Description

This application is a definitive of provisional application Nos. US 62/187,014, filed June 30, 2015, all its contents are incorporated herein by reference.

Background of the invention

HABs are associated to an excessive proliferation of different types of microalgae naturally present in aquatic environments. The colloquial expression "red tide" refers to blooms where a certain microalgae types, either toxic or non-toxic, generate a red or brown color in ocean waters. Red tide related microalgae have been largely associated with the production of high levels of neurotoxins which are detrimental to human health

There are currently no methods that provide a fast and easy identification of seafood and water contaminated by red tide toxins, while remaining cost-effective. In the case of the invention's country of origin, Chile's Public Health Institute has made it clear in its many reports on the matter that there are currently no other ways of testing samples other than taking them to specialized laboratories distributed unevenly throughout the country. Other countries have similar difficulties, or have implemented expensive methods that have not solved the problem, for it is still necessary to invest in new equipment, laboratories and qualified scientists to perform the tests.

There are at least 28 countries gravely affected by red tide, including major markets such as the United States of America (USA) and Japan. Only in the USA, between the years 1987 and 2000, the average economic impact of red tide events was USD 75 million per year. However, individual events can have considerably bigger impacts, as was the case of the 1976 bloom on New York Bay, where the total aggregated impact reached USD 1.33 billion.

Moreover, it is estimated that the economic impact caused by red tide damage is of USD 82 million in average per year, out of which USD 38 million correspond to the fishing industry, USD 37 million to the healthcare and public health industry, USD 4 million to tourism and USD 3 million to associated monitoring costs. There is also an average of 1 ,600 registered cases of intoxication due to ingestion of contaminated seafood per year. At least 300 of said cases are fatal. In Europe, while the loss associated to the shellfish industry reaches USD 200 million per year, the tourism industry suffers a loss of approximately USD 1 billion. The cases of intoxication per year are 60,000 in average.

Another technical field that relates to the present invention's prior art are molecular techniques stemming from Synthetic Biology. This discipline can be defined as the application of engineering concepts and methodologies to biological applications. It allows the extraction of interchangeable parts of living systems so that they can be encapsulated and used as building blocks for new biological systems that may or may not be present in nature. These units or biological devices can thus be used to generate synthetic genetic circuits that give new functionalities to the host cell. The hierarchy present in synthetic biology is strongly inspired by the one found in digital systems, where the cell corresponds to a computer, and the metabolic pathways contained in different biological devices relate to logical gates found in software programming. In this analogy, each cell can be used as a biological computer, capable of analyzing its close environment or its own functions, and then add logical gates that will allow the biological entity to translate the information it has gathered to a possible user, mimicking a digital user interface. This is the base of the biosensors described in the present invention.

However, in prior art the concept of biosensor refers merely to a device capable of sensing a certain characteristic within a biological medium. This biosensor's functions are then limited to measuring physical and chemical changes which harbor a biological application. For the purpose of the present invention, the concept of biosensor is broadened and is understood as a device that results from the combination of biological or synthetic parts within a base biological or synthetic entity. The resulting device is capable, through the biological or synthetic parts therein contained, of receiving a certain input signal from its environment, processing this information and then providing a certain output related to it. This allows the device to provide certain analytical information, be it quantitative or qualitative about for example the presence, absence or concentration of a target metabolite that the device is capable of recognizing. The prior art already describes cell-based sensors for toxin detection such as US patent 5,420,01 1 , which relates to a cell bioassay for neurotoxins. The method described therein includes incubating a plurality of mouse neuroblastoma cells, which are responsive in a dose-dependent manner to sodium channel-activating toxins, with a medium comprising a solution of ouabain and veratridine, and a portion of the fluid sample to be analyzed. Following this, different additional stages are required to remove the medium and the fluid sample, and to incubate the cell cultures with an indicator which is acted upon by living cells to form a measurable product. The US patent method is different to the present invention because in addition to only treating higher mammalian cell cultures with the potentially toxin-containing medium, said method forcedly requires an additional stage with an indicator to obtain a response with a measureable product to the presence of the toxin. In contrast to this method, the present invention only requires any genetically modified cell or microorganism to contact the potentially toxin-containing medium, which can then provide a detection result within 24 hours.

