAV 141 150 Epididymal-specific lipocalin- Epididymal-specific lipocalin- Homo sapiens
10 10
496388 DLATRNILV 973 981 Tyrosine-protein kinase JAK2 Tyrosine-protein kinase JAK2 Homo sapiens
496389 DLEVKQEEV 150 158 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 85A containing protein 85A
496390 DLSDIPGAQV 21259 21268 Other Homo sapiens Titin Homo sapiens
(human) protein
496391 DLVHDDFSV 1200 1208 Sacsin Sacsin Homo sapiens
496404 DVEEIFRKV 33 41 Caspase-1 Caspase-1 Homo sapiens
496435 EILQLPNGAL 364 373 ATP-binding cassette subATP-binding cassette subHomo sapiens family A member 13 family A member 13
496436 EIQGNINKV 293 301 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP2 protein IQGAP2
496437 EIRTVLEKL 91 99 Neuroguidin Neuroguidin Homo sapiens
(UniProt:Q8NEJ9)
496444 ELANLAAFL 276 284 2,4-dienoyl-CoA reductase, 2,4-dienoyl-CoA reductase, Homo sapiens mitochondrial mitochondrial
496445 ELKDRDKEL 36 44 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 62 containing protein 62
496446 ELMQLEKEL 6628 6636 Nesprin-2 (UniProt:G3V5X4) Nesprin-2 Homo sapiens
496448 ELSKGQAKKL 705 714 Cysteine-tRNA ligase, Cysteine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
496449 EMDDLKLYL 81 1 819 A-kinase anchor protein 6 A-kinase anchor protein 6 Homo sapiens
496463 EVGMLHQQV 74 82 Centrosomal protein of 63 Centrosomal protein of 63 Homo sapiens kDa kDa
496464 EVKALNANL 206 214 BPI fold-containing family C BPI fold-containing family C Homo sapiens protein protein
496473 FIILGALLLL 173 182 Immunoglobulin-like domain- Immunoglobulin-like domain- Homo sapiens containing receptor 1 containing receptor 1
496477 FLEMCNDLL 306 314 Heat shock 70 kDa protein 4 Heat shock 70 kDa protein 4 Homo sapiens
496478 FLFIFFFLL 636 644 Band 4.1 -like protein 3 Band 4.1 -like protein 3 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
(UniProt:Q9Y2J2)
496481 FUVMHRSLV 83 92 Rab1 1 family-interacting Rab1 1 family-interacting Homo sapiens protein 2 protein 2
496484 FLSRQLESL 109 117 Metastasis-associated Metastasis-associated Homo sapiens protein MTA1 protein MTA1
(UniProt:Q13330)
496513 GIKAVDAPV 60 68 PMS1 protein homolog 1 PMS1 protein homolog 1 Homo sapiens
(UniProt:P54277)
496514 GIKLSAIPVV 1011 1020 Protein patched homolog 2 Protein patched homolog 2 Homo sapiens
496518 GLDALKVTV 850 858 Hexokinase-2 Hexokinase-2 Homo sapiens
496519 GLDTFSGFKV 70 79 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase STK1 1 kinase STK11
496522 GLQDFDLIRV 248 257 Protein kinase C zeta type Protein kinase C zeta type Homo sapiens
496523 GLRTIVTTL 286 294 Thrombospondin-1 Thrombospondin-1 Homo sapiens
496524 GLSPLLQKI 51 1 519 Sec1 family domain- Sec1 family domain- Homo sapiens containing protein 2 containing protein 2
496525 GLSSPIYIDL 31 40 Uridine 5'-monophosphate Uridine ^-monophosphate Homo sapiens synthase (UniProt:P11 172) synthase
496530 GQYTDLLRL 66 74 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase PP1-beta phosphatase PP1-beta
catalytic subunit catalytic subunit
496533 GVLPFVRGV 4 12 Protein flightless- 1 homolog Protein flightless-1 homolog Homo sapiens
496536 HLEEQIAKV 599 607 Kinetochore protein NDC80 Kinetochore protein NDC80 Homo sapiens homolog homolog
496538 HLLQYNHRV 217 225 Galectin-3 Galectin-3 Homo sapiens
496546 HVCHINRIL 2806 2814 Dynein heavy chain 9, Dynein heavy chain 9, Homo sapiens axonemal (UniProt:Q9NYC9) axonemal
496561 IILEILLLL 3 11 17-beta-hydroxysteroid 17-beta-hydroxysteroid Homo sapiens dehydrogenase 13 dehydrogenase 13
496563 ILAPCKLETV 128 137 COMM domain-containing COMM domain-containing Homo sapiens protein 10 protein 10
496564 ILDEQAVQGL 252 261 Epiplakin Epiplakin Homo sapiens
496566 ILLQIDNARL 220 229 Keratin, type I cytoskeletal 10 Keratin, type I cytoskeletal 10 Homo sapiens
496567 ILNEDGSPNL 147 156 Neudesin Neudesin Homo sapiens
496569 ILSKCNIQV 662 670 F-box/WD repeat-containing F-box/WD repeat-containing Homo sapiens protein 10 protein 10
496622 KILPTPETV 2898 2906 Serine-protein kinase ATM Serine-protein kinase ATM Homo sapiens
496623 KINNEIRSV 226 234 F-box only protein 7 F-box only protein 7 Homo sapiens
496624 KISEEQQQL 8 16 Golgin subfamily A member Golgin subfamily A member Homo sapiens
4 (UniProt:Q13439) 4
496626 KISVIVETV 126 134 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- diphosphooligosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit 1 (UniProt:P04843) subunit 1
496629 KLDETGVAL 151 159 DNA topoisomerase 2-beta DNA topoisomerase 2-beta Homo sapiens
496630 KLDIISPQL 1308 1316 Thyroid receptor-interacting Thyroid receptor-interacting Homo sapiens protein 11 protein 1 1
496632 KLEEKGVYV 975 983 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 5B initiation factor 5B
496633 KLEGVLAEV 567 575 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
496634 KLFDSLTLL 251 259 ATP-binding cassette subATP-binding cassette subHomo sapiens family G member 2 family G member 2
496635 KLFQSNDPTL 75 84 Coatomer subunit gamma-1 Coatomer subunit gamma-1 Homo sapiens
496636 KLLEAISSL 45 53 U3 small nucleolar RNA- U3 small nucleolar RNA- Homo sapiens associated protein 14 associated protein 14
homolog A homolog A
496637 KLLEGEESRL 394 403 Keratin, type II cytoskeletal 7 Keratin, type II cytoskeletal 7 Homo sapiens
496638 KLLGLDVPSL 158 167 Transcription factor NIB 50 Transcription factor NIB 50 Homo sapiens kDa subunit kDa subunit
496639 KLQDAEIARL 47 56 Protein S100-A6 Protein S100-A6 Homo sapiens
496640 KLQEQVTDL 699 707 Nucleoprotein TPR Nucleoprotein TPR Homo sapiens
496641 KLQQLFIEL 243 251 Unconventional myosin-lc Unconventional myosin-lc Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
496644 KLWPEASKV 386 394 Sacsin Sacsin Homo sapiens
496645 KMDDKALLV 159 167 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit ATPase regulatory subunit
11 11
496675 KVENLVDQL 584 592 Thyroid receptor-interacting Thyroid receptor-interacting Homo sapiens protein 11 protein 1 1
496676 KVIDQQNGL 489 497 Replication protein A 70 kDa Replication protein A 70 kDa Homo sapiens
DNA-binding subunit DNA-binding subunit
496677 KVLHHTAKL 198 206 Sacsin Sacsin Homo sapiens
496707 LITRNLQEV 13 21 Tyrosine-tRNA ligase, Tyrosine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
496709 LLAEENQRL 2572 2580 Plectin Plectin Homo sapiens
496710 LLDTVLPHL 973 981 Cullin-associated NEDD8- Cullin-associated NEDD8- Homo sapiens dissociated protein 1 dissociated protein 1
49671 1 LLFLLSQNRV 103 112 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 8 ATPase regulatory subunit 8
(UniProt:P48556)
496712 LLGVGNNLLV 53 62 Other Homo sapiens Opsin-3 Homo sapiens
(human) protein
496713 LLLQHGGPVL 257 266 SMC5-SMC6 complex SMC5-SMC6 complex Homo sapiens localization factor protein 1 localization factor protein 1
496714 LLNAGEIPNL 2415 2424 Dynein heavy chain 7, Dynein heavy chain 7, Homo sapiens axonemal axonemal
496715 LLNEDLEKV 105 113 Protein kinase C and casein Protein kinase C and casein Homo sapiens kinase substrate in neurons kinase substrate in neurons
protein 1 protein 1
496716 LLQCTRNIL 153 161 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 35 associated protein 35
496717 LLQEEKLLL 344 352 Mismatch repair Mismatch repair Homo sapiens endonuclease PMS2 endonuclease PMS2
496718 LLSDKDLTV 72 80 Protein phosphatase 1 L Protein phosphatase 1 L Homo sapiens
496721 LLYSGRTIL 1265 1273 Low-density lipoprotein Low-density lipoprotein Homo sapiens receptor-related protein 1 B receptor-related protein 1 B
496766 LVEINKILL 1873 1881 Utrophin Utrophin Homo sapiens
496797 MVCYTAQTL 309 317 Interleukin enhancer-binding Interleukin enhancer-binding Homo sapiens factor 2 factor 2
496809 NIIPYITNV 333 341 Clathrin heavy chain 1 Clathrin heavy chain 1 Homo sapiens
49681 1 NLLEKDYFGL 35 44 Band 4.1 -like protein 3 Band 4.1 -like protein 3 Homo sapiens
(UniProt:F5GX05)
496812 NLLHHPKLL 1180 1188 Synaptojanin-2 Synaptojanin-2 Homo sapiens
496836 PLRTKVAKL 285 293 Neurolysin, mitochondrial Neurolysin, mitochondrial Homo sapiens
496860 QIGRENPQL 284 292 UV excision repair protein UV excision repair protein Homo sapiens
RAD23 homolog B RAD23 homolog B
496861 QINEQVEKL 356 364 Peroxisomal membrane Peroxisomal membrane Homo sapiens protein PEX14 protein PEX14
496862 QIPPVSTPV 1436 1444 5'-3' exoribonuclease 1 5'-3' exoribonuclease 1 Homo sapiens
496863 QIQEKLQQL 2261 2269 Apolipoprotein B-100 Apolipoprotein B-100 Homo sapiens
496866 QLENUEKL 251 259 Centrosomal protein of 152 Centrosomal protein of 152 Homo sapiens kDa kDa
496867 QLFKFDMNV 1163 1171 ATP-binding cassette subATP-binding cassette subHomo sapiens family A member 13 family A member 13
496868 QLKKELNEL 583 591 Phosphogl ucom utase-2 Phosphoglucomutase-2 Homo sapiens
496870 QMVKGMLQL 308 316 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
496876 QVNAVTVLTL 52 61 Serum deprivation-response Serum deprivation-response Homo sapiens protein protein
496878 QVTVPPKKPV 13126 13135 Other Homo sapiens Titin Homo sapiens
(human) protein
496888 RIIGLKPEGV 35 44 Sodium/potassium- Sodium/potassium- Homo sapiens transporting ATPase subunit transporting ATPase subunit beta-3 beta-3
496889 RLAADDFRV 100 108 Keratin, type I cytoskeletal 18 Keratin, type I cytoskeletal 18 Homo sapiens
496891 RLAAMLRQL 740 748 26S proteasome non- 26S proteasome non- Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
ATPase regulatory subunit 2 ATPase regulatory subunit 2
496892 RLAEVELRL 72 80 Kinesin-like protein KIFC3 Kinesin-like protein KIFC3 Homo sapiens
496894 RLAQGLTHL 763 771 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 2 ATPase regulatory subunit 2
496895 RLEEGIRFL 94 102 Zinc finger and BTB domain- Zinc finger and BTB domain- Homo sapiens containing protein 25 containing protein 25
496896 RLKEENEKL 266 274 Caspase recruitment Caspase recruitment Homo sapiens domain-containing protein 14 domain-containing protein 14
496897 RLLEGEDAHL 417 426 Keratin, type I cytoskeletal 14 Keratin, type I cytoskeletal 14 Homo sapiens
496898 RLLNFQRQL 408 416 Transcription activator BRG1 Transcription activator BRG1 Homo sapiens
496899 RLQEENQQL 749 757 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 35 containing protein 35
496900 RLSQLEGVNV 226 235 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 35 associated protein 35
496901 RLVGIHELFL 286 295 Protein SDA1 homolog Protein SDA1 homolog Homo sapiens
496902 RMFADDLHNL 101 110 39S ribosomal protein L51 , 39S ribosomal protein L51 , Homo sapiens mitochondrial mitochondrial
496908 RQPDLVLRL 449 457 Gem-associated protein 4 Gem-associated protein 4 Homo sapiens
496915 RVIEKEIKDV 1619 1628 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA1 polymerase I subunit RPA1
496931 SIDGVQQISL 50 59 Biliverdin reductase A Biliverdin reductase A Homo sapiens
496935 SLADFEKAL 298 306 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit ATPase regulatory subunit
11 11
496936 SLAKKCMAV 154 162 Cleavage and Cleavage and Homo sapiens polyadenylation specificity polyadenylation specificity
factor subunit 3 factor subunit 3
496938 SLAPDTRLFV 98 107 Guanine nucleotide-binding Guanine nucleotide-binding Homo sapiens protein G(I)/G(S)/G(T) protein G(I)/G(S)/G(T)
subunit beta-1 subunit beta-1
496939 SLAVSSPRL 196 204 Other Homo sapiens Acylamino-acid-releasing Homo sapiens
(human) protein enzyme
496940 SLDDHVVAV 132 140 WD repeat-containing protein WD repeat-containing protein Homo sapiens
27 27
496943 SLDKDIVAL 230 238 DNA topoisomerase 2-alpha DNA topoisomerase 2-alpha Homo sapiens
496944 SLDKTSHSL 1308 1316 General transcription factor General transcription factor Homo sapiens
3C polypeptide 1 3C polypeptide 1
496945 SUDIIUSL 42 51 Taste receptor type 2 Taste receptor type 2 Homo sapiens member 9 member 9
496946 SUDQFFGV 241 249 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 14 hydrolase 14
496947 SLKEIVINV 78 86 Stomatin-like protein 2, Stomatin-like protein 2, Homo sapiens mitochondrial mitochondrial
(UniProt:B4E1 K7)
496949 SLKPEVAQV 331 339 GDP-fucose protein O- GDP-fucose protein O- Homo sapiens fucosyltransferase 1 fucosyltransferase 1
496951 SLSESWYNL 798 806 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
496952 SLVDIYSQL 120 128 Signal transducer and Signal transducer and Homo sapiens activator of transcription 6 activator of transcription 6
496953 SLVEGEALHL 291 300 Transcription factor AP-2- Transcription factor AP-2- Homo sapiens delta delta
496954 SLYDQAEKL 262 270 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 3 ATPase regulatory subunit 3
496984 SVRSIVTTL 1851 1859 Nuclear receptor coactivator Nuclear receptor coactivator Homo sapiens
6 6
496996 TLTGKNVLIV 120 129 Hypoxanthine-guanine Hypoxanthine-guanine Homo sapiens phosphoribosyltransferase phosphoribosyltransferase
496997 TLWDIQKDL 323 331 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
497015 TVAENVYRL 2300 2308 Sacsin Sacsin Homo sapiens
497018 TVILEIPEL 670 678 DNA mismatch repair protein DNA mismatch repair protein Homo sapiens
Msh3 Msh3 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
497019 TVLTSALSPV 2074 2083 Neurogenic locus notch Neurogenic locus notch Homo sapiens homolog protein 2 homolog protein 2
497020 TVMNTIQQL 1 9 Retinoblastoma-associated Retinoblastoma-associated Homo sapiens protein protein
497036 VLDSKSVEV 684 692 Other Homo sapiens Centromere protein F Homo sapiens
(human) protein
497037 VLFTGREFFV 92 101 N(G),N(G)-dimethylarginine N(G),N(G)-dimethylarginine Homo sapiens dimethylaminohydrolase 1 dimethylaminohydrolase 1
497062 YIDDVFHAL 170 178 GTP-binding protein Rit1 GTP-binding protein Rit1 Homo sapiens
497063 YILDCNGIAV 461 470 Synapsin-2 Synapsin-2 Homo sapiens
497065 YLDKTFYNL 733 741 WASH complex subunit 7 WASH complex subunit 7 Homo sapiens
497066 YUTGNLEKL 707 716 Coatomer subunit alpha Coatomer subunit alpha Homo sapiens
497067 YLLILKACVV 148 157 UniProt:P33765 Homo sapiens
497068 YLQIHPQEL 274 282 DNA damage-binding protein DNA damage-binding protein Homo sapiens
1 1
497069 YLSDEGHYWV 70 79 Probable 18S rRNA Probable 18S rRNA Homo sapiens
(guanine-N(7))- (guanine-N(7))- methyltransferase methyltransferase
(UniProt:O43709)
499571 HEQLSVAEITN 282 292 Tubulin alpha-3C/D chain Tubulin alpha-3C/D chain Homo sapiens
503971 CLGHNHKEV 200 208 Zinc transporter 8 Zinc transporter s Homo sapiens
504005 KIADPICTFI 245 254 Zinc transporter 8 Zinc transporter 8 Homo sapiens
504008 KMYAFTLESV 16 25 Zinc transporter 8 Zinc transporter s Homo sapiens
504015 LUDLTSFLL 107 116 Zinc transporter 8 Zinc transporter s Homo sapiens
504065 VMIIVSSLAV Zinc transporter 8 Zinc transporter s Homo sapiens
504101 FILPVLGAV 655 663 Cadherin-3 Cadherin-3 Homo sapiens
504144 AAAAVIPTV 499 507 RNA-binding protein 47 RNA-binding protein 47 Homo sapiens
(UniProt:A0AV96)
504262 AILPTSIFL 212 220 Protein arginine N- Protein arginine N- Homo sapiens methyltransferase 5 methyltransferase 5
504264 AIMENANVL 163 171 Fructose-bisphosphate Fructose-bisphosphate Homo sapiens aldolase A aldolase A
504383 ALAKIEIKL 148 156 Cytochrome b-d complex Cytochrome b-d complex Homo sapiens subunit Rieske, mitochondrial subunit Rieske, mitochondrial
504390 ALDGLLQQV 241 249 RNA polymerase II RNA polymerase II Homo sapiens elongation factor ELL elongation factor ELL
504393 ALDTTRHEL 239 247 HAUS augmin-like complex HAUS augmin-like complex Homo sapiens subunit 8 subunit 8
504402 ALGPGVPHI 359 367 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA49 polymerase I subunit RPA49
504417 ALLGGNVRMML 389 399 Long-chain-fatty-acid--CoA Long-chain-fatty-acid--CoA Homo sapiens ligase 4 ligase 4
504422 ALLPQNHKL 796 804 Symplekin Symplekin Homo sapiens
504424 ALLQQPLFL 359 367 Large neutral amino acids Large neutral amino acids Homo sapiens transporter small subunit 4 transporter small subunit 4
504440 ALVNVQIPL 142 150 ATP-binding cassette subATP-binding cassette subHomo sapiens family B member 8, family B member 8,
mitochondrial mitochondrial
504446 ALYHFNHSL 709 717 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
504448 ALYSELLAV 376 384 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR5 UBR5
505196 FAYPAIRYL 117 125 28S ribosomal protein S29, 28S ribosomal protein S29, Homo sapiens mitochondrial mitochondrial
505266 FLAGAVTSV 29 37 Carbohydrate deacetylase Carbohydrate deacetylase Homo sapiens
505267 FLAPDNSLLLA 368 378 DENN domain-containing DENN domain-containing Homo sapiens protein 3 (UniProt:A2RUS2) protein 3
505274 FLFGYPKRL 206 214 Melanoma-associated Melanoma-associated Homo sapiens antigen F1 antigen F1
505281 FUPIYHQV 2174 2182 Acetyl-CoA carboxylase 1 Acetyl-CoA carboxylase 1 Homo sapiens
505282 FUQDQQGUTL 318 329 STAM-binding protein STAM-binding protein Homo sapiens
505287 FLLPTGLSSL 181 190 MIF4G domain-containing MIF4G domain-containing Homo sapiens protein (UniProt:J3QRZ6) protein Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
inhibitor
506426 KLMAPDISL 114 122 BCL2/adenovirus E1 B 19 BCL2/adenovirus E1 B 19 Homo sapiens kDa protein-interacting kDa protein-interacting
protein 2 (UniProt:J3KN59) protein 2
