TAGGING OF PRODUCTS OF WOOD PROCESSING USING TRACER COMPOUNDS COMPRISING A

SYNTHETIC OLIGONUCLEOTIDE

FIELD OF THE INVENTION

The invention relates to the use of a tracer compound to label products of wood processing, including timber, engineered wood, wood pulp, and timber-derived biomass or biofuel, to ensure that such products are traceable back to source.

BACKGROUND TO THE INVENTION

It is key that forests continue to provide us with resources, keep our climate stable and conserve biodiversity. The WWF's Living Forest report predicts that future global demand for wood for timber, paper and energy could triple by 2050 from economic and population growth, particularly in the emerging markets. It is therefore more important than ever to protect our forests for future generations by ensuring that all timber is from legal, sustainable sources.

Although there are a variety of actions that contribute to the continued destruction of natural forests, illegal logging poses a significant threat to global resources and in short, buying timber from sustainably managed forests helps to keep forests standing. Sustainably managed forests not only ensure good environmental practices but that the rights and livelihoods of forest communities are respected and taken into account.

Committing to protect our forests for future generations requires a need for change in the timber market so that trade in non-sustainably-sourced timber is excluded. Not only does illegal logging undermine responsible forest management but cheap imports of illegal timber products also distort market pricing and investment prospects.

Certification of timber is a means of protecting forests by promoting legal, responsible, sustainable forestry practices. Two major international schemes oversee and promote development of forest certification; the Forest Stewardship Council (FSC) and the Programme for Endorsement of Forest Certification (PEFC). Both use Chain of Custody (CoC) certification which establishes a 'paper trail' as assurance to the end user that the timber comes from where it says it comes from and was not, for example, mixed up in the timber yard or deliberately substituted.

Whilst the Chain of Custody system attempts to provide a means of proving that the sourced timber is legal and sustainable, all too often the chain is broken by supply members who are not certified. This means there is no longer any guarantee about the origin of the timber. Notwithstanding this, as certification expands worldwide into regions known for high levels of corruption, the risk of fraud increases and the integrity of such schemes is called in to doubt.

SUMMARY OF THE INVENTION

The invention relates to the use of a synthetic oligonucleotide tracer to "tag" products of wood processing, including timber, engineered wood, wood pulp, and timber-derived biomass or biofuel, to ensure that such products are traceable back to source. In contrast to known schemes which certify the wood processing factory, the synthetic oligonucleotide tracer can be used to verify the source of the product at any point in the supply chain, thereby enabling procurers to have full confidence they are buying legally and sustainably produced products. The use of an oligonucleotide tracer to tag products of wood processing will advantageously help prevent illegal logging, mitigate the risk of continued destruction of our forests, improve supply chain controls and help suppliers demonstrate regulatory compliance. The synthetic tracer compound comprises an oligonucleotide which has the ability to provide a large number of unique, secure codes ("fingerprints") that can readily be decoded by the producer of the tag and generally by them alone. The tracer therefore has a unique signature which effectively adds a "fingerprint" to the product of wood processing, which can encode useful information about the tagged product such as the product's source and, for instance, the date of application of the tag. The tracer compound can then be recovered from the product at any point and decoded by the producer of the tag to verify the product' s source and any other useful encoded information such as, for instance, the date of application of the tag. If need be, the oligonucleotide can be modified with hydrophobic or hydrophilic groups, to ensure stability in hydrophobic or hydrophilic scenarios, and/or can be encapsulated for a greater level of protection of the tag in case of exposure to harsh conditions. The tracer meets all the requirements for an invisible, environmentally safe, secure, robust, recoverable and decipherable tag, which will allow enforcement agencies and other stake holders to verify the source of a forest-derived product at any point in the supply chain, identify products that have originated from legal and sustainable sources, and take action against any wrongdoers.

The tracer can be included in an ink with which a wood product can be marked, for example by inkjet printing. The ink may be visible ink, for instance black ink, or it can be "invisible" ink, for example fluorescent ink that is invisible unless illuminated by ultraviolet light. This allows for products of wood processing to be marked with information, such as text, a bar code, and/or a two-dimensional (2D) data matrix code in order to provide useful data about the product, as well as to mark the product with the tracer compound. The inventors have found that a very high quality, durable print can be achieved on rough, planed or finished timber using such an ink and on timber packaging materials such as plastic. In each case, the print can incorporate all four of text, a barcode, a 2D data matrix code and a covert DNA code in the form of the tracer compound. Either the product of wood processing itself, or packaging material containing one or more such products packaged therein, can be marked with the ink in this way. Marking can start in the forest, if desired. For instance a cross section, or a de-barked portion, of a felled tree trunk or log can be marked with text, a bar code or a two-dimensional data matrix code, and preferably all three, using handheld inkjet printer with ink containing the tracer compound. Further marking can then occur at the saw mill, if desired, and also during subsequent storage, transportation or distribution of the wood product, all the way through to the customer and retailer. For example, planks of timber produced at a sawmill can be marked by the ink during the processing of logs into sawn timber, using an industrial inkjet printer stationed on the production line. A mark can also be applied to packaged-up products of wood processing, e.g. using a handheld data gun. A "track and trace" system can thereby be implemented for products of wood processing, whereby the wood's origin and subsequent processing history, from forest to customer, can be identified by reading the information printed by the ink, e.g. in the text, barcode or 2D data matrix code, and/or by analysing the information encoded in the synthetic

oligonucleotide of the tracer compound.

Accordingly, the present invention provides a product of wood processing which comprises a tracer compound, