AND USES THEREOF

Technical field The present invention related to surface functionalized cellulosic fibres, as well as methods of manufacture for such fibres, product in which comprise such fibre and uses/methods related to the use of such fibres.

Background to the invention

Since the first production of paper sheets from cellulosic plant fibres centuries ago, paper- based materials continue to be harnessed in a growing number of applications, motivated, in part, by a low cost, high strength-to-weight ratio, and inherent resource renewability. Beyond traditional uses as a substrate for writing and the graphic arts, paper and

paperboard are used widely in advanced technical areas such as food packaging, barrier applications (e.g., disposable protective clothing, masks, and sheeting), and filtration. With an eye toward value-added applications, increasing attention is now being focused on the development of "bioactive paper," i.e., advanced, cellulose-based functional materials that have the capacity to bind, detect, and/or deactivate biological substances, ranging from small molecules, proteins, carbohydrates, and nucleic acids, to whole organisms such as fungi, bacteria and viruses. Indeed, there is a diversity of potential uses for bioactive papers, including environmental remediation, security applications, "smart" (i.e., indicator) packaging, pathogen filters, and, not least, medical diagnostics.

A key advantage of cellulosic paper over competing substrates such as glass or

petrochemical-derived plastics (beyond weight or environmental concerns) is the intrinsic porosity of the sheet structure, which facilitates chromatographic separations and inexpensive microfluidics devices based on capillary flow. The functionality of paper-based diagnostics can be further elaborated by printing, coating, or impregnation technologies, as well as covalent chemical modification. As such, paper-based assay platforms have been available since the mid-twentieth century; perhaps the most well-known example of which is the pregnancy test stick, an immunochromatographic assay based upon a lateral-flow device. Recent times have however witnessed a resurgence in the development of paper- based assays, using paper either as a separation medium or as a sample capture and transport medium in "dipstick" analyses. Nonetheless, the development of paper-based diagnostic tests, which are at the same time simple, affordable, sensitive, specific, rapid, and robust remains a major challenge in many application areas. In particular, the last decade has witnessed a significant increase in interest for new and improved deoxyribonucleic acid (DNA)-based diagnostic tests, and there presently exists significant scope to further expand the use of cellulose-based paper substrates for the specific capture and detection of DNA originating from clinical or forensic samples. DNA- functionalized glass surfaces have traditionally been powerful tools for the hybridization- based isolation, detection, and analysis of specific DNA sequences. However, hour-long hybridization times and detection methods requiring expensive and bulky equipment have imposed limitations on the broad commercial application of glass-supported DNA assays, especially in field diagnostics, including those in resource-poor regions.

Brumer H et al. {J. Am. Chem. Soc, 126, 5715-5721 (2004)) and Zhou Q. et al.

(Macromolecules, 38, 3547-3549 (2005)) disclose a chemoenzymatic approach for the efficient incorporation of chemical functionality onto cellulose surfaces by using a transglycosylating enzyme, xyloglucan endotranglycosylase, to join chemically modified xyloglucan oligosaccharides to xyloglucan, which has a naturally high affinity to cellulose. A publication by Mangalam A et al (Biomacromolecules 10(3), 497-504; 2009) contains a summary of known linkers and reactions for coupling DNA to cellulose in the section entitled "DNA/Cellulose Reactions".

Thus, it is an object of the invention to provide surface-functionalized cellulosic fibres bearing a functional group, which may e.g. be a biological molecule (such as DNA) or a functional group useful in further modification. An additional object is provision of materials comprising such fibres.

It is a further object of the invention to provide a facile method of surface functionalizing cellulosic fibres e.g. with DNA.

It is yet another object of the invention to provide a rapid analytical method utilizing the surface-functionalized cellulosic fibres. Brief description of figures

Figure 1. Schematic illustration of the methodology of activation of cellulose surfaces with PDITC for DNA immobilization and subsequent rapid hybridization with complementary DNA target. Three types of cellulose surfaces were evaluated: filter paper, filter paper with XG and filter paper with amino-functionalized XG. (a) PDITC surface functionalization (b) Amino- modified ssDNA probes immobilization (c) Hybridization with complementary Cy3-labeled ssDNA.

Figure 2. A. Image of fluorescently labeled filter paper surfaces after hybridization, analyzed with FujiFilm luminescent Image Analyser. All papers shown above were reacted with 15.6 mM PDITC either in DMF or DMSO: a) FP/PDITC in DMF; b) FP/PDITC in DMSO; c) FP/XG- PDITC in DMF; d) FP/XG-PDITC in DMSO; e) FP/XG-NH ₂ -PDITC in DMF; f) FP/XG-NH ₂ -PDITC in DMSO; B. Cartoon representation of the filter paper spotting.

Figure 3. The illustration shows the fluorescence intensity as a function of PDITC

concentration in DMF or DMSO of all activated surfaces. The surfaces without PDITC immobilization (FP, FP/XG and FP/XG-NH ₂ ) showed a fluorescence intensity of zero. A.U. means arbitrary unit.

Figure 4. Sample detection using activated filter papers with FP/XG-NH ₂ a. Schematic of the robotically printed detection array. The immobilized oligonuleotides are complementary to (Tl) Dog Mitochondrial amplicon, (T2) Dog Genomic amplicon, (T3) Human Mitochondrial amplicon and (T4) HumanGenomic amplicon. (neg) is a negative control and (SI) is complementary to the positive control probe PS_1. b. Fluorescent detection of Cy3-labeled hybridized ssDNA sample. For visualization, a cutoff was set according to the mean signal of the maximum recorded background. A fluorescence of zero meant there was no recorded signal. Sample ssDNA matches its complementary surface probe correctly, c. Graphs depicting the signal intensities from the four detected samples shows that intensities are similar among the samples and the corresponding positive controls (PTC) and that the background signal from the negative control (NTC) and unspecific hybridization to surface probes are minimal. Figure 5. Overview of sample preparation through PCR and strand separation. The forward primer is coupled to a Cy3 label, and the reverse primer is fused with a sequence ID-tag (T_l to T_4 respectively), and coupled to a biotin moiety. During strand separation the

biotinylated PCR product is bound to streptavidin-coated paramagnetic beads. The Cy3- labeled forward strand is eluted with NaOH and used for downstream detection.