506550 KVQEQVHKV 1300 1308 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase, H3 lysine- methyltransferase, H3 lysine- 36 and H4 lysine-20 specific 36 and H4 lysine-20 specific
506573 LAGTALAAL 846 854 L-fucose kinase L-fucose kinase Homo sapiens
506712 UKEVDIYTV 274 283 Protein arginine N- Protein arginine N- Homo sapiens methyltransferase 8 methyltransferase 8
506715 ULGKLHYV 125 133 Tetratricopeptide repeat Tetratricopeptide repeat Homo sapiens protein 7A protein 7A
506774 LLLAATPGL 216 224 Tapasin Tapasin Homo sapiens
506780 LLLDVPTAA 15 23 Gamma-interferon-inducible Gamma-interferon-inducible Homo sapiens lysosomal thiol reductase lysosomal thiol reductase
506786 LLLSAEPVPA 19 28 B-cell antigen receptor B-cell antigen receptor Homo sapiens complex-associated protein complex-associated protein
beta chain beta chain
506790 LLQDIILQV 39 47 F-box/LRR-repeat protein 3 F-box/LRR-repeat protein 3 Homo sapiens
506820 LMWELEKKSAV 214 224 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit H initiation factor 3 subunit H
507078 MAPARLFAL 1 9 Syndecan-4 Syndecan-4 Homo sapiens
507409 NIASIGSTIFL 73 83 Vesicle transport protein Vesicle transport protein Homo sapiens
SFT2B (UniProt:095562) SFT2B
507644 QLLPQGIVPAL 186 196 Transmembrane and coiled- Homo sapiens coil domain-containing
protein 6
507812 RUDRIKTV 331 339 N-alpha-acetyltransferase N-alpha-acetyltransferase Homo sapiens
35, NatC auxiliary subunit 35, NatC auxiliary subunit
507832 RLSPVSPAL 436 444 tRNA wybutosine- tRNA wybutosine- Homo sapiens synthesizing protein 4 synthesizing protein 4
508113 SIAPRMMSV 1166 1174 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit RPB2 polymerase II subunit RPB2
508121 SIIPPLFTV 126 134 Translocon-associated Translocon-associated Homo sapiens protein subunit delta protein subunit delta
508194 SLASFIPAV 11 1 119 HAUS augmin-like complex HAUS augmin-like complex Homo sapiens subunit 1 subunit 1
508218 SLLGGVLRV 1456 1464 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 8 protein 8
508226 SLLRDVPLA 35 43 Midi -interacting protein 1 Midi-interacting protein 1 Homo sapiens
508243 SLSHLVPAL 369 377 UniProt:Q2T9F4 Homo sapiens
508248 SLTSWLTL 430 438 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DHX40 RNA helicase DHX40
508259 SMHQILLYL 661 669 Ribonuclease 3 Ribonuclease 3 Homo sapiens
(UniProt:Q9NRR4)
508261 SMMGPSPGPPSV 42 53 Probable global transcription Probable global transcription Homo sapiens activator SNF2L2 activator SNF2L2
(UniProt:P51531)
508439 SQIPAQPSV 377 385 Protein PRRC2C Protein PRRC2C Homo sapiens
508492 SVGSRPPAV 352 360 FSDMike protein FSDMike protein Homo sapiens
(UniProt:Q9BXM9)
508637 TILKRLFRV 192 200 Other Homo sapiens MOB kinase activator 1A Homo sapiens
(human) protein
508663 TLAAIAVHL 927 935 ADNP homeobox protein 2 ADNP homeobox protein 2 Homo sapiens
508669 TLFGLTPTL 80 88 Sterol regulatory element- Sterol regulatory element- Homo sapiens binding protein cleavage- binding protein cleavage- activating protein activating protein
(UniProt:Q12770)
508670 TLFPRRIFL 641 649 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ATR kinase ATR
508671 TLGDAHIYL 251 259 Thymidylate synthase Thymidylate synthase Homo sapiens
508686 TLSPRPPU 115 123 AP-5 complex subunit mu-1 AP-5 complex subunit mu-1 Homo sapiens
508688 TLSSLVFQL 1175 1183 Serine/threonine-protein Serine/threonine-protein Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
543225 KIWEELSVLEV 220 230 Melanoma-associated Melanoma-associated Homo sapiens antigen 6 antigen 6
543245 KLDDYVYYV 456 464 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF139 RNF139
543276 KLLDKPEQFL 11 19 1128 Formin-1 Formin-1 Homo sapiens
543323 KMDASLGNLFA 30 40 Protein FAM3C Protein FAM3C Homo sapiens
543334 KMVDGVGVCTV 1683 1693 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR4 UBR4
543414 KSIARVLTV 52 60 60S ribosomal protein L35 60S ribosomal protein L35 Homo sapiens
543451 KTLGKLWRL 16 24 Transcription factor SOX-8 Transcription factor SOX-8 Homo sapiens
543464 KTTTIAVEV 294 302 Vigilin (UniProt:Q00341 ) Vigilin Homo sapiens
543467 KTWDQVPFSV Unidentified protein unidentified
543473 KVADGLVKV 32 40 Dynactin subunit 3 Dynactin subunit 3 Homo sapiens
543495 KVLEHWRV 286 294 Melanoma-associated Melanoma-associated Homo sapiens antigen 4 antigen 4
543689 LILEKQPAYV 107 116 Syndetin Homo sapiens
543720 LLAEKVEQL 48 56 Tumor suppressor candidate Tumor suppressor candidate Homo sapiens
3 3
543727 LLAPKLNEA 414 422 N-terminal kinase-like protein N-terminal kinase-like protein Homo sapiens
543745 LLDUQTKV 395 403 AP-1 complex subunit beta-1 AP-1 complex subunit beta-1 Homo sapiens
543760 LLFGKIGYYL 238 247 Protein YIF1 B Protein YIF1 B Homo sapiens
543768 LLGSAHEV 1228 1235 Spectrin alpha chain, non- Spectrin alpha chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
543799 LLMEKEDYHSL 514 524 Tyrosinase Tyrosinase Homo sapiens
543801 LLNAILHSA 587 595 Nucleolar protein 1 1 Nucleolar protein 11 Homo sapiens
543836 LLWGDUWL 242 250 Structure-specific Structure-specific Homo sapiens endonuclease subunit SLX1 endonuclease subunit SLX1
543841 LLYDFQUNV 1173 1182 Intron-binding protein Intron-binding protein Homo sapiens aquarius aquarius
543947 LQSDVTCQV 305 313 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 22 hydrolase 22
544008 LTFPVRDGV 423 431 Zinc finger MIZ domain- Zinc finger MIZ domain- Homo sapiens containing protein 2 containing protein 2
544056 LYLGLFNRL 320 328 SWI/SNF-related matrix- SWI/SNF-related matrix- Homo sapiens associated actin-dependent associated actin-dependent
regulator of chromatin regulator of chromatin
subfamily A containing subfamily A containing
DEAD/H box 1 DEAD/H box 1
544062 LYPQFMFHL 578 586 Protein transport protein Protein transport protein Homo sapiens
Sec23B Sec23B
544141 MVLPLUFV 169 111 ER membrane protein ER membrane protein Homo sapiens complex subunit 7 complex subunit 7
544576 QLEERTWLL 383 391 Circadian clock protein Circadian clock protein Homo sapiens
PASD1 PASD1
544618 QQNPRLVYV 103 111 Pyridoxal kinase Pyridoxal kinase Homo sapiens
544770 RLLQETMYMTV 217 221 G2/mitotic-specific cyclin-B1 G2/mitotic-specific cyclin-B1 Homo sapiens
544806 RLYSVSYLL 2612 2620 Filamin-A Filamin-A Homo sapiens
544861 RQFLFHWTV 218 226 Dol-P- Dol-P- Homo sapiens
Man:Man(5)GlcNAc(2)-PP- Man:Man(5)GlcNAc(2)-PP- Dol alpha-1 ,3- Dol alpha-1 ,3- mannosyltransferase mannosyltransferase
545088 SAWISKPPGV 331 340 Transcription factor SOX-10 Transcription factor SOX-10 Homo sapiens
545196 SILADRILL 643 651 Protein transport protein Protein transport protein Homo sapiens
Sec23B Sec23B
545203 SISAGIPKV 550 558 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR5 UBR5
545215 SLADTNSLAW 577 581 Melanocyte protein PMEL Melanocyte protein PMEL Homo sapiens
545216 SLAEUQAL 190 198 Sestrin-2 Sestrin-2 Homo sapiens
545228 SLDDYNHLVTL 288 298 L-dopachrome tautomerase L-dopachrome tautomerase Homo sapiens
545230 SLDEKPRIV 190 198 Heat shock protein 105 kDa Heat shock protein 105 kDa Homo sapiens
545245 SLFGNIKGA 231 239 Mannosyl-oligosaccharide Mannosyl-oligosaccharide Homo sapiens
1 ,2-alpha-mannosidase IA 1 ,2-alpha-mannosidase IA
(UniProt:P33908) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
545250 SLFSGKPEV 596 604 Zinc finger MYM-type protein Zinc finger MYM-type protein Homo sapiens
3 3
545265 SLHFLILYV 942 950 Sarcoplasmic/endoplasmic Sarcoplasmic/endoplasmic Homo sapiens reticulum calcium ATPase 1 reticulum calcium ATPase 1
545269 SUDGIKRA 198 206 Adenosylhomocysteinase Adenosylhomocysteinase Homo sapiens
545272 SUHGLWNL 107 115 Protein LMBR1 L Protein LMBR1 L Homo sapiens
(UniProt:Q6UX01 )
545281 SLLDNLLTI 1619 1627 Rotatin Rotatin Homo sapiens
545290 SLLNWMDL 1004 1012 Chromodomain-helicase- Chromodomain-helicase- Homo sapiens
DNA-binding protein 4 DNA-binding protein 4
545296 SLLTSLVTA 401 409 Zinc finger ZZ-type and EF- Zinc finger ZZ-type and EF- Homo sapiens hand domain-containing hand domain-containing
protein 1 protein 1
545299 SLMKDFPGA 562 570 Band 4.1 -like protein 2 Band 4.1 -like protein 2 Homo sapiens
(UniProt:043491)
545300 SLMWTLLK 369 376 Oxysterol-binding protein- Homo sapiens related protein 5
(UniProt:Q9H0X9)
545310 SLQEEKLIYV 485 494 Hyccin (UniProt:Q9BYI3) Hyccin Homo sapiens
545318 SLSGVMLTDV 355 364 Melanoma antigen Melanoma antigen Homo sapiens preferentially expressed in preferentially expressed in
tumors tumors
545324 SLSSLELFL 378 386 Coiled-coil domain- Homo sapiens containing protein 91
545325 SLSSLLVKL 11 19 Centrosomal protein of 290 Centrosomal protein of 290 Homo sapiens kDa (UniProt:O15078) kDa
545337 SLWKGLVGI 4 12 Membrane magnesium Membrane magnesium Homo sapiens transporter 1 transporter 1
545351 SMLEEGKEPWTV 58 69 Zinc finger protein 160 Zinc finger protein 160 Homo sapiens
545420 SQFSGKITV 402 410 Transmembrane protein 131 Transmembrane protein 131 Homo sapiens
545513 SVALKGHSL 424 432 Zinc finger protein 518B Zinc finger protein 518B Homo sapiens
545523 SVIEQLFFV 223 231 COUP transcription factor 2 COUP transcription factor 2 Homo sapiens
545537 SVTSHIYQV 1000 1008 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
4B 4B
545691 TLAAVLQRI 389 397 Hexokinase-2 Hexokinase-2 Homo sapiens
545697 TLDEKVAEL 140 148 Melanoma-associated Melanoma-associated Homo sapiens antigen C2 antigen C2
545726 TLLESIQHV 4029 4037 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HERC2 HERC2
545727 TLLESIRQA 364 372 WAS protein family homolog WAS protein family homolog Homo sapiens
1 1
545731 TLLRALQAL 148 156 Vacuolar protein-sorting- Vacuolar protein-sorting- Homo sapiens associated protein 25 associated protein 25
545761 TLSTVISKV 1410 1418 Other Homo sapiens MAX gene-associated Homo sapiens
(human) protein protein
545767 TLVPMPVRV 87 95 Transcription factor SOX-9 Transcription factor SOX-9 Homo sapiens
545771 TLWYRAPEV 182 190 Cyclin-dependent kinase 6 Cyclin-dependent kinase 6 Homo sapiens
545772 TLWYRAPEVLL 182 192 Cyclin-dependent kinase 6 Cyclin-dependent kinase 6 Homo sapiens
545773 TLWYRPPEL 642 650 Putative cell-cycle- Putative cell-cycle- Toxoplasma associated protein kinase associated protein kinase gondii ME49
546085 VLFTITKTV 517 525 Ribosomal protein S6 kinase Ribosomal protein S6 kinase Homo sapiens alpha-3 alpha-3
546089 VLGKIEKV 137 144 Lipopolysaccharide- Lipopolysaccharide- Homo sapiens responsive and beige-like responsive and beige-like
anchor protein anchor protein
546093 VLGPKIEAV 550 558 Hepatoma-derived growth Hepatoma-derived growth Homo sapiens factor-related protein 2 factor-related protein 2
546138 VLSECIEGV 252 260 Probable helicase with zinc Probable helicase with zinc Homo sapiens finger domain finger domain
546140 VLSSDGVWRV 124 133 Protein misato homolog 1 Protein misato homolog 1 Homo sapiens
546155 VLYRYGSFSVTL 483 494 Melanocyte protein PMEL Melanocyte protein PMEL Homo sapiens
546156 VMDAALLLI 151 159 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 2 subunit 3 initiation factor 2 subunit 3 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
546385 WLDPNETNEI 4 13 60S ribosomal protein L19 60S ribosomal protein L19 Homo sapiens
546522 YLGKVLEL 788 795 Clustered mitochondria Clustered mitochondria Homo sapiens protein homolog protein homolog
546537 YLMDINGKMWL 2078 2088 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF213 RNF213
546542 YLPPGFLSA 1096 1104 Sterol regulatory element- Sterol regulatory element- Homo sapiens binding protein 1 binding protein 1
546546 YLRGGAITEV 247 256 Ubiquitin-like modifier- Ubiquitin-like modifier- Homo sapiens activating enzyme 7 activating enzyme 7
546551 YLSEKVLAA 490 498 Coatomer subunit beta' Coatomer subunit beta' Homo sapiens
(UniProt:P35606)
546563 YLVYILNEL 248 256 Probable ATP-dependent Probable ATP-dependent Homo sapiens
RNA helicase DDX47 RNA helicase DDX47
(UniProt:Q9H0S4)
546681 YVIELQHVV 643 651 Glutamine-tRNA ligase Glutamine-tRNA ligase Homo sapiens
546800 AILEYLTAEV 79 88 Histone H2A Histone H2A Toxoplasma
(UniProt:Q8MZS6) gondii GT1
546803 ALAEPVTGVGEA 51 62 Dense granule protein 3 Dense granule protein 3 Toxoplasma gondii GT1
54681 1 ALLRLDDLFI 194 203 Putative pre-rRNA- Putative pre-rRNA- Toxoplasma processing protein PN01 processing protein PN01 gondii GT1
546812 ALPAVGMGA 144 152 Dense granule antigen Dense granule antigen Toxoplasma
(UniProt:A8l7E5) gondii GT1
546814 ALVEAFKAIQRA 412 423 MAG1 MAG1 Toxoplasma gondii GT1
546825 AQFEHTLLV 241 249 Methionine aminopeptidase 1 Methionine aminopeptidase 1 Homo sapiens
546828 AVPGDNVGFNV 288 298 Elongation factor 1 -alpha Elongation factor 1 -alpha Toxoplasma gondii GT1
546838 FANTIIEEA + 220 228 Putative transmembrane Putative transmembrane Toxoplasma
DEAM(N3) protein (UniProt:B9QH40) protein gondii GT1
546839 FGIVEGLMTTV + 168 178 Glyceraldehyde-3-phosphate Glyceraldehyde-3-phosphate Homo sapiens
INDIST(L3) dehydrogenase dehydrogenase
546841 FGLVEGLMTTV + 41 1 421 Other Toxoplasma gondii Toxoplasma
INDIST(L3) protein gondii
546843 FIMDEADEMLS 185 195 Eukaryotic initiation factor- Eukaryotic initiation factor- Toxoplasma
4A, putative 4A, putative gondii GT1
546844 FITLHVPLL 210 218 D-3-phosphoglycerate D-3-phosphoglycerate Toxoplasma dehydrogenase dehydrogenase gondii GT1
546845 FLALHILTA 363 371 Rhoptry protein 5B Rhoptry protein 5B Toxoplasma gondii GT1
546847 FLAQVIVLNHPG 326 337 Elongation factor 1 -alpha Elongation factor 1 -alpha Toxoplasma gondii GT1
546854 FLDELAKVFT 621 630 Putative microtubule-binding Putative microtubule-binding Toxoplasma protein protein gondii GT1
546855 FLFEDDTPKKP 207 217 MAC/Perforin domain- MAC/Perforin domain- Toxoplasma containing protein containing protein gondii GT1
546856 FLFEDDTPKKPK 207 218 MAC/Perforin domain- MAC/Perforin domain- Toxoplasma containing protein containing protein gondii GT1
546858 FLLDDLKQILVT 230 241 Ubiquitin family protein Ubiquitin family protein Toxoplasma
(UniProt:B9QPA6) gondii GT1
546859 FLLSTRAGGLG 577 587 SWI2/SNF2 ISWI-like (AT SWI2/SNF2 ISWI-like (AT Toxoplasma hook) hook) gondii ME49
546862 FLNTVEVRV 325 333 Dense granule protein Dense granule protein Toxoplasma
GRA12 GRA12 gondii GT1
546863 FLNTVEVRVT 325 334 Dense granule protein Dense granule protein Toxoplasma
GRA12 GRA12 gondii GT1
546864 FLNTVEVRVTG 325 335 Dense granule protein Dense granule protein Toxoplasma
GRA12 GRA12 gondii GT1
546866 FLTNEGIEFL 75 84 Ribosomal protein RPS10 Ribosomal protein RPS10 Toxoplasma gondii GT1
546867 FLTNEGIEFLRT 75 86 Ribosomal protein RPS10 Ribosomal protein RPS10 Toxoplasma gondii GT1
546869 FMADETDLAGRS 79 90 Other Toxoplasma gondii Toxoplasma Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
protein gondii GT1
546871 FMDPPAPETLM 205 215 ATP-dependent RNA ATP-dependent RNA Toxoplasma helicase helicase gondii ME49
546874 FRGLLAEARIVG + 180 191 Putative transmembrane Putative transmembrane Toxoplasma
ACET(F1) protein (UniProt:B9Q6Y8) protein gondii GT1
546875 FVDTLKTLA 148 156 Microneme protein MIC11 Microneme protein MIC11 Toxoplasma gondii GT1
546880 FVLELEPEWTVK 16 27 Ubiquitin family protein Ubiquitin family protein Toxoplasma
(UniProt:B6KDY1 ) gondii GT1
546882 FVYPLDFART 130 139 Other Homo sapiens ADP/ATP translocase 2 Homo sapiens
(human) protein
546883 GGNGMLATI 1493 1501 Prochlorococcus phage P- Prochlorococcus
HM1 protein phage P-HM1
546884 GILNFLTSV + 10116 10124 Amine-terminal region of Amine-terminal region of Toxoplasma
DEAM(N4) chorein, A TM vesicle- chorein, A TM vesicle- gondii GT1 mediated sorter mediated sorter
546890 GLDKQIQEL 177 185 Putative 26S protease Putative 26S protease Toxoplasma regulatory subunit 4 regulatory subunit 4 gondii ME49
546891 GLDNAGKTTI 23 32 ADP-ribosylation factor-like ADP-ribosylation factor-like Homo sapiens protein 2 protein 2
546892 GLDNAGKTTL 27 36 Putative small GTP-binding Putative small GTP-binding Toxoplasma protein sari protein sari gondii ME49
546895 GLSAFLHAI 810 818 V-type proton ATPase 1 16 V-type proton ATPase 1 16 Homo sapiens kDa subunit a isoform 2 kDa subunit a isoform 2
546896 GLVEGLMTT 815 823 Other Toxoplasma gondii Toxoplasma protein gondii GT1
546897 GLVEGLMTTV 815 824 Other Toxoplasma gondii Toxoplasma protein gondii GT1
546898 GMEEGEFSEA 391 400 Alpha tubulin TUBA1 Alpha tubulin TUBA1 Toxoplasma gondii GT1
546899 GQAPVDSLRPT 46 56 Dense granule antigen Dense granule antigen Toxoplasma
(UniProt:A8l7E5) gondii GT1
546903 GVIEEDLKAW 502 512 Putative transmembrane Putative transmembrane Toxoplasma protein (UniProt:B9Q5Q9) protein gondii GT1
546904 HIVGLDIFTGK + 59 69 Eukaryotic translation Eukaryotic translation Toxoplasma
INDIST02) initiation factor 5A initiation factor 5A gondii ME49
546905 HLDATTVLS 407 415 ATP synthase subunit beta ATP synthase subunit beta Toxoplasma gondii ME49
546909 HLLDFPNIVIK 2077 2087 Pre-mRNA processing Pre-mRNA processing Toxoplasma splicing factor PRP8 splicing factor PRP8 gondii ME49
546910 HLLQTDASAQL 81 91 Putative nucleolar protein 5 Putative nucleolar protein 5 Toxoplasma gondii GT1
546912 HLMDEAVEVAK 261 271 Other Toxoplasma gondii Toxoplasma protein gondii GT1
