Consequently, the federal government has certain rights in this invention.

Field of the Invention The present invention relates generally to the fields of microbiology and vaccine technology. More specifically, the present invention relates to mutant strains of Streptococcus pneumoniae that provide potential new means for eliciting immunity to pneumococcal infections.

Description of the Related Art

The polysaccharide capsule of Streptococcus pneumoniae is significant for both its role in pathogenesis and its role in the development of molecular genetics. In the laboratory, the inter-strain transformation of pneumococcal capsular polysaccharide biosynthetic genes was a central step in demonstrating that the"transforming principle", and hence the genetic material, is DNA (12). In nature, the genetic exchange of DNA among S. pneumoniae strains is likely to have played a major role in the generation of new strains and in the evolution of capsular serotypes, of which 90 have now been described (33,59).

The significance of the capsule in virulence, antiphagocytosis, and protective immunity has long been recognized (11,31,40,43,45, 55,61,62). However, the molecular mechanisms underlying capsule expression, the generation of serotype diversity, and the apparent differences in virulence associated with capsular serotype (18,34,37,60) have never been addressed.

Early genetic and biochemical studies (8,9,21,26,31, 42,44,49) of pneumococcal capsules provide the following significant observations: a) the type-specific genes, i. e., those involved in the biosynthesis of a specific polysaccharide, are linked on the chromosome; b) the type-specific genes for different capsular types may occupy identical sites in the chromosome; c) the type-specific genes are transferred as a unit during genetic transformation and are integrated into a recipient chromosome by recombination between homologous sequences flanking the type- specific regions in a mechanism since referred to as a cassette (41); d) there is little homology between type-specific genes from different capsular types; e) unlinked genes are likely involved in

the regulation of capsule expression; and f) only one set of type- specific genes is present in a given strain. An exception to the latter observation occurs with binary encapsulated strains, which occur only rarely and, apparently only between specific combinations of donors and recipients. Binary encapsulated strains occur when the transfer of type-specific capsule gene cassettes results in the maintenance and expression of both the donor and recipient type-specific genes, rather than in the replacement of the recipient's type-specific genes with those of the donor (8,14,15).

Recent studies using molecular genetic techniques have confirmed and have begun to extend the earlier observations. Sequence, hybridization, and linkage analyses have demonstrated the expected organization of the capsule loci in which type-specific genes are flanked by sequences common to strains of apparently all capsular types (Figure 1). These types of analyses have also shown that the type-specific biosynthetic genes for a given polysaccharide occur only in strains expressing that polysaccharide (25,28,32). In addition, direct evidence for a cassette-like transfer of capsule loci between strains of different capsular types has been obtained (23,25).

Despite the high degree of overall similarity between loci of different capsular types, important differences have begun to be recognized. In particular, analysis of the type 3 locus has yielded some unexpected findings that may help explain the emergence of new capsular types and the apparent correlation between serotype and virulence. The type 3 locus contains the type-specific biosynthetic genes cps3D and cps3S, which are

required for type 3 capsule production (24,25). cps3D encodes a UDP-glucose (UDP-Glc) dehydrogenase which converts UDP-Glc to UDP-glucuronic acid (UDP-GlcUA). cps3S encodes the type 3 synthase that catalyzes formation of the linkages required to form the (GlcUA-Glc) type 3 polysaccharide. The functions encoded by these genes were originally demonstrated in mutant and functional analyses (6,24,25), and have been confirmed b y expression of the cloned genes in E. coli (cap3A and cap3B (4,7)).

Two additional type 3-specific genes, cps3U andcps3M, are present and are predicted to encode proteins with homology to UDP-Glc-1-P uridylyltransferases (Glc-l-P < UDP-Glc) and phosphomutases (Glc-6-P Glc-l-P), respectively (24). The UDP- Glc-1-P uridylyltransferase function has been demonstrated through complementation of an E. coli galU mutant (cap3C (5)) but expression of the gene is not required for type 3 capsule production in S. pneumoniae (24).

The type 3 locus differs from the other capsule loci thus far described in that the type-specific genes are separated from the common upstream flanking sequences by a region of DNA that includes a sequence that is repeated in the pneumococcal chromosome (5,24). Unlike the situation in type 19F, where both the common and the type-specific capsule genes appear to b e contained in a single operon (32), the type 3-specific genes can b e transcribed independently of the upstream common region (24). cps3D and cps3S were shown in genetic analyses to be transcribed as part of the same operon (24) which, as demonstrated in Northern analyses, includes cps3U (cap3C (5)). In addition, the upstream common sequences of type 3 that are homologous to the

type 19F genes cpsl9fA and cpsl9fB contain deletions and the common sequences do not appear to be transcribed in type 3 (5).

Further characterization of the type 3 locus, described herein, shows additional deviations from what appears to be the norm for S. pneumoniae capsule loci. Some of the unique features of this locus appear to lend support to the hypothesis, based on the presence of the repeated element in the type 3 upstream region and elsewhere on the pneumococcal chromosome, that a transposition-like event might explain the occurrence of binary encapsulated strains and might provide a possible mechanism for novel capsule type formation (24).

The pneumococcal vaccine available currently is not effective in infants and young children, and is not used to its full potential in the elderly. Other vaccines are in development, but all require antigen injection, and frequently multiple doses.

Therefore, the prior art is deficient in the lack of a mutant strain of Streptococcus pneumoniae that produces reduced levels of capsular polysaccharide but maintains the ability of colonization, which provides a continuous source of antigen. The present invention fulfills this long-standing need and desire in the art.

SUMMARY OF THE INVENTION The present invention is directed to mutants of Streptococcus pneumoniae that produce reduced levels of capsular polysaccharide but maintain the ability of colonization. Full expression of capsule is required for systemic infection. Thus, these mutants provide potential a means for eliciting immunity to

pneumococcal infections through the use of a live, attenuated vaccine that can be maintained in the host with a limited potential for causing disease. In addition, heterologous antigens can b e expressed in the strain, providing a delivery vehicle for eliciting immunity to other infectious agents.

In one embodiment of the present invention, there is provided a mutant of Streptococcus pneumoniae that has reduced capsule production and reduced virulence in a mammalian host, but the mutant maintains the ability to colonize in the mammalian host. Preferably, the mutant has a mutation in the cps3D gene within the type 3 locus. More preferably, the mutant has a point mutation of a single base pair change located at base pair 1876 within cps3D, resulting in a change of amino acid from a valine to a glutamic acid. Specifically, the mutant is AM188. Additionally, the present invention is also drawn to a mutant that has a mutation in the pgm gene encoding a phosphoglucomutase homologue. Preferably, the mutant has a point mutation of a single base pair change located at base pair 1485 within the p g m gene, resulting in a change of amino acid from a lysine to a threonine. Specifically, the mutant is JY1060.

In another embodiment of the present invention, there is provided a vaccine comprising the mutant strain of Streptococcus pneumoniae. Preferably, the mutant has mutation in the cps3D gene, mutation in the pgm gene, or mutation in both cps3D and pgm. Specifically, the mutant is AM188 or JY1060.

In yet another embodiment of the present invention, there is provided a method of eliciting immunity to pneumococcal antigens in an individual in need of such treatment, comprising

the step of contacting the individual with the mutant disclosed herewith. One preferred route of administering the mutant is intranasal aerosol sprays.

In still yet another embodiment of the present invention, there is provided a method of delivering heterologous antigens to an individual in need of such treatment, wherein the antigens are from bacteria or viruses other than Streptococcus pneumoinae, comprising the steps of overexpressing the heterologous antigens in the mutant disclosed herewith and contacting the individual with the mutant containing the overexpressed heterologous antigens. Preferably, the route of administering the mutant includes intranasal aerosol sprays.

Other and further aspects, features, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of the invention given for the purpose of disclosure.

BRIEF DESCRIPTION OF THE DRAWINGS So that the matter in which the above-recited features, advantages and objects of the invention, as well as others which will become clear, are attained and can be understood in detail, more particular descriptions of the invention briefly summarized above may be had by reference to certain embodiments thereof which are illustrated in the appended drawings. These drawings form a part of the specification. It is to be noted, however, that the appended drawings illustrate preferred embodiments of the

invention and therefore are not to be considered limiting in their scope.

Figure 1 shows conserved structure of the capsule loci. The maps are derived from sequence data of the type 19F (32) and type 3 loci (5,24,25). A similar organization is apparent in type 14, where the upstream common sequences and the type- specific genes have been identified (38). The common downstream sequence containing plpA has also been identified adjacent to the type 2,5,6B, and 14 loci (24,25,37). Solid squares, homologous sequences; squares with dots or lines, type- specific sequences; clear squares, non-homologous sequences;', deleted sequence.

Figure 2 A shows Map of type 3 capsule locus.

Restriction sites: Bg, BglII; Ev, EcoRV; H, HindIII; P, PstI, Pv, PvuII; S, SacI; Sp, SphI; St, StuI; X, XbaI. Triangles, with strain names denoted in Figure 2B, indicate the points of insertion mutations: clear triangles, insertions which do not affect capsule production; solid triangles, insertions which result in a capsule-negative phenotype. The insertions in cps3DSU have been described (24).

Mutated homologs of cpsl 9fA and cpsl 9fB (cps3A and cps3B, respectively) are located upstream of cps3C (5). Arrowheads indicate the directions of open reading frames.

Figure 2B shows DNA sequence of the region containing the 3'end of cps3U, cps3M, tnpA, and plpA from strain WU2. Numbering of nucleotide sequence is based on the previously reported cps3DSU sequence (24). The putative cps3M- 35 and-10 sequences and the putative Cps3M ribosome binding site (RBS) are indicated. Lower case letters are used to denote

amino acid sequence which is not expected to be expressed due to lack of translational signals and/or a frameshift mutation.

Underlined amino acids in PlpA indicate differences from the type 2 PlpA sequence (47). Overlined amino acids indicate sequences conserved in phosphomutases. Symbols: 1 bp deletion in pIpA sequence; <, >, direction of translation.

Figure 3 shows comparison of Cps3M with phosphomutases. Amino acid positions are given in parentheses with the total number of amino acids given at the end. The proteins shown are Xanthomonas campestris XanA (PGM/PMM) (39), E. coli CpsG (PMM) (3), Mycobacterium leprae cosmid clone L308 ORF (GenBank accession # U00022), and Mycoplasma pirum ORF5 (57). The putative active site regions contain a serine which is thought to be phosphorylated to form the active enzyme (51).

The reported Mg2+ binding site sequence in yeast and rabbit muscle PGMs is DGDGDR (20). The putative substrate binding site is homologous to that reported for PGMs and PMMs (20).

Figure 4 shows comparison of'TnpA'with transposases. Sizes of the transposases are indicated in amino acids at the C-terminal ends. The sequences shown and their homologies (% identity/% similarity) with'TnpA' (over the region present in each sequence) are: IS1167, S. pneumoniae (48/71, (69)); IS1001, Bordetella parapertussis (19/41, (68)); IS1165, Leuconostoc mesenteroides (31/56, (36)); IS1251, Enterococcus faecium (34/61, GenBank accession &num L34675); IS1181, Staphylococcus aureus (29/53, (22)).

Figure 5 shows sequence of the flanking region upstream of the type 3-specific genes. The sequence begins in the

3'end of cps3C. Sequences homologous to cpsl9fA, B, and Care present upstream of this sequence (not shown and 5, GenBank accession number Z47210). The promoter for cps3D, the first type 3-specific gene, begins 442 bp downstream of the last nucleotide shown here. Underlined amino acids in the Cps3C, Cps3P, and Cps3E sequences indicate differences from the homologous type 19F sequences (32). The cps3C, cps3P, and cps3E sequences shown are 95%, 99%, and 65% identical to their type 19F homologs over the regions present in both sequences. The Cps3P ORF extends an additional 19 aa but this region is not homologous to Cpsl9fD. The Cps3E amino acids in lower case are not expected to be translated. Symbols are as in Figure 2. The sequence contains an additional"A"at bp 972 that was not noted in the previously reported sequence (24).

Figure 6 shows orf5 Southern analyses. Hybridization with orf5-specific probe generated using primers Orfl and Orf2.

Lanes 1, WU2 (type 3); 2, D39 (type 2); 3, DBL1 (type 6B).

Figure 7 shows plpA and tnpA in strains of different capsular types. Figure 7 A shows PCR analysis of plpA.

Chromosomal DNA was amplified using primers at the 5' (P4) and 3' (P5) extremes and internal (P3, P8) to plpA. Lanes: 1, P4/P5; 2, P4/P3; 3, P8/P5. Figure 7B shows hybridization with plpA.

Southern blots were hybridized with the 5'end of plpA obtained from DBL1 (type 6B) by PCR amplification using primer combination P4/P3 and followed by digestion of the product with BamHI. Lanes: 1, BglII; 2, HindIII; 3, SacI; 4, SphI. Strains: WU2 (type 3), D39 (type 2), DBL1 (type 6B). Figure 7C shows hybridization with tnpA. The 1.6 kb band which appears in lane 1

of type 6B is the result of contamination from an adjacent lane containing the molecular size standards. Lanes and strains are as in Figure 7B.

Figure 8 shows conservation of type 3 locus structure among independent type 3 isolates. Figure 8 A shows RFLP analysis. Restriction digests were probed with pJD351 (25) which contains a 2.4 kb Sau3AI fragment extending from the 3'end of cps3D through the middle of cps3 U. Results from six of th e fourteen tested enzymes are shown. Not shown are the results with BstXI, ClaI, HhaI, PvuII, ScaI, StuI, StyI, and XcmI. Lanes: 1, WU2; 2, A66; 3, EF 3113; 4, L8 1995; 5, ATCC 6303. Figure 8B shows PCR analysis. Chromosomal DNA was amplified using primers within the 3'end of cps3M (M3) and internal to plpA (P3). Lanes: 1, No DNA; 2, WU2; 3, A66; 4, ATCC 6303; 5, L8 1995; 6, EF3113; 7, DBL1 (type 6B).

Figure 9 shows transcriptional analysis of the type 3 locus using cat fusions. Positions of fragments used to construct gene fusions are indicated. Levels of resistance to chloramphenicol (, ug/ml) are given to the right of each fragment to indicate the direction of transcription. Insertion of cat fusions in the orientation opposite to that indicated for transcription results in resistance to 0.5 llg/ml. Symbols:, points of cat fusions;, potential stem-loop structure (bp 3732 to 3771 in 24). Restriction sites (in addition to those indicated in Figure 1): M, MunI; He, HaeIII; Ss, Sspl.

Figure 10 shows Northern analysis of the type 3 locus. Each lane contains 20 ig denatured RNA isolated from strain WU2. The probe used is indicated above each lane. Figure

10 A shows hybridization with probes from the type 3 locus and an unlinked gene. The pspA probe recognizes the transcript for pneumococcal surface protein A (major transcript expected to be -2 kb, 64 and unpublished data) and was used to confirm the integrity of the RNA preparation. Figure 10B shows map of the type 3 capsule locus indicating the locations of the probes.

Figure 11 shows the colony morphology and capsule production of WU2 and JY1060. Figure 11A shows growth at 37°C on blood agar medium. Figure 11B shows capsule quantitation. Cultures were grown in THY and the amount of capsule contained on washed cells and in filtered culture supernatants (super) was determined using an inhibition ELISA.

Values are normalized to the OD600 of the starting culture. Each sample was measured in duplicate and the results are the means standard errors from six independent experiments. For both the cells and culture supernatant fluids, JY1060 was significantly different from WU2 (P < 0.0001, unpaired two-tailed t-test).

Figure 12 shows the analysis of type 3 capsule transcripts. Figure 12A shows the Northern blots probed with internal fragments of each type 3-specfic gene. Each lane contained 20 pg total RNA from a culture grown in THY and harvested at OD600 = 0.05. pspA is a non-capsule related gene. The probe used is indicated above each pair of samples. The RNA marker sizes are indicated to the left of the figure. The type 3 capsule transcript is 6700 nt and the pspA transcript is 2100 nt.

Lanes: 1, WU2; 2, JY1060. Figure 12B shows densitometry curve derived from dot blots using cps3D to probe dilutions of total RNA for capsule-specific transcripts. Mean peak OD values for each

dilution with standard error of the mean calculated from3 replicates are shown. pspA transcript levels for WU2 and JY1060 <BR> <BR> <BR> <BR> also did not differ from each other (not shown). D, WU2;0, JY1060. Figure 12C shows Northern blots of type 3 and pspA transcripts throughout growth in THY. Results for WU2 are shown.

Identical results were obtained for JY1060. The probe for each blot is indicated above the figure. Probing with cps3S, U, or M yielded the same result as shown for cps3D. Each lane contained 20 ug of total RNA. Lanes and culture OD600 values: 1,0.1; 2,0.2; 3, 0.3; 4,0.4; 5,0.7.

Figure 13 shows the mapping and repair of JY 1060 mutation by co-transformation with restriction fragments from GH4511. The restriction map was generated by Southern analysis of GH4511 probed with the plasmid used to make the insertion.

The'aatAB sequence was used to target the insertion and is therefore duplicated. Fragments corresponding to single or double digests are shown below the map, with the frequency of co- transformation shown in the table. Gene designations were obtained from sequence analysis of type 3 WU2 or from the type 4 genomic sequence and are based on homology. (_), PGM (pgm); (#), glycerol facilitator (glpF); (EU), muramidase released protein (mrp); (c) transposase (tnpB); (sis) bacteriocin transport associated protein (bta); (tus) amino acid transport protein permease (aatP); (sua) amino acid transport protein ATP binding (aatA); (mm), amino acid transport binding protein (aatB); point of EmR plasmid insertion. The solid block within tnpB is the site of the 90 bp repeat sequence (see text). Restriction sites: A, AatII;

B, BsaHI; Bc, BcII; Bg, BgIII; Bs, BstXI; Ec, EcoNI; M, MscI; N, NsiI; Pm, PmlI.

Figure 14 shows localization of JY1060 mutation.

Figure 14A shows restriction map of pGH4045 and fragments <BR> <BR> <BR> <BR> used in repair of JY1060 mutation. PGM functional sites: (n) (#) active site, (F Mg2+ binding site, (B) substrate binding site.

Amino acid transport (aatAB) conserved sequences: linker 0 peptide; S, Walker B ATP binding site; S, putative transcription terminator; 41, JY1060 mutation. Arrows above the map indicate directions and lengths of putative transcripts. Each DNA fragment used to transform JY1060 is indicated by a line below the map.

Repair of the JY1060 mutation is indicated by a + or-to the right of the fragment. Gene designations and restriction sites are as indicated in Fig. 13. Additional restriction sites: E, EcoRI, P, PstI.

Figure 14B shows DNA and amino acid sequence of WU2 and JY1060 region encompassing mutation in pgm. Mutation is noted by the underlined nucleotide and the bold amino acid. Nucleotide numbering is from the beginning of the pGH4045 insertion.

Amino acids are numbered from the PGM initiation site.

Figure 15 show recombinant PGM and Cps3M.

Figure 15A show the expression in E. coli. Whole cultures were analyzed by SDS-PAGE. cps3M expression was induced with IPTG. pgm was expressed from its natural promoter. Lanes 1,2,5, and 6 are Coomassie-stained and lanes 3,4, and 7 to 9 are Western blots reacted with a-Cps3M. Equal numbers of cells were loaded in all lanes. Lanes: 1, E. coli BL21 (DE3, pET-21a); 2 and 3, MC4033 [recombinant WU2 Cps3M in E. coli BL21 (DE3)]; 4, rabbit muscle PGM; 5 and 7, GH4078 [E. coli W1485Apgm : : tet, vector only]; 6 and

8, GH4080 [recombinant WU2 PGM in E. coli W1485Apgm : : tet] ; 9, GH4104 [recombinant JY1060 PGM in E. coli W1485Apgm:: tet].

Figure 15B shows PGM assay of E. coli sonicates. +, E. coli 1485 (PGM+ parent strain);-, GH4078 (E. coli W1485Apgm : : tet, vector only); WU2, GH4080 (recombinant WU2 PGM in E. coli <BR> <BR> <BR> <BR> <BR> JY1060,GH4104(recombinant)JY1060PGMinE.W1485#pgm::tet); coli W1485Apgm : : tet).

Figure 16 shows virulence in BALB/cByJ mice. Mice were infected intraperitoneally (A) or intravenously (B) with either the type 3 parent (WU2, D), the PGM mutant (JY1060, ), or the repaired PGM mutant (GH5088, Ea). The total number of mice used in each group is indicated above the bar. JY1060 was significantly different from WU2 at all doses (i. p., P =<0.005 [102], <0.0001 [103], <0.005 [105, compared to WU2 at 103]; i. v., P = 0.007 [5 x 105], <0.0001 [8 x 106]), as calculated by Fisher's exact test.

GH5088 was not significantly different from WU2 by either route of infection, but was different from JY1060 (P = 0.026 [i. p.], 0.001 [i. v.]). The median times to death (calculated using the Mann- Whitney two sample rank test) also were not different for WU2- and GH5088-infected mice (68 and 13.5 h for i. p. and i. v. infections, respectively).

Figure 17 shows blood clearance of bacteria. Mice were infected i. v. with 10'bacteria and bled at 1 min (time 0), 1 h, 4 h, and 20 h. Results are the mean SEM from either 5 (WU2, o) or 3 (JY1060, N) mice. JY1060 was significantly different from WU2 at all time points (P = 0.046 [1 h], 0.001 [4 h], 0.002 [20 h]), as calculated by Student's t test.

Figure 18 shows effect of decomplementation on mouse virulence. BALB/cByJ mice were infected i. v. with WU2 (D) or JY1060 (1), 5 to 8 hours after injection with cobra venom factor (CVF). Statistical significance was calculated using Fisher's exact test. P values at the 105 dose were 0.0014 (WU2, +/-CVF) and 0.007 (WU2 vs JY1060, + CVF). At the 107 dose, P = 0.007 (JY1060, +/-CVF) and 0.015 (WU2 vs. JY1060,-CVF).

Figure 19 shows binding of antibodies to surface components. Reactivity of antibodies to whole cells was tested in indirect ELISAs. Amount of binding to WU2 (0) and JY1060 (t) is expressed relative to the non-encapsulated JD611. The a-type 19 polyclonal antiserum contains a high titer of antibody to non- capsule components and reacts with JD611 at dilutions of >2 x 105.

It was used as a source of polyclonal antibody to S. pneumoniae surface antigens. Similar results were obtained using the a-type 23 polyclonal antiserum. TA, teichoic acid (C-polysaccharide); PC, phosphocholine.

Figure 2 0 shows virulence in immunodeficient (Xid) mice. CBA/N mice were infected i. p. and i. v. at the indicated doses with either WU2 () or JY1060 (A). A time to death of >504 h indicates survival. Numbers in parentheses indicate P values for comparison of median time to death with WU2, as determined using the Mann-Whitney two sample rank test. Comparison of the higher JY1060 doses was with the next lower dose of WU2. There were no significant differences in overall survival.

Figure 21 shows virulence of suppressor mutants.

BALB/cByJ mice were infected i. p. with 103 WU2, 6 x 103 GH5087 or GH5089, or 5 x 104 GH5000 or GH5001. A time to death of >504

h indicates survival. Numbers in parentheses indicate P values for comparison of median time to death with WU2, as determined using the Mann-Whitney two sample rank test.

DETAILED DESCRIPTION OF THE INVENTION The present invention is directed to new mutants of Streptococcus pneumoniae that produce reduced levels of capsular polysaccharide but maintain the ability of colonization. Full expression of capsule is required for systemic infection. Thus, these mutants provide potential new means for eliciting immunity to pneumococcal infections through the use of a live, attenuated vaccine that can be maintained in the host with a limited potential for causing disease. In addition, heterologous antigens can be expressed in the mutant, providing a delivery vehicle for eliciting immunity to other infectious agents. The use of the mutant that could colonize and continuously provide a source of antigen would eliminate the need for multiple doses or injections of antigens, as it could be delivered by intranasal aerosol sprays. The same method could be used for delivering heterologous antigens.

In one embodiment of the present invention, there i s provided a mutant of Streptococcus pneumoniae that has reduced capsule production and reduced virulence in a mammalian host, but said mutant maintains the ability to colonize in said mammalian host. Preferably, the mutant has a mutation in the cps3D gene within the type 3 locus. More preferably, the mutant has a point mutation of a single base pair change located at base pair 1876 within cps3D, resulting in a change of amino acid from

a valine to a glutamic acid. Specifically, the mutant is AM 188.

Additionally, the present invention is also drawn to a mutant that has a mutation in the pgm gene encoding a phosphoglucomutase homologue. Preferably, the mutant has a point mutation of a single base pair change located at base pair 1485 within the p g m gene, resulting in a change of amino acid from a lysine to a threonine. Specifically, the mutant is JY1060.

In another embodiment of the present invention, there is provided a vaccine comprising the mutant strain of Streptococcus pneumoniae. Preferably, the mutant has mutation in the cps3D gene, mutation in the pgm gene, or mutation in both cps3D and pgm. Specifically, the mutant is AM188 or JY1060.

In yet another embodiment of the present invention, there is provided a method of eliciting immunity to pneumococcal antigens in an individual in need of such treatment, comprising the step of contacting the individual with the mutant disclosed herewith. One preferred route of administering the mutant is intranasal aerosol sprays.

In still yet another embodiment of the present invention, there is provided a method of delivering heterolohous antigens to an individual in need of such treatment, wherein the antigens are from bacteria or viruses other than Streptococcus pneumoinae, comprising the steps of overexpressing the heterologous antigens in the mutant disclosed herewith and contacting the individual with the mutant containing the overexpressed heterologous antigens. Preferably, the route of administering the mutant includes intranasal aerosol sprays.

The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion.

EXAMPLE 1 Structure and Genetics of Type 3 Locus in Streptococcus pneumoniae METHODS Bacterial Strains and Plasmids. The strains and plasmids are described in Table 1. S. pneumoniae strains were grown in Todd-Hewitt broth (Difco, Detroit, MI) supplemented with 0.5% yeast extract (THY), or on Blood Agar Base #2 (Difco) supplemented with 3% sheep red blood cells. E. coli derivatives were grown in L-broth or on L-agar. Antibiotic concentrations (gg/ml) for S. pneumoniaelE. coli were: erythromycin, 0.3/250; kanamycin, 10/50; and ampicillin,-/100.

Isolation and Cloning of the Type 3 locus DNA from S. pneumoniae WU2. Cloning of the 3.1 kb HindIII fragment containing the downstream type 3-specific genes has been described (24). The 3'end of the type 3 plpA was obtained as a PCR product using primers P5 and P6 (Table 2). The region upstream of cps3D was obtained from JD1008 by cloning the 2.2 kb HindIII fragment flanking the pJD396 insertion (Table 1).

DNA Techniques and Sequence Analysis. Plasmid DNA, isolated by the alkaline lysis method (17), was purified by CsCI centrifugation (48) when necessary. Chromosomal DNA from S. pneumoniae was prepared essentially as described by Hotchkiss (35). S. pneumoniae was transformed as previously described

(67). E. coli, washed in water and resuspended in 10% glycerol, was electroporated using a BTX Electro Cell Manipulator 600 (Biotechnologies and Experimental Research, Inc., San Diego, CA).

Taq polymerase (Fisher Scientific, Pittsburgh, PA) was used for PCR amplifications. The Genius System (Boehringer Mannheim, Indianapolis, IN) was used for DIG-dUTP labeling of probes and chemiluminescent detection in blotting experiments.

Sanger dideoxy sequencing of plasmid DNA was performed using the Sequenase 2.0 kit (US Biochemicals, Cleveland, OH). Sequencing of PCR products was performed using the Sequenase PCR Product Sequencing kit (US Biochemicals).

Greater than 98% of the sequence was obtained for each strand of the cps3U-cps3M-tnpA-plpA and the orf5 regions. Sequence from the I region (80% single-stranded) was compared to the published sequence for type 19F 32. Differences between the two were verified in the type 3 sequence. Sequence analyses and data base searches were performed using the programs of The University of Wisconsin Genetics Computer Group (GCG) 29 and the NCBI BLAST server 2. The sequences presented here have been assigned GenBank accession numbers U66845 (Figure 2) and U66846 (Figure 5).

Transcription Analyses. Gene fusions with the cat reporter gene were constructed using the insertion-duplication vectors pJY4163 and pJY4164 (Table 1) to target insertions into the S. pneumoniae chromosome. Sites of the insertions were confirmed in Southern blot analyses. Due to low levels of chloramphenicol acetyltransferase activity in the standard enzyme assay (53), levels of resistance to chloramphenicol (, ug/ml) were

used to assess cat expression. Levels of resistance were determined by growth on blood agar medium containing erythromycin (0.3 Rg/ml) and chloramphenicol (1 to 8 Fg/ml, in 1 , ug/ml increments). The level of resistance was defined as the highest concentration permitting the formation of single colonies.

For Northern analyses, S. pneumoniae cultures (500 ml) were grown in THY to an OD620 = 0.05, iced, and the cells pelleted by centrifugation at 4000 x g for 15 min at 4°C. RNA was prepared according to the procedure of Pearce et al. (47). Residual chromosomal DNA was removed by RQ1 DNase digestion (Promega Corporation, Madison, WI) followed by extraction twice with phenol/chloroform/isoamyl alcohol (25: 24: 1), once with chloroform/isoamyl alcohol (24: 1), and then precipitation overnight in ethanol. The pellet was resuspended in 50 ul DEPC- treated water containing 10 mM Ribonucleoside-Vanadyl Complex (New England Biolabs, Beverly, MA) and stored at-20°C. Yield and purity were determined by spectrophotometry and agarose gel electrophoresis. For blotting experiments, RNA was denatured at 65°C for 10 min and electrophoresed on a 1.0% agarose/2.2 M formaldehyde gel with DIG-labeled and unlabeled RNA markers (Boehringer-Mannheim or Gibco-BRL). The Genius System (Boehringer-Mannheim) was used for labeling of probes and chemiluminescent detection. Probes were derived by PCR amplification of: a) the cloned inserts from pJD390 (cps3D), pJD362 (cps3S), and pJD357 (cps3U); b) an internal fragment from pJD364 (cps3M) using the M-specific primers Ml and M5 (Table 2); and c internal fragments from pJD377 using the IS2/P1 (tnpA) and P8/P3 (palpa) primers.

Capsule Determinations. Capsular serotypes were confirmed by slide agglutination using type-specific antisera (Statens Seruminstitut, Copenhagen, Denmark). For use in ELISA determinations, cultures of S. pneumoniae were grown to mid- exponential phase (OD600 = 0.5) in THY and were then heat killed (65°C, 20 min). Supernatant fluids from centrifuged (12,000 x g, 10 min) cultures were filtered and the cell pellets were washed and resuspended in the original culture volume with PBS (50 mM sodium phosphate pH 7.4,100 mM NaCl). Type 3 capsule was quantitated in competitive-inhibition ELISA assays 10 using microtiter plates coated with purified type 3 polysaccharide (0.25 Rg/ml PBS; ATCC, Rockville, MD) coupled to poly-L-lysine (30).

Ascites fluid containing the type 3-specific monoclonal antibody 16.3 (19) was used to detect polysaccharide. Purified type 3 polysaccharide was used as the standard. Samples were diluted either 125-fold (whole cells and sonicates) or 625-fold (supernatant fluids). For each strain, the percent inhibition was determined as the mean from at least two independent cultures, with at least four replicates performed for each culture. Statistical significance was determined using Student's t-test.

TABLE 1 Bacterial strains and plasmids Strain/Plasmid Derivation and Properties Reference Strain S. pneumoniae WU2 Type 3 encapsulated; parent strain for 19 sequencing and mutation analyses JD770 Type 3 encapsulated derivative of WU2 25, 37 containing insertion-duplication of'cps3DSU' identical to WU2 in capsule production and virulence,EmR L82006 Type 1 encapsulated 46 D39 Type 2 encapsulated 12 A66 Type 3 encapsulated 18 ATCC 6303 Type 3 encapsulated 18 EF3113 Type 3 encapsulated 18 L8 1995 Type 3 encapsulated 18 DBL5 Type 5 encapsulated 65 DBL1 Type 6B encapsulated 18 L82231 Type 14 encapsulated 18 JD867 pJD355 x WU2, insertion-duplication of 24 'cps3DSU', type 3 encapsulated, EmR JD900 pJD357 x WU2, Cps3U-, type 3 encapsulated, 24 EmR JD902 pJD362 x WU2, Cps3S-, non-encapsulated, 24 EmR JD981 pJD392 x WU2, upstream insertion 24 duplication, type 3 encapsulated, EmR

JD982 pJD390 x WU2, Cps3DS-, non-encapsulated, 24 EmR JD1008 pJD396 x WU2, ORF5-, type 3 encapsulated, 24 KmR JY1200 pJY5006 x WU2, Cps3C-, type 3 encapsulated, EmR MC1032 pMC107 x WU2, PIpA-, type 3 encapsulated, EmR MC1077 pMC159 x WU2, insertion-duplication of'cps3DS' terminating in S-U intergenic region, type 3 encapsulated, EmR MC1092 pMC123 x WU2, Cps3M-, type 3 encapsulated, EmR MC1098 pMC186 x WU2, Cps3C-, type 3 encapsulated, EmR MC1114 pMC205 x WU2, Cps3M-, type 3 encapsulated, EmR MC1119 pMC180 x WU2, insertion-duplication of'tnpA- pIpA', type 3 encapsulated, EmR E. coli DH5a endAl hsdR17 (rK-mK+) supE44 thi-1 10 recA1 gyrA relA1 D (lacZYA- argF)U169 (f80DlacZDM15) LE392 hsdR514 (rK-mK+) supE44 supF58 58 D (lacIZY) 6 galK2 galT22 metB 1 trpR55 1- Plasmids* pJY4163 Lack origin of replication for S. pneumoniae; 6 6 and promoterless cat gene downstream of pJY4164 multiple cloning site (opposite orientations

in pJY4163 and pJY4164), EmR pSF151 Lacks origin of replication for S. pneumoniae; 56 KmR pJD355 pJY4164:: 2.0 kb Sau3Al-PstI 24 ('cps3D-cps3S-cps3U') pJD357 pJY4164:: 0.275 kb MfeI-EcoRV ('cps3U') 25 pJD362 pJY4164:: 0.4 kb HaeIII-MunI ('cps3S') 25 pJD364 pJY4164:: 3.2 kb HindIII 25 ('cps3UM-tnpA-plpA', bp 3905-7220, Figure 2B) pJD374 pJY4163:: 1.4 kb Sau3Al ('cps3M-tnpA', 25 bp 4734-6108, Figure 2B) pJD377 pJY4164:: 1.2 kb SacI-HindIII ('tnpA-plpA', 25 bp 6121-7310, Figure 2B) pJD390 pJY4164:: 0.35 kb HindIII-MunI ('cps3D') 24 pJD392 pJY4164:: 0.6 kb Ec1136II-HindIII 24 (between orf5 and cps3D) pJD396 pSF151:: 0.26 kb Ec1136II-MscI ('orf5', 24 bp 709-965, Figure 5) pJY5006 pJY4163:: 0.8 kb SacI-PstI ('cps3C', upstream SacI to bp 120, Figure 5) pMC107 pJY4163:: 0.27 kb SspI-PstI ('plpA', bp 6941-7211, Figure 2B) pMC123 pJY4164:: 0.36 kb PvuII ('cps3M', bp 4822-5190, Figure 2B) pMC135 pJY4163:: 0.36 kb PvuII ('cps3M', bp 4822-5190, Figure 2B) pMC159 pJY4164:: 1.9 kb PCR product ('cps3D-cps3S; terminates in cps3S-cps3U intergenic region, Figure 9) pMC180 pJY4164:: 0.3 SacI-RsaI ('tnpA-plpA',

bp 6121-6419, Figure 2B) pMC186 pJY4164:: 0.8 kb SacI-PstI ('cps3C', upstream SacI to bp 120, Figure 5) pMC205 pJY4164:: 0.48 kb EcoRI-XmnI ('cps3M', hp 4983-5458, Figr Bl * Most of the restriction sites are shown in Figure 2,5, and 9. The gene (s), or part (s) thereof, contained in the clone and the location of the fragment (for sequence presented here) are given in parentheses.

TABLE 2 Primer Sequences.

Sequence Source'Position2 SEQ ID NO.

IS2 5'-GCCTCAGTTAACAAGTCAAA-3'WU2 6035-6054 1 M 1 5'-GTGGACACCTATGAATTGTATAG-3'WU2 4682-4704 2 M3 5'-GTCACCAAAATTGCGGAAAG-3'WU2 5775-5794 3 M5 5'-GGCAGATTCAAAAGCGAA-3'WU2 5003-4986 4 Orfl 5'-ATCAAAAGGGCGTTAGGGTA-3'WU2 834-854 5 Orf2 5'-AATAATTGATTAGCGCCATT-3'WU2 1107-1088 6 PI 5'-GCCGTAGATGATGACAACCA-3'WU2 6326-6307 7 P3 5'-TTGCTGTCTGGTCAACTGGC-3'WU2 6833-6814 8 P4 5'-GCATGCTCTGGATCAGGTTC-3'R6x 13-32 9 P5 5'-CAAGAGAAATACTAAATC-3'R6x 1971-1953 10 P6 5'-GTTGCTAAACGATATGAT-3'WU2 7181-7198 11 P8 5'-TGCATTTGGATTTGACCG-3'WU2 6523-6540 12 'Denotes strain from which primer sequence was taken 2Positions of primers are numbered according to nucleotide sequence published here for WU2 in Figure 2 or 5 as indicated, and previously for R6X41.

RESULTS Truncated Sequences Associated with the Type 3 Locus The loci of different capsular serotypes are designated by the locus name followed by the number of the serotype, e. g., type 3 is indicated as cps3 (24,32). For type 3, the type-specific genes and the genes downstream are named based on expected function 25.

Common sequences that are located upstream of the type 3- specific genes have been given the designation of their type 19F homolog when the two are identical, e. g., cps3C is equivalent to cpsl9fC. The type 3 locus is shown in Figure 2A.

Cps3M The putative translational start codon of Cps3M, the most downstream of the type 3-specific open reading frames, overlaps the putative stop codon of Cps3U (Figure 2B).

Cps3M has homology to phosphoglucomutases (PGM) and phosphomannomutases (PMM) from both gram-positive and gram-negative bacteria, as well as phosphomutases from rabbit and yeast. Several regions conserved among phosphoglucomutases and phosphomannomutases, and expected to be important in their function, are present within Cps3M (Figure 3). However, a stop codon located immediately after the last amino acid in the putative substrate binding site of Cps3M results in a truncated molecule that has lost over 100 amino acids when compared to the other proteins (Figure 2B and Figure 3).

The alteration is apparently due to a deletion rather than to a frameshift mutation as sequences homologous to phosphomutases were not detected downstream of the Cps3M stop codon. Four domains (I-IV), which together form the floor and sides of the enzymatic active site crevice, were identified in the rabbit muscle

phosphoglucomutase crystal structure (20). The sequence of Cps3M indicates that this protein lacks sequences which would b e involved in the formation of structural domain IV.

TnpA Overlapping the C-terminus of Cps3M, but of opposite orientation, is'TnpA' (Figure 2B). Although'tnpA' extends for 555 bp and has the potential to encode a polypeptide of 22,169 Da, it lacks any apparent transcriptional or translational signals, including a methionine start codon.'TnpA'has homology with putative transposases of insertion sequences (IS) from several gram-positive bacteria, including IS1167 of S. pneumoniae, and one gram-negative bacterium. Compared to the other transposases, however,'TnpA'represents only an internal portion of a larger open reading frame (Figure 4). No inverted or direct nucleotide repeat sequences were identified within the 'tnpA'region. A 23 amino acid region of'TnpA'which overlaps Cps3M is most likely coincidental, as it includes the potential sugar substrate binding site of the latter molecule (Figure 2B) and has no homology to other transposases.

PlpA The region adjacent to'tnpA'contains sequence that is essentially identical to that of plpA from derivatives of the S. pneumoniae serotype 2 strain D39 (plpA, permease-like protein A (47), also named aliA (1). PlpA has homology with several bacterial permeases involved in the transport of oligopeptides, including AmiA, the substrate binding protein member of the Ami ABC transporter in S. pneumoniae (1, 47). In both gram-positive and gram-negative organisms, proteins belonging to the ABC transporter family of ATP- dependent membrane transport proteins have been found to b e

involved in the transport of exopolysaccharides (reviewed in 27).

Completion of the type 3 plpA sequence has revealed 98% DNA identity with bp 843 to 1949 of the type 2 plpA. However, two striking differences between the plpAs are apparent. First, the type 3 plpA has undergone a deletion at the 5'terminus that resulted in loss of the first 281 amino acids present in the type 2 sequence. The site of the deletion is immediately adjacent to the beginning of'tnpA'. Second, a one bp deletion in the type 3 plpA (Figure 2B, position 6519) results in a frameshift mutation at amino acid position 43 of the type 3 PlpA. Correcting for the frameshift, the predicted amino acid sequence of the type 3 PlpA differs from that of the type 2 PlpA by only 8 amino acids (Figure 2B). Sequencing of PCR products was used to confirm the one bp deletion in the type 3 chromosome.

Upstream common sequences Upstream of the type 3-specific locus are sequences that are also present upstream of the type-specific genes in a type 19F isolate (32), a type 14 isolate (38), and another type 3 isolate (5). The predicted protein sequences of these genes have homology to proteins involved in polysaccharide export (13,32). As with the downstream region, however, partial genes are apparent in the type 3 sequences. The type 3 cpsl9fD homolog, cps3P, lacks 279 bp found at the 3'end of the type 19F gene. The Cps3P ORF is 154 amino acids long but the last 19 amino acids are not homologous to Cpsl9fD, whereas the first 135 amino acids are 98% identical (Figure 5). A shift in reading frame 5 bp past the end of the homology identifies a 2 3 amino acid peptide ('Cps3E', Figure 5) that has 57% identity with a peptide encoded by the 5'end of cpsl9fE, the next downstream

type 19F capsule gene. The region deleted in the type 3 strain extends 453 bp from the point of truncation in cpsl9fD to the start of the 23 amino acid peptide encoded by cpsl9fE. The remaining 1,119 bp of cpsl9fE have not been identified in the type 3 sequence. The complete Cpsl9fE homolog is present in the type 14 strain, where glycosyltransferase activity has been demonstrated (38). Comparison of the sequences from the two characterized type 3 strains, WU2 and 406 (Arrecubieta, et al. (5) GenBank accession #Z47210) revealed only two nucleotide differences and a single amino acid difference in a 639 bp region containing the cpsl9fD homolog and the 3'end of the cpsl9fC homolog. Thus, both strains contain the partial sequence structures identified in WU2.

ORFS Located between cps3D and the common upstream region is sequence that is present in multiple copies in the chromosomes of strains of types 2,3,5,6B, 8,9, and 22, but that is not necessarily linked to each of these capsule loci (24).

Additional sequencing of this region, along with a correction in the previously reported nucleotide sequence, identified an open reading frame (ORF5) of 197 amino acids that reads in the direction opposite to Cps3DSUM (Figure 5). No extensive homologies with known protein sequences are apparent in this open reading frame. The protein predicted from the orf5 sequence is highly hydrophobic, with at least 3 potential membrane spanning regions present (data not shown). Southern blot analyses using a probe specific for orf5 detected only a single copy of this sequence in strains of capsule types 2 and 6B, but two copies were present in the type 3 strain (Figure 6). The highly

repetitive sequence identified in this region of the capsule locus (24) can thus not be explained by orf5. Based on restriction fragment sizes, the unique copy of orf5 in type 3 is the one upstream of cps3DSUM. From previous linkage analyses (24) and the present data, it can be concluded that the type 2 and type 6B copies of this gene are not linked to their respective capsule loci.

It also is not present in the capsule loci of type 19F (32) or type 14 (38) (GenBank accession # X85787).

Confirmation of plpA Deletion in the Type 3 WU2 <BR> <BR> <BR> <BR> <BR> Chromosome and Identification of Full Length plpA in Other Capsular Serotypes In contrast to the type 3 plpA, the pIpA identified in derivatives of the serotype 2 D39 strain is a complete gene (1,47). To confirm the 5'deletion of plpA in the type 3 WU2 chromosome, and to determine whether this gene is intact in strains of other capsular types, PCR analyses using primers expected to permit amplification of the 5'end, the 3'end, and the full length plpA were performed (Figure 7A). A 997 bp PCR product corresponding to the 3'end of plpA was obtained from strains of capsular types 1,2,3,5,6B, and 14. A 1,272 bp product corresponding to the 5'end and a 1,959 bp product corresponding to the full length plpA were obtained from strains of types 1,2,5, 6B and 14. However, neither the 1,272 bp or 1,959 bp products was obtained from the type 3 strain. Using the 5'end plpA PCR product from the type 6B strain as a probe in Southern blot analyses, the 5'end of plpA in type 3 WU2 was not detected (Figure 7B). Thus, the 5'end of plpA has been lost from the type 3 chromosome, and the deletion may be unique to type 3 strains.

Conservation of the Type 3 Locus Structure among Different Type 3 Strains and in Rxl To determine whether the deletions observed in strain WU2 are conserved among type 3 strains, the capsule loci of four additional independent clinical isolates was examined by RFLP and PCR analyses. The type 3 strains used-WU2, A66, L8 1995, ATCC 6303, and EF3113-differ with respect to PspA serotypes, virulence properties, and sites of isolation (18). In Southern blot analyses using 14 restriction enzymes, the fragment sizes obtained with 12 enzymes were identical for all strains (Figure 8A). A PvuII polymorphism was noted for one strain and two strains exhibited the same StuI polymorphism (data not shown). The area examined extends >14 kb from the StuI site upstream of cps3C to the SphI site downstream of plpA (Figure 2A). To more precisely determine whether the cps3M-tnpA-plpA deletions are characteristic of all type 3 chromosomes, PCR analysis was performed using primers located within cps3M and plpA. The amplified products were identical for all five type 3 strains (Figure 8B). No amplification product was detected using a type 6B strain as a negative control.

The common laboratory strain Rxl was derived as a nonencapsulated mutant of the type 2 strain D39, was then transformed to type 3 encapsulation, again selected for nonencapsulation, and finally selected as a highly transformable mutant (50,54). This strain retains the type 3 capsule locus and makes a small amount of type 3 polysaccharide. It can b e restored to normal type 3 encapsulation by the repair of a point mutation in cps3D (24). PCR analyses confirmed that the cps3M-

tnpA-plpA region of Rxl contains the same deletions observed in type 3 strains (data not shown). tnpA is Present in Single Copy and is Linked to plpA in Other Capsule Types IS1167, with which tnpA has homology (Figure 4), is present in multiple copies in the pneumococcal chromosome (69). However, only a single copy of tnpA was detected in strains of types 2,3, and 6B (Figure 7C). The sequences detected using tnpA as a probe are not likely to b e copies of IS1167, as the two sequences are only 53% homologous and hybridizations were done at >95% stringency. Thus, these two transposases represent distinct members of a family of transposases.

Probes specific for plpA also revealed only a single copy of this gene (Figure 7B). Restriction mapping with either tnpA-or plpA-specific probes yielded maps identical to those determined using a single probe containing both sequences (24, Figures 6B and 6C). Thus, tnpA is present in strains of other capsule types and both it and plpA are located on the s am e restriction fragments.

Transcription of the Type 3 Locus Insertion- duplication mutations using vectors that yield transcriptional cat fusions (pJY4163 and pJY4164, Table 1) were constructed in the genes of the type 3 locus. As shown in Figure 9, cps3D and cps3S are transcribed at approximately equivalent levels. cps3U is transcribed at approximately one-half the level of cps3DS, whereas transcription through cps3M and plpA is about one-sixth of the cps3DS level. A low but detectable level of transcription was apparent through the regions flanking the type 3-specific

genes (Figure 9). Northern blot analyses using probes for the type 3-specific genes showed that cps3D, S, U, and M are present on the same transcripts (Figure 1 osa). Although multiple transcripts are apparent, all four probes detected an approximate 6,700 nucleotide transcript. The remaining transcripts may result from transcription initiations at additional promoters or they may be the result of processing of the larger transcript. Utilization of the promoter identified upstream of cps3D (4,24) and of a potential transcription termination sequence identified downstream of plpA (47) would result in an approximate 6,500 nucleotide transcript that would contain cps3DSUM-tnpA-plpA.

Hybridization with tnpA-and plpA-specific probes showed that these sequences are contained on the same transcripts as cps3DSUM (Figure 10A). These results confirm the previous genetic observations showing that cps3D and cps3S are transcribed as part of the same operon (24), and extend the observations of Arrecubieta et al., showing that a single transcript contains at least cps3D, cps3S, and cps3 U (cap3A, cap3B, cap3C (4)).

Effect of Mutations on Type 3 Capsule Production Strains containing mutations in either cps3D or cps3S do not make detectable type 3 polysaccharide (24,25). With these exceptions, there are no apparent requirements for expression of the genes in the type 3 locus for capsule production under standard laboratory growth conditions. The strains examined contained insertion- duplication mutations in cps3C (JY1200), orf5 (JD1008), cps3U (JD900), cps3M (MC1092), and plpA (MC1032). Capsule production was assessed by inspection of colony morphology for

cells grown on blood agar medium and in competitive-inhibition ELISA assays using whole cells, culture supernatants, and cell sonicates of THY-grown cultures.

EXAMPLE 2 Differential Effects Caused bv Insertions and Deletions of Type 3 Capsule Genes.

It was previously showed that insertion mutations in the type 3 capsule genes cps3U and cps3M do not affect capsule production during laboratory culture, but they do reduce the virulence of these strains in mice. Further studies have shown that insertions located anywhere within the cps3UM region also reduce virulence, whether or not they affect the open reading frames. Further, this result was not due to polar effects. To more directly address the requirement for cps3UM in virulence, these genes were specifically deleted, as well as a larger region in which they were contained. In contrast to the insertion mutants, the deletion mutants were as virulent as the parent strain. Thus, i n the mouse models, cps3U and cps3M are not required for virulence. The reasons that insertions in and around these genes do affect virulence is not known, but may be related to transcription effects or the generation of dominant negative mutations.

EXAMPLE 3 Capsule Production and Intranasal Colonization Using a mutant that contains a point mutation in cps3D and produces approximately 10% of the parental level of type 3,

intranasal colonization of mice was observed at levels comparable to the fully encapsulated parental strain. In contrast, a mutant that produced no capsule as the result of an insertion mutation in cps3S was unable to colonize. Thus, only minimal levels of capsule are essential for colonization, and high levels of capsule production may not occur in this environment.

EXAMPLE 4 AMI 88. A New Mutant of Streptococcus pneumoniae A spontaneous mutant of the Streptococcus pneumoinae type 3 strain A66 was isolated. This mutant, AM 188, appeared non-encapsulated upon visual inspection on blood agar plates supplemented with 3% sheep blood. Though the mutant appeared to be non-encapsulated, performance of the Quellung reaction indicated that type 3 capsule was indeed present on the mutant. The Quellung test allows for the visualization of type 3 capsule under the microscope following incubation of the bacteria with antiserum against type 3 polysaccharide. Capsule production by the mutant was quantitated in competitive inhibition ELISAs, using ascites fluid containing a type 3-specific monoclonal antibody. The mutant produced approximately 25% of wild-type levels of capsule. The mutation in AM188 was repaired b y transformation with a 0.356 kb Sau3AI-SspI fragment from cps3D. This fragment corrected the AM188 mutation and restored capsule production to wild type levels. Sequence analysis showed that the mutation is a single base pair change located within cps3D, which encodes a UDP-Glc dehydrogenase that is required for type 3 capsular polysaccharide synthesis, at base pair 1876,

resulting in an amino acid change from a valine to a glutamic acid.

This mutation is located approximately sixty base pairs downstream of the active site of Cps3D.

1866--1876 A 6 6 ACAGCTGTGGTGCAATCTAAT SEQ ID NO. 13 T A V V Q S N SEQ ID NO. 14 AM 188 ACAGCTGTGGAGCAATCTAAT SEQ ID NO. 15 T A V E Q S N SEQ ID NO. 16 Colonization of Immunological Normal Mice The ability of AM188 to colonize the nasopharynx of mice was measured by infecting BALB/cByJ mice intranasally with 10'cfu of bacteria in 10 ul of lactated Ringer's solution. Seven days post- infection, mice were sacrificed and their nares rinsed. Dilutions of the nasal washes were plated and counted. As shown in Table 3, encapsulated type 3 Streptococcus pneumoniae (strain A66 and AM 161) colonize the nasal pharyngeal cavity of mice. In contrast, a non-encapsulated isolate (AM199) failed to colonize. The AM188 strain colonizes as well as the parent.

TABLE 3 Intranasal Colonization of Mice by Cps+ and Cps- Type 3 S. pneumoniae Infecting Phenotype Mice Log CFU SEM Strain Colonized Recovered 13/253.880.17A6wt, 6 Cps+ 3/43.320.342AMwt, 161 Cps+, Em Am S-, 0/10------ 199 Cps-, 0/10 Em' (both) 3.60 0.309 6/10 (wt only) Am D-, 20735 3. 29 0. 134 188 Cps* 3/10 4.32 0.195, (both) (wt), 0.293 3.85 (D-) 0.202 2/10 (wt 4.02 only) Colonization of Immunodeficient Mice The mutant was also tested in Xid (X-linked immunodeficient) mice, which make poor immune responses to polysaccharides and are highly susceptible to pneumococcal infection. Mice were infected with 10'bacteria in 10 pl Ringer's solution. Colonization levels were determined for surviving mice 7 days post infection. As shown in

Table 4, introduction of the parent type 3 strain A66 by the intranasal route results in death of a large percentage of mice.

However, the mutant AM188 was able to colonize but did not kill in this model. This result suggests that AM188 is either unable to cross the mucosal barrier and cause systemic infection, or that it crosses the barrier but is unable to survive in the blood stream.

Either way, the result is significant because it implies that AM188 is avirulent via the intranasal route, which would be the preferred route of immunization. Additionally, infants and young children, who would be potential recipients of the vaccine strain, respond poorly to polysaccharides and can be highly susceptible to pneumococcal infection. Thus, administration of AM188, or derivatives thereof, by the intranasal route may prove harmless. as would be required for a vaccine strain.

TABLE 4 Intranasal infection/colonization of Xid mice Strain dead/total colonized/mean log CFU recovered s u r v i ving total (SEM) A66 3/4 0/1 AM188 0/10* 3/10 3.16 (0.23) * significantly different from A66 (P = 0.011)

Infection of immunologically normal mice by intravenous (i. v.) and intraperitoneal (i. p.) routes Mice were infected i. v. with 10'bacteria and i. p with 105 bacteria. As shown in Table 5, AM188 was essentially avirulent by the i. v. route. It appeared, however, to remain highly virulent by the i. p. route.

Death here may have been due to revertants of AM188 in which the mutation had been repaired or suppressed.

TABLE 5 Route A66 (dead/total) AM188 (dead/total) i. v. 7/7 1/7 (P = 0.005) i.p. 6/7 6/7 EXAMPLE 5 Role of Sequences Flanking the Type 3 Capsule Locus in Genetic Switching of Capsule Cassettes and Regulation of Capsule Production Genes flanking the type 3 capsule locus generally contain deletions and appear not to be transcribed or to b e required for capsule production. They are, however, maintained in apparently all type 3 strains. To test the requirement for these sequences in the genetic recombination that results in exchange of the cassettes that contain the different capsular serotype genes, derivatives were constructed in which either the upstream,

downstream, or both flanking sequences have been deleted.

Deletion of the genes upstream of cps3D appears to have an effect on the level of transcription of the type 3-specific genes.

Transcript levels are elevated in the mutant, possibly due to deletion of a repressor binding site. Consistent with regulation occurring via a repression mechanism, type 3 transcripts are not detected in late log phase, but a reduction in capsule production is not observed in the deletion mutants.

EXAMPLE 6 Reductions in Type 3 Capsule Production Resulting from Mutations in Genes Unlinked to the Capsule Locus.

Cps3U and Cps3M appear to contribute little to the production of type 3 capsule, as mutations in the genes encoding these enzymes (a Glc-1-P uridylyltransferase and a phosphoglucomutase homolog, respectively) have no effect in this regard. It was found that a spontaneous mutant producing approximately 25% of the parental levels of type 3 capsule harbors a mutation in a second phosphoglucomutase homolog (Pgm) that is unlinked to the capsule locus. Mapping and sequencing analyses revealed a point mutation located in a region that forms the active site cleft of Pgm enzymes. The parent type 3 Pgm was cloned and overexpressed in E. coli, where it was shown to have phosphoglucomutase activity.

The cloned mutant Pgm had a reduced level of activity.

Mutations in galU, which is also unlinked to the type 3 capsule locus and encodes a second Glc-1-P uridylyltransferase, reduced

capsule production to approximately 5% of parental levels. A similar result was obtained with insertions located immediately downstream of galU, suggesting the presence of additional genes involved in capsule production. Mutants in which either pgm or galU were completely inactivated had severe growth deficiencies, and spontaneous mutants producing near normal levels of capsule were obtained at apparently high frequencies. UDP-glucose, the end product resulting from the activities of Pgm and GalU, i s required for the production of teichoic acids, which are essential for cell wall production in S. pneumoniae. Thus, synthesis of the type 3 polysaccharide is heavily dependent on the cellular pools of UDP-glucose, and mutations that eliminate the enzymes catalyzing synthesis of this precursor have severe effects on both capsule production and cell growth.

METHODS Cloning and Expression of pgm and cps3M. To obtain the pgm region, DNA surrounding the WG44.6 insertion was cloned and sequenced by a combination of marker rescue and anchored PCR of the chromosomal DNA adjacent to the pVA891 insertion.

First, a clone containing a 2 kb insert was obtained by digestion of WG44.6 chromosomal DNA with KpnI followed by self-ligation, transformation into E. coli, and selection on Em. The sequence from one clone, pGH5518, was used to design primer crr-2 in order to obtain a larger clone. For that procedure, WG44.6 chromosomal DNA was digested with SphI and NsiI, ligated into pJY4163, and PCR amplification was performed using the ligation reaction as a template. A plasmid specific primer, TT-2, and c rr-2 were used for the PCR. The resulting 1.6 kb PCR product was

cloned using the pGEM-T Easy vector system (Promega) and transformation into E. coli with selection for Ap resistance. The sequence of one clone, pGH5540, was homologous to that of a periplasmic binding protein for an amino acid transport operon (aatB) and to contig 130 of the S. pneumoniae type 4 genome sequence (70). A primer (crr-13) specific for the expected upstream sequence (aatA) was used in conjunction with an aatB- specific primer (crr-9) to generate a 1.2 kb PCR product. This fragment was initially cloned into pGEM-T Easy and then subcloned into pJY4163. Transformation of the subclone (pGH5559) into WU2 and JY1060 resulted in a plasmid insertion in the respective chromosomes. These strains (GH4511 and GH5075, respectively) were then used in marker rescue experiments to clone pgm and the adjacent downstream DNA. The 4 kb clone containing the WU2 pgm region (pGH4045) was obtained by self- ligation of SmaI/PmlI-digested GH4511 chromosomal DNA followed by transformation into E. coli and selection on Em. A clone (pGH4061) containing the partial pgm and'aatAB of JY1060 was obtained in the same manner using EcoNI/SmaI-digested GH5075 chromosomal DNA. The sequence of the JY1060 pgm was obtained from this clone and from PCR sequencing of the chromosome using primers designed from the WU2 sequence. A clone containing the complete JY1060 pgm was obtained b y replacing the EcoNI/BstXI fragment in pGH4045, which contains the complete WU2 pgm, with the same (mutant) fragment from JY1060. EmR transformants were isolated in E. coli W1485Apgm.

An E. coli clone expressing a recombinant cps3M was obtained from WU2 using primers MI and P1. The 1.6 kb PCR

product was digested with NdeI and XhoI and ligated into pET-21a (Novagen, Inc.) so as to utilize the ribosome binding site of the vector. The ligation was transformed into DH5a and subsequently into BL21 (DE3) to permit induction of cps3M. E. coli cultures were grown overnight, diluted 1: 100, grown to mid-exponential phase and then induced for 2 h at 37°C by the addition of isopropyl-1- thio-P-D-galactoside (IPTG) at a final concentration of 2 mM.

Uninduced cultures were used as negative controls. For complementation analysis in E. coli W1485Apgm :: tet, cps3M was cloned in pKK223-3 and expression was induced using IPTG.

Protein Analysis and Generation of a-Cps3M. Protein concentrations were determined using the Bio-Rad Protein Assay (Bio-Rad). Proteins were examined by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) using 10% gels and staining with Coomassie brilliant blue dye R-250. The Rainbow protein standard (Amersham) was used to estimate molecular size. Western immunoblotting was performed as previously described (66). PGM-specific mouse polyclonal antiserum was obtained by subcutaneous injection of 10 BALB/cByj mice with 0.2 ml each of a 1: 1 mixture of Freund's Incomplete adjuvant and a polyacrylamide gel slice containing recombinant Cps3M. Mice were boosted by intraperitoneal injection of the same mixture after 8 days. Blood was collected 1 0 days after the boost, and the serum was pooled and absorbed with E. coli by incubation overnight with shaking at 4°C. E. coli were removed by centrifugation and the serum was sterilized b y filtration through a 0.45, um filter.

PGM Assay. One ml of an E. coli culture grown overnight at 37°C was harvested by centrifugation, washed once with imidazole buffer (5 mM imidazole, pH 7.4,1 mM MgCl2) and suspended in the original culture volume using the same buffer.

Cells were frozen at-70°C, thawed and sonicated on ice 3x for 10 s at 30 s intervals. Cell debris was removed by centrifugation at 10,000 x g for 15 min. at 4°C. The supernatant was saved and the protein concentration determined. The PGM assay was performed according to the method of Joshi et al. (71) using 1 ml reactior. mixtures containing 40 mM imidazole-HCl [pH 7.8], 2 mM Glc-1-P, 7.9 aM Glc 1,6-diphosphate, 5 mM MgCl2,0.5 mM NADP+, and 1 U of Glc-6-P dehydrogenase. Samples were read at 30 s intervals for 5 min at A340. Values for controls containing no NADP+ were subtracted from each sample and PGM activity was determined as the change in gmole NADPH per min per mg protein.

Nucleotide Sequence Accession Number. The type 3 pgm and flanking sequences have been deposited in GenBank under accession number AF165218.

RESULTS Isolation and Initial Characterization of the Type 3 Capsule Mutant JY1060 JY1060 was isolated during transformation of the type 3 strain WU2 with DNA from the type 2 strain D39, in an attempt to transfer the type 2 capsule genes into the type 3 background. Four small colonies, characteristic of the type 2 morphology, were obtained but none proved to b e reactive with antiserum to the type 2 capsule. Instead, two retained reactivity with the type 3-specific antiserum, and two were non-encapsulated. The studies described herein involve the

characterization of one of the type 3 small colony mutants, JY 1060 (Figure 11 A).

The small colony morphology of JY1060 was stable on passage, suggesting that it was the result of either a spontaneous mutation that had occurred in one of the parent strains or the introduction of a potential regulatory element from the type 2 donor. That the phenotype was the result of a spontaneous mutation was suggested by the fact that the mutation could b e repaired (as determined by restoration of parental colony morphology) by transformation with DNA from either the type 3 or the type 2 parental strains (data not shown). As will b e discussed below, the mutation most likely arose in the type 2 parent and was subsequently transferred to the type 3 recipient.

Initial characterizations showed that growth of JY 1060, as determined by cellular morphology, chain length, and the number of CFU/colony, was indistinguishable from the type 3 parent strain. In addition, the growth rate in liquid medium (THY) and the ability to undergo autolysis were unchanged in the mutant (data not shown). The amount of capsule associated with both the cell and the culture supernatant fluid of JY1060 was, however, only 25% of that found with the type 3 parent (Figure 11B). Both the type 3 parent and the mutant released approximately 2-fold more capsular polysaccharide into the supernatant than was retained on the cell surface. The buoyant densities in Percoll density gradients were also examined. In general, the buoyant density varies relative to the capsule structure. Non-encapsulated cells pass through the gradient whereas type 2 and type 3 encapsulated cells band at distinct

densities. Despite noted differences in capsule amounts, the buoyant densities of JY1060 and the type 3 parent were the same and 1.033 0.0014 g/ml, respectively).

Transcription of the Type 3 Capsule Genes. To determine whether the decrease in capsule production was the result of alterations in transcription of the type 3 capsule locus, Northern and RNA dot blot analyses of the steady-state transcript levels were performed. Northern analysis of the type 3-specific genes revealed the same 6700 nt transcript (cps3D through'plpA) in both the parent WU2 and in JY1060 (Figure 12A).

Densitometric analysis of RNA dot blots performed using serial two-fold dilutions of total RNA indicated that there was n o difference in the amount of steady-state capsule transcripts produced by JY1060, relative to its type 3 parent (Figure 12B).

Because the amount of capsule produced is a cumulative effect, we next examined the possibility that expression of the JY1060 capsule genes was altered during the growth cycle. For the parent WU2, the type 3-specific transcript was present throughout the early to mid-exponential phase of growth, but was detected only at reduced levels during the late exponential phase. In contrast, the transcript for pspA, a non- capsule related gene, was present at the same level during all stages of the growth cycle (Figure 12C). The results for JY 1060 were identical to those obtained for the parent strain (data not shown), further indicating that the mutation did not affect transcription of the capsule genes.

Analysis of Potential Linkage to the Capsule Locus.

Linkage of the JY1060 mutation to the capsule locus was examined

by transformation of JY1060 with DNA from strains that contained Em or KmR insertions within the capsule locus, but which produced normal levels of type 3 capsule. The insertions were located either upstream of the type 3 biosynthetic genes in cps3B (KW1004A) or orf5 (JD1008), or within the type 3-specific biosynthetic gene region (JD770). Transformation and selection for the antibiotic resistance marker contained in such strains results in a high frequency of co-transformation of the type 3 capsule locus (25). Transformation of strain Rxl, which makes reduced amounts of capsule due to a point mutation in cps3D (24, 25), resulted in an EmR/Cps+ co-transformation frequency of 86% (269/313) when using JD770 donor DNA. In contrast, transfer of the antibiotic resistance markers from JD770, KW1004, or JD1008 into JY1060 resulted in only low frequency co-transformation of the Cps+ phenotype, indicating that the JY1060 mutation was not located in the type 3 locus (Table 7).

Localization of the JY1060 Mutation on the Chromosome. To localize the mutation on the chromosome, linkage analysis using strains containing EmR insertions at various sites in the chromosome was performed (Table 7). Transformation with DNA from strains WG44.6 and WG44.14 resulted in co- transformation of the Em marker and repair of the JY 1060 mutation at frequencies of 70% and 83.7%, respectively.

Subsequent Southern blot analyses of the insertions in these strains indicated that they were in the same location (data not shown). Transformation and repair of JY1060 with serial dilutions of WG44.6 DNA indicated that only a single mutation, or possibly more than one closely linked mutation, was responsible for the

JY 1060 phenotype. As the amount of DNA added to t h e transformation reaction was reduced, the frequency of co- transformation of EmR and repair of the mutation remained the same. Thus, the co-transformation was due to true genetic linkage and not to saturating levels of DNA (data not shown).

Pulsed-field Mapping of the WG44. 6 Insertion. To localize the Em insertion on the WG44.6 chromosome, pulsed-field gel electrophoresis (PFGE) was performed on SmaI-and ApaI- digested DNA. Distinct band shifts indicated that the insertion w a s located in SmaI fragment 4 and ApaI fragment 5 of the S. pneumoniae genome. The chromosomal map for S. pneumoniae R6 was previously generated by Gasc et al. using PFGE and was utilized here as a control, since WG44.6 and R6 are both derivatives of the type 2 strain D39. The capsule locus is at least 450 kb away from the site of the WG44.6 insertion, on SmaI fragment 3 (6).

Identification of the JY1060 Mutation. A restriction map of the chromosomal region surrounding the Em insertion of WG44.6 was generated by Southern analysis, and the ability of WG44.6 restriction fragments containing the insertion and flanking DNA to repair JY1060 was examined. For these experiments, digested chromosomal DNA was transformed into JY1060 and the colony morphology of EmR transformants was examined. A high frequency of EmR transformants exhibiting normal colony morphology was obtained using BglII-digested DNA, indicating that the mutation was located within the 10 kb region contained in this restriction fragment. Because WG44.6 w a s derived from Rxl, a highly passaged laboratory strain descended

from a type 2 isolate, further characterization of the region containing the JY1060 mutation was done using GH4511. This strain is a derivative of the type 3 parent that contains an EmR insertion in the 10 kb BglII fragment. Restriction fragments containing the EmR insertion and flanking DNA were used in transformation experiments to test for repair of the JY 1060 mutation. The results of these experiments are summarized in Figure 13. Taken together, they suggested that the mutation was located within or adjacent to the EcoNIlBstXI restriction fragment.

These results were confirmed in repair experiments using a clone (pGH4045) encompassing the 4 kb region between the EmR insertion of GH4511 and the PmlI restriction site. As shown in Figure 14A, repair was obtained only with fragments containing the region between EcoNI and BstXI.

Sequence analysis of the 800 bp EcoNI-BstXI fragment identified a single base pair change in the JY1060 DNA, an ABC transversion which resulted in a lysine changing to a threonine (Figure 14B). To confirm that this point mutation was responsible for the reduced capsule phenotype observed in JY1060, a 350 bp PCR fragment (bottom, Figure 14A) derived from WU2 and encompassing the region containing the mutation, was used to transform JY1060. Additionally, an identical PCR fragment from JY1060 was transformed into WU2. From each transformation, isolates with the appropriate capsule phenotype were chosen, and the DNA in the region surrounding the mutation was sequenced.

Transfer of the JY1060 phenotype to WU2 corresponded with transfer of the expected point mutation and a level of capsule production similar to that observed with JY1060 (GH4535, Table

8). Likewise, repair of the JY1060 mutation resulted in a return to parental levels of capsule production (GH5088, Table 8).

Identification of the Gene Affected by the JY1060 Mutation. Sequence analysis of pGH4045 revealed five complete or partial open reading frames (ORFs) within the 4 kb insertion (Figure 14A). The JY1060 mutation was located in a 1716 nt ORF (pgm) encoding a predicted protein of 572 aa with an expected molecular size of 62.7 kDa. A putative promoter containing a-10 region identical to consensus E. coli Z770 promoters and a-3 5 sequence containing 2 mismatches when compared to the consensus E. coli sequence (72) were present upstream of the ORF.

The highest observed sequence similarity was with Cps3M, the phosphoglucomutase homologue contained in the S. pneumoniae type 3 capsule locus. At the amino acid level, these sequences were 81% identical and at the nucleotide level, they were 74% identical. Comparison with the type 4 S. pneumoniae genomic sequence revealed 99% nucleotide and amino acid identity with the sequence contained in that strain (70). Sequence similarity for the predicted protein was also observed with PGMs and phosphomannomutases (PMM) from numerous organisms, including the PGMs from E. coli and yeast (20 to 25% amino acid identity and 34 to 44% similarity) and a putative PMM from Bacillus subtilis (45% identity and 61% similarity). The S. pneumoniae sequence contained three conserved functional sites present in each of these proven or putative phosphomutases: a substrate binding site, a Mg2+ binding site, and an active site (Figure 14A). The JY1060 sequence differed from that of the parent type 3 only at position 381, where the mutation resulted in

a lysine changing to a threonine (K381T) (Figure 14B). This residue is analogous to K-359 of rabbit muscle PGM (51). K359 is not part of the conserved active or binding sites. However, based on the crystal structure of rabbit muscle PGM, it is a surface residue contained within the active site pocket and it is expected to be important for interaction with the substrate (20,73).

Formation of the active site pocket involves four domains. The last of these domains is deleted in Cps3M, which truncates immediately after the substrate binding site (74).

As described in Figures 13 and 14A, several other ORFs were present in the region surrounding pgm. Within the aatAB region, several missense mutations were noted between the JY1060 and WU2 sequences. The JY1060 sequence was, however, identical to the WG44.6 sequence and the type 4 genomic sequence in this region. Strain WG44.6 was derived from the type 2 strain used as the donor during the original isolation of JY1060.

Thus, the differences between the WU2 and JY1060 sequences may have resulted from integration of type 2 DNA and the original spontaneous mutation resulting in the JY1060 phenotype probably occurred in the type 2 donor pgm. Finally, in the homologous type 4 tnpB sequence, which lies upstream of pgm, a 90 bp sequence that was also located upstream of the capsule loci in S. pneumoniae types 1,2,3,8,14,19A, 19F, and 33F was identified (Figure 13). These sequences had 95% nucleotide identity. In the capsule loci, this 90 bp sequence is located between dexB and cpsA, just upstream of the 115 bp element previously described (75).

Function of PGM. Recombinant clones expressing Cps3M and the putative S. pneumoniae PGM were constructed to determine if these proteins could function as PGMs. E. coli clones that expressed Cps3M, which is truncated at the C-terminal end relative to other phosphomutases, yielded proteins of the expected size (43 kDa), but no PGM or PMM activity could be demonstrated in either enzymatic or complementation assays (data not shown).

Nonetheless, recombinant Cps3M was reactive with antibody to yeast PGM (a-yeast PGM), and polyclonal antibody raised against the recombinant Cps3M (a-Cps3M) reacted with rabbit muscle PGM (Figure 15A). Sequence analyses indicated that the clones were intact, hence the lack of activity may be due to the C- terminal truncation. Neither the a-yeast PGM nor the a-Cps3M detected Cps3M or PGM expressed in S. pneumoniae (data not shown). In addition, insertional inactivation of cps3M in JY1060 did not further reduce the amount of type 3 capsule produced by this strain (data not shown).

Expression of the parental WU2 pgm resulted in a protein of approximately 60 kDa that reacted with mouse polyclonal a-Cps3M (Figure 15A). In contrast to the WU2 pgm, the mutant JY1060 pgm proved difficult to clone, with numerus attempts utilizing a variety of methods being unsuccessful. A clone was obtained by replacing the EcoNI-BstXI fragment of the WU2 clone with the same fragment from JY1060. From this clone, a protein of approximately 60 kDa that reacted with the a-Cps3M polyclonal antibody was observed (Figure 15A). Sequence analysis of the region that contained the pgm mutation and the

putative promoter indicated that both were intact (data not shown).

PGM activity was assessed in complementation studies and in direct enzyme assays. E. coli PGM mutants do not ferment galactose and grow on MacConkey agar containing galactose as pale pink colonies, whereas PGM+ strains ferment the sugar and grow as bright pink colonies (76). In our assay, the E. coli W1485 PGM+ parent, as well as W1485_pgm transformed with the WU2 and JY1060 pgm clones, grew as bright pink colonies, indicating the presence of functional PGMs (data not shown). Because complementation assays are not quantitative, PGM activity was determined using extracts from the E. coli strains used in the complementation studies. As shown in Figure 15B, the WU2 PGM exhibited high levels of PGM activity, whereas the JY1060 PGM had approximately 15% of the parental level of activity. Direct analysis of PGM activity in S. pneumoniae was not done because of the presence of NADPH oxidases which interfere with the assay (77).

Suppressor Mutations and the Effect of Insertional Inactivation of pgm. During transformation reactions with JY1060, we noted an increased frequency of isolates exhibiting near normal colony morphology. Under standard growth conditions, such colonies were rarely observed, and reversion was estimated to occur in less than 1 in 105 cells. Following a transformation reaction, however, large colony isolates were noted at a frequency of 1.3 x 10-3. This number was calculated from seventeen independent control transformations of JY1060 to which no DNA was added. A similar frequency was observed in

the presence of exogenous DNA. The DNA sequence of the region containing the JY1060 mutation was determined for two such isolates. One (GH5087) was obtained from a no DNA control transformation and the other (GH5089) was obtained during transformation with the 350 bp PCR fragment from WU2 that repaired the JY1060 mutation. As shown in Table 8, the JY106C mutation was not corrected in either of these isolates, and the amount of capsule produced was intermediate between that of WU2 and JY1060. Second site suppressor mutations were also obtained when pgm was insertionally inactivated in WU2. Unlike the JY1060 PGM, which retained its full length and was partially functional, the PGM in the insertion mutants had lost both the C- terminal domain and the substrate binding site. These mutants exhibited a small colony morphology. Determination of their true capsule phenotype was complicated, however, by an apparently high frequency of pseudorevertants. Inoculation of THY with cells derived from a single small colony often resulted in as many as 10 to 50% of the isolates exhibiting a large colony morphology following growth in the liquid medium. The majority of these isolates (>90%) retained the insertion in pgm, indicating the presence of suppressor mutations. Cultures that retained the small colony phenotype had extended doubling times (at least 150 min as compared to 60 min for WU2 and JY1060), whereas those containing large colony variants demonstrated normal doubling times after extended incubation. Microscopic examination of THY- cultured cells reacted with type 3 antiserum (Quellung reaction) showed that those retaining the small colony phenotype uniformly produced a small amount of capsule. In contrast, those containing

large colony variants had a mixed population that contained non- encapsulated cells as well as ones of minimal and high capsule levels. The amount of capsule produced by four independent p g m insertion mutants (GH4531, GH4532, GH4533, GH4534) was consistently determined to be less than 30% of that produced by JY1060 and less than 10% of the parental level. Insertions downstream of pgm did not show similar effects, hence the phenotype is expected to be due to loss of PGM activity.

TABLE 6 DNA Primers Name Sequence Sourcea Position SEQIDNO. crr-2 5'-ACAACCTTCTTATCAATGCC-3' WG44. 6 ND 17 crr-9 5'-CAATTATCCATATTCAATCGC-3'type 4 2704-2724 18 crr-13 5'-CTTGCAAGTCCATTGGAAGCC-3'type 4 8105-8085 19 pmm-6 5'-TCGATACCGTCAGCAAGTGTC-3'WU2 1677-1657 20 p m m-7 5'-CAAATCGGTGCTATCATGGC-3'WU2 1322-1341 21 TT-2 5'-TCATTTGATATGCCTCCG-3'pJY4163 22 a Denotes strain from which the primer sequence was taken.

Positions of primers are numbered according to the nucleotide sequence for the WU2 type 3 capsule locus (74) or for contig 130 of the S. pneumoniae type 4 genome sequence (70). ND, complete sequence not determined.

TABLE 7 Linkage analysis of JY1060 mutation with the type 3 capsule locus and chromosomal Em insertions. a Donor Strainb No. EmR No. EmR, Cps+ % Co- transformants transformants transformation 11600KW1004A(cps3B) JD1008 (orf5) 131 1 0.7 JD770 (cps3DSU) c 198 3 1.5 AL-2 (lytA) 102 0 0 PLN-A (plnA) 147 2 1.4 GH1001 (pspA) 83 0 0 WG44.4 168 2 1.2 WG44.5 94 0 0 WG44.6 900 636 70 WG44.7 2568 40 1.5 WG44.9 2004 9 0.4 WG44.10 2524 37 1.5 WG44.11 1484 6 0.4 WG44.12 116 0 0 WG44.13 70 0 0 WG44.14 984 824 83.7 a JY1060 recipients were transformed with chromosomal DNA from the indicated donors. Transformants were selected on Em (except with donor JD1008, which contains a Km insertion) and assessed for their colony morphology. Cps+ indicates parental phenotype. b Donors were generated by insertion-duplication mutagenesis. The genes in parentheses indicate the target

fragment and the location of the Em (or Km, for JD1008) marker.

The Em insertions in AL-2, PLN-A, and GH1001 are in the genes encoding autolysin, pneumolysin, and PspA, respectively. The insertions in JD770, KW1004A, and JD1008 are within or upstream of the type 3 locus. The WG44. * strains are derivatives of Rxl that contain random insertion-duplication mutations generated using pVA891 containing Sau3A I-digested Rxl DNA.

TABLE 8 Sequence and Capsule Production of Repaired and Suppressor PGM Mutants. <BR> <BR> <BR> <BR> <P>Straina DNAsequenceb (SEOIDNO.) CapsuleC pd % w 2 WU25'ACAGGTTTCAAATTTATCGCT3' (23) 100 GH4535 5'ACAGGTTTCACATTTATCGCT3' (24) 12. 5 # 1. 7 <0.0001 28 JY1060 5'ACAGGTTTCACATTTATCGCT3'(25) <0.0001 18 GH5088 5'ACAGGTTTCA_ATTTATCGCT3' (26) 48+2. 4 n. s. 106 Suppressor Mutants GH5087 5'ACAGGTTTCACATTTATCGCT3' (27) 33. 8 # 2. 5 0.011 74 GH5089 5'ACAGGTTTCACATTTATCGCT 3' (28) 22 0.5 0.0003 49 a Derivatives are indented below their parent strain. b Sequence is for the region of pgm containing the site of the JY1060 mutation (underlined nucleoitde). Sequence numbering (1475--1495) corresponds with WU2 sequence from pGH4045 (Figure 14).

"Values are the mean pg cps/ml standard error from either 2 (GH5089) or 3 (all others) independent samples. Values were determined for washed cells using the Stains-All assay and are expressed relative to the OD600 of the starting culture. P values are for comparison to WU2 using a two-tailed unpaired t-test.

GH4535 was not significantly different from JY1060, whereas

GH5087, GH5088, and GH5089 were (P = 0.0006, <0.0001, and 0.0011, respectively).

EXAMPLE 7 Effect of Capsule Type and Amount on Virulence and Accessibility of Surface Components.

It was found that the phosphoglucomutase mutant that is reduced in type 3 capsule production bound more complement (C3) than did the parent strain, and was essentially avirulent in mice. Decomplementation of the mice enhanced, but did not completely restore virulence to parental levels, suggesting that part of the reduction in virulence may be due to a growth defect in the animal environment. In contrast, PspA-mutants, which also bound more C3 than the parent strain and were reduced in virulence, were found to be fully virulent in decomplemented mice. The Pgm mutant was more reactive with a polyclonal antiserum to non-capsular surface antigens than was the parent strain, but the accessibility of three major surface antigens (PspA, teichoic acids, and phosphocholine) was not altered by the reduction in capsule. In contrast, a change in the type of capsule expressed (from type 2 to type 3) altered the general accessibility of surface antigens, the amount of C3 deposited, and the binding of specific antibodies to PspA, teichoic acids, and phosphocholine.

Thus, the type of capsule expressed appears to be the major determining factor in accessibility of pneumococcal surface antigens.

Mouse infections. Virulence was assessed in 8 to 12 week old BALB/cByJ and CBA/N female mice (Jackson Laboratories, Bar Harbor, ME). Bacteria were grown to 3 x 108 CFU/ml in THY, serially diluted in lactated Ringer's solution, and injected either intraperitoneally (i. p.) or intravenously (i. v.) in a volume of 0.2 ml. Mice were subsequently monitored for 21 days.

Complement depletion was accomplished by i. p. injection of 12.5 units of cobra venom factor (Quidel Corp., San Diego, CA) 5 to 8 h prior to infection. Consistent with previous reports showing near undetectable levels of C3 by 4 h post treatment and sustained reductions for up to 4 days, C3 levels were reduced to <3% of initial levels 4 h after cobra venom factor injection.

Antibody binding and complement fixation assays.

Antibody binding to the bacterial surface was examined in indirect enzyme-linked immunosorbent assays (ELISA). Cultures, grown to 3 x 108 CFU/ml in THY, were heat killed for 20 min at 65°C and then pelleted by centrifugation (14,000 x g, 20 min). The cells were suspended in the original culture volume of phosphate- buffered saline (PBS) (140 mM NaCl, 3 mM KCI, 5 mM Na2HP04,2 mM KH2PO4, pH 7.4) and all samples were adjusted to the same OD600. Duplicate columns of a Falcon flexible microtiter plate (Fisher Scientific, Pittsburgh, PA) were coated with 50 gui of the cell suspension and incubated overnight at 4°C. Plates were washed 3 times with 0.05% Tween-20 in PBS (PBST) and then blocked with 1% bovine serum albumin (BSA) in PBS for 1 h.

Polyclonal antiserum or tissue culture supernatants containing monoclonal antibodies (MAbs) were two-fold serially diluted down each column. The starting dilutions were 1/5000 for

polyclonal antisera and 1/10 for MAbs. Plates were incubated for 45 min, washed 3 times with PBST and then incubated with both a goat a-rabbit (or a-mouse for MAbs) biotin conjugate and a strepavidin-alkaline phosphatase conjugate (Fisher Scientific) a t dilutions of 1: 1000 and 1: 2500, respectively. Plates were washed, developed with p-nitrophenyl phosphate (Sigma), and read at OD415. Except as noted, all incubations were at room temp.

Binding is expressed relative to that of JD611, a non-encapsulated type 3 derivative. Results are the mean SEM for 3 independent cultures of each strain. The a-C-polysaccharide (teichoic acid), a- type 19-specific, and a-type 23-specific polyclonal antisera were obtained from Statens Serum Institut (Copenhagen, Denmark).

MAbs specific for phosphocholine (PC, 140.1C2) and PspA (2A4) were kindly provided by David Briles (University of Alabama at Birmingham). Type 3 capsule was measured using the MAb 16. 3.

Quantitation of the amount of capsule produced by WU2 a n d JY1060 gave results comparable to those obtained using an inhibition ELISA and a dye-binding assay. The methods are thus comparable, and the amount of capsule does not affect binding of the bacteria to the microtiter assay plate (data not shown).

Complement fixation was determined using the method of Gordon et al., with some modification. Cells were grown to 3 x 108 CFU/ml in THY, pelleted by centrifugation, washed in one-half the original culture volume with Gelatin Veronal Buffer (GVB: 0.1% gelatin, 1.8 mM sodium barbital and 3.1 mM barbituric acid, pH 7.4; Sigma) and resuspended in 180 ul GVB per 1 ml of original culture. Each sample was divided in half and mixed with 10 pl of either pooled mouse serum or heat inactivated (56°C, 3 0

min) mouse serum. Following incubation at 37°C for 30 min, samples were centrifuged and washed 3 times with an equal volume of PBS. Duplicate wells of microtiter plates were coated with 50 pl/well of washed cells and plates were incubated overnight at 4°C. All subsequent incubations were done at room temp. The plates were washed 3 times with PBST, blocked with 1% BSA/PBS for 1 h, incubated with a 1/500 dilution of goat a- mouse C3 conjugated to horse radish peroxidase (ICN Pharmaceuticals, Inc., Aurora, OH) in 1% BSA/PBS for 1 h, washed 3 times with PBST, developed with ABTS (2,2'-Azino-di- (3-ethyl- benz-thiazoline-sulfonic acid)) substrate, and read at OD415. A C3 standard curve was generated using the normal mouse serum amyloid P component standard from Calbiochem-Novabiochem Corp. (La Jolla, Calif.). Values for the S. pneumoniae samples were normalized to CFU/ml, which were determined at each step of the procedure. Results are expressed as the mean SEM from 5 replicates and were compared using the unpaired Student t-test.

RESULTS Virulence of JY1060 in Immunologically Normal Mice.

To examine the effect of reduced PGM and capsule production on virulence, BALB/cByJ mice were infected with either the type 3 WU2 parent or the JY1060 mutant. As shown in Fig. 16, virulence by both the intraperitoneal (i. p.) and intravenous (i. v.) routes was significantly reduced in the mutant strain. Repair of the JY 1060 pgm mutation restores parental levels of capsule production.

Likewise, virulence was restored in the repaired mutant (Fig. 16, GH5088). Mutants GH4531 and GH4533, in which pgm is insertionally inactivated, produce less than 10% of the parental

level of capsule and exhibit severe growth defects during laboratory culture. They, too, were significantly reduced in virulence (88% [7/8] survival at a dose of 2 x 104 cfu i. p.; P = 0.019 vs. WU2 at a dose of 103).

Blood Clearance and Binding by Complement and Antibodies to Surface Antigens. Following i. v. infection, JY1060 was rapidly cleared from the bloodstream and, by 20 h, was not detectable (Fig. 17). Consistent with this result, in vitro complement fixation assays using BALB/cByJ mouse serum as a source of complement indicated a six-fold higher level of detectable, cell-bound C3 in the JY1060 mutant, relative to its type 3 parent (mean SEM = 0.25 0.074 vs. 0.038 0.013 fg C3/CFU; P = 0.022). For both JY1060 and the type 3 parent, decomplementation of BALB/cByJ with cobra venom factor prior to infection reduced the numbers of bacteria required for lethal i. v. infection (Fig. 18). Even in the absence of complement, however, the mutant was not restored to the parental level of virulence (compare the 105 doses in Fig. 18).

To determine whether interaction with factors other than complement was altered in the mutant, the ability of antibodies to bind surface components was tested. As a measure of general surface exposure, serotyping antiserum reactive with capsule type 19 strains was used in indirect ELISA experiments.

Because whole cells are used as immunogens for generating these antisera, and because the type 19 polysaccharide itself is weakly immunogenic, the majority of antibodies in these sera are reactive with non-capsular surface components. As shown in Fig. 19, high levels of antibody bound to the non-encapsulated type 3

derivative (JD611), whereas the presence of the type 3 capsule largely blocked this binding. Reduced capsule expression in JY1060 resulted in a significant increase in antibody binding, as compared to the type 3 parent. In contrast, both JY1060 and the type 3 parent bound reduced levels of monoclonal antibodies specific for the cell surface components PspA and phosphocholine (PC), as well as a polyclonal antiserum to C-polysaccharide (teichoic acid) (Fig. 19).

Virulence in immunodeficient mice. CBA/N mice express the X-linked immunodeficient (Xid) phenotype and, consequently, respond poorly to polysaccharides antigens, including the capsular polysaccharides and PC components of the S. pneumoniae cell surface. Due in part to the lack of innate antibodies to PC, CBA/N mice are highly susceptible to infections with S. pneumoniae. In contrast to the results obtained with the immunologically normal BALB/cByJ mice, the lethality of JY1060 in CBA/N mice was not significantly different from that observed with WU2. Median times to death were, however, extended for the mutant following both i. v. and i. p infection (Fig. 20). Levels of detectable, surface-bound C3 in in vitro assays using CBA/N serum were identical to those reported above using BALB/cByJ serum, i. e., approximately six-fold more C3 was detected on the surface of the mutant.

Virulence of JY1060 suppressor mutants. Infection of BALB/cByJ mice with JY1060 at a dose of approximately 107 by either the i. p. or i. v. route resulted in death of a small number of animals (Fig. 16,18 and data not shown). Isolation of bacteria from these animals yielded both large and small colonies that

appeared intermediate in size between JY1060 and its WU2 parent. It was previously found that second site suppressor mutations, at least some of which were located outside pgm, could restore capsule production to levels intermediate between that of JY1060 and WU2. In subsequent i. p. infections, the virulence of two phenotypic variants obtained from mice that died following i. p. infection (GH5000 and GH5001) and two of the previously characterized suppressor mutants (GH5087 and GH5088) were tested. Each of the suppressor mutants, except GH5000, produced an amount of capsule intermediate between that of JY1060 and WU2 (Table 9). The amount of capsule produced by GH5000 was not significantly different from that produced by JY1060 (Table 9). Nonetheless, the virulence of GH5000 was, like the other suppressor mutants, increased over that observed with JY1060.

At doses of 5 x 103 to 5 x 104, an overall survival of 29% (n = 14) was observed with the suppressor mutants, whereas 100% survival (n = 11) was observed for JY1060-infected mice in this dose range (P = 0.0005; compare Fig. 16 and Fig. 21). The full level of parental virulence was not restored, however, as 3 of the 4 suppressor mutants exhibited longer median times to death than did the parent, even at a 10-fold higher inoculum (Fig. 21).

TABLE 9 Capsule production Stra Capsule'PC p % ina (n) (WU (JY106 WU 2) 0) 2 wu 47. 8-<0. 000 100 2 1.2 (9) 1 JY1 9.6 1.2 <0.0-2 0 060 (9) 001 GH5 34.4 # #0. 0 <0.000 7 2 087 1.4 (5) 001 1 GH5 22 0.5 <0.0 0.0013 46 089 (2) 001 GH5 10.6 # #0. 0 n. s. 2 2 000 0.45 (2) 001 GH5 40.1 # 0. 02 <0.000 84 001 2.9 (2) 4 1 a Capsule production by WU2, JY1060, GH5087, and GH5089 has previously been reported. b Values are the mean amounts of capsule per milliliter standard error. Numbers in parentheses are the number of independent samples tested. Values were determined for washed cells using the Stains-All assay and are expressed relative to the optical density at 600 nm of the starting culture. P values were determined by comparison to WU2 or JY1060, as indicated, using a two-tailed, unpaired t-test.

The present studies provide the basis for understanding the genetic mechanisms involved in expression of the capsular polysaccharides of S. pneumoniae. As the major

virulence factor of this organism, the capsule serves as a potential target for both vaccines and antibiotics. Understanding the basis of its expression may permit the development of rational drugs and vaccines. The studies to understand the effect of capsule type in virulence will also shed light on the potential impact of capsule type on the efficacy of vaccines directed towards non-capsular antigens.

The mutant strain of S. pneumoniae disclosed in the present studies can potentially be used to colonize humans, thereby providing a means for eliciting immunity to either naturally expressed native pneumococcal antigens or pneumococcal antigens that are cloned and overexpressed in the vaccine strain. Heterologous antigens, from other bacteria or viruses, for example, could also be overexpressed in the strain, allowing it to be used as a delivery vehicle for other immunogens.

The vaccine strain may not be fully attenuated, in that there is a possibility that systemic injection of the strain could result in infection. This limitation can be readily overcome by the introduction of a mutation that eliminates growth in the bloodstream.

The following references were cited herein.

1. Alloing, et al., 1994, J. Mol. Biol. 241: 44-58.

2. Altschul, et al., 1990, J. Mol. Biol. 215: 403-410.

3. Aoyama, et al., 1994, Mol. Biol. Evol. 11: 829-838.

4. Arrecubieta, et al., 1996, J. Bacteriol. 178: 2971-2974.

5. Arrecubieta, et al., 1995, Gene. 167: 1-7.

6. Arrecubieta, et al., 1994, J. Bacteriol. 176: 6375-6383.

7. Arrecubieta, et al., 1996, J. Exp. Med. 184: 449-455.

8. Austrian, et al., 1959, J. Exp. Med. 110: 585-602.

9. Austrian, R. A. 1952. Johns Hopkins Hosp. 91: 189-196.

10. Ausubel, et al., 1987. Current Protocols in Molecular Biology. John Wiley & Son, New York.

11. Avery, et al., 1931, J. Exp. Med. 54: 73-89.

12. Avery, et al., 1944, J. Exp. Med. 79: 137-158.

13. Becker, et al., 1995, Mol. Microbiol. 16: 191-203.

14. Bernheimer, et al., 1967, J. Bacteriol. 93: 320-333.

15. Bernheimer, et al., 1969, J. Bacteriol. 98: 1073-1079.

16. Bik, et al., 1995, EMBO J. 14: 209-216.

17. Birnboim, et al., 1979, Nucl. Acids Res. 7: 1513-1523.

18. Briles, et al., 1992, Infect. Immun. 60: 111-116.

19. Briles, et al., 1981, J. Exp. Med. 153: 694-705.

20. Dai, et al., 1992, J. Biol. Chem. 267: 6322-6337.

21. Dawson, et al., 1931, J. Exp. Med. 54: 681-699.

22. Derbise, et al., 1994, Plasmid. 31: 251-263.

23. Dillard, et al., 1995, Dev. Biol. Stand. 85: 261-265.

24. Dillard, et al., 1995, J. Exp. Med. 181: 973-983.

25. Dillard, et al., 1994, Mol. Microbiol. 12: 959-972.

26. Ephrussi-Taylor, H. 1951. Cold Spr. Harb. Symp. Quant. Biol.

16:445-456.

27. Fath, et al., 1993, Microbiol. Rev. 57: 995-1017.

28. Garcia, et al., 1993, Mol. Gen. Genet. 239: 188-195.

29. Genetics Computer Group. 1991. Program Manual for the m Package, Version 8 ed.

30. Gray, B. M. 1979. J. Immunol. Methods. 28: 187-192.

31. Griffith, F. 1928. J. Hygiene. 27: 113-159.

32. Guidolin, et al., 1994, Infect. Immun. 62: 5384-5396.

33. Henrichsen, J. 1995. J. Clin. Microbiol. 33: 2759-2762.

34. Hostetter, M. K. 1986. J. Infect. Dis. 153: 682-693.

35. Hotchkiss, R. D. 1957. Methods Enzymol. 3: 692-696.

3 6. Johansen, et al., 1992, Plasmid. 27: 200-206.

37. Kelly, et al., 1994, Infect. Immun. 62: 1813-1819.

38. Kolkman, et al., 1996, J. Bacteriol. 178: 3736-3741.

39. Koplin, et al., 1992, J. Bacteriol. 174: 191-199.

40. Kruse, et al., 1891, Ztschr. f. Hyg. u. Infektionskr. 11: 279- 280.

41. Lacks, et al., 1986, Cell. 46: 993-1000.

42. Langvad-Nielson. 1944. Acta. Path. et Microbiol. Scand.

21: 362-369.

43. MacLeod, et al., 1945, J. Exp. Med. 82: 445-465.

44. MacLeod, et al., 1956, J. Exp. Med. 97: 767-771.

45. MacLeod, et al., 1950, J. Exp. Med. 92: 1-9.

46. McDaniel, et al., 1992, Microb. Pathog. 13: 261-269.

47. Pearce, et al., 1994, Mol. Microbiol. 12: 881-892.

48. Radloff, et al., 1967, Proc. Natl. Acad. Sci. USA. 57: 1514- 1521.

49. Ravin, A. W. 1960. Genetics. 45: 1387-1403.

50. Ravin, A. W. 1959. J. Bacteriol. 77: 296-309.

51. Ray, et al., 1983, J. Biol. Chem. 258: 9166-9174.

52. Sandlin, et al., 1994, J. Bacteriol. 176: 2930-2937.

53. Shaw, W. V. 1975. Meth. Enzymol. 43: 737-755.

54. Shoemaker, et al., 1974, Mol. Gen. Genet. 128: 283-290.

55. Stryker, L. M. 1916. J. Exp. Med. 24: 49-68.

56. Tao, et al., 1992, Gene. 120: 105-110.

57. Tham, et al., 1993, J. Bacteriol. 175: 5281-5285.

58. Tilghman, et al., 1977, Proc. Natl. Acad. Sci. USA. 74: 4406- 4410.

59. van Dam, et al., 1990, Antonie van Leeuwenhoek. 58: 1-47.

60. Walter, et al., 1941, J. Immunol. 41: 279.

61. White, B. 1938. The biology of pneumococcus. The Commonwealth Fund, New York.

62. Wood, et al., 1949, J. Exp. Med. 90: 85-96.

63. Xiang, et al., 1994, J. Bacteriol. 176: 4357-4365.

64. Yother, et al., 1992, J. Bacteriol. 174: 601-609.

65. Yother, et al., 1982, Infect. Immun. 36: 184-188.

66. Yother, et al., 1992, J. Bacteriol. 174: 610-618.

67. Yother, et al., 1986, J. Bacteriol. 168: 1463-1465.

68. Zee, et al., 1993, J. Bacteriol. 175: 141-147.

69. Zhou, et al., 1995, Plasmid. 33: 127-138.

70. The Institute for Genomic Research. 1999.

71. Joshi, 1982, Methods Enzymol. 89: 599-605.

72. Hawley, et al., 1983, Nucleic Acids Res. 11: 2237-2255.

73. Lin, et al., 1986, J. Biol. Chem. 261: 264-274.

74. Caimano, et al., 1998, Microbial Drug Resist. 4: 11-23.

75. Munoz, et al., 1997, Mol. Microbiol. 25: 79-92.

76. Adhya, et al., 1971, J. Bacteriol. 108: 621-626.

77. Smith, et al., 1959, J. Gen. Microbiol. 20: 654-669.

Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. These patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present examples along with the methods, procedures, treatments, molecules, and specific compounds described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims.