CHALLIS GREGORY (GB)
LAURETI LUISA (FR)
SONG LIJIANG (GB)
LEBLOND PIERRE (FR)
UNIV WARWICK (GB)
AGRONOMIQUE INST NAT RECH (FR)
AIGLE BERTRAND (FR)
CHALLIS GREGORY (GB)
LAURETI LUISA (FR)
SONG LIJIANG (GB)
LEBLOND PIERRE (FR)
WO2000000618A2 | 2000-01-06 | |||
WO2006045063A2 | 2006-04-27 |
EP0791655A2 | 1997-08-27 |
CHALLIS; HOPWOOD, PROC NATL ACAD SCI U S A, vol. 100, no. 2, 2003, pages 14555 - 14561
IKEDA ET AL., NAT BIOTECHNOL, vol. 21, 2003, pages 526 - 531
MC LEOD ET AL., PROC NATL ACAD SCI USA, vol. 103, 2006, pages 15582 - 15587
UDWARY ET AL., PROC NATL ACAD SCI U S A, vol. 104, 2007, pages 10376 - 10381
OLIYNYK ET AL., NAT BIOTECHNOL, vol. 25, 2007, pages 447 - 453
LAUTRU ET AL., NAT CHEM BIOL, vol. 1, 2005, pages 265 - 269
COSAR ET AL., C R HEBD SEANCES ACAD SCI, vol. 234, 1952, pages 1498 - 1499
PINNERT-SINDICO, ANN INST PASTEUR (PARIS), vol. 87, 1954, pages 702 - 707
CHOULET ET AL., MOL BIOL EVOL, vol. 23, 2006, pages 2361 - 2369
BARONA-GOMEZ ET AL., MICROBIOLOGY, vol. 152, 2006, pages 3355 - 3366
CHALLIS, MICROBIOLOGY, vol. 154, 2008, pages 1555 - 1559
YADAV ET AL., NUCLEIC ACID RESEARCH, vol. 31, no. 13, 2003, pages 3654 - 3658
KARRAY ET AL., MICROBIOLOGY, vol. 153, no. 12, 2007, pages 4111 - 4122
WILSON ET AL., J BACTERIOL, vol. 183, 2001, pages 3468 - 3475
ANTON ET AL., J BACTERIOL, vol. 186, 2004, pages 2567 - 2575
KUSCER ET AL., JBACTERIOL, vol. 189, 2007, pages 4756 - 4763
HANAHAN, D., J MOL BIOL, vol. 166, 1983, pages 557 - 580
MACNEIL ET AL., GENE, vol. 111, 1992, pages 61 - 68
PAGET ET AL., J BACTERIOL, vol. 181, 1999, pages 204 - 211
WILKINSON ET AL., J MOL MICROBIOL BIOTECHNOL, vol. 4, 2002, pages 417 - 426
KIESER ET AL., PRACTICAL STREPTOMYCES GENETICS, 2000
PERNODET ET AL., J GEN MICROBIOL, vol. 139, 1993, pages 1003 - 1011
LEBLOND ET AL., MOL MICROBIOL, vol. 19, 1996, pages 261 - 271
PANG, ANTIMICROB AGENTS CHEMOTHER, vol. 48, 2004, pages 575 - 588
BUNET ET AL., J BACTERIOL, vol. 190, 2008, pages 3293 - 3305
YADAV ET AL., J MOL BIOL, vol. 328, 2003, pages 335 - 363
DONADIO; KATZ, GENE, vol. 111, 1992, pages 51 - 60
BISANG ET AL., NATURE, vol. 401, 1999, pages 502 - 505
KEATINGE-CLAY, CHEM BIOL, vol. 14, 2007, pages 898 - 908
REID ET AL., BIOCHEMISTRY, vol. 42, 2003, pages 72 - 79
KARRAY ET AL., MICROBIOLOGY, vol. 153, 2007, pages 4111 - 4122
KAMRA ET AL., NUCLEIC ACIDS RES., vol. 33, 2005, pages W220 - 225
KIM ET AL., JBIOL CHEM, vol. 277, 2002, pages 48028 - 48034
MENGES ET AL., APPL MICROBIOL BIOTECHNOL, vol. 77, 2007, pages 125 - 134
See also references of EP 2456777A2
CLAIMS 1. Compounds having the following the general formula (H-A) (H-A) wherein A represents a sugar Cs-C6, preferably a Cs-C6 amino sugar, more preferably an amino sugar selected from the group comprising the amino sugars represented by the following formulae: (A3) and (A4), and B represents an hydrogen atom, or a linear or branched, substituted or not, saturated or not, C1-C12 alkyl, preferably a linear or branched, substituted or not, saturated or not, Cs- Cio alkyl, more preferably a linear or branched, substituted or not, saturated or not, C6-Cs alkyl, said compounds being in the form of a racemate, or anyone of their enantiomers or diastereomers, or any one of the tautomers of said racemates and of said enantiomers and diastereomers, and their respective pharmaceutically acceptable salts. 2. Compounds according to claim 1, characterised in that B represents: wherein Rl, R2, and R3 independently from each other, represent : an hydrogen atom, or a linear or branched, substituted or not, saturated or not, Ci -C 12 alkyl, preferably a methyl group, 3. Compounds according to claim 1 or 2, said compounds being selected from the group comprising : (Ha) (lie) (He), 4. Process for producing compounds according to anyone of claims 1 to 3, comprising a step of activating the silenced large type I polyketide synthase (PKS) gene cluster of a microorganism preferably belonging to the family of Streptomycetaceae : • either by artificially over-expressing a transcriptional activator, • or by culturing said microorganism in a specific medium allowing the expression of said transcriptional activator, at a level sufficient to activate the expression of the biosynthetic genes, said type I polyketide synthase (PKS) gene cluster being preferably located at about 500 Kbases from the end of the right arm of the chromosome of said microorganism, and said microorganism being preferably Streptomyces ambofaciens, in particular Streptomyces ambofaciens deposited at the American Type Culture Collection (ATCC) under the number ATCC 23877. 5. Process according to claim 4, wherein said step of activation is carried out by over expressing a transcriptional activator belonging to the LAL family, preferably said transcriptional activator being not, or substantially not, expressed, by said microorganism under normal conditions. 6. Process according to claim 4 or 5, wherein said transcription activator comprises or consists of the amino acid sequence SEQ ID NO 1. 7. Modified microorganism producing compounds according to anyone of claims 1 to 3, preferably said modified microorganism being obtained by permanently expressing a transcriptional activator in a natural microorganism, said transcriptional activator being substantially not, or not, expressed in said natural microorganism. 8. Modified microorganism according to claim 7, wherein said microorganism constitutively expresses genes contained in the large type I polyketide synthase (PKS) gene cluster, said type I PKS gene cluster being preferably located at about 500 Kbases from the end of the right arm of the chromosome of said microorganism, said microorganism being preferably Streptomyces ambofaciens deposited at the ATCC under the number ATCC 23877. 9. Modified microorganism according to claim 7 or 8, wherein the transcriptional activator belongs to the LAL family, and in particular wherein said transcriptional activator comprises or consists of the amino acid sequence SEQ ID NO 1. 10. Modified microorganism according to anyone of claims 7 to 9, deposited at the Collection Nationale de Culture des Microorganismes (CNCM; Institut Pasteur, 25, rue du Docteur Roux, 75014 PARIS, FRANCE) on July 1st, 2009, under the number CNCM-I-4175. 11. Composition comprising at least one compound according anyone of claims 1 to 3. 12. Pharmaceutical composition comprising at least one compound according to any one of claims 1 to 3 as active ingredient, in association with a pharmaceutically acceptable vehicle, said composition possibly further comprising - either at least one antitumor compound, - or at least one antibacterial compound. 13. Compounds according to anyone of claims 1 to 3, for their use as a drug intended for the prevention or the treatment of: - pathologies associated with microbial infection, in particular bacterial, fungal or parasitic infections, and/ or - pathologies associated with abnormal cellular proliferation, including cancer. 14. Compounds obtainable by the process according to anyone of claims 4 to 6, said compounds being preferably the compounds according to anyone of claims 1 to 3. |
USE AS DRUGS
The present invention relates to stambomycin compounds and derivatives. The invention also relates to a process for producing stambomycin compounds. The invention also relates to the use of stambomycin compounds, in particular as drugs.
In the invention, stambomycin compounds can also be named sambomycin compounds as mentioned in the priority document EP 09290587.6 of July 24, 2009.
Since the discovery of the first antibiotic secreted by a Streptomyces by Selman
Waksman in 1942, many antibiotics have been developed by the pharmaceutical industry to treat bacterial infections.
However, the large use of single or multiple antibiotherapies have enhanced the emergence of resistant bacterial strains, which have developed mechanisms to resist said antibiotics. To date, some bacteria, such as Staphylococcus aureus, are resistant to more than 4 different antibiotics.
So, there is a need to provide new antibiotics that can treat bacterial infections, in particular infections caused by multi-drug resistant bacterial strains.
Streptomycetes are Gram-positive, filamentous, soil-living bacteria that undergo a complex program of morphological differentiation. In addition to this singular multicellular morphogenesis, the members of the Streptomyces genus are well known for their ability to produce various compounds via secondary metabolism with important uses in medicine and in agriculture. Recent advances in the sequencing of Streptomyces genomes, and more generally those of actinomycetes, have highlighted the underestimated potential of these organisms to biosynthesise secondary metabolites. Indeed, the analysis of Streptomyces coelicolor revealed the presence of 22 gene clusters with deduced roles in the production of secondary metabolites whereas only half a dozen of them were identified before (Bentley et al, Nature ,2002, 417: 141-147; Challis and Hopwood, Proc Natl Acad Sci U S A, 2003, 100 Suppl 2: 14555-14561). Similarly, analysis of the Streptomyces avermitilis genome sequence revealed 30 secondary metabolite gene clusters (Ikeda et al.,, Nat Biotechnol ,2003, 21: 526-531). More recently, the genome sequences of non-Streptomyces actinomycetes such as the biotechno logically important Rhodococcus sp. RHAl (Mc Leod et al. , Proc Natl Acad Sci USA, 2006, 103:
15582-15587.), the potent anticancer salinosporamide A producer Salinispora tropica (Udwary et al, Proc Natl Acad Sci U S A ,2007, 104: 10376-10381) and the erythromycin-producing bacterium Saccharopolyspora erythraea (Oliynyk et al., Nat Biotechnol, 2007, 25: 447-453) identified, in total, more than 70 clusters for the biosynthesis of secondary metabolites. From these sequences, a genome mining approach allowed, for instance, to discover the tris-hydroxamate tetrapeptide siderophore coelichelin from S. coelicolor A3(2) (Lautru et al., Nat Chem Biol ,2005, 1: 265-269). In S. ambofaciens ATCC 23877, which was known to produce congocidine (Cosar et al., C R Hebd Seances Acad Sci, 1952, 234: 1498-1499) and spiramycin (Pinnert-Sindico, Ann Inst Pasteur (Paris), 1954, 87: 702-707), the sequencing of the left (1,544 kb; accession number AM238663) and right (1,367 kb; AM238664) arms of the linear chromosome, has unveiled eleven novel secondary metabolite gene clusters (http://www.weblgm.scbiol.uhp-nancy.fr/ambofaciens/, Choulet et al., MoI Biol Evol ,2006, 23: 2361-2369).
Except for the des cluster identified in the core region of the chromosome that directs the biosynthesis of desferrioxamines B and E, only the cch coelichelin biosynthetic gene cluster (Barona-Gomez et al., Microbiology ,2006, 152: 3355-3366) and clusters presumed to be involved in the biosynthesis of carotenoids are found to be the same as clusters present in the phylogenetically close relative S. coelicolor, highlighting the powerful ability of Streptomycetes to produce distinct secondary metabolites.
The international application WO2000/000618 discloses processes and materials for preparing novel polyketides, particularly 12-, 14- and 16-membered ring macrolides, by recombinant biosynthesis, and the novel polyketides thus produced. The process according to the international application discloses the use of specific genes of a type I PKS gene cluster for producing said macrolides.
Challis 2008 Microbiology vol 154, Part 6, p: 1555-1559 discloses methods developed to characterize the metabolic products of cryptic biosynthetic gene clusters.
Yadav et al. 2003 Nucleic Acid Research vol 31 n° 13, p: 3654-3658 disclose a software SEARCHPKS allowing detection and analysis of polyketide synthase domains in a polypeptide sequence. SEARCHPKS can also aid in identification of polyketide products made by PKS clusters found in newly sequenced genomes
Karray et al. 2007 Microbiology, vol 153 Part 12, p: 4111-4122 disclose the organisation of the cluster of genes allowing the biosynthesis of spiramycin by Streptomyces ambofaciens.
The European application EP 0791655 discloses the characterization of a new polyketide gene
cluster allowing the production of tylactone.
The international application WO 2006/045063 discloses the biosynthesis of novel polyketides by incorporating starter units that differ from the natural starter units used in the native production of polyketides.
One aim of the present invention is to provide new compounds having biological effects.
Another aim of the invention is to provide a process that allows the production of said compounds.
Another aim of the invention is to provide compositions comprising said compounds and their use as drugs for the treatment of pathologies.
The invention relates to compounds having general formula (I)
(I) wherein
D represents:
with A representing a sugar Cs-C 6 , preferably a Cs-C 6 amino sugar, more preferably an amino sugar selected from the group comprising the amino sugars represented by the following formula:
with R 4 representing an hydrogen atom, or a linear or branched, substituted or not, saturated or not, Ci -C 12 alkyl, and
B represents an hydrogen atom, or a linear or branched, substituted or not, saturated or not, C 1 -C 12 alkyl, preferably a linear or branched, substituted or not, saturated or not, C5-C10 alkyl, more preferably a linear or branched, substituted or not, saturated or not, C 6 -Cs alkyl, and
said compounds being in the form of a racemate, or anyone of their enantiomers or diastereomers, or anyone of the tautomers of said racemates and of said enantiomers and diastereomers, and their respective pharmaceutically acceptable salts. The invention relates also to compounds having the following general formula (I -A)
or having the following general formula (I-B)
(I-B), the tautomer of
(I-A)
wherein
- A represents a Cs-C 6 sugar, preferably a Cs-C 6 amino sugar, more preferably an amino sugar selected from the group comprising the amino sugars represented by the following formula: 2 ^\), and 1
- B represents an hydrogen atom, or a linear or branched, substituted or not, saturated or not, C 1 -C 12 alkyl, preferably a linear or branched, substituted or not, saturated or not, Cs- Cio alkyl, more preferably a linear or branched, substituted or not, saturated or not, C 6 -Cs alkyl,
said compounds being in the form of a racemate, or anyone of their enantiomers or diastereoisomers, or anyone of the tautomers of said racemates and of said enantiomers and diastereomers, and their respective pharmaceutically acceptable salts. Hereafter, D will be only represented in the enol form. Both enol and keto form of D exist in an equilibrium state.
It is well known in the art that keto-enol tautomerism refers to a chemical equilibrium between a keto form (a ketone or an aldehyde) and an enol. The enol and keto forms are said to be tautomers of each other. The interconversion of the two forms involves the movement of a proton and the shifting of bonding electrons; hence, the isomerism qualifies as tautomerism.
The invention is based on the characterization of the compounds having the formula (I).
These compounds are novel.
In the invention, A group represents a Cs-C 6 sugar also called a Cs-C 6 monosaccharide, which has 5 carbon atoms or 6 carbon atoms.
The natural Cs monosaccharides are also called pentoses and are represented by desoxyribose, ribose, arabinose, xylose, lyxose, ribulose and xylulose. The pentoses according to the invention may be under the form of furanose or pyranose which correspond to the cyclic forms of the pentoses. They are preferably in form of pyranoses.
The natural C 6 monosaccharides are also called hexoses and are represented by allose, altrose, glucose, mannose, gulose, idose, galactose, talose, psicose, fructose, sorbose and tagatose. The hexoses according to the invention may be under the form of furanose or pyranose which correspond to the cyclic forms of the hexoses. They are preferably in form of pyranoses.
In the above mentioned furanoses or pyranoses, the anomeric center can be in a configuration α or β.
Preferably in the invention the Cs-C 6 sugars, or Cs-C 6 monosaccharides, are amino sugars.
Amino sugar refers, in the invention, to a monosaccharide wherein a hydroxyl group is substituted by an amino group. Amino sugars are also called aminoglycosides.
As for the monosaccharides from which they derive, amino sugars are preferably in a form of an aminopyranose (cyclic C 6 amino sugar) or in the form of an amino furanose
(cyclic Cs amino sugar).
The amino sugar of the invention can be selected from the group comprising: galactosamine, glucosamine, N-acetyl glucosamine, mycaminose or desosamine. These examples are not limiting. Preferably, the amino sugar according to the invention is one of the amino sugars having the following formulae:
l) which represents mycaminose, and
(A2) which represents desosamine. In the invention, B group can be a linear or branched Ci -C 12 alkyl, which means that B represents a carbon chain having 1, or 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12 carbons. In other words, if said B group is a linear alkyl, B group can be a methyl, an ethyl, a propyl, a butyl, a pentyl, a hexyl, a heptyl, an octyl, a nonyl, a decyl, an undecyl and a dodecyl group.
An advantageous B group represents a linear or branched C5-C10 alkyl which means that B represents a carbon chain having 5, or 6, or 7, or 8, or 9, or 10 carbons. Another advantageous B group represents a linear or branched C 6 -Cs alkyl which means that B represents a carbon chain having 6, or 7, or 8 carbons.
From the composition of the alkyl group, for instance 4 carbons, the skilled person can easily determine the corresponding branched alkyl group having 4 carbons: isobutyl, sec- butyl and tert-butyl.
The above mentioned alkyl groups can be unsaturated, which means that double or triple bounds can be present in the alkyl chain, with respect to the carbon valence.
The above mentioned alkyl groups, saturated or not, can be substituted, which means that some groups can be present such as hydroxyl groups, amino groups, acid groups or ester groups.
The compounds having the general formula (I) have many asymmetric carbons. Therefore, the compounds according to the invention can be in a form of any of their enantiomers or diastereoisomers. The compounds according to the invention can also be in a form of a racemic mixture, or racemate, of two enantiomers, each enantiomer of said racemic mixture being present in a ratio from 1 :10 to 10:1, preferably from 1 :5 to 5:1, more preferably in a ratio of 1 : 1.
Also the compounds according to the invention can be present in a form of the pharmaceutically acceptable salts known to a person skilled in the art, such as sodium salts, ammonium salts, calcium salts, magnesium salts, potassium salts, acetate salts, carbonate salts, citrate salts, chloride salts, sulphate salts, amino chlorhydate salts, borhydrate salts, phosphate salts, dihydrogenophosphate salts, succinate salts, citrate salts, tartrate salts, lactate salts, mandelate salts, methane sulfonate salts (mesylate) or p- toluene sulfonate salts (tosylate).
In one advantageous embodiment, the invention relates to compounds defined above, having the following general formula (II)
wherein
D represents
with A representing a sugar Cs-C 6 , preferably a Cs-C 6 amino sugar, more preferably an amino sugar selected from the group comprising the amino sugars represented by the following formula:
with R 4 representing an hydrogen atom, or a linear or branched, substituted or not, saturated or not, Ci -C 12 alkyl, and
B represents an hydrogen atom, or a linear or branched, substituted or not, saturated or not, C 1 -C 12 alkyl, preferably a linear or branched, substituted or not, saturated or not, C5-C10 alkyl, more preferably a linear or branched, substituted or not, saturated or not, C 6 -C8 alkyl, and their respective pharmaceutically acceptable salts. In one advantageous embodiment, the invention relates to compounds defined above, having the following general formula (H-A)
wherein
A represents a sugar Cs-C 6 , preferably a Cs-C 6 amino sugar, more preferably an amino sugar selected from the group comprising the amino sugars represented by the following formula:
B represents an hydrogen atom, or a linear or branched, substituted or not, saturated or not, C 1 -C 12 alkyl, preferably a linear or branched, substituted or not, saturated or not, Cs- Cio alkyl, more preferably a linear or branched, substituted or not, saturated or not, C 6 -Cs alkyl,
and their respective pharmaceutically acceptable salts.
Another advantageous embodiment of the invention relates to compounds previously defined and characterised in that B represents: wherein Rl, R2 and R3, independently from each other, represent:
an hydrogen atom, or
a linear or branched, substituted or not, saturated or not, Ci -C 12 alkyl, preferably a methyl group.
In another preferred embodiment, the invention relates to compounds defined above, said compounds being selected from the group comprising:
The compounds represented by the formula Ha-IIf are novel and have been named by the Inventors Stambomycin A (Ha), Stambomycin B (lib), Stambomycin C (lie), Stambomycin D (Hd), Stambomycin E (He) and Stambomycin F (Hf).
The invention also relates to a process for producing the compounds defined above, comprising a step of activating the silenced large type I polyketide synthase (PKS) gene cluster of a microorganism preferably belonging to the family of Streptomycetaceae:
• either by artificially over-expressing a transcriptional activator, • or by culturing said microorganism in a specific medium allowing the expression of said transcriptional activator at a level sufficient to activate the expression of the biosynthetic genes.
said transcriptional activator being encoded by a gene belonging to said type I PKS gene cluster,
said type I PKS gene cluster being preferably located at about 500 kbp from the end of the right arm of the chromosome of said microorganism, and said microorganism being preferably Streptomyces ambofaciens, in particular Streptomyces ambofaciens deposited at the American Type Culture Collection under the number ATCC 23877.
Other advantageous Streptomyces ambofaciens strains such as Streptomyces ambofaciens deposited at the German Collection of Microorganisms and Cell Cultures (DSMZ - Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, InhoffenstraBe 7 B 38124 Braunschweig GERMANY) under the number DSM 40697 ,or at ATCC under the deposit number ATCC 15154, can be used to produce compounds according to the invention.
According to the invention, the phrase "allowing the expression of said transcriptional activator at a level sufficient to activate the expression of the biosynthetic genes." means that said expression would be sufficient to cause production of the metabolic products of the genes. On the contrary in standard medium, the inventors hypothesized that either the transcriptional activator is unexpressed or is expressed at a level insufficient to activate the expression of the biosynthetic genes.
An advantageous embodiment of the invention relates to a process for producing the compounds defined above, comprising a step of activating the silenced large type I polyketide synthase (PKS) gene cluster of Streptomyces ambofaciens, in particular Streptomyces ambofaciens deposited at the American Type Culture Collection under the number ATCC 23877:
• either by artificially over-expressing a transcriptional activator, • or by culturing said microorganism in a specific medium allowing the expression of said transcriptional activator, at a level sufficient to activate the expression of the biosynthetic genes. said transcriptional activator being coded by a gene belonging to said type I PKS gene cluster,
said type I polyketide synthase (PKS) gene cluster being preferably located at about 500 kbp from the end of the right arm of the chromosome of said Streptomyces ambofaciens deposited at the American Type Culture Collection (ATCC : Patent Depository, 10801 University Blvd. Manassas, VA 20110, USA) under the number ATCC 23877.
As mentioned above, the invention relates to a process that allows the production of compounds having formula (I) and (I-A), formula (II) and (H-A), or at least one of the compounds having the formula Ha, lib, Hc, Hd, He or Hf.
The process according to the invention comprises a step of activating a silenced type I PKS gene cluster. Indeed, the process according to the invention is based on the characterization of the genes that belong to a new PKS gene cluster: the Stambomycin cluster. The Stambomycin cluster is detailed in Example 1.
The inventors have observed that the Stambomycin cluster is silenced, which means that all or most of the biosynthetic genes that compose said Stambomycin cluster are not, or substantially not expressed in the wild type microorganism, under standard laboratory culture conditions. It is well known in the art that genes that are not expressed means that the DNA sequence is not transcribed into RNA, and thus said RNA cannot be translated into protein. The consequence of the silencing of the said Stambomycin cluster is that the secondary metabolites that can be biosynthesised by the said Stambomycin cluster are not produced. The inventors have unexpectedly observed that, if said Stambomycin cluster is unlocked, i.e. if said cluster is activated, i.e. if each biosynthetic gene of said Stambomycin cluster is expressed, then the microorganism containing said Stambomycin cluster is able to produce new compounds: the compounds according to the invention. In the invention the generic terms "unlock" and "activation" will be used uniformly to refer to the activation of the cluster. During the characterization of the cluster the Inventors have identified a transcriptional activator that could govern the expression of almost all or all the genes contained in the cluster. Indeed, in microorganisms, some genes that are involved in the same signalling pathway, the same biosynthesis pathway or the same degradation pathway, are often grouped in the genome of said microorganism in a genetic entity called a cluster, said cluster containing at least one operon. Said genetic unit contains the genes coding for the proteins or enzymes involved in a signalling pathway, a biosynthesis pathway, a degradation pathway, but also genes that code for regulatory proteins (activators or repressors) and specific coding sequences involved in said regulation.
Thus, for instance, when a microorganism cannot biosynthesize a molecule, the cluster containing the genes that govern the proteins or enzymes involved in said biosynthesis is silenced, i.e. all or most of the genes of the cluster are not expressed. On the contrary, when a microorganism produces a molecule, the cluster is unlocked, then genes contained in said cluster are expressed and finally the molecule is bio synthesized.
The inventors have discovered that the expression of a transcriptional activator contained in the Stambomycin cluster is sufficient to unlock said Stambomycin cluster.
The type I PKS gene cluster according to the invention, to which the Stambomycin cluster belongs, is advantageously found in microorganisms belonging to the family of Streptomycetaceae, a family of bacteria comprising the genus Streptomyces said genus comprising S. achromo genes, S. ambofaciens, S. aureofaciens, S. avermitilis, S. clavuligerus, S. coelicolor, S. felleus, S. ferralitis, S. filamentosus, S. griseus, S. hygroscopicus, S. iysosuperficus, S. lividans, S. noursei, S. scabies, S. somaliensis, S. thermoviolaceus, S. toxytricini, S. tsukubaensis, S. venezuelae, S. violaceoruber.
One advantageous microorganism according to the invention is Streptomyces ambofaciens and in particular the strains of Streptomyces ambofaciens deposited at the ATCC under the deposit number ATCC 23877 and ATCC 15154, Streptomyces ambofaciens deposited at the DSMZ under the deposit number DSM 40697 and ETH9427 and ETHl 1317 strains from Eidgenόssische Technische Hochschule (Zϋrich- Switzerland).
In the above mentioned microorganisms according to the invention, the type I PKS gene cluster, or Stambomycin cluster, is preferably located at about 500,000 base pairs (500 kbp) from the end of the right arm of the chromosome. Indeed, in contrast to most other bacteria, Streptomyces have a linear chromosome. From the chromosome linearity, the skilled person can easily determine the right arm of the chromosome.
In the art, Streptomyces bacteria are commonly cultured in a medium allowing their growth, said medium being not specifically adapted to the production of secondary metabolites.
For the production of secondary metabolites such as macro lides, specific media are used, such as MP5 or HT for spiramycin production in Streptomyces ambofaciens . The Inventors have noticed that culturing Streptomyces ambofaciens in MP5 medium does not activate the biosynthetic genes of the Stambomycin cluster.
Unexpectedly, when Streptomyces ambofaciens is cultured in a medium not commonly used for the production of spiramycin (the other macrolide antibiotic produced by S. ambofaciens) the Stambomycin cluster is unlocked, and thus the compounds mentioned above are produced. Said medium is in particular R2 medium. The composition of R2 medium is disclosed in Example 1, and the protocol to obtain the compounds according to the invention by growing Streptomyces is described in Example 6.
The Inventors have also found that a transcriptional activator of said Stambomycin cluster is expressed when bacteria are cultured in said R2 medium, at a sufficient level to produce biologically active compounds.
Thus, the Inventors have transformed Streptomyces bacteria in order to obtain Streptomyces bacteria constitutively expressing the transcriptional activator, even if said Streptomyces is cultured in a medium that does not allow the production of macro lides. They have then identified that said Streptomyces produce the compounds according to the invention.
Thus, to sum up, for carrying out the process according to the invention, and produce the compounds according to the invention, the Stambomycin cluster can be unlocked by
- either culturing Streptomyces in a medium that is not commonly used for the production of macro lides, such as R2 medium
or artificially over expressing a transcriptional activator contained in said Stambomycin cluster. In one advantageous embodiment, the invention relates to a process previously defined, wherein said step of activation is carried out by over expressing a transcriptional activator belonging to the LAL family, preferably said transcriptional activator being not, or substantially not, expressed, by said microorganism under normal conditions.
The term "under normal conditions" refers in the invention to the conditions used for the proliferation of Streptomyces . Normal conditions are different from conditions allowing the productions of secondary metabolites such as macro lides.
The LAL family corresponds to a family of transcription factors, which was found to have an active role in the induction of expression of some type I PKS clusters, for example PikD for pikromycin production and RapH for rapamycin production (Wilson et al. 2001, J Bacteriol 183: 3468-3475; Anton et al. 2004, J Bacteriol 186: 2567-2575 ;Kuscer et al. 2007, J Bacteriol 189: 4756-4763).
Another advantageous embodiment of the invention relates to a process defined above, wherein said transcriptional activator comprises or consists of the amino acid sequence SEQ ID NO: 1.
Said transcription factor characterized in that it comprises or consists of the amino acid sequence SEQ ID NO: 1 and is coded by the nucleic acid molecule comprising or constituted by the nucleic acid sequence SEQ ID NO: 2.
Another advantageous embodiment of the invention relates to a process as defined above, further comprising a step of isolating the compounds described above.
The step of isolation of the compounds can be carried out by routine protocols commonly used by a skilled person. An example of such a protocol is disclosed in the Examples section.
Another advantageous embodiment of the invention relates to a process as defined above, further comprising a step of purifying said compounds.
The step of purification of the compounds according to the invention can be carried out by routine protocols commonly used by a skilled person. An example of such a protocol is disclosed in the Examples section. Another advantageous embodiment of the invention relates to a process for producing the above mentioned compounds comprising:
a step of activating the silenced large type I polyketide synthase (PKS) gene cluster of Streptomyces ambofaciens, in particular Streptomyces ambofaciens deposited at the ATCC under the number ATCC 23877 by artificially over- expressing the transcriptional activator comprising or consisting of SEQ ID NO:1,
a step of isolating the compounds described above, and
- a step of purifying the compounds isolated in the previous step.
said type I polyketide synthase (PKS) gene cluster being preferably located at about 500 kbp from the end of the right arm of the chromosome of said Streptomyces ambofaciens deposited at the ATCC under the number ATCC 23877.
The process according to the invention may comprise, before the step of activating the silenced large type I polyketide synthase (PKS) gene cluster, a step of adding specific substrates.
The process according to the invention may also include biological modifications of the compounds produced by the microorganism before the step of isolation and/or chemical modifications after the step of purification.
All these methods are well known to the skilled person and belong to his general knowledge.
The step of activating described above can be carried out by introducing in said Streptomyces an expression vector comprising the nucleic acid sequence SEQ ID NO:2, said sequence SEQ ID NO:2 being placed under the control of constitutive regulatory elements, i.e. a strong promoter.
Such vector can be integrated by site-specific recombination in the genome of said Streptomyces. The above mentioned step of isolating the compounds produced by said microorganism defined above can be achieved as described in the Examples section, by isolating compounds from mycelia, when said microorganism is cultured in MP5 liquid medium or on MP5 solid medium. An alternative corresponds to the isolation of said compound from the medium when said microorganisms are cultured on HT supplemented with 15mM MgCl 2 . Another advantageous embodiment of the invention relates to a process for producing the above mentioned compounds comprising:
a step of culturing of Streptomyces ambofaciens, in particular Streptomyces ambofaciens deposited at the ATCC under the number ATCC 23877, in a specific medium allowing the expression of the transcriptional activator at a level sufficient to activate the expression of the biosynthetic genes comprising or consisting in SEQ ID NO:1, such as R2 medium
- a step of isolating the compounds described above, and
- a step of purifying the compounds isolated in the previous step.
said type I polyketide synthase (PKS) gene cluster being preferably located at about 500 kbp from the end of the right arm of the chromosome of said Streptomyces ambofaciens deposited at the ATCC under the number ATCC 23877.
The invention also relates to a modified microorganism producing the compounds previously defined, preferably said modified microorganism being obtained by permanently expressing a transcriptional activator in a natural microorganism, said transcriptional activator being substantially not, or not, expressed in said natural microorganism.
The invention encompasses microorganisms liable to be used for industrial production of the compounds according to the invention. The above microorganisms can be selected from bacteria, including Actinobacteria, such as Actinomycetales, and yeasts, such as Saccharomyces cerevisiae, Schizosaccharomyces pombe or Pichia pastoris, which are easy to grow in a fermentor. The microorganism according to the invention can also be Streptomyces species strains, including Streptomyces ambofaciens.
For the production of Stambomycin compounds in bacteria and yeast, the organisms have to be transformed with a vector containing the Stambomycin cluster.
This cluster, having a size of approximately 150kbp can be easily cloned into Bacterial Artificial chromosomes (BACs), or Yeast Artificial Chromosomes (YACs) which are respectively replicative vectors allowing the transfer of foreign sequences into bacteria or yeast.
Bacteria transformed with a BAC containing the Stambomycin cluster can also be transformed with another vector allowing the expression of transcription factors allowing, or enhancing the expression of the Stambomycin cluster genes contained in the BAC.
Yeast transformed with a YAC containing the Stambomycin cluster can also be transformed with another vector allowing the expression of transcription factors allowing, or enhancing the expression of the Stambomycin cluster genes contained in the YAC. The above transcription factor is preferably a transcriptional activator being substantially not, or not, expressed in said natural microorganism.
The skilled person has the common knowledge to select specific bacteria or yeast containing BACs or YACs, and vectors containing transcription factors, by using genetic markers (antibiotic resistance genes, susceptibility to drugs, color selection, auxotrophy etc). These procedures are routine for a person having ordinary skills in the art of genetics.
From bacteria or yeast, the skilled person, by culturing the transformed microorganisms in appropriate culture medium, can easily purify the Stambomycin compounds produced by referring to the example section.
The process of purification described in Example 2 is transposable mutatis mutandis to transformed bacteria or yeast.
According to the invention, the phrase "transcriptional activator being substantially not, or not, expressed in said natural microorganism" means that either the transcriptional activator is expressed at a level not sufficient to allow the expression of the bio synthetic genes or not expressed in the natural microorganism.
As mentioned above, the microorganism according to the invention can be transformed by a vector comprising a nucleic acid sequence coding for a transcription factor that is able to unlock the Stambomycin cluster. Said nucleic acid sequence coding for said transcriptional factor is placed under the control of a regulatory element that allows its permanent expression, i.e. the regulatory element allows the expression irrespective of the regulatory proteins present in said microorganism. Thus, if said microorganism over expresses an inhibitor of the transcription of said transcriptional activator, the sequence of the transcriptional activator placed under the control of regulatory elements that allow its permanent expression will be insensitive to said inhibitor of transcription. Another advantageous embodiment of the invention relates to a modified microorganism previously described, wherein said microorganism constitutively expresses genes contained in the large type I polyketide synthase (PKS) gene cluster, said type I polyketide synthase (PKS) gene cluster being preferably located at about 500 kbp from the end of the right arm of the chromosome of said microorganism, said microorganism being preferably Streptomyces ambofaciens deposited at the ATCC under the number ATCC 23877.
In one other advantageous embodiment, the invention relates to a modified microorganism defined above, wherein the transcriptional activator belongs to the LAL family, and in particular wherein said transcriptional activator comprises or consists of the amino acid sequence SEQ ID NO: 1.
Another advantageous embodiment of the invention relates to a modified microorganism previously described, deposited at the Collection Nationale de Culture des Microorganismes (CNCM; Institut Pasteur, 25, rue du Docteur Roux, 75014 PARIS,
FRANCE) on July 1st, 2009, under the number CNCM- 1-4175.
The strain deposited under the number CNCM-I-4175 is also called in the invention
ATCC/OE484.
The exact description of the construction of the strain ATCC/OE484 is disclosed in the Examples section.
Another aspect of the invention relates to a composition comprising at least one compound defined above. In one advantageous embodiment, the invention relates to a composition as defined above, as a drug, in particular as an antibacterial drug or an antitumor drug. The composition according to the invention can also be a food composition, a nutraceutical composition, an agricultural composition or a composition for industrial use, such as a decontaminating composition.
The invention also relates to a pharmaceutical composition comprising at least one compound as defined above as the active ingredient, in association with a pharmaceutically acceptable vehicle.
The invention also relates to a pharmaceutical composition comprising at least one compound as defined above as the active ingredient, in association with a pharmaceutically acceptable vehicle, said composition further comprising:
- either at least one antitumor compound,
- or at least one antibacterial compound.
The invention also relates to a pharmaceutical composition comprising at least one compound as defined above as active ingredient, in association with a pharmaceutically acceptable vehicle, said composition further comprising at least one antitumor compound. An advantageous embodiment of the invention relates to compounds defined above, in association with at least one antitumor agent, for use as a drug intended for the treatment of cancer, said compounds and said antitumor agent being simultaneously or separately used, or used spread over time.
The invention also relates to a pharmaceutical composition comprising at least one compound as defined above as active ingredient, in association with a pharmaceutically acceptable vehicle, said composition further comprising at least one antibacterial compound.
An advantageous embodiment of the invention relates to compounds defined above, in association with at least one antibacterial agent, for use as drugs intended for the treatment of bacterial infections, said compounds and said antibacterial agent being simultaneously or separately used, or used spread over time. Dosage of the active substance depends on the administration route, and can be easily determined by a skilled person. The pharmaceutical composition according to the invention can be administered by intravenous route, sub-cutaneous route, systemic route, or can be administered locally by infiltration, or per os. The pharmaceutical composition according to the invention can be administered at a dosage from about 0.1 g/kg/day to about 10 g/kg/day, according to the administration route.
In particular, the pharmaceutical compositions according to the invention may be administered at a dosage from about 2 to about 5g/day in adults, or from about 50mg to about 100mg/kg/day for children.
"Antitumor compound" means in the invention any compounds having an activity which inhibit cell proliferation, or enhance apoptosis of tumour cells. These compounds are called chemotherapeutic agents. The skilled person can easily determine from the pathology which antitumor compound can be added to the compounds according to the invention.
"Antibacterial compound" means, in the invention, any antibiotic having bacteriostatic (inhibition of cell growth) or bactericidal (cell death) properties on bacteria.
The invention also relates to compounds defined above, for use as a drug intended for the prevention or the treatment of:
- pathologies associated with microbial infection, in particular bacterial, fungal or parasitic infections, and/ or
- pathologies associated with abnormal cellular proliferation, including cancer.
In the invention, pathologies associated with microbial infection can be, for instance, sepsis, septicaemia, nosocomial disease, including Staphylococcus aureus infection, Lyme disease, celulitis, osteomylitis, syphilis, meningitis or plague. Microbial infections also encompass in the invention viral infections.
In the invention, pathologies associated with parasitic infection can be, for instance, infections caused by metazoa or protozoa living in the human body and causing symptoms. For instance, parasites can be plasmodies, taenia, leshmanias, etc.
Pathologies associated with abnormal cellular proliferation correspond to pathologies wherein cells grow indefinitely, without senescence. The cells are then considered as "immortalized". These pathologies include cancer, in particular metastatic cancer, such as lung cancer, breast cancer, prostate cancer, bladder cancer, intestinal cancer, colon cancer, skin cancer, brain cancer. The cancers according to the invention also include myeloproliferative and lumphoproliferative diseases, leukaemia, lymphoma. The invention also relates to the use of compounds as defined above, for the preparation of a drug intended for the prevention or the treatment of:
- pathologies associated with microbial infection, in particular bacterial, fungal or parasitic infections, and/ or
- pathologies associated with abnormal cellular proliferation, including cancer.
Another aspect of the invention relates to a method for treating
- pathologies associated with microbial infection, in particular bacterial, fungal or parasitic infections, and/ or
- pathologies associated with abnormal cellular proliferation, including cancer, said method comprising a step of administering in a patient in need thereof a therapeutically effective amount of at least one compound defined above.
An advantageous embodiment of the invention relates to compounds defined above, in association with at least one antitumor agent, for use as a drug intended for the treatment of cancer, in particular said compounds and said antitumor agents are simultaneously or separately used, or used spread over time.
An advantageous embodiment of the invention relates to compounds defined above, in association with at least one antimicrobial agent, for use as a drug intended for the treatment of microbial infections, in particular said compounds and said antimicrobial agents are simultaneously or separately used, or used spread over time.
The composition comprising compounds according to the invention and at least an antitumor agent can be delivered continuously or sequentially, by perfusion delivering said compounds continuously eventually in a constant dosage, or discontinuously by one or more daily injection or absorption, eventually repeated during many days, either consecutive, or with a delay during which no treatment is taken. The invention also relates to compounds obtainable by the process defined above. In other words, the invention relates to compounds obtainable by the process comprising a step of activating the silenced large type I polyketide synthase gene cluster of a microorganism preferably belonging to the family of Streptomycetaceae:
• either by artificially over-expressing a transcriptional activator, • or by culturing said microorganism in a specific medium allowing the expression of said transcriptional activator, at a level sufficient to activate the expression of the biosynthetic genes.
said transcriptional activator being encoded by a gene belonging to said type I PKS gene cluster,
said type I PKS gene cluster being preferably located at about 500 kbp from the end of the right arm of the chromosome of said microorganism, and said microorganism being preferably Streptomyces ambofaciens, in particular Streptomyces ambofaciens deposited at the ATCC under the number ATCC 23877. In one advantageous embodiment, the invention relates to compounds obtainable by the process as defined above, said compounds being Stambomycin A, and/or Stambomycin B, and/or Stambomycin C, and/or Stambomycin D.
In one advantageous embodiment, the invention relates to compounds obtainable by the process as defined above, said compounds being Stambomycin A, and Stambomycin B, and Stambomycin C, and Stambomycin D.
Also, one advantageous embodiment of the invention relates to compounds obtainable by the process as defined above, said compounds being Stambomycin E and Stambomycin F.
Said compounds E and F are obtained from the above mentioned process in which:
- either precursors of secondary metabolites are included in the culture medium
- or by chemical or biological modifications of Stambomycin A, Stambomycin B, Stambomycin C or Stambomycin D.
The invention also relates to compounds obtainable by the process defined above, preferably said process being carried out by using the modified microorganism defined above. The invention also relates to compounds obtainable by the process defined above, preferably said process being carried out by using a modified microorganism said modified microorganism being obtained by permanently expressing a transcriptional activator in a natural microorganism, said transcriptional activator being substantially not, or not, expressed in said natural microorganism.
The invention also relates to a method for decontaminating a surface or a biological sample, contaminated by bacteria, comprising:
- incubating the surface or the biological sample with at least one compound as defined above,
- leaving said compound killing the bacteria, and
- eventually, eliminating dead bacteria. The invention will be better explained by the following figures and examples. In any case, the following examples should not be considered as restricting the scope of the invention.
Figure IA represents the organisation of the Stambomycin cluster.
Figure IB represents the modular structure of the PKS proteins and the domain organization of the 25 modules, according to the SEARCHPKS prediction. The enzymatic domains are represented in circles: KSQ, β-ketoacyl synthase in which the active site cysteine residue is replaced by glutamine; KS, β-ketoacyl synthase; AT, acyltransferase; ACP, acyl carrier protein; KR, ketoreductase; DH, dehydratase; ER, enoyl reductase; TE, thioesterase. Inactive KR domain is marked with an asterisk.
Figure 2 represents the alignment of the characteristic motifs present in the KR domains. The consensus sequence at the N-termini was proposed to bind to NAD(P)H. The amino acids of the catalytic triad are marked with an asterisk. The boxed amino acids are involved in determining the stereochemistry of the polyketide. For each KR domain we propose the stereochemical configuration on the right of the alignment (Keatinge-Clay, 2007). Al= 2R, 3S; A2=2S, 3S; B1=2R, 3R; B2= 2S, 3R; C1=2R. Figure 3 represents the alignment of the characteristic motifs present in the AT domains. The amino acids of the active site, also involved in the substrate specificity are boxed. The amino acids marked with an asterisk are highly conserved. The arginine marked with a hash interacts with the carboxyl group of the precursors.
Figure 4 represents the mycaminose biosynthetic pathway from glucose- 1 -phosphate. For each enzymatic step, the gene encoding for the protein involved is indicated in bold. In brackets, the percentages of identity/similarity to the spiramycin genes are indicated. Abbreviations: TTP, thymidine triphosphate; TDP, thymidine diphosphate; NAD+, nicotinamide adenine dinucleotide; PMP, pyridoxamine 5 '-phosphate; SAM, S-adenosyl- L-methionine.
Figure 5 represents the comparative transcriptional analysis of the control strain ATCC/pIB139 and the overexpressing mutants ATCC/OE468-9 and ATCC/OE484. The expression of four biosynthetic genes (SAMR0467, SAMR0465, SAMR0477,
SAMR0474), together with the expression of the regulatory gene SAMR0484, were analysed by RT-PCR and the experiments were repeated at least three times. hrdB was used as a control. Tl corresponds to the exponential phase, T2 to the transition phase and T3 to the stationary phase.
Figure 6 represents the ESI-TOF mass spectrum of Stambomycins A/B (top) and the simulated mass spectrum for the C73H134NO22+ ion (bottom). Figure 7 represents the 1 H-NMR spectrum (700 MHz) of Stambomycins A/B in d 4 - MeOH.
Figure 8 represents the 13 C-NMR spectrum (125 MHz) of Stambomycins A/B in d 4 - MeOH.
Figure 9 represents the DQF-COSY spectrum (700 MHz) of Stambomycins A/B, in d 4 - MeOH. Figure 10 represents the HSQC spectrum (700/175 MHz) of Stambomycins A/B in d 4 -
MeOH.
Figure 11 represents the HMBC spectrum (700/175 MHz) of Stambomycins A/B in d 4 - MeOH.
Figure 12 represents the NOESY spectrum (700 MHz) of Stambomycins A/B in d 4 - MeOH.
Figure 13 represents the ESI-TOF mass spectrum of Stambomycins C/D (top) and the simulated mass spectrum for the Cy 2 Hn 2 NO 22 + ion (bottom).
Figure 14 represents the 1 H-NMR spectrum (700 MHz) of Stambomycins C/D in d 4 - MeOH. Figure 15 represents the DQF-COSY spectrum (700 MHz) of Stambomycins C/D, in d 4 - MeOH.
Figure 16 represents the HSQC spectrum (700/175 MHz) of Stambomycins C/D in d 4 - MeOH.
Figure 17 represents the HMBC spectrum (700/175 MHz) of Stambomycins C/D in d 4 - MeOH.
Figure 18 represents the NOESY spectrum (700 MHz) of Stambomycins C/D in d 4 - MeOH.
Figure 19 represents the LC-MS base peak chromatogram for extracts from the control strain ATCC/pIB139 (top) and the mutant strain ATCC/OE484 (bottom). The two framed peaks, with retention times of approximately 19 and 20 min, correspond to Stambomycins C/D and A/B, respectively. Figure 20 represents the proposed structures of Stambomycins A, B, C and D elucidated by mass spectrometry, NMR spectroscopy and bio informatics analyses. Carbons 1', 3, 28 and 50 are indicated on the structure. Figures 2 IA-B represents the effects of Stambomycin A/B and C/D on Bacillus subtilis proliferation.
Figure 21 A represents a Petri dish wherein the effect of Stambomycins C/D has been tested on B. subtilis proliferation. A: corresponds to 1 μg of Stambomycins C/D, B: corresponds to 3 μg of Stambomycins C/D, C: corresponds to 5 μg of Stambomycins C/D, D: corresponds to 10 μg of Stambomycins C/D.
Figure 2 IB represents a Petri dish wherein the effect of Stambomycins A/B has been tested on B. subtilis proliferation. A: corresponds to 1.25 μg of Stambomycins A/B, B: corresponds to 2.5μg of Stambomycins A/B, C: corresponds to 10 μg of Stambomycins A/B, D: corresponds to 12.5 μg of Stambomycins A/B.
Figures 22A-B represents the Stambomycins A/B and C/D effects on Micrococcus luteus proliferation
Figure 22A represents a Petri dish wherein the effect of Stambomycins C/D has been tested on M. luteus proliferation. A: corresponds to 1 μg of Stambomycins C/D, B: corresponds to 3 μg of Stambomycins C/D, C: corresponds to 5 μg of Stambomycins C/D, D: corresponds to 10 μg of Stambomycins C/D.
Figure 22B represents a Petri dish wherein the effect of Stambomycins A/B has been tested on M. luteus proliferation. A: corresponds to 1.25 μg of Stambomycins A/B, B: corresponds to 2.5μg of Stambomycins A/B, C: corresponds to 10 μg of Stambomycins A/B, D: corresponds to 12.5 μg of Stambomycins A/B.
Figure 23 represents a Bacillus subtilis proliferation curve in the presence of Vancomycin or Stambomycin C/D. The Y-axis represents relative proliferation in % compared to B. subtilis cultured without drug, and the X-axis represents the drug concentration in μg/mL. The solid line represents the dose response curve with Vancomycin, and the hashed line represents the dose response curve with Stambomycins C/D. Figure 24 represents the Enterococcus faecalis proliferation curve in the presence of
Vancomycin or Stambomycins C/D. The Y-axis represents relative proliferation in % compared to E. faecalis cultured without drug, and the X-axis represents the drug concentration in μg/mL. The solid line represents the dose response curve with Vancomycin, and the hashed line represents the dose response curve with Stambomycins C/D.
Figure 25 represents the Staphylococcus aureus proliferation curve in the presence of Vancomycin or Stambomycins C/D. The Y-axis represents relative proliferation in % compared to S. aureus cultured without drug, and the X-axis represents the drug concentration in μg/mL. The solid line represents the dose response curve with Vancomycin, and the hashed line represents the dose response curve with Stambomycins C/D. Figure 26 represents the Mycobacterium smegmatis proliferation curve in the presence of Kanamycin or Stambomycins C/D. The Y-axis represents relative proliferation in % compared to M. smegmatis cultured without drug, and the X-axis represents the drug concentration in μg/mL. The solid line represents the dose response curve with Kanamycin, and the hashed line represents the dose response curve with Stambomycins C/D.
Figures 27 A and B represent the LC-MS base peak chromatogram for extracts from the strain ATCC/OE484 and ATCC23877.
Figure 27A represents the base peak of ATCC/OE484 grown in liquid R2 medium.
Figure 27B represents the base peak of ATCC23877 grown in liquid R2 medium.
The peaks, with retention times of approximately 19 min, correspond to Stambomycins A/B.
Figure 28 represents mass spectra of compounds indicated in figure 27B. The ion with m/z = 680 corresponds to the doubly charged parent ions (M+2H) 2+ of Stambomycins A/B. The X-axis represents mass/charge (m/z) and the Y-axis represents ion intensity x 10 6 , expressed in arbitrary units. Figures 29 A and B represent the LC-MS base peak chromatogram for extracts from the strain ATCC/OE484 and ATCC23877.
Figure 29A represents the base peak of ATCC/OE484 grown in liquid R2 medium.
Figure 29B represents the base peak of ATCC23877 grown in liquid R2 medium.
The peaks, with retention times of approximately 19 min, correspond to Stambomycins C/D.
Figure 30 represents mass spectra of compounds indicated in figure 29B. The ion with m/z = 673 corresponds to the doubly charged parent ions (M+2H) 2+ of Stambomycins C/D. The X-axis represents mass/charge (m/z) and the Y-axis represents ion intensity x 10 6 , expressed in arbitrary units.
Figures 3 IA, B, C, D and E represent the LC-MS extracted ion chromatograms for mycelium extracts from the strains grown in liquid R2 medium.
Figure 31A represents the extracted ion chromatogram of ATCC23877 in which the
SAMR0467 ORF is deleted.
Figure 3 IB represents the extracted ion chromatogram of ATCC23877 in which the
SAMR0484 ORF is deleted.
Figure 31C represents the extracted ion chromatogram of ATCC/OE484 in which the SAMR0467 ORF is deleted.
Figure 3 ID represents the extracted ion chromatogram of ATCC/OE484.
Figure 3 IE represents the extracted ion chromatogram of ATCC23877.
The peaks, with retention times of approximately 12,5 min, correspond to Stambomycins
A/B.
Figures 32A, B, C, D and E represent the LC-MS extracted ion chromatogram for mycelium extracts from the strains grown in R2 medium.
Figure 32A represents the extracted ion chromatogram of ATCC23877 in which the
SAMR0467 ORF is deleted.
Figure 32B represents the extracted ion chromatogram of ATCC23877 in which the
SAMR0484 ORF is deleted.
Figure 32C represents the extracted ion chromatogram of ATCC/OE484 in which the
SAMR0467 ORF is deleted. Figure 32D represents the extracted ion chromatogram of ATCC/OE484.
Figure 32E represents the extracted ion chromatogram of ATCC23877.
The peaks, with retention times of approximately 12,5 min, correspond to Stambomycins
C/D.
EXAMPLES
Example 1: Composition of the R2 medium
The R2 medium is prepared as follows: in 800 mL of distilled water Sucrose 103 g,
K 2 SO 4 0.25 g, MgCl 2 6H 2 O 10.12 g, Glucose 10 g and Difco casaminoacids 0.1 g are dissolved. The solution is sterilized for 20 min at 120 0 C.
Then the following are added: 10 mL OfKH 2 PO 4 (0.5%), 80 mL of CaCl 2 2H 2 O (3.68%),
15 mL of L-proline (20%), 10OmL of TES buffer (5.73%, adjusted to pH 7.2), 2mL of
Trace element solution and 5 mL of NaOH (IM).
The trace element solution contains ZnCl 2 40 mg, FeCl 3 6H 2 O 200 mg, CuCl 2 2H 2 O 10 mg, MnCl 2 4H 2 O 10 mg, Na 2 B 4 O 7 10H 2 O 10 mg and (MLt) 6 Mo 7 O 24 4H 2 O lOmg in IL of distilled water.
For preparation of plates, 22g of Difco Bacto agar are added to the 80OmL of solution prior to sterilization. Example 2: Activation of the silent modular polyketide synthase gene cluster in Streptomyces ambofaciens
Methods
Bacterial strains, BACs, plasmids
Streptomyces ambofaciens ATCC23877 was the reference strain for all the experiments (Pinnert-Sindico et ah, 1954 cited above). Escherichia coli DH5α was used for routine cloning (Hanahan, D. J Mo/ Biol, 1983, 166: 557-580); E. coli ET12567/pUZ8002 was used for intergenic conjugation with Streptomyces (MacNeil et al., Gene ,1992, 111:, 61- 68; Paget et al. J Bacteriol, 1999, 181: 204-211). The pGEMT-easy (Promega) and pIB139 (Wilkinson et al., J MoI Microbiol Biotechnol ,2002, 4: 417-426) vectors were used for cloning and overexpression.
Media and growth conditions Luria-Bertani (LB) medium was used for E. coli growth, as well as for Bacillus subtilis and Micrococcus luteus. All E. coli strains were grown at 37°C. For spore production, Streptomyces strains (ATCC23877, ATCC15154, DSM40697 and CNCM-I-4175) were grown on SFM at 30 0 C, while for conjugation SFM was supplemented with 1OmM MgCl 2 (Kieser et al, 2000 Practical streptomyces genetics. Norwich). Genomic DNA was isolated from cultures grown in HT at 30 0 C; YEME 34% was used to grow cultures for pulsed-fϊeld gel electrophoresis analysis. Growth curves and cultures for RNA isolation were performed in HT or MP5 (Pernodet et al, J Gen Microbiol ,1993, 139: 1003-1011.) media at 30 0 C. LC-MS and HPLC samples were always obtained from cultures grown on or in MP5 for at least three days. When needed the following antibiotics were added into the cultures: apramycin, nalidixic acid (both at 25μg/mL).
DNA manipulation
Plasmids were extracted from E. coli by the alkaline lysis method (Sambrook et al. 1989, Molecular cloning: A laboratory manual Cold Spring Harbor Laboratory Press, New
York). Genomic DNA from Streptomyces was isolated as already described (Leblond et al. MoI Microbiol, 1996, 19: 261-271). Southern blots were performed with a Hybond-N nylon membrane (Amersham-Pharmacia) and a vacuum transfer system (BioRad), as previously described (Pang Antimicrob Agents Chemother ,2004, 48: 575-588). Preparation of chromosomal DNA for analysis by pulsed-field gel electrophoresis was performed essentially as described by Leblond et al (1996 cited above).
Amplification of DNA fragments by PCR was performed with Taq DNA polymerase
(NEB) or Takara polymerase (Fermentas), according to the manufacturer's instructions.
PCR products and restriction fragments were purified from agarose gels with the High Pure PCR product purification kit (Roche).
Overexpression of SAMR0468-9 and SAMR0484
The coding sequences of SAMR0468-9 (1971bp) and SAMR0484 (2877bp) were amplified by PCR from the wild type strain of S. ambofaciens ATCC 23877, with the primers OE468-F and OE469-R, and with the primers OE484-F and OE484-R, respectively, which contain the restriction sites for Ndel and Xbal (see Table 1). The PCR products were gel purified and cloned into pGEMT-easy (Promega). The integrity of the coding sequences was checked by sequencing. The vectors pGEMT-468-9 and pGEMT- 484 were digested using Ndel and Xbal; the inserts were gel purified and cloned into a modified version of the plasmid pIB139, digested using the same enzymes. The ORFs are under the control of the strong and constitutive promoter ermEp* which was previously modified to have a typical Streptomyces ribosome binding site (AAAGGAGG) (Bunet et al, JBacteriol 2008, 190: 3293-3305). The recombinant vectors pOE468-9 and pOE484 were introduced by conjugation into S. ambofaciens ATCC 23877 in which they integrated by site specific recombination with the attB site of the chromosome. All the mutants were analysed by PCR, Southern Blot and PFGE, to ensure the desired modification had occurred.
The strain over expressing SAMR0484 corresponds to the strain deposited at the CNCM under the deposit number CNCM 1-4175.
SEQ ID NO: Primers Nucleotide
sequence (5'— >3')
Overexpression:
SEQ ID NO: 3 OE468-F AGGTCTAGAGTCAGCCGAGGAAAC
SEQ ID NO: 4 OE469-R CATATGACGAACGTGTCACGCGCGC
SEQ ID NO: 5 OE484-F CATATGCTGGTCCATCGAGACGAAC
SEQ ID NO:6 OE484-R TCTAGACTCTGCTCTCTCCAAGGCT
Transcriptional analysis:
SEQ ID NO:7 hrdB-F CGCGGCATGCTCTTCCT
SEQIDNO:8 hrdB-R AGGTGGCGTACGTGGAGAAC
SEQ ID NO:9 RT-467-F GTCGCCGGATCACCGAGGAA
SEQ ID NO:10 RT-467-R AGGTCGCGGAACGCCTTGTC
SEQ ID NO:11 RT-465-F TGCCTGCGGTGCTCCACCAA
SEQ ID NO:12 RT-465-R CGTCGTCTTCTCCTCCATCG
SEQ ID NO:13 RT-474-F ACCGCGCCGGAGGTGAGACA
SEQ ID NO:14 RT-474-R GCTGCTCGCCTGCGTGGACA
SEQ ID NO:15 RT-477-F GGAACAGCTCGCCGTACTCC
SEQ ID NO:16 RT-477-R CCGAACTCGTCGGCGTATGG
SEQ ID NO:17 RT-484-F CTGGAGACCTTCGGGGAGTG
SEQ ID NO:18 RT-484-R TGCCCGAGCACTCCGAAATG
Table 1 lists the oligonucleotides used in the invention. The underlined sequences correspond to the Xbal or Ndel sites.
Transcriptional analysis
Total RNA of Streptomyces ATCC23877 wild type and mutant strains was isolated from MP5 or HT liquid cultures at different time points of the growth curve, and treated as described by Kieser et al (2000 cited above). cDNAs were obtained as already described by Bunet et al. (2008 cited above).
The primer pairs used to analyse the expression of the genes in the PKS cluster are listed in Table 1. They were designed to amplify an internal region of about lOObp, at the beginning of the gene. PCR conditions were: 4 min at 94°C, 28 cycles of 30s at 94°C; 30s at 60 0 C, and 30s at 72°C, followed by a final extension of 5 min at 72°C. To check possible contamination by genomic DNA, the same PCR programme (35 cycles instead of 28) was applied to RNA samples, before reverse transcriptase treatment, using as a control, primers to amplify the hrdB gene, which encodes a major sigma factor considered to be constitutively expressed.
1- Identification and characterization of a new type I PKS cluster
During the sequencing of the linear chromosome of Streptomyces ambofaciens ATCC23877, 12 clusters potentially associated with secondary metabolites production were identified in the terminal regions (Choulet et al., cited above). In particular, in the right arm, at 500Kb from the end of the chromosome, a large type I polyketide synthase (PKS) cluster was found, which has been named the Stambomycin cluster. This cluster contains 25 genes and its size is about 150Kb. The genes are listed in Table 2.
Table 2. Genes within the Stambomycin biosynthetic gene cluster and their proposed functions. Analyses were carried out with the BlastP programme (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The best hits are indicated.
From the computational data, the Stambomycin cluster genes can be separated into four groups: a) Biosynthetic genes
The cluster is composed of nine giant PKS genes, whose size varies from 4.7 kbp to 24 kbp. The PKS genes are not arranged straight forwardly head to tail, but they are separated by six ORFs, (see Fig. 1). Their analysis with the program SEARCHPKS (Yadav et al. 2003 J Mo/ Biol 328: 335-363) revealed they encode a total of 25 PKS modules. All together, the PKS genes cover 124 kbp out of the 150 kbp the Stambomycin cluster spans. The Stambomycin cluster is one of the largest type I PKS gene clusters ever described in the literature.
The order in which the PKS genes interact with each other to allow the carbon chain elongation (from SAMR0467 to SAMR0465, and from SAMR0477 to SAMR0474), was established by the position of the loading domain (SAMR0467) and the TE domain (module 24 in SAMR0474). In the Stambomycin cluster, the loading domain, which is responsible for the initiation of polyketide biosynthesis, contains a particular KS domain in which the usual cysteine residue of the active site is replaced by glutamine to facilitate decarboxylation of the starter unit (Donadio and Katz, 1992, Gene 111: 51-60; Bisang et al., 1999, Nature 401: 502-505). The thioesterase is required to release the linear carbon chain of the molecule. Sequence comparisons with other TE domains suggested that, in this case, it would catalyse a cyclization reaction to give rise to a lactone ring. However, it was not possible to predict where the cyclization would occur.
In silico analyses confirmed that all the enzymatic domains, but one (see below), harbour a functional active site. Based on the AT domain sequences (Yadav et al., 2003 cited above), it was possible to predict the substrates incorporated into the polyketide backbone: the starter unit, a propionate, and the extender units (16 malonyl-CoA, 6 methylmalonyl-CoA, 1 ethylmalonyl-CoA and an unknown precursor loaded by module 12, see Fig. 3). Conserved and well characterized motifs inside the KR domain sequence (Keatinge-Clay, 2007, Chem Biol 14: 898-908) allowed the stereochemistry of the CC- substitute and the β-hydroxyl groups derived from each precursor to be predicted, the KR domains are mostly Al type and Bl type, with just two exceptions for KRl 8, which is a A2 type and KR21, which is a B2 type (see Fig. 2). The last ketoreductase domain (KR24) has an arginine and a serine instead of a tyrosine and an asparagine, respectively, in the catalytic triad (see Fig. 2). The replacement of these amino acids was shown to critically affect the activity of KR domains (Reid et al, 2003 Biochemistry 42: 72-79). Thus this KR domain is predicted to be no longer functional. Since the organization of the modules reflects the chemical structure of the polyketide chain, we could predict the structure of the linear backbone of the product. The approximate mass (1120Da) and molecular formula (C 61 H 111 O 18 ) of the molecule assembled by the PKS could be predicted. b) Post PKS modification genes
The boundaries of the cluster were estimated to be from SAMR0465 to SAMR0487 according to their putative function: 16 other genes, in addition to the nine PKS genes, have been identified to be putatively involved in the biosynthesis of the compound (see Table 2). No gene encoding a 4'-phosphopantetheinyl transferase (PPT ase), required for the activation of the ACP domain, by post-translational modification, was found inside or near the cluster. The same situation was observed for the spiramycin cluster (Karray et al, 2007 Microbiology 153: 4111-4122), suggesting that the PKSs encoded by the two clusters might share the same PPTase.
A glycosyltransferase (GT; SAMR0481) would be responsible for the transfer of a specific activated sugar to the lactone ring, suggesting that the final structure would be a glycoslated macro lide. The program SEARCHGTr (Kamra et al, Nucleic Acids Res., 2005, 33: W220-225) indicated a 6-deoxyhexose was the substrate of the GT, most probably an amino sugar such as desosamine or mycaminose. Sequence comparisons with the spiramycin biosynthetic gene cluster (Karray et al, 2007, cited above) (spiramycin contains two amino sugars a mycaminose and a forosamine), enabled identification of five genes (SAMR0472, SAMR0473, SAMR0480, SAMR0486 and SAMR0487) potentially involved in the conversion of glucose- 1 -phosphate into NDP- mycaminose (Fig. 4). Taking into account this data, we could predict the approximate mass and molecular formula of the macrolide (1322 Da; C69H127O22N). Searches in the chemical databases suggested that this structure would be novel.
Two genes (SAMR0478, SAMR0479) encoding enzymes belonging to the cytochrome P450 family were also identified. Usually these enzymes take part in hydroxylation reactions of the polyketide structure. The hydroxylation reaction catalysed by SAMR0479 seems to be directly connected with the formation of the lactone, as the structure determination showed.
The gene SAMR0482 encodes a putative acyl-CoA synthetase and SAMR0483 encodes an acyl-CoA carboxylase β domain. They are likely to be involved in the biosynthesis of a particular precursor for the polyketide synthase. SAMR0485 encodes a type II thioesterase whose function is not yet clarified. It is likely to play a role in removing aberrant groups attached to the ACP domains of the PKS, which block chain elongation (Kim et al, 2002, J Biol Chem 111: 48028-48034). c) Resistance genes
Two genes SAMR0470 and SAMR0471 encode proteins showing a significant percentage of identity (87% and 88%) respectively to an integral permease protein and an ATP -binding subunit of an ABC transporter, both from S. griseus (SGR876 and SGR877, respectively). Bacterial resistance by active efflux of antibiotics has been described for several macrolides (Karray et al., 2007, cited above). The proteins encoded by SAMR0470 and SAMR0471 could be involved in export of the metabolite, (not related to the resistance), as proposed by Menges et al. {Appl Microbiol Biotechnol, 2007, 77: 125- 134). d) Regulatory genes
With regard to the regulation of metabolite biosynthesis, the Stambomycin cluster contains three putative regulatory genes. The gene SAMR0468 encodes a response regulator and SAMR0469 encodes a histidine kinase. Together these products form a two component system. So far only a few examples of this kind of regulator were found inside secondary metabolite bio synthetic gene cluster and have been described to control secondary metabolite biosynthesis. For example, the absA operon, associated with the cda cluster in S. coelicolor, was shown to negatively regulate multiple antibiotics (Anderson et al. 2001). The Stambomycin cluster also contains a "large ATP -binding LuxR family" (LAL) regulator, encoded by SAMR0484. The latter belongs to a new family recently discovered, which was found to have an active role in the onset of type I PKS cluster expression, such as PikD for pikromycin production and RapH for rapamycin production (Wilson et al. 2001 cited above; Anton et al. J Bacteriol ,2004, 186: 2567-2575 ;Kuscer et al. J Bacteriol ,2007, 189: 4756-4763).
2- Activation of the Stambomycin cluster
To verify if the Stambomycin cluster was expressed in the wild type strain of S. ambofaciens ATCC23877, transcriptional analyses were carried out in MP5 and HT media as described in Methods. These media were initially chosen because macrolides, like spiramycin, are produced (Pernodet et al., 1993 cited above.). Under these conditions, no or very low expression of the biosynthetic genes was detected (Fig. 5), hence the Stambomycin cluster was considered to be essentially silent.
In order to trigger the expression of the Stambomycin cluster, we sought to manipulate the regulatory genes. Heterologous expression was not taken into account because of the size of the cluster.
The SAMR0468 and SAMR0469 coding sequences together (the sequences overlap, probably they are cotranscribed) and the SAMR0484 coding sequence were cloned, separately, in front of the strong and constitutive promoter ermEp* within the conjugative and integrative vector pIB139, as described in Methods (Wilkinson et al. 2002 cited above). The wild type strain of S. ambofaciens ATCC23877 was transformed by intergenic conjugation with the recombinant vectors and integration took place at the attB site of the chromosome. As a control, the wild type strain was also transformed with the plasmid pIB139 alone.
To test the role of these genes in the regulation of the Stambomycin cluster, comparative transcriptional analyses were carried out between the regulator over-expressing and the control strains, grown in MP5 or HT media. Total RNAs were isolated from mycelium samples, taken at different time points of the growth curve (transition, exponential and stationary phase) and cDNAs were prepared as described in Methods. The expression of the PKS genes was induced by the overexpression of the LAL regulator (ATCC/OE484), thus confirming the positive role already observed for this kind of regulator (Fig. 5). On the other hand, no expression of the biosynthetic genes (i.e. SAMR0467) was detected in the ATCC/OE468-9 mutant, as well as in the control strain (ATCC/pIB139), indicating that the two component system did not act as a positive regulator, at least for the PKS genes (see Fig. 5). It remains to be clarified if the LAL regulator acts directly on the expression of the PKS genes.
3-Identification of new metabolites produced by S. ambofaciens ATCC23877
In order to examine whether the product of the Stambomycin cluster was being made, comparative metabolic profiling of the control strain ATCC/pIB139 and the mutant ATCC/OE484 was carried out. The strains were grown in MP5 medium and the samples were analysed using Liquid-Chromatography Mass Spectroscopy (LC-MS) (see Methods). Culture extracts of both the supernatant and the mycelium were analysed. The LC-MS base peak chromatogram of the mycelium extract of the overexpressed mutant revealed two peaks, giving doubly charged ions with m/z of 673 and 680 (positive ion mode) corresponding to molecular formulae of C72H132NO22 and C73H134NO22, respectively. These are not present in the mycelium extract of the control strain. These data showed that the Stambomycin cluster was responsible for the production of at least two compounds, here named Stambomycins A/B and C/D respectively. No Stambomycins were detected in the supernatant, under these conditions.
However, same strains cultured on HT medium supplemented with 15 mM MgCl2 presents Stambomycins A/B and C/D secretion in the culture medium.
To prove that the two molecules, corresponding to the peaks 673 and 680, arise from the Stambomycin cluster, a deletion of the first PKS gene, SAMR0467, was made in the mutant ATCC/OE484, (data not shown). The deletion of the first four modules, including the loading domain, would be expected to abolish the production of Stambomycins. Indeed, no Stambomycins were detected in the mycelium extract of this mutant.
Example 3: Elucidation of the structure of Stambomycins
1. Isolation of Stambomycins A (Ha), B (lib), C (lie) and D (Hd) from S. ambofaciens.
Streptomyces ambofaciens ATCC23877/OE484 (CNCM- 1-4175) spores were stored in 25% (v/v) aqueous glycerol at -20 0 C. Solid medium containing 7 g/L yeast extract, 5 g/L sodium chloride, 1 g/L sodium nitrate, 15 g/L glycerol, 20 g/L MOPS was used for production of Stambomycins. The pH was adjusted to 7.4 with 1OM sodium hydroxide and 15 g/L of agar was added prior to auto-claving.
Twenty 10cm x 10cm square Petri dishes each containing 50 mL of medium were used. A sterile cellophane membrane was placed on the agar in each plate and 20μl of Streptomyces ambofaciences ATCC23877/OE484 spores from the stock were spread on top of each cellophane membrane. The plates were incubated for 4 days at 30 0 C and the cellophane membranes were lifted off the plates. The mycelia were scraped off the cellophane membranes and combined. The mycelia were extracted with 3 x 20OmL of methanol. The combined extracts were concentrated to 200 mL under reduced pressure and passed through a 0.2 micron filter. 2. Purification of Stambomycins A, B, C and D
Stambomycins were partially purified from the concentrated methanol extract using semi- preparative HPLC on a reverse phase column (C 18, 100x21 mm, fitted with Cl 8 pre- column 10x21 mm). The mobile phases used were water (A) and acetonitrile (B), both with 0.1% formic acid added. The gradient employed was as follows: 0 minutes, 80% A / 20% B; 10 minutes, 80% A / 20% B; 20 minutes, 100% B; 35 minutes 100% B. Absorbance was monitored at a wavelength of 240nm. Fractions containing Stambomycins were identified using ESI-MS and combined. The combined fractions were evaporated under reduced pressure and re-suspended in small volume of 50% aqueous methanol. Stambomycins were purified from the combined fractions by semi- preparative HPLC on the same column using the following gradient: 0 minutes, 60% A / 40% B; 15 minutes, 5% A / 95% B; 20 minutes, 100% B; 25 minutes, 100% B. Fractions containing a mixture of Stambomycins A and B were collected, combined and lyophilised as were separate fractions containing a mixture of Stambomycins C and D. 15.6mg of Stambomycins A/B and 8.6mg of Stambomycins C/D were obtained from twenty agar plates.
3. Structure elucidation of Stambomycins A/B and C/D by NMR spectroscopy and mass spectrometry
High resolution ESI-TOF-MS analyses of Stambomycins A/B and C/D established their molecular formulae as C73H134NO22 (Stambomycins A/B) and C72H132NO22 (Stambomycins C/D) ([M+H] + calculated for C 73 Hi 34 NO 22 : 1376.9392, found: 1376.9391; [M+H] + calculated for C 72 Hi 32 NO 22 : 1362.9236, found: 1362.9232) (Figures 6 and 13 respectively).
1H, 13 C, COSY, NOESY, TOCSY, HSQC and HMBC NMR spectra (in d 4 -MeOH and d 6 - DMSO, Figures 7-12, 14-18) established the planar structures of Stambomycins A, B, C and D (Figure 20). The absolute stereochemistry of the stereocentres in the macro lide ring of Stambomycins A, B, C and D was predicted by bio informatics analyses using the method of (Keatinge-Clay et al. 2007, Kwan, David H et al. 2008). The stereochemistry at C-3, C-28 and C-50, as well as the R 1 group in the C-26 alkyl chain, could not be predicted using these analyses. The absolute stereochemistry of the stereocentres in the mycaminose residue of Stambomycins A, B, C and D was predicted using bioinformatics analyses based on the known pathway for TDP-D-mycaminose biosynthesis from D- glucose- 1 -phosphate {Melancon, Charles, et al. 2005). The stereochemistry of C-T could not be predicted using these analyses.
4. The production of Stambomycins A/B and C/D with Streptomyces ambofaciens DSM 40697 and ATCC15154 strains transformed with LAL transcription factor, according to the procedure defined above was also analysed in liquid R2 medium.
Example 4: Antimicrobial effects of Stambomycins
The antibacterial properties of mixtures of Stambomycins A/B (M2) and Stambomycins C/D (M 1 ) have been tested.
1; First, the antibacterial effects of Ml and M2 have been tested on LB soft agar plates, using Gram-positive Bacillus subtilis ATCC 6633 and Micrococcus luteus as indicator strains.
The mixtures were added directly on the surface of the medium.
The plates were incubated at 4°C for two hours to allow diffusion of the antibiotic and then at 30 0 C (for B. subtilis) or 37°C (for M. luteus) over night.
Ml and M2 were diluted with H 2 O, and added at the following dosages: Ml : lμg, 3μg,
5μg, and lOμg; M2: 1.25μg, 2.5μg, lOμg and 12.5μg.
The results for B. subtilis are shown in figures 21 A and 2 IB, and the results for M. luteus are shown in figures 22A and 22B.
As shown in figures 21 and 22, strains turned out to be susceptible to both the molecules when lμg is used. However, Stambomycins C/D appear to be more active than
Stambomycins A/B.
2z. Second, the antibacterial effects of Ml and M2 have been tested by determining 90% inhibiting concentration (IC90) on proliferation of B. subitilis, Enterococcus faecalis,
Staphylococcus aureus and Mycobacterium smegmatis.
Bacteria were inoculated at 10 6 cells/mL in LB (Luria Bertani) medium, except for E. faecalis which was inoculated in Muller Hinton (MH) medium, in the presence of Ml or
M2 at a concentration varying from about 0.14 μg/mL to about 70μg/mL. After 24h, the number of cells was counted.
Proliferation of the above mentioned bacteria in the presence of Ml or M2 was compared to the proliferation of said bacteria in the presence of Vancomycin, (or Kanamycin for
Mycobacterium smegmatis) The results for Ml are represented in figures 23 to 26.
As seen in the figures, Ml inhibits growth of the bacteria tested, except M. smegmatis. The calculated IC90 values are presented in table 3.
Table 3 IC90 values for Stambomycins
Similar results were obtained with the M2 mixture.
3^The anti fungal properties of Ml and M2 have been also evaluated. 4^_The anti parasitic properties of Ml and M2 have been also evaluated.
^Finally, the anti viral properties of Ml and M2 have been also evaluated.
Example 5: Antiproliferative effects of Stambomycins
Cytotoxicity was tested using CHO-Kl cells and anti-pro liferative activity was examined using HT29 cells.
The effects were compared with Doxorubicin and Sodium butyrate.
Both Ml and M2 are less cytotoxic than Doxorubicin (Table 4) and, more importantly, they revealed an interesting activity on the tumour cell line HT29 from a human colon adenocarcinoma (Table 4).
Table 4: represents the cytotoxicity and antitumor assays of both Ml and M2. CHO-Kl is an ovary sane cell line from an adult Chinese hamster. HT29 is a tumour cell line from a human colon adenocarcinoma. Doxorubicin and sodium butyrate are controls. Similar results were obtained with other tumorigenic cells lines: MCF-7 human breast cancer cell line, PC-3 human prostate cancer cell line, and H460 human lung cancer cell line. Also, cells lines such as HL-60 and K562 have been tested. The following table 5 represents the cytotoxicity and antitumor assays of both Ml and M2, in H460, MCF7 and PC3 cell lines.
nd: not determined Example 6: Activation of the silent modular polyketide synthase gene cluster in Streptomyces ambofaciens, by culturing in R2 medium.
Composition of R2 medium is disclosed in Example 1.
The production of Stambomycins by the wild-type strain Streptomyces ambofaciens ATCC23877 was analysed in R2 medium. This medium is not usually used for production of macro lides and was not expected to be suitable for the production of
Stambomycins.
The strain was grown in R2 medium and the supernatant and mycelium were extracted with ethyl acetate. The protocol is the same as the one used for the extraction of the ATCC/OE484 strain grown on MP5 medium
The extracts were analysed using Liquid-Chromatography Mass Spectroscopy (LC-MS).
As control, extracts from :
- ATCC/OE484 strain grown in R2 medium
- ATCC/OE484 strain in which the SAMR0467 ORF has been deleted, grown in R2 medium,
- ATCC 23877 strain in which the SAMR0467 ORF has been deleted, grown in R2 medium, and
- ATCC 23877 strain in which the SAMR0484 ORF, grown in R2 medium were also were analysed using LC-MS. Results are shown in Figures 27 to 32.
Unexpectedly, the LC-MS base peak chromatogram of the mycelium extract revealed two peaks, giving doubly charged ions with m/z of 680 and of 673 (positive ion mode) corresponding to molecular formulae:
- C 73 Hi 34 NO 22 (Stambomycins A/B) (Figures 27B, 28 and 31E).
- C 72 Hi 32 NO 22 (Stambomycin C/D) (Figures 29B, 30 and 32E).
These peaks are similar to those obtained with the ATCC/OE484 strain cultured as disclosed in Example 2 (Figures 27A, 3 ID, 29A and 32D).
The peaks were not present in the mycelium extract of the wild type strain deleted for SAMR0467 (Figures 31A and 32A), which encodes the first PKS involved in the biosynthesis of the Stambomycins, and the mycelium extract of the wild type strain deleted for SAMR0484 (Figures 3 IB and 32B), nor in the mycelium extract of the ATCC/OE 484 strain deleted for SAMR0467 (Figures 31C and 32C), when grown in the same conditions as the wild-type strain (i.e. in R2 medium).
These data confirmed that the peak observed in the wild-type strain is due to the
Stambomycins.
The production of Stambomycins in R2 by the wild-type strain is explained by the fact that the expression of the biosynthetic genes is activated in this growth condition.
The production of Stambomycins A/B and C/D by the wild-type strain Streptomyces ambofaciens DSM 40697 and ATCC15154 was also analysed in liquid R2 medium.
Next Patent: BEVERAGE VENDING MACHINE