546913 HLVGIDIFTGK + 57 67 Eukaryotic translation Eukaryotic translation Homo sapiens
INDIST(L2) initiation factor 5A-2 initiation factor 5A-2
546914 IIIDEIHLL 1023 1031 Putative Superkiller viralicidic Putative Superkiller viralicidic Toxoplasma activity 2 family 2 activity 2 family 2 gondii GT1
546918 ILFDSKLATI 250 259 Dense-granule antigen DG32 Dense-granule antigen DG32 Toxoplasma gondii GT1
546919 ILFDSKLATIR 250 260 Dense-granule antigen DG32 Dense-granule antigen DG32 Toxoplasma gondii GT1
546921 ILLELEAPIKI 50 60 Serine/threonine-protein Serine/threonine-protein Toxoplasma phosphatase phosphatase gondii GT1
546922 ILMDLEPGTMDS 64 75 Beta tubulin Beta tubulin Toxoplasma gondii GT1
546925 ILPDSLPLDTL 69 79 LSM domain-containing LSM domain-containing Toxoplasma protein protein gondii ME49
546927 ILTAQLIRL 368 376 Rhoptry protein 5B Rhoptry protein 5B Toxoplasma gondii GT1
546931 IRKLFNLSKDQD + 141 152 40S ribosomal protein S6 40S ribosomal protein S6 Toxoplasma
DEAM(Q1 1) gondii GT1
546933 ITNCLLSTA 370 378 Crimean-Congo hemorrhagic Crimean-Congo Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
fever orthonairovirus protein hemorrhagic fever orthonairovirus
546935 IVLGUATA 1223 1231 Structural polyprotein Structural polyprotein Eastern equine encephalitis virus
546937 KDLVLLATI 221 229 Other Human Human
mastadenovirus A protein adenovirus 12
546939 KLALPAVGM 142 150 Dense granule antigen Dense granule antigen Toxoplasma
(UniProt:A8l7E5) gondii GT1
546940 KLALPAVGMGA 142 152 Dense granule antigen Dense granule antigen Toxoplasma
(UniProt:A8l7E5) gondii GT1
546941 KLDESEQTLEVL 347 358 Cathepsin CPC1 Cathepsin CPC1 Toxoplasma gondii GT1
546943 KLEEIDDLLQLT 273 234 MAG1 MAG1 Toxoplasma gondii GT1
546945 KLFHLDSTLLA 239 249 Other Toxoplasma gondii Toxoplasma protein gondii GT1
546949 KLIVTSATL 699 707 Pre-mRNA-splicing factor Pre-mRNA-splicing factor Toxoplasma
ATP-dependent RNA ATP-dependent RNA gondii ME49 helicase, putative helicase, putative
546950 KLLADIPKA 102 110 Other Toxoplasma gondii Toxoplasma protein gondii GT1
546951 KLLDQIKQLK 150 159 Brfl p family coiled coil Brfl p family coiled coil Toxoplasma protein protein gondii GT1
546953 KLMQLLEEDTVA 15 26 GDA1/CD39 (Nucleoside GDA1/CD39 (Nucleoside Toxoplasma phosphatase) family protein phosphatase) family protein gondii GT1
546954 KLNPMLAKA 726 734 Mycobacterium virus Mycobacterium
Predator protein phage Predator
546958 KVIDDVQQLEKD 163 174 Dense granule protein GRA1 Dense granule protein GRA1 Toxoplasma gondii GT1
546963 KVLGLWATV 27 35 Enterobacteria phage RB43 Enterobacteria protein phage RB43
546964 KVVAEKGFTAA 105 115 Dense granule protein GRA2 Dense granule protein GRA2 Toxoplasma gondii GT1
546965 LALEQVADI 1052 1060 3'5'-cyclic nucleotide 3'5'-cyclic nucleotide Toxoplasma phosphodiesterase domain- phosphodiesterase domain- gondii GT1 containing protein containing protein
546966 LALPMPATA 5 13 Streptomyces phage mu1/6 Streptomyces protein phage mu1/6
546967 LGNPLSLSTLQ + 676 686 Other Toxoplasma gondii Toxoplasma
DEAM(Q1 1) protein gondii GT1
546968 LILEVQPHPS 423 432 Glucose-6-phosphate 1- Glucose-6-phosphate 1 - Toxoplasma dehydrogenase dehydrogenase gondii GT1
546969 LILEVQPHPSV 423 433 Glucose-6-phosphate 1- Glucose-6-phosphate 1 - Toxoplasma dehydrogenase dehydrogenase gondii GT1
546970 LLASLATSV 732 740 HEAT repeat-containing HEAT repeat-containing Toxoplasma protein protein gondii GT1
546971 LLDEHGHVRL 589 598 AGC kinase AGC kinase Toxoplasma gondii GT1
546975 LLGRIPSAVG 321 330 ATP synthase subunit beta, ATP synthase subunit beta, Homo sapiens mitochondrial mitochondrial
546977 LLLQQQQQL 1167 1175 Other Toxoplasma gondii Toxoplasma protein gondii GT1
546982 LLTIEDGIFEV + 174 184 Heat shock protein 70 Heat shock protein 70 Toxoplasma
INDIST(U ) gondii
546988 LQLCCLATA 127 135 membrane protein US19 membrane protein US19 Panine
betaherpesvirus 2
546989 LSLETVLNI 1188 1196 Carbamoyl phosphate Carbamoylphosphate Toxoplasma synthetase synthetase gondii GT1
546990 LVEGLMTTV + 413 421 Other Toxoplasma gondii Toxoplasma
INDIST(U ) protein gondii
546991 LVLPIUTI 506 514 Spodoptera litura Spodoptera litura nucleopolyhedrovirus protein nucleopolyhed rovi rus Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
546993 MGLPGVATV 11 1 119 Enterobacteria phage 933W Enterobacteria sensu lato protein phage VT2-Sakai
546994 MGNGCLRIV 299 307 Bovine papular stomatitis Bovine papular virus protein stomatitis virus
546996 MINPLVITT 1833 1841 RNA-directed RNA RNA-directed RNA Guanarito polymerase L polymerase L mammarenavirus
547001 NDFCCVATV 123 131 Spodoptera litura Spodoptera litura nucleopolyhedrovirus II nucleopolyhedrovi protein rus II
547003 NGVRVLATA 153 161 Fusion glycoprotein F0 Fusion glycoprotein F0 Human
metapneumovirus
547004 NIQGITKPAIR 26 36 Histone H4 Histone H4 Toxoplasma gondii ME49
547005 NIVCPLCTL 82 90 Protein E7 Protein E7 Mupapillomavirus
1
547006 NLLSDLSVRL 392 401 Putative transmembrane Putative transmembrane Toxoplasma protein (UniProt:B9Q5Q9) protein gondii GT1
54701 1 QFLSPWLL + 233 241 Putative P-type ATPase4 Putative P-type ATPase4 Toxoplasma
DEAM(Q1 ) gondii GT1
547012 QIQEUEAT + 337 345 Putative tat-binding family Putative tat-binding family Toxoplasma
PYRE(Q1 ) protein protein gondii ME49
547013 QLNEEQKVQV 167 176 GDA1/CD39 (Nucleoside GDA1/CD39 (Nucleoside Toxoplasma phosphatase) family protein phosphatase) family protein gondii GT1
547018 RDVPMUTT 775 783 Outer capsid protein VP1 Outer capsid protein VP1 Grass carp reovirus
547019 RGTPMVITV 461 469 Gallid alphaherpesvirus 2 Marek's disease
(Marek disease virus type 1 ) herpesvirus strain protein GA
547020 RIINEPTAA 136 144 Heat shock protein 70 Heat shock protein 70 Toxoplasma gondii
547021 RINAILATA 355 363 Klebsiella phage phiK02 Klebsiella phage protein phiK02
547026 RLNTVLATA 696 704 Spodoptera frugiperda Spodoptera ascovirus 1 a protein frugiperda ascovirus 1 a
547027 RVNRUIWV 17 25 Bovine papular stomatitis Bovine papular virus protein stomatitis virus
547028 SGDGLVATG 91 99 Escherichia virus IME08 Enterobacteria protein phage IME08
547036 SLFDEEGAK 256 264 Phosphoglycerate kinase Phosphoglycerate kinase Toxoplasma gondii
547037 SLFDEEGAKIV 256 266 Phosphoglycerate kinase 1 Phosphoglycerate kinase 1 Homo sapiens
(UniProt:P00558)
547038 SLFEGIDYSVS 288 298 Heat shock protein 70 Heat shock protein 70 Toxoplasma gondii GT1
547040 SLGEWQGLTL 1835 1844 Other Toxoplasma gondii Toxoplasma protein gondii ME49
547042 SLLEHTDVAVM 172 182 Alpha tubulin TUBA1 Alpha tubulin TUBA1 Toxoplasma gondii GT1
547043 SLLGVDAVEKQL + 334 345 MAG1 MAG1 Toxoplasma
DEAM(Q1 1) gondii ME49
547045 SLLTIEDGIFEV + 173 184 Heat shock protein 70 Heat shock protein 70 Toxoplasma
INDIST(L2) gondii
547047 SLMTKGPST 139 147 Histone H2A Histone H2A Toxoplasma
(UniProt:Q8MZS6) gondii GT1
547048 SLMTKGPSTQPM 139 150 Histone H2A Histone H2A Toxoplasma
(UniProt:Q8MZS6) gondii GT1
547049 SLQDIIAILGMD 462 473 ATP synthase subunit beta ATP synthase subunit beta Toxoplasma gondii ME49
547052 SLQEDSIAKM 10 19 40S ribosomal protein SA 40S ribosomal protein SA Toxoplasma gondii GT1
547059 TIMPKDIQLA 119 128 Histone H3 Histone H3 Toxoplasma gondii ME49 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
547060 TLLAAVRGEAA 347 357 Putative transmembrane Putative transmembrane Toxoplasma protein (UniProt:B9QFL1) protein gondii GT1
547061 TLVEALDTM 213 221 Elongation factor 1 -alpha Elongation factor 1 -alpha Toxoplasma gondii GT1
547062 TLVEALDTME 213 222 Elongation factor 1 -alpha Elongation factor 1 -alpha Toxoplasma gondii GT1
547063 TLVEALDTM EAP 213 224 Elongation factor 1 -alpha Elongation factor 1 -alpha Toxoplasma gondii GT1
547067 TMLELLNQL 309 311 Putative 26S protease Putative 26S protease Toxoplasma regulatory subunit 4 regulatory subunit 4 gondii GT1
547068 TMLELLNQLDG 309 319 Putative 26S protease Putative 26S protease Toxoplasma regulatory subunit 4 regulatory subunit 4 gondii ME49
547071 TWEIRNFL 109 111 Ribosomal protein RPL9 Ribosomal protein RPL9 Toxoplasma gondii GT1
547072 TWPGGDLAKV 361 311 Alpha tubulin TUBA1 Alpha tubulin TUBA1 Toxoplasma gondii ME49
547073 VFLLLAPAPTF 209 219 Dense granule protein Dense granule protein Toxoplasma
GRA12 GRA12 gondii GT1
547076 VLATLLNNL 1093 1101 Splicing factor 3B subunit 1 Splicing factor 3B subunit 1 Homo sapiens
547077 VLEEWLDTYAG 544 554 GDA1/CD39 (Nucleoside GDA1/CD39 (Nucleoside Toxoplasma phosphatase) family protein phosphatase) family protein gondii GT1
547083 VTIMPKDIQL 118 121 Histone H3 Histone H3 Toxoplasma gondii ME49
547084 VTIMPKDIQLA 118 128 Histone H3 Histone H3 Toxoplasma gondii ME49
547086 VTLSAHPLTL 2812 2821 Other Toxoplasma gondii Toxoplasma protein gondii GT1
547090 YLALPPHIFAPA 174 185 Glucose-6-phosphate 1- Glucose-6-phosphate 1 - Toxoplasma dehydrogenase dehydrogenase gondii GT1
547092 YLDEGKVIKA 54 63 Rab1 1 Rab1 1 Toxoplasma gondii GT1
547094 YLFKEGVIWQK 22 33 Ribosomal protein RPS10 Ribosomal protein RPS10 Toxoplasma gondii GT1
547095 YLGDGPKLV 260 268 Putative 26S protease Putative 26S protease Toxoplasma regulatory subunit 4 regulatory subunit 4 gondii ME49
547096 YLGKEVKEA 135 143 Heat shock protein 70 Heat shock protein 70 Toxoplasma gondii GT1
547097 YLGKTVQV 106 113 CTP synthase 2 CTP synthase 2 Homo sapiens
547099 YLLTAPVKA 157 165 Phosphorylase family protein Phosphorylase family protein Toxoplasma gondii GT1
547109 YLTAEVLELAGN 83 94 Histone H2A Histone H2A Toxoplasma
(UniProt:Q8MZS6) gondii ME49
547117 YLYETPLETR 159 168 Other Toxoplasma gondii Toxoplasma protein gondii GT1
547120 YNFEKPFLWLA 155 165 GTP-binding nuclear protein GTP-binding nuclear protein Homo sapiens
Ran Ran
548108 GLAARMSQV 2203 2211 Serine/arginine repetitive Serine/arginine repetitive Homo sapiens matrix protein 2 matrix protein 2
548276 LLPPQPALA 21 29 Angiotensin-converting Angiotensin-converting Homo sapiens enzyme enzyme
548327 NLLEQFILL 10 18 COP9 signalosome complex COP9 signalosome complex Homo sapiens subunit 7b (UniProt:J3KQ41 ) subunit 7b
548405 RMDGAVTSV 835 843 Nuclear receptor coactivator Nuclear receptor coactivator Homo sapiens
1 1
548415 RQLAKIHAI 232 240 Ethanolamine kinase 1 Ethanolamine kinase 1 Homo sapiens
548436 RVMEYINRL 1039 1041 Clathrin heavy chain 1 Clathrin heavy chain 1 Homo sapiens
549109 DULELLDL 55 63 Trichohyalin Trichohyalin Homo sapiens
549118 ELAGIGILT 26 34 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
549152 FLLFIFKVA 74 82 Trichohyalin Trichohyalin Homo sapiens
549168 KLQQKEEQL 965 913 Trichohyalin Trichohyalin Homo sapiens
549180 KTVDLILEL 52 60 Trichohyalin Trichohyalin Homo sapiens
549187 LLQEEEEEL 905 913 Trichohyalin Trichohyalin Homo sapiens
member 7 member 7 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
558684 KLSSLGLNSV 1406 1415 Genome polyprotein Genome polyprotein Hepatitis C virus
558685 KLTALGINAV Other Hepatitis C virus Hepatitis C virus protein
558686 KLVALGNNAV 109 118 Genome polyprotein Genome polyprotein Hepatitis C virus
558687 KLVTLGINAV 1406 1415 Genome polyprotein Genome polyprotein Hepatitis C virus
562048 ALDIUTNV 8 16 TATA box-binding proteinTATA box-binding proteinHomo sapiens like protein 1 like protein 1
562051 ALDRQTATQLL 86 96 60S ribosomal protein L7a 60S ribosomal protein L7a Homo sapiens
562063 AUDGSREGFYL 341 352 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
CBL-B CBL-B
562070 ALLAELEKI 128 136 Spliceosome-associated Spliceosome-associated Homo sapiens protein CWC15 homolog protein CWC15 homolog
562076 ALLERASATL 371 380 Melanoma antigen Melanoma antigen Homo sapiens preferentially expressed in preferentially expressed in
tumors tumors
562091 ALQDSNNKL 191 199 Homer protein homolog 3 Homer protein homolog 3 Homo sapiens
562101 ALSELTQGV 1148 1156 Kinesin-like protein KIF20B Kinesin-like protein KIF20B Homo sapiens
562105 ALTDIDLQL 45 53 Chondroitin sulfate Chondroitin sulfate Homo sapiens proteoglycan 4 proteoglycan 4
562106 ALTDKAIVK 84 92 Other Homo sapiens HRAS-like suppressor 3 Homo sapiens
(human) protein
562125 AMLGTHTMEVTV 184 195 Melanocyte protein PMEL Melanocyte protein PMEL Homo sapiens
562147 AQYGKVIDR 130 138 Other Homo sapiens GMP synthase [glutamine- Homo sapiens
(human) protein hydrolyzing]
562857 ELSDVUYL 95 103 dCTP pyrophosphatase 1 dCTP pyrophosphatase 1 Homo sapiens
563526 FLPPEHTIVYI 404 414 Polyphosphoinositide Polyphosphoinositide Homo sapiens phosphatase phosphatase
563719 GTMDMSITRL 1218 1227 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 1 complex subunit 1
563745 GVYDIDNKTIEL 78 89 Copine-3 Copine-3 Homo sapiens
563906 HVDSTLLQV 222 230 P protein P protein Homo sapiens
563907 HVFDHPWETV 8 17 PRELI domain containing PRELI domain containing Homo sapiens protein 3B protein 3B
563924 HVITKTMEL 2985 2993 E3 SUMO-protein ligase E3 SUMO-protein ligase Homo sapiens
RanBP2 RanBP2
564118 KIFEDIPTL 67 75 Other Homo sapiens Gamma-interferon-inducible Homo sapiens
(human) protein protein 16
564144 KIWDLKERTNVA 375 386 Pre-mRNA-processing factor Pre-mRNA-processing factor Homo sapiens
19 19
564195 LLNVDPDNVVL 45 56 Growth arrest and DNA Growth arrest and DNA Homo sapiens damage-inducible protein damage-inducible protein
GADD45 alpha GADD45 alpha
564205 KLQEENHQL 250 258 RUN and FYVE domain- RUN and FYVE domain- Homo sapiens containing protein 2 containing protein 2
564232 KMDDPTVNWSI 350 360 Eukaryotic peptide chain Eukaryotic peptide chain Homo sapiens release factor GTP-binding release factor GTP-binding
subunit ERF3B subunit ERF3B
564254 KMQEDLVTL 39 47 Voltage-dependent calcium Voltage-dependent calcium Homo sapiens channel subunit alpha- channel subunit alpha- 2/delta-1 2/delta-1
564265 KMYGYVDTLLT 166 176 General transcription factor General transcription factor Homo sapiens
3C polypeptide 3 3C polypeptide 3
564276 KQDFSVPQL 629 637 Melanocyte protein PMEL Melanocyte protein PMEL Homo sapiens
564277 KQDILYLH 264 271 EF-hand calcium-binding EF-hand calcium-binding Homo sapiens domain-containing protein 14 domain-containing protein 14
564351 KTMEDTLMTV 216 225 Arfaptin-2 Arfaptin-2 Homo sapiens
564362 KTWDQVPFSVSV Unidentified protein Homo sapiens
564364 KTWNAVLLR 176 184 UDP-glucose 4-epimerase UDP-glucose 4-epimerase Homo sapiens
564383 KVLGKGSFGK 353 362 Protein kinase C delta type Protein kinase C delta type Homo sapiens
564470 LLFERELHSV 98 107 RAD50-interacting protein 1 Homo sapiens
564571 MIRKEELEI 45 53 Protein mago nashi homolog Protein mago nashi homolog Homo sapiens
(UniProt:B1ARP8)
564640 NLFEWAKNSPL 631 641 Peroxisomal acyl-coenzyme Peroxisomal acyl-coenzyme Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
565980 VLWSDSSITSV 120 130 Zinc finger CCHC domain- Zinc finger CCHC domain- Homo sapiens containing protein 14 containing protein 14
565986 VMAPRTLL 3 10 HLA class I histocompatibility HLA class I histocompatibility Homo sapiens antigen, A-29 alpha chain antigen, A-29 alpha chain
565991 VMLDKQKEL 134 142 Signal transducer and Signal transducer and Homo sapiens activator of transcription 1 - activator of transcription 1 - alpha/beta alpha/beta
566061 WLLDNVRKV 156 164 Glycerol kinase Glycerol kinase Homo sapiens
566088 YIMEPSIFNTL 47 57 Negative elongation factor Negative elongation factor Homo sapiens
C/D C/D
566100 YLINEIDRIRA 981 991 Dystonin (UniProt:Q03001) Dystonin Homo sapiens
566101 YUNNPNQISL 191 201 Tubulin polyglutamylase Tubulin polyglutamylase Homo sapiens
TTLL5 TTLL5
566297 IMPGQEAGL 592 600 Melanocyte protein PMEL Melanocyte protein PMEL Homo sapiens
566380 QILKGGSGT 563 571 Melanocyte protein PMEL Melanocyte protein PMEL Homo sapiens
566383 QLIMPGQEA 590 598 Melanocyte protein PMEL Melanocyte protein PMEL Homo sapiens
566414 SLAVVSTQL 583 591 Melanocyte protein PMEL Melanocyte protein PMEL Homo sapiens
566422 SSADVEFCL 314 322 Tyrosinase Tyrosinase Homo sapiens
566537 VIMPCSWWV 319 327 Leukocyte cell-derived Leukocyte cell-derived Homo sapiens chemotaxin 1 chemotaxin 1
567375 AIRNDEEL 87 94 Histone H2AX Histone H2AX Homo sapiens
567582 FLLEREQLL 21 1 219 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 138 containing protein 138
567750 IIADNIIFL 132 140 Single-stranded DNA-binding Single-stranded DNA-binding Homo sapiens protein, mitochondrial protein, mitochondrial
568335 RIFAPNHVV 31 39 60S ribosomal protein L18a 60S ribosomal protein L18a Homo sapiens
568339 RIHPVSTMV 270 278 L-lactate dehydrogenase B L-lactate dehydrogenase B Homo sapiens chain chain
568351 RILDILEYI 160 168 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase VRK1 kinase VRK1
568364 RISPWLLRV 1206 1214 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit RPB1 polymerase II subunit RPB1
568906 YLNDLHEVL 243 251 G1/S-specific cyclin-E1 G1/S-specific cyclin-E1 Homo sapiens
568942 YVHMVTHFI 46 54 Bax inhibitor 1 Bax inhibitor 1 Homo sapiens
(UniProt:P55061 )
569162 ILAKFLHEL 540 548 Telomerase reverse Telomerase reverse Homo sapiens transcriptase transcriptase
569163 ILAKFLHRL 540 548 Telomerase reverse Telomerase reverse Homo sapiens transcriptase transcriptase
569164 ILAKFLHTL 540 548 Telomerase reverse Telomerase reverse Homo sapiens transcriptase transcriptase
569165 ILGKFLHRL 540 548 Telomerase reverse Telomerase reverse Homo sapiens transcriptase transcriptase
569166 ILGKFLHTL 540 548 Telomerase reverse Telomerase reverse Homo sapiens transcriptase transcriptase
569167 ILGKFLHWL 540 548 Telomerase reverse Telomerase reverse Homo sapiens transcriptase transcriptase
569868 AAFAHFPEL 340 348 Intron-binding protein Intron-binding protein Homo sapiens aquarius aquarius
569889 AALKLPLLV 29 37 Phosphopantothenoylcystein Ph os ph opan toth e n oyl cystei n Homo sapiens e decarboxylase e decarboxylase
569892 AALSKIFAV 231 239 Mitochondrial folate Mitochondrial folate Homo sapiens transporter/carrier transporter/carrier
569894 AAMSVAQRV 197 205 Pre-mRNA-splicing factor Pre-mRNA-splicing factor Homo sapiens
ATP-dependent RNA ATP-dependent RNA
helicase DHX15 helicase DHX15
570254 AIAPCEVTVPA 115 125 60S acidic ribosomal protein 60S acidic ribosomal protein Homo sapiens
P0 (UniProt:P05388) P0
570256 AIFAIPLQI 479 487 Transmembrane protein 131 - Transmembrane protein 131 - Homo sapiens like (UniProt:A2VDJ0) like
570282 AIYPEPFU 661 669 U2 snRNP-associated SURP U2 snRNP-associated SURP Homo sapiens motif-containing protein motif-containing protein
570286 ALASLVQHI 236 244 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
570704 AQLPMSIRI 487 495 AT-rich interactive domain- AT-rich interactive domain- Homo sapiens containing protein 3A containing protein 3A
570708 AQNDUWNI 240 248 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 1 polymerase 1
570747 AQSGFPLRV 79 87 RalBPI -associated Eps RalBPI -associated Eps Homo sapiens domain-containing protein 1 domain-containing protein 1
(UniProt:Q96D71 )
570754 AQVPVFLAL 701 709 Protein sel-1 homolog 1 Protein sel-1 homolog 1 Homo sapiens
570758 AQYFEPLTL 1735 1743 Talin-1 Talin-1 Homo sapiens
570946 ATLGAILNRL 388 397 Hexokinase-1 Hexokinase-1 Homo sapiens
571032 AVHNVPLSV 40 48 Sulfiredoxin-1 Sulfiredoxin-1 Homo sapiens
571036 AVIHEAPAV 266 274 NF-kappa-B inhibitor epsilon NF-kappa-B inhibitor epsilon Homo sapiens
571051 AVLDGADCIML 351 361 Pyruvate kinase PKM Pyruvate kinase PKM Homo sapiens
571057 AVMACRNEV 334 342 ER membrane protein ER membrane protein Homo sapiens complex subunit 1 complex subunit 1
571083 AVSAAVQAV 599 607 Spermatid perinuclear RNA- Spermatid perinuclear RNA- Homo sapiens binding protein binding protein
572303 FAQEALTVL 578 586 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 2A 65 kDa phosphatase 2A 65 kDa
regulatory subunit A alpha regulatory subunit A alpha
isoform isoform
572306 FATKVVHLL 308 316 Sortilin-related receptor Sortilin-related receptor Homo sapiens
572308 FAVPKNYKL 185 193 Cleavage and Cleavage and Homo sapiens polyadenylation specificity polyadenylation specificity
factor subunit 5 factor subunit 5
572362 FIDEAGHCM 643 651 Putative helicase MOV-10 Putative helicase MOV-10 Homo sapiens
572364 FIISRTQAL 209 217 Transportin-1 Transportin-1 Homo sapiens
572365 FIMDNCEEL 369 377 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens alpha alpha
572366 FIMDSCDEL 361 369 Heat shock protein HSP 90- Heat shock protein HSP 90- Homo sapiens beta beta
572367 FIPATGHSL 414 422 Septin-9 (UniProt:Q9UHD8) Septin-9 Homo sapiens
572370 FISGHTSEL 229 237 Mannosyl-oligosaccharide Mannosyl-oligosaccharide Homo sapiens glucosidase glucosidase
572372 FITNIPFDV 74 82 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein M ribonucleoprotein M
(UniProt:P52272)
572376 FLDNACHQL 391 399 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase N3 kinase N3
572377 FLDPYCSASV 540 549 Rhophilin-2 Rhophilin-2 Homo sapiens
572378 FLDSUYGA 6 14 Sugar transporter SWEET1 Sugar transporter SWEET1 Homo sapiens
(UniProt:Q9BRV3)
572380 FLEEANRVL 374 382 Ribosomal RNA-processing Ribosomal RNA-processing Homo sapiens protein 8 protein 8
572382 FLFDCPGQVEL 107 117 GPN-loop GTPase 2 GPN-loop GTPase 2 Homo sapiens
572383 FLFPNKESL 223 231 Zinc finger protein 217 Zinc finger protein 217 Homo sapiens
572384 FLFTTPCRL 61 1 619 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase I subunit RPA2 polymerase I subunit RPA2
(UniProt:Q9H9Y6)
572385 FLGRVLEA 78 85 Potassium channel subfamily Potassium channel subfamily Homo sapiens
K member 1 K member 1
572386 FLGSILTAV 921 929 Sperm-associated antigen 5 Sperm-associated antigen 5 Homo sapiens
572388 FUDNGVSL 566 574 Probable RNA-binding Probable RNA-binding Homo sapiens protein 19 protein 19
572389 FUEEQKIV 95 103 60S ribosomal protein L34 60S ribosomal protein L34 Homo sapiens
572391 FLKKQIPAI 771 779 Ras GTPase-activating-like Ras GTPase-activating-like Homo sapiens protein IQGAP1 protein IQGAP1
572392 FLKQGEDHCL 817 826 PH and SEC7 domain- PH and SEC7 domain- Homo sapiens containing protein 4 containing protein 4
572393 FLLKSCPLL 54 62 Abhydrolase domain- Abhydrolase domain- Homo sapiens containing protein 2 containing protein 2
572394 FLLPTLRKV 114 122 Leucine-rich repeat and WD Leucine-rich repeat and WD Homo sapiens repeat-containing protein 1 repeat-containing protein 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
572734 GLYPAPLKI 296 304 Trifunctional enzyme subunit Trifunctional enzyme subunit Homo sapiens alpha, mitochondrial alpha, mitochondrial
572735 GLYSKTSQSV 585 594 Calcium-transporting ATPase Calcium-transporting ATPase Homo sapiens type 2C member 1 type 2C member 1
572823 GQADPVVAV 945 953 Huntingtin Huntingtin Homo sapiens
572861 GQMGSFIRL 663 671 Nucleoporin GLE1 Nucleoporin GLE1 Homo sapiens
572880 GQSPHKFTV 183 191 N-acylethanolamine- N-acylethanolamine- Homo sapiens hydrolyzing acid amidase hydrolyzing acid amidase
572882 GQTSVVSFL 538 546 Nuclear factor NF-kappa-B Nuclear factor NF-kappa-B Homo sapiens p100 subunit p100 subunit
572884 GQWLWAQRL 278 286 Interferon regulatory factor 3 Interferon regulatory factor 3 Homo sapiens
(UniProt:Q14653)
573024 GTIGLIHAV 91 99 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase isozyme L1 hydrolase isozyme L1
573074 GVAFFPLHI 79 87 Dynactin subunit 5 Dynactin subunit 5 Homo sapiens
573095 GVSDVELRV 271 279 Sorting nexin-27 Sorting nexin-27 Homo sapiens
573108 HAAGVLLHV 145 153 Probable Probable Homo sapiens palmitoyltransferase palmitoyltransferase
ZDHHC24 ZDHHC24
573209 HIDNNILU 513 521 Transmembrane protein 131 Transmembrane protein 131 Homo sapiens
573214 HILECEFYL 134 142 Cyclin-C Cyclin-C Homo sapiens
573217 HLAEALEQL 299 307 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
BRE1 B (UniProt:O75150) BRE1 B
573218 HLHNMPPSAL 354 363 Myocyte-specific enhancer Myocyte-specific enhancer Homo sapiens factor 2C factor 2C
573223 HLLKSETSV 113 121 UBX domain-containing UBX domain-containing Homo sapiens protein 4 protein 4
573224 HLLPCEVAV 30 38 Ribonuclease H2 subunit C Ribonuclease H2 subunit C Homo sapiens
573225 HLLPTEQRI 282 290 Kelch-like protein 2 Kelch-like protein 2 Homo sapiens
573226 HLLSGQLPTI 138 147 TOX high mobility group box TOX high mobility group box Homo sapiens family member 2 family member 2
573228 HLPPGFLHL 343 351 Leucine-rich repeat Leucine-rich repeat Homo sapiens serine/threonine-protein serine/threonine-protein
kinase 1 kinase 1
573230 HLSELVQQI 707 715 DNA polymerase alpha DNA polymerase alpha Homo sapiens catalytic subunit catalytic subunit
573310 HQLNICSKV 788 796 Catenin alpha-1 Catenin alpha-1 Homo sapiens
573378 HVSEVPVSV 561 569 Pre-rRNA-processing protein Pre-rRNA-processing protein Homo sapiens
TSR1 homolog TSR1 homolog
573493 IIADCQVYL 134 142 Tetratricopeptide repeat Tetratricopeptide repeat Homo sapiens protein 39C protein 39C
573495 IIFHLGHAA 577 585 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- diphosphooligosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit 2 (UniProt:P04844) subunit 2
573509 IIQHSIPAV 588 596 Transcription initiation factor Transcription initiation factor Homo sapiens
TFIID subunit 1 TFIID subunit 1
573515 ILDDVCATM 462 470 Unconventional myosin-le Unconventional myosin-le Homo sapiens
573516 ILDKNLESV 406 414 Activating transcription factor Activating transcription factor Homo sapiens
7-interacting protein 2 7-interacting protein 2
573517 ILDPCIYRV 74 82 Protein FAM102B Protein FAM102B Homo sapiens
573518 ILFDCPGQIEL 103 113 GPN-loop GTPase 3 GPN-loop GTPase 3 Homo sapiens
573522 ILHDAVVFL 3722 3730 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase 2A methyltransferase 2A
(UniProt:Q03164)
573528 lUECGADVNV 513 523 Protein fem-1 homolog C Protein fem-1 homolog C Homo sapiens
573537 ILLEKEAEL 321 329 Septin-2 Septin-2 Homo sapiens
573539 ILNKALLL 2 9 Other Major HLA class II Homo sapiens histocompatibility complex histocompatibility antigen,
DQ alpha 1 chain
573543 ILQEYVEHQV 484 493 Asparagine synthetase Asparagine synthetase Homo sapiens
[glutamine-hydrolyzing] [glutamine-hydrolyzing]
573554 ILSDDCATL 981 989 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
hydrolase 48 hydrolase 48
573559 ILTAVLPCL 300 308 Protein VAC 14 homolog Protein VAC14 homolog Homo sapiens
573561 ILTSDVPQI 84 92 Serine/threonine-protein Serine/threonine-protein Homo sapiens phosphatase 6 regulatory phosphatase 6 regulatory
subunit 1 subunit 1
573562 ILWEHCIRL 846 854 Syndetin Syndetin Homo sapiens
573563 ILYDSNCQL 644 652 Engulfment and cell motility Engulfment and cell motility Homo sapiens protein 1 protein 1
573673 IQDFEMPTV 46 54 Nucleolar protein 10 Nucleolar protein 10 Homo sapiens
573674 IQDKCVPLV 237 245 Endoplasmic reticulum Endoplasmic reticulum Homo sapiens resident protein 44 resident protein 44
573694 IQLPACLRV 220 228 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 8 complex subunit 8
573720 IQVNCPPAV 60 68 Synaptophysin-like protein 1 Synaptophysin-like protein 1 Homo sapiens
(UniProt:Q16563)
573721 IQWSIVPEV 274 282 GRAM domain-containing GRAM domain-containing Homo sapiens protein 4 protein 4
573812 ITSKILFV 366 373 Ufm1 -specific protease 2 Ufm1 -specific protease 2 Homo sapiens
573826 IVMEQSCEL 215 223 Glycine N-acyltransferase- Glycine N-acyltransferase- Homo sapiens like protein 2 like protein 2
573829 IVPEGVHAL 54 62 Zinc transporter ZIP9 Zinc transporter ZIP9 Homo sapiens
573834 IVSPVVAAV 425 433 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF19A RNF19A
574103 KIPEDVSGL 416 424 Leucine-rich repeat protein Leucine-rich repeat protein Homo sapiens
SHOC-2 SHOC-2
57411 1 KITSCIFQL 59 67 Multifunctional protein ADE2 Multifunctional protein ADE2 Homo sapiens
574113 KIYEGAYHV 262 270 Monoglyceride lipase Monoglyceride lipase Homo sapiens
(UniProt:Q99685)
574116 KLADICKNL 809 817 Exosome complex Exosome complex Homo sapiens exonuclease RRP44 exonuclease RRP44
574121 KLDDCITYI 228 236 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 3 complex subunit 3
574123 KLDVQPKCV 405 413 WD repeat-containing protein WD repeat-containing protein Homo sapiens
1 1
574132 KLFVIAQKI 21 1 219 Probable U3 small nucleolar Probable U3 small nucleolar Homo sapiens
RNA-associated protein 11 RNA-associated protein 1 1
574138 KUDIQEKI 755 763 Pericentriolar material 1 Pericentriolar material 1 Homo sapiens protein protein
574139 KUEESCPQL 80 89 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 5 complex subunit 5
574142 KUPNAIQI 161 169 GRAM domain-containing GRAM domain-containing Homo sapiens protein 1A (UniProt:Q96CP6) protein 1A
574146 KLKEIFDKI 440 448 Nucleoporin GLE1 Nucleoporin GLE1 Homo sapiens
574161 KLLDAGDLDI 71 80 Hypoxia-inducible factor 1- Hypoxia-inducible factor 1 - Homo sapiens alpha alpha
574164 KLLEEICNL 683 691 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
574165 KLLEGEECRI 404 413 Neurofilament heavy Neurofilament heavy Homo sapiens polypeptide polypeptide
574167 KLLEWQPCL 1559 1568 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
HUWE1 HUWE1
574168 KLLKPSLAV 33 41 Transcription factorjun-B Transcription factor jun-B Homo sapiens
574169 KLLNIQQQL 483 491 Cytospin-B Cytospin-B Homo sapiens
574178 KLPEYNPRTL 513 522 Protein RCC2 Protein RCC2 Homo sapiens
574183 KLQNKEHVI 141 149 60S ribosomal protein L10 60S ribosomal protein L10 Homo sapiens
(UniProt:P27635)
574186 KLRDLEDSL 319 327 Prelamin-A/C Prelamin-A/C Homo sapiens
574187 KLRECESVL 31 1 319 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit E initiation factor 3 subunit E
574190 KLRQLQDLV 668 676 Pericentriolar material 1 Pericentriolar material 1 Homo sapiens protein protein
574201 KLTELEQRI 814 822 Ankyrin repeat domain- Ankyrin repeat domain- Homo sapiens containing protein 17 containing protein 17 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
complex subunit 8 complex subunit 8
576010 QLFDQIPEL 277 285 Lysine-specific demethylase Lysine-specific demethylase Homo sapiens
8 (UniProt:Q8N371) 8
576012 QLHGLQLRI 294 302 tRNA (cytosine(34)-C(5))- tRNA (cytosine(34)-C(5))- Homo sapiens methyltransferase methyltransferase
576026 QLLDCDTPSV 163 172 Phosphatidylinositol 3-kinase Phosphatidylinositol 3-kinase Homo sapiens regulatory subunit alpha regulatory subunit alpha
576027 QLLEDSHQV 534 542 Zinc finger SWIM domain- Zinc finger SWIM domain- Homo sapiens containing protein 3 containing protein 3
576034 QLPEGASAV 167 175 Charged multivesicular body Charged multivesicular body Homo sapiens protein 1a protein 1 a
576035 QLPELFHKI 228 236 Voltage-gated potassium Voltage-gated potassium Homo sapiens channel subunit beta-2 channel subunit beta-2
(UniProt:Q13303)
576036 QLPSGWASI 463 471 Signal transducer and Signal transducer and Homo sapiens activator of transcription 1 - activator of transcription 1 - alpha/beta alpha/beta
576042 QLQPTDALLCV 126 136 Ribonucleoprotein PTB- Ribonucleoprotein PTB- Homo sapiens binding 1 (UniProt:Q8IY67) binding 1
576047 QLSDVAEKL 2584 2592 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF213 RNF213
576214 QQSCGTYLRV 116 125 B-cell antigen receptor B-cell antigen receptor Homo sapiens complex-associated protein complex-associated protein
alpha chain alpha chain
576346 RAFGIPIRV 151 159 Cyclin-dependent kinase 1 Cyclin-dependent kinase 1 Homo sapiens
(UniProt:P06493)
576354 RALDHYLTL 188 196 Sodium channel modifier 1 Sodium channel modifier 1 Homo sapiens
576541 RIDGKTYVI 287 295 Interferon-induced, double- Interferon-induced, double- Homo sapiens stranded RNA-activated stranded RNA-activated
protein kinase protein kinase
576543 RIFEKMFAM 546 554 Nck-associated protein 1-like Nck-associated protein Mike Homo sapiens
576545 RIFKAWAV 58 65 Interferon regulatory factor 7 Interferon regulatory factor 7 Homo sapiens
576549 RIIDCAFTV 259 267 Methionine aminopeptidase 2 Methionine aminopeptidase 2 Homo sapiens
576551 RIIEAAHQV 787 795 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIP12 TRIP12
576560 RILGGVISAI 60 69 Calpain small subunit 1 Calpain small subunit 1 Homo sapiens
576574 RISSKSLKV 952 960 SURP and G-patch domain- SURP and G-patch domain- Homo sapiens containing protein 2 containing protein 2
576582 RIYESHVGI 198 206 1 ,4-alpha-glucan-branching 1 ,4-alpha-glucan-branching Homo sapiens enzyme enzyme
576583 RLAAIVAKQV 18 27 60S ribosomal protein L13a 60S ribosomal protein L13a Homo sapiens
576584 RLAAIVAKQVL 18 28 60S ribosomal protein L13a 60S ribosomal protein L13a Homo sapiens
576588 RLAECVKQV 186 194 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 45 associated protein 45
576591 RLAHLGVQV 80 88 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- diphosphooligosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit 1 (UniProt:P04843) subunit 1
576594 RLALFNPDV 35 43 Cytochrome c oxidase Cytochrome c oxidase Homo sapiens subunit NDUFA4 subunit NDUFA4
576596 RLAPUQVI 179 187 Huntingtin-interacting protein Huntingtin-interacting protein Homo sapiens
1 1
576601 RLAQICSSI 268 276 Borealin Borealin Homo sapiens
576617 RLFPVPGSGLV 5 15 Lysosome-associated Lysosome-associated Homo sapiens membrane glycoprotein 2 membrane glycoprotein 2
576622 RLGDKILQV 309 317 ELAV-like protein 1 ELAV-like protein 1 Homo sapiens
(UniProt:Q15717)
576623 RLGDVVRV 363 370 GH3 domain-containing GH3 domain-containing Homo sapiens protein protein
576624 RLGFTPSV 1991 1998 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
576625 RLGHAPCV 182 189 ATP-dependent DNA ATP-dependent DNA Homo sapiens helicase Q5 helicase Q5 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
576627 RLGPVPPGL 78 86 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIM4 TRIM4
576631 RUNLVGESL 321 330 Large proline-rich protein Large proline-rich protein Homo sapiens
BAG6 (UniProt:P46379) BAG6
576636 RLKEAFDYI 285 293 Dual specificity protein Dual specificity protein Homo sapiens phosphatase 5 phosphatase 5
576651 RLLEQGIRV 225 233 DNA polymerase delta DNA polymerase delta Homo sapiens catalytic subunit catalytic subunit
576654 RLLNVEVPQKV 361 371 Inner centromere protein Inner centromere protein Homo sapiens
576656 RLLQQVSQI 438 446 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 3 subunit A initiation factor 3 subunit A
576658 RLMANPEALKI 20 30 Guanylate-binding protein 1 Guanylate-binding protein 1 Homo sapiens
576661 RLNDSPTL 620 627 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase SETD2 methyltransferase SETD2
576663 RLNIPVSQV 647 655 Sodium/potassium- Sodium/potassium- Homo sapiens transporting ATPase subunit transporting ATPase subunit alpha-1 alpha-1
576664 RLNKKVVLL 1400 1408 U5 small nuclear U5 small nuclear Homo sapiens ribonucleoprotein 200 kDa ribonucleoprotein 200 kDa
helicase helicase
576666 RLNPEMLQI 3690 3698 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
576667 RLNPKALTL 277 285 NmrA-like family domain- NmrA-like family domain- Homo sapiens containing protein 1 containing protein 1
576671 RLPEHCIEYV 244 253 NEDD8-activating enzyme NEDD8-activating enzyme Homo sapiens
E1 catalytic subunit E1 catalytic subunit
576673 RLPPEVNRI 12 20 Splicing factor 3B subunit 6 Splicing factor 3B subunit 6 Homo sapiens
576676 RLPRSVTTV 1160 1168 Pre-mRNA-processing- Pre-m RNA-processi ng- Homo sapiens spl icing factor 8 splicing factor 8
576680 RLQEASQTI 158 166 SET and MYND domain- SET and MYND domain- Homo sapiens containing protein 4 containing protein 4
576683 RLQKLHTSI 630 638 3-hydroxy-3-methylglutaryl- 3-hydroxy-3-methylglutaryl- Homo sapiens coenzyme A reductase coenzyme A reductase
576688 RLQTALLVV 3 11 C-C motif chemokine 22 C-C motif chemokine 22 Homo sapiens
576697 RLRSFTTTI 182 190 Mitotic spindle assembly Mitotic spindle assembly Homo sapiens checkpoint protein MAD2A checkpoint protein MAD2A
576704 RLTDLCTKI 213 221 LETM1 domain-containing LETM1 domain-containing Homo sapiens protein 1 (UniProt:Q6P1 Q0) protein 1
576706 RLTDTDAAI 699 707 Mitotic checkpoint Mitotic checkpoint Homo sapiens serine/threonine-protein serine/threonine-protein
kinase BUB1 kinase BUB1
(UniProt:043683)
576707 RLTEICTKI 579 587 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 16 II transcription subunit 16
(UniProt:Q9Y2X0)
576709 RLVEGLREA 263 271 TFIIH basal transcription TFIIH basal transcription Homo sapiens factor complex helicase XPD factor complex helicase XPD subunit (UniProt:P18074) subunit
576713 RLVQHDLQV 50 58 Coiled-coil domain- Coiled-coil domain- Homo sapiens containing protein 50 containing protein 50
576718 RLYGLGTGV 258 266 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 8 complex subunit 8
576720 RLYKDDQLL 43 51 Transcription elongation Transcription elongation Homo sapiens factor B polypeptide 2 factor B polypeptide 2
576725 RLYTGMHTV 207 215 Sphingosine-1 -phosphate Sphingosine-1 -phosphate Homo sapiens phosphatase 2 phosphatase 2
576729 RMIGQICEV 59 67 Tuberin (UniProt:P49815) Tuberin Homo sapiens
576981 RQADFVQVL 466 474 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 6 complex subunit 6
576983 RQAEITRLLL 204 213 Endophilin-B1 Endophilin-B1 Homo sapiens
576992 RQDRLTVGV 32 40 Growth arrest and DNA Growth arrest and DNA Homo sapiens damage-inducible protein damage-inducible protein
GADD45 beta GADD45 beta Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
cell differentiation protein cell differentiation protein
Mcl-1 Mcl-1
577791 SLTDKVQEA 3692 3700 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase 2A methyltransferase 2A
(UniProt:Q03164)
577792 SLTNTDLKV 362 370 Mediator of RNA polymerase Mediator of RNA polymerase Homo sapiens
II transcription subunit 16 II transcription subunit 16
(UniProt:Q9Y2X0)
577798 SLYVQQLKI 934 942 Nesprin-2 Nesprin-2 Homo sapiens
(UniProt:Q8WXH0)
577800 SMIDCSMVQV 74 83 Mitochondrial import inner Mitochondrial import inner Homo sapiens membrane translocase membrane translocase
subunit Tim17-A subunit Tim17-A
577802 SMPEQAHKV 281 289 Lon protease homolog 2, Lon protease homolog 2, Homo sapiens peroxisomal peroxisomal
578082 SQADCAVLI 107 115 Elongation factor 1 -alpha 1 Elongation factor 1 -alpha 1 Homo sapiens
(UniProt:P68104)
578089 SQFGHWDI 32 40 U2 small nuclear U2 small nuclear Homo sapiens ribonucleoprotein B" ribonucleoprotein B"
578091 SQFLYPKV 121 128 Transcription factorjun-D Transcription factor jun-D Homo sapiens
578092 SQFPGTQRL 347 355 Selenocysteine lyase Selenocysteine lyase Homo sapiens
578102 SQHDILQMI 634 642 Antigen KI-67 Antigen KI-67 Homo sapiens
578110 SQIKYAAKV 118 126 Antizyme inhibitor 1 Antizyme inhibitor 1 Homo sapiens
578112 SQIYPVVCV 69 77 UBX domain-containing UBX domain-containing Homo sapiens protein 4 protein 4
578122 SQLDVPFKV 49 57 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13A associated protein 13A
578124 SQLKLWNV 620 627 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RFWD2 RFWD2
578136 SQPSKTLFV 568 576 Nucleolin (UniProt:P19338) Nucleolin Homo sapiens
578151 SQSNMTQKV 1107 1115 CCR4-NOT transcription CCR4-NOT transcription Homo sapiens complex subunit 1 complex subunit 1
(UniProt:A5YKK6)
578153 SQTDGTLKI 2792 2800 A-kinase anchor protein 9 A-kinase anchor protein 9 Homo sapiens
578157 SQVTFPIRV 751 759 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 8 protein 8
578161 SQWSLQHEI 151 159 Nucleoporin SEH1 Nucleoporin SEH1 Homo sapiens
578268 SSTSHVPEV 1478 1486 Fatty acid synthase Fatty acid synthase Homo sapiens
578350 SVALVIHNV 11 1 119 Butyrophilin subfamily 2 Butyrophilin subfamily 2 Homo sapiens member A2 member A2
(UniProt:Q8WW5)
578357 SVFPGARLLTI 30 40 Histone-arginine Histone-arginine Homo sapiens methyltransferase CARM1 methyltransferase CARM1
578370 SVISHLLRV 232 240 Sorting nexin-4 Sorting nexin-4 Homo sapiens
578440 SVTDLAFKV 644 652 Histone deacetylase 7 Histone deacetylase 7 Homo sapiens
578445 SVWFGPKEV 226 234 Feline leukemia virus Feline leukemia virus Homo sapiens subgroup C receptor-related subgroup C receptor-related
protein 1 protein 1
578698 TIAGVPQSV 147 155 Poly(rC)-binding protein 1 Poly(rC)-binding protein 1 Homo sapiens
578699 TIANVPIU 123 131 GTP-binding protein SAR1 b GTP-binding protein SAR1 b Homo sapiens
578703 TIFGKAHSL 1251 1259 MAP kinase-activating death MAP kinase-activating death Homo sapiens domain protein domain protein
578709 TILDKAMVL 410 418 Cullin-3 Cullin-3 Homo sapiens
578719 TISAYYARV 601 609 Regulator of telomere Regulator of telomere Homo sapiens elongation helicase 1 elongation helicase 1
(UniProt:Q9NZ71)
578722 TLAPATSIL 293 301 Protein quaking Protein quaking Homo sapiens
578724 TLENGVPCV 1424 1432 Transmembrane protein 131 - Transmembrane protein 131 - Homo sapiens like (UniProt:A2VDJ0) like
578726 TLFPKDVQL 120 128 Histone H3-like centromeric Histone H3-like centromeric Homo sapiens protein A protein A
578729 TLHAAVLQI 397 405 Solute carrier family 25 Solute carrier family 25 Homo sapiens member 46 member 46 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
(UniProt:Q96AG3)
578731 TUCDVHSI 172 180 Transcription factor SPT20 Transcription factor SPT20 Homo sapiens homolog (UniProt:Q8NEM7) homolog
578744 TLLDRNTEL 37 45 Cerebellar degeneration- Cerebellar degeneration- Homo sapiens related protein 2 related protein 2
578745 TLLEALDCI 227 235 Elongation factor 1 -alpha 1 Elongation factor 1 -alpha 1 Homo sapiens
(UniProt:P68104)
578747 TLLSCKVQL 603 611 Protein phosphatase 1 Protein phosphatase 1 Homo sapiens regulatory subunit 15B regulatory subunit 15B
578748 TLLSNSISV 129 137 Thymocyte selection- Thymocyte selection- Homo sapiens associated high mobility associated high mobility
group box protein TOX group box protein TOX
578749 TLMSLPTKI 100 108 Neutrophil cytosol factor 1 Neutrophil cytosol factor 1 Homo sapiens
578750 TLPKISPSSL 237 246 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 15 hydrolase 15
578752 TLPYIKQEV 259 267 DNA-directed RNA DNA-directed RNA Homo sapiens polymerase II subunit RPB2 polymerase II subunit RPB2
578753 TLQNTVDIL 3620 3628 Sacsin Sacsin Homo sapiens
578760 TLSSIRHMI 89 97 60S ribosomal protein L28 60S ribosomal protein L28 Homo sapiens
(UniProt:P46779)
578762 TLTDCVVW 32 40 Heterogeneous nuclear Heterogeneous nuclear Homo sapiens ribonucleoprotein AO ribonucleoprotein AO
578763 TLWVDPCEV 93 101 Protein BTG3 Protein BTG3 Homo sapiens
578890 TQAGIVAHI 151 159 Protein Daple Protein Daple Homo sapiens
578908 TQLDVPHVI 25 33 Amidophosphoribosyltransfer Amidophosphoribosyltransfer Homo sapiens ase ase
578913 TQPPSHFSV 969 977 Huntingtin Huntingtin Homo sapiens
578914 TQPTHSWKV 67 75 Survival of motor neuron- Survival of motor neuron- Homo sapiens related-splicing factor 30 related-splicing factor 30
579015 TTNGGILTV 224 232 UAP56-interacting factor UAP56-interacting factor Homo sapiens
579054 TVLATVQAL 157 165 Dolichyl- Dolichyl- Homo sapiens diphosphooligosaccharide- diphosphooligosaccharide- protein glycosyltransferase protein glycosyltransferase
subunit 2 (UniProt:P04844) subunit 2
579058 TVNEIVLKV 474 482 Target of rapamycin complex Target of rapamycin complex Homo sapiens
2 subunit MAPKAP1 2 subunit MAPKAP1
579248 VIACDGIWNV 437 446 Protein phosphatase 1 G Protein phosphatase 1 G Homo sapiens
579252 VIHATVTSV 261 269 Prenylcysteine oxidase-like Prenylcysteine oxidase-like Homo sapiens
579255 VILDPVHSV 352 360 Transmembrane protein Transmembrane protein Homo sapiens
183A 183A
579257 VILRDSHGV 52 60 40S ribosomal protein S13 40S ribosomal protein S13 Homo sapiens
579265 VLADACWAL 270 278 Importin subunit alpha-5 Importin subunit alpha-5 Homo sapiens
579266 VLADFEAGL 14 22 5'(3')-deoxyribonucleotidase, 5'(3')-deoxyribonucleotidase, Homo sapiens cytosolic type cytosolic type
579267 VLADQGVCCI 435 444 DNA replication licensing DNA replication licensing Homo sapiens factor MCM7 factor MCM7
579268 VLADRGVCU 577 586 DNA replication licensing DNA replication licensing Homo sapiens factor MCM2 factor MCM2
(UniProt:P49736)
579269 VLAEIPQQV 507 515 Copine-3 Copine-3 Homo sapiens
579271 VLAPHLTRA 17 25 60 kDa heat shock protein, 60 kDa heat shock protein, Homo sapiens mitochondrial mitochondrial
(UniProt:P10809)
579274 VLESTMVCV 2 10 26S proteasome non- 26S proteasome non- Homo sapiens
ATPase regulatory subunit 4 ATPase regulatory subunit 4
579279 VLIKDTTAL 779 787 Leucine-rich PPR motif- Leucine-rich PPR motif- Homo sapiens containing protein, containing protein,
mitochondrial mitochondrial
579283 VLLDVCPLTL 415 424 78 kDa glucose-regulated 78 kDa glucose-regulated Homo sapiens protein protein
579285 VLLHEVPHEV 355 364 Zinc transporter SLC39A7 Zinc transporter SLC39A7 Homo sapiens
579288 VLLPKKTESHKA 115 126 Histone H2A type 2-C Histone H2A type 2-C Homo sapiens
579289 VLLTHCHSL 199 207 Sestrin-2 Sestrin-2 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
579290 VLMGHVAAV 496 504 F-box/WD repeat-containing F-box/WD repeat-containing Homo sapiens protein 7 protein 7
579292 VLPDSGHLHPL 217 227 Phenylalanine-tRNA ligase Phenylalanine-tRNA ligase Homo sapiens alpha subunit alpha subunit
579293 VLPERYSSL 35 43 Geranylgeranyl transferase Geranylgeranyl transferase Homo sapiens type-1 subunit beta type-1 subunit beta
579297 VLPPPPTTL 170 178 Protein transport protein Protein transport protein Homo sapiens
Sec24D Sec24D
579298 VLPRDTASL 255 263 Gephyrin Gephyrin Homo sapiens
579299 VLPVPPLSV 62 70 Other Homo sapiens DNA-directed RNA Homo sapiens
(human) protein polymerase II subunit RPB1
579300 VLPVYMNCL 841 849 Protein transport protein Protein transport protein Homo sapiens
Sec24D Sec24D
579302 VLQPYEHU 280 288 Ankyrin repeat and BTB/POZ Ankyrin repeat and BTB/POZ Homo sapiens domain-containing protein 2 domain-containing protein 2
579304 VLSECSPLM 619 627 Coatomer subunit beta Coatomer subunit beta Homo sapiens
(UniProt:P53618)
579308 VLSSLPLNSL 164 173 Renin receptor Renin receptor Homo sapiens
579310 VLTDLPCVGV 144 153 Endonuclease V Endonuclease V Homo sapiens
579313 VLYPGCDTL 80 88 Long-chain-fatty-acid-CoA Long-chain-fatty-acid-CoA Homo sapiens ligase 3 ligase 3
579474 VQAPVIQQV 197 205 Transcription initiation factor Transcription initiation factor Homo sapiens
HA subunit 1 IIA subunit 1
579489 VQIKDVNLEV 126 135 N-myc-interactor N-myc-interactor Homo sapiens
579516 VQPLELPMV 113 121 Interferon-induced 35 kDa Interferon-induced 35 kDa Homo sapiens protein protein
579671 VVDGHKLEV 798 806 Probable RNA-binding Probable RNA-binding Homo sapiens protein 19 protein 19
579698 VVSGVVSKV 89 97 Cytoskeleton-associated Cytoskeleton-associated Homo sapiens protein 5 protein 5
579746 WLLEQTSHV 186 194 N-acetyltransferase 9 N-acetyltransferase 9 Homo sapiens
579747 WLLQKNPQL 2255 2263 DNA polymerase epsilon DNA polymerase epsilon Homo sapiens catalytic subunit A catalytic subunit A
579748 WLSTSIPEA 712 720 Fatty acid synthase Fatty acid synthase Homo sapiens
579770 YAIGNAPEL 129 137 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase BAP1 hydrolase BAP1
579850 YIASLPFQV 169 177 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 1 complex subunit 1
579851 YIFTTPKSV 974 982 Fibronectin type-Ill domain- Fibronectin type-Ill domain- Homo sapiens containing protein 3A containing protein 3A
579857 YIVPCLHEV 18 26 Egl nine homolog 3 Egl nine homolog 3 Homo sapiens
(UniProt:Q9H6Z9)
579860 YLDRYLSCV 84 92 G1/S-specific cyclin-D3 G1/S-specific cyclin-D3 Homo sapiens
(UniProt:P30281)
579861 YLFKCPQSV 709 717 Glutamine-rich protein 1 Glutamine-rich protein 1 Homo sapiens
579862 YLFPGHPPT 444 452 Caspase-2 Caspase-2 Homo sapiens
579864 YLHDQNPDA 127 135 Coatomer subunit epsilon Coatomer subunit epsilon Homo sapiens
579870 YLLDGSCMV 2227 2235 Spectrin alpha chain, non- Spectrin alpha chain, non- Homo sapiens erythrocytic 1 erythrocytic 1
579871 YLLDIGCGTGL 56 66 Probable 18S rRNA Probable 18S rRNA Homo sapiens
(guanine-N(7))- (guanine-N(7))- methyltransferase methyltransferase
(UniProt:O43709)
579872 YLLHGLECV 313 321 Eukaryotic translation Eukaryotic translation Homo sapiens initiation factor 5 initiation factor 5
579873 YLLQYATLL 1831 1839 Transformation/transcription Transformation/transcription Homo sapiens domain-associated protein domain-associated protein
579875 YLLVRRVLHL 376 385 Antigen peptide transporter 2 Antigen peptide transporter 2 Homo sapiens
579876 YLPDKLPKV 349 357 Zinc finger protein PLAGL2 Zinc finger protein PLAGL2 Homo sapiens
579878 YLPPGVIAL 338 346 Transmembrane channel-like Transmembrane channel-like Homo sapiens protein 8 protein 8
579879 YLQCKLEQL 830 838 Sorting nexin-14 Sorting nexin-14 Homo sapiens
579880 YLQSEPCYV 42 50 Krueppel-like factor 6 Krueppel-like factor 6 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
kinase 17A kinase 17A
606684 EVIALLHSL 674 682 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HECTD4 ligase HECTD4
(UniProt:Q9Y4D8)
606689 EVIRELAGI 212 220 THUMP domain-containing Homo sapiens protein 1
606706 FLAPVKTEV 132 140 Synaptopodin-2 Synaptopodin-2 Homo sapiens
606710 FLYNLLTRV 450 458 Sec24A protein, partial Protein transport protein Homo sapiens
Sec24A
606751 HLYASLSRV 58 65 mitochondrial ribosomal 28S ribosomal protein S5, Homo sapiens protein S5, isoform CRA_b mitochondrial
606765 IILVAVPHV 650 658 Exocyst complex component Exocyst complex component Homo sapiens
8 8
606794 KLMNIQQKL 278 286 A-kinase anchor protein 13 A-kinase anchor protein 13 Homo sapiens isoform 1
606796 KMAGIGIREA 416 425 Keratin, type I cytoskeletal 15 Keratin, type I cytoskeletal 15 Homo sapiens
606797 KMIGNHLWV 153 161 cyclin-dependent kinase Cyclin-dependent kinase Homo sapiens inhibitor 2A isoform inhibitor 2A
p16gamma
606799 KTLLVSEEL 402 410 Other Homo sapiens SH3 domain-binding protein Homo sapiens
(human) protein 4
606805 LDINALQEL 174 182 Tetratricopeptide repeat Tetratricopeptide repeat Homo sapiens protein 39C protein 39C
606830 LVDKLQLKV 1866 1874 Myosin-7 Myosin-7 Homo sapiens
606843 MLGEQLFPL 556 564 PABP3, partial Polyadenylate-binding Homo sapiens protein 3
606880 QIDPTIQRV 151 159 Horn s 5 Horn s 5 Homo sapiens
606883 QLSCISTYV 186 194 olfactory receptor 8B3 Olfactory receptor 8B3 Homo sapiens
606899 RLLPLPLGV 4966 4974 Hemicentin-2 Hemicentin-2 Homo sapiens
606900 RLQTALLV 740 747 Spectrin beta chain, non- Spectrin beta chain, non- Homo sapiens erythrocytic 5 erythrocytic 5
606908 RVIDYAVKI 12 20 Electron transfer flavoprotein Electron transfer flavoprotein Homo sapiens subunit beta subunit beta
606910 RVVELQQTL 235 243 TNF receptor-associated TNF receptor-associated Homo sapiens factor 1 factor 1
606961 TTRPALKEL 308 316 UNE-1 retrotransposable UNE-1 retrotransposable Homo sapiens element ORF1 protein element ORF1 protein
606963 TVYPMERLV 46 54 UM domain-containing UM domain-containing Homo sapiens protein 2 protein 2
60701 1 YLPKIQLVI 82 90 Other Homo sapiens Homo sapiens
(human) protein
607061 FLQLLLVTL 105 113 3'-nucleotidase/nuclease, 3'-nucleotidase/nuclease, Leishmania putative putative donovani
607062 FMGDIHQPL 246 254 3'-nucleotidase/nuclease, 3'-nucleotidase/nuclease, Leishmania putative putative donovani
607083 LEATYASTL 322 330 3'-nucleotidase/nuclease, 3'-nucleotidase/nuclease, Leishmania putative putative donovani
607093 LLSTAALPV 115 123 3'-nucleotidase/nuclease, 3'-nucleotidase/nuclease, Leishmania putative putative donovani
607122 REANLSHYV 64 72 3'-nucleotidase/nuclease, 3'-nucleotidase/nuclease, Leishmania putative putative donovani
619630 KLAGIGILTV 26 35 Melanoma antigen Melanoma antigen Homo sapiens recognized by T-cells 1 recognized by T-cells 1
623576 RIADLSYTV 566 574 Centrosomal protein of 120 Centrosomal protein of 120 Homo sapiens kDa kDa
623614 RILDYVINL 78 86 F-box only protein 36 Homo sapiens
625509 SLASVFVRL 741 749 Histone deacetylase 4 Histone deacetylase 4 Homo sapiens
626866 TLLGKEIKI 58 66 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ULK1 kinase ULK1
628943 AIFSAIIFL 107 115 Rhomboid domain-containing Rhomboid domain-containing Homo sapiens protein 2 protein 2
628976 AIWDGLILL 227 235 Potassium voltage-gated Potassium voltage-gated Homo sapiens channel subfamily H member channel subfamily H member Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
containing protein 1 containing protein 1
629372 ALVHITUL 155 163 Olfactory receptor 2A12 Homo sapiens
629374 ALVQITLPTV 499 508 Protein Niban Protein Niban Homo sapiens
629381 ALWVSQPPEI 18 27 Other Homo sapiens Homo sapiens
(human) protein
629383 ALYAVIEKA 393 401 Phosphatidylinositol 4,5- Phosphatidylinositol 4,5- Homo sapiens bisphosphate 3-kinase bisphosphate 3-kinase
catalytic subunit delta catalytic subunit delta
isoform (UniProt:O00329) isoform
629386 ALYEYQPLQI 244 253 CDK-activating kinase CDK-activating kinase Homo sapiens assembly factor MAT1 assembly factor MAT1
629393 ALYTGFSILV 32 41 Other Homo sapiens HLA class II Homo sapiens
(human) protein histocompatibility antigen
gamma chain
629453 APGNLSLPIP 329 338 Syncytin-2 Homo sapiens
629482 AQILELPYA 251 259 Plasminogen activator Plasminogen activator Homo sapiens inhibitor 2 inhibitor 2
629636 AVLGFSFRL 402 410 Threonine-tRNA ligase, Threonine-tRNA ligase, Homo sapiens mitochondrial mitochondrial
(UniProt:U3KQG0)
629643 AVLQQHHVKL 24 33 Leucine-rich repeat- Leucine-rich repeat- Homo sapiens containing protein 16B containing protein 16B
629646 AVMAPRTLVLL 2 12 HLA class I histocompatibility Homo sapiens antigen, A-2 alpha chain
629673 AVVEPYNSILTT 145 156 Tubulin alpha-1 C chain Tubulin alpha-1 C chain Homo sapiens
(UniProt:Q9BQE3)
629760 CUKEVDIYTV + 273 283 Protein arginine N- Protein arginine N- Homo sapiens
CYSTL(C1) methyltransferase 8 methyltransferase 8
629762 CLYEIYPEL + 220 228 Amyloid beta A4 precursor Amyloid beta A4 precursor Homo sapiens
CYSTL(C1) protein-binding family B protein-binding family B
member 1 -interacting protein member 1-interacting protein
629763 CLYELPENIRV + 75 85 Uncharacterized protein Uncharacterized protein Homo sapiens
CYSTL(C1) C9orf78 C9orf78
629764 CLYPHIDKQYL + 690 700 Gamma-tubulin complex Gamma-tubulin complex Homo sapiens
CYSTL(C1) component s component 5
630158 EAVPYLEFI 426 434 Glutamyl-tRNA(Gln) Glutamyl-tRNA(Gln) Homo sapiens amidotransferase subunit A, amidotransferase subunit A, mitochondrial mitochondrial
630308 EIQYLKDLI 330 338 Cyclic AMP-dependent Cyclic AMP-dependent Homo sapiens transcription factor ATF-4 transcription factor ATF-4
630749 FAMEIDPSL 85 93 ATPase ASNA1 ATPase ASNA1 Homo sapiens
630836 FIFDGLHKA 84 92 Endogenous Bornavirus-like Homo sapiens nucleoprotein 1
630870 FIYQGKIPIA 167 176 Rho guanine nucleotide Homo sapiens exchange factor 6
630876 FLASILEEL 346 354 Protein Niban Protein Niban Homo sapiens
630908 FLDIVELLL 237 245 Acyl-CoA-binding domain- Acyl-CoA-binding domain- Homo sapiens containing protein 6 containing protein 6
630954 FLEGQIHPEL 387 396 Nodal modulator 3 Nodal modulator 3 Homo sapiens
630970 FLFQEVLVI 384 392 Rho guanine nucleotide Homo sapiens exchange factor 3
(UniProt:E9PG37)
630971 FLFQFIPYM 70 78 Methylsterol monooxygenase Methylsterol monooxygenase Homo sapiens
1 1
630972 FLFRITQV 43 50 Leupaxin (UniProt:B7Z5P7) Homo sapiens
630976 FLFVDPELV 37 45 Phosphoinositide 3-kinase Homo sapiens regulatory subunit 6
630977 FLFVDPELVSA 37 47 Phosphoinositide 3-kinase Homo sapiens regulatory subunit 6
630980 FLGCIGAVNEV + 71 81 CD82 antigen CD82 antigen Homo sapiens
CYSTL(C4)
630982 FLGEKYIRRV 117 126 60S ribosomal protein L9 60S ribosomal protein L9 Homo sapiens
(UniProt:P32969) Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
630983 FLGIHVFLV 44 52 Other Homo sapiens Ancient ubiquitous protein 1 Homo sapiens
(human) protein
630985 FLHAADWL 323 331 Butyrophilin subfamily 2 Homo sapiens member A2
(UniProt:Q8WW5)
630987 FLHAVDWL 263 271 Butyrophilin subfamily 2 Homo sapiens member A1
630988 FLHESLILL 829 837 UHRF1-binding protein Mike UHRF1 -binding protein Mike Homo sapiens
630991 FUAALDVL 266 274 Ubiquitin carboxyl-terminal Ubiquitin carboxyl-terminal Homo sapiens hydrolase 22 hydrolase 22
630993 FUGILLREV 1152 1161 Dedicator of cytokinesis Dedicator of cytokinesis Homo sapiens protein 10 protein 10
630995 FUPKFFEL 173 181 UniProt:F6VAU2 Homo sapiens
63101 1 FLLALGHFL 98 106 Other Homo sapiens Homo sapiens
(human) protein
631012 FLLDIEDRIYQG 950 961 Bromodomain adjacent to Bromodomain adjacent to Homo sapiens zinc finger domain protein 1A zinc finger domain protein 1A
631015 FLLEDDIHVS 120 129 tRNA-splicing endonuclease Homo sapiens subunit Sen15
631016 FLLEIRQTL 129 137 Sorting nexin-13 Sorting nexin-13 Homo sapiens
631017 FLLEPGNLEVLL 1152 1163 Neurobeachin-like protein 2 Neurobeachin-like protein 2 Homo sapiens
(UniProt:Q6ZNJ1)
631019 FLUQLSCYF 9 18 UDP-glucuronosyltransferase Homo sapiens
2B15
631020 FLLLPDAEAQL 14 24 Transmembrane protein 128 Transmembrane protein 128 Homo sapiens
631021 FLLPHPGLKVA 67 77 Atlastin-2 Homo sapiens
631022 FLLPLIIVL 7 15 Major histocompatibility Homo sapiens complex class l-related gene
protein
631024 FLLQINDILL 169 178 Ral GTPase-activating Ral GTPase-activating Homo sapiens protein subunit beta protein subunit beta
(UniProt:Q86X10)
631025 FLLQLHWRL 57 65 Tumor necrosis factor ligand Tumor necrosis factor ligand Homo sapiens superfamily member 14 superfamily member 14
631026 FLLQQHLISA 229 238 DNA-binding protein RFX5 DNA-binding protein RFX5 Homo sapiens
631029 FLMWFIETA 181 189 Histone acetyltransferase Histone acetyltransferase Homo sapiens type B catalytic subunit type B catalytic subunit
631073 FLPQVWTV 732 740 Autophagy-related protein 2 Autophagy-related protein 2 Homo sapiens homolog A homolog A
631095 FLSDIPETV 85 93 3-ketoacyl-CoA thiolase, 3-ketoacyl-CoA thiolase, Homo sapiens peroxisomal peroxisomal
(UniProt:B4DVF4)
631097 FLSEVWNTHTL 599 609 Protein FAM11 1 B Protein FAM11 1 B Homo sapiens
631 102 FLSPQQPPLL 31 40 Cyclin-dependent kinase 13 Homo sapiens
631 105 FLTAAIILL 105 113 Anterior pharynx defective 1 Homo sapiens homolog A (C. elegans)
631 106 FLTEIENLFL 695 704 Histone H2A deubiquitinase Histone H2A deubiquitinase Homo sapiens
MYSM1 MYSM1
631 110 FLVEEEDLFL 183 192 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
TRIM4 TRIM4
631 112 FLVLDVVYL 204 212 Apolipoprotein L1 Homo sapiens
631 119 FLWTEKFPSL 116 125 GRB2-related adapter Homo sapiens protein 2 (UniProt:075791)
631 120 FLYAAQPELL 821 830 Neuroblastoma-amplified Neuroblastoma-amplified Homo sapiens sequence sequence
631 123 FLYGGELVL 103 111 Other Homo sapiens Kelch-like protein 36 Homo sapiens
(human) protein
631 126 FLYPFPLALF 141 150 Transmembrane protein 41 B Transmembrane protein 41 B Homo sapiens
631 128 FLYWHLEDL 467 475 Major facilitator superfamily Major facilitator superfamily Homo sapiens domain-containing protein 6 domain-containing protein 6
631 140 FMFQEALKL 102 110 Melanoma-associated Melanoma-associated Homo sapiens antigen 9 antigen 9
631 156 FMYNFQLVTL 180 189 Long-chain-fa tt -acid-CoA Long-chain-fa tty-acid-CoA Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
ligase 3 ligase 3
631417 FQWDSDNIYL 80 89 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ULK3 kinase ULK3
631501 FVDEFLTYL 286 294 1-phosphatidylinositol 4,5- 1-phosphatidylinositol 4,5- Homo sapiens bisphosphate bisphosphate
phosphodiesterase gamma-2 phosphodiesterase gamma-2
631566 FVQPFGPQYEV 1134 1144 Centrosomal protein of 192 Centrosomal protein of 192 Homo sapiens kDa (UniProt:Q8TEP8) kDa
631685 GILSVRDATKI 501 511 Contacti n-2 Contactin-2 Homo sapiens
631706 GLAAFRAFL 93 101 Regulator of G-protein Regulator of G-protein Homo sapiens signaling 2 signaling 2
631710 GLAEILVLV 283 291 Kelch-like protein 21 Kelch-like protein 21 Homo sapiens
631718 GLAHFVNEI 857 865 Zinc finger MYM-type protein Zinc finger MYM-type protein Homo sapiens
2 2
631735 GLDDLLLFL 197 205 Protein timeless homolog Protein timeless homolog Homo sapiens
631752 GLDSNLKYILV 114 124 Other Homo sapiens MAX gene-associated Homo sapiens
(human) protein protein
631761 GLFDQQLAL 195 203 Cholinesterase Cholinesterase Homo sapiens
631762 GLFERDKUFL 438 448 Dynein heavy chain 17, Dynein heavy chain 17, Homo sapiens axonemal axonemal
631764 GLFGVPLCL + 119 127 Potassium channel subfamily Potassium channel subfamily Homo sapiens
CYSTL(C8) K member 5 K member 5
631765 GLFGYLVFL 579 587 V-type proton ATPase 1 16 V-type proton ATPase 1 16 Homo sapiens kDa subunit a isoform 3 kDa subunit a isoform 3
631785 GUEDHFDVTV 230 240 Endoplasmic reticulum Endoplasmic reticulum Homo sapiens aminopeptidase 1 aminopeptidase 1
631789 GUSFSDYIFL 39 49 Calcium uptake protein 1 , Homo sapiens mitochondrial
631798 GLLDGGVDILL 182 192 Methionine synthase Methionine synthase Homo sapiens
(UniProt:Q99707)
631802 GLLEEAYTL 274 282 Protein Niban Protein Niban Homo sapiens
631803 GLLEGLVEV 403 411 Rapamycin-insensitive Rapamycin-insensitive Homo sapiens companion of mTOR companion of mTOR
631807 GLLPEHFLFLA 468 478 Signal transducer and Signal transducer and Homo sapiens activator of transcription 6 activator of transcription 6
631808 GLLPGCVYHV + 592 601 Nodal modulator 3 Nodal modulator 3 Homo sapiens
CYSTL(C6)
631809 GLLPSKIRINL 28 38 Transcription factor E2F6 Transcription factor E2F6 Homo sapiens
631867 GLSPLRPPSV 2026 2035 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase 2D methyltransferase 2D
631873 GLTLAPGLSPA 178 188 Interferon regulatory factor 2- Interferon regulatory factor 2- Homo sapiens binding protein 1 binding protein 1
631882 GLVTWDAALYL 101 111 Putative protein N- Putative protein N- Homo sapiens methyltransferase FAM86B1 methyltransferase FAM86B1
631967 GVAPSRAIYFA 90 100 Solute carrier family 25 Homo sapiens member 36
631986 GVQDFVPFV 262 270 Trafficking protein particle Trafficking protein particle Homo sapiens complex subunit 11 complex subunit 11
632002 GYFDERYVL 183 191 Creatine kinase U-type, Homo sapiens mitochondrial
(UniProt:P12532)
632127 HLLDIYIQL 498 506 Midasin Midasin Homo sapiens
632134 HLLPGDELYL 304 313 Nucleoside diphosphate- Nucleoside diphosphate- Homo sapiens linked moiety X motif 19 linked moiety X motif 19
632136 HLLSELEAAPYL 338 349 General transcription factor General transcription factor Homo sapiens
3C polypeptide 2 3C polypeptide 2
632137 HLMEENMIVYV 128 138 NAD kinase NAD kinase Homo sapiens
632421 IFVEAVLR 7 14 Zinc transporter 10 Homo sapiens
632487 ILADIVISA 245 253 Bifunctional Bifunctional Homo sapiens methylenetetrahydrofolate methylenetetrahydrofolate
dehydrogenase/cyclohydrola dehydrogenase/cyclohydrola se, mitochondrial se, mitochondrial
632488 ILADKSSFISV 34 44 CD82 antigen CD82 antigen Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
633324 KLSFIIRTV 909 917 Leucyl-cystinyl Leucyl-cystinyl Homo sapiens aminopeptidase aminopeptidase
633326 KLTDNLVAL 185 193 Cyclin-dependent kinase 16 Homo sapiens
633327 KLTDQTLIYL 418 427 Lysine-specific demethylase Homo sapiens
2A
633337 KLWNVAAPLYL 239 249 Integrator complex subunit 4 Integrator complex subunit 4 Homo sapiens
633338 KLWSFFIYL 19 27 CTD nuclear envelope CTD nuclear envelope Homo sapiens phosphatase 1 phosphatase 1
633364 KMMELFIRL 665 673 ATP-binding cassette subATP-binding cassette subHomo sapiens family A member 12 family A member 12
633440 KTFNLIPAV 138 146 39S ribosomal protein L4, 39S ribosomal protein L4, Homo sapiens mitochondrial mitochondrial
(UniProt:Q9BYD3)
633500 KVGNFKFIYV 42 51 SAM domain-containing SAM domain-containing Homo sapiens protein SAMSN-1 protein SAMSN-1
633501 KVGSFKFIYV 220 229 SAM and SH3 domain- SAM and SH3 domain- Homo sapiens containing protein 3 containing protein 3
633518 KVLPQELV 224 231 Leucine-rich repeat and Homo sapiens calponin homology domain- containing protein 1
633634 LAQLRVLYL 121 129 Leucine-rich repeat- Homo sapiens containing protein 24
633657 LEGLLPRLLSL 680 690 Brefeldin A-inhibited guanine Homo sapiens nucleotide-exchange protein
3
633684 LFKNAERML 277 285 N-acetylglutamate synthase, Homo sapiens mitochondrial
633695 LFNENPYP 34 41 Divergent paired-related Homo sapiens homeobox
633781 LIQYHEPEL 174 182 TBC1 domain family member TBC1 domain family member Homo sapiens
23 23
633801 LLAGFAFLTGV 145 155 Bax inhibitor 1 Bax inhibitor 1 Homo sapiens
(UniProt:F8W034)
633802 LLAHVTLEL 681 689 Methionine-tRNA ligase, Methionine-tRNA ligase, Homo sapiens cytoplasmic cytoplasmic
(UniProt:P56192)
633806 LLAPIVFVL 209 217 TBC1 domain family member TBC1 domain family member Homo sapiens
5 5
633835 LLDEPTNHLDL 251 261 ATP-binding cassette subATP-binding cassette subHomo sapiens family F member 2 family F member 2
633922 LLFEHSDIVVI 20 30 Zinc transporter 5 Zinc transporter s Homo sapiens
633923 LLFGKIGYYLV 238 248 Protein YIF1 B Protein YIF1 B Homo sapiens
633931 LLFTWEELI 257 265 Cell division cycle protein Homo sapiens
123 homolog
633936 LLGQVFQV 212 219 Cerebral cavernous Homo sapiens malformations 2 protein
633943 LUDTQGVPYTV 54 65 Zinc finger protein 581 Homo sapiens
633945 LUGTDVSL 715 723 Protein VPRBP Protein VPRBP Homo sapiens
633961 LLLDERQDVHL 91 101 AP-1 complex subunit AP-1 complex subunit Homo sapiens gamma-1 gamma-1
633964 LLLDIMPGL 2 10 Protein VPRBP Protein VPRBP Homo sapiens
633965 LLLDTEGFVK 631 640 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase N2 kinase N2
633967 LLLEPGSLYIL 157 167 Alpha-ketogluta rate- Alpha-ketoglutarate- Homo sapiens dependent dioxygenase alkB dependent dioxygenase alkB homolog 7, mitochondrial homolog 7, mitochondrial
633969 LLLNELPSV 177 185 H/ACA ribonucleoprotein H/ACA ribonucleoprotein Homo sapiens complex non-core subunit complex non-core subunit
NAF1 NAF1
633970 LLLPETQSLPL 513 523 Solute carrier family 22 Homo sapiens member 12
633972 LLLTDQHLYKL 889 899 Unconventional myosin-lg Unconventional myosin-lg Homo sapiens
633975 LLLYEEGLRVV 268 278 Tyrosyl-DNA Tyrosyl-DNA Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
635371 NLLSKVUYL 42 51 TATA-binding protein- TATA-binding protein- Homo sapiens associated factor 172 associated factor 172
635373 NLMELUMI + 94 102 Ribose-phosphate Ribose-phosphate Homo sapiens
OX(M8) pyrophosphokinase 2 pyrophosphokinase 2
635375 NLMPQMKTLYL 174 184 Rho guanine nucleotide Homo sapiens exchange factor 7
635604 PINGNGKQ 203 210 Glutathione S-transferase P Glutathione S-transferase P Homo sapiens
(UniProt:P0921 1)
635609 PLGYEIQL 918 925 Nuclear pore complex protein Nuclear pore complex protein Homo sapiens
Nup107 (UniProt:P57740) Nup107
63561 1 PLLDLHIEL 410 418 CASP8 and FADD-like Homo sapiens apoptosis regulator
(UniProt:015519)
635640 PVEQYLGVP 50 58 Neuroligin-4, X-linked Homo sapiens
635653 PYHWPLLV 79 86 Progestin and adipoQ Homo sapiens receptor family member 6
635759 QIMDYLLCL + 99 107 Lysosomal-associated Lysosomal-associated Homo sapiens
CYSTL(C8) transmembrane protein 5 transmembrane protein 5
635814 QUDYKILGL 105 114 Neutrophil cytosol factor 2 Neutrophil cytosol factor 2 Homo sapiens
635821 QLLDLMHTL 1494 1502 Golgi-specific brefeldin A- Homo sapiens resistance guanine
nucleotide exchange factor 1
635832 QLLGLIQRV 204 212 GTPase lMAP family Homo sapiens member 4
635879 QLWFREFFL 654 662 Cytoplasmic FMR1- Cytoplasmic FMR1 - Homo sapiens interacting protein 1 interacting protein 1
635885 QLYSVDVTL 312 320 Zinc finger protein RFP Zinc finger protein RFP Homo sapiens
635891 QMFQYFITV 246 254 Endoplasmic reticulum-Golgi Endoplasmic reticulum-Golgi Homo sapiens intermediate compartment intermediate compartment
protein 2 (UniProt:Q96RQ1 ) protein 2
635898 QMMQNPQILAA 41 51 Nucleosome assembly Nucleosome assembly Homo sapiens protein 1-like 1 protein Mike 1
636142 RIADGLPVAV 59 68 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase pirn -3 kinase pim-3
636161 RIIDIWILL 648 656 F-box DNA helicase 1 F-box DNA helicase 1 Homo sapiens
636190 RKSLKIIYI 196 204 PRAME family member 2 PRAME family member 2 Homo sapiens
636200 RLASTLVQV 746 754 Rho GTPase-activating Homo sapiens protein 30
636231 RLFEVPHEL 748 756 StAR-related lipid transfer StAR-related lipid transfer Homo sapiens protein 13 protein 13
636232 RLFEVPHELVA 748 758 StAR-related lipid transfer StAR-related lipid transfer Homo sapiens protein 13 protein 13
636256 RLIDDMVAQV 255 264 Isocitrate dehydrogenase Homo sapiens
[NADPl, mitochondrial
636257 RUDIFIINL 66 75 G-protein coupled receptor Homo sapiens
15
636261 RUQGDQILSV 118 128 InaD-like protein Homo sapiens
636271 RLLAETHYQL 242 251 Nuclear autoantigenic sperm Nuclear autoantigenic sperm Homo sapiens protein (UniProt:Q5T624) protein
636284 RLLEQGCTDFTV + 156 167 Probable ATP-dependent Probable ATP-dependent Homo sapiens
CYSTL(C7) RNA helicase DDX49 RNA helicase DDX49
(UniProt:Q9Y6V7)
636287 RLLEVNQQSLL 358 368 Protein scribble homolog Homo sapiens