Additionally, US patent application 20030108980 A1 refers to bioluminescent methods for direct visual detection of environmental compounds. This application relates to devices and methods that utilize immobilized bacteria that act as genetically modified bioreporters capable of emitting visible light to the naked eye in the presence of selected analytes. This patent application exemplifies one of its practical embodiments as an E. coli strain modified through the incorporation of a merRop/lux gene cassette into its genome. In contrast to this US patent application, the present invention is not limited to the detection of certain selected analytes. Moreover, the present invention incorporates metabolic routes and different stages to provide a response to the user.

While some companies such as Jellett and Abraxis have available in-situ detection assays in the market, the issue with those is that they are based on the use of antibodies and are therefore limited to a particular structural detection depending on the antibodies used, effectively limiting their reach. In particular, Jellett Rapid Testing, now Scotia Rapid Testing (www.iellett.ca). provides three commercial tests for three toxic groups: ASP, DSP and PSP. The tests are qualitative ('yes or no' response) and are based on immunoassay techniques, which allow them to recognize very specific conformations of toxin strands, therefore leading to a considerable amount of false negative results. The tests require three steps: preparing the sample (which usually entails grinding the mollusk tissue), preparing the extract (through a chemical extraction process, converting ground shellfish into a liquid form) and finally applying the test itself. The final stage takes between 35 minutes and 1 hour. These tests include a positive control, are single-use, have a shelf life of one year and may be stored between 4 and 25°C.

Conversely, Abraxis Kits (www.abraxiskits.com) provides ELISA-like tests for marine biotoxin testing. It is described as an enzyme-linked immunoabsorbent assay for the detection of PSP/DSP (+) in water and contaminated samples. It allows for both quantitative and qualitative detection. For meat testing, it requires extra preparation stages. The testing stage takes about an hour, and requires pipetting and other basic laboratory techniques. It produces a colored signal (blue) which is inversely proportional to the content of toxin in the sample. The color reaction must be stopped and evaluated using an ELISA plate reader, and the final concentration of the samples is determined by interpolating the data using a standard curve constructed with each run. This test must be used in temperatures between 10-30°C, stored in refrigerators (4-8°C) and the associated solutions must be at room temperature (20-25°C) before use.

In contrast to both Jellett and Abraxis, the method and biosensor system of the present invention are not based on a structural detection of the toxins or their toxic metabolites. Instead, they rely on the toxicological effect produced by said metabolites in at least one genetically modified cell. Given the concatenation of the stages of the method, the present invention allows the measurement of the toxicity itself as opposed to that of a specific toxin structure.

In summary, the inventors of the present invention, utilizing tools of synthetic biology, have designed and constructed a biosensor system comprising concatenated metabolic routes that confers to a number of microbial, neuronal or cardiovascular cell, among others the capacity to sense the amount of toxin present in its medium. This biosensor system later shows a response, signal or change that informs the presence or absence of marine toxins to the user. Brief description of the drawings

Figure 1. Illustrates a scheme of the three stages/routes that the system of the invention entails. These are (A) detection route (B) regulation or tuning route and (C) organoleptic route.

Figure 2. Illustrates a scheme of the minimum two stages/routes that the system of the invention entails. These are (A) detection route and (B) organoleptic route

Figure 3. Schematically illustrate the genetically modified microorganism/cells with each one of the tested plasmid vectors, (A) reporter gene under oxidative stress promotor (B) reporter gene under osmotic stress promotor and (C) reporter gene under cooper channel promoter.

