CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority to and the benefit of U.S. provisional patent application serial number 61/758,648 filed on January 30, 2013, and U.S. provisional patent application serial number 61/911,421 filed on December 3, 2013, the disclosures of which are incorporated herein by reference in their entirety.

STATEMENT OF GOVERNMENT SUPPORT

[0001] This invention was made with Government support under Grant No. AI083432 and AI088393, awarded by the National Institutes of Health. The Government has certain rights in the invention.

INTRODUCTION

[0002] The function of Ca ²⁺ -Release-Activated-Ca ²⁺ (CRAC) channels is crucial for activation of immune cells. Ca ²⁺ entry via CRAC channels triggers the downstream signaling cascades such as calcineurin and a transcription factor, NFAT to turn on the transcription event such as cytokine production in immune cells. Because of its role in immune responses, activation of the CRAC channel activity is a seminal event in the etiology of autoimmune diseases and blocking this activity can be used to treat undesired autoimmune responses such as those arising with autoimmune diseases such as rheumatoid arthritis, multiple sclerosis, type I diabetes, and inflammatory bowel disease as well as with organ transplantation. [0003] The importance of the CRAC channel-calcineurin-NFAT pathway has been emphasized by the common use of cyclosporin A and FK506 as immunosuppressant that block the calcineurin activity. However, because calcineurin is ubiquitously important for most of cell types, application of cyclosporin A and FK506 can have a broad side effect. CRAC channels are made of homomultimers of Orail and current specifically carried by these homomultimers is detected predominantly only in the immune cells. Hence a specific blocker of CRAC channels is unlikely to have the same negative side effects observed with cyclosporine A and FK506.

[0004] Because of the ubiquitous expression of calcineurin, there is a need in the art for methods and compositions that specifically block the CRAC channel without inhibiting calcineurin. SUMMARY

[0005] Methods and compositions of this disclosure relate to suppressing Ca ²⁺ -Release-

Activated-Ca ²⁺ (CRAC) channel activity using novel compounds of Formula I:

Formula I

or a pharmaceutically acceptable salt thereof, wherein

R is selected from the group consisting of aryl, heteroaryl, substituted aryl, and substituted heteroaryl;

R ^J and R ² are independently selected from the group consisting of hydrogen and CX ₃ or R and R ² together form a carbonyl or thiocarbonyl;

each X is selected from the group consisting of CI, F and Br;

L is selected from the group consisting of a covalent bond and Ci-C ₆ alkylene; and

R ³ is selected from the group consisting of aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl and substituted heteroaryl;

wherein the IC ₅₀ of the compound is less than 10 μΜ. As used herein and unless specifically excluded, when reference is made to Formula I, the pharmaceutically acceptable salt thereof is also intended.

[0006] Compounds of Formula I have been shown to inhibit the activities of CRAC. The function of the CRAC channel is important for the immune response and is largely limited to cells of the immune system. Accordingly, in one aspect, there is provided a method for suppressing an immune response in a mammal in need thereof comprising administering to the mammal a compound of Formula I in an amount sufficient to suppress said immune response. [0007] Another aspect of this invention relates to a method for modulating calcium transport through the CRAC channel so as to modulate the immune response of an immune cell by contacting said immune cell with a therapeutically effective amount of a compound of Formula I so as to modulate the immune response. The contacting can be in vitro or in vivo. [0008] Also provided are pharmaceutical compositions useful for suppressing an immune response comprising a compound of Formula I as described herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0009] FIG. la-c depict the immunosuppressive activity of the compound N-[2,2,2- trichloro- 1 -(2 -naphthylamino)ethyl]-2-furamide (compound 5D). FIG. la, shows the IC50 value of the compound N-[2,2,2-trichloro-l-(2-naphthylamino)ethyl]-2-furamide to block Ca2+ entry in T cells as 195 nM. FIG. lb demonstrates that N-[2,2,2-trichloro-l-(2- naphthylamino)ethyl]-2-furamide blocks the cytokine production of T cells and T cell activation/proliferation in FIG. lc. [0010] FIG. 2a-c depict development of high throughput screening system using NFAT translocation as readout. HeLa-OSN cells are a cell-line that harbors amplified CRAC currents by overexpression of Orail and STIM1, the components of CRAC channels (a). Comparing plain HeLa cells, these cells show much higher Ca2+ entry levels mediated by CRAC channels. In these cells, also we stably expressed NFAT1-460-GFP to use as readout for the screen. NFAT is a transcription factor that is activated by CRAC channels and translocates from the cytoplasm into the nuclei (b). By measuring NFAT accumulation in the nuclei, we can monitor CRAC channel activity. The known CRAC channel blocker, 2-APB was used as a positive control for the screen. The calculated Z' factor was 0.692 meaning that our design was suitable for high throughput screen (c). [0011] FIG. 3 depicts compounds identified in the chemical library screen.

[0012] FIG. 4 shows the structure of N-[2,2,2-trichloro-l-(l-naphthylamino)ethyl]-2- thiophenecarboxamide and analogues that were tested.

[0013] FIG. 5a-b demonstrate that the compound 5d can block CRAC current by electrophysiology. The graphs are plotted as current- voltage relation (a) and versus time (b). [0014] FIG. 6a-e demonstrate the therapeutic potential of the compound 5d and 5j-4 using an animal model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE) was further tested. In this model, the disease can be induced by T cell attack of central nervous system (e.g. brain and spinal cord) to mimic multiple sclerosis. The severity of the disease and attack of T cells is decreased by treatment of the compound N-[2,2,2-trichloro-l- (2-naphthylamino)ethyl]-2-furamide (compound 5D) (a). These results were obtained by H&E staining of T cells in the spinal cord and isolation and counting of infiltrated T cells from the central nervous system (b). In addition, the therapeutic potential of N-{[(6-hydroxy- l-naphthyl)amino]carbonothioyl}-2-furamide (compound 5J-4) was tested and it was found to have a better suppressive effect on the onset and severity of the diseases considering the reduced disease severity (c) and the infiltrated T cell number to the central nervous system (d and e). The infiltrated T cell number was determined after isolation of mononuclear cells from the spinal cord and the frequency of CD4+ T cells (helper T cells) among the isolated cells was determined by surface staining of CD4 and analysis by flow cytometry.

[0015] FIG. 7a-c show the development of a high throughput system to screen chemical libraries, (a) Development of a cell-line with enhanced Orail -mediated store-operated Ca ²⁺ entry (SOCE) to facilitate chemical library screening. HeLa cells were retrovirally transduced with vectors encoding Orail and STIM1 (HeLa-O+S) and examined for SOCE after intracellular store depletion with thapsigargin (1 μΜ). Orail -mediated SOCE was inhibited by 2-APB (100 μΜ). The influx rate, peak, and sustained levels of intracellular Ca ²⁺ concentrations were calculated, (b) Enhanced sustained levels of Ca ²⁺ are observed in HeLa- O+S cells. Raw images acquired at peak (600 sec) and later time point (900 sec) of SOCE measurements (depicted in panel (a)) from HeLa and HeLa O+S cells. Warmer colors indicate higher intracellular Ca ²⁺ concentrations ([Ca ²⁺ ];). (c) Development of NFAT translocation as readout for high throughput screen. HeLa-O+S cells expressing NFATc2 (1- 460)-GFP (HeLa-OSN) were left untreated (-TG) or treated with thapsigargin (+TG, 1 μΜ, 30 min) with and without 2-APB and analyzed by microscopy. The scores were computed based on overlap between GFP and nuclear staining with DAPI.

[0016] FIG. 8a-f show the identification of compound 5D as a small molecule blocker of CRAC channels, (a) Development of NFAT translocation as readout for high throughput screen. HeLa cells stably expressing Orail, STIM1, and NFATc2 (l-460)-GFP, were left untreated (-TG) or treated with thapsigargin (+TG, 1 μΜ, 30 min) with and without 2-APB. These cells were analyzed by microscopy for nuclear NFAT-GFP (left) or immunoblotting to examine dephosphorylation of NFAT with anti-GFP antibody (right). P, phosphorylated; deP, dephosphorylated; WB, western blotting, (b) Chemical structures of compound 5 and its structural analogue compound 5D. (c) Dose-dependent block of endogenous SOCE in primary murine effector T cells after exposure to compound 5D. Each trace represents average ± s.e.m from 50-60 primary T cells. The graph on the right shows dose-dependent block of sustained [Ca ²⁺ ]iby compound 5D with the indicated half-max (IC ₅₀ ). (d) Inhibition of CRAC currents by compound 5D. Measurement of CRAC currents from HEK293 cells co- expressing Orail and STIM1 (black trace). Cells were exposed to compound 5D (10 μΜ) by either intracellular (green trace) or extracellular (red trace) application. Representative I-Vs from at least four different cells in each condition are depicted, (e) Schematic of Orail . Orail contains four transmembrane segments (TM1-TM4) with its N- and C-termini facing the cytoplasm, and two extracellular loops (ECl and EC2). Residues L95, VI 02 and El 06 in TM1 directly line the ion permeation pathway and VI 02 has been proposed to form the gate of the CRAC channel (marked in red). The D ¹¹⁰ xD ¹¹² xD ¹¹⁴ motif in the ECl is important for ion selectivity of the channel and mutation of W176 in TM3 makes the channel constitutively open, (f) Compound 5D-mediated block of SOCE induced by various mutants of Orail . SOCE measurements and its block by compound 5D from Orail ^"7" murine embryonic fibroblasts (MEFs) transduced with retroviruses encoding either wild-type (WT) or indicated mutants of Orail . Residues deleted in the second extracellular loop (AEC) are described in Methods. Data represent average ± s.e.m from 25-35 fibroblasts and are normalized to the block of wild-type Orail . The blocking effect of compound 5D on constitutively active channels such as W176C, V102A, and V102C was measured without store depletion. [0017] FIG. 9 shows structural analogues of compound 5 used in this study. Chemical structures of analogues of compound 5 examined for their potency in blocking SOCE. The structures of known CRAC channel blockers, 2-APB and SFK96365 are also presented in a dotted box. Boxed areas highlight divergent side chains.

[0018] FIG. lOa-g are the characterization of the inhibitory activity of compound 5D on CRAC channels, (a) Comparison of the inhibitory effects of compound 5 (10 μΜ) and 5D (1 μΜ) on CRAC channel activity in HeLa-OSN cells, (b) Measurement of nuclear translocation of NFAT in HeLa-OSN cells left untreated (-TG) or treated with thapsigargin (+TG, ΙμΜ, 30 min) in the presence of 100 μΜ 2-APB or 10 μΜ compound 5D. Cells were fixed, stained with DAPI to label the nuclei, and imaged, (c) TIRF microscopy analysis of HEK293 cells expressing STIMl-mCherry and Orail -GFP in the presence of DMSO (left three panels) or compound 5D (10 μΜ, right three panels). 1 μΜ thapsigargin was added to deplete the intracellular stores (t = 0) and epifluorescence (top panels) and TIRF (lower two panels) images of STIM1 and Orail clustering into ER-PM junctions are shown before and after store depletion, (d) The graphs represent an average of normalized fluorescence intensity ± s.e.m. of STIMl-mCherry (left panel) and Orail -GFP (right panel) from measurements of 5 cells treated with (blue traces) and without (black traces) compound 5D (10 μΜ). (e) Compound 5D blocks currents generated by Orail ^wl76C . Measurement of currents from HEK293 cells expressing Orail ^wl76C (in the absence of STIM1). I-Vs were plotted in the absence (black trace), presence (red trace) or after washing out (green trace) of 10 μΜ compound 5D. Each trace is representative of data obtained from six different cells, (f) Compound 5D marginally blocks currents generated by Orail ^vl02C . I-V relationship of currents from HEK293 cells expressing Orail ^vl02C (without STIM1) in the absence (black trace) and presence (blue trace) of 20 μΜ compound 5D. Each trace is representative of data obtained from 8-10 different cells, (g) Block of currents generated by Orail ^V102 mutants by compound 5D. Inhibition of currents generated by Orail ^vl02C (n = 8) and Orail ^vl02A (n = 4) mutants by 20 μΜ compound 5D. Data represent average ± s.e.m and are normalized to block of wild-type Orail .

[0019] FIG. lla-c demonstrate that compound 5D inhibits SOCE and cytokine production in effector T cells, (a) Measurement of CRAC channel activity in naive and indicated effector T cells in the absence and presence of 1 or 10 μΜ of compound 5D. Data represent average ± s.e.m of peak SOCE from 40-60 cells and are normalized to SOCE in the absence of compound 5D. (b) Compound 5D-mediated inhibition of IL-17 production. Na ^' ive T cells cultured under TnlV-polarizing conditions and re-stimulated with PMA and ionomycin with different concentrations of compound 5D or DMSO (vehicle) were examined for IL-17A and IFN-γ production, (c) Compound 5D-mediated inhibition of cytokine production by T _H 1, T _H 2, and T _H 17 cells. Na ^' ive T cells cultured under Τ _Η 1-, T _H 2-, or T _H 17-polarizing conditions were stimulated with PMA and ionomycin after 4 days in the presence of different concentrations of compound 5D and examined for cytokine expression using intracellular staining. Data were normalized to cytokine levels of cells treated with DMSO.

[0020] FIG. 12a-c show that inhibition of CRAC channels reduces cytokine production and differentiation of effector T cells, (a) Compound 5D affects T cell differentiation. Na ^' ive T cells differentiated under T _H 1, T _H 2, and T _H 17-polarizing conditions in the absence or presence of compound 5D (15 μΜ) for four days were re-stimulated with PMA and ionomycin for 6 hrs (without compound 5D) and stained for indicated cytokines, (b)

Compound 5D-mediated reduction in the expression of cytokines and transcription factors in T cells. Na ^' ive T cells differentiated under T _H 1, T _H 2, and T _H 17-polarizing conditions with compound 5D were washed, restimulated with PMA plus ionomycin, and harvested for examination of the mRNA expression levels of IFN-γ (T _H 1 cells), IL-4 (T _H 2 cells), and IL- 17A (T _H 17 cells) (left panel). In addition, the mRNA levels of T-bet, GATA-3, RORyt, and RORa were measured using quantitative PCR under T _H 1, T _H 2, and T _H 17-polarizing conditions, respectively (right panel). *P<0.05, ***P<0.0005. (c) Compound 5D-mediated block of expansion and maintenance of pre-differentiated T _H 17 cells. Cells were collected from draining lymph nodes of mice 7 days after immunization with MOG ₃₅ _5s/CFA and cultured for four days with MOG ₃₅ -55 peptide together with IL-12 or IL-23 in the presence of DMSO or 10 μΜ of compound 5D. CD4 ⁺ T cells were examined for IL-17A and IFN-γ production after stimulation with PMA and ionomycin using intracellular staining. [0021] FIG. 13a-c show the expression levels of molecules involved in T _H 17 pathogenicity and differentiation in compound 5D-treated T cells, (a) The mRNA expression levels of IL- 23R, CCR6, and LFA-1 (Integrin aL) from na ^' ive T cells cultured under T _H 17-skewing conditions in the presence or absence of compound 5D. The transcript levels were normalized to those of DMSO-treated cells. Data represent average ± s.d.m. from triplicates, (b) The mRNA expression levels of various transcription factors important for T _H 17 differentiation. Transcripts were analyzed from na ^' ive T cells cultured under T _H l7-polarizing conditions in the presence or absence of 10 μΜ of compound 5D. The mRNA levels were normalized to that of β-actin. Data represent average ± s.d.m. from triplicates, (c) Compound 5D treatment reduces IL-17A production irrespective of blocking proliferation. CFSE-labeled na ^' ive cells differentiated under T _H l7-polarizing conditions with compound 5D were examined for IL- 17A production in each division after 3 days of stimulation. Line graph below shows average ± s.d.m. from 3 independent experiments.

[0022] FIG. 14a-d show that Ca ²⁺ signalling mediated by Orail is important for NFAT- mediated expression of RORa and RORyt in T _R 17 cells, (a) Recovery of IL-17A ⁺ population by expression of RORa and RORyt in compound 5D-treated cells. Na ^' ive T cells cultured under T _H 17-polarizing conditions with compound 5D were transduced with retroviruses encoding RORa or RORyt, and examined for IL-17A production on day 4. Line graph on the right shows average ± s.e.m of IL-17A ⁺ population from four independent experiments, (b) Cyclosporin A (CsA) treatment suppresses expression of IL-17A, RORa, and RORyt. Na ^' ive T cells were cultured under T _H 17-polarizing conditions with 5 nM cyclosporine A (CsA) for four days, washed, restimulated with PMA and ionomycin, and examined for production of IL-17A (top) and mRNA levels of RORa or RORyt (bottom). Data are representative of three independent experiments. Transcript analysis shows average ± s.d.m. (c) Expression of constitutively active NFAT rescues compound 5D-mediated inhibition of T _R 17

differentiation. Na ^' ive T cells cultured under T _H 17-polarizing conditions with different concentrations of compound 5D were transduced with retroviruses encoding constitutively active NFATc2 (CA-NFAT), and examined for IL-17A production and RORyt expression on day 4 using intracellular staining (left two panels). The same cells were also used for mRNA expression analysis of RORa or RORyt using quantitative PCR (right two panels), (d) ChlP-PCR analysis of NFAT recruitment and acetylation of histone H3K9/14 at the promoters of RORa or RORyt. Real-time PCR quantification of RORa and RORyt promoters (RORap and RORytp) sequences after ChIP with antibody to NFATc2 (left two panels) and acetylated H3K9 and H3K14 (H3K9/14Ac, right two panels) in DMSO and compound 5D- treated cells after stimulation with anti-CD3 and anti-CD28 antibodies for 16 hours under TnlV-polarizing conditions. Data were normalized to the mean ChIP recovery of all experiments. *P<0.05, **P<0.005, ***P<0.0005.

[0023] FIG. 15a-e demonstrate that Orail ^"7" T cells show a defect in T _R 17 differentiation similar to that observed in compound 5D-treated cells, (a) Orail ^"7" T cells show a defect in IL- 17 production. Naive CD4 ⁺ T Cells were stimulated and cultured under T _H 17-polarizing conditions, restimulated with PMA and ionomycin after four days, and examined for IL-17A expression, (b) Real-time PCR quantification of the mRNA levels of RORa and RORyt in control and Orail ^"7" T cells after stimulation with anti-CD3 and anti-CD28 antibodies under T _H l7-polarizing conditions for four days, (c) The mRNA expression analyses in Orail ^"7" T cells cultured under T _H 17-polarizing conditions. WT and Orail ^"7" na ^' ive T cells cultured for four days were stimulated with PMA and ionomycin, and analyzed by quantitative RT-PCR for expression of indicated genes, (d) Expression of CA-NFAT partially rescues T _H 17 differentiation defect in Orail ^"7" T cells. WT and Orail ^"7" na ^' ive T cells differentiated under T _H 17-polarizing conditions were transduced with retroviruses encoding CA-NFAT, and examined for mRNA expression of RORa or RORyt (top panels) and IL-17A production (lower panels), (e) ChlP-PCR analysis of NFAT recruitment into the promoters of RORa or RORyt. Real-time PCR quantification of RORa and RORyt promoter (RORap and RORytp) sequences after ChIP recovery with antibody to NFATc2 in control and Orail ^"7" T cells left unstimulated (na ^' ive) or after stimulation with anti-CD3 and anti-CD28 antibodies for 16 hours under T _H l7-polarizing conditions. Data were normalized to the mean ChIP recovery of all experiments. **P<0.005, ***P<0.0005.

[0024] FIG. 16a-b show the chemical structures of compound 5D analogues and their blocking efficacy on SOCE. (a) Chemical structures of analogues of compound 5D with substitution of the -CI ₃ side chain, (b) Measurement of block of SOCE by compound 5J-4 in HeLa-OSN cells (left panel) or primary T _R 17 cells (right panel). In all the graphs data represent average ± s.e.m. from 25-35 different cells. [0025] FIG. 17a-f show that a structural analogue of compound 5D, 5J-4 ameliorates T _R 17- mediated autoimmune disease, (a) Chemical structures of compound 5D and its analogue, compound 5J-4. (b) Compound 5J-4 ameliorates symptoms of experimental autoimmune encephalomyelitis (EAE) in vivo. EAE disease course in mice injected intraperitoneally with either DM SO or compound 5 J-4 (2 mg/kg) every alternate day starting from day 0 after disease induction with MOG ₃₅ - ₅₅ /CFA. The graph shows average ± s.e.m. from one of three independent repeats of the experiments with 10-20 mice per trial, (c) Compound 5 J-4 reduces infiltration of T cells into the spinal cord when administered in vivo. Representative histological sections of spinal cords from control and compound 5J-4-injected mice. Arrows depict sites of infiltration of mononuclear cells, (d) Compound 5 J-4 decreases MOG ₃₅ - ₅₅ peptide-responding T cells in the draining lymph nodes after immunization. Cells were isolated from the draining lymph nodes (dLNs) of control and compound 5 J-4-treated mice after 14 days of immunization and MOG ₃₅ - ₅₅ peptide-responding T cells were estimated by thymidine incorporation after incubation with the peptide. The graph shows average ± s.d.m. from triplicates, (e) Compound 5J-4 treatment decreases T _R 17 differentiation in vivo.

Expression levels of RORa, RORyt, and IL-17A were measured in the cells isolated from the draining lymph nodes of DMSO and compound 5J-4-treated mice after 14 days of

immunization with MOG ₃₅ _ ₅₅ peptide/CFA. Non-immunized mice were used as negative controls (no EAE). The graph shows average ± s.d.m. from triplicates, (f) Suppression of expansion and maintenance of pre-differentiated human T _R 17 cells by inhibition of Orail activity. Human PBMCs were harvested, stimulated with anti-CD3 and anti-CD28 antibodies, and cultured with IL-Ιβ and IL-23 in the presence of DMSO or 20 μΜ of compound 5D. CD4 ⁺ T cells were restimulated with PMA and ionomycin at day 6 and examined for IL-17A and IFN-γ production using intracellular staining. The graph shows results from eight donors. [0026] FIG. 18a-b demonstrate that compound 5J-4 inhibits T cell infiltration into the central nervous system, (a) Compound 5 J-4 reduces infiltration of mononuclear cells into the CNS when administered in vivo. Mononuclear cells purified from the central nervous system of control and compound 5 J-4-treated mice were counted (left) or examined for frequency (middle) and numbers (right) of CD4 ⁺ T cells. Each symbol represents data from an individual animal (n = 5). ** P<0.005, ***P<0.0005. (b) Reduced IL-17A production by cells isolated from CNS of EAE -induced mice treated with compound 5 J-4. Each symbol represents data from an individual animal (n = 5). [0027] FIG. 19 shows the induction of regulatory T cells by Orail deficiency. Na ^' ive CD4 ⁺ CD25 ^~ T cells were purified and stimulated in the indicated conditions, non-skewing, TGF-β, or TGF-β with different concentrations of IL-6. After four days of stimulation, Foxp3 expression was measured by intracellular staining in control and Orail -deficient T cells. [0028] FIG. 20 shows the induction of regulatory T cells by treatment of a small molecule blocker of Orail, SKF96365. Na ^' ive CD4 CD25 T cells were purified and stimulated in the indicated conditions with different concentrations of TGF-β. After four days of stimulation, Foxp3 expression was measured by intracellular staining in non-treated and SKF96365- treated CD4 ⁺ CD25 ⁺ cells. Please note that SKF96365 -treated cells contain higher levels of Foxp3 and functionally more active in their suppression activity (data not shown).

[0029] FIG. 21 shows the increased natural regulatory T cells in Orail-null mice. Cells from the thymus, lymph nodes, and spleen of control and Orail-null mice were isolated and stained for CD4, CD25, and Foxp3 to determine the population of regulatory T cells. The cells were gated for CD4 ⁺ populations. [0030] FIG. 22 (right and left panels) show the reduced autoimmune disease symptoms of SKF96365 -treated mice. The EAE symptoms of control and SKF96365 -treated mice were compared (left). SKF96365 was treated in an alternate day between day 5 and 20.

Importantly, SKF96365-treted mice were tolerant for further repetitive immunization to induce autoimmune disease (data not shown). A single injection of SKF96365 at day 5 and one day earlier of immunization (day-1) dramatically ameliorate the symptoms of EAE (right).

DEFINITIONS

[0031] Before the compositions and methods are described, it is to be understood that the invention is not limited to the particular methodologies, protocols, cell lines, assays, and reagents described, as these may vary. It is also to be understood that the terminology used herein is intended to describe particular embodiments of the present invention, and is in no way intended to limit the scope of the present invention as set forth in the appended claims.

[0032] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods, devices, and materials are now described. All technical and patent publications cited herein are incorporated herein by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

[0033] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3 ^rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) PCR 1 : A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5 ^th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid

Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987)

Immunochemical Methods in Cell and Molecular Biology (Academic Press, London);

Herzenberg et al. eds (1996) Weir's Handbook of Experimental Immunology; Manipulating the Mouse Embryo: A Laboratory Manual, 3 ^rd edition (Cold Spring Harbor Laboratory Press (2002)).

[0034] As used herein, certain terms may have the following defined meanings. As used in the specification and claims, the singular form "a," "an" and "the" include singular and plural references unless the context clearly dictates otherwise.

[0035] The term "comprising" is intended to mean that the compounds and methods include the recited elements, but not excluding others. "Consisting essentially of when used to define compositions and methods, shall mean excluding other elements of any essential significance to the compounds or methods. "Consisting of shall mean excluding more than trace elements of other ingredients for claimed compounds and substantial method steps. Embodiments defined by each of these transitional terms are within the scope of this invention. Accordingly, it is intended that the processes and compositions can include additional steps and components (comprising) or alternatively include additional steps and compounds of no significance (consisting essentially of) or alternatively, intending only the stated methods steps or compounds (consisting of).

[0036] Mammals include, but are not limited to, murines, rats, rabbits, simians, bovines, ovines, porcines, canines, felines, farm animals, sport animals, pets, equines, and primates, particularly humans.

[0037] Subjects include, but are not limited to, mammals, patients, laboratory animals, and the like.

[0038] As used herein, "treating" or "treatment" of a disease, disorder, symptom or condition will depend on the disease, disorder, symptom or condition to be treated, and the mammal to be treated. In general, treatment intends one or more of inhibiting the progression of the manifested disease, disorder, symptom or condition as measured by clinical or subclinical parameters (where the term "inhibiting" or "inhibition" is intended to be a subset of "treating" or "treatment"), arresting the development of the disease, disorder, symptom or condition as measured by clinical or sub-clinical parameters, ameliorating or causing regression of the disease, disorder, symptom or condition as measured by clinical or subclinical parameters, or reducing pain or discomfort for the mammal treated as measured by clinical and/or pharmacological parameters.

[0039] As used herein, "inhibit," "inhibiting," "reduce" or "reducing" or any variation of these terms includes any measurable decrease or complete inhibition to achieve a desired result.

[0040] As used herein, a "therapeutically effective amount" or an "effective amount" is used synonymously with and intends an amount sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications, or dosages. [0041] As used herein, the term in vitro administration refers to manipulations performed on cells removed from or outside of a subject, including, but not limited to cells in culture.

[0042] The term in vivo administration includes all manipulations performed within a subject, including administrations.

[0043] "Aryl" or refers to a monovalent aromatic carbocyclic group of from 6 to 14 carbon atoms having a single ring {e.g., phenyl) or multiple condensed rings {e.g., naphthyl or anthryl) which condensed rings may or may not be aromatic {e.g., 2-benzoxazolinone, 2H-l,4-benzoxazin-3(4H)-one-7-yl, and the like) provided that the point of attachment is at an aromatic carbon atom. Preferred aryl groups include phenyl and naphthyl.

[0044] "Substituted aryl" refers to aryl groups which are substituted with 1 to 5, preferably 1 to 3, or more preferably 1 to 2 substituents selected from the group consisting of alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminocarbonyl, aminothiocarbonyl, aminocarbonylamino, aminothiocarbonylamino, aminocarbonyloxy, aminosulfonyl, aminosulfonyloxy, amino sulfonylamino, amidino, aryl, substituted aryl, aryloxy, substituted aryloxy, arylthio, substituted arylthio, carboxyl, carboxyl ester, (carboxyl ester)amino, (carboxyl ester)oxy, cyano, cycloalkyl, substituted cycloalkyl, cycloalkyloxy, substituted cycloalkyloxy, cycloalkylthio, substituted cycloalkylthio, cycloalkenyl, substituted cycloalkenyl, cycloalkenyloxy, substituted cycloalkenyloxy, cycloalkenylthio, substituted cycloalkenylthio, guanidino, substituted guanidino, halo, hydroxy, heteroaryl, substituted heteroaryl, heteroaryloxy, substituted heteroaryloxy, heteroarylthio, substituted heteroarylthio, heterocyclic, substituted heterocyclic, heterocyclyloxy, substituted

heterocyclyloxy, heterocyclylthio, substituted heterocyclylthio, nitro, S0 ₃ H, substituted sulfonyl, substituted sulfonyloxy, thioacyl, thiol, alkylthio, and substituted alkylthio, wherein said substituents are as defined herein.

[0045] The term "heteroaryl" refers to a monovalent, aromatic ring having 6-14 ring carbon atoms and 1-6 ring heteroatoms selected preferably from N, O, S, and P. Nonlimiting examples of heteroaryl include furan, imidazole, pyridine, quinoline, and the like.

[0046] "Substituted heteroaryl" refers to heteroaryl groups that are substituted with from 1 to 5, preferably 1 to 3, or more preferably 1 to 2 substituents selected from the group consisting of the same group of substituents defined for substituted aryl. [0047] "Carbonyl" refers to the divalent group -C(O)- which is equivalent to -C(=0)-.

[0048] "Thiocarbonyl" refers to the divalent group -C(S)- which is equivalent to -C(=S)-.

[0049] "Alkylene" refers to a linear or branched saturated divalent hydrocarbon radical. In particular, "Ci-C6-alkylene", means a linear saturated divalent hydrocarbon radical of one to six carbon atoms or a branched saturated divalent hydrocarbon radical of three to six carbon atoms, e.g. methylene, ethylene, 2,2-dimethylethylene, n-propylene, 2-methylpropylene, 1- methyl-ethylene, 2-methyl-ethylene and the like. [0050] "Cycloalkyl" refers to a divalent cyclic or polycyclic alkyl group containing 3 to 15 carbon atoms.

[0051] "Substituted cycloalkyl" refers to a cycloalkyl group substituted with from 1 to 5, preferably 1 to 3, or more preferably 1 to 2 substituents selected from the group consisting of the same group of substituents defined for substituted aryl.

[0052] "Pharmaceutical composition" refers to a composition comprising an active ingredient and a pharmaceutically acceptable carrier.

[0053] The term "pharmaceutically acceptable" indicates that the indicated material does not have properties that would cause a reasonably prudent medical practitioner to avoid administration of the material to a patient, taking into consideration the disease or conditions to be treated and the respective route of administration. For example, it is commonly required that such a material be essentially sterile, e.g., for injectibles.

[0054] The term "carrier" refers to a glidant, diluent, adjuvant, excipient, or vehicle with which the compound is administered. Examples of carriers are described herein and also in "Remington's Pharmaceutical Sciences" by E.W. Martin.

[0055] The term "diluent" refers to chemical compounds that are used to dilute the compound of interest prior to delivery. Diluents can also serve to stabilize compounds. Non- limiting examples of diluents include starch, saccharides, disaccharides, sucrose, lactose, polysaccharides, cellulose, cellulose ethers, hydroxypropyl cellulose, sugar alcohols, xylitol, sorbitol, maltitol, microcrystalline cellulose, calcium or sodium carbonate, lactose, lactose monohydrate, dicalcium phosphate, cellulose, compressible sugars, dibasic calcium phosphate dehydrate, mannitol, microcrystalline cellulose, and tribasic calcium phosphate.

[0056] The term "binder" when used herein relates to any pharmaceutically acceptable film which can be used to bind together the active and inert components of the carrier together to maintain cohesive and discrete portions. Non- limiting examples of binders include hydroxypropylcellulose, hydroxypropylmethylcellulose, povidone, copovidone, and ethyl cellulose.

[0057] The term "disintegrant" refers to a substance which, upon addition to a solid preparation, facilitates its break-up or disintegration after administration and permits the release of an active ingredient as efficiently as possible to allow for its rapid dissolution. Non-limiting examples of disintegrants include maize starch, sodium starch glycolate, croscarmellose sodium, crospovidone, microcrystalline cellulose, modified corn starch, sodium carboxymethyl starch, povidone, pregelatinized starch, and alginic acid.

[0058] The term "lubricant" refers to an excipient which is added to a powder blend to prevent the compacted powder mass from sticking to the equipment during the tabletting or encapsulation process. It aids the ejection of the tablet form the dies, and can improve powder flow. Non-limiting examples of lubricants include magnesium stearate, stearic acid, silica, fats, calcium stearate, polyethylene glycol, sodium stearyl fumarate, or talc; and solubilizers such as fatty acids including lauric acid, oleic acid, and C ₈ /Ci ₀ fatty acid.