636288 RLLEVTNTIRV 222 232 Poly [ADP-ribose] Poly [ADP-ribose] Homo sapiens polymerase 14 polymerase 14
636290 RLLILENILL 236 245 Nuclear pore membrane Nuclear pore membrane Homo sapiens glycoprotein 210 glycoprotein 210
636299 RLLQAVALV 7 15 Polypeptide N- Homo sapiens acetylgalactosaminyltransfer
ase 10
636307 RLLTVLPSL 789 797 Coiled-coil alpha-helical rod Coiled-coil alpha-helical rod Homo sapiens protein 1 protein 1
636308 RLLYQLVFL 44 52 lnterleukin-4 receptor subunit lnterleukin-4 receptor subunit Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
alpha alpha
636341 RLPNRALLVNV 184 194 Phosphatidylinositol 4,5- Phosphatidylinositol 4,5- Homo sapiens bisphosphate 3-kinase bisphosphate 3-kinase
catalytic subunit delta catalytic subunit delta
isoform (UniProt:O00329) isoform
636378 RLYEITIEV 364 372 Nuclear pore membrane Nuclear pore membrane Homo sapiens glycoprotein 210 glycoprotein 210
636397 RMGGFGSIIQL 220 230 tRNA (adenine(58)-N(1 ))- tRNA (adenine(58)-N(1 ))- Homo sapiens methyltransferase non- methyltransferase non- catalytic subunit TRM6 catalytic subunit TRM6
636405 RMLYMIEQV 900 908 Mitotic checkpoint Mitotic checkpoint Homo sapiens serine/threonine-protein serine/threonine-protein
kinase BUB1 kinase BUB1
(UniProt:043683)
636546 RVLDFDPMAV 592 601 ATP-dependent DNA ATP-dependent DNA Homo sapiens helicase PIF1 helicase PIF1
636710 SDPFTHLAP 645 653 Endoribonuclease Dicer Endoribonuclease Dicer Homo sapiens
636850 SIGKPSLFISV 566 576 Potassium voltage-gated Homo sapiens channel subfamily KQT
member 1
636852 SIIDWLNSV 97 105 E3 ubiquitin-protein ligase Homo sapiens
RLIM
636857 SIISNLDEV 264 272 Potassium channel subfamily Homo sapiens
K member 18
636861 SIKNYLQFL + 574 582 Other Homo sapiens Outer dense fiber protein 2- Homo sapiens
DEAM(N4) (human) protein like
636865 SILPVILRL 153 161 Olfactory receptor 51 B2 Olfactory receptor 51 B2 Homo sapiens
636866 SILQTULV 207 215 Transmembrane emp24 Transmembrane emp24 Homo sapiens domain-containing protein 9 domain-containing protein 9
636867 SILSLUKL 1088 1096 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR3 UBR3
636868 SILSLVTKI 73 81 Interleukin enhancer-binding Interleukin enhancer-binding Homo sapiens factor 2 factor 2
636913 SLAGFLLSV 492 500 Other Homo sapiens Transmembrane protein 8B Homo sapiens
(human) protein
636919 SLAPIIVYI 336 344 Voltage-dependent L-type Homo sapiens calcium channel subunit
beta-1
636925 SLASFIPAVNDL 11 1 122 HAUS augmin-like complex HAUS augmin-like complex Homo sapiens subunit 1 subunit 1
636962 SLDPTLPSV 2467 2475 Probable E3 ubiquitin-protein Probable E3 ubiquitin-protein Homo sapiens ligase HERC1 ligase HERC1
636977 SLDWQMVFL 455 463 Beta-adrenergic receptor Beta-adrenergic receptor Homo sapiens kinase 1 kinase 1
636981 SLEENLPCI + 620 628 Plexin-B2 Plexin-B2 Homo sapiens
CYSTL(C8)
636983 SLFAQRLKTL 851 860 Unconventional myosin-lg Unconventional myosin-lg Homo sapiens
637022 SUARLERL 176 184 Angiopoietin-related protein 6 Homo sapiens
637024 SUDILVAL 1983 1991 ATP-binding cassette subATP-binding cassette subHomo sapiens family A member 12 family A member 12
637026 SUEDLILLL 268 277 Histone-lysine N- Histone-lysine N- Homo sapiens methyltransferase SMYD3 methyltransferase SMYD3
637027 SUEWIGL 223 231 Solute carrier family 23 Solute carrier family 23 Homo sapiens member 2 member 2
637028 SUEYCIEL + 307 315 FERM domain-containing Homo sapiens
CYSTL(C6) protein 8 (UniProt:Q9BZ67)
637031 SUKYFLFV 9 17 Leukocyte antigen CD37 Leukocyte antigen CD37 Homo sapiens
637032 SUPEGPPQV 395 404 Homocysteine-responsive Homocysteine-responsive Homo sapiens endoplasmic reticulum- endoplasmic reticulum- resident ubiquitin-like domain resident ubiquitin-like domain member 2 protein member 2 protein
637035 SUSIKRLTL 1826 1835 U5 small nuclear U5 small nuclear Homo sapiens ribonucleoprotein 200 kDa ribonucleoprotein 200 kDa
helicase helicase Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
637084 SLLDELLEV 127 135 Sterol O-acyltransferase 1 Sterol O-acyltransferase 1 Homo sapiens
637087 SLLDPRVGIRSV 179 190 Mitogen-activated protein Mitogen-activated protein Homo sapiens kinase-binding protein 1 kinase-binding protein 1
637089 SLLDTLVLL 77 85 AP-5 complex subunit beta-1 AP-5 complex subunit beta-1 Homo sapiens
637090 SLLEAVSFL 8 16 Phosphorylase b kinase Homo sapiens gamma catalytic chain,
liver/testis isoform
637094 SLLEWCQEV + 1042 1050 EH domain-binding protein 1- EH domain-binding protein 1 - Homo sapiens
CYSTL(C6) like protein 1 like protein 1
637095 SLLGFVATV 18 26 UDP-N-acetylglucosamine- Homo sapiens dolichyl-phosphate N- acetylglucosaminephosphotr
ansferase
637105 SLLLLQLLL 22 30 Cation-independent Cation-independent Homo sapiens mannose-6-phosphate mannose-6-phosphate
receptor receptor
637113 SLLPPQDPHL 490 499 Protocadherin beta-8 Protocadherin beta-8 Homo sapiens
637118 SLLQVUSI 214 222 (E3-independent) E2 (E3-independent) E2 Homo sapiens ubiquitin-conjugating enzyme ubiquitin-conjugating enzyme
637119 SLLSDIIAL 386 394 Phosphatidylinositol N- Phosphatidylinositol N- Homo sapiens acetylglucosaminyltransferas acetylglucosaminyltransferas e subunit Q e subunit Q
637121 SLLSHVIVA 1210 1218 Serine/threonine-protein Serine/threonine-protein Homo sapiens kinase ATR kinase ATR
637122 SLLSLLPLFL 68 77 WD repeat- and FYVE WD repeat- and FYVE Homo sapiens domain-containing protein 4 domain-containing protein 4
(UniProt:Q6ZS81 )
637124 SLLSNDLKLNL 27 37 Other Homo sapiens Gamma-interferon-inducible Homo sapiens
(human) protein protein 16
637127 SLLTAISEV 527 535 Uncharacterized protein Uncharacterized protein Homo sapiens
CXorf57 CXorf57
637129 SLMALILFL 255 263 Alpha-1 ,2- Alpha-1 ,2- Homo sapiens mannosyltransferase ALG9 mannosyltransferase ALG9
637131 SLMDLTLLL 878 886 Tubulin-specific chaperone D Tubulin-specific chaperone D Homo sapiens
637132 SLMDPNKFLLLV 683 694 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
UBR1 UBR1
637135 SLMEILYTL 266 274 Conserved oligomeric Golgi Conserved oligomeric Golgi Homo sapiens complex subunit 7 complex subunit 7
637140 SLMLVSTVL 88 96 Membrane-spanning 4- Membrane-spanning 4- Homo sapiens domains subfamily A domains subfamily A
member 6E member 6E
637191 SLQEFLAAL 516 524 Protein NLRC5 Protein NLRC5 Homo sapiens
637192 SLQELUQV 864 872 Pecanex-like protein 4 Pecanex-like protein 4 Homo sapiens
637231 SLSTCIPAI + 108 116 Uncharacterized protein Uncharacterized protein Homo sapiens
CYSTL(C5) ZMYM6NB ZMYM6NB
637232 SLSTVFWL 159 167 Choline/ethanolaminephosph Choline/ethanolaminephosph Homo sapiens otransferase 1 otransferase 1
637238 SLVDASWEL 30 38 Other Homo sapiens Homo sapiens
(human) protein
637240 SLVELLVQL 785 793 Anaphase-promoting Anaphase-promoting Homo sapiens complex subunit 1 complex subunit 1
637245 SLVGLLLYL 40 48 Nuclear envelope pore Nuclear envelope pore Homo sapiens membrane protein POM 121 membrane protein POM 121
637247 SLVHINIFL 1783 1791 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13D associated protein 13D
637255 SLVYLCYTV + 264 272 Nodal modulator 2 Nodal modulator 2 Homo sapiens
CYSTL(C6)
637259 SLWGTHWV 268 276 Methylmalonic aciduria and Methylmalonic aciduria and Homo sapiens homocystinuria type D homocystinuria type D
protein, mitochondrial protein, mitochondrial
637267 SLYHVESTV 26 34 WD repeat-containing protein WD repeat-containing protein Homo sapiens mio mio
637269 SLYNDDRNLLRI 6 17 AF4/FMR2 family member 1 AF4/FMR2 family member 1 Homo sapiens Epitope Epitope Starting Ending Antigen Parent Organism
ID Peptide Position Position Name Protein Name
(UniProt:P51825)
637273 SLYPSAPFL 207 215 Phospholipase ABHD3 Phospholipase ABHD3 Homo sapiens
(UniProt:Q8WU67)
637301 SMLLEIIFL 212 220 Nucleoporin NUP188 Nucleoporin NUP188 Homo sapiens homolog homolog
637305 SMLTLPLSL 190 198 Ubl carboxyl-terminal Homo sapiens hydrolase 18
637308 SMMALLVQL 695 703 Alpha-catulin Alpha-catulin Homo sapiens
637350 SPPAILVTV 1242 1250 Hydrocephalus-inducing Hydrocephalus-inducing Homo sapiens protein homolog protein homolog
637370 SQFQQEFPSL 139 148 Protein PRRC2C Protein PRRC2C Homo sapiens
637373 SQLDISDPYKV 114 124 Interferon regulatory factor 4 Interferon regulatory factor 4 Homo sapiens
637374 SQLDISEPYKV 99 109 Interferon regulatory factor 8 Interferon regulatory factor 8 Homo sapiens
637385 SQYDYILPQV 706 715 Nodal modulator 3 Nodal modulator 3 Homo sapiens
637470 SVAPFALPTV 239 248 Histone deacetylase 7 Histone deacetylase 7 Homo sapiens
637510 SVFAGVVGV 455 463 Guanylate cyclase soluble Homo sapiens subunit alpha-3
637542 SVLDLLVQL 109 117 Gamma-tubulin complex Homo sapiens component 6
637543 SVLDLVVAL 652 660 Other Homo sapiens Homo sapiens
(human) protein
637822 TLADLRVLFGI 1152 1162 Transcription termination Homo sapiens factor 2
637826 TLAELHISL 927 935 Protein NLRC5 Protein NLRC5 Homo sapiens
637833 TLCDLYETL + 263 271 Eukaryotic initiation factor Eukaryotic initiation factor Homo sapiens
CYSTL(C3) 4A-II 4A-II
637867 TLFHDPWKLLI 451 461 Methyl-CpG-binding domain Methyl-CpG-binding domain Homo sapiens protein 4 protein 4
637881 TUAAILYL 88 96 Proteolipid protein 2 Proteolipid protein 2 Homo sapiens
637886 TUGLSIKVKL 97 107 Mitotic spindle-associated Mitotic spindle-associated Homo sapiens
MMXD complex subunit MMXD complex subunit
MIP18 MIP18
637906 TLLDASEKLKL 186 196 UniProt:E9PFS7 Homo sapiens
63791 1 TLLGVTVTV 412 420 Other Homo sapiens Autophagy-related protein 9A Homo sapiens
(human) protein
637912 TLLHFLVEI 835 843 Protein diaphanous homolog Protein diaphanous homolog Homo sapiens
3 3
637913 TLLHLAVSL 43 51 Ankyrin repeat domain- Homo sapiens containing protein 13A
637916 TLLPGEGPFL 216 225 Other Homo sapiens Guanidinoacetate N- Homo sapiens
(human) protein methyltransferase
637918 TLLPTLYEI 240 248 E3 ubiquitin-protein ligase Homo sapiens
RNF180
637923 TLMEEVLLL 47 55 Golgi phosphoprotein 3-like Golgi phosphoprotein 3-like Homo sapiens
637924 TLMEEVLLLGL 47 57 Golgi phosphoprotein 3-like Golgi phosphoprotein 3-like Homo sapiens
637961 TLQPTLVAV 118 126 Intercellular adhesion Intercellular adhesion Homo sapiens molecule 2 molecule 2
637974 TLSNLWIFL 338 346 Acyl- Acyl- Homo sapiens
CoA:lysophosphatidylglycerol CoA:lysophosphatidylglycerol acyltransferase 1 acyltransferase 1
637975 TLSPLLLFL 2 10 Gamma-interferon-inducible Gamma-interferon-inducible Homo sapiens lysosomal thiol reductase lysosomal thiol reductase
637981 TLVTWLQCV + 766 774 HEAT repeat-containing HEAT repeat-containing Homo sapiens
CYSTL(C8) protein 2 protein 2
637982 TLWQIVINI 27 35 NAD-dependent protein Homo sapiens deacetylase sirtuin-1
637983 TLWRGPWV 210 218 Metal loreductase STEAP2 Metalloreductase STEAP2 Homo sapiens
637985 TLWYKIFTT 213 221 Transmembrane protein 248 Transmembrane protein 248 Homo sapiens
637986 TLWYVPLSL 117 125 Other Homo sapiens Cytosolic acyl coenzyme A Homo sapiens
(human) protein thioester hydrolase
638009 TMLELLLRL 1059 1067 Zinc finger protein Rlf Zinc finger protein Rlf Homo sapiens
638010 TMLSLEFHL 257 265 Protection of telomeres Protection of telomeres Homo sapiens protein 1 protein 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
639184 YLAGLHANIAV 296 306 Apoptosis-inducing factor 2 Apoptosis-inducing factor 2 Homo sapiens
639185 YLAIVWPVV 132 140 G-protein coupled receptor Homo sapiens
15
639187 YLATFALKV 432 440 Short transient receptor Short transient receptor Homo sapiens potential channel 1 potential channel 1
639201 YLDFRNNSL 107 115 Other Homo sapiens Homo sapiens
(human) protein
639205 YLDIINLFL 264 272 Protein lifeguard 4 Protein lifeguard 4 Homo sapiens
(UniProt:G3XAA5)
639232 YLEEILVRV 592 600 RNA polymerase II subunit A RNA polymerase II subunit A Homo sapiens
C-terminal domain C-terminal domain
phosphatase phosphatase
639236 YLFDIQLPNI 156 165 (E3-independent) E2 (E3-independent) E2 Homo sapiens ubiquitin-conjugating enzyme ubiquitin-conjugating enzyme
639240 YLFEIRDWRL 1032 1041 Protein KIAA0100 Homo sapiens
639241 YLFGKEMYQV 77 86 Actin-related protein 6 Actin-related protein 6 Homo sapiens
639244 YLFKWLI 10 17 Ras-related protein Rab-11 B Ras-related protein Rab-1 1 B Homo sapiens
639247 YLFTIINSL 529 537 Adhesion G protein-coupled Adhesion G protein-coupled Homo sapiens receptor E3 receptor E3
639248 YLGIVELLV 195 203 NF-kappa-B inhibitor alpha NF-kappa-B inhibitor alpha Homo sapiens
(UniProt:P25963)
639251 YLHEDIPGL 302 310 Activin receptor type-2A Homo sapiens
639256 YUDRDPTYF 119 128 BTB/POZ domain-containing BTB/POZ domain-containing Homo sapiens protein KCTD2 protein KCTD2
639259 YULHUSTV 29 38 Mini-chromosome Mini-chromosome Homo sapiens maintenance complex- maintenance complex- binding protein binding protein
639260 YUNFEIRSL 651 660 WD repeat-containing protein WD repeat-containing protein Homo sapiens
35 35
639261 YUPFTGIVGL 173 183 E3 ubiquitin-protein ligase E3 ubiquitin-protein ligase Homo sapiens
RNF167 RNF167
639263 YLIQSVPAEL 167 176 Vacuolar-sorting protein Vacuolar-sorting protein Homo sapiens
SNF8 SNF8
639264 YUSELEAA 114 122 Protein FAM98A Protein FAM98A Homo sapiens
639273 YLLDMPLWYL 1127 1136 DNA topoisomerase 2-alpha DNA topoisomerase 2-alpha Homo sapiens
639274 YLLEEILDKV 726 735 Other Homo sapiens Histone-lysine N- Homo sapiens
(human) protein methyltransferase SETDB2
639275 YLLEKSRIV 1392 1400 Unconventional myosin-XV Unconventional myosin-XV Homo sapiens
(UniProt:Q9UKN7)
639284 YLMNLNIMTV 366 375 THO complex subunit 5 THO complex subunit 5 Homo sapiens homolog homolog
639285 YLMQNWEHVL 486 495 Digestive organ expansion Digestive organ expansion Homo sapiens factor homolog factor homolog
639292 YLNLIELFL 146 154 Farnesyl pyrophosphate Farnesyl pyrophosphate Homo sapiens synthase synthase
639325 YLPVKIEQV 403 411 DNA repair and DNA repair and Homo sapiens recombination protein recombination protein
RAD54-like RAD54-like
639327 YLQDQHLLLTV 751 761 Other Homo sapiens Phosphatidylinositol 3,4,5- Homo sapiens
(human) protein trisphosphate 5-phosphatase
2
639336 YLSDEGHYWVGL 70 81 Probable 18S rRNA Probable 18S rRNA Homo sapiens
(guanine-N(7))- (guanine-N(7))- methyltransferase methyltransferase
(UniProt:O43709)
639338 YLSELSEHVKL 214 224 Rho GTPase-activating Rho GTPase-activating Homo sapiens protein 1 (UniProt:Q07960) protein 1
639340 YLSGIIVTL 214 222 CMP-sialic acid transporter CMP-sialic acid transporter Homo sapiens
639341 YLSHNGIEVI 258 267 Protein phosphatase 1 Protein phosphatase 1 Homo sapiens regulatory subunit 7 regulatory subunit 7
(UniProt:Q15435)
639346 YLTSQLPPL 31 39 Nuclear factor erythroid 2- Nuclear factor erythroid 2- Homo sapiens related factor 1 related factor 1 Epitope Epitope Starting Ending Antigen Parent Organism ID Peptide Position Position Name Protein Name
639348 YLTYILLHL 1087 1095 SMC5-SMC6 complex Homo sapiens localization factor protein 2
639349 YLVELSSLL 110 118 CDK5 regulatory subunit- CDK5 regulatory subunit- Homo sapiens associated protein 3 associated protein 3
639350 YLVNDIYEL 778 786 N-alpha-acetyltransferase N-alpha-acetyltransferase Homo sapiens
25, NatB auxiliary subunit 25, NatB auxiliary subunit
639351 YLWEHIFEGL 11 1 120 Transmembrane protein 5 Transmembrane protein 5 Homo sapiens
639355 YLYEHNFAF 79 87 GPI mannosyltransferase 2 GPI mannosyltransferase 2 Homo sapiens
639358 YLYPIKNLEM 399 408 Alpha-N- Homo sapiens acetylgalactosaminidase
639364 YMAPEWEA 256 264 MAP kinase-interacting MAP kinase-interacting Homo sapiens serine/threonine-protein serine/threonine-protein
kinase 2 kinase 2
639378 YMFEAREFL 398 406 Staphylococcal nuclease Staphylococcal nuclease Homo sapiens domain-containing protein 1 domain-containing protein 1
639379 YMFEEVPIVI + 193 202 Eukaryotic translation Eukaryotic translation Homo sapiens
OX(M2) initiation factor 3 subunit H initiation factor 3 subunit H
639387 YMIDNVILU 27 36 V-type proton ATPase V-type proton ATPase Homo sapiens subunit d 1 subunit d 1
639513 YQFDSALLPAV 249 259 Transcription factor Spi-B Transcription factor Spi-B Homo sapiens
639520 YQSELELRV 661 669 Vacuolar protein sorting- Vacuolar protein sorting- Homo sapiens associated protein 13D associated protein 13D
639557 YTIGKEIIDLVL 73 84 Tubulin alpha-1 C chain Tubulin alpha-1 C chain Homo sapiens
(UniProt:Q9BQE3)
639612 YVIAYIRDLAL 509 519 Alkyldihydroxyacetonephosp Alkyldihydroxyacetonephosp Homo sapiens hate synthase, peroxisomal hate synthase, peroxisomal
639617 YVLDLAAKV 213 221 ATP-citrate synthase ATP-citrate synthase Homo sapiens
639618 YVLEDLEVTV 748 757 Coatomer subunit gamma-2 Coatomer subunit gamma-2 Homo sapiens
639620 YVLKYLFEV 110 118 Other Homo sapiens Hermansky-Pudlak Homo sapiens
(human) protein syndrome 1 protein
639621 YVMEYRELFL 474 483 Protein timeless homolog Protein timeless homolog Homo sapiens
639624 YVNLPINGNGKQ 199 210 Glutathione S-transferase P Glutathione S-transferase P Homo sapiens
(UniProt:P0921 1)
[0321] In some embodiments, any of the epitopes in Table 6.3 can be employed as the epitope in the SABR arrangement provided herein. In some embodiments, any of the epitopes in table 6.4 can be used as the epitope in the SABR arrangements provided herein.