Figure 4. Graphics show the fluorescence vs time on E. coli normalized for the amount of microorganism (optical density at 600 nm) for different plasmid vector constructs for sensing oxidative stress (oxyR, grxA), osmotic stress (osmC) and potassium flux (kck, trkA). For each promoter, three conditions were assessed; (a, d, g, j, m) 8 uL shot of toxic shellfish extract, (b, e, h, k, n) 2,6 uM shot of saxitoxin and (c, f, i, I, o) 5,2 uM shot of saxitoxin. Every treatment show was added at initial time unless indicated otherwise. Each series has a negative control, corresponding to the microorganism without any treatment.

Figure 5. Graphic shows the fluorescence vs time on E. coli normalized for the amount of microorganism (optical density at 600 nm) for different plasmid vector constructs for sensing oxidative stress (SodB; SodC; ahpC; katG; katE) that are tested with Saxitoxin, toxic extract and hydrogen peroxide as a positive control, showing reaction to all.

Figure 6. Graphic shows the fluorescence vs time on E. coli normalized for the amount of microorganism (optical density at 600 nm) for different plasmid vector constructs for sensing osmotic stress, oxidative stress and potasium flux (SodB; ahpC; katE; oxyR; katG; kch; trkA) working in tandem and treated with toxic shellfish extract (6A). Graphic shows the fluorescence vs time on E. coli normalized for the amount of microorganism (optical density at 600 nm) for at least two different plasmid vector constructs for sensing osmotic stress (osmB) and oxidative stress and potassium flux (grxA) (6B). The graphic has a negative control, corresponding to the microorganism without any treatment.

Figure 7. Graphic show luminescence production by Saccharomyces cerevisiae under exposition to toxic shellfish extract and pure saxitoxin. The plasmid contained in the S. cerevisiae has a luciferase gene regulated by copper inducible promoter (CUP1 ). Positive control was tested with the addition of 40 uM Cu++ to the media and negative control shows the basal expression of luciferase without addition of Cu++.

Detailed description of the invention

The present invention provides a product corresponding to a biosensor system based on at least one cell selected from neuronal or cardiovascular cell lines, among other eukaryote cells and microbial cells such as Escherichia coli, Saccharomyces cerevisiae, among other bacteria and yeasts, which are suitable to be genetically modified in a standardized manner, with vectors that have already been used for this purpose, and that can be found in prior art. For instance, such vectors can be selected from pGEM-T vector, pYES2.1/V5-His-TOPO®, Biobrick plasmid backbone, pUA66, pSal1 luc-skl, among others. This biosensor system is capable of detecting or sensing the presence of diverse toxins, independent of their source of origin or chemical nature.

The present invention utilizes the mode of action mechanism of the diverse toxins associated to red tide to indicate their presence or absence in a sample. This is achieved by an interaction between the marine toxin, selected from the group formed by saxitoxins, domoic acid, yessotoxins, okadoic acid, brevetoxins, azaspiracids, among others; and the genetically modified cell, which for the purposes of the present invention is also referred to as a biosensor. The following table summarizes some of the toxins that can be sensed through the method and product of the present invention, including their chemical nature, syndrome generated by its consumption in higher vertebrates, and the genus/species of algae of origin to date.

Family Type Syndrome Genus Specie(s)

Saxitoxins Hydrophilic Paralytic Alexandrium angustitabulatum, catanella, fundyense, lusitanicum, minutum, tamarense, tamiyavanichii

catenatum Gymnodinium bahamense

Pyrodinium

Domoic Acid Hydrophilic Amnesic Pseudo- australis, callianta, cuspidata,

nitzschia delicatissima, fraudulenta, galaxiae, multiseries, multistriata,

pseudodelicatissima, pungens, seriata, turgidula

Yessotoxins Lipophilic Undetermined Protoceratium Reticulatum

Lingulodinium polyhedrum

Gonyaulax polyhedra

Okadoic acid Lipophilic Diarrhetic Phalacroma Rotundatum

Prorocentrum arenarium, belizeanum, concavem, lima acuminata, actua

Dinophysis

Brevetoxins Lipophilic Neurotoxic Karenia caudate, fortii, mitra, norvegica, ovum,

Chatonella rotundat, sacculus, tripos

Azaspiracids Lipophilic Azaspiracid Azadinium Spinosum

Gymnodimines Lipophilic - Karenia Selliforme

Gymnodinium mikimotoi

Espirolides Lipophilic - Alexandrium ostenfeldii, peruvianum

Apart from providing a biosensor system, the present invention also refers to a method of detection which in general allows: (1 ) detection of the toxin, or some of its related metabolites, by the biosensor, (2) optionally, necessary amplification to obtain a measurement at the cellular level, and (3) organoleptic change. This last step is the final result-displaying effect resulting from applying the method of this invention.

In this regard, the method depicted by the present invention is simple, where in one embodiment the invention does not require additional steps to observe an organoleptic response that can be appreciated by the user. While in other embodiments, a pretreatment stage may be required within the method of the invention to achieve bioavailability, by liberating and solubilizing the toxin present in the sample. Alternatively, for the purposes of this invention, an organoleptic response/change can also mean a suitable result such as any data measurable by the user, with or without the assistance of additional means.

As illustrated in Figure 1 , the biosensor system of this invention consists of three distinct and consecutive stages that are:

(a) Detection stage: corresponds to one or several synthetic (i.e.: artificially, non-natural occurring) reactions introduced to the biosensor cell, which recognizes an exogenous molecule, identifying a characteristic metabolite or the particular effect thereof, that will serve to trigger the reaction. This stage determines the object to be sensed by the biosensor, optionally;

(b) Tuning stage: where the biosensor's sensitivity is regulated through repetition or interruption or one or multiple anchored reactions, both to regulate the input and output signal and the biosensor's internal detection threshold, and last;

(c) Organoleptic stage: where a determined organoleptic change is produced to transmit the information to the user interface system.

Moreover, as shown in Figure 2, in another embodiment of this invention, the biosensor system and method thereof can be performed in a simpler manner, said method consists in two consecutive stages that are:

(a) Detection stage: corresponds to one or several synthetic (i.e.: artificially, non-natural occurring) reactions introduced to the biosensor cell, which recognizes an exogenous molecule, which recognizes cellular effects caused by marine biotoxins. Again this stage determines the object to be sensed by the biosensor system; and

(b) Organoleptic stage: where a determined organoleptic change is produced to transmit the information to the user interface system.

In a preferred embodiment of the present invention the user interface can be but is not limited to: an isolated cell, a cell culture contained in an adequate matrix, a lyophilized cell culture, among others. In one embodiment, the present invention provides a biosensor system for detection of Paralytic Shellfish Poisoning (PSP) related toxins, which comprises:

a) a first component consisting of at least one genetically modified microorganism, that contains at least one DNA construct for sensing osmotic stress comprising a promoter sequence and a reporter gene;

b) a second component consisting of at least one genetically modified microorganism, that contains at least one DNA construct for sensing oxidative stress comprising a promoter sequence and a reporter gene;

wherein the genetically modified microorganisms, for sensing osmotic stress construct and oxidative stress reacts to the presence of PSP related toxins through expression of at least one reporter gene.

For purposes of this invention, work in tandem means that either one or both of a first and second biosensor system reacts with the presence of a one or more PSP biotoxins, so the user can determine its presence in less than 24 hours through an organoleptic response.

For purposes of this invention, the first component of the biosensor system having at least one DNA construct for sensing osmotic stress has a promoter sequence selected from osmB, spr, yehZ, osmE, osmC, among others. The selected promoter must be compatible with the host microorganism, in other words, the plasmid vector is designed to ensure transcription of the reporter gene

For purposes of this invention, the second component of the biosensor system having at least one DNA construct for sensing oxidative stress has a promoter sequence selected from: ygjG, ybgS, ybgS, tktB, lysR, talA, pdhR, dps, gadW, hdhA, gadB, tarn, psiF, sufl, narU, ycaC, rssA, yhhT, yncG, yncG, mscL, grxA, hdeD, osmE, yiaG, bolA, sip, wrbA, yjbJ, yjeB, chaB, oxyR, ompC, ahpC, ahpF, among others. The selected promoter must be compatible with the host microorganism, in other words, the plasmid vector is designed to ensure transcription of the reporter gene.

Also for the purposes of this invention, the biosensor system of claim 1 , first and second components having at least one DNA construct comprising a reporter gene selected from any luminescent, fluorescent or colorimetric protein, such as, eGFP, GFP, crtEBI, mCherry, luciferase, amilCP, among others.

Furthermore, in addition to the two-component biosensor system; for purposes of providing higher specificity in the detection of complete toxin extracts copper metabolism related promoters or proteins that bind specifically to a desired target, such as Saxiphilin for the case of Saxitoxin. In this case, the biosensor system optionally comprises a third component consisting of at least one genetically modified microorganism that contains at least one DNA construct for sensing cooper fluxes comprising a promoter sequence and a reporter gene. The promoter is selected from any prior art promoter related to cooper flux membrane protein, such as, Cup1 .

For the first embodiment of the invention, several metabolic pathways that might be affected by the presence of PSP related toxins are identified from a literature review and selected for construction of plasmid vectors. Any of the aforementioned promoters and reporter genes can be selected to construct a plasmid vector to transform the at least one microorganism. These targets genes, promoter and reporter, are chosen in a way their combined effects can allow for specific detection by having numerous sensors working in tandem based on different biological effects provoked by target toxins. Each one of the microorganisms of this embodiment present a detection route, an organoleptic route and optionally, a tuning route, all of them are artificially introduced in the cells. The targets explored for this embodiment correspond to oxidative stress related promoters such as oxyR and grxA; and osmolality-related gene osmC. Additionally, channel proteins such as cupl , and saxitoxin-specific Saxiphilin can be used additionally to determine specificity of the biosensor system.

After identifying the possible genetic parts that might serve as a detection route for the two- component biosensor system, bacterial and yeast cultures containing said parts are prepared for thorough examination. For the trial sensors, detection routes correspond to the addition of said genetic parts, and organoleptic routes correspond to the addition of a reporter gene.

Examples.

What follows is the methodology used in the construction of biosensors related to the present invention, in which certain promoters are activated when confronted with PSP related toxins and then express reporter genes accordingly.

Microorganism culture

Escherichia coli DH5a and JM109 were cultured in liquid LB media (NaCI 5g/L; yeast extract 5g/L; tryptone 10 g/L) at 37°C and stored in LB media with agar (NaCI 5g/L; yeast extract 5g/L; triptona 10 g/L; agar 15 g/L) for one month periods at a 4°C and with 15% glycerol at -80°C for periods longer than a month. Saccharomyces cerevisiae By4741 and By4742 cultures were cultured in YPD media (yeast extract 10 g/L; peptone 20 g/L; glucose 2%) and stored in YPD and 20% agar plates for monthly periods or in glycerol stock for longer periods.

Bacteria culture had already been transformed with resistance plasmids; the corresponding antibiotics ampicillin and kanamycin, added to the respective LB media. For yeast a selective media was used that did not contain the corresponding amino acid uracil or leucine (Yeast Nitrogen Base 1.72 g/L, NH4SO4 5 g/L; Drop out mix 0.94 g/L)

Plasmid construction

The plasmids used as vector backbones were pGEM-T vector (Promega), pYES2.1 /V5-His-TOPO® (ThermoFisher), Biobrick plasmid backbone (iGEM), pUA66 (Dharmacon E.coli promoter collection), pSaM luc-skl (P. Leskinen, M. Virta and M. Karp. One-step measurement of firefly luciferase activity in yeast. Yeast Functional Analysis Report. v20: 1 109-1 1 13). The selected reporter genes included amilCP, eGFP and luciferase. All DNA manipulations were performed according to standard techniques (Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbour Laboratory Press: New York.) complemented with synthetic biology techniques such as Gibson Assembly and through the use of commercial kits such as Promega pGEM®-T Easy Vector II for bacterial transformation, kit Frozen-EZ Yeast Transformation II for yeast transformation and In-Fusion Cloning kit.

The plasmids were constructed with Escherichia coli DH5a and JM109 as hosts. In order to evaluate the performance of a construct containing the desired insert, a colony PCR was conducted. For the case of yeast, the verification of the inclusion is proceeded by the transformation in By4741 and By4742.

The primer sequences used for the amplification of some of the promoters present in the embodiments of the invention described in this patent are as follows:

PROMOTER SEQ ID FORWARD PRIMER SEQ ID REVERSE PRIMER NAME NO. 5 ^' -» 6 ^' NO. 5 ^' -» 6 ^'

Cupl 1 ATTAAGCTCGCCCTTCCGT 9 CCAGCACCTGCTCCGGTCGAC

ACGCTAGTTAGAAAAAGA GATGACTTCTATATGATATTG CATTTTTGC CAC

SodB 2 CCGCTCGAGGCACAGGTC 10 CGGGATCCTGGTGCTTGCCGT

AGGAAATTCAA AGTGA

SodC 3 CCGCTCGAGTGCGACGTG 11 CGGGATCCATCCGTAAAGCGG

ACGAGGTT CACTG KatG 4 CCGCTCGAGAGCCGTGAA 12 CGGGATCCCATTTGCCAGTGG

GGAGTGAAAGA CTGTG

KatE 5 CCGCTCGAGCGTGCGTGG 13 CGGGATCCTTTCGCTTCGCTG

GACATAGC GAATC

OxyR 6 CCGCTCGAGAATCGTGCCT 14 CGGGATCCAGCCAATGCCACC

CGACAAGC AGGTA

GrxA 7 CCGCTCGAGCATCGCGTTC 15 CGGGATCCGAGTCGCTTACCG

ATTGCTCA ACAGCA

ahpA 8 CCGCTCGAGCTATCTCATC 16 CGGGATCCAAGGAGATGAGG

GCCAGCGG CCAGGG

If necessary, complete sequences for all promoters can be found in prior art libraries containing registry of biological parts such as those on IGE (http://parts.iqem.org/). Every single oligonucleotide or complete sequence, when it was necessary, was synthesized using services of I DT (http://www.idtdna.com/site).

Shellfish extraction

Shellfish contaminated with red tide toxins were taken from the southern coast of Chile and the following methodology was performed to extract the toxins. After blending and homogenization, 100 mL 0.1 N HCI was added per 100 g of shellfish pulp. The pH was adjusted to 3 with 0.1 N NaOH or 5N HCI and gently boiled at 70°C. The extract was centrifuged at 4,000 x g at 4 °C for 5 min; the supernatant was then concentrated to 1/10 of the initial volume at 70 ^S C. Proteins were precipitated by centrifuging at 4,000 x g for 10 min. Saturated ammonium sulfate was then added to the supernatant, agitated for 10 min and then centrifuged at 4,070 x g, 4 ^e C for 10 min. Then 100 μΙ of tricloroacetic acid (TCA) 30% (w/v) per mL of extract were added and agitated for 5 min and afterwards centrifuged at 25,200 x g for 10 min. To reduce the total fat content, 1 .6 mL of hexane/diethyl ether (97:3) per mL of the extract was added and agitated in vortex for 10 min. Two phases were separated with a separatory funnel and the lower phase was recovered and finally sterilized with 0.22 μιη filter.

Biosensor system testing

Every potential biosensor constructed was screened by exposure to different concentrations of Saxitoxin standard (NRC Canada) as well as toxic mollusk extract (Rubio, D.P., Roa, L.G., Soto, D.A., Velasquez, F.J., Gregorcic, N.A, Soto, J.A, Martinez, M.C., Kalergis, A.M., Vasquez, A.E., Purification and characterization of saxitoxin from Mytilus cilensis of southern Chile, Toxicon (2015), doi: 10.1016/j.toxicon.2015.09.045) and stimuli that garnered a positive response according to literature, such as H ₂ 0 ₂ and Cu. Depending on the reporter gene utilized in each specific biosensor, either a Perkin Elmer EnSpire microplate reader or a Promega Glomax luminometer was used to measure either fluorescence or luminiscence.

As show in series of Figure 4, the fluorescence vs time for E. coli microorganism normalized for the amount of cells (optical density at 600 nm) for different plasmid vector constructs bearing: sensing oxidative stress (oxyR, grxA), osmotic stress (osmC). For all these tests, in general a positive correlation is observed after the toxin shellfish extract and/or the saxitoxin (pure or in emulated saline medium - 0.6 M) is added. Potassium flux promoters (kck, trkA) were also tested in equivalent conditions, since it was presumed that type of flux might be affected by marine biotoxins. Only kch and not trkA construct when treated with complete toxin extract show higher fluorescence. Thus, the expert in the art can infer that no every single promoter for said particular physiological effect can be assessed for a biosensor system such as the one of the present invention. On the other hand, from Figure 4, each promoter oxyR, grxA, and osmC - in an independent manner - reacts with a variable range of higher fluorescence. For instance, osmC does not show a high fluorescence difference in respect to the negative control when treated with the complete toxic extract; however, a higher difference is noticed for saxitoxin doses directly. These effect is opposed to the fluorescence differences observed for instance with grxA. This is why the biosensor system of this invention requires at least said two components, sensing osmotic stress and sensing oxidative stress, working at the same time or in tandem.

Figure 5 shows several promoters of oxidative stress that are tested with Saxitoxin, toxic extract and hydrogen peroxide as a positive control, showing reaction to all. Despite the relatively low response to hydrogen peroxide on SodB and katG promoters, it is clear that each of this promoters are reacting to oxidative stress as it can be proved with the addition of hydrogen peroxide, thus, confirming that the toxic effect of the PSP toxins could lead to a oxidative stress on the cells, and also, that this response can be measured using reporter genes.

Figure 6a and 6b shows the combined effect on fluorescent reporter expression under several promoters working in tandem. It is noticed that fluorescence is higher compared to the negative control, for complete toxic extract and pure saxitoxin (at a higher concentration).

Figure 7 shows the relative units of luminescence that are released when a luciferase/luciferine reaction occurs in S. cerevisiae with and without copper. The graph also shows the effect of adding a toxic shellfish extract containing PSP related toxins or Saxitoxin standard to a culture before incubating with copper at 40uM. It is clear that adding the shellfish extract inhibits the entrance of copper ions to the cell, and the subsequent light emission is similar in shape to the negative control which was incubated without copper.

When the sample is incubated with Saxitoxin standard, a small diminishment of copper intake can be perceived through the amount of luminescence emitted at the beginning of the experiment. From this we can conclude that Saxitoxin and its derivatives are capable of binding to copper channel molecules present in the membrane of S. cerevisiae, thus blocking copper ions from entering the cell and making this a possible detection target for PSP related toxins.

Comparative example.

The biosensor system of this present invention was evaluated in relation to other techniques commercially available today. The results of these tests are demonstrated in the following table.

* From the analyzed parameters, 'Biological detection' refers to the capacity to detect biological toxicity in relation to, for example, the toxin structure or metabolite. The fact that the mouse bioassay meets these parameters is today, one of the main reasons why this method is maintained as a standard.