[0059] The term "glidant" as used herein is intended to mean agents used in tablet and capsule formulations to improve flow-properties during tablet compression and to produce an anti-caking effect. Non-limiting examples of glidants include colloidal silicon dioxide, talc, fumed silica, starch, starch derivatives, and bentonite.

[0060] As used herein, the term "pharmaceutically acceptable salts" refers to salts that retain the desired biological activity of the above -identified compounds and exhibit minimal or no undesired toxicological effects. Examples of such salts include, but are not limited to, salts formed with inorganic acids (for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like), and salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmoic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalenedisulfonic acid, methanesulfonic acid, p-toluenesulfonic acid and

polygalacturonic acid. The compounds can also be administered as pharmaceutically acceptable quaternary salts known by those skilled in the art, which specifically include the quaternary ammonium salt of the formula— NR+Z— , wherein R is hydrogen, alkyl, or benzyl, and Z is a counterion, including chloride, bromide, iodide, --O-alkyl, toluenesulfonate, methylsulfonate, sulfonate, phosphate, or carboxylate (such as benzoate, succinate, acetate, glycolate, maleate, malate, citrate, tartrate, ascorbate, benzoate, cinnamoate, mandeloate, benzyloate, and diphenylacetate). When a compound of Formula I is described, it is also intended to include pharmaceutically acceptable salts of Formula I unless otherwise stated.

DETAILED DESCRIPTION [0061] Compounds of Formula I have been shown to inhibit the activities of CRAC (Kim et al., J Immunol. 2014 Jan 1 ; 192(1): 110-22, incorporated by reference herein in its entirety). The function of the CRAC channel is important for the immune response and is largely limited to cells of the immune system. Accordingly, aspects of this invention relate to compounds and methods for suppressing an immune response in a mammal in need thereof.

[0062] Method aspects of the disclosure relate to a method for suppressing an immune response in a mammal in need thereof comprising administering to the mammal an immunosuppressive amount of a compound of Formula I:

Formula I or a pharmaceutically acceptable salt thereof wherein

R is selected from the group consisting of aryl, heteroaryl, substituted aryl, and substituted heteroaryl;

R ¹ and R ² are independently selected from the group consisting of hydrogen and CX ₃ or R and R ² together form a carbonyl or thiocarbonyl;

each X is independently selected from the group consisting of F, CI, and Br;

L is selected from the group consisting of a covalent bond and Ci-C ₆ alkylene;

R ³ is selected from the group consisting of aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl and substituted heteroaryl and wherein the IC ₅₀ of the compound is less than 10 μΜ.

[0063] The IC ₅₀ of the compound refers to the half maximal inhibitory concentration. More specifically, the IC ₅₀ of the compound refers to the half maximal inhibitor concentration required for Compounds of Formula I to block SOCE (store -operated Ca2+ entry) and/or the CRAC channel-calcineurin-NFAT pathway. In certain embodiments, the IC ₅₀ of the compound is about less than 5 μΜ, about less than 2 μΜ, about less than 1 μΜ, about less than 500 nM, or about less than 300 nM.

[0064] In one embodiment, the mammal suffers from an autoimmune disease.

Autoimmunity is the failure of an organism to recognize its own constituent parts as self, which allows an immune response against its own cells and tissues. Any disease that results from such an aberrant immune response is termed an autoimmune disease. Autoimmune diseases resulting from an immune response against the body's own cells and tissues are well known in the art. In one embodiment, the autoimmune disease is selected from rheumatoid arthritis, multiple sclerosis, type I diabetes, and inflammatory bowel disease. Autoimmune diseases also include, for example, inflammatory hyperproliferative skin diseases, psoriasis, allergic intraocular inflammatory diseases, scleroderma (including systemic scleroderma), sclerosis such as systemic sclerosis, multiple sclerosis (MS) such as spino-optical MS, primary progressive MS (PPMS), and relapsing remitting MS (R MS), atherosclerosis, arteriosclerosis, inflammatory bowel disease (IBD) (for example, Crohn's disease, autoimmune-mediated gastrointestinal diseases, colitis such as ulcerative colitis, colitis ulcerosa, microscopic colitis, collagenous colitis, colitis polyposa, necrotizing enterocolitis, and transmural colitis, and autoimmune inflammatory bowel disease), asthma, conditions involving infiltration of T cells and chronic inflammatory responses, immune reactions against foreign antigens such as fetal A-B-0 blood groups during pregnancy, chronic pulmonary inflammatory disease, autoimmune myocarditis, leukocyte adhesion deficiency, lupus, juvenile onset (Type I) diabetes mellitus, including pediatric insulin-dependent diabetes mellitus (IDDM), and adult onset diabetes mellitus (Type II diabetes). Additional autoimmune diseases as treated herein are immune responses associated with acute and delayed hypersensitivity mediated by cytokines and T-lymphocytes, sarcoidosis,

granulomatosis, Addison's disease, autoimmune neutropenia, pancytopenia, leukopenia, diseases involving leukocyte diapedesis, CNS inflammatory disorders, Alzheimer's disease, Parkinson's disease, multiple organ injury syndrome such as those secondary to septicemia, trauma or hemorrhage, antigen-antibody complex-mediated diseases, anti-glomerular basement membrane disease, anti-phospholipid antibody syndrome, allergic neuritis, Behcet's disease/syndrome, Castleman's syndrome, Goodpasture's syndrome, Reynaud's syndrome, Sjogren's syndrome, Stevens-Johnson syndrome, pemphigoid such as pemphigoid bullous and skin pemphigoid, pemphigus (including pemphigus vulgaris, pemphigus foliaceus, pemphigus mucus-membrane pemphigoid, and pemphigus erythematosus), autoimmune polyendocrinopathies, myasthenia gravis such as thymoma-associated myasthenia gravis, cerebellar degeneration, neuromyotonia, opsoclonus or opsoclonus myoclonus syndrome (OMS), and sensory neuropathy, multifocal motor neuropathy, Sheehan's syndrome, autoimmune hepatitis, Celiac or Coeliac disease, amylotrophic lateral sclerosis (ALS; Lou Gehrig's disease), fibromyalgia, multiple endocrine failure, tissue injury, and endometriosis. In one embodiment, the autoimmune disease is multiple sclerosis. In a further embodiment, the autoimmune disease is lupus. [0065] Methods and compositions of this invention are useful for suppressing an immune response in different situations. Therefore, compounds of Formula I can be used as an immunosuppressant in any situation in which suppression of the immune system is desired. In one embodiment, the compound of Formula 1 is administered to a mammal undergoing organ transplantation surgery.

[0066] In another of its method aspects, there is provided a method for modulating calcium transport through the CRAC channel so as to modulate the immune response of an immune cell by contacting (in vitro or in vivo) said immune cell with a compound of Formula I. The term modulating as used herein can refer to a decrease, increase, reduction, or inhibition of an activity and preferably refers to a decrease or inhibition. An immune cell refers to cells that are active in the immune system and the immune response of a mammal. Immune cells include, for example, leukocytes such as neutrophils, eosinophils, basophils, lymphocyts, monocytes, macrophages, dendritic cells, and more specifically B cells, T cells such as Th cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, gamma delta T cells, plasma B cells, memory B cells, B-l cells, B-2 cells, marginal-zone B cells, and follicular B cells.

[0067] In one embodiment, the immune cell is a T cell. In another embodiment, the activation and/or proliferation of the T cell is reduced. The activation and proliferation of a T cell can be assessed by methods known in the art. One example is a CFSE

(carboxyfluorescein diacetate, succinimidyi ester) T cell proliferation assay. Kits and protocols to conduct such assays are commercially available (see for e.g. Invitrogen, Cat No. C34554).

[0068] Some typical immunosuppressants have some level of toxicity due to off-target effects. The term "off-target effect" as used herein describes an undesired, non-specific effect of the administered compound. For example, some immunosuppressants target the CRAC channel-calcineurin-NFAT pathway. While the activities of the CRAC channel can be limited to cells of the immune system, calcineurin is a ubiquitously expressed protein that has important activities in other cell types. Calcineurin is a protein phosphatase also known as protein phosphatase 3, PPP3CA, and calcium-dependent serine-threonine phosphatase, and formerly known as protein phosphatase 2B (PP2B). Thus, it is desirable to inhibit an immune response by inhibiting the CRAC channel without inhibiting calcineurin. [0069] It is contemplated that compounds of this invention are less toxic than immunosuppressants that inhibit multiple components of the CRAC channel-calcineurin- NFAT pathway such as cyclosporin A and FK506. Accordingly, in one embodiment, calcineurin is inhibited by less than about 30%, or by less than about 25% or by less than about 20% of the activity obtained in the absence of a compound of the disclosure.

Preferably, calcineurin is inhibited by less than about 15%, or by less than about 10% of the activity obtained in the absence of a compound of the disclosure. In another embodiment, calcineurin is inhibited by less than about 5% or less than about 1% of the activity obtained in the absence of a compound of the disclosure. In yet another embodiment, there is no detectable inhibition of calcineurin.

[0070] The inhibition of calcineurin can be determined by methods known in the art. Such methods include those that assess the protein or RNA level of calcineurin in a sample of cells. These can be assessed using standard immunohistochemistry, western blotting, southern blotting, PCR, microarray analysis, or RNA analysis techniques well known in the art. Since the sequence of calcineurin is known, and antibodies are commercially available, these techniques are easily performed by one skilled in the art. The activity and/or inhibition of calcineurin can also be determined by accessing the phosphatase activity of the protein. The protein can be isolated from tissues using standard techniques and a protein phosphatase assay can be performed according to standard protocols. [0071] In another embodiment, the compound of Formula I specifically inhibits the Orail protein and/or its homologues. The Orail gene encodes for proteins that make up the CRAC. The mammalian Orai family has two additional homo logs, Orai2 and Orai3. In one embodiment, Orail is specifically inhibited by the compound of Formula I. In another embodiment, compounds of this invention exhibit inhibitory activity towards all Orai homologs. It is also contemplated that inhibitory activity is specific to one homolog and not the others. The inhibition of Orai can be assessed by methods known in the art and as previously stated.

[0072] In some embodiments, the methods of this invention can be used as an adjunct to conventional drug therapy or other therapeutic modalities for immunosuppression, anti- inflammation, or palliative treatments. For example, when treating autoimmune diseases using the compounds described herein, the therapy can be combined with that of traditional therapies such as hormone replacement, dietary manipulation, steroidal or NSAID anti- inflammatants, TNFa antagonists, the B cell depleting agent rituximab, the anti-IL-6 receptor tocilizumab or the costimulation blocker abatacept.

[0073] In another of its method aspects, there is provided a method for inhibiting Orai activity in a cell by administering to the cell a compound of Formula I or a pharmaceutically acceptable salt thereof in an amount sufficient to inhibit Orai activity. Blocking Orai has been shown to have therapeutic effects in certain diseases. For example, blocking Orai has been shown to inhibit metastasis of cancers in vivo. Accordingly, in one embodiment, inhibition or Orai activity inhibits metastasis in a subject with cancer. Cancers in which Orai has been shown to be important for metastasis include cervical and breast cancer. Therefore, compounds of formula I can be used as therapeutics for the inhibition of metastasis in cervical and breast cancer.

[0074] Further aspects of the disclosure relate to methods for screening compounds for their ability to act as immunosuppressants. Acordingly, one aspect relates to a method for identifying a compound that modulates calcium transport through the CRAC channel of a cell comprising contacting a candidate compound with the cell, and assaying and comparing the CRAC channel activity to the activity of the compounds of Formula I. In a related embodiment, the method comprises identifying a compound that reduces CRAC channel activity. CRAC channel activity can be measured directly or indirectly. For example, store- operated Ca2+ entry (SOCE) can be measured by methods known in the art and methods described in the examples. Also, NFAT (nuclear factor of activated T-cells) translocation can serve as a readout for CRAC channel activity. Nuclear translocation of NFAT in cells triggered by store depletion is suppressed by reduced CRAC channel activity. NFAT translocation can be measured by methods known in the art and methods described in the Examples provided herein. [0075] A further method aspect relates to a method for identifying a compound that modulates Orail protein function, or its homologue, in a cell comprising contacting a candidate compound with the cell, and assaying for Orail protein activity. In a related embodiment, the method comprises identifying a compound that reduces Orail protein activity. Orail protein activity can be measured by methods known in the art and by methods described herein. The phrase "modulates Orai protein function" includes modulation at the RNA or protein level. For example, a compound that reduces the transcription of Orail would be considered one that modulates its protein function. Also, compounds that reduce or change the amount of translation of the protein or inhibit the protein directly or indirectly would be considered one that modulates its protein function.

[0076] Turning now to the aspects of the compound of Formula I uselful in the methods described herein, in certain embodiments, of the above aspects and the pharmaceutical

compositions described herein, R is a heteroaryl. In a related embodiment, R is

[0077] In a further embodiment, R ³ is aryl. In a related embodiment, R ³ is naphthyl. In a yet further embodiment, R ³ is selected from the group consisting of 1-naphthyl and 2- naphthyl. In a specific embodiment, R ³ is 2- naphthyl.

[0078] In another embodiment, R is a heteroaryl and R ³ is aryl.

[0079] In a further embodiment, R ¹ is hydrogen and R ² is CX ₃ . In a related embodiment, X is CI.

[0080] In a further embodiment, L is a covalent bond. In a specific embodiment, R is a heteroryl, R ³ is aryl, and L is a covalent bond.

[0081] In one embodiment, the compound of Formula I is selected from a compound disclosed below in Table 1 or a pharmaceutically acceptable salt thereof:

Table 1

[0082] Another aspect of this invention relates to pharmaceutical compositions for use in suppressing an immune response comprising a compound of Formula I as described herein and a carrier or excipient. In one embodiment, the composition comprises one or more excipients, e.g., talc, gum arabic, lactose, starch, magnesium stearate, cocoa butter, aqueous or non-aqueous solvents, oils, paraffin derivatives, glycols, etc. Coloring and flavoring agents may also be added to preparations, particularly to those for oral administration.

Solutions can be prepared using water or physiologically compatible organic solvents such as ethanol, 1 ,2-propylene glycol, polyglycols, dimethylsulfoxide, fatty alcohols, triglycerides, partial esters of glycerine and the like. In another embodiment, the compound is present in an amount sufficient to suppress the immune response.

[0083] Another aspect of the disclosure relates to novel compounds of formula I

Formula I or a pharmaceutically acceptable salt thereof, wherein

R is selected from the group consisting of aryl, heteroaryl, substituted aryl, and substituted heteroaryl;

R ¹ and R ² are independently selected from the group consisting of hydrogen and CX ₃ or R and R ² together form a carbonyl or thiocarbonyl;

each X is selected from the group consisting of CI, F and Br;

L is selected from the group consisting of a covalent bond and Ci-C ₆ alkylene;

R ³ is selected from the group consisting of aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl and substituted heteroaryl, wherein the compound is not a compound tabulated below:

[0084] In one embodiment, R is a heteroaryl. In a related embodiment, R is

[0085] In a further embodiment, R ³ is aryl. In a related embodiment, R ³ is naphthyl. In yet a further embodiment, R ³ is selected from the group consisting of 1-naphthyl and 2- naphthyl. In another embodiment, R ³ is 2- naphthyl.

[0086] In another embodiment, R ¹ is hydrogen and R ² is CX ₃ . In a related embodiment, X is CI. [0087] Another embodiment provides for a pharmaceutical composition comprising a compound described herein and a carrier, e.g., a pharmaceutically acceptable carrier.

[0088] Solid pharmaceutical excipients include starch, cellulose, hydroxypropyl cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk and the like.

Liquid and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oils, including those of petroleum, animal, vegetable or synthetic origin, e.g., peanut oil, soybean oil, mineral oil, sesame oil, etc.

[0089] The concentration of the excipient is one that can readily be determined to be effective by those skilled in the art, and can vary depending on the particular excipient used.

[0090] In practicing methods of the invention, the compounds of Formula I can be administered to the subject using any method and route suitable for delivery of the compounds, including systemic or localized routes. Routes of administration may be combined, if desired, or adjusted depending upon the pharmaceutical composition and/or the desired effect.

[0091] The compounds of Formula I may be administered using any medically appropriate procedure, e.g., intravascular (intravenous, intraarterial, intracapillary) administration, injection into the cerebrospinal fluid, intracavity or direct injection. Intrathecal

administration maybe carried out through the use of an Ommaya reservoir, in accordance with known techniques. (F. Balis et al., Am J. Pediatr. Hematol. Oncol. 11, 74, 76 (1989).