TABLE 6.4
Example 7: Antigen-presenting Cells to Detect Islet Autoimmunity in Type 1 Diabetes
[0322] Type 1 Diabetes (TID) is an autoimmune disorder caused by progressive destruction of insulin-producing pancreatic β cell islets. The role of T cells in pathology of TID is well established by immunological studies and discovery of genetic risk factors. However, there is an unmet need for tools to link the immune manifestations of these genetic risk factors.
[0323] An immune -reactive cell, such as a pancreatic β cell in TID, presents antigenic epitopes on human leukocyte antigen molecules (pHLA complexes) on its surface. T cells use their unique TCR to specifically recognize pHLA. In T1D, both CD4+ and CD8+ T cells recognize and respond to self-antigens on pancreatic β cells. CD8+ T cells recognize Class I pHLA and induce a cytotoxic response, whereas, CD4+ T cell recognize Class II pHLA and induce a helper response that modulates immune function. A bottleneck in studying T cells is at the identification of the antigens they target. Two major tools to detect the antigen-specific T cells are pHLA-multimers and functional assays. pHLA multimers are purified HLA molecules complexed with peptides and conjugated to fluorophores and are used to identify antigen-specific T cells by flow cytometry. Despite their extensive use, they have several limitations: Class II pHLA multimers are inherently unstable, in particular, those for alleles associated with increased risk for T1D (HLA-DQ2 and -DQ8) and are therefore difficult and non-robust to use, they do not represent the physiological immune synapse, and they fail to detect low-avidity T cells inherently associated with autoimmunity. Functional assays, such as ELISAs and ELISPOTs, efficiently detect T cell function by measuring cytokine production upon stimulation with Antigen Presenting Cells (APCs) presenting desired epitopes. However, these assays do not allow distinction between different pHLAs, as APCs have three to ten different HLA alleles. They are also reliant on the induction of a strong functional response such as IFNy secretion and thus cannot detect functionally impaired autoimmune T cells. The detection of antigen-specific regulatory T cells (Tregs) is particularly challenging as their activity inhibits typically measured responses, and therefore is masked in functional assays as negative response. Indeed, there is an unmet need for detection of antigen-specific Tregs.
[0324] To that end, SABRs to detect pHLA-TCR interactions were constructed. FIG. 14A illustrates a schematic showing the structure of the SABR and signal induction by SABRs upon TCR-pHLA recognition. The extracellular domain of the SABR used in this example was a pHLA complex, which upon recognition by a T cell, causes the intracellular domain to induce a signal. APCs engineered to express SABRs present a given epitope and induce a measurable output when recognized by cognate T cells. The advantages of SABR- APCs over multimers or functional assays include: physiological pHLA display of single alleles on the surface of an APC, ability to define pHLA combinations genetically, multiplexed detection of epitope specificities, and detection of pHLA-TCR interaction independently from T cell function. FIG. 14B and FIG. 14C demonstrate this technique by showing induction of a signal by a SABR presenting Ovalbumin peptide on a mouse class II pMHC (IAb-OVA) upon recognition by cognate T cells. These SABR-APCs can be used to detect islet- specific immune responses in TID patients, to study the immunological effects of genetic risk factors, and to interrogate natural and immunotherapy-induced T cells.
[0325] The SABR-APCs can be used to understand the immunological mechanism of protective and susceptible genetic risk factors. Several Class II HLA alleles are associated with either protection from or susceptibility to TID. Both HLA-DQ2 and DQ8 are risk factors for TID, and particularly, patients who carry both alleles are at significantly higher risk than those carrying either allele alone. This phenomenon is thought to be due to cross-pairing of DQ2 and DQ8 chains (known as DQ2trans or DQ8trans) that may present peptide epitopes and induce autoimmunity. APCs from these patients express correctly paired and cross-paired molecules simultaneously, which cannot be distinguished by current methods, as shown in FIG. 14D. FIG. 14D illustrates four combinations of HLA-DQ alleles on APCs from DQ2-DQ8 heterozygous patients. SABRs can be used to display genetically encoded peptide epitopes linked to specific pairs of such so-called HLA-DQ transdimers on separate APCs to study the differences between patients carrying different genetic risk factors using a rare B-cell line lacking the endogenous DR and DQ locus, as shown in FIG. 14E. FIG. 14E illustrates SABRs encoding four DQ2/8 combinations on separate APCs allowing their distinction. Furthermore, SABR-APCs can be used to distinguish between immunogenicity of protective and susceptible variants of Insulin Defective Ribosomal Products (INS-DRiPs). Thus, the differences between immune responses from individuals carrying different genetic risk alleles can be dissected.
[0326] The function of islet autoreactive effector and regulatory T cells using SABR-APCs can also be studied. Autoimmune T cells exhibit unusual modes of antigen recognition and subsequent functional output. For instance, regulatory T cells specific for HLA-DR4-Proinsulin (CI 9- A3) bind with reversed polarity compared to effector T cells specific for the same epitope. Because of the inherent limitations in pHLA multimers, studying these distinctions has been extremely challenging. Therefore, SABR-APCs presenting these epitopes as substrates can be used for measuring the functional differences between islet-specific T cell clones derived from TID patients. These studies can be used understand the functional basis of distinct T cell subtypes from the perspective of the APC.
[0327] Natural and immunotherapy-induced islet-specific T cell responses can be detected using SABRs. In scenarios of suppressed immune function, current methods fail to detect antigen-specific T cells. This is particularly relevant in scenarios of islet transplantation or immune tolerance observed in healthy individuals or in patients successfully treated with tolerogenic immunotherapy, such as vaccination with Proinsulin C19-A3. Since the technology platform described herein only relies on TCR/epitope/HLA interaction, islet specific effector or regulatory T-cells can be detected and enumerated, even if their response is suppressed. SABR-APCs can be used to diagnose C19-A3-specific T cell responses from patients receiving immunotherapy with tolerogenic dendritic cells pulsed with this immunodominant proinsulin peptide. The use of SABRs can be extended for immunomonitoring by multiplexing detection of several epitopes from the same patient sample, allowing identification of 'immune signatures' in the islet-specific autoimmune responses that may correlate with response to this novel type of tissue specific immune intervention therapy.
Example 8: Class II MHC SABRs
[0328] SABRs comprising antigen presenting domains comprising class II MHC were also tested to determine signaling induction capability. The experimental methods described in Example 1 and 6 were used to test the capacity of class II MHC SABRs. FIG. 15A illustrates a schematic of IAb-OVA and Hum IAb-OVA SABRs and signaling induction upon recognition of an OT-II TCR. FIG. 15B illustrates a bar graph showing signaling induction of OT-II TCR for IAb-OVA and Hum IAb-OVA SABRs. As shown in FIG. 15B, the class II MHC SABRs were capable of inducing a signal while the other constructs did not induce signals. The results show that SABRs comprising class II MHC can induce signaling upon successful and specific TCR-pMHC interaction.
[0329] Furthermore, FIG. 16A illustrates a schematic of IAb-OVA DCH and an IAb-OVA DCH-SABR and signaling induction upon recognition of an OT-II TCR. FIG. 16B illustrates a bar graph showing signaling induction of OT-II TCR for IAb-OVA and Hum IAb-OVA SABRs. These results also show that SABRs comprising class II MHC can induce signaling upon successful and specific TCR-pMHC interaction. Thus, the experiment using Class I MHC SABRs, which are known for being relatively easy to work with, also worked for Class II MHC SABRs, which are known for being difficult to work with traditional methods for antigen discovery described herein.
Example 9: SABRs recognize primary cells
[0330] SCDR constructs were constructed to express, for example, either A2- NYESO (a cancer-specific MHCT antigen combination) or B27-KK10 (an HIV-specific MHC-antigen combination). In some embodiments, the SCDR constructs for A2 and B27 can be constructed and a peptide can be used to present, for example, either NYESO or KK10 antigen. NFAT-GFP-Jurkats, can be transduced with the SCTR constructs or with SCDR constructs and pulsed with peptide antigen as reporter cells. The reporter cells can be transduced with Jurkat cells expressing, for example, either A2-NYESO-specific TCR or B27-KK10-specific TCR, and the frequency of GFP+ cells can be measured with flow cytometry. FIG. 17A illustrates a line graph depicting %GFP+ cells over time. FIG. 17B illustrates representative flow cytometry plots from the experiment.
[0331] The results show that a signal was induced in about 30% of reporter cells within 4 hours of incubation and about 50% of reporter cells within 8 hours of incubation. Also, about 50% of the maximal signal was attained at 4 hours and about 100% of the maximal signal was attained by 8 hours.
[0332] Using the experimental results of Examples 3 and 6, TCR-transduced Jurkat cells were co-incubated with SCTR-transduced NFAT-GFP-Jurkat cells. FIG. 18A illustrates a bar graph depicting the frequency of %GFP+ for TCR-transduced Jurkat cells incubated with SCTR-transduced NFAT-GFP-Jurkat cells. FIG. 18B illustrates a bar graph depicting the frequency of %GFP+ for TCR-transduced PBMCs incubated with SCTR- transduced NFAT-GFP-Jurkat cells. FIG. 18C illustrates a line graph depicting the frequency over time of %GFP+ for TCR-transduced PBMCs incubated with SCTR-transduced NFAT- GFP-Jurkat cells.
[0333] As illustrated in FIGS. 18A-18C, SABRs are able to recognize antigen receptors on primary cells (e.g. directly from patient samples), the same way they recognize transgenic antigen receptors in cell lines.
Species, Variants, Deletions, or Modified Versions of Embodiments
[0334] In some embodiments, any species, variant, deletion, or modified version of each of the noted protein components (especially MHC fragment) can be employed, as long as they function as described herein. In some embodiments, this is achieved if the sequence employed is a human sequence for the component provided herein. In some embodiments, the sequence of the component can be mammalian. In some embodiments, the sequence of the component can be 80% or greater identity to a sequence provided herein or the human sequence of the component provided herein, for example, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.9% or greater identity to the human sequence of the component (e.g., MHC, epitope, etc.). In some embodiments, the component can be a variant, as long as those sequences that are conserved between organisms are maintained. Examples of such permissible variants are described in the logo based sequence alignments provided in FIGS. 20A-20F. FIG. 20A displays a sequence alignment for class I MHC across a wide variety of species. FIG. 20B displays a sequence alignment for class I MHC across humans. FIG. 20C displays a sequence alignment for class II alpha MHC across a wide variety of species. FIG. 20D displays a sequence alignment for class II alpha MHC across humans. FIG. 20E displays a sequence alignment for class II beta MHC across a wide variety of species. FIG. 20F displays a sequence alignment for class II beta MHC across humans. With this information, one of skill in the art will appreciate those sections of the protein that are conserved and thus important for function, and those sections that are not conserved and thus can be varied.
[0335] The images in FIGS. 20A-20F are sequence logos, which are graphical representations of an amino acid or nucleic acid multiple sequence alignment. The logo is a sequence of stacks of letters, one stack for each position in the amino acid sequence alignment. The overall height of the stack indicates the sequence conservation at that position, while the height of symbols within the stack indicates the relative frequency of each amino or nucleic acid at that position. Similar to a stacked bar graph, where the one-letter code of the amino acid is used instead of a colored bar. The width of the stack is proportional to the fraction of missing sequences at that position. It is noted that many of the MHC molecules do not contain full sequences. Thinner letters mean that some sequences are missing information for that region. In these depictions, the width of the letters shouldn't matter overly. In some embodiments, the guidance is focused on those sections from parts that have deeper sequencing coverage.
References
[0336] All references are incorporated by reference in their entireties.
[0337] Shankar an, V. et al. IFNgamma and lymphocytes prevent primary tumour development and shape tumour immunogenicity. Nature 410, 1107-1111, doi: 10.1038/35074122 (2001).
[0338] Lollini, P. L., Cavallo, F., Nanni, P. & Forni, G. Vaccines for tumour prevention. Nature reviews. Cancer 6, 204-216, doi:10.1038/nrcl815 (2006). [0339] Leach, D. R., Krummel, M. F. & Allison, J. P. Enhancement of antitumor immunity by CTLA-4 blockade. Science 271, 1734-1736 (1996).
[0340] Dong, H. et al. Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nature medicine 8, 793-800, doi: 10.1038/nm730 (2002).
[0341] Yee, C. et al. Adoptive T cell therapy using antigen-specific CD8+ T cell clones for the treatment of patients with metastatic melanoma: in vivo persistence, migration, and antitumor effect of transferred T cells. Proceedings of the National Academy of Sciences of the United States of America 99, 16168-16173, doi: 10.1073/pnas.242600099 (2002).
[0342] Davis, M. M. & Bjorkman, P. J. T-cell antigen receptor genes and T-cell recognition. Nature 334, 395-402, doi: 10.1038/334395a0 (1988).
[0343] Weiss, A. & Littman, D. R. Signal transduction by lymphocyte antigen receptors. Cell 76, 263-274 (1994).
[0344] Bethune, M. T. & Joglekar, A. V. Personalized T cell-mediated cancer immunotherapy: progress and challenges. Curr Opin Biotechnol 48, 142-152, doi: 10.1016/j .copbio.2017.03.024 (2017).
[0345] Woodsworth, D. J., Castellarin, M. & Holt, R. A. Sequence analysis of T- cell repertoires in health and disease. Genome Med 5, 98, doi: 10.1186/gm502 (2013).
[0346] Buchholz, V. R., Schumacher, T. N. & Busch, D. H. T Cell Fate at the Single-Cell Level. Annual review of immunology 34, 65-92, doi: 10.1146/annurev-immunol- 032414-112014 (2016).
[0347] Klenerman, P., Cerundolo, V. & Dunbar, P. R. Tracking T cells with tetramers: new tales from new tools. Nature reviews. Immunology 2, 263-272, doi: 10.1038/nri777 (2002).
[0348] Castle, J. C. et al. Exploiting the mutanome for tumor vaccination. Cancer research 72, 1081-1091, doi: 10.1158/0008-5472.CAN-11-3722 (2012).
[0349] Boon, T. & van der Bruggen, P. Human tumor antigens recognized by T lymphocytes. The Journal of experimental medicine 183, 725-729 (1996).
[0350] Matsushita, H. et al. Cancer exome analysis reveals a T-cell-dependent mechanism of cancer immunoediting. Nature 482, 400-404, doi: 10.1038/naturel0755 (2012).
[0351] Gee, M. H. et al. Antigen Identification for Orphan T Cell Receptors Expressed on Tumor-Infiltrating Lymphocytes. Cell 172, 549-563 e516, doi: 10.1016/j.cell.2017.11.043 (2018). [0352] Birnbaum, M. E. et al. Deconstructing the Peptide-MHC Specificity of T Cell Recognition. Cell 157, 1073-1087, doi: 10.1016/j.cell.2014.03.047 (2014).
[0353] Yu, Y. Y., Netuschil, N., Lybarger, L., Connolly, J. M. & Hansen, T. H. Cutting edge: single-chain trimers of MHC class I molecules form stable structures that potently stimulate antigen-specific T cells and B cells. Journal of immunology 168, 3145- 3149 (2002).
[0354] Morgan, R. A. et al. Cancer regression in patients after transfer of genetically engineered lymphocytes. Science 314, 126-129 (2006).
[0355] Joglekar, A. V. et al. T cell receptors for the HIV KK10 epitope from patients with differential immunologic control are functionally indistinguishable. Proceedings of the National Academy of Sciences of the United States of America 115, 1877-1882, doi: 10.1073/pnas.l718659115 (2018).
[0356] Bennett, M. S., Joseph, A., Ng, H. L., Goldstein, H. & Yang, O. O. Fine- tuning of T-cell receptor avidity to increase HIV epitope variant recognition by cytotoxic T lymphocytes. Aids 24, 2619-2628, doi:10.1097/QAD.0b013e32833f7b22 (2010).
[0357] Sahin, U. et al. Personalized RNA mutanome vaccines mobilize poly- specific therapeutic immunity against cancer. Nature 547, 222-226, doi: 10.1038/nature23003 (2017).
[0358] Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows- Wheeler transform. Bioinformatics 25, 1754-1760, doi: 10.1093/bioinformatics/btp324 (2009).
[0359] Vita, R. et al. The immune epitope database (IEDB) 3.0. Nucleic acids research 43, D405-412, doi: 10.1093/nar/gku938 (2015).
[0360] Yokomaku, Y. et al. Impaired processing and presentation of cytotoxic-T- lymphocyte (CTL) epitopes are major escape mechanisms from CTL immune pressure in human immunodeficiency virus type 1 infection. Journal of virology 78, 1324-1332 (2004).
[0361] Dorrell, L. et al. Distinct recognition of non-clade B human immunodeficiency virus type 1 epitopes by cytotoxic T lymphocytes generated from donors infected in Africa. Journal of virology 73, 1708-1714 (1999).
[0362] Peakman, M. et al. T cell clones generated from patients with type 1 diabetes using interleukin-2 proliferate to human islet antigens. Autoimmunity 17, 31-39 (1994). [0363] Tang, Q. & Bluestone, J. A. The Foxp3+ regulatory T cell: a jack of all trades, master of regulation. Nature immunology 9, 239-244, doi: 10.1038/nil572 (2008).
[0364] Garcia, K. C. et al. Structural basis of plasticity in T cell receptor recognition of a self peptide-MHC antigen. Science 279, 1166-1172 (1998).
[0365] Taguchi, T. et al. Detection of individual mouse splenic T cells producing IFN-gamma and IL-5 using the enzyme-linked immunospot (ELISPOT) assay. Journal of immunological methods 128, 65-73 (1990).
[0366] Suwandi, J. S., Nikolic, T. & Roep, B. O. Translating Mechanism of Regulatory Action of Tolerogenic Dendritic Cells to Monitoring Endpoints in Clinical Trials. Frontiers in immunology 8, 1598, doi: 10.3389/fimmu.2017.01598 (2017).
[0367] Bentzen, A. K. & Hadrup, S. R. Evolution of MHC-based technologies used for detection of antigen-responsive T cells. Cancer immunology, immunotherapy : CII 66, 657-666, doi: 10.1007/s00262-017-1971-5 (2017).
[0368] Tran, E. et al. Cancer immunotherapy based on mutation-specific CD4+ T cells in a patient with epithelial cancer. Science 344, 641-645, doi: 10.1126/science. l251102 (2014).
[0369] Bassani-Sternberg, M. et al. Direct identification of clinically relevant neoepitopes presented on native human melanoma tissue by mass spectrometry. Nature communications 7, 13404, doi: 10.1038/ncomms 13404 (2016).
[0370] Roep BO (2003) The role of T-cells in the pathogenesis of Type 1 diabetes: from cause to cure. Diabetologia 46(3):305-321.
[0371] Sharma G & Holt RA (2014) T-cell epitope discovery technologies. Human immunology 75(6):514-519.
[0372] Bentzen AK & Hadrup SR (2017) Evolution of MHC-based technologies used for detection of antigen-responsive T cells. Cancer immunology, immunotherapy : CII 66(5):657-666.
[0373] Pike KA, Hui C, & Krawczyk CM (2016) Detecting Secreted Analytes from Immune Cells: An Overview of Technologies. Methods in molecular biology 1458: 111- 124.
[0374] Nepom GT, et al. (2002) HLA class II tetramers: tools for direct analysis of antigen-specific CD4+ T cells. Arthritis and rheumatism 46(1):5-12. [0375] Arif S, et al. (2004) Autoreactive T cell responses show proinflammatory polarization in diabetes but a regulatory phenotype in health. The Journal of clinical investigation 113(3):451-463.
[0376] Van Lummel M, et al. (2012) Type 1 diabetes-associated HLA-DQ8 transdimer accommodates a unique peptide repertoire. The Journal of biological chemistry 287(12):9514-9524.
[0377] Kracht MJ, et al. (2017) Autoimmunity against a defective ribosomal insulin gene product in type 1 diabetes. Nature medicine 23(4):501-507.
[0378] Beringer DX, et al. (2015) T cell receptor reversed polarity recognition of a self-antigen major histocompatibility complex. Nature immunology 16(11):1153-1161.
[0379] Alhadj Ali M, et al. (2017) Metabolic and immune effects of immunotherapy with proinsulin peptide in human new-onset type 1 diabetes. Science translational medicine 9(402).
Next Patent: A METHOD OF INTRACELLULAR DELIVERY