TECHNICAL FIELD

The present embodiments generally relate to side effect assessment, and in particular to assessment of a risk of statin side effects in subjects.

BACKGROUND

Millions of patients around the world (>20 million patients in the USA) receive daily statin-based treatments to lower circulating cholesterol levels and thereby prevent cardiovascular diseases. Furthermore, the prescription rates for statins are increasing, with some investigators recommending statins for all individuals above the age of 50 years old, irrespective of cholesterol status.

Statins are inhibitors that act by inhibiting 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase, the rate-limiting enzyme in the mevalonate pathway of cholesterol biosynthesis. This pathway is also essential for the synthesis of other important molecules, such as the short lipids containing prenyl groups that are attached to small GTPases (hydrolase enzymes that can bind and hydrolyze guanosine triphosphate (GTP)) to target them to membranes; dolichol-P, an intermediate during protein glycosylation; and coenzyme Q (CoQ), a soluble antioxidant that is also part of the respiratory chain in mitochondria. Statins also have anti-inflammatory effects and are promising anticancer agents. The molecular basis for many of the non-cholesterol-mediated effects of statins is poorly understood, which curtails their usefulness.

Statins also have side effects for which the mechanisms are poorly understood. For instance, many patients treated with statins experience adverse side effects including muscle pains (myopathies) or even muscle breakdown (rhabdomyolysis). While the side effects caused by statins are usually well- tolerated, there are low incidences of severe adverse effects: rhabdomyolysis and neuropathy occur in 3.4 and 12 cases per 100 000 person-years, respectively. Furthermore, 10-15 % of the patients experience statin-induced myopathies that often lead to treatment discontinuation. It would therefore be beneficial to identify those patients at risk for statin-induced side effects before prescribing statins.

US 7,611 ,902 discloses a diagnostic method for determining statin-induced myopathy. The method includes collecting a lipidomic profile from a biological sample and comparing it to reference lipidomic markers that have been established by combining a pro-inflammatory muscle tissue gene expression profile with a lipidomic profile associated with high dosage statin treatment.

US 2010/0310574 discloses a diagnostic method for detecting statin-mediated myopathy. The method comprises measuring the level of an atrogin-1 polypeptide, which is a muscle-specific F-box protein that is generally highly expressed during muscle atrophy. This measured level is compared to a reference level and an alteration in the atrogin-1 level relative to the reference level is diagnostic of a statin-mediated myopathy. US 2003/0224470 discloses a diagnostic method for detecting statin-mediated myopathy. The method comprises detecting the presence of 3-methylglutaconic acid in the urine of the patient taking statin.

Previous diagnostic methods, as exemplified by the above mentioned U.S. patent documents, have primarily focused on diagnosing early symptoms of myopathy and not the risk of severe side effects before starting the statin treatment.

US 2012/0202205 discloses a diagnostic method for detecting the susceptibility of a patient to statin- induced myopathy. The method comprises detecting the presence or absence of one or more polymorphisms in the SLC01 B1 gene, which encodes the organic anion transport protein OATP1 B1 that is known to affect the hepatic uptake and biliary excretion of various drugs, including statins.

US 2007/0202518 discloses a diagnostic method for predicting a patient's susceptibility to muscular injury and muscular side effects in response to statin therapy. The method comprises detecting genetic variants in angiotensin II Type 1 receptor (AGTR1) and nitric oxide synthase 3 (NOS3) genes.

There is still a need for techniques enabling assessment of the risk of statin-induced side effects in patients prior to starting statin treatment.

SUMMARY

It is an objective to enable assessment of a risk of statin-induced side effects in a subject.

It is another objective to identify subjects susceptible to statin-induced side effects.

These and other objectives are met by embodiments disclosed herein. An aspect of the embodiments relates to a method of determining the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin-induced side effect. The method comprises determining a mitochondrial unfolded protein response (UPR ^mt ) response for the subject and determining the susceptibility of the subject to the at least one statin- induced side effect based on the determined UPR ^mt response.

A related aspect of the embodiments defines a kit configured to determine the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin- induced side effect. The kit comprises means configured to determine a UPR ^mt response for the subject. In an optional embodiment, the kit also comprises instructions defining that the susceptibility of the subject to the at least one statin-induced side effect is determined based on the determined UPR ^mt response. Another aspect of the embodiments relates to a method of determining a suitable dosage for a subject, preferably a mammalian subject and more preferably a human subject, in need of treatment with at least one statin. The method comprises determining the susceptibility of the subject to at least one statin-induced side effect as defined above and determining a suitable dosage of the at least one statin for the treatment based, at least partly, on the determined susceptibility of the subject to the at least one statin-induced side effect.

A related aspect of the embodiments defines a kit configured to determine a suitable dosage for a subject, preferably a mammalian subject and more preferably a human subject, in need of treatment with at least one statin. The kit comprises means configured to determine the susceptibility of the subject to at least one statin-induced side effect. In a particular embodiment, the means is in the form of the above mentioned kit configured to determine the susceptibility of a subject to at least one statin- induced side effect. In an optional embodiment, the kit also comprises instructions defining that the suitable dosage of the at least one statin for the treatment is determined based, at least partly, on the determined susceptibility of the subject to the at least one statin-induced side effect.

A further aspect of the embodiments relates to a method of reducing the risk of side effects in a subject, preferably a mammalian subject and more preferably a human subject, during treatment with at least one statin. The method comprises determining a suitable dosage of the at least one statin for the subject as defined above and administering the at least one statin according to the determined dosage to the subject.

A related aspect of the embodiments defines a kit configured to reduce the risk of side effects in a subject, preferably a mammalian subject and more preferably a human subject, during treatment with at least one statin. The kit comprises means configured to determine a suitable dosage of the at least one statin for the subject. In a particular embodiment, the means is in the form of the above mentioned kit configured to determine a suitable dosage for a subject in need of treatment with at least one statin. In an optional embodiment, the kit also comprises instructions defining that the at least one statin is to be administered to the subject according to the determined dosage.

BRIEF DESCRIPTION OF THE DRAWINGS

The embodiments, together with further objects and advantages thereof, may best be understood by making reference to the following description taken together with the accompanying drawings, in which:

Fig. 1 illustrates an overview of the screening strategy used to isolate and identify mutations that confer fluvastatin resistance in Caenor abditis elegans.

Fig. 2 illustrates mutations in atfs-1 that confer resistance to inhibitors of the mevalonate pathway. (A) Simplified version of the mevalonate pathway, its sub-branches, and sites of action of various inhibitors. The cholesterol branch of the pathway is absent in C. elegans. (B) Fluvastatin dose- response curve of different atfs-1 alleles. The novel atfs-1 alleles confer resistance to rosuvastatin (C) and to ibandronate (D). (E) Mevalonate abrogates the effects of fluvastatin on wild-type worms, but has no effect on three gain-of-function atfs-1 mutants. The bars in (C-E) show the average ± SEM (n>20). (F) Schematics of the ATFS-1 protein indicating the position and nature of the four atfs-1 alleles isolated in this study {et15-et18). MTS: mitochondrial targeting sequence; NLS: nuclear localization signal; NES: nuclear export signal.

Fig. 3 illustrates that the novel atfs-1 mutants carry gain-of-function (gof) alleles that activate the UPR ^mt . (A) RNAi against atfs-1 suppresses the fluvastatin resistance of the atfs-1{et15) allele. The control RNAi vector (L4440) has no effect. (B) The affe- ^" /(gk3094) loss-of-function mutant is hypersensitive to fluvastatin. It fails to grow on 0.1 mM, a concentration that has only a minor effect on wild-type and no effect on the atfs-1{et15) gain-of-function allele. (C) The atfs-1 alleles et15, et17, and et18 display constitutive expression of two UPR ^mt reporters (hsp-60::GFP and hsp-6::GFP) but not of a UPR ^er reporter (hsp4::GFP). The bars show the average ± SEM (n>20).

Fig. 4 illustrates that pre-induction of UPR ^mt using ethidium bromide protects against the adverse effects of statins in nematodes, yeast, and mammalian cells. (A-B) Worms pre-treated with ethidium bromide are viable and grow into fertile adults when subsequently cultivated on 0.5 mM fluvastatin. (C) The fission yeast Sacc aromyces pombe tolerates higher doses of fluvastatin when pre-treated with 250 ng/ml or 500 ng/ml ethidium bromide. (D) The mammalian fibroblast cell line NIH 3T3 shows better viability in the presence of 1 mM fluvastatin when it has been pre-treated with 1 μς/ιτιΙ ethidium bromide. Bars show the average readout from the Presto Blue Cell Viability assay (Invitrogen) ± SEM (n>5 wells; ***: p<0.001).

Fig. 5 illustrates that the affe-ffgof) alleles protect C. elegans against prenylation inhibition. (A) Images of wild-type (WT), atfs-1 (gk3094), and atfs-1(et15) worms cultivated for 96 hours on control or gliotoxin (100 μΜ) plates. The gain-of-function atfs-1 (et15) allele confers partial resistance to gliotoxin while the loss-of-function affe-1 (gk3094) allele confers hypersensitivity as assessed by measuring growth (B) or viability (C) after 96 hours on 100 μΜ gliotoxin. (D) The affe-1 [et15) allele can partially rescue the protein prenylation defects caused by fluvastatin. The protein prenylation reporter (pGLO-1 P::GFP- CAAX) shows clear membrane enrichment in untreated L1 larvae for both wild-type and affe-1 {et15). In L1 larvae from parents cultivated in the presence of 0.5 mM statin for 48 hours, only the affe-1 {et15) mutant continues to show membrane enrichment (white arrowheads). (E) Quantification of the prenylation assay using pGLO-1 P::GFP-CAAX. The results are presented as the number of intestinal cells showing distinct membrane enrichment. Note that both affe-1 {et15) and affe-1 {et18) show a slight but significant increase in prenylation. The bar shows the average ± SEM (n>35 worms; **: p<0.01 ; ***: p<0.001). (F) Model illustrating the effects of statins on mitochondria and the protective induction of UPR ^mt by ATFS-1.

Fig. 6 illustrates that the statin-resistant mutants are less healthy than wild-type worms. (A) The affe- 1 (gof) mutants have reduced life span compared to wild-type worms. Mean life spans in days were: wild-type (15.68 ± 0.85), et15 (11.35 ± 0.64), et17 (13.44 ± 0.82), and et18 (12.62 ± 0.67). (B) The brood size of the affe-1 (gof) mutants is smaller than for wild-type worms.

Fig. 7 illustrates that pre-induction of the UPR ^mt protects C. elegans and mammalian cells from the effects of statins. (A) Worms pre-treated with paraquat are able to reach adulthood and reproduce while worms placed directly on fluvastatin arrest as small larvae. (B) Paraquat pre-treatment protects C. elegans from the lethal effects of statins. (C) NIH 3T3 cells pre-treated with ethidium bromide show better cell morphology and adhesion when subsequently cultured in the presence of 10 mM fluvastatin. The deleterious effects of statins on NIH 3T3 are on-target effects because they can be abrogated by including 10 mM mevalonate in the culture medium.

Fig. 8 illustrates that the atfsA [et15) allele confers resistance to the respiration inhibitory effects of fluvastatin (A), but not to the growth inhibitory effects of three respiratory chain inhibitors (C-D). Fig. 9 schematically illustrates UPR ^mt activation pathway in a human cell (1).

Fig. 10 illustrates that prolonged treatment with ethdium bromide results in activation of mitochondrial chaperones (hsp10 and hsp75) in mouse fibroblast 3T3 cells. The figure also illustrates that the QPCR method can be used to monitor the levels of UPR ^mt activation. Error bars are standard error of the mean of biological triplicates for each gene.

DETAILED DESCRIPTION

The present embodiments generally relate to side effect assessment, and in particular to assessment of a risk of statin-induced side effects in subjects. Thus, the embodiments enable identification of subjects that are susceptible to at least one statin-induced side effect if the subject is undergoing treatment with the at least one statin. The present embodiments can therefore be used to identify subjects that should avoid statins during treatment of, for instance, high cholesterol levels. For those subjects alternative cholesterol lowering medicaments or treatments could be more beneficial. The present embodiments can also be used to individually adapt statin dosages for subjects based on their susceptibility to statin-induced side effects. Hence, the suitable statin dosages for these subjects can be determined to minimize or at least reduce the risk of developing side effects from treatment with statin.

Statins, also known as 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors in the art, are a class of drugs used to, among others, lower cholesterol levels by inhibiting the enzyme HMG- CoA reductase, which plays a central role in the production of cholesterol in the liver, see Fig. 2A.

Statin-induced side effects refer to side effects seen in some subjects undergoing statin treatment. Such side effects include muscle pain (myopathy), muscle breakdown (rhabdomyolysis) and neuropathy. Embodiments as disclosed herein can therefore be used to detect subjects susceptible to statin-induced myopathy, susceptible to statin-induced rhabdomyolysis, susceptible to statin-induced neuropathy or susceptible to at least two of statin-induced myopathy, statin-induced rhabdomyolysis and statin-induced neuropathy.

The embodiments are based on the effects of the mitochondrial unfolded protein response (UPR ^mt ) in protecting cells and organisms against the side effects of statins. Hence, a subject's UPR ^mt response determines or at least significantly affects the subject's susceptibility to statin-induced side effects. UPR ^mt is a stress response configured to maintain protein-folding homeostasis within mitochondria. UPR ^mt generally activates transcription of nuclear-encoded mitochondrial chaperone and protease genes to promote protein homeostasis within the organelle. The mitochondrial chaperones are required for protein import and facilitate protein folding, whereas the proteases degrade proteins that fail to fold or assembly correctly. Mitochondria-localized chaperones include a heat shock protein 70 kDa (HSP70) family member, mtHSP70, as well as HSP60 and HSP10, sometimes referred to as chaperonin 60 (CPN60) and CPN10, respectively. A further mitochondrial chaperone is mtDnaJ, also referred to as HSP40. These generally reside in the mitochondrial matrix and are encoded by nuclear genes, see Fig. 9. Mitochondrial proteases include the protease encoded by the ClpP gene. Fig. 9 is a schematic illustration of UPR ^mt signaling in a mammalian cell. UPR ^mt is generally initiated by the activation of the chop gene and the c/ebp gene through a respective AP-1 element in the chop promoter and c/ebp gene. CHOP (C/EBP homology protein) and C/ΕΒΡβ (CCAAT-enhancer-binding protein β) are transcription factors that hetero-dimerise to activate transcription of UPR ^mt responsive genes. Hence, the promoters of these UPR ^mt responsive genes comprise a CHOP element (GPTTGCA, wherein P denotes the purine nucleoside adenosine or guanosine) to which the CHOP- C/ΕΒΡβ dimer binds. Mitochondrial response genes typically also comprise two additional conserved promoter elements denoted mitochondrial unfolded protein response element 1 (MURE1) and MURE2.

Activation of the chop and c/ebp genes is thought to be through the binding of the Jun transcription factor to the AP-1 elements of the chop and c/ebp promoters. A further upstream molecule, the JNK2 kinase, seems to be involved in the Jun activation. For more information with regard to UPR ^mt signaling reference can be made to documents (1 , 2). In human, UPR ^mt activation therefore relates to expression, i.e. synthesis of the corresponding transcript and translation of the encoded protein as well as any post-translational modification, such as phosphorylation, processing, cleavage, glycosylation, etc., and transport to the mitochondria of the UPR ^mt response or effector proteins, such as mitochondrial chaperones, e.g. mtHSP70, HSP60, HSP10, and/or mitochondrial protease, such as ClpP.

The degree of activation of UPR ^mt in response to a given mitochondrial stress may vary among subjects, and such variations are revealed in varying levels of expression and localization to the mitochondria of the UPR ^mt response or effector proteins.

The difference in susceptibility to statin-induced side effects as seen among patients is, according to the present embodiments, based, at least partly, on differences in UPR ^mt responses among the patients. Hence, techniques for monitoring UPR ^mt responses, or detecting or scoring differences in UPR ^mt responses can be used to determine the susceptibility of a subject to statin-induced side effects and detect subjects that are likely to suffer from such statin-induced side effects if prescribed statin to, for instance, lower the cholesterol level in the subjects. Thus, variation in UPR ^mt activity/regulation may account for the variation in the effects that statins have on different patients.

The UPR ^mt signaling and response differs significantly from the more well known and studied endoplasmic reticulum unfolded protein response (UPR ^er ). UPR ^er involves a wide range of genes and has three signaling pathways: IRE-1 , PERK and ATF6. The genes and proteins involved in UPR ^er are generally different from the genes and proteins of the UPR ^mt signaling.

The effects of statins on the nematode C. elegans, a well established model organism, have previously been described (3). That article established C. elegans as an excellent platform with which to elucidate the non-cholesterol activities of statins. As is further disclosed herein, randomly mutagenized C. elegans have been screened to isolate mutants that can be propagated in the presence of statins, i.e. that are resistant to statins. Four statin-resistant mutants were identified, and, astonishingly, all of them had activating mutations in the same protein, i.e. activating transcription factor associated with stress-1 (ATFS-1). This protein is the key activator of the UPR ^mt stress response that can protect mitochondria in C elegans. Activation of UPR ^mt also protected yeast cells and mammalian cells from the effects of statins. Hence, the UPR ^mt is a mechanism that can protect human cells from the deleterious effects of statins. C. elegans is eminently suited to study the cholesterol-independent effects of statins because it lacks the sterol synthesis branch of the mevalonate pathway but retains the other branches (Fig. 2A). In C. elegans, statins cause decreased protein prenylation, induction of the UPR ^er , growth arrest, and lethality. These are all on-target effects of statins because they can be abrogated by the inclusion of mevalonate in the culture medium. About 150,000 randomly mutagenized haploid genomes have been screened and four mutant alleles {et15-et18) that confer statin resistance in C. elegans have been isolated. et15 and et16 are molecularly identical, and only data from et15 will be shown in most experiments since all four alleles behaved similarly. The isolated mutants are resistant to various statins, including fluvastatin and rosuvastatin, and to ibandronate, which is a potent bisphosphonate drug that inhibits farnesyl diphosphate synthase, i.e. several steps downstream of HMG-CoA reductase (Figs. 2B-2D). These results indicate that all four mutants can compensate for inhibition of the mevalonate pathway. Providing the mutants with mevalonate did not improve their growth or their resistance to fluvastatin, which is consistent with the fact that they grow as well on 0.5 mM statins as they do on control plates (Fig. 2E).

Using a gene identification strategy based on outcrossing and whole-genome sequencing (Fig. 1), it was surprisingly found that all four statin-resistant mutants carried mutations in the mitochondrial targeting signal (MTS) of the protein ATFS-1 (Fig. 2F). ATFS-1 is a leucine zipper transcription factor that contains an MTS at its N-terminus and a nuclear localization signal (NLS) at its C-terminus. The primary function of ATFS-1 is to activate the UPR ^mt . In the absence of mitochondrial stress, ATFS-1 is effectively recruited to the mitochondria where it is degraded. However, during mitochondrial stress ATFS-1 is not efficiently targeted to the mitochondria and therefore allowed to accumulate in the nucleus and activate target genes, including the mitochondrial chaperones HSP-6 and HSP60. The novel statin-resistant atfs-1 alleles are gain-of-function (gof) mutations because:

1) RNAi against atfs-1 eliminates statin resistance in the mutants (Fig. 3A);

2) the null affe-1 (gk3094) allele is hypersensitive to statin (Fig. 3B);

3) the UPR ^mt reporters hsp-60::GFP and hsp-6::GFP (but not the UPR ^er reporter hsp-4::GFP) are constitutively expressed in the mutants (Fig. 3C);

4) the novel atfs-1 mutants all grow rather poorly on normal plates (Fig. 6A-B) and this phenotype is abrogated by treating the mutants with atfs-1 RNAi (Fig. 3A); and

5) the affe-1 [et15) heterozygous worms are resistant to statins (data not shown). Constitutive activation of the UPR ^mt is, therefore, the most likely mechanism by which the affe-l (gof) alleles confer resistance to statins while also reducing the growth rate on control plates. Induction of UPR ^mt through other means ought to confer statin resistance in wild-type worms. UPR ^mt can be induced in C. elegans by exposure to ethidium bromide, which impairs mitochondrial DNA replication, or paraquat, which causes oxidative stress. Both treatments conferred statin resistance to wild-type C. elegans (Figs. 4A-4B and Figs. 7A-7B).

The UPR ^mt appears to be an evolutionarily conserved mechanism to cope with the consequences of an impaired mevalonate pathway because statin resistance was also induced in the yeast Saccharomyces pombe (Fig. 4C) and the mammalian fibroblast line NIH 3T3 when the mitochondrial stress response was activated (Fig. 4D and Fig. 7C). Conservation of the UPR ^mt as a statin resistance mechanism in C. elegans, S. pombe, and mammals is especially important in view of the fact that the latter two types of organisms do have the branch of the mevalonate pathway that leads to sterol synthesis, which is lacking in C. elegans. In other words, the cytotoxic effects of statins are primarily related to mitochondria homeostasis even in organisms where the main output of the pathway is considered to be sterols.

The fact that the UPR ^mt protects against the deleterious effects of statins suggests that these compounds, i.e. statins, interfere with mitochondria homeostasis. One mechanism for this could be that inhibiting the mevalonate pathway results in reduced synthesis of CoQ and failure of the respiratory chain in mitochondria. Indeed, fluvastatin treatment causes reduced respiration in C. elegans, and the atfs-\ {et15) mutant respires normally even in the presence of fluvastatin (Fig. 8A). However, several lines of evidence argue against CoQ depletion accounting for the effects of statins on mitochondria:

1) supplying CoQ does not protect C. elegans from the toxic effects of statins (data not shown); 2) the affe-1 [et15] mutant is not resistant to three inhibitors of the mitochondrial respiratory chain (Figs. 8B-8D); and

3) it is well known that CoQ is dietarily available to C. elegans that is fed Escherichia coli as in the conducted experiments (4, 5). Small GTPases, especially those of the RAB family (members of the Ras superfamily of monomeric G proteins), are essential for intracellular trafficking and organelle homeostasis. Their activity depends on the addition of prenyl groups, i.e. farnesyl pyrophosphate or geranylgeranyl pyrophosphate, which are synthesized through the mevalonate pathway. Statins inhibit protein prenylation in C. elegans (3), and it is, therefore, possible that statins impair mitochondria by preventing the prenylation of small GTPases. This hypothesis predicts that the affe-1 (gof) mutants that are resistant to statins should also be resistant to more specific inhibitors of prenylation. Gliotoxin is an inhibitor of farnesyl-transferase, the enzyme that ligates farnesyl-groups to the C-terminal end of small GTPases, resulting in growth defects and lethality in worms. Gliotoxin also suppresses the effect of an activated form of the Ras GTPase. The affe-1 (efi 5) gain-of-function mutant is resistant to gliotoxin while the affe-1 (gk3094) null mutant is hypersensitive (Figs. 5A-5B). These results are consistent with the hypothesis that statins exert their negative effects on mitochondria via inhibition of small GTPases (Figs. 5A-B). The affe- ^ {etlS) and affe-1 [et18) mutants were also partially resistant to the prenylation inhibitory effects of statins (Figs. 5C-5D).

Hence, statins interfere with mitochondria homeostasis, the mechanism is related to the effects of statins on small GTPase prenylation, and the UPR ^mt is a powerful protective pathway (Fig. 5E). Many studies have previously pointed to mitochondria as a basis for the adverse effects of statins, but no mechanism had been proposed that could protect cells from these effects. Data as presented herein indicate that UPR ^mt can help preserve mitochondria homeostasis in the presence of statins, which allows the cells to better utilize the residual output from the mevalonate pathway, hence sustaining essential GTPase prenylation.

The variation in the regulation of UPR ^mt and UPR ^mt response among individuals may therefore be a key contribution to the varied susceptibility to developing side effects seen among patients receiving statin therapy. This connection between variation in UPR ^mt response and susceptibility to statin-induced side effects is exploited in the present embodiments.

An aspect of the embodiments relates to a method of determining the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin-induced side effect. The method comprises determining a UPR ^mt response for the subject and determining the susceptibility of the subject to the at least one statin-induced side effect based on the determined UPR ^mt response. In some embodiments, the method further comprises administering at least one statin to the subject based on the determined susceptibility. In other embodiments, the method further comprises withholding administration of a statin based on the determined susceptibility. Another aspect of the embodiments relates to a method of determining a suitable dosage for a subject, preferably a mammalian subject and more preferably a human subject, in need of treatment with at least one statin. The method comprises determining the susceptibility of the subject to at least one statin-induced side effect as defined above and determining a suitable dosage of the at least one statin for the treatment based, at least partly, on the determined susceptibility of the subject to the at least one statin-induced side effect.

A further aspect of the embodiments relates to a method of reducing the risk of side effects in a subject, preferably a mammalian subject and more preferably a human subject, during treatment with at least one statin. The method comprises determining a suitable dosage of the at least one statin for the subject as defined above and administering the at least one statin according to the determined dosage to the subject.

An additional aspect of the embodiments relates to a method of treating a subject, preferably a mammalian subject and more preferably a human subject, with at least one statin, comprising determining a suitable dosage of the at least one statin for the subject as defined above and administering the at least one statin according to the determined dosage to the subject.

A further aspect of the embodiments relates to a method of treating a subject, preferably a mammalian subject and more preferably a human subject, with at least one statin, comprising administering a suitable dosage of the at least one statin, the suitable dosage is determined as defined above.

An additional aspect of the embodiments relates to a method of treating a subject in need of treatment with at least one statin, preferably a mammalian subject and more preferably a human subject, comprising administering at least one statin to a subject that has been determined to have a normal or enhanced UPR ^mt response. A normal or enhanced UPR ^mt response is one that is equal to or greater than the UPR ^mt response measured in a population of subjects that do not exhibit side effects in response to statin administration. A further aspect of the embodiments relates to a method of monitoring a subject, preferably a mammalian subject and more preferably a human subject, that is currently being treated with at least one statin by determining the UPR ^mt response of the subject and lowering the dose of at least one statin or halting administration of at least one statin if the UPR ^mt response is below normal or baseline UPR ^mt response. Another aspect of the embodiments relates to an assay for determining the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin-induced side effect, the assay comprising determining a UPR ^mt response for the subject and determining the susceptibility of the subject to the at least one statin-induced side effect based on the determined UPR ^mt response.

The subject subject to treatment with statin could suffer from any medical condition for which statin could be prescribed as medicament. In a typical embodiment the subject is suffering from high (circulating) cholesterol levels. In other embodiments the anti-inflammatory or anticancer effects of statins are used so the subject is suffering from an inflammatory or cancer disease.

Yet another aspect of the embodiments relates to a kit configured to determine the susceptibility of a subject, preferably a mammalian subject and more preferably a human subject, to at least one statin- induced side effect. The kit comprises means configured to determine a UPR ^mt response for the subject. In an optional embodiment, the kit also comprises instructions defining that the susceptibility of the subject to the at least one statin-induced side effect is determined based on the determined UPR ^mt response. A further aspect of the embodiments relates to a kit configured to determine a suitable dosage for a subject, preferably a mammalian subject and more preferably a human subject, in need of treatment with at least one statin. The kit comprises means configured to determine the susceptibility of the subject to at least one statin-induced side effect. In a particular embodiment, the means is in the form of the above mentioned kit configured to determine the susceptibility of a subject to at least one statin- induced side effect. In an optional embodiment, the kit also comprises instructions defining that the suitable dosage of the at least one statin for the treatment is determined based, at least partly, on the determined susceptibility of the subject to the at least one statin-induced side effect.

Yet another aspect of the embodiments relates to a kit configured to reduce the risk of side effects in a subject, preferably a mammalian subject and more preferably a human subject, during treatment with at least one statin. The kit comprises means configured to determine a suitable dosage of the at least one statin for the subject. In a particular embodiment, the means is in the form of the above mentioned kit configured to determine a suitable dosage for a subject in need of treatment with at least one statin. In an optional embodiment, the kit also comprises instructions defining that the at least one statin is to be administered to the subject according to the determined dosage.

The determination of the UPR ^mt response in a subject can be performed according to various embodiments as further described below. Also the determination of a subject's susceptibility to at least one statin-induced side effect based on the determined UPR ^mt response can be performed according to various embodiments.

For instance, the determination of the UPR ^mt response could involve determining the expression and/or activity level of at least one gene involved in the UPR ^mt . Alternatively, or in addition, the translation and/or activity level of at least one protein encoded by a gene involved in the UPR ^mt response could be determined. In such a case, the determination of the subject's susceptibility could involve comparing a value representing expression and/or activity level of the at least one gene and/or a value representing translation and/or activity level of the at least one protein with a respective threshold. If the subject has a high value, indicating an active UPR ^mt response, he/she could be predicted to be less susceptible to a statin-induced side effect as compared to a subject having a comparatively lower value. Hence, if the value exceeds the threshold (alternatively, exceeds or is equal to the threshold) the subject is predicted or determined to have a low susceptibility to statin-induced side effects, whereas if the value is equal to or below the threshold (alternatively, is below the threshold) the subject is predicted to have a high susceptibility to statin-induced side effects.

This concept can be extended to the case with more than one threshold per activity/expression/translation value. For instance, subjects could be categorized to either have low susceptibility, medium susceptibility or high susceptibility to statin-induced side effect depending on whether the determined value representing the subject's UPR ^mt response exceeds a first threshold and a second threshold, is below the first threshold but exceeds the second threshold or is below both the first and second threshold, respectively.

It could be sufficient to determine a single value for the subject relating to a single UPR ^mt gene or protein. Alternatively, multiple, i.e. at least two, values could be determined relating to different genes and/or proteins involved in the UPR ^mt response. In such a case, each such determined value is preferably compared to a respective threshold or a respective set of thresholds. The determination of the subject's susceptibility could then be based on the combined assessment of the different values and their respective threshold(s). The value(s) of the threshold(s) can be determined by the person skilled in the art, for instance by dividing test subjects into two groups; one containing subjects diagnosed as suffering from statin- induced side effects and one containing subjects that do not suffer from any statin-induced side effects. The value(s) of the expression and/or activity of the at least one gene and/or of the translation and/or activity of the at least one protein is(are) then determined for the test subjects. The threshold value(s) is(are) then set to enable a discrimination between the susceptible test subjects and the non- susceptible test subjects. In more complex prediction embodiments involving, for instance, pattern matching between gene or protein profiles a respective control pattern, e.g. an average gene or protein profile or pattern, could be determined for each of the test groups. The prediction of a subject's susceptibility to statin-induced side effects could then be based on pattern matching by calculating a respective measure indicating how close the subject's gene or protein profile matches the control or average gene or protein profile of the two test groups.

The techniques discussed above could be extended to the case of investigating the subject's susceptibility to different types of statin-induced side effects, such as statin-induced myopathy, statin- induced rhabdomyolysis, and statin-induced neuropathy. In such a case, a respective threshold, set of thresholds or average gene or protein profiles could be determined and used for each such type of statin-induced side effect.

Determination of UPR ^mt response in a subject can be performed according to various embodiments as is further disclosed herein.

In a first embodiment genotyping is used to determine the UPR ^mt response in a subject. Thus, in this approach genotyping is used to detect or determine whether a subject has a mutation or an allele associated with susceptibility to statin-induced side effects in any of the genes involved in the UPR ^mt signaling, i.e. inferior or impaired UPR ^mt response, such as reduced or inferior UPR ^mt activation or impaired UPR ^mt regulation. Alternatively, or in addition the genotyping approach could be used to detect or determine whether a subject has no mutation or an allele associated with low or no susceptibility to statin-induced side effects in any of the genes involved in the UPR ^mt signaling, i.e. normal or even enhanced UPR ^mt response. In a particular embodiment of this approach a body sample, preferably a body fluid sample and more preferably a blood sample, is taken from the patient that is candidate for statin therapy. The blood sample could be collected in a tube containing heparin as anticoagulant. DNA from the blood sample is purified, for instance using the QIAamp DNA Blood Mini Kit (Qiagen). The purified DNA can then be used as a template in an amplification assay, e.g., a polymerase chain reaction (PCR) to amplify a target gene involved in the UPR ^mt signaling, a target portion of a gene involved in the UPR ^mt signaling and/or a regulatory sequence, such as promoter sequence or a portion thereof, of a gene involved in the UPR ^mt signaling. In an embodiment, the HotStarTaq Plus DNA Polymerase kit (Qiagen) can be used in the PCR-based amplification.

For instance, PCR can be used to amplify the chop gene using the primers 5'- GTCAGAGACTTAAGTCT-3' (SEQ ID NO: 1) and 5'-TGGCTCATAGAAAGTCA-3' (SEQ ID NO: 2) and the HotStarTaq Plus DNA Polymerase kit (Qiagen). The resulting 3.9 kb product containg the chop gene sequence and obtained with the two above- mentioned primers can be separated on a 0.8 % agarose (Sigma) gel in a Tris-Borate-EDTA buffer using a Standard Submarine Electrophoresis Unit (Hoefer), cut out from the gel and the DNA is purified using a QIAquick Gel Extraction Kit (Qiagen). Also other techniques for DNA purification are possible. The purified DNA can then be used for DNA sequencing to detect any mutation or target allele. For instance, the purified DNA may be recovered in 50 μΙ water and shipped for sequencing to the company Eurofins, using their Value Read service. Presence of a mutation or indicative polymorphism in the sequence is predictive of impaired activity in the UPR ^mt of the patient, hence gives an impaired UPR ^mt response. Such a patient is then regarded as being susceptible to statin-induced side effects. This type of assay is based on a correlation between genetic variant and UPR ^mt activity and statin sensitivity in patients. Such genetic variants could be identified by correlating single-nucleotide polymorphism (SNP) variants with UPR ^mt activity among individuals, or by sequencing parts of the genomes of individuals that vary in their UPR ^mt . Then, variations in genes that are part of the UPR ^mt signaling can be identified and tested to determine whether these gene variants explain the variation in UPR ^mt . Genotyping of patients would then be used to predict who is at risk for the statin side effects. There are many ways to genotype including sequencing; hybridization-based methods, such as dynamic allele-specific hybridization, molecular beacons, SNP microarrays; enzyme-based methods, such as restriction fragment length polymorphism, PCR-based methods, flap endonuclease, primer extension, 5'-nuclease, oligonucleotide ligase assay; and other post-amplification methods, such as single strand conformation polymorphism, temperature gradient gel electrophoresis, denaturing high performance liquid chromatography, high-resolution melting of the entire amplicon, use of DNA mismatch-binding proteins and SNPIex. In a second embodiment quantitative PCR (QPCR) can be used to determine the UPR ^mt response in a subject. Thus, in this approach QPCR is used to determine the cellular UPR ^mt response in a sample taken from the subject. It is then possible to determine how the UPR ^mt response is affected by statin addition. Thus, if the subject is capable of providing an effective UPR ^mt in response to the statin addition, the subject is regarded as being less susceptible to statin-induced side effect. However, if the statin-induced UPR ^mt response is impaired or inferior as determined by QPCR the subject is regarded as being susceptible to statin-induced side effects.

In a particular embodiment of this approach a body sample, preferably a body fluid sample and more preferably a blood sample, is taken from a patient that is candidate for statin therapy and collected, e.g., in a clinical Purple tube containing EDTA as anticoagulant. The white blood cells are then purified, e.g., by preparative centrifugation as follows:

1) For each 5 ml of blood, add 45 ml of room temperature 0.17 M ammonium chloride solution to lyse red blood cells. Generally, the cells will not correctly lyse if the solution is cold.

2) Incubate for 5 minutes on a rotator. Generally, white blood cells may begin to lyse if 5 minutes are exceeded.

3) Centrifuge for 5 minutes at 2000 RPM.

4) Aspirate supernatant, resuspend pellet in -50 ml cold 1x PBS.

5) Centrifuge for 5 minutes at 2000 RPM.

6) Aspirate supernatant.

The cells are resuspended in, for instance, RPMI 1640 culture medium (ATCC Modification) (InVitrogen) containing 10 % fetal calf serum (InVitrogen) to a density of 500,000 cells per ml, then dispensed into, for instance, six wells of a 96-well plate. Fluvastatin or another statin to be tested is added to three of the wells to a final concentration of, e.g., 10 μΜ and the three other wells serve as controls. The wells are kept at 37°C for 4 hours in an incubator with an air C0 ₂ concentration of 5 %. The mRNA from the cultures is purified using the Dynabeads® mRNA DIRECT™ Kit (InVitrogen) or some other mRNA purifying kit. The purified mRNA is then used as a template in a QPCR using the Fast SYBR® Master Mix (InVitrogen) or some other kit to amplify a transcript of a target gene involved in the UPR ^mt signaling or a transcript of a target portion of a gene involved in the UPR ^mt signaling. For instance, QPCR can be used to amplify the Hsp60 mRNA transcript using the primers 5'- TAGAGGCGGAGGGAGGGGA-3' (SEQ ID NO: 3) and 5'- TCTCCACAGAAAGGCTGCT-3' (SEQ ID NO: 4). The average ratio of the QPCR results of fluvastatin-treated wells over the control wells provides a UPR ^mt score or value that is representative of the UPR ^mt response of the subject and thereby representative of the patient's susceptibility to fluvastatin-induced side effects.

In a particular embodiment the UPR ^mt score can be compared to a defined threshold. In such a case, if the UPR ^mt score is below the threshold, the subject is regarded as being susceptible to fluvastatin- induced side effect.

In a third embodiment enzyme-linked immunosorbant assay (ELISA) can be used to determine the UPR ^mt response in a subject. Thus, in this approach ELISA is used to determine the cellular UPR ^mt response in a sample taken from the subject. It is then possible to determine how the UPR ^mt response is affected by statin addition. Thus, if the subject is capable of providing an effective UPR ^mt in response to the statin addition, the subject is regarded as being less susceptible to statin-induced side effect. However, if the statin-induced UPR ^mt response is impaired or inferior as determined by ELISA the subject is regarded as being susceptible to statin-induced side effects.

In a particular embodiment of this approach a body sample, preferably a body fluid sample and more preferably a blood sample, is taken from a patient that is candidate for statin therapy and collected, e.g., in a clinical Purple tube containing EDTA as anticoagulant. The white blood cells are then purified, e.g., by preparative centrifugation as follows:

1) For each 5 ml of blood, add 45 ml of room temperature 0.17 M ammonium chloride solution to lyse red blood cells. Generally, the cells will not correctly lyse if the solution is cold.

2) Incubate for 5 minutes on a rotator. Generally, white blood cells may begin to lyse if 5 minutes are exceeded.

3) Centrifuge for 5 minutes at 2000 RPM.

4) Aspirate supernatant, resuspend pellet in -50 ml cold 1x PBS.

5) Centrifuge for 5 minutes at 2000 RPM.

6) Aspirate supernatant.

The cells are resuspended in, for instance, RPMI 1640 culture medium (ATCC Modification) (InVitrogen) containing 10 % fetal calf serum (InVitrogen) to a density of 500,000 cells per ml, then dispensed into, for instance, 12 wells of a 96-well plate. Fluvastatin or another statin to be tested is added to six of the wells to a final concentration of, e.g., 10 μΜ and the six other wells serve as controls. The wells kept at 37°C for 4 hours in an incubator with an air C0 ₂ concentration of 5 %. The abundance of at least one of the proteins involved in the UPR ^mt signaling can then be determined.

For instance, the abundance of the HSP60 protein is determined in half of the samples and the abundance of an internal control protein, such as alpha-tubulin, is determined in the other half of the samples. This determination can be performed, e.g., using an In-Cell ELISA Detection Kit (Thermo Scientific) together with a custom-developed anti-HSP60 antibody and an anti-alpha tubulin antibody (Thermo Scientific). The average ratio of the ELISA results (HSP60 over alpha-tubulin ratio) of fl uvastati n-treated wells over the control wells provides a UPR ^mt score or value that is representative of the UPR ^mt response of the subject and thereby representative of the patient's susceptibility to fl u astati n-i n d uced side effects. In a particular embodiment the UPR ^mt score can be compared to a defined threshold. In such a case, if the UPR ^mt score is below the threshold, the subject is regarded as being susceptible to fluvastatin- induced side effect.

A variant of the ELISA concept could be to monitor UPR ^mt activity by providing a fixed amount of a substrate then quantifying the UPR ^mt chaperone activity using an antibody that discriminates between two folded states, i.e. pre- versus post-chaperone.

Other techniques of inducing UPR ^mt than by statin challenge could be used. For instance, paraquat or ethidium bromide could be used instead of fluvastatin (or some other statin) as the UPR ^mt inducing agent.

In the second and third embodiments QPCR and ELISA, respectively, have been used to assess the UPR ^mt response. Alternatively, a colorimetric assay could be used. The UPR ^mt response involves the expression of chaperones that modify protein folding as well as proteases. In this approach a substrate for one of the chaperones or proteases (e.g. a modified form of green fluorescent protein or other reporter protein) is included with the cells during incubation and where the color/absorbance is affected by the action of the UPR ^mt response. Detection of this color or absorbance change using a spectrophotometer would be a measurement of the UPR ^mt response. The above described embodiments of determining the UPR ^mt response or score of a subject should merely be seen as illustrative but non-limiting examples. Thus, other variants of using, for instance, genotyping, QPCR and/or ELISA, could be used to determine the UPR ^mt response. This means that the particular reagents, enzymes, volumes, concentrations and procedures, etc. mentioned in these examples should not be regarded as fixed but could be adopted or replaced according to the knowledge of the person skilled in the art. In addition, other types of statins than the above exemplified fluvastatin could be used, including combinations of more than one statin. Also other types of body samples than blood samples and other types of cells than white blood cells could be used when determining the UPR ^mt response. For instance muscle cells extracted using a fine biopsy needle could instead be used.

Also other techniques for determining the UPR ^mt response from a body sample could be used including immunoassay-based techniques and/or techniques that involve measuring amounts of cellular RNA. Non-limiting examples of immunoassay-based techniques to measure UPR ^mt response comprise Western blotting, ELISA, indirect immunofluorescence assays and immunoprecipitation assays. Non- limiting examples of techniques involving measuring an amount of cellular RNA comprise amplification assays (quantitative or semiquantitative PCR) or hybridization assays (Northern blotting, slot blotting, dot blotting, nuclease protection assays or microarray assays). Also allele specific oligonucleotides or enzymatic techniques could be used.

A measure of UPR ^mt response in mammals, such as humans, may involve measuring the level of expression and/or activity of any of the genes and/or their encoded proteins involved in the UPR ^mt signaling. Non-limiting examples include the mitochondrial chaperones, such as mtHSP70 (TRAP1), HSP60, HSP10, and mtDNAJ, the mitochondrial proteases, such as ClpP and HtrA2, and/or the transcription regulators JNK2, CHOP, CEBPp, SatB2, Ubl5 and the nuclear hormone receptor estrogen receptor alpha (ERa) or any combination thereof. In some embodiments, the level of expression and/or activity of two or more (e.g. three, four, or five or more) of the genes and/or their encoded proteins involved in the UPR ^mt signaling is measured. It is also possible to determine a gene profile and/or a protein profile of the subject with regard to selected multiple, i.e. at least two, of the genes or proteins involved in the UPR ^mt signaling. Such a profile could then list activity levels of each of the selected genes or protein quantities of each of the selected proteins involved in the UPR ^mt . Such a gene profile or protein profile will then typically differ between a subject suffering from statin-induced side effects and a subject not suffering from any statin- induced side effects when being under statin treatment. The determination of a UPR ^mt response is then preferably based on profile or pattern matching between a gene or protein profile generated from a subject and a reference gene or protein profile obtained from at least one subject known to be suffering from statin-induced side effects or at least one subject known to not suffer from any statin-induced side effects.

Monoclonal and polyclonal antibodies useful for measuring UPR ^mt response can be produced by methods known in the art. Methods to design nucleic acid sequences useful for detecting a specific amount of cellular RNA in a hybridization or amplification based methodology are also known in the art.

The previously mentioned kits of the embodiments comprise means to perform the intended function, i.e. determine a UPR ^mt response in a subject, determine the susceptibility of the subject to at least one statin-induced side effect or determine a suitable dosage of the at least one statin for the subject. The particular means of the kits depend on which of the UPR ^mt response assessment technique used.

For instance, when using genotyping the kit comprises the primers required to amplify the target gene involved in the UPR ^mt signaling, the target portion of a gene involved in the UPR ^mt signaling and/or the regulatory sequence of a gene involved in the UPR ^mt signaling. The kit optionally, but preferably, also comprises reagents needed to produce the purified DNA. Examples of such reagents include QIAamp DNA Blood Mini Kit, HotStarTaq Plus DNA Polymerase kit and/or QIAquick Gel Extraction Kit. The kit may optionally also comprise a tube containing heparin or other anticoagulant, Tris-Borate-EDTA buffer and/or agarose for forming an agarose gel.

The kit may optionally also comprise instructions defining the particular mutation(s) and/or allele(s) that is(are) indicative of susceptibility of a subject to statin-induced side effects. Hence, the user of the kit could then verify whether the current patient has a particular mutation and/or allele that is associated with such susceptibility.

In the case of QPCR the kit comprises the primers required to amplify a transcript of a target gene involved in the UPR ^mt signaling or a transcript of a target portion of a gene involved in the UPR ^mt signaling. The kit optionally, but preferably, also comprises reagents needed to get the QPCR result. Examples of such reagents include Dynabeads® mRNA DIRECT™ Kit and/or the FAST SYBR® Master Mix. The kit may optionally also comprise a tube containing EDTA or other anticoagulant, ammonium chloride solution and/or RPMI 1640 culture medium with fetal calf serum or other culture medium. In an optional approach the kit may also comprise fluvastatin or another statin.

The kit may optionally also comprise instructions defining the threshold to which the UPR ^mt score or value is to be compared. Hence, the user of the kit could then verify whether the current patient has a UPR ^mt score that is associated with such susceptibility.

If the kit is based on the ELISA technique the kit comprises antibodies, such as monoclonal or polyclonal antibodies or fragments thereof, that specifically bind to the target protein involved in the UPR ^mt signaling and optionally also antibodies directed against the internal standard protein. The kit optionally, but preferably, also comprises reagents needed to get the ELISA result. Examples of such reagents include In-Cell ELISA Detection Kit. The kit may optionally also comprise a tube containing EDTA or other anticoagulant, ammonium chloride solution and/or RPM1 1640 culture medium with fetal calf serum or other culture medium. In an optional approach the kit may also comprise fluvastatin or another statin.

The kit may optionally also comprise instructions defining the threshold to which the UPR ^mt score or value is to be compared. Hence, the user of the kit could then verify whether the current patient has a UPR ^mt score that is associated with such susceptibility.

The particular mutation(s), allele(s) and/or thresholds used in the kits of the embodiments can be determined using the methods disclosed herein applied to a first group of patients that are not susceptible to statin-induced side effects and to a second group of patients that are suffering from statin-induced side effects. By then comparing the UPR ^mt scores or values (if using QPCR or ELISA) obtained from the patients in these different groups a suitable threshold value could be set. Correspondingly, the target nucleotide sequences could be compared between the two groups in order to identify the mutation(s) or allele(s) that are found among the patients in the second group but not among or at least being less common in the first group. The purpose of each kit concept is to assess how well a patient's UPR ^mt response would protect against the negative effects of inhibitors of the mevalonate pathway, such as statins. Each example offers a concept of what the kit might be like, but the components of each example are possibly interchangeable. Various embodiments of the aspects will now briefly be summarized.

A general embodiment relates to a method of determining a susceptibility of a subject to at least one statin-induced side effect. The method comprises determining a mitochondrial unfolded protein response (UPR ^mt ) response for the subject. The method also comprises determining the susceptibility of the subject to the at least one statin-induced side effect based on the UPR ^mt response.

In an embodiment, determining the UPR ^mt response comprises determining the UPR ^mt response using genotyping on a body sample taken from the subject.

In an embodiment, determining the UPR ^mt response comprises purifying DNA from the body sample. Determining the UPR ^mt response also comprises amplifying at least a portion of a gene involved in UPR ^mt signaling and/or at least a portion of a regulatory sequence of a gene involved in the UPR ^mt signaling. Determining the UPR ^mt response further comprises detecting presence or absence of at least one mutation or allele in the at least a portion of the gene and/or the at least a portion of the regulatory sequence indicative of susceptibility to the at least one statin-induced side effect.

In an embodiment, determining the UPR ^mt response comprises determining the UPR ^mt response using quantitative polymerase chain reaction (QPCR) on a body sample taken from the subject.

In an embodiment, determining the UPR ^mt response comprises purifying mRNA from the body sample. Determining the UPR ^mt response also comprises amplifying a transcript of at least a portion of a gene involved in UPR ^mt signaling using QPCR to form a quantitative value of the activity of the gene. Determining the UPR ^mt response further comprises determining the UPR ^mt response based on the quantitative value.

In an embodiment, the method also comprises culturing cells from the body sample in presence of a statin and culturing cells from the body sample in the absence of the statin. In this embodiment, purifying the mRNA and amplifying the transcript are performed on the cells cultured in presence of the statin and on the cells cultured in absence of the statin. The method further comprises calculating a quotient between the quantitative value for the cells cultured in presence of the statin and the quantitative value for the cells cultured in absence of the statin. Determining the UPR ^mt response comprises, in this embodiment, determining the UPR ^mt response based on a comparison between the quotient and a threshold value. In an embodiment, determining the UPR ^mt response comprises determining the UPR ^mt response using enzyme-linked immunosorbant assay (ELISA) on a body sample taken from the subject. In an emobidment, determining the UPR ^mt response comprises determining a quantity of a protein involved in the UPR ^mt signaling using the ELISA and determining the UPR ^mt response based on the quantity.

In an embodiment, the method also comprises culturing cells from the body sample in presence of a statin and culturing cells from the body sample in the absence of the statin. In this embodiment, determining the quantity is performed on the cells cultured in presence of the statin and on the cells cultured in absence of the statin. The method further comprises determining a quantity of a reference protein not involved in the UPR ^mt signaling using the ELISA for the cells cultured in presence of the statin and for the cells cultured in absence of the statin. The method additionally comprises calculating a first ratio between the quantity of the protein and the quantity of the reference protein for the cells cultured in presence of the statin, and calculating a second ratio between the quantity of the protein and the quantity of the reference protein for the cells cultured in absence of the statin. The method also comprises calculating a quotient between the first ratio and the second ratio. In this embodiment, determining the UPR ^mt response comprises determining the UPR ^mt response based on a comparison between the quotient and a threshold value.

In an embodiment, determining the susceptibility comprises determining susceptibility of the subject to at least one of statin-induced myopathy, statin-induced rhabdomyolysis, and statin-induced neuropathy based on the UPR ^mt response.

In an embodiment, the subject is a mammalian subject and preferably a human subject.

In an embodiment, determining the UPR ^mt response for the subject comprises determining a level of expression and/or activity of at least one gene in a group consisting of mitochondrial chaperon mtHSP70, HSP60, HSP10 and mtDNAJ; mitochondrial protease CIpP and HtrA2; transcription factor JNK2, CHOP, CEBP , SatB2 and Ubl5; and nuclear hormone receptor estrogen receptor alpha, ERa. Alternatively, or in addition, determining the UPR ^mt response for the subject comprises determining a level of expression and/or activity of a protein encoded by at least one gene in the group. Another general embodiment relates to a method of determining a suitable dosage for a subject in need of treatment with at least one statin. The method comprises determining a susceptibility of the subject to at least one statin-induced side effect according the method disclosed above. The method also comprises determining the suitable dosage of the at least one statin for the treatment based on the susceptibility of the subject to the at least one statin-induced side effect.

A further general embodiment relates to a method of reducing a risk of side effects in a subject during treatment with at least one statin. The method comprises determining a suitable dosage of the at least one statin for the subject according to the method disclosed above. The method also comprises administering the at least one statin to the subject according to the suitable dosage.

A general embodiment further relates to a kit configured to determine a susceptibility of a subject to at least one statin-induced side effect comprising means configured to determine a mitochondrial unfolded protein response (UPR ^mt ) response for the subject.

In an embodiment, the kit also comprises instructions defining that the susceptibility of the subject to the at least one statin-induced side effect is determined based on the UPR ^mt response.

In an embodiment, the kit also comprises polymerase chain reaction primers complementary to at least a portion of a gene involved in UPR ^mt signaling and/or at least a portion of a regulatory sequence of a gene involved in the UPR ^mt signaling.

In an embodiment, the kit also comprises quantitative polymerase chain reaction primers complementary to at least a portion of a gene involved in UPR ^mt signaling and/or at least a portion of a regulatory sequence of a gene involved in the UPR ^mt signaling.

In an embodiment, the kit also comprises antibodies that specifically bind to a portion of a protein involved in UPR ^mt signaling. Another general embodiment relates to a kit configured to determine a suitable dosage for a subject in need of treatment with at least one statin comprising means configured to determine a mitochondrial unfolded protein response (UPR ^mt ) response for the subject. In an embodiment, the kit also comprises instructions defining that the suitable dosage of the at least one statin for the treatment is determined based on the UPR ^mt response.

A further general embodiment relates to a kit configured to reduce a risk of side effects in a subject during treatment with at least one statin comprising means configured to determine a suitable dosage of the at least one statin for the subject.

In an embodiment, the kit also comprises instructions defining that the at least one statin is to be administered to the subject according to the suitable dosage.

EXPERIMENTS

Several examples are presented below to demonstrate that UPR ^mt is the key cellular process that protects cells from the deleterious effects of statins or other inhibitors of the mevalonate pathway. Experiment 1 - isolation of atfs-1 mutants

In order to discover the mechanisms by which worms of Caenor abditis elegans can become resistant to statins, the strategy outlined in Fig. 1 was followed. This strategy involved mutagenizing normal wild- type N2 worms (obtained from the C. elegans Genetics Center m Minnesota) for 4 hours by incubation in the presence of 0.5 % ethyl methane sulfonate (EMS) according to the standard protocol (6). The worms were then washed with water and placed on a culture dish. Two hours later, vigorous hermaphrodite L4 animals were transferred to a new culture plate. Five days later, F1 progeny were bleached, washed and their eggs allowed to hatch overnight in M9 (22 mM KH2PO4, 42 mM Na2HP04, 85.5 mM NaCI and 1 mM MgS04). The resulting L1 larvae were transferred to new plates containing 0.5 mM or 1.0 mM fluvastatin then screened from days 5 to 10 to identify statin-resistant mutants, which were picked to new plates for further analysis. In this example, the isolated mutant alleles, named et15 to et18 were outcrossed 4 to 6 times prior to whole genome sequencing (see below), and 10 times prior to their phenotypic characterization or use in the experiments presented herein. Outcrossing was done by mating wild-type N2 males to a suppressor, then crossing the male progeny to wild-type hermaphrodites. Individual progeny from this cross were picked to individual plates then screened for resistance to statin. Five such cycles were carried out amounting to ten outcrosses. The genomes of suppressor mutant that had been outcrossed 4 or 6 times were sequenced to a depth of 25-40x as previously described (7). The sequencing results were analyzed using the MAPQGene software to produce tables listing all differences between the reference N2 genome and that of the mutants, and sort these differences by criteria such as non-coding substitutions, termination mutations, splice-site mutations, etc. (8). For each suppressor mutant, one or two hot spots, i.e. small genomic area containing several mutations, were identified in accordance to previous reports (9). Mutations in the hot spot(s) that were still retained after ten outcrosses were considered candidate statin-resistance mutations. In the case of et15-et18, it was mutations in the gene atfs-1 that conferred resistance to statins.

Experiment 2 - UPR ^mt confers resistance to effects of fluvastatin

Using established methods, normal (wild-type) worms of the strain N2 or worms with activating mutations in the UPR ^mt regulator ATFS-1 (see Fig. 2F for a description of the mutant alleles et15, et16, et17 and et18) were grown on normal worm culture plates (60 mm-Petri dishes purchased from Sigma and to which was added standard Nematode Growth Medium, NGM) or culture plates containing various concentrations of fluvastatin (brand Lescol® from Novartis). The worms were allowed to grow for 96 hours, photographed using a microscope and then their lengths measured using the software ImageJ (from the National Institute of Health). The results showed that worms with activated ATFS-1 mutations, i.e. with activated UPR ^mt , were resistant to higher doses of fluvastatin than control worms (Fig 2B).

Experiment 3 - UPR ^mt confers resistance to effects of rosuvastatin

This experiment demonstrated that UPR ^mt was important for resistance to rosuvastatin, i.e. another type of statin as compared to fluvastatin used in Experiment 2. This experiment was performed as disclosed in Experiment 2 except that a fixed dose of 0.4 mM rosuvastatin (brand Crestor® from AstraZeneca) was used instead of fluvastatin. Again, it was evident that the worms with the activated ATFS-1 mutations were resistant to the statin (Fig. 2C). This showed that the UPR ^mt was important for protection against different types of statins.

Experiment 4 - UPR ^mt confers resistance to effects of inhibitors of the mevalonate pathway

This experiment showed that UPR ^mt was important for resistance not only against statins but also against other inhibitors of the mevalonate pathway. Here, worms were again studied as in Experiment 2, but this time a fixed dose of 1 mM ibandronate was used instead of fluvastatin. Ibandronate is a bisphosphonate and an inhibitor of an enzymatic reaction that takes place several steps below the step that is inhibited by statins (see Fig. 2A). It was evident that the worms with the activated ATFS-1 mutations were resistant to ibandronate (Fig. 2D). This showed that the UPR ^mt was important for protection against different types of inhibitors of the mevalonate pathway, and not only against statins. Experiment 5 - validation of C. elegans as model for studying statin effects

This experiment demonstrated that worms were a valid model for studying the effects of statins and that UPR ^mt was a very good protectant against the effects of statins. Worms were again studied as in Experiment 2, except that the culture plates contained either a fixed fluvastatin dose of 1 mM or 1 mM fluvastatin plus 10 mM mevalonate. The results (Fig. 2E) demonstrated that wild-type worms benefit greatly by the inclusion of mevalonate, which showed that the effects of the fluvastatin on the worms was specifically on the enzyme HMG-CoA reductase that is responsible for mevalonate synthesis. In contrast, the mutants with activating mutations in ATFS-1 not only grew well in the presence of statin but they also did not benefit from the inclusion of mevalonate.

Experiment 6 - mutations in ATFS-1 are responsible for protection against statins

This experiment showed that the mutations in ATFS-1 were responsible for the protection against fluvastatin. For this purpose, wild-type worms or worms carrying the ATFS-1 mutant allele et15 were grown on normal culture plates or culture plates containing 0.5 mM of fluvastatin and also fed either a control RNAi vector (13) or an RNAi vector that caused inhibition of ATFS-1 via RNA interference (13). The results (Fig. 3A) showed that inhibiting the ATFS-1 gene eliminated the statin resistance in the ATFS-1 mutant, demonstrating that the mutated version of that gene had to be expressed to confer statin resistance. Experiment 7 - lack of ATFS-1 implies hypersensitivity to statins

This experiment demonstrated that worms that completely lacked ATFS-1 were hypersensitive to statins. Three types of worms (wild-type, worms with the et15 activating mutation in ATFS-1 or worms with a loss-of-function mutation in ATFS-1 : affe-1 (gk3094) obtained from the C. elegans Genetics Center m Minnesota) were grown on normal culture plates with or without a very low dose of fluvastatin (0.1 mM), and their lengths were measured after 96 hours of growth. The results (Fig. 3B) showed that while the wild-type and ATFS-1 mutant et15 were not affected by 0.1 mM fluvastatin, the loss of function ATFS-1 mutant was severely affected. This was yet another proof that the UPR ^mt was very important for statin resistance since the primary function of ATFS-1 is to activate the UPR ^mt . Experiment 8 - ATFS-1 mutations induce UPR ^mt

This experiment demonstrated that the ATFS-1 mutations that protected from statins specifically induced UPR ^mt . For this experiment, the UPR ^mt Green Fluorescent Protein (GFP) reporter hsp-60::GFP (14) was introduced into normal worms or worms carrying the activating ATFS-1 mutations et15, et17 and et18, the UPR ^mt GFP reporter hsp-6::GFP (14) was introduced into normal worms or worms carrying the activating ATFS-1 mutation et15, and the UPR ^er GFP reporter hsp-4::GFP (3, 15) was introduced also into normal worms or worms carrying the activating ATFS-1 mutation et15. The resulting worms were grown on normal plates and the expression of the reporters documented by photographing the worms using epifluorescence microscopy. The results (Fig. 3C) showed that the ATFS-1 mutations et15, et17 and et18 activated the UPR ^mt reporters but not the UPR ^er reporter. These results were consistent with the ATFS-1 mutations causing constitutive UPR ^mt , but not UPR ^er , activation and that UPR ^mt activation was the protective mechanism against the statin effects.

Experiment 9 - UPR ^mt protects cells from statins

This experiment demonstrated that the UPR ^mt is a cellular process that protected cells from statins. Here normal wild-type worms were first pre-treated for 24 hours on normal culture plates or culture plates containing 25 pg/ml ethidium bromide (EtBr), which stresses their mitochondria and activates the UPR ^mt , then moved to either to normal plates or to plates containing 0.5 mM fluvastatin. Growth (assessed by photographing the worms) and viability (assessed by determining if a worm was able to respond by moving its head when gently prodded with a platinum wire while observed using a stereoscope with 25X-50X magnification) were scored at 24, 48, 72, 96 and 120 hours after pre- treatment. The results (Figs. 4A and Fig. 4B) showed that the ethidium pre-treatment, hence the UPR ^mt activation, did protect the worms from the deleterious effects of fluvastatin. Experiment 10 - UPR ^mt protects yeast cells from negative effects of statins

This experiment demonstrated that activation of the UPR ^mt protected not only the nematode C. elegans but also yeast cells from the negative effects of statins. For this example, the wild-type Saccharomyces pombe strain L972h- was cultured on YES agar or in YES broth (0.5 % yeast extract, 3 % glucose, and 225 mg/l each of adenine, histidine, leucine, lysine and uracil) at 30°C. Cells were grown overnight in liquid culture with EtBr (250 or 500 ng/ml) until early or mid-log phase was reached. The cells were then pelleted so as to have an ODeoonm of 0.5 in 5 ml of medium. Fluvastatin was added to the resuspended culture to achieve a final concentration of 0.1 mM, 0.2 mM, or 0.4 mM. The culture was grown for 24 hrs and then equilibrated to an ODeoonm of 0.5. The equilibrated culture was serially diluted in two-fold increments, spotted on YES agar plates, and incubated for 48 hrs at 30°C, then photographed. The results (Fig. 4C) showed that EtBr pre-treatment allowed the yeast cells to grow better when challenged by the presence of fluvastatin. Thus, yeast cells and worms were both protected from statins when their UPR ^mt was preactivated by an EtBr treatment.

Experiment 11 - UPR ^mt protects mammalian cells from negative effects of statins This example demonstrated that activation of the UPR ^mt protected not only the nematode C. elegans but also mammalian cells from the negative effects of statins. NIH 3T3 mouse embryonic fibroblast cells were maintained in Dulbecco ^' s Modified Eagle Medium (DMEM) with high glucose (Gibco) and 10 % fetal bovine serum (FBS). For pre-inducing the mitochondrial stress response machinery, -2,000 3T3 cells were seeded per well on 96-well plates (TPP Nordic Biolab) and allowed to grow for 24 hrs. These cells were then treated with media containing EtBr (1 pg/ml) for 48 hrs. Medium was then replaced by fresh DMEM containing fluvastatin (10 μΜ), mevalonolactone (1 mM), or fluvastatin (10 μΜ) with mevalonolactone (1 mM) for 48 hrs. Cell viability was measured using Presto Blue Cell Viability Reagent (InVitrogen) as recommended by the manufacturer. The results (Fig. 4D and Fig. 7C) showed that EtBr pre-treatment protected the mammalian cells from the toxic effects of statins. The results also confirmed that the effect of statins in these cells were due to on-target inhibition of HMG- CoA reductase since providing mevalonate completely protected the cells from the effects of statins, as would be expected. Thus, yeast cells, worms and mammalian cells were all protected from statins when their UPR ^mt is preactivated by an EtBr treatment.

Experiment 12 - UPR ^mt provides resistance to inhibitors of the mevalonate pathway

This experiment, like Experiment 4, showed that the UPR ^mt was important for resistance not only against statins but also against other inhibitors of the mevalonate pathway. Here, worms were again studied as in Experiment 2, but this time a fixed dose of 100 μΜ gliotoxin (Sigma) was used instead of fluvastatin. Gliotoxin is an inhibitor of an enzymatic reaction that takes place several steps below the step that is inhibited by statins and by which proteins may become covalently coupled to a lipid molecule that is a product of the mevalonate pathway. Proteins modified in this way are said to be "prenylated" (see Figs. 2A and 5F). It was evident that the worms with the activated ATFS-1 et15 mutations were resistant to gliotoxin compared to normal worms or worms with the null ATFS-1 gk3094 allele in terms of growth (Fig. 1A and B) and viability (Fig. 1 C). This showed that the UPR ^mt , which was activated by the et15 allele of ATFS-1 , was important for protection against different types inhibitors of the mevalonate pathway, and not only against statins.

Experiment 13 - UPR ^mt protects prenylated proteins from the effects of statins

This experiment showed that the UPR ^mt activation allowed prenylated proteins to be partially protected from the effects of statins. The purpose of this experiment was to provide an indication regarding the mechanism by which the activated UPR ^mt may confer resistance to statins. For this example, the prenylation assay was performed as described by Morck et al., 2009 (3). Briefly, young adults were placed on different drug plates and their progeny (L1 larvae) were scored for the number of GFP- enriched intestinal cells after 48 hrs. The results (Fig. 5D and E) showed that worms with activated forms of ATFS-1 (alleles et15 or et16) were able to retain more prenylation when cultivated in the presence of statins. Since many prenylated proteins are essential for cellular functions and survival, it is possible that this is a key beneficial effect by which UPR ^mt activation protects cells from the statin effects.

Experiment 14 - effects of constitutively active UPR ^mt

This experiment showed that the mutants with constitutively active UPR ^mt were not as healthy as normal worms. The purpose of this experiment was to show that the mutations that cause resistance against statins were not without some negative effects of their own. For this example, normal worms or worms homozygous for the atfs-1 alleles et15, et17 and et18 were grown on normal plates. The average number of progeny per worm was counted, as well as the life span of each worm. The results (Figs. 6A and 6B) showed that the atfs-1 mutants did not live as long and produced fewer progeny than wild-type worms. Thus, while the UPR ^mt was a key process for protection against statins, its constitutive activation by the documented atfs-1 mutations came at a cost to the worms in terms of biological fitness.

Experiment 15 - UPR ^mt activation by paraquat

This experiment described a third way to activate the UPR ^mt and protected worms from the effects of statins. Activating mutations in the gene atfs-1 were used in several experiments as the UPR ^mt activation mechanism leading to statin resistance in C. elegans. Experiment 9 used EtBr as a UPR ^mt activation treatment, which also protected worms from the effects of statins. In the present experiment, a third method was used to activate the UPR ^mt , namely cultivating worms in the presence of paraquat, which caused oxidative damage to the mitochondria leading to UPR ^mt activation. Here normal wild-type worms were first pre-treated for 24 hours on normal culture plates or culture plates containing 0.5 mM paraquat (Sigma), which stressed their mitochondria and activated the UPR ^mt , then moved either to normal plates or to plates containing 0.5 mM fluvastatin. Growth (assessed by photographing the worms) and viability (assessed by determining if a worm was able to respond by moving its head when gently prodded with a platinum wire while observed using a stereoscope with 25X-50X magnification) were scored at 24, 48, 72, 96 and 120 hours after pre-treatment. The results (Figs. 7A and 7B) showed that the paraquat pre-treatment, hence the UPR ^mt activation, did protect the worms from the deleterious effects of fluvastatin.

Experiment 16 - mitochondrial respiration inhibitors This experiment showed that while activation of the UPR ^mt protected mitochondria from statin effects, it did not protect them against specific mitochondrial respiration inhibitors.

In the first part of this experiment, the oxygen consumption rates of wild-type or atfsA [et15) mutant worms was measured in the presence or absence of 0.5 mM fluvastatin as in previously published protocols using an Oxytherm (Hansatech) oxygen electrode (10-12). Briefly, two crowded but not starved 60-mm diameter plates containing L4 larvae were washed three times with M9 buffer and resuspended in 1 ml of M9 buffer then transferred into the chamber, and respiration was measured at 20°C for at least 10 min. Samples were recovered from the chamber, centrifuged, and homogenized using a sonicator, and protein concentration measured using a Pierce BCA Protein Assay Kit (Thermo Scientific). The results (Fig. 8A) showed that the et15 mutant was resistant to the respiration inhibition caused by fluvastatin. Thus a mutation that caused constitutive activation of the UPR ^mt protected mitochondria from the statin effects on oxygen consumption, i.e. respiration. In the second part of this example, wild-type worms or worms with the affe-1 (efi5) mutation were grown in the presence of various amounts of three different mitochondrial respiration inhibitors, namely Rotenone (Sigma), Antimycin A (Sigma) and Sodium Azide (Sigma), and their lengths were then measured by photographing the worms using a microscope and using the ImageJ (NIH) software to measure worm length on the photographs. The results (Figs. 8B, 8C and 8D) showed that having a constitutive UPR ^mt did not protect worms against specific mitochondrial respiration inhibitors. Thus, the UPR ^mt did not provide a general protection against all sorts of inhibitory insults, but rather showed specificity for the sort of effects that statins have.

Experiment 17 - detection of UPR ^mt activation in mouse cells

This experiment showed that induction of the UPR ^mt can be quantifiably measured using QPCR to monitor the mouse hsp10 and hsp75 genes, which are part of the UPR ^mt response and are the homologs of the human hsp10 and hsp70 (TRAP1) genes, respectively. The NIH 3T3 mouse embryonic fibroblast cells were maintained in DMEM with high glucose (Gibco) and 10 % (vol/vol) FBS (Gibco). For preinducing the mitochondrial stress response machinery, -10,000 3T3 cells were seeded per well on 24-well plates (Nunclon™ surface plate; Cat No. 150628) and allowed to grow for 24 h. These cells were then treated with media containing EtBr (20 pg/mL; Sigma) for 48 h and 72 h to induce the UPR ^mt . RNA was isolated from treated or non-treated NIH 3T3 mouse embryonic fibroblast cells by using Sigma RNAasy kits (Cat No. 74104), and cDNA was then synthesized for each sample using a high-capacity cDNA RT kit (ABI) as follows: Mix RNA template (10 μΙ of 150 ng/μΙ), 10X RT buffer (2 μΙ), 100 mM dNTP Mix (0.8 μΙ), Reverse Transcriptase (1 μΙ), and water (4.2 μΙ). The reaction was then incubated for 10 minutes at 25°C, 120 min at 37°C, 5 min at 85°C then stored at 4°C (can also be stored at -20°C for extended periods). The QPCR Assay was then performed as follows. Reagents: 1. EVAgreen (5 x HOT FIREPOL EvaGreen qPCR Mix; Cat no. 08-36-00001) from SOLIS BIODYNE; 2. Primers (forward and reverse, see below); 3. cDNA sample; 4. Optical adhesive covers (Bio-rad; Cat no. MSB1001); and 5. 96-well optical reaction plate. (Bio-rad; Cat no. HSP9601). Each reaction was prepared by mixing: cDNA (10 μΙ; Dilute the stock 5X i.e. 20 μΙ cDNA + 80 μΙ water); 5 μΜ Primer Mix (1 μΙ), water (5 μΙ), and Evagreen mix (4 μΙ). A CFX Connect QPCR instrument (Bio- Rad) was programmed to carry out the following reaction: Step 1 (95°C, 10 min); Step 2 (95°C, 15 sec); Step 3 (60°C, 20 sec); Step 4 (72°C, 20 sec); step 2, 3 and 4 was repeated for 45 times. The instrument quantitatively determined the abundance of newly synthesized PCR products. Fig. 10 shows the results when using the following primers to detect the levels of hsp10 and hsp75 mRNAs in the samples: hsp10 (omHSP10/FOR1 : AGTTTCTTCCGCTCTTTGACAG (SEQ ID NO: 5) and omHSP10/REV1 : TGCCACCTTTGGTTACAGTTTC (SEQ ID NO: 6)) and hsp75 (omHSP75-F: AACTGTGCCTGTGTTCCTGG (SEQ ID NO: 7) and omHSP75-R: TGTTCCTTAGGGTTCACTGGT (SEQ ID NO: 8)). At 48 hours post-ethidium treatment, the hsp10 and hsp75 mRNAs were increased 2- and 8-fold compared to non-treated cells, respectively.

Experiment 18 - analysis of UPR ^mt in patients

A blood sample is taken from a selected number, such as 50, patients that have taken statins for 1 year or more and experienced no side effects. A blood sample is also taken from a selected numbers, such as 50, patients that discontinued statin therapy because of serious side effects. The UPR ^mt response of all blood samples is analyzed using one of the previously disclosed methods or kits. A "UPR ^mt response or score" may be obtained for each patient. The patients with a UPR ^mt response or score below the defined threshold experience the serious side effects. These results validate the value of the method or kit in terms of its predictive value, i.e. show that the method or kit can be used to predict who would be suffering from statin side effects based on their UPR ^mt response score.

The UPR ^mt responses or scores from the patients suffering no side effects and/or from the patients suffering from statin-induced side effects can also be used to set a threshold value with regard to the UPR ^mt response or score. Thus, a UPR ^mt response or score below (or above) the threshold indicates that a patient is susceptible to statin-induced side effects whereas a UPR ^mt response or score above (or below) the threshold indicates that a patient has low or no risk or likelihood of suffering from any side effects due to a statin therapy. Experiment 19 - assessment of a risk of statin-induced side effects

A blood sample is taken from a patient prescribed statin therapy or currently on statin therapy. The UPR ^mt response of the blood sample is analyzed using one of the previously disclosed method or kits. A UPR ^mt response or score may be obtained for the patient. This UPR ^mt response or score is then compared to the threshold determined as disclosed in Experiment 18 to assess whether the patient is susceptible to statin-induced side effects. The comparison between the determined UPR ^mt response or score can then be used as basis for determining whether the patient should be prescribed statin- therapy or not, and/or determining a suitable dosage of the statin for the patient.

Experiment 20 - treatment of subjects with statins

A patient in need of statin therapy, prescribed statin therapy, or currently on statin therapy is administered at least one statin if the patient has a UPR ^mt response or score that is equal to or above the threshold determined as disclosed in Experiment 18. A patient in need of statin therapy or prescribed statin therapy is withheld from administration of a statin or is administered a lower dose of at least one statin if the patient has a UPR ^mt response or score that is below the threshold determined as disclosed in Experiment 18. A patient that is currently on statin therapy is administered a lower dose of at least one statin or withdrawn from statin treatment if the patient has or develops a UPR ^mt response or score that is below the threshold determined as disclosed in Experiment 18.

The embodiments described above are to be understood as a few illustrative examples of the present invention. It will be understood by those skilled in the art that various modifications, combinations and changes may be made to the embodiments without departing from the scope of the present invention. In particular, different part solutions in the different embodiments can be combined in other configurations, where technically possible.

REFERENCES

1. C. M. Haynes, D. Ron, The mitochondrial UPR - protecting organelle protein homeostasis, Journal of Cell Science 123, 3849-3855 (2010).

2. J. E. Aldridge, et al., Discovery of genes activated by the mitochondrial unfolded protein response (mtUPR) and cognate promoter elements, PLoS One 2, e874 (2007). 3. C. Morck et al., Statins inhibit protein lipidation and induce the unfolded protein response in the non- sterol producing nematode Caenorhabditis elegans, Proceedings of the National Academy of Sciences 106, 18285-18290 (2009). 4. A. K. Hihi, et al., Ubiquinone is necessary for Caenorhabditis elegans development at mitochondrial and non-mitochondrial sites, J Biol Chem 277, 2202-2206 (2002).

5. T. Jonassen, et al., A dietary source of coenzyme Q is essential for growth of long-lived Caenorhabditis elegans clk-1 mutants, Proc Natl Acad Sci USA 98, 421-426 (2001).

6. J. E. Sulston, J. A. Hodgkin, in The NematodeCaernorhabditis elegans, W. B. Wood, Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988), pp. 587-606.

7. S. Sarin, et al., Caenorhabditis elegans mutant allele identification by whole-genome sequencing, Nat Methods 5, 865-867 (2008).

8. H. Bigelow, et al., MAQGene: software to facilitate C. elegans mutant genome sequence analysis, Nat Methods 6, 549 (2009). 9. S. Zuryn, et al., A strategy for direct mapping and identification of mutations by whole-genome sequencing, Genetics 186, 427-430 (2010).

10. T. J. Schulz et al., Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress, Cell Metab 6, 280-293 (2007).

11. S.-J. Lee, et al., Glucose shortens the life span of C. elegans by downregulating DAF-16/FOXO activity and aquaporin gene expression, Cell Metab 10, 379-391 (2009).

12. K. T. Tan, et al, lnsulin/IGF-1 receptor signaling enhances biosynthetic activity and fat mobilization in the initial phase of starvation in adult male C. elegans, Cell Metab 14, 390-402 (2011).

13. R. S. Kamath, et al., Systematic functional analysis of the Caenorhabditis elegans genome using RNAi, Nature 421, 231-237 (2003). 14. C. Benedetti, et al., Ubiquitin-like protein 5 positively regulates chaperone gene expression in the mitochondrial unfolded protein response, Genetics 174, 229-239 (2006).

15. M. Calfon, et al., IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA, Nature M5, 92-96 (2002).