Figure 6. Standard curve for ninhydrin-assay using amino-functionalized xyloglucan (XG-NH ₂ ).

Figure 7. Binding isotherm of amino-functionalized xyloglucan (XG-NH ₂ ) onto cellulose.

Definitions

In the context of the present disclosure, the following terms are to be interpreted to have the meanings given below.

The term polynucleotide is to be interpreted broadly as any polymer comprising nucleosides capable of specific hybridization with a polynucleotide with a natural (phosphodiester) backbone. In particular, the term encompasses polynucleotides with phosphodiester backbones, polynucleotides with phosphorothioate backbones, peptide nucleic acids (PNAs) and locked nucleic acids (LNAs). The term encompasses polynucleotides comprising naturally occurring bases adenine, thymine, cytosine, guanine and uracil but also

polynucleotides comprising one base analogue, polynucleotides comprising more than one base analogue, and polynucleotides comprising solely base analogues.

The term hybridization means a specific binding interaction between two polynucleotides. In this context specific has the meaning that the interaction is dependent on the degree of sequence complementarity between the two interacting polynucleotides. It is well known in the field that the specificity of the interaction depends on the temperature, the length of the interacting polynucleotides, the sequence (e.g. CG-content) of the interacting

polynucleotides, the degree of sequence complementarity between the interacting polynucleotides, type of polynucleotide, components of the medium in which the

polynucleotides interact (such as salt content and crowding agents), the concentration of the interacting polynucleotides as well as many other factors. Thus, based on common general knowledge in the field, the skilled person can by mere routine experimentation devise suitable combination of conditions for the hybridization such that the

polynucleotides of interest will specifically hybridize to each other but will not hybridize to other targets to an interfering degree for the purpose(s) of the analysis being performed. Preferably, hybridization in the context of the present invention is such that it is specific in stringent conditions.

Summary of the invention

In a first aspect, there is provided a surface-functionalized cellulosic fibre, characterized in that it comprises a group according to formula (A) below:

Cellulosic fibre

Y = NH or O

Formula (A).

The surface-functionalized cellulosic fibre may be characterized in that it comprises a functional group denoted X covalently linked to a cellulose molecule as depicted in formula (I):

Cellulose— O

Formula (I).

The surface functionalized cellulosic fibre may comprise a xyloglucan molecule bound to a cellulose molecule.

The xyloglucan molecule may comprise a functional group X covalently linked to it as depicted in formula (III): s

NH- glucan— γ

Y = NH or O

Formula

The functional group X may comprise a moiety suitable for covalent coupling or non- covalent binding of polynucleotides or functionalized polynucleotides. The moiety may comprise an amine-reactive moiety. The moiety may preferably be an isothiocyanate gro an isocyanate group, an epoxide group, an acrylate group, an acrylamide group, an N- hydroxysuccinimidyl ester group or an imidoester group.

The functional group X may be as depicted in formula (II):

Formula (II).

The functional group X may comprise a polynucleotide. The functional group X may be non- covalently bound to a polynucleotide. The polynucleotide may be a single-stranded DNA molecule. Preferably, the fibre comprises at least 1 μg polynucleotide per gram of total dry weight.

In a second aspect there is provided a porous material, comprising a surface functionalized cellulosic fibre according to the first aspect. The porous material may be hydrophilic.

In a third aspect, there is provided a paper comprising a surface functionalized cellulosic fibre according to the first aspect. The paper may be a filter paper sheet. In a fourth aspect there is provided a method of surface-functionalizing cellulosic fibre, comprising the step of contacting a cellulosic fibre with a bifunctional reagent comprising a isothiocyanate group and a second functional group denoted X, under such conditions that the isothiocyanate group reacts with the OH-groups of the cellulose comprised in the fibre, thereby forming a modified cellulose molecule as depicted in formula (I):

Cellulose

Formula (I). The cellulosic fibre of the fourth aspect may comprise a xyloglucan molecule bound to a cellulose molecule. The xyloglucan molecule is amine-functionalized.

The functional group X may comprise a moiety suitable for covalent coupling or non- covalent binding of polynucleotides or functionalized polynucleotides. The moiety may comprise an amine-reactive moiety. The moiety may preferably be an isothiocyanate group, an isocyanate group, an epoxide group, an acrylate group, an acrylamide group, an N- hydroxysuccinimidyl ester group or an imidoester group.

The bifunctional reagent may be 1,4-phenylenediisothiocyanate (PDITC) present in a solvent.

The solvent may be dimethylformamide (DM F) or dimethyl sulfoxide (DMSO).

The PDITC may be present in a solvent at a concentration of 1-500 mM, preferably 2-10 mM . Preferably, the bifunctional reagent comprises PDITC dissolved in DMSO at a concentration of about 5 mM.

The method of the fourth aspect may comprise the further step of covalently coupling or non-covalently binding a polynucleotide to the functionalized cellulosic fibre. Preferably, the second functional group is amine-reactive and the polynucleotide is amine-functionalized. The polynucleotide may be a single-stranded DNA molecule.

I n a fifth aspect, there is provided a surface-functionalized cellulosic fibre obtainable by the method according to the fourth aspect.

I n a sixth aspect, there is provided a use of a surface-functionalized cellulosic fibre, porous material or paper according to the first, second, third or fifth aspects in an analytical, diagnostic or forensic method.

I n a seventh aspect, there is provided a method for analysis of a polynucleotide analyte via hybridization to an immobilized capture polynucleotide, comprising the steps of: a) providing a hydrophilic porous material comprising surface-functionalized cellulosic fibres according to the first aspect, wherein the fibres are

functionalized such that at least a first portion of the material comprises a target polynucleotide capable of hybridization with the analyte;

b) providing a liquid test sample comprising a single-stranded polynucleotide

analyte labelled with a detectable label;

c) contacting said porous material with said test sample such that the liquid is dispersed in the porous material by capillary action, whereby the analyte has opportunity to hybridise with the target polynucleotide;

d) optionally, washing the porous material to remove unbound analyte to increase signal to noise-ratio; and

e) detecting the presence of the detectable label on the first portion of the porous material.

The analyte may be labelled by way of amplification in a PCR reaction using a labelled primer. A primer used in said PCR reaction may comprise a sequence which can be used for hybridization with the target polynucleotide, or a complementary sequence thereof.

The detectable label is preferably biotin or a fluorescent label.

The biotin label is preferably detected (in step e) by using beads or particles comprising avidin or streptavidin on the surface. The duration of step c) is preferably less than 10 minutes. The analyte concentration is preferably less than 1 μΜ. The porous material of the seventh aspect is preferably filter paper.

Detailed description

In the development of alternatives to silicate glass for the production of DNA biosensors, a variety of materials, including latex beads, polystyrene, carbon, gold, and oxidized silicon, has been explored. Nonetheless, traditional paper - macroporous sheets produced by the rapid filtration of individual, native cellulose fibres from herbaceous plants or wood - continues to evoke interest as a substrate for DNA diagnostics, due to unique material properties. The inventors were able to adapt well-established and straightforward chemistry, traditionally used for glass surfaces, to activate cellulosic fibres in paper e.g. for coupling with aminated DNA. The gentle activation conditions maintained the porous sheet structure (with no visible morphology changes whatsoever), which was essential for subsequent capillary action-driven sample hybridization. Equally vital, sufficient reactivity to yield high signal-to-background ratios was simultaneously obtained. The concerted design of an array of probes with unique ID-tag sequences make the printed arrays broadly applicable to any DNA sample by the straightforward incorporation of an ID- tag sequences into the PCR primers used in sample amplification. Here, the concept was demonstrated with a four-plex differentiation of human and dog mitochondrial and genomic DNA; higher-order multiplexing can be readily achieved. As such, diverse diagnostic and detection applications can be readily envisaged, in which the paper substrate confers certain advantages such as in terms of ease-of-transport and disposability.

As a prelude to the elaboration of paper-based DNA diagnostics, covalent attachment is essential to overcome the inherent low affinity between polynucleotides and cellulose. Carbodiimide-mediated coupling between these biomolecules has been reported as early as the 1960's. Since then, DNA sequences have been coupled to micro- and nanocrystalline cellulose, non-woven cellulose fabric, and regenerated cellulose (cellulose II allomorph), using a diversity of methods, including epichlorohydrin- and bis-epoxide-mediated coupling, reductive amination, photocrosslinking, and cellulose-binding DNA aptamers. In contrast, silicate glass surfaces, e.g. microscope slides, are typically activated toward coupling with amino-modified DNA via initial reaction with an aminoalkyltrialkoxysilane, such as 3- aminopropyltriethoxysilane (APTES), to install surface amino groups, followed by treatment with the amine-reactive, homobifunctional linker 1,4-phenylenediisothiocyanate (PDITC).

Surface-functionalized cellulosic fibre and materials comprising said fibre Earlier work in the inventor's laboratory established that reducing-end derivatives of the water-soluble, plant cell wall polysaccharide xyloglucan (XG) could be utilized to deliver reactive amino groups to paper surfaces for subsequent functionalization by harnessing the unique, essentially irreversible, sorption of XG on cellulose. A key advantage of this approach is that cellulose surface amination occurs under gentle conditions (shaking in aqueous solution at room temperature), which maintain fibre and sheet structures. Thus, the inventors envisioned that PDITC-based cross-linking chemistry, widely employed for glass supports, could be transferred to porous filter paper as a matrix for aminated ssDNA probe immobilization, following initial activation with amino-xyloglucan (XG-NH ₂ ).

Surprisingly however, the results indicated that unmodified cellulose could be directly modified with PDITC. This observation lead to the realization that essentially any functional group could be covalently coupled to cellulose using isothiocyanate chemistry without need of prior modification of the cellulose (although it is to be noted that prior modification is not excluded).

In a first aspect, the present invention provides a surface-functionalized cellulosic fibre characterized in that it comprises a group as depicted in formula (A) below:

Cellulosic fibre

Y = NH or O

Formula (A).

Such cellulosic fibre may be obtained by way of the teachings contained herein. The modifying group may be coupled to cellulose molecules and/or to xyloglucan molecules bound to the cellulose molecules.

The surface-functionalized cellulosic fibre may be characterized in that it comprises a functional group denoted X covalently linked to a cellulose molecule as depicted in formula (I):

Cellulose-— O Formula (I)

The product shown in formula (I) may be achieved by reacting a bi-functional reagent comprising an isothiocyanate group and a second functional group X with cellulose, by guidance of the teachings herein. An example of a suitable bi-functional reagent is PDITC. The cellulosic fibre may optionally comprise a xyloglucan molecule bound to it. The xyloglucan molecule may comprise a functional group X covalently linked to it as depicted in formula (III)

Xyloglucan

Y = NH or O Formula

A further illustration of the modified cellulose molecule of formula (I) is depicted in the formula (la) below.

Formula (la)

Formulas (IV) and (V) further illustrate the modified xyloglucan molecules of formula (III). Formula (IV) exemplifies amine-modified xyloglucan and formula (V) exemplifies unmodified xyloglucan having been modified in the manner of the invention.

Formula (IV)

Formula (V)

It is to be understood that formulas (la), (IV) and (V) are provided for illustration only and not to be interpreted literally or to be limiting. In particular, some of the R-groups may have additional alternative structures different from the ones given, such as in cases where the cellulose or xyloglucan is further modified in some additional manner not subject of the present invention. Similarly, the formulas (la), (IV) and (V) are not to be taken to imply that each repeating unit depicted in the parenthesis is identical to each other with regard to the R-groups and their placement. The groups denoted R merely illustrate potential positions for a modification according to the invention.

The linkage of formula (III) where Y = NH may be accomplished by reacting an

isothiocyanate reagent (such as 1,4-phenylenediisothiocyanate, PDITC) with the amino group of amine-modified xyloglucan, by guidance of the teachings herein.

The linkage of formula (III) where Y = 0 may be accomplished by reacting an isothiocyanate reagent (such as PDITC) with OH-groups of xyloglucan, by guidance of the teachings herein.

The surface-functionalized cellulosic fibre of formula (A) comprising xyloglucan according to formula (III) can also be obtained by a method comprising a first step of coupling the functional group X to xyloglucan or amine-modified xyloglucan using an isothiocyanate reagent and a second step of contacting the thus obtained modified xyloglucan according to formula (III) with a cellulosic fibre under suitable conditions, whereby the xyloglucan binds to the cellulose comprised in the fibre.

The functional group X may comprise a moiety suitable for covalent coupling or non- covalent binding of polynucleotides or functionalized polynucleotides, such as aminated polynucleotides. Said moiety may comprise an amine-reactive moiety, such as an isothiocyanate group. The moiety may preferably be an isothiocyanate group, an isocyanate group, an epoxide group, an acrylate group, an acrylamide group, an N-hydroxysuccinimidyl ester group or an imidoester group. For instance, such functional group can be

accomplished by reacting cellulose (or xyloglucan) with PDITC. The resulting functional group X after said reaction is shown in formula (II):

Formula (II)

Since the moiety of formula (II) is readily reactive with amines, any amine-containing molecule of interest may be readily covalently coupled to the cellulose or xyloglucan functionalised in this way. A preferred example of an amine-containing molecule of interest is an aminated polynucleotide.

Preferably, the functional group X comprises a polynucleotide which may be bound covalently or non-covalently. For instance, the functional group X may comprise streptavidin, whereby a biotinylated polynucleotide may readily be bound to the functional group in a non-covalent manner. Preferably, said polynucleotide is single-stranded, which allows for a plurality of applications based on hybridization. Said polynucleotide may have natural phosphodiester bonds or other bonds forming the backbone and may comprise base analogues (see Definitions). Most preferably, said polynucleotide is a DNA molecule.

The surface-functionalized fibre may comprise at least 1 μg polynucleotide per gram of total dry weight, more preferably at least 5 μg per gram, even more preferably at least 10 μg per gram, yet more preferably at least 15 μg per gram, still more preferably at least 50 μg per gram and most preferably at least 100 μg per gram. In preferred embodiments the fibre may comprise polynucleotide in a range formed by any combination of the above amounts, such as 1-100 μg per gram, 5-100 μg per gram, 5-50 μg per gram, 10- 50 μg per gram, 15-100 μg per gram, or 50-100 μg per gram.

In a second aspect, the present invention discloses porous material comprising a surface functionalized cellulosic fibre of the first aspect. Said porous material may be hydrophilic. Preferably, the porous hydrophilic material is such that it enables efficient capillary transport of aqueous liquids.

In a third aspect, the present invention discloses paper comprising a surface functionalized cellulosic fibre of the first aspect. Said paper may be filter paper, such as a filter paper sheet.

Method of surface-functionalizing cellulosic fibre In a fourth aspect, the present invention discloses a method of surface-functionalizing cellulosic fibre, comprising the step of contacting a cellulosic fibre with a bifunctional reagent comprising a isothiocyanate group and a second functional group denoted X, under such conditions that the isothiocyanate group reacts with the OH-groups of the cellulose comprised in the fibre, thereby forming a modified cellulose molecule as depicted in formula (I):

Cellulose— O

Formula (I)

Said cellulosic fibre may comprise xyloglucan molecules bound to cellulose molecules. The xyloglucan molecules may be amine-functionalized, in which case the isothiocyanate groups would also react with the amine groups of the functionalized xyloglucan molecules, yielding modified xyloglucan of formula (III) where Y = NH.

Additionally, the isothiocyanate group would react with the OH-groups of the xyloglucan yielding modified xyloglucan of formula (III) where Y = O. The same applies also when the xyloglucans are not amine-modified. Alternatively, a surface-functionalized cellulosic fibre comprising xyloglucan according to formula (III) can also be obtained by a method comprising a first step of contacting a xyloglucan or amine-modified xyloglucan with a bifunctional reagent comprising an isothiocyanate group and a second functional group denoted X, under such conditions that the isothiocyanate group reacts with the OH-groups of the xyloglucan and/or amine-groups of the amine-modified xyloglucan, and a second step of contacting the thus obtained modified xyloglucan (according to formula (III)) with a cellulosic fibre, whereby the xyloglucan binds to the cellulosic fibre. However, the resulting product of said alternative method would not comprise modified cellulose fibres according to formula (I).

The functional group X may comprise a moiety suitable for covalent coupling or non- covalent binding of polynucleotides or functionalized polynucleotides. For instance, said moiety may comprise an amine-reactive moiety, such as an isothiocyanate group. The moiety may preferably be an isothiocyanate group, an isocyanate group, an epoxide group, an acrylate group, an acrylamide group, an N-hydroxysuccinimidyl ester group or an imidoester group. Such groups, such as isothiocyanate groups, can then readily be used to covalently couple any amine-containing molecules, such as aminated polynucleotides, to the cellulose or the xyloglucan and thereby the cellulosic fibre. For non-covalent binding, the functional group may comprise streptavidin, which can then readily be used to non-covalently bind any biotin-containing molecules, such as biotinylated polynucleotides to the cellulose.

Said bifunctional reagent may be PDITC, in which case the reacting step takes place in a solvent which is preferably DMF or DMSO. The PDITC may be present in the solvent at a concentration of 1-500 mM, more preferably 2-10 mM.

For example, the reagent PDITC may be dissolved in DMSO at a concentration of about 5 mM (e.g. 2-10 mM).

The method may comprise the further step of covalently coupling or non-covalently binding a polynucleotide to the functionalized cellulosic fibre. Preferably, if the further step is performed, the second functional group is amine-reactive and the polynucleotide is amine-functionalized. Said polynucleotide is preferably single- stranded, such as single-stranded DNA. Alternatively, a double stranded polynucleotide may be coupled or bound, optionally followed by separation of the strands.

In a fifth aspect, disclosed is a surface-functionalized cellulosic fibre obtainable by the method according to the fourth aspect. Methods of use for a surface-functionalized cellulosic fibre

In a sixth aspect, the present invention discloses a use of a surface-functionalized cellulosic fibre, porous material or paper according to the first, second, third or fifth aspects aspect in an analytical, diagnostic or forensic method.

In a seventh aspect, the present invention discloses a method for analysis of a

polynucleotide analyte via rapid hybridization to an immobilized target polynucleotide, comprising the steps of: a) providing a hydrophilic porous material comprising surface-functionalized

cellulosic fibres according to the first aspect, wherein the fibres are

functionalized such that at least a first portion of the material comprises a target polynucleotide capable of hybridization with the analyte, preferably in stringent conditions;

b) providing a liquid test sample comprising a single-stranded polynucleotide

analyte labelled with a detectable label;

c) contacting said porous material with said test sample such that the liquid is dispersed in the porous material by capillary action, whereby the analyte has opportunity to hybridise with the target polynucleotide;

d) optionally, washing the porous material to remove unbound analyte to increase signal to noise-ratio; and

e) detecting the presence of the detectable label on the first portion of the porous material.

The analyte may be labelled by way of having undergone amplification in a PCR reaction using a labelled primer. At least one of the primers used in the PCR reaction may preferably comprise a sequence which can be used for hybridization with the target polynucleotide, or a complementary sequence thereof

Said detectable label may preferably be a fluorescent marker such as Cy3 or FITC, an enzymatic marker, a dye marker, biotin, a particle or a bead, more preferably biotin or a fluorescent marker. Said particle or bead is preferably dyed or otherwise visible. Preferably, the biotin label is detected by using coloured beads or particles comprising avidin or streptavidin on the surface. An example of such a detection method is disclosed in PCT/EP2010/069617.

Preferably, the duration of step c) is less than 30 minutes, more preferably less than 10 minutes, even more preferably less than 5 minutes, most preferably less than 30 seconds.

Preferably, the analyte concentration is less than 1 μΜ, more preferably less than 200 nM, most preferably less than 30 nM.

The porous material is preferably filter paper.

The following examples are not to be seen as limiting. All references are hereby

incorporated in their entirety.

Examples

For the practical details concerning the examples below, the reader is directed to consult a separate section titled Materials and Methods below.

Example 1: Modification of cellulose surface chemistry followed by covalent

immobilization of aminated ssDNA

Whatman No.l filter paper was selected as a matrix due to low non-specific biomolecule adsorption, good aqueous flow characteristics, cost-effectiveness, and ready availability. Filter papers bearing XG-NH ₂ , as well as control sheets bearing unmodified XG of the same molar mass, were initially prepared by adsorption over 24h at room temperature under orbital agitation. An adsorption isotherm using a ninhydrin assay for primary amino groups indicated that saturation of the paper surface with XG-NH ₂ was achieved at addition levels of 250 mg XG-NH ₂ per gram of filter paper (24 h adsorption, Figures 5 and 6). For subsequent modification, an addition level 50 mg XG-NH ₂ per gram of filter paper (5% w/w) was selected to economize the use of the polysaccharide reagent. The reaction of PDITC with aminoalkylsilane-modified glass surfaces is typically performed in organic solvents such as DMF or dichloromethane. Due to the highly polar, hydrophilic nature of the filter paper surfaces, the inventors were interested to explore polar solvents for PDITC activation of cellulose and XG-modified cellulose. PDITC is, however, practically insoluble in water, thus, filter papers bearing XG-NH ₂ (FP/XG-NH ₂ ), unfunctionalized XG (FP/XG), and control filter papers (FP) were immersed and orbitally shaken in solutions of PDITC of increasing concentration up to 500 mM in Ν,Ν-dimethylformamide (DMF) or 250 mM in dimethylsulfoxide (DMSO). Subsequent array spotting of aminated ssDNA by hand pipetting, capping of unreacted surface thiocyanate groups with ethanolamine, and hybridization with a fluorescently (Cy3) labeled complementary strand under capillary flow conditions allowed the relative immobilization capacity of these papers to be quantified under functional assay conditions. Optimized washing steps were derived from those used for glass microarrays to minimize background signal. Figure 2 shows a representative set of paper strips produced by varying the surface preparation and solvent conditions. As highlighted by Figure 2, signal is clearly visible above the background in all cases, and the cross-reaction between the target and a second sequence probe immobilized on the surface is undetectable. Figure 3 summarizes the quantitative data similarly obtained for range of PDITC concentrations in different solvents (DMSO and DMF).

The presence of surface-bound amino groups from XG-NH ₂ did not appear to dramatically enhance PDITC activation of the papers, except at the lowest concentrations of PDITC in DMF and DMSO. Rather, the solvent appeared to be the biggest factor affecting the relative capacity of the papers, with the more polar DMSO proving to be significantly more effective than DMF. Unfortunately, solubility limitations of PDITC in DMSO restricted the working range, and apparently limited the activation of the papers, at the highest concentration (or more correctly, mixture compostion) tested, 250 mM. Preliminary experiments using fluorescein isothiocyanate (FITC) as a model compound indicated that addition of the amine bases triethylamine (TEA) or pyridine (1% v/v) to either solvent did not improve the surface coupling efficiency (data not shown). Briefly, the PDITC reaction in DMF and DMSO was performed by addition of TEA or Pyr, after which the filter papers were reacted with FITC. Any free amino groups present on the filter paper (after the PDITC functionalization) are expected to react with FITC giving a yellow colour to the paper. By measuring the intensity of the yellow is was possible to evaluate the amount of free amino groups left after the PDITC functionalization, and consequently the efficiency of the PDITC activation on FP.

Based upon these results, the activation of FP/XG-NH ₂ with 5 mM PDITC in DMSO was selected for all subsequent analyses. Importantly, although the pre-addition of aminated xyloglucan (XG-NH ₂ ) conferred a slight improvement in coupling efficiency/detection sensitivity and allowed reduced PDITC consumption, the bis-isothiocyanate was clearly not only reactive with the surface-bound amino groups, but also with hydroxyl groups present on cellulose. It may, therefore, be adventitious to activate paper directly with higher concentrations of PDITC when scaling-up the method for eventual application (Figure 3). In addition, a preliminary study with Whatman RC55 regenerated cellulose membranes

(catalog reference 10410212) was performed to evaluate the performance of these readily available surfaces for DNA hybridization and detection. The results showed that regenerated cellulose membranes are deformed by repeated wetting/drying cycles occurring during chemical treatment and washing, and, further, are not capable of effective capillary wicking due to the lack of a porous structure. Example 2: Application of ssDNA-functionalized paper for sample discrimination

With an optimized surface chemistry at hand, a diagnostic application of the DNA-bearing filter papers was developed. Using robotic nanoplotter printing, originally developed for printing of microarrays on microscopic glass slides, the inventors created an array of six distinct features, comprised of five different oligonucleotide probes and one negative control, in which only buffer was printed. One of the oligonucleotides was identical to the positive control used in the optimization of surface chemistry (S_l), while the other four (T_l, T_2, T_3, and T_4) each included a unique ID-tag sequence generated using in-house developed software. The use of generic ID tags allows the generation of a versatile diagnostic array, the specificity of which is determined by the design of PCR primers used for target amplification from essentially any sample type. Full probe sequences are provided in Table SI, and their positions on the array are given in Figure 4a.

PCR primers against four unique targets in dog mitochondrial DNA, dog genomic DNA, human mitochondrial DNA and human genomic DNA, respectively, were generated with unique ID-tag sequences from the surface-attached oligonucleotide probes included in each of the reverse primers (Table S2). Each primer pair was designed with a biotin-labeled reverse primer and a Cy3-labeled forward primer. Following PCR amplification and biotin- mediated capture on streptavidin-coated magnetic beads, strand separation at high pH allowed the facile isolation of the Cy3-labeled single stranded product for hybridization to the paper-based array.

After sample transport by capillary action, a signal from the positive control and one of the unique ID-tag oligos is expected (Figure 4a). Figure 4b shows the results after detection with each of the four amplicon samples on independent paper chips. Integrated signal intensities were comparable for similar amounts of sample, as shown in Figure 4c.

Together, these data illustrate the use of activated filter papers for the rapid detection of DNA samples in a variety of applications, which is driven by the intrinsic capillary transport properties of the cellulosic fibre matrix. The hybridization step, in particular, is

exceptionally rapid, due to the high rate of flow of sample DNA across the surface-bound oligonucleotide probes. Thus, a traditionally rate-limiting step in DNA-based diagnostics was removed. Materials and methods

Chemicals and substrates

Ν,Ν-dimethylformamide (DMF) and dimethylsulfoxide (DMSO) were purchased from Sigma- Aldrich and dried over 4 A molecular sieves for at least 24 h prior to use. Ultrapure water (18ΜΩΐΐη) was obtained from a Milli-Q. purification system (Milipore) and was used in all experiments. 1,4-Phenylenediisothiocyanate 98% (PDITC) was obtained from Sigma-Aldrich. Whatman filter paper sheets (7.5x10cm) grade 1 (CAT no. 1001-824) were used as a cellulose surface for ssDNA array production and Whatman filter paper disks (0=lcm) grade 1 (CAT no. 1001-6508) were used the binding isotherm determinations. Xyloglucan (XG, _w 4345 Da, _w / _n 1.2) and amine-functionalized xyloglucan (XG-NH ₂ , ¹⁹ synthesized from the aforementioned XG by reductive amination) was obtained from SweTree Technologies (Stockholm, Sweden).

Preparation of activated surfaces

Binding isotherms of XG-NH _? on cellulose. Whatman No. 1 filter paper disks (0 1 cm, total mass 14 mg) were immersed in 700 μί of an aqueous solution containing 0.11, 0.22, 0.43, 0.87, 1.75, 3.5 and 7 mg of XG-NH ₂ in glass vials and incubated at room temperature with orbital shaking for 24h. The amount of XG- NH ₂ adsorbed onto cellulose was measured by a ninhydrin assay. ²⁰ The amount of XG-NH ₂ in solution (after equilibrium) was calculated from a standard curve with XG-NH ₂ solutions of increasing concentrations (Figure 5). The amount of bound XG-NH ₂ was then calculated by reduction of the amount of XG-NH ₂ in solution from the amount of XG-NH ₂ added to the vial

(XGsorbed = XGadded ^" XGsolution, Figure 6).

Preparative adsorption of XG and XG-NH _? onto filter paper.

Whatman No. 1 filter paper sheets (7.5x10cm, total mass 630 mg) were each cut in half lengthwise immersed in 32 mL of an aqueous solution of XG or XG-NH ₂ (32 mg) in a rectangular glass tray with a glass cover. The mixture was placed on an orbital shaker for 24 h at room temperature, after which time it was washed twice with water (2 x 60 mL) for 5 min and dried under a gentle stream of air. Under these conditions, 50% of the total amount of the XG-NH ₂ was sorbed into cellulose at this concentration (cf. Figure 6). Activation of filter paper with PDITC

Unmodified filter paper (FP), filter paper containing adsorbed XG-NH ₂ (FP/XG-NH ₂ ), and filter paper containing adsorbed non-functionalized XG (FP/XG) were immersed

independently in a series of solutions of PDITC, either in dry DMSO (250 mM - ImM) or dry DMF (500 mM - ImM), in a glass container (30 mL per sheet) and placed under orbital shaking for 12 h at room temperature, after which time the sheets were washed twice with DMSO or DMF and water (each with twice the volume of the PDITC solution) for 5 min and then dried under a gentle stream of air.

Oligonucleotide design Oligonucleotides for immobilization and detection were designed using software developed in-house, and ordered from the manufacturer (Sigma-Aldrich, St. Louis, USA & MWG, Ebersberg, Germany). Unique sequences for surface immobilized oligonucleotides T_l through T_4 (Table SI) were created through generating 30-mer randomized ID tag sequences and mapping against the human and dog genomes, and to each other. The top ranking sequences with maximum difference to each other and minimum cross-reactivity were selected. Sequences S_l, 0_2 and PS_1 (Table SI) were generated with less stringency and were used as test probes for surface chemistry optimization.

Table SI. Printed surface probes

Modification Spacer ID tag sequence

s_i 5'-Aminoterminal c6 UUAAGTACAATAAGGTTATGGCTCGGTTCGATTGTTGCG

GACGGTTGTTG polyT(30) (SEQ ID NO: 1)

0_2 5'-Aminoterminal c6 ATCTCGACTGCCACTCTGAAGCCTTATCATCGACACATCC polyT(20)VN (SEQ ID NO: 2)

T_l 5'-Aminoterminal c6 polyT(15) AAATTCTTAG GC G C C C ATAC GTTAG GTAC C (SEQ ID NO:

3)

T_2 5'-Aminoterminal c6 polyT(15) AAATTTCGTCTGCTATCGCGCTTCTGTACC (SEQ ID NO:

4)

T_3 5'-Aminoterminal c6 polyT(15) AAATTTGCCGACTCGCATAGGTCTGTGATA (SEQ ID NO:

5)

T_4 5'-Aminoterminal c6 polyT(15) AACAGCCGGAGAGTCTAGCGATCACCACAC (SEQ ID NO:

6)

Primers for PCR amplification of unique target sequences in dog mitochondrial DNA, dog genomic DNA, human mitochondrial DNA and human genomic DNA respectively were designed to incorporate ID tag sequences, which matched the surface probes, in the resulting amplicons (Table S2). Synthetic probe PS_1, was used as a positive control.

Table S2. PCR pri mers and synthetic detection probes

5'Modification ID tag sequence Primer sequence

DM_T1_FWD

(SEQ ID N0:7) i Cy3 GGTTTGCCCCATGCATATAAG

DM_T1_REV Biotin AAATTCTTAG GC G C C C ATAC GTTAG ATTACGAGCAAGGGTTGATGG

(SEQ ID NO: 8) GTACC

DG_T2_FWD

(SEQ ID NO:

10) Cy3 TGCCATTTCACCAACGGGAC

DG_T2_REV

(SEQ ID NO: AAATTTCGTCTGCTATCGCGCTTCT CCTCTGCTCCAAGATCTCCTTC

11) Biotin GTACC

HM_T3_FWD

(SEQ ID NO:

12) : Cy3 AGTC C C AGAG GTTAC C C AAG

HM_T3_REV

(SEQ ID NO: AAATTTGCCGACTCGCATAGGTCTG AGATTGAGAGAGTGAGGAGAA

13) Biotin ; TGATA G

HM_T4_FWD

(SEQ ID NO:

14) ; Cy3 GACTGCTCTTTTCACCCATC

HM_T4_REV

(SEQ ID NO: AACAGCCGGAGAGTCTAGCGATCA

15) Biotin CCACAC GGAGCTGCTGGTGCAGGG

PS_1

(SEQ ID NO:

16) Cy3 CAACAACCGTCCGCAACAAT

Array preparation DNA arrays were prepared on the surface of the activated filter paper chips through either manual or robotic printing.

Manual Printing

To analyze the optimization of surface chemistry for PDITC activation of filter papers (FP, FP/XG, and FP/XG-NH ₂ ), paper "chips" (0.8 cm x 1.2 cm) were cut from larger sheets. Two synthetic oligonucleotide probes were used (S_l and 0_2, Supplementary table 1) and an array pattern of three features per filter paper chip (see Figure 2B) was printed manually by pipetting a 0.1 μΙ solutions containing 20 μΜ of oligonucleotide probe in 50 mM sodium phosphate buffer, pH 8.5, for each of the probes. After spotting, the paper chips were stored in a humidification chamber at room temperature overnight. At this time, the chips were treated by submersion in a pre-warmed (50°C) "blocking" solution of 0.1 M TRIS and 50 mM ethanolamine, pH 9.0, to quench unreacted isothiocyanate groups. Chips were then washed sequentially with deionized water (3 x 2 mL, 2 min), a pre-warmed (50°C) solution of 4x saline-sodium citrate (SSC) buffer containing 0.1% sodium dodecylsulfate (2 mL, 30 min), and deionized water (3 x 2 mL, 2 min), followed by drying in air.

Robotic Printing

Arrays of oligonucleotide probes were printed with an array printer (Nano-PlotterTM NP2.1, GeSiM, Germany) on FP/XG-NH ₂ surfaces. A pattern of eight arrays per filter paper chip (7.5 x 2.5cm) was prepared by plotting a solution containing 20 μΜ oligonucleotide probe in 50mM sodium phosphate buffer, pH 8.5, respectively for each probe. Six features were included in each array, consisting of four oligonucleotide ID_tag probes (T_l through T_4), one positive control (S_l), and one negative control (buffer only) (Figure 4a). Following printing, chips were maintained in a humid atmosphere overnight, blocked with

ethanolamine, washed, and dried, according to the protocol described above for manually printed chips.

Preparation of sample DNA

DNA from canine blood samples and human blood samples had been previously extracted using a commercial DNA extraction kit (DNeasy, Qjagen, Carlsbad, CA, USA).

Amplification of target DNA Four pairs of primers were designed to target unique amplicons in dog mitochondrial DNA, dog genomic DNA, human mitochondrial DNA, and human genomic DNA, respectively. Primers were modified with biotin and Cy3 tags to allow processing into single stranded DNA products by magnetic bead capture and subsequent detection by fluorescence, respectively. Each 50μΙ PCR mixture contained 1U Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) , IX Platinum Taq PCR buffer (Invitrogen, Carlsbad, CA, USA), 0.2mM dNTPs, 1.5 mM MgCI ₂ , 200 nM each of a Cy3-labeled forward primer and a biotin-labeled reverse primer, and ΙμΙ extracted sample DNA. The reaction mixture was processed at 94°C for 5m; cycled 45 times through 94°C for 30 s, 58°C for 40 s, and 72°C for 60 s, and after the cyclic amplification final elongation step of 72°C for 10 min was performed.

Generation of single stranded DNA

10 μΙ of 1 μιη streptavidin-coated paramagnetic beads (MyOne CI, Dynal, Invitrogen, Carlsbad, CA, USA) were pipetted into a 1.5ml tube and put on a magnetic stand to remove the bead storage buffer. 3 pmol PCR product and an equal volume of 2x Bind and Wash buffer (lOmM Tris-HCI, ImM EDTA, 2M NaCI, ImM beta-mercaptoethanol, 0.1% Tween20, pH 7.5) was added to the beads and the final mixture was incubated at 50°C for 15 minutes with 10 seconds of mixing every 30 seconds at 300 rpm in a Thermomixer comfort

(Eppendorf, Hamburg, Germany). Double stranded amplicons were denatured using 11 μΙ 0.1 M NaOH to generate single-stranded DNA. The supernatant containing the eluted Cy3 labeled strand was kept and neutralized with 10.2 μΙ 0.1M HCI. lx Klenow Fragment reaction buffer (Fermentas, St. Leon-Rot, Germany) was added to the collected sample to a total volume of 30 μΙ. Hybridization by capillary transport

For surface chemistry optimization experiments, 25 ul of 0.5 pmol single-stranded PS_1 target (Table S2) in lx Klenow Fragment reaction buffer (Fermentas, St. Leon-Rot, Germany) was placed as a drop in the bottom of a Petri dish prior to capillary force hybridization. For experiments with ssDNA obtained from dog and human DNA, 0.5 pmol single stranded PS_1 probe was mixed with half of the sample collected after single strand generation to yield a final volume of 15.5 ul placed on the Petri dish. The respective filter paper chips were then contacted with each sample solution, which resulted in the vertical wicking of the solution through the paper matrix and, consequently, the printed probe arrays. Immediately as wicked fluid reached the top of the paper chip, it was removed from contact with the Petri dish and washed with 2xSSC containing 0.1% SDS at 55°C for 10 minutes in a Thermomixer Comfort Exchangeable MTP thermoblock (Eppendorf, Hamburg, Germany) with shaking at a speed of 300 rpm, followed by 5 min washing with 0.2xSSC buffer and 5 min washing with O.lx SSC buffer at room temperature. The filter paper chips were then air dried at room temperature in the dark. For experiments probing single-stranded DNA obtained from dog and human samples, the hybridization through capillary wicking and subsequent washing and drying steps were performed twice on the same chip. I n the second hybridization cycle, the PS_1

oligonuclotide was not added. Signal analysis

Following hybridization, the filter paper chips from the surface chemistry optimization were scanned in a Fujifilm Luminescent Image Analyzer and the signal intensity was measured using the associated software (Fujifilm, Tokyo, Japan). Filter papers used in the dog/human sample detection assays were scanned in a Tecan LS™ Series Laser Scanner (Tecan, Switzerland) and the images were analyzed using the GenePix 5.1 software (Molecular Devices Corporation, USA).