[0092] Where local delivery is desired, administration may involve administering the compound of Formula I to a desired target tissue, such a brain, spine, etc. For local delivery, the administration may be by injection or by placement of a composition containing the inhibitor in the desired tissue or organ by surgery, for example. In certain cases, an implant, such as a cannula implant, that acts to retain the active dose at the site of implantation may be used. In some instances, systemic, intraperitoneal, intravascular or subcutaneous protocols are employed, e.g., as described in Pardridge WM (2008) Re-engineering biopharmaceuticals for delivery to brain with molecular Trojan horses. Bioconjug Chem. 19: 1327-38. In some instances, nanoparticle mediated delivery protocols may be employed, e.g., as described in Tosi G, Costantino L, Ruozi B, Forni F, Vandelli MA (2008) Polymeric nanoparticles for the drug delivery to the central nervous system. Expert Opin Drug Deliv. 5:155-74; and Ulbrich K, Hekmatara T, Herbert E, Kreuter J (2008) Transferrin- and transferrin-receptor-antibody- modified nanoparticles enable drug delivery across the blood-brain barrier (BBB). Eur J Pharm Biopharm. 2008 Sep 5. [Epub ahead of print]. In some instances, intracerebral, ventricular or intrathecal delivery protocols may be employed, e.g., as described in Buchli AD and Schwab ME (2005) Inhibition of Nogo: a key strategy to increase regeneration, plasticity and functional recovery of the lesioned central nervous system. Ann Med. 37:556- 67; and Shoichet MS, Tator CH, Poon P, Kang C, Baumann MD (2007).

[0093] In some embodiments, the compound may be formulated to cross the blood brain barrier (BBB). One strategy for drug delivery through the blood brain barrier (BBB) entails disruption of the BBB, either by osmotic means such as mannitol or leukotrienes, or biochemically by the use of vasoactive substances such as bradykinin. The potential for using BBB opening to target specific agents to brain tumors is also an option. A BBB disrupting agent can be co-administered with the compositions disclosed herein when the compositions are administered by intravascular injection. Other strategies for transportation across the BBB may entail the use of endogenous transport systems, including carrier- mediated transporters such as glucose and amino acid carriers, receptor-mediated transcytosis for insulin or transferrin, and active efflux transporters such as p-glycoprotein. Active transport moieties may also be conjugated to a compound for use in the methods disclosed herein to facilitate transport across the epithelial wall of the blood vessel. Alternatively, drug delivery behind the BBB is by intrathecal delivery of therapeutics directly to the cranium, as through an Ommaya reservoir.

[0094] Methods of administration of the compound through the skin or mucosa include, but are not necessarily limited to, topical application of a suitable pharmaceutical preparation, transdermal transmission, injection and epidermal administration. For transdermal transmission, absorption promoters or iontophoresis are suitable methods. Iontophoretic transmission may be accomplished using commercially available "patches" which deliver their product continuously via electric pulses through unbroken skin for periods of several days or more.

[0095] Further aspects of the disclosure relate to kits comprising the pharmaceutical composition of any one of claims 1-30 or 43 and instructions for use. [0096] The compounds of this invention may typically contain one or more chiral centers. Accordingly, if desired, such compounds can be prepared or isolated as pure stereoisomers, i.e., as individual enantiomers or diastereomers, or as stereoisomer-enriched mixtures. All such stereoisomers (and enriched mixtures) are included within the scope of this invention, unless otherwise indicated. Pure stereoisomers (or enriched mixtures) may be prepared using, for example, optically active starting materials or stereoselective reagents well-known in the art. Alternatively, racemic mixtures of such compounds can be separated using, for example, chiral column chromatography, chiral resolving agents and the like.

[0097] The starting materials useful for making the compounds utilized in this invention are generally known or can be prepared by known methods or obvious modifications thereof. For example, many of the starting materials are available from commercial suppliers such as Aldrich Chemical Co. (Milwaukee, Wis., USA), Bachem (Torrance, Calif, USA), Emka- Chemce or Sigma (St. Louis, Mo., USA). Others may be prepared by procedures, or obvious modifications thereof, described in standard reference texts such as Fieser and Fieser's Reagents for Organic Synthesis, Volumes 1 15 (John Wiley and Sons, 1991), Rodd's Chemistry of Carbon Compounds, Volumes 1 5 and Supplemental (Elsevier Science Publishers, 1989), Organic Reactions, Volumes 1 40 (John Wiley and Sons, 1991), March's Advanced Organic Chemistry, (John Wiley and Sons, 4th Edition), and Larock's

Comprehensive Organic Transformations (VCH Publishers Inc., 1989).

[0098] The compounds utilized in this invention can be prepared from readily available starting materials using methods well known to the skilled artisan or methods that will be apparent to the skilled artisan upon reading this disclosure. Illustrative and non- limiting methods are schematically shown below:

wherein BtH is benzotriazole and Bt is 1-benzotriazolyl or 2-benzotriazolyl. See also, Katritzky et al, Synthesis, 1998(10): 1421-23 and Sansone et al., Tetrahedron Lett., 51(46), 2010, 6031-33 (each of which is incorporated herein in its entirety by reference).

[0099] The reactions are carried out for a period of time sufficient to produce a substantial amount of the product, which can be determined using well known methods such as thin layer chromatography and ¹ H-nuclear magnetic resonance spectroscopy. The product obtained can be used without purification in a subsequent step, or may be separated using well known methods such as crystallization, precipitation, column chromatography, and distillation.

[0100] It will be appreciated that where typical or preferred process conditions (i.e., solvents, reagents, etc.) are given, other process conditions can also be used unless otherwise stated. Optimum reaction conditions may vary with the particular reactants or solvent used, but such conditions can be determined by one skilled in the art by routine optimization procedures.

[0101] Additionally, as will be apparent to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing undesired reactions. Suitable protecting groups for various functional groups as well as suitable conditions for protecting and deprotecting particular functional groups are well known in the art. For example, numerous protecting groups are described in T. W. Greene and G. M. Wuts, Protecting Groups in Organic Synthesis, Third Edition, Wiley, New York, 1999, and references cited therein.

EXAMPLES

Example 1: Chemical library screen and assays to test for blockers of CRAC.

[0102] HeLa-OSN cells are a cell-line that harbors amplified CRAC currents by

overexpression of Orail and STIM1, the components of CRAC channels (FIG. 2a).

Comparing plain HeLa cells, these cells show much higher Ca2+ entry levels mediated by CRAC channels. In these cells, NFAT1-460-GFP was stably expressed for use as a readout for the screen. NFAT is a transcription factor that is activated by CRAC channels and translocates from the cytoplasm into the nuclei (FIG. 2b). By measuring NFAT accumulation in the nuclei, CRAC channel activity can be monitored. The known CRAC channel blocker, 2-APB was used as a positive control for the screen. The calculated Z' factor was 0.692 meaning that the design was suitable for high throughput screen. [0103] Thirteen chemical compounds were identified from the screen using a chemical library composed of 85,000 compounds (FIG. 3). These are potential immunosuppressants. Among these, compound 5 (N-[2,2,2-trichloro-l-(l-naphthylamino)ethyl]-2- thiophenecarboxamide) was found to be the most potent blocker of the CRAC. [0104] Compound 5 and analogues of compound 5 (FIG. 4) were tested. Among these, the compound 5d (N-[2,2,2-trichloro-l-(2-naphthylamino)ethyl]-2-furamide) and the compound 5 J (N-[(2-naphthylamino)carbonothioyl]-2-furamide) showed the strongest blocking activity.

[0105] FIG. 5 demonstrates that the compound 5d can block CRAC current by

electrophysiology. The graphs are plotted as current- voltage relation (a) and versus time (b). [0106] FIG. 1 demonstrates the immunosuppressive activity of the compound 5d (N-[2,2,2- trichloro-l-(2-naphthylamino)ethyl]-2-furamide). The IC50 value of the compound 5d to block Ca2+ entry in T cells was determined to be 195 nM using single cell fura-2 Ca2+ imaging (FIG. la). It was shown that the compound 5d blocks the cytokine production of T cells (FIG. lb), and T cell activation/proliferation in (FIG. lc). [0107] The therapeutic potential of the compound 5d using an animal model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE) was further tested. In this model, the disease can be induced by T cell attack of central nervous system (e.g. brain and spinal cord) to mimic multiple sclerosis. The severity of the disease is decreased by treatment of the compound 5d (FIG. 6a). It was found that T cell attack is much less after treatment of the compound 5d (FIG. 6b). These results were obtained by H&E staining of T cells in the spinal cord (left) and isolation and counting of infiltrated T cells from the central nervous system (right). In addition, the therapeutic potential of the compound 5d analogue, compound 5J-4 (N-{[(6-hydroxy-l-naphthyl)amino]carbonothioyl}-2-furamide) was tested and it showed a better suppressive effect on the onset and severity of the diseases considering the reduced disease severity (FIG. 6c) and the infiltrated T cell number to the central nervous system by H&E staining (FIG. 6d). The infiltrated T cell number was determined after isolation of mononuclear cells from the spinal cord and the frequency of CD4+ T cells (helper T cells) among the isolated cells was determined by surface staining of CD4 and analysis by flow cytometry (FIG. 6e). Methods

[0108] Reagents. Thapsigargin and 2-APB were purchased from EMD biochemicals.

Polyclonal rabbit antibody for detection of Orail was generated, affinity-purified (Open Biosystems, Huntsville, AL), and used at 1 : 1000 dilution for immunocytochemistry. Alexa Fluor 568 labeled secondary antibodies were purchased from Invitrogen (Carlsbad, CA) and used at 1 : 1000 dilutions for immunocytochemistry.

[0109] Plasmids. Full-length cDNA of human Orail was subcloned into bicistronic retroviral expression vector pMSCV-CITE-eGFP-PGK-Puro, which allows for simultaneous expression of Orail, GFP and a puromycin resistance gene. Single-point mutants were generated using Quickchange XL site-directed mutagenesis kit (Stratagene) following manufacturer's instructions. All the clones were verified by sequencing.

[0110] Cell lines and transductions. HEK293 cells were obtained from ATCC and cultured in Dulbecco's modified Eagle's medium (DMEM - Mediatech, Hargrave, VA) supplemented with with 10% fetal bovine serum (Hyclone, Logan, UT), 10 mM HEPES, 10 mM Glutamine and 1% penicillin/streptomycin (Mediatech, Hargrave, VA). Cells were transfected at 80- 90% confluency using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. For retroviral transductions, phoenix cells stably expressing gag-pol and ecotropic env (purchased from ATCC) were transfected with plasmids encoding Orai proteins to produce ecotropic, replication-incompetent retrovirus using calcium phosphate transfection method. Virus-containing supernatant was collected at 2 and 3 days after transfection and immortalized Orail ^"7" murine embryonic fibroblasts (MEFs) were transduced twice on day 2 and day 3 in the presence of 8 μg/ml polybrene. Transduction efficiencies were evaluated visually by GFP expression and Orail expression using immunoblotting.

[0111] High throughput Screen for Small Molecule Blockers. HeLa cells stably expressing Orail and STIM1 and NFAT-1-466-GFP (HeLa-OSN) were generated by retroviral transduction followed by flow cytometry sorting for bright GFP ⁺ cells. Cells were FACS- sorted for selection of high-GFP expressing cells. -5000 cells were plated onto individual 384-well plates coated with poly-L-Lysine (Greiner Bioone) over night. Next day, the cells were washed twice with 2 mM Ca ²⁺ -containing Ringer solution and bathed in the same solution. Compounds were added using a 384-well pin tool (V&P Scientific, Inc.) at a final concentration of 10 μΜ. Cells were incubated with the compounds for 5 mins and then treated with a final concentration of 1 μΜ thapsigargin for ~30 mins, fixed, and stained with 4',6-diamidino-2-phenylindole (DAPI), and the coincident GFP and DAPI images were acquired by an automated camera from each well. Every plate included two types of controls-one without any compound to monitor nuclear translocation of NFAT-GFP and another with 100 μΜ 2-APB to visualize block of NFAT-GFP nuclear translocation. Only the plates showing proper patterns for control wells were used for further evaluation. The chemical libraries of Biomol, FDA approved drugs, MicroSource, Prestwick, Chembridge, Druggable compounds totaling to ~ 85,000 small molecule compounds were used for primary screening. Candidates from the primary screen were cherry picked into 96-well plates and a confirmatory screen was performed in triplicates using the protocol described above.

Positive candidates from confirmatory screen were then used for a secondary screen based on

2_ _| _

ratiometric Ca measurements.

[0112] Secondary screening of candidates. Secondary screen was performed on Flexstation II (Molecular devices). Briefly, HeLa-OSN cells were plated in 96-well plates overnight, loaded with 2 μΜ Fura-2-AM for 45 mins and rinsed with 2 mM Ca ²⁺ -containing Ringers solution twice. The baseline Fura-2 ratio was acquired and cells were treated with individual compounds at 10 μΜ final concentration and treated with thapsigargin (1 μΜ final concentration) for measurement of store-operated Ca2+ entry (SOCE). The ratio values after store-depletion were acquired and only the compounds showing block of SOCE were used for tertiary screening with single cell ratiometric Ca ²⁺ -imaging.

[0113] Single-cell Ca ²⁺ imaging. HeLaO+S cells and fibroblasts were grown directly on UV-sterilized coverslips and loaded with 2 μΜ Fura 2-AM for 45 min. Primary T cells were loaded with 1 μΜ Fura 2-AM for 30 min and attached onto poly-D-Lysine coated coverslips. For [Ca ²⁺ ]j measurements, cells were mounted in a RC-20 closed bath flow chamber (Warner Instrument Corp., Hamden, CT) and analyzed on an Olympus 1X51 epifluorescence microscope with Slidebook (Intelligent Imaging Innovations, Inc.) imaging software. Cells were perfused with Ca ²⁺ -free Ringer's solution, and Ca ²⁺ stores were passively depleted with 1 μΜ thapsigargin. Store-operated Ca ²⁺ entry (SOCE) was measured by exchanging the Ca ²⁺ -free Ringer's solution with that containing 2 mM CaCl ₂ . At the peak of SOCE, cells were exposed to the same solution containing 10 μΜ (or different concentrations) of individual blockers identified from the secondary screen. Fura-2 emission was detected at 510 nm with excitation at 340 and 380 nm, and the Fura-2 emission ratio (340/380) was acquired at every 5-s interval after subtraction of background. For each experiment, 50-100 individual cells were analyzed using OriginPro (Originlab) analysis software. [Ca ²⁺ ] _z was estimated from the relation [Ca ²⁺ ], = K*(R - Rmin) (Rmax ^~ R). K*, R _m i _n , and i? _max were measured in control cells. Peak Ca ²⁺ was calculated as the maximal amount of Ca ²⁺ accumulated in the cell after store depletion, upon reintroduction of Ca ²⁺ containing Ringer's solution.

[0114] Measurement of CRAC currents by whole cell recording. For recording of CRAC currents, HEK293T cells were co-transfected with plasmids encoding Orail WT or mutant cDNAs in the presence or absence of STIM1 encoding plasmid at a molar ratio of 1 : 1 using Lipofectamine 2000 (Invitrogen, Carlsbad). Cells were used for experiments 24-48 hrs post transfection. Patch-clamp recordings were performed using an Axopatch 200B amplifier (Molecular Devices, California) interfaced to a Digidata 1320A (Axon Instruments, CA) for stimulation and data acquisition. Currents were filtered at 1 kHz with a 4-pole Bessel filter and sampled at 5 kHz. Recording electrodes were pulled from borosilicate glass capillaries (WPI, Sarasota, Fl) using a Flaming Brown pipette puller (Sutter Instrument, CA) to a final resistance of 2-7 ΜΩ. Stimulation, data acquisition and analysis were performed using pCLAMP8 and SigmaPlot or Origin software. The standard extracellular Ringer solution contained (in mM): 145 Cs-aspartate, 4.5 KC1, 6 CaCl ₂ , 10 D-glucose, and 10 Na-Hepes (pH 7.35). The standard internal solution contained (in mM): 145 Cs-glutamate, 8 MgCl ₂ , 12 EGTA, and 10 Cs-Hepes (pH 7.3). Unless otherwise stated the cell membrane was held at 0 mV and pulses were applied between -110 mV to +115 mV at 15 mV intervals for 250 ms. For each solution the concentration of HEDTA and Ca ²⁺ was calculated using the

WEBMAXC program and validated using a Ca ²⁺ electrode. [0115] Analysis of patch Clamp data. Ionic currents from cells expressing WT and mutant channels were recorded using only the analog compensation of the membrane linear components. In most cases (mutant channels) 2-APB had no inhibitory effects and the current traces could not be corrected for leak currents. The time course of outward current activation was fitted by a single exponential function. The first 1 ms of recorded data following the onset of the voltage pulses, was not included in the fitting to minimize the effect of uncompensated membrane capacitance on the estimated time course of the current. For the I- V, steady state currents measured at the end of the pulse unless otherwise specified were used.

[0116] T cell isolation and differentiation. CD4 ⁺ CD25 T cells were purified from single- cell suspensions of spleens and lymph nodes of adult mice. Single-cell suspensions were prepared by mechanical disruption using cell strainer (BD Biosciences). CD4 ⁺ CD25 ^" T cells were isolated by magnetic sorting with CD4 ⁺ beads (Invitrogen) followed by CD25 MACS positive selection (Miltenyi Biotech). For effector T cell differentiation, cells were stimulated with 2 μ§/ι 1 of anti-CD3 (Bio X cell) and 2 μ§/ι 1 of anti-CD28 (Bio X cell) for 48 hours on a plate coated with 0.1 mg/ml of goat anti-hamster (ICN). For T _R I

differentiation, CD4 ⁺ CD25 ^" T cells were cultured in the presence of 10 μ§/ι 1 anti-IL-4 (Bio X cell), and lOng/ml IL-12. For T _H 2 differentiation, CD4 ⁺ CD25 were cultured in the presence of 20 μ§/ι 1 anti-IFN-γ (Bio X cell), 2.5 μ§/ι 1 anti-IL-12 and 10 ng/ml IL-4

(peprotech). For T _H 17 differentiation, CD4 ⁺ CD25 ^" cells were cultured in the presence of 10 μg/ml anti-IL-4, 20 μ^πιΐ anti-IFN-γ, 30 ng/ml IL-6 (Peprotech), 10 ng/ml TGF-β

(peprotech) and 10 ng/ml IL-23 (Peprotech). At day 4, differentiated T cells were restimulated with anti-CD3 antibody with or without anti-CD28 antibody, or with ionomycin with or without phorbol myristate acetate (PMA) for Intracellular staining.

[0117] T cell proliferation assays. Proliferation was analyzed by flow cytometric measurement of carboxy fluorescein succinimidyl ester (CFSE) dilution. Purified T cells were labeled with 5 μΜ CFSE (Invitrogen) at 37°C for 10 minutes followed by extensive washing with phosphate-buffered saline (PBS). CFSE-labeled T cells were stimulated with anti-CD3 and anti-CD28 for 48 hours.

[0118] E AE induction and Treatment. Dilute the MOG35-55

(MEVGWYRSPFSRVVHLYRNGK,Genscript) peptide in PBS to a final concentration of 2 mg/ml. Mix equal volumes of MOG peptide and complete Freund's adjuvant (Difco) containing 5 mg/mL of Mycobacterium tuberculosis H37 Ra (Difco). Mice were immunized s.c. in the 2 flanks, 100 μΐ per site. These mice also received i.p. 200 ng of pertussis toxin (List Biological Laboratories) in 200 μΐ of PBS at the time of immunization and again 2 days later. EAE was scored according to the following clinical scoring system : 0, no clinical signs; 1, loss of tail tone; 2, wobbly gait; 3, hind limb paralysis; and 4, moribund or death. Mice in the test groups were treated i.p. 5D or 5J-4 in 50μ1 DMSO on every other day from 0 to 29 days following induction of EAE. Mice in the control group received 50 μΐ DMSO.

[0119] T cell analysis. Draining lymph nodes were collected 14 days after EAE induction, and cell suspensions were prepared. For proliferation analysis, cells were distributed in a 96- well plate at 1 x 10 ⁶ /ml concentration and cultured in media. Cell suspensions were restimulated with 20 μg/ml of MOG35-55 for 2 days at 37 °C with 5% C0 ₂ and humidified atmosphere. All of the cultures were run in triplicate. The 48-h cultures were pulsed with 1 μΟΛνεΙΙ [ ³ H]-thymidine (Amersham Biosciences) for an additional 16-18 h. After this treatment, cells were harvested, lysed, and acid precipitated. Finally [ ³ H] -thymidine incorporation was determined by liquid β-scintillation counting (Beckman). For intracellular staining, cells were distributed in a 12-well plate at 0.5 x 10 ⁶ /ml concentration and cultured with 50ng/ml ionomycin and lmg/ml phorbol myristate acetate for 5h. For Real-time PCR, the total RNA of draining lymph nodes was extracted with TRIzol reagent (Gibco BRL) following the manufacturer's instructions. For ex-vivo experiment, draining lymph nodes were collected 7 days after EAE induction, and cell suspensions were prepared. For ex-vivo differentiation, cells were distributed in a 12-well plate at 1 x 10 ⁶ /ml concentration and cultured Cells cultured for four more days with MOG peptide and exogenous IL-6 and IL-23 or IL-12, in the presence or absence of 5D.

[0120] Isolation of Mononuclear Cells from the Central Nervous System. To isolate mononuclear cells from PBS-perfused spinal cord and brain, tissues were digested in collagenase and DNase I (Roche) 30 min at 37 °C and cells were separated on a 40%/80% Percoll gradient by centrifuging at 500 x g for 30 min. Cells at the 40%:80% interface were collected. For intracellular cytokine staining, cells were incubated media containing 50 ng/ml PMA, 1 μg/ml ionomycin and 3 μg/ml brefeldin A (eBioscience). After 5 h of culture, cells were stained for CD4, IFN-γ and IL-17 according to eBioscience instructions.

[0121] Histology. Following perfusion with PBS, spinal cords were removed and fixed with 4% paraformaldehyde in PBS at 4°C overnight. Tissues were blocked in paraffin wax.

Sections (5 μιη) were cut from paraffin block. Paraffin-embedded sections were stained with H&E and Luxol Fast Blue for visualization of inflammatory infiltrates and demyelination. Example 2: Small molecule inhibitors reveal a crucial role of Orail-nuclear orphan receptor pathway for TH17 differentiation

[0122] To develop a high throughput screen to identify Orail inhibitors, a cell-line in which the CRAC currents (ICRAC) are amplified was generated by stable expression of Orail and STIM1. Endogenous SOCE (store-operated Ca ²⁺ entry) was relatively marginal in HeLa cells. However, a tenfold enhancement in SOCE at the peak and sustained levels was observed in HeLa cells stably expressing Orail and STIM1 (HeLa-O+S), which could be blocked by 2- aminoethoxydeiphenyl borate (2-APB), a widely used CRAC channel blocker (FIG. 7a and b). A pilot screen using direct measurement of cytoplasmic Ca ²⁺ concentration ([Ca ²⁺ ]i) provided a Z' factor of ~0.5. Earlier, using NFAT translocation as a readout for CRAC channel activity in Drosophila cells, ~20 candidates were selected from a genome-scale RNAi screen while similar screens using direct [Ca ²⁺ ]i measurement resulted in 500-1,000 candidates. Therefore, we generated HeLa-O+S cells stably expressing NFATc2 (amino acid l-460)-GFP (abbreviated NFAT-GFP) to utilize nuclear translocation of NFAT-GFP as readout (FIG. 8a). Nuclear translocation of NFAT in HeLa-O+S cells triggered by store depletion was specifically suppressed by blocking CRAC channels with 2-APB, La ³⁺ , and Gd ³⁺ suggesting that it is predominantly regulated by CRAC channel activity (FIG. 8a and data not shown). A pilot screen utilizing NFAT translocation as readout showed a Z' factor of ~0.7, providing an ideal platform for high throughput screening (FIG. 7c). A chemical library encompassing -85,000 compounds was screened to identify blockers of NFAT translocation. Each plate included a positive control, 2-APB and plates were automatically scored for colocalization of NFAT-GFP and 4,6-diamidino-2-phenylindole (DAPI) signals. Candidates affecting survival or morphology of the cells were excluded from further analysis. Positive candidates from the primary screen were further examined for direct block of SOCE using single cell ratiometric Ca ²⁺ imaging. This analysis resulted in identification of compound 5, N-[2,2,2-trichloro-l-(l-naphthylamino)ethyl]-2-thiophenecarb oxamide as a specific inhibitor of CRAC channels (FIG. 8b). [0123] A structural analogue of compound 5 strongly blocks CRAC channel activity. To identify compounds with better blocking efficacy, structural analogues of compound 5 were examined for block of SOCE in HeLa-O+S cells (FIG. 4 and FIG. 9). Among these, compound 5D, N-[2,2,2-trichloro-l-(2-naphthylamino)ethyl]-2-furamide showed an enhanced blocking of SOCE and NFAT translocation (FIG. 10a and b). Modifications in the structure of the thiophene or naphthalene rings of compound 5 reduced the blocking effect suggesting their important role in inhibiting CRAC channel activity. We next examined the blocking efficacy of compound 5D on endogenous CRAC channels from murine primary CD4 ⁺ T cells. Compound 5D blocked endogenous SOCE, especially sustained Ca ²⁺ levels of effector T cells in a dose-dependent manner with a half-maximum inhibitory concentration (IC ₅₀ ) of 195 nM (FIG. 8c).

[0124] Compound 5D inhibits CRAC channel activity by blocking ion permeation. The CRAC channel has unique gating and inactivation mechanisms. ER store depletion induces multimerization and clustering of STIM1 at the ER-PM junctions, which allows for a direct protein interaction between Orail and STIM1. To elucidate the molecular mechanism of inhibition by compound 5D, we measured the effect of compound 5D at different stages of Orail activation. First, we examined whether presence of compound 5D altered accumulation of STIM1 and Orail at the ER-PM junctions using total internal reflection fluorescence (TIRF) microscopy. These studies showed no significant effect of compound 5D on the rate or extent of accumulation of Orail or STIMl at the ER-PM junctions (FIG. 10c and d). Next, to examine the effect of compound 5D on CRAC currents, HEK293 cells transiently expressing Orail and STIMl were used. In these cells, we could detect large IC _R AC that was almost completely blocked by compound 5D when applied in the external solution, while intracellular application via the patch pipette had no effect (FIG. 8d). These results suggested that the binding site of compound 5D is located at or near the extracellular region of Orail .

[0125] Orail contains four transmembrane segments (TM1-4), cytoplasmic N and C termini, and two extracellular loops ECl and EC2 with TMl lining the pore (FIG. 8e).

Recently, Applicants showed that the mutation W176C in TM3 resulted in STIM1- independent, constitutively active CRAC currents, yielding high basal [Ca ²⁺ ]i. Compound 5D could reversibly inhibit currents generated from Orail ^wl76C (FIG. 8f and FIG. lOe). These data suggest that blocking by compound 5D is independent of STIMl interaction. Previous mutational analysis of transmembrane segments of Orail suggested that residues L95, G98 and VI 02 in TMl segment of Orail are directly involved in ion permeation. Since Orail inhibitor is active from the extracellular region, residues in the two EC loops were examined as well as residues in TMl that can be accessible to the extracellular milieu when the channel is open. Conserved residues in the extracellular regions and in TMl of Orail were systematically mutated and the effect of compound 5D on activity of the mutant channels after expression in Orail ^"7" murine embryonic fibroblasts (MEFs) was examined (FIG. 8f). It has been suggested that extracellular loop 1 , which contains three aspartate residues

(D ¹¹⁰ xD ¹¹² xD ¹¹⁴ ), forms the channel's outer vestibule and is possibly involved in ion selectivity. Mutational analysis of these residues (mutants Q ¹⁰⁸ LD ¹¹⁰ >AAA and

D ¹¹⁰ AD ¹¹² >AAA) did not affect blocking by compound 5D. In addition, deletion of extracellular loop 2 also did not affect block by compound 5D (FIG. 8f). Recent studies showed that residue VI 02 within TMl may form the gate that opens and closes CRAC channels and its mutation results in STIMl -independent and constitutively active channels. The mutational analysis described herein of this residue demonstrated a very slow and partial block of Orail ^vl02C and Orail ^vl02A -evoked currents by compound 5D (FIG. 8f, FIG. lOf and g). These data suggest that compound 5D binds at or near V102 to close the channel although we cannot rule out the possibility of its binding to a remote site and allosterically causing closure of the channel gate at VI 02. Collectively, these results suggests that compound 5D blocks Orail by binding to a site facing the extracellular milieu and its inhibitory mechanism involves the potential channel gate located at VI 02. [0126] T _R 17 differentiation exhibits highest sensitivity to CRAC channel inhibition. To analyze the effect of compound 5D on SOCE in various T cells, SOCE from naive and stimulated T cells cultured under T _H 1, T _H 2, and T _H 17-skewing conditions was measured. Differentiated T _H 17 cells showed highest sensitivity to block of SOCE by compound 5D when compared with na ^' ive, T _H 1 or T _H 2 cells (FIG. 11a). Consistent with these results, IL-17 production by T _H 17 cells was dramatically reduced when compared to IFN-γ and IL-4 production by T _H 1 and T _H 2 cells respectively, in the presence of compound 5D (FIG. 1 lb and c). Next, to determine the effect of inhibition of SOCE on T cell differentiation, na ^' ive T cells were stimulated under T _H 1, T _H 2, and T _H 17-polarized conditions in the presence and absence of compound 5D. In these experiments, compound 5D was included only during the differentiation stage but excluded during restimulation to examine cytokine production.

Compound 5D showed the strongest inhibitory effects on T _H 17 differentiation when compared to that of T _H 1 and T _H 2 cells as judged by their production of IL-17A, IFN-γ, and IL-4, cytokines, respectively (FIG. 12a). Further analysis of lineage-specific transcription factors showed a pronounced reduction of mRNA levels of RORa and RORyt under T _H 17- polarized conditions even with low concentrations of compound 5D, compared to those of T- bet or GATA-3 expression under T _H 1 or T _H 2 -polarized conditions (FIG. 12b). In addition, the mRNA expression levels of molecules involved in T _H 17 pathogenicity including IL-23 receptor (IL-23R), CCR6, and integrin aL (LFA-1) also decreased in compound 5D-treated cells (FIG. 13a). Inhibition of CRAC channel activity by compound 5D did not significantly alter mRNA expression levels of other transcription factors including c-Maf, Runt-related transcription factor 1 (Runxl), aryl hydrocarbon receptor (AHR), interferon-regulatory factor 4 (IRF-4), suppressor of cytokine signalling 3 (SOCS3), ΙκΒζ, basic leucine zipper transcription factor ATP-like (BATF), or hypoxia-inducible factor 1 (HIF1), all of which are known to play an important role in T _R 17 differentiation (FIG. 13b). These data suggest a selective role of Orail -mediated Ca ²⁺ signalling in regulating the expression levels of RORa and RORyt during T _R 17 differentiation.

[0127] Next, whether compound 5D inhibits in vitro expansion/maintenance of antigen- specific effector T cells was investigated. For these experiments, wild-type mice were injected with a peptide derived from myelin oligodendrocyte glycoprotein (MOG ₃₅ _ ₅₅ peptide) emulsified with complete Freund's adjuvant (CFA) and after 7 days, draining lymph nodes were harvested. Cells from the draining lymphnodes were cultured with MOG ₃₅ - ₅₅ peptide plus exogenous IL-12 or IL-23 with or without compound 5D, and examined for IFN-γ- and IL- 17-producing populations. A pronounced reduction in IL- 17 population was observed when compared to IFN-y-producing cells upon compound 5D treatment, suggesting that expansion/maintenance of pre-specified T _R 17 cells also needed CRAC channel activity, in addition to de novo differentiation (FIG. 12c). [0128] Expression of RORa and RORyt can reverse the inhibitory effect of compound 5D on T _H 17 differentiation. So far, the data described herein indicates that inhibition of Ca ²⁺ signalling suppresses T _R 17 differentiation and maintenance. However, it is not clear whether this suppressive effect is caused by indirect effect of blocking cell proliferation or inhibition of specific signalling pathways required for T _H 17 differentiation. Thus, we examined IL-17 ⁺ populations during different division cycles of carboxyfluorescein succinimidyl ester

(CFSE)-labeled cells incubated with compound 5D. In consistence with the important role of Ca ²⁺ signalling in T cell proliferation after stimulation, treatment with compound 5D suppressed cell proliferation (FIG. 13c). However, even within the same division cycle, compound 5D-treated cells showed much lower IL-17 production. These results suggest that suppression of T _R 17 differentiation by compound 5D is derived primarily from a direct block of signalling pathways required for T _R 17 differentiation, independent of cell proliferation.

[0129] Since treatment with compound 5D specifically reduced expression of RORa and RORyt in T _H 17 cells, not other cellular factors (FIG. 13b), we examined if overexpression of these transcription factors can override the inhibitory effect of compound 5D on T _R 17 differentiation. In these experiments, naive T cells were cultured under T _H l7-polarized conditions and transduced with retroviruses encoding RORa and RORyt. As seen in FIG. 14a, a moderate expression of RORa or RORyt slightly enhanced T _H 17 differentiation in control cells. Under these conditions, in compound 5D-treated cells, there was a significant rescue of IL-17A expression in cells expressing either RORa or RORyt. These results further demonstrated that blocking of CRAC channels affects T _R 17 differentiation by inhibiting signalling pathways that selectively regulate the expression of RORa and RORyt because overexpression of these transcription factors did not rescue reduced proliferation observed in compound 5 D -treated cells (data not shown).

[0130] Orail-NFAT-RORa/yt axis plays a crucial role in T _R 17 differentiation. Previous studies have predicted putative NFAT binding elements on the RORyt promoter. In addition, expression of a constitutively active NFATc2 mutant influenced expression of RORyt during early stages of T _H 17 differentiation. Since NFAT family of transcription factors are directly activated by the increase in [Ca ²⁺ ]i, their role in regulating expression of RORa and RORyt was examined. Na ^' ive T cells were stimulated and cultured under T _H 17-polarizing conditions in the presence of cyclosporine A (CsA), a calcineurin blocker that also inhibits nuclear translocation of NFAT. Blocking calcineurin activity during T _R 17 differentiation severely reduced IL-17 ⁺ population consistent with previous observations (FIG. 14b). In addition, both mRNA levels of RORyt and RORa were reduced in the presence of CsA. These results suggested an important role for Ca ²⁺ -NFAT signaling pathway in regulating RORa and RORyt expression. It was next examined whether constitutive active NFAT (CA-NFAT) could rescue the compound 5D treatment-induced defect in RORa and RORyt expression. As seen in FIG. 14c, exogenous expression of CA-NFAT in compound 5D-treated cells during differentiation resulted in a strong recovery of IL-17 ⁺ population as well as expression of RORa and RORyt. To examine a direct role of NFAT in expression of RORa and RORyt, chromatin immunoprecipitation (ChIP) experiments were performed from na ^' ive T cells stimulated and cultured under T _H 17-polarizing conditions with and without compound 5D. These experiments demonstrated a direct recruitment of NFATc2, the predominant NFAT family member in na ^' ive T cells, into the promoters of RORyt and RORa under T _H 17- polarizing conditions, which was markedly reduced in compound 5D-treated cells (FIG. 14d, left two panels). Next, the effect of compound 5D treatment on the chromatin structure of the RORyt and RORa promoters in na ^' ive and T _H l7-polarized CD4 ⁺ T cells was examined.

Acetylation of histone-3 at lysine-9 or lysine- 14 residues (H3K9/K14Ac), an indication of active transcription site and open chromatin structure at the promoter region of RORyt and RORa was measured. These studies demonstrated a severe reduction in H3K9/14 acetylation in compound 5D treated T _H 17-polarized CD4 ⁺ T cells (FIG. 14d, right two panels). Together, these results demonstrated an important role for Orail-Ca ²⁺ -NFAT pathway in the transcription of RORyt and RORa, thereby T _R 17 differentiation. [0131] Orail -deficient T cells show a defect in T _R 17 differentiation. To confirm whether the defective T _H 17 differentiation observed in compound 5D-treated cells was specifically due to block of Orail activity, T _R 17 differentiation of CD4 ⁺ T cells from Orail ^"7" mice was examined. Deficiency of Orail drastically decreased the expression levels of IL-17, RORa and RORyt (FIG. 15a and b). Transcript analysis showed a pronounced reduction in the mRNA expression levels of cytokines and receptors including IL-17A, IL-17F, IL-22, and IL-23R in Orail ^"7" T cells (FIG. 15c). Previously, we showed that Orail ^{" "} na ^' ive T cells do not have any defect in proliferation after TCR stimulation. Therefore, together with the results from compound 5D-treated cells (Fig. 13c), reduced T _H 17 differentiation in Orail ^"7" cells suggests that Orail -mediated Ca ²⁺ entry regulates specific signalling pathways essential for T _R 17 differentiation, which is independent of T cell proliferation.

[0132] To investigate if NFAT can recover the defects observed in T _R 17 differentiation of Orail ^"7" T cells, these cells were transduced with CA-NFAT. Expression of CA-NFAT almost completely recovered expression of RORa and RORyt and moderately rescued IL- 17A expression in Orail ^"7" T _R 17 cells (FIG. 15d). The moderate recovery of IL-17 observed after overexpression of CA-NFAT may be due to induction of anergy in Orail ^"7" T _H 17 cells because unbalanced NFAT signalling via overexpression of CA-NFAT is known to induce non-responsiveness to TCR stimulation in effector T cells. These results together with the rescue experiments from compound 5D-treated cells (FIG. 14d) strongly suggested that expressions of RORa and RORyt are regulated by Orai-Ca ²⁺ -NFAT signalling pathway. Furthermore, the recruitment of NFAT into the promoters of RORa and RORyt was severely decreased in Orail ^"7" T cells cultured under T _H 17-polarized conditions, similar to results obtained from compound 5D-treated cells (FIG. 15e). [0133] Amelioration of EAE by CRAC channel inhibition. To examine the effects of

CRAC channel inhibition on T _H 17 differentiation in vivo, a mouse model of inflammation, EAE, was utilized. Compound 5D treatment greatly ameliorated EAE in vivo; however, it also influenced the survival of mice when injected at 2 mg/kg every alternate day (data not shown). A careful structural analysis revealed the possibility of a trichloride (-CI3) motif to be toxic in vivo. Thus, we examined the potency of various structural analogues of compound 5D lacking this motif and identified compound 5J-4 with comparable levels of blocking activity without any in vivo toxic effect (FIG. 16a, b, and FIG. 17a). Injection of compound 5J-4 into MOG35_ ₅₅ peptide-immunized mice dramatically reduced the symptoms and delayed the onset of EAE demonstrating its protective effects on autoimmunity (FIG. 17b). In consistence with the clinical score, infiltrated mononuclear cell numbers into the CNS were greatly reduced, in particular, the infiltrated CD4 ⁺ population was drastically decreased (FIG. 17c, FIG. 18a). Furthermore, mononuclear cells isolated from the CNS of compound 5J-4 treated animals produced significantly reduced amounts of IL-17A (FIG. 18b).

[0134] To examine if the reduced infiltration of T cells in the CNS was caused by a decrease in T _R 17 differentiation, the function of inflammatory T cells from the draining lymph nodes of control and 5J-4-injected mice was examined. Cells from the draining lymph nodes of EAE -induced control mice proliferated in response to incubation with MOG3 ₅ _ ₅₅ peptide while those from compound 5J-4-treated mice did not (FIG. 17d). The mRNA levels of RORa, RORyt, and IL-17A were drastically decreased in the draining lymph nodes from compound 5J-4-treated mice (FIG. 17e). These results suggest that injection of compound 5J- 4 interfered with T _R 17 differentiation after immunization that led to reduced numbers of inflammatory T cells into the CNS of EAE-induced mice. It was then examined if suppression of Orail activity is also important for sustained expression of IL-17A in human CD4 ⁺ T cells. Human peripheral blood mononuclear cells (PBMCs), were isolated and stimulated and cultured under T _H l7-maintenance conditions by inclusion of IL-Ι β and IL-23. In the vehicle-treated control cells, both IFN-y ⁺ and IL-17A ⁺ populations from CD4 ⁺ T cells (FIG. 17f, left) were observed. Importantly, treatment with compound 5D led to more than 50% reduction in IL-17A ⁺ cells without significantly affecting IFN-y ⁺ population (FIG. 17f). These results demonstrate that similar to murine T cells, Orail plays an important role in maintenance and expansion of human T _H 17 population.

[0135] In this study, Applicants identified a novel class of Orail blockers using high throughput chemical library screen and asked how inhibition of Ca ²⁺ signaling would influence differentiation and effector functions of T cells in vitro and in vivo. Using a combination of NFAT translocation as readout and a cell-line harboring amplified CRAC currents, a novel class of immunomodulators, compound 5 and its analogues, were identified. A more potent analog of the compound 5, compound 5D, blocked CRAC currents generated by WT Orail and a constitutively active mutant of Orail (Orail ^wl76C ) without affecting Orail and STIM1 translocation, indicating that the blocking mechanism directly involves the pore- forming subunit, Orail (FIG. 8f). Further studies of CRAC current inhibition show block by extracellular, but not intracellular, application of compound 5D, suggesting that the binding site is accessible only from the extracellular face of Orail . Comprehensive mutational analysis of all the residues with possible exposure to the extracellular milieu identified the channel gate V102 to be important for the blocking activity of compound 5D (FIG. 8).

[0136] It is remarkable that blocking Orail has a profound effect on differentiation of T _R 17 cells and, to a lesser extent, on T _R I and T _R 2 cells. The high sensitivity of T _R 17 differentiation to compound 5D is readily explained by high dependence of the lineage-specific transcription factors on Orail -NFAT pathway. Notably, the blocking effect of compound 5D was specific to the expression levels of RORa and RORyt, not other transcription factors known to be important for T _R 17 differentiation (FIG. 12b and FIG. 13b). Therefore, exogenous expression of RORa and RORyt could significantly reverse the inhibitory effect of compound 5D on IL- 17 production (FIG. 14a). Previous studies had predicted putative NFAT -binding elements on the RORyt promoter and an involvement of NFAT in IL-17, IL-21, and IL-22 production in T _H 17 cells. In consistence with these studies, blocking NFAT translocation using

cyclosporine A reduced expression of RORa and RORyt in T cells cultured under T _H 17- polarizing conditions (FIG. 14b). Conversely, expression of CA-NFAT showed a strong rescue of the expression of RORa and RORyt in both, compound 5D-treated and Orail ^7-

T _R 17 cells (FIG. 14c and 15d). We also confirmed a recruitment of NFAT onto the promoters of RORa and RORyt, which was reduced in compound 5D-treated or Orail -deficient T cells (Fig. 14d and 15e). Previous studies of transcriptional regulation of RORa and RORyt promoters have suggested an important role for STAT3 and c-Rel transcription factors.

Durant et al used genome -wide ChIP and parallel sequencing (ChlP-seq) experiments from wild-type and STAT3 -deficient T cells cultured under T _H 17-polarizing condition and identified recruitment of STAT3 to both RORa and RORyt promoters (See, for example, Durant et al, Immunity 32, 605:615 (2010)). Consequently, expression levels of RORa and RORyt were significantly reduced in ST AT3 -deficient T cells. More recently, using ChIP and luciferase reporter assays, Ruan et al have shown a direct regulation of RORyt expression by c-Rel. Furthermore, the authors also observed reduced expression of RORa transcripts in c- Rel deficient T cells. Our studies now add another transcription factor, NFAT as a direct regulator of both RORa and RORyt expression. Orail -mediated Ca ²⁺ signalling is not only required for differentiation but also important for maintenance and expansion of pre-existing T _H 17 cells. When compound 5D was included during the maintenance and expansion of preformed T _H 17 cells ex vivo, a stronger suppression of IL-17 production was observed in both murine and human T cells (FIG. 12c and 17f). Collectively, these findings identify the Orail-NFAT-RORa/RORyt-IL17 axis as an important pathway for the differentiation and survival/expansion of T _H 17 cells. [0137] Consistent with the results from in vitro experiments, the structural analogue of compound 5D, compound 5J-4 had a highly potent anti-inflammatory effect in vivo.

Compound 5J-4 treatment blocked infiltration of T cells into the CNS and reduced IL-17- producing cells as well as expression of RORa and RORyt (FIG. 17). Recent screening studies have identified various small molecules that block the function of inflammatory T cells. Digoxin and its derivatives were identified from a small molecule library screen using transcriptional activity of RORyt as readout. In addition, a synthetic ligand, SRI 001 was also identified as a blocker for the transcriptional activities of RORyt and RORa. Both these small molecule blockers showed protective effects on EAE. The molecular mechanism of the anti- inflammatory effect of another small molecule halofuginone was recently elucidated. Instead of acting on orphan receptors directly, halofuginone was shown to activate the amino acid starvation response (AAR) pathway. Halofuginone influenced the functions of T _R I , T _R 2, and T _H 17 cells at high concentrations; however, it selectively suppressed cytokine production by T _R 17 cells at low concentrations and ameliorated the symptoms of EAE when administered in vivo. Although the outcomes of these small molecules are similar (e.g. anti-inflammatory effects), their working mechanisms are distinct from each other. CRAC channel blockers can be considered as general immunosuppressants taking into account their broad role in various immune cells. However, the results described herein suggest that similar to halofuginone, low concentrations of compound 5D and its derivatives can have a stronger blocking effect on inflammatory T _R 17 cells than other T cell subsets due to their high dependence on Ca ²⁺ - NFAT signalling pathway for de novo differentiation, maintenance, and expansion.

[0138] Human patients with non-functional CRAC channels suffer from fatal SCID, which can be rescued by bone marrow transplantation. These results suggest a predominant role for CRAC channels in immune cells. Hence, blockers of CRAC channels are likely to have fewer side effects than widely used immunosuppressive drugs such as cyclosporin A and tacrolimus that block calcineurin activity. The studies described herein reveal that small molecule blockers of CRAC channels can provide a molecular probe for examination of the role of Ca ²⁺ signalling in the immune system, and potentially lead to novel and improved therapeutic approaches to suppress hypersensitive immune responses by suppressing cytokine production in a short term and reducing differentiation and survival/expansion of inflammatory T cells in a long term.

[0139] Reagents and antibodies. Thapsigargin and 2-APB were purchased from EMD Biochemicals. Following antibodies were obtained from eBioscience and utilized for surface and intracellular staining - CD4 (GK1.5), IL-4 (11B11), IFN-γ (XMG1.2), IL-17A

(eBiol7B7) and RORyt (AFKJS-9).

[0140] Plasmids. Full-length cDNA of human Orail subcloned into bicistronic retroviral expression vector pMSCV-CITE-eGFP-PGK-Puro, which allows for simultaneous expression of Orail, GFP and a puromycin resistance gene has been described previously ¹ . Single-point mutants were generated using Quickchange XL site-directed mutagenesis kit (Stratagene) following manufacturer's instructions. All the clones were verified by sequencing. For total internal reflection fluorescence (TIRF) analysis, WT Orail cDNA was fused in frame with pEGFP to have a C-terminal GFP -tag. STIMl-mCherry plasmid has been described previously ¹ ' ² . Orail Q ¹⁰⁸ LD ¹¹⁰ ^ A ¹⁰⁸ AA ¹¹⁰ and D ¹¹⁰ AD ¹¹² >A ¹¹⁰ AA ¹¹² were generated by introducing a Notl site in the primers. Orail AEC2 clone was generated by deletion of amino acids L 202 -P 231 within the second extracellular loop by introduction of a Notl restriction enzyme site. [0141] Cell-lines and transductions. HEK293 cells were obtained from ATCC and cultured in Dulbecco's modified Eagle's medium (DMEM - Mediatech, Hargrave, VA) supplemented with with 10% fetal bovine serum (Hyclone, Logan, UT), 10 mM HEPES, 10 mM Glutamine and 1% penicillin/streptomycin (Mediatech, Hargrave, VA). Cells were transfected at 60- 70% confluency using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. For retroviral transductions, phoenix cells stably expressing gag- pol and ecotropic env (purchased from ATCC) were transfected with plasmids encoding Orai cDNAs to produce ecotropic, replication-incompetent retrovirus using calcium phosphate transfection method. Virus-containing supernatant was collected at 2 and 3 days after

-/- 3

transfection and immortalized Orail ^{" "} murine embryonic fibroblasts (MEFs) or primary T cells were transduced in the presence of 8 μg/ml polybrene. Transduction efficiencies were evaluated visually by GFP expression.

[0142] High throughput screen to identify small molecule blockers of CRAC channels. HeLa cells stably expressing Orail, STIM1 and NFATc2-l-460-GFP (NFAT-GFP) were generated by retroviral transduction with viruses encoding each cDNA and antibiotic selection. Cells were FACS-sorted for selection of GFP ^hlgh population. -5000 cells were plated onto individual 384-well plates coated with poly-L-Lysine (Greiner Bioone). Next day, the cells were washed twice with 2 mM Ca ²⁺ -containing Ringer solution and bathed in the same solution. Compounds were added using a 384-well pin tool (V&P Scientific, Inc.) at a final concentration of 10 μΜ. Cells were incubated with the compounds for 5 mins and then treated with a final concentration of 1 μΜ thapsigargin for ~30 mins, fixed, permeabilized and stained with 4',6-diamidino-2-phenylindole (DAPI), and the coincident GFP and DAPI images were acquired by an automated camera from each well. Every plate included two type of controls; one without any compound to monitor nuclear translocation of NFAT-GFP and another with 100 μΜ 2-APB to visualize block of NFAT-GFP nuclear translocation. Only the plates showing expected patterns for control wells were used for further evaluation. The chemical libraries of Biomol, FDA-approved drugs, MicroSource, Prestwick, Chembridge, Druggable compounds totaling to -85,000 small molecule compounds were used in the primary screen. Candidates from the primary screen were cherry-picked into 96-well plates and a confirmatory screen was performed in triplicates using the protocol described above. Positive candidates from the confirmatory screen were then examined for their blocking efficacy on SOCE using single-cell Ca ²⁺ imaging.

[0143] Single-cell Ca ²⁺ imaging. HeLa O+S cells and fibroblasts were grown directly on UV-sterilized coverslips and loaded with 2 μΜ Fura 2-AM for 45 min. Primary T cells were loaded with 1 μΜ Fura 2-AM for 30 min and attached onto poly-D-Lysine coated coverslips. For [Ca ²⁺ ]j measurements, cells were mounted on a RC-20 closed bath flow chamber (Warner Instrument Corp., Hamden, CT) and analyzed on an Olympus 1X51 epifluorescence microscope with Slidebook (Intelligent Imaging Innovations, Inc.) imaging software. Cells were perfused with Ca ²⁺ -free Ringer's solution, and Ca ²⁺ stores were passively depleted with 1 μΜ of thapsigargin. Store-operated Ca ²⁺ entry (SOCE) was measured by exchanging the Ca ²⁺ -free Ringer's solution with that containing 2 mM CaCl ₂ . At the peak of SOCE, cells were exposed to the same solution containing 10 μΜ (or different concentrations) of individual blockers. Fura-2 emission was detected at 510 nm with excitation at 340 and 380 nm, and the Fura-2 emission ratio (340/380) was acquired at every 5-s interval after background subtraction. For each experiment, 50-100 individual cells were analyzed using OriginPro (Originlab) analysis software. Peak-basal Ca ²⁺ ratio was calculated after subtracting the ratio value after store depletion, before reintroduction of Ca ²⁺ containing Ringer's solution from the maximal value of 340/380 ratio after reintroduction of Ca ²⁺ containing Ringer's solution. In Fig. lc, sustained Ca ²⁺ was calculated as the 340/380 ratio at the time point of 800s after subtracting basal Ca ²⁺ ratio.

[0144] Total internal reflection fluorescence microscopy (TIRFM) analysis. HEK293 cells were transfected with plasmids encoding STIMl-mCherry along with WT Orail-GFP fusion protein encoding cDNAs at a molar ratio of 1 : 1. TIRFM was performed using an Olympus 1X2 illumination system mounted on an Olympus 1X51 inverted microscope. Laser beams from a 488 nm argon ion laser (Melles Griot) and a 594 nm diode laser (Cobolt instruments) were combined and controlled using an Olympus OMAC TIRF dual port condenser and controller system. The angle of the incident light at the interface between the glass coverslip and the aqueous medium was controlled by independently adjusting the position of each laser beam before passing through a 60x oil-immersion objective (NA 1.49, Olympus). The emission was filtered either at D525/50 or 660/50 nm filter (Chroma) and captured by a Hamamatsu ORCA cooled CCD (Roper Scientific) camera. Acquisition and image analysis were performed using Slidebook (Intelligent Imaging Innovations, Inc.) and OriginPro8.5 software.

[0145] Measurement of CRAC currents by whole-cell recording. For recording of CRAC currents, HEK293 cells were co-transfected with plasmids encoding Orail WT or mutant cDNAs in the presence or absence of STIM1 encoding plasmid at a molar ratio of 1 : 1 using Lipofectamine 2000 (Invitrogen, Carlsbad). Cells were used for experiments 24-48 hrs post transfection. Patch-clamp recordings were performed using an Axopatch 200B amplifier (Molecular Devices, California) interfaced to a Digidata 1320A (Axon Instruments, CA) for stimulation and data acquisition. Currents were filtered at 1 kHz with a 4-pole Bessel filter and sampled at 5 kHz. Recording electrodes were pulled from borosilicate glass capillaries (WPI, Sarasota, Fl) using a Flaming Brown pipette puller (Sutter Instrument, CA) to a final resistance of 2-7 ΜΩ. Stimulation, data acquisition, and analysis were performed using pCLAMP8 and Origin software. The standard extracellular Ringer solution contained (in mM): 145 Cs-aspartate, 4.5 KC1, 6 CaCl ₂ , 10 D-glucose, and 10 Na-Hepes (pH 7.35). The standard internal solution contained (in mM): 145 Cs-glutamate, 8 MgCl ₂ , 12 EGTA, and 10 Cs-Hepes (pH 7.3). Unless otherwise stated the cell membrane was held at 0 mV and pulses were applied between -110 mV to +115 mV at 15 mV intervals for 250 ms.

[0146] Analysis of patch clamp data. Ionic currents from cells expressing WT and mutant channels were recorded using only the analog compensation of the membrane linear components. In some cases (mutant channels) the blocker(s) had no inhibitory effects and the current traces could not be corrected for leak currents. The first 1 ms of recorded data following the onset of the voltage pulses, was not included in the fitting to minimize the effect of uncompensated membrane capacitance on the estimated time course of the current. For the I-V, steady state currents measured at the end of the pulse were used. [0147] T cell isolation and differentiation. CD4 ⁺ T cells were purified from single-cell strained suspensions prepared by mechanical disruption of spleens and lymph nodes of adult mice after magnetic sorting with CD4 ⁺ beads (Invitrogen). CD4 CD25 ^" naive T cells were selected by CD25 MACS positive selection (Miltenyi Biotech). For effector T cell differentiation, cells were stimulated with 2 μg/ml of anti-CD3 (Bio X cell) and anti-CD28 (Bio X cell) antibodies for 48 hours on a plate coated with 0.1 mg/ml of goat anti-hamster (MP Biomedicals). CD4 CD25 T cells were cultured with 10 μg/ml anti-IL-4 (Bio X cell), and 10 ng/ml IL-12 for T _R I differentiation, 20 μg/ml anti-IFN-γ (Bio X cell), 2.5 μg/ml anti- IL-12 and 10 ng/ml IL-4 (Peprotech) for T _H 2 differentiation, and 10 μg/ml anti-IL-4, 20 μ /ηι1 anti-IFN-γ, 30 ng/ml IL-6 (Peprotech), 3 ng/ml TGF-β (Peprotech) and 10 ng/ml IL-23 (R&D Systems) for T _H 17 differentiation. On day 4, differentiated T cells were restimulated with 20 nM phorbol myristate acetate (PMA) and 1 μΜ ionomycin for cytokine analysis.

[0148] EAE induction in mice. All animals were maintained in pathogen-free barrier facilities and used in accordance with protocols approved by the Institutional Animal Care and Use Committee at the University of California, Los Angeles. For induction of EAE, mice were immunized subcutaneously on day 0 with 100 μg of MOG35-55 peptide (N- MEVGWYRSPFSRVVHLYRNGK-C, Genscript) emulsified in complete Freund's adjuvant (CFA, Difco) supplemented with 5 mg/mL of Mycobacterium tuberculosis H37Ra (Difco). These mice were also injected i.p. with 200 ng/mouse of pertussis toxin (List Biological Laboratories) on day 0 and 2. EAE was scored according to the following clinical scoring system: 0, no clinical signs; 1, limp tail; 2, partial hind leg paralysis; 3, complete hind leg paralysis or partial hind and front leg paralysis; 4, complete hind and partial front leg paralysis. Mice were injected i.p. with either the vehicle (DMSO, 50 μΐ ), compound 5D (1 mg/kg) or 5J-4 (2 mg/kg) every alternate day starting from day 0.

[0149] T cell analysis. Draining lymph nodes were collected 14 days after EAE induction, and cell suspensions were prepared. For proliferation analysis, cells were distributed in a 96- well plate at 1 x 10 ⁶ cells/ml concentration and cultured in media. Cell suspensions were restimulated with 20 μg/ml of MOG35-55 for 2 days at 37°C with 5% C0 ₂ and humidified atmosphere. All the cultures were run in triplicates. After 48 h, cultures were pulsed with 1 μΟΛνεΙΙ [ ³ H]-thymidine (Amersham Biosciences) for an additional 16-18 h. After this treatment, cells were harvested, lysed, and acid precipitated. Finally, [ ³ H]-thymidine incorporation was determined by liquid β-scintillation counting (Beckman). For intracellular staining, cells were distributed in a 12-well plate at 1 x 10 ⁶ cells/ml concentration and cultured with 20 nM PMA and 1 μΜ ionomycin for 5h. For Real-time PCR, the total RNA of draining lymph nodes was extracted with TRIzol reagent (Gibco-BRL) following the manufacturer's instructions. For ex vivo experiments, draining lymph nodes were collected 7 days after EAE induction, and cell suspensions were prepared. Cells were distributed in a 12- well plate at 1 x 10 ⁶ cells/ml concentration and cultured for four more days with the MOG peptide (20 μg/ml) together with exogenous IL-6 and IL-23 or IL-12, in the presence or absence of compound 5D.

[0150] Isolation of mononuclear cells from the central nervous system. To isolate mononuclear cells from phosphate-buffered saline (PBS)-perfused spinal cords and brain, tissues were digested in collagenase and DNase I (Roche) for 30 min at 37°C, and cells were separated on a 40-80% Percoll gradient by centrifuging at 500g for 30 min. Cells at the 40- 80% interface were collected. For intracellular cytokine staining, cells were stimulated with 20 nM PMA and 1 μΜ ionomycin in the presence of 3 μg/ml brefeldin A (eBioscience) for 5 h and stained for CD4, IFN-γ, and IL- 17A.

[0151] Histology. Following perfusion with PBS, spinal cords were removed and fixed with 4% paraformaldehyde in PBS at 4°C overnight. Tissues were blocked in paraffin wax.

Sections (5 μιη) were cut from paraffin block. Paraffin-embedded sections were stained with H&E and Luxol Fast Blue for visualization of inflammatory infiltrates and demyelination. [0152] Real-time quantitative PCR. cDNA was synthesized from total RNA using oligo(dT) primers and Superscript III First-Strand cDNA synthesis kit (Invitrogen). Real-time PCR was performed using an iCycler IQ5 system (Biorad) and SYBR Green dye (Sigma) using the primers described in Table 2. Threshold cycles (C _T ) for all the candidate genes were normalized to the C _T values for beta-actin housekeeping gene control to obtain AC _T . The specificity of primers was examined by melt-curve analysis and agarose gel

electrophoresis of PCR products.

Table 2

hOrailE106D ATG GTG GCA ATG GTG GAC GTG AGC GTC CAG CTG CAC GTC CAC CAT

CAG CTG GAC GCT TGC CAC CAT

hOrailL95A AGC CGG ACC TCG GCT GCG CTC TCC GGC GAA GCC GGA GAG CGC AGC CGA

GGC TTC GCC GGT CCG GCT

hOrailV102C TCC GGC TTC GCC ATG TGT GCA ATG CAC CTC CAC CAT TGC ACA CAT GGC

GTG GAG GTG GAA GCC GGA

hOrailV102A TCC GGC TTC GCC ATG GCG GCA ATG CAC CTC CAC CAT TGC CGC CAT GGC

GTG GAG GTG GAA GCC GGA

RORap ATCCTCCCTCTC CTCTTTAACC AACGCGGATAACCGGATTTGT ChIP PCR

RORytp AGACACCACCCAAGACAGATT AAACCACAGCTACAGCCGCGG ChIP PCR

[0153] Chromatin immunoprecipitation (ChIP). After culturing naive T cells under T _R 17- polarizing conditions with plate-coated anti-CD3 and anti-CD28 antibodies for 16 hours, cells were fixed for 8 min at room temperature with 1 :37 dilution of 37.1 % formaldehyde

(Calbiochem), neutralized with 1 :20 dilution of 2.5 M glycine and washed twice in ice-cold phosphate buffered saline. Cells were lysed in 500 μΐ of low salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, PH 8.1, 150 mM NaCl), and chromatin sheared by sonication to generate 200-800 bp DNA fragments. For immunoprecipitation with anti-acetyl-Histone H3-K14 (Cat. #07-353; MiUipore), anti-acetyl-Histone H3-K9 (Cat. #07- 352; MiUipore), and anti-NFATl antibody (clone 67.1), chromatin from lxlO ⁷ whole-cell equivalents was used. Chromatin was diluted in low salt washing buffer and

immunoprecipitation was performed by overnight incubation with the indicated antibodies, followed by 2 hours (at 4°C) incubation with 3 μg of Protein A sepharose CL-4B (GE Healthcare). Immunocomplexes were captured and washed twice for 5 min each with low salt washing buffer, high salt washing buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, PH 8.1, 500 mM NaCl), LiCl washing buffer (0.25 M LiCl, 1% NP-40, 0.1% deoxycholate, 1 mM EDTA, 10 mM Tris 8.1), and TE buffer (Tris-HCl 10 mM, EDTA 1 mM). Beads were resuspended in TE and then treated with 5 μΐ of 1 mg/ml RNase A for 30 mins at 37°C, and, finally, with proteinase K (0.2 mg/ml, Roche) overnight at 37°C. The samples were heated to reverse crosslinking at 65°C overnight. DNA was purified using Phenol-chloroform extraction. Selected DNA sequences were quantified by real-time quantitative PCR using primers described in Table 2. ChIP data are presented as the percentage recovery of input.

[0154] Human PBMC culture. Mononuclear cells were obtained from the CFAR Virology core Laboratory at UCLA that were prepared from buffy coats from healthy, unidentified adult donors using FicollPAQUE gradients. PBMCs were activated with anti-CD3/CD28 beads (Miltenyi Biotech) and cultured in T cell media (DMEM containing 20% Fetal bovine serum and 1% Pen-Strep) supplemented with 20 U/mL IL-2 (Peprotech), 10 ng/mL IL-Ι β, and 10 ng/mL IL-23 (eBioscience) in the presence or absence of 20 μΜ of compound 5D. Cells were expanded with fresh media, cytokines and compound 5D every alternate day. On day 6, cells were extensively washed and activated with 20 nM of PMA, 1 μΜ of ionomycin, and Brefeldin A (3 μg / ml) for 5 hrs, surface stained with anti-CD4-FITC, and intracellularly stained with anti-IL-17A-APC and anti-IFN-γ-ΡΕ. CD4-FITC-positive cells were gated for analysis. For flow cytometry, the following human specific antibodies were used: CD4-FITC (OKT4, eBioscience), IL-17A-APC (eBio64CAP17, eBioscience) and IFN-y-PECy7 (45. B3, eBioscience).

Example 3: Immunosuppression in mammals with Systemic lupus erythematosus (SLE)

[0155] Systemic lupus erythematosus (SLE) is caused by complex communications between hypersensitive, self-reactive innate and adaptive immune cells. There is a possibility that blocking Orail, the pore component of CRAC (Ca ²⁺ -re lease-activated Ca ²⁺ ) channels can be developed as a therapeutic method to shut down the innate and adaptive immune system temporally to relieve the symptoms, and to increase immune tolerance in a long term. This hypothesis can be tested by blocking the activity of Orail that is crucial for functions of various innate and adaptive immune cells including mast, B, and T cells. In addition, to induce long-term immune tolerance, one can take advantage of new findings (described herein) that blocking the activity of CRAC channels induces enhanced survival and differentiation of regulator T cells that are key players in immune tolerance.

[0156] Triggering of Ca ²⁺ signalling though CRAC channels by receptor stimulation is a key step for proliferation and cytokine production of immune cells. Applicants have recently identified and named Orail as a long-sought pore component of the CRAC channel.

Applicants have shown that human patients with a missense mutation in the Orail gene have lethal, severe combined immune deficiency (SCID) emphasizing its predominant and specific role in immune cells. Furthermore, analysis of Orail -null mice has shown that Orail is critical for B, T, and mast cell activation by shutting down the majority of innate or adaptive immune systems. These results strongly suggest that blocking of Orail can be considered as therapy targeting diverse, complicated autoimmune diseases that are caused from

hyperactive, self-reactive immune cells. [0157] Identification of Orail provides a molecular target for development of drugs that can block immune responses and ameliorate the symptoms of autoimmune diseases in a short term as exemplified in the use of strong immunosuppressive regimens including cytotoxic drugs and glucocorticoids. However, questions remain for the treatment of

immunosuppressant because the patients will have a weak immune defense during the period of treatment and remission of the disease may occur. Unexpectedly, novel findings described herein indicate that blocking of Orail activity plays a positive role in differentiation of inducible (adaptive) regulatory T cells (iTregs or aTregs) and homeostatic growth of natural regulatory T cells (nTregs). Inhibition of Ca ²⁺ entry by Orail deficiency and treatment of a small molecule blocker polarized diverse T cell subsets (e.g. Thl7) into regulatory T cells expressing very high levels of Foxp3, a critical transcription factor for regulatory T cell development. Importantly, T cells expressing Foxp3 generated by blocking Orail were functionally active based on the suppression assays to test the functions of regulatory T cells. Likewise, Orail deficiency increases nTreg populations in the peripheral lymphoid organs and functionally Orail -deficient nTregs were undistinguishable with normal nTregs.

[0158] Analysis of SCID patients with a defect in Orail and knockout mice showed that Orail activity is crucial for the functions of diverse immune cells. These data indicate that it is highly possible that blocking Orail will relieve the symptoms of SLE during the treatment. This idea is further supported by the results showing SLE T cells are prone to get activated by sensitized T cell receptor signaling and Ca ²⁺ entry those are crucial for the disease onset.

Induction of long-term immune tolerance by inhibition of Orail is a novel aspect, however, it has a high chance of success because; (i) The function of regulatory T cells and their therapeutic potential in SLE has been already shown, (ii) Applicants' preliminary data show that blocking Orail activity can induce more Tregs with much higher expression levels of Foxp3 than normal Tregs. (iii) Applicants' results show that the frequency of nTregs were increased by Orail deficiency, (iv) The preliminary results showed that in an animal model of autoimmune diseases such as multiple sclerosis (EAE animal model), very short period or even single injection of a small molecule blocker for Orail drastically ameliorated the symptoms, indicating that blocking of Orail not only blocked immune responses temporally, but also enhances immune tolerance in a long term. Together, these short- and long-term effects of blocking Orail provide an ideal and novel therapeutic strategy for SLE. To test this hypothesis two experimental tools such as treatment of a specific small molecule blocker of Orail and a knockout mouse strain developed to delete Orail gene specifically in T or B cell lineages can be used.

[0159] To determine the mechanism of how suppression of Orail activity induces differentiation of regulatory T cells, the signaling pathways that influence regulatory T cell development by blocking of Orail . In theory, the decreased levels of Ca ²⁺ signaling by suppression of Orail should influence the downstream of Ca ²⁺ signaling pathways such as calcineurin or a transcription factor, nuclear factor of activated T cells (NFAT). It is contemplated that lower recruitment levels of NFAT polarize T cells into regulatory T cells because abundant levels of nuclear NFAT is required for differentiation of other T cell subsets. If the promoter of Foxp3 is not as sensitive to the decreased levels of NFAT as other promoters, this will polarize T cells into cells expressing Foxp3 in a passive manner.

Accordingly, this hypothesis can be checked by measuring expression levels of NFAT and recruitment of NFAT into the Foxp3 promoter using chromatin immunoprecipitation in Orail -deficient T cells or with small molecule treatment. Alternatively, lowered Ca ²⁺ signaling may actively influences other transcription factors such as STAT5, Runxl, c-Rel, p65, or SMAD2/3 that are crucial for the expression of Foxp3 and TGF-β signaling. This alternate possibility can be checked by chromatin immunoprecipitation, quantitative PCR, and immunoblotting.

[0160] To determine the role of Orail in T cell differentiation, na ^' ive wild-type and Orail - deficient T cells were stimulated in combination of transforming growth factor (TGF)-P and/or IL-6 that are critical regulators for differentiation of Tregs and Thl7 cells.

Surprisingly, it was found that Orail deficiency induced high levels of Foxp3 expression without adding any cytokines or skewing antibodies (FIG. 19, left, indicated as "No addition"). When TGF-β was added, approximately 10% of Foxp3 ⁺ cells (IL6, 0 ng/ml) in WT cells were observed. In Orail -null cells, Foxp3 expression was very robust. Almost 60%> cells were expressing Foxp3. Adding IL-6 into this condition decreased Foxp3 expression in WT T cells because there was more Thl7 cell differentiation when we checked by IL-17 and RORyt (retinoic acid orphan receptor yt) expression (data not shown). Even in the conditions of Thl7 differentiation (TGF-β plus 30-60 ng/ml of IL6), a strong Foxp3 expression (average approximately 20%) was observed in Orail -deficient cells. These results indicate that lowering Ca ²⁺ via Orail deficiency induces more Foxp3 expression in any given conditions. This data was recapitulated with a small molecule blocker for Orail, SKF96365 (FIG. 20). Like Orail -deficient cells, treatment of SKF96365 strongly polarized native T cells into cells expressing Foxp3 (top and middle panels). Not only the population of Foxp3 cells increased, the expression level of Foxp3 in a single cell drastically increased (Fig. 20, bottom, overlay of Foxp3 expression between control and SKF96365 -treated cells).

[0161] To dissect the signaling pathways that influence regulatory T cell development by blocking of Orail, the following experimental plan can be utilized. The decreased levels of Ca ²⁺ signaling by suppression of Orail should influence the downstream of Ca ²⁺ signaling pathways such as calcineurin or a transcription factor, nuclear factor of activated T cells (NFAT). It is contemplated that lower recruitment levels of NFAT turn T cells into regulatory T cells because abundant levels of nuclear NFAT is required for differentiation of other T cell subsets (e.g. Thl7). The essential role of NFAT in diverse T cell differentiations has been emphasized. However, how these promoters are differentially sensitive to reduced levels or Ca ²⁺ entry or NFAT nuclear accumulation has not been studied. If the promoter of Foxp3 is not as sensitive to lower levels of NFAT as the promoter of RORyt, a key transcription factor for Thl7 differentiation, this will skew more T cells into Tregs if Orail activity is blocked. Accordingly, this hypothesis can be checked by measuring expression levels of NFAT by immunoblots and recruitment of NFAT into the Foxp3 promoter together with the RORyt promoter using chromatin immunoprecipitation.

[0162] Alternatively, lowered Ca ²⁺ signaling may positively influence other transcription factors such as STAT5, Runxl, c-Rel, p65, or SMAD2/3 that are crucial for the expression of Foxp3 and TGF-β signaling in addition to NFAT. This possibility can be checked by determining the expression levels of these transcription factors and chromatin

immunoprecipitation in Orail -deficient T cells or after treatment of Orail blockers. In addition, to determine the differences between WT and Orail -deficient T cells after stimulation, microarray in nonskewing conditions (ThN) (data not shown) was performed. These analyses showed that SMAD2 and SMAD3 are highly upregulated in Orail -deficient T cells. The possibility of a relation between SMADs and Ca ²⁺ signaling mediated by Orail to regulate the expression of Foxp3 can be checked.

[0163] The mechanism of how Orail deficiency increases natural regulatory T cell population can be determined. The preliminary data showed that Orail -deficient mice harbor more natural regulatory T cells in the peripheral lymphoid system. One can elucidate the molecular mechanism of how blocking of Orail activity influences regulatory T cell homeostasis using the experimental plan described herein. The homeostatic mechanism of regulatory T cells has not been investigated in detail. However, understanding of Treg homeostasis is extremely important to induce immune tolerance towards autoimmune diseases. Applicants' recent results showed that Orail -deficient T cells have strong resistance to cell death due to decreased levels of apoptotic signals. It is contemplated that the decreased levels of Ca ²⁺ signaling in regulatory T cells provides strong resistance to cell death, therefore increases the number of Tregs. To test this possibility, the cell death levels of Orail -deficient Tregs can be checked, and the number of Tregs after treatment of a small molecule blocker for Orail can be determined. These studies will provide a basis to develop a method using transfer of regulatory T cells.

[0164] Analysis of Orail knockout mice showed that nTreg population increased in the peripheral lymphoid organs (FIG. 21). Interestingly, nTreg percent in the thymus was not increased indicating that Orail deficiency does not benefit development of Tregs in the thymus. However, in the peripheral lymphoid system such as lymph nodes, a drastic increases more than 3-folds were observed. These results imply that lowered Ca ²⁺ entry benefits homeostatic growth or survival of nTregs in the peripheral system, rather than acts on the developmental status of nTregs.

[0165] The homeostatic mechanism of regulatory T cells has not been investigated extensively. However, understanding of homeostasis of Tregs is extremely important to induce immune tolerance towards autoimmune diseases. Applicants' recent results showed that Orail -deficient T cells have strong resistance to cell death due to decreased levels of apoptotic signals. It is contemplated that the decreased levels of Ca ²⁺ signaling in regulatory T cells provides strong resistance to cell death, therefore increases the number of Tregs. To test this possibility, the cell death levels of Orail -deficient Tregs can be checked. Rhe number of Tregs after treatment of a small molecule blocker for Orail to support the results from Orail -deficient mice can also be determined. In addition to in vitro cell death analysis after purification of Tregs, ex vivo analysis of cell death shows a clear correlation with in vivo cell death assays. Thus, the cell survival rate using ex vivo analysis of culturing the lymphocytes or splenocytes with or without cytokines can be checked. After culturing cells from WT and Orail -deficient mice, the frequency of Tregs will be determined by CD4, CD25, and Foxp3 staining at 24 and 48 hours. [0166] Next, the survival of nTregs after adoptive T cell transfer can be measured to prove that the increased population of nTregs is due to the increased levels of resistance to cell death. nTregs can be purified from the control and Orail -deficient mice, and transfered into the immune-compromised mice after labeling with CFSE. At week 1 and 2, the mice can be dissected to check the survival by CFSE cells and proliferation rate. These studies will provide an insight to develop an enhanced method using transfer of regulatory T cells.

[0167] In addition to a change in cell survival, it is also possible that Orail deficiency change in IL-2 and IL-7 signalling that are known to be important for homeostasis of Tregs. The expression levels of IL-2 and IL-7 receptors in Orail -deficient CD4 ⁺ Fopxp3 ⁺ cells will be checked to determine the enhanced levels of Orail -deficient Tregs may be caused by the enhanced IL-2 and IL-7 signalling.

[0168] The possibility that blocking Orail can be considered as a novel therapy to treat SLE can be checked using the following experimental plan. The effect of treatment of a CRAC channel blocker will be tested using lupus-prone mouse strains. The goals of these experiments are to check blocking of Orail ameliorates the onset of lupus, and to determine the dose and duration of the treatment to induce immune tolerance. It is contemplated that inhibition of Orail during the onset of lupus will induce immune tolerance by increasing the number and frequency of regulatory T cells. Therefore, regulatory T cell populations can be checked periodically in comparison of non-treated control animals. In addition, a mouse model of lupus in a setting of Orail deficiency can be generated. Currently Applicants have used a conventional Orail knockout mouse model to have a preliminary data. However, the low survival rate of these mice delays our further progresses. To tackle this problem, we have generated an Orail knockout mouse model that is conditionally targeted in T cells

(unpublished). By cross-breeding and generation of animal models of lupus with Orail deficiency in specific immune cell subtypes, one can determine how suppression of Orail activity can influence the disease settings and the regulatory T cell populations. Furthermore, to determine the role of Orail in B cells in an onset of lupus, an animal model of Orail knockout in B cells can be generated. These studies are important to determine the role of the recently identified molecule Orail in autoimmune diseases and, to check the possibility whether one can consider blocking Orail activity as therapy for SLE.

[0169] These studies contain a novel concept to test a possibility of development of immune tolerance in a shot- and long-term. In addition, understanding the role of Ca ²⁺ signaling via Orail in Tregs is crucial for basic knowledge of development and homeostasis of Tregs.

[0170] Amelioration of autoimmune diseases by blocking Orail activity was expected because Orail plays a major role in effector T cell functions. As a simple autoimmune disease model, first, the effect of blocking Orail using an animal model of multiple sclerosis, experimental autoimmune encephalomyelitis (EAE) was checked. As expected, a great reduction in EAE symptoms after treatment of SKF96365 for 15 days during the onset of EAE was observed (Fig. 22, left). In addition, surprisingly, it was found that a single injection of SKF96365, a known CRAC channel inhibitor not typically used in vivo because of known side-effects, at the early immunization process greatly reduces the symptoms (right). These results indicate that blocking of Orail at the initial stage of diseases can induce a robust immune tolerance most like by induction of more regulatory T cells based on our in vitro results. Accordingly, the increased population of Tregs in the peripheral lymphoid organs and central nerve system of SKF96365 -treated mice after EAE induction was observed. In summary, these results strongly suggest that blocking Orail can be considered as an effective therapy for autoimmune diseases.

[0171] To determine the Treg population after blocking Orail in lupus-prone mice, the following experimental plan can be used. The effect of treatment of a CRAC channel blocker can be tested using lupus-prone mouse strains. The goals of these experiments are to check blocking of Orail ameliorates the onset of lupus, and to determine whether the treatment for a short period induces immune tolerance. It is contemplated that inhibition of Orail during the onset of lupus will induce immune tolerance by promoting the differentiation or growth of regulatory T cells. Therefore, regulatory T cell populations can be checked periodically in comparison of non-treated control animals. Diverse lupus animal models such as MRL/lpr and (NZBxNZW)Fi mice can be tested. The mice will be treated at the initial stage of the disease (3-4 weeks of age). After treatment of SKF96365 and compounds of Formula I as described herein, the mice can be analyzed for the symptoms of lupus (e.g. production of autoantibodies and inflammatory cytokines (e.g. TNF-a, MCP-1, IL-6, IL-12, IFN-γ, and IL- 10), splenomegaly, and spontaneous lymphocyte activation. In addition, these mice will be dissected and analyzed for the population of regulatory T cells.

[0172] The generation and analysis of Orail -deficient lupus-prone mice can be performed according to the following experimental plan. In addition to use of Orail chemical blockers, a mouse model of lupus in a setting of Orail deficiency can be generated. Currently Applicants have used a conventional Orail knockout mouse model to have a preliminary data. However, the low survival rate of these mice delays progress. To tackle this problem, an Orail knockout mouse model where the Orail gene is conditionally targeted in T cells was generated. By generation of animal models of lupus with Orail deficiency in specific immune cell subtypes, it can be determined how suppression of Orail activity can influence the disease settings in a long term and the populations of regulatory T cell can be determined. Furthermore, to determine the role of Orail in B cells in a disease setting of lupus, an animal model of Orail knockout in B cells by crossbreeding with a mouse strain with CD19-Cre can be generated. These studies are important to determine the role of the recently identified molecule Orail in autoimmune diseases and, to check the possibility whether one can consider blocking Orail activity as therapy for SLE. A minor concern about generation of lupus-prone Orail -deficient mice is a genetic background since MRL/lpr and (NZBxNZW)Fi mice are not available as C57BL/6 background. To resolve this issue, one can first try with a lupus-prone mouse model with a C57BL/6 background (e.g. TLR7.Tg.6). The TLR7.Tg.6 strain displays increased TLR7 expression, accumulation of anti-RNA autoantibodies, upregulation of type I IFN gene signature and an autoimmune syndrome resembling human SLE. After generation of Orail -deficient lupus-prone mice, lupus phenotypes can be analyzed together with determination of regulation of regulatory T cell populations. [0173] The striking effect of the Orail blocker in autoimmune disease such as EAE (FIG. 22) may be explained by two hypotheses. First, naive T cells may preferentially differentiate into regulatory T cells when Orail is blocked. Second, there is a possibility that blocking of Orail may influence dendritic cell functions since it is known that innate immunity plays a pivotal role in the onset of lupus. To check whether the Orail deficiency influences other innate immunity, the innate immunity such as downstream events of various ligands for Tolllike receptors using Orail -deficient cells can be checked. These results will provide an important clue about the crosstalk between Ca ²⁺ signaling and the innate immune system. In addition, the results from conditional Orail knockout mice will provide strong evidence that the results are derived from blocking the intrinsic properties of T cells. [0174] These studies contain a novel concept to test the possibility of development of immune tolerance in a shot- and long-term. In addition, understanding the role of Ca ²⁺ signaling via Orail is crucial for basic knowledge of T cell activation. These studies are directly related with development of therapy for SLE because we will test the possibility that Orail can be an excellent drug target to ameliorate SLE in a short and long term. [0175] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[0176] Accordingly, the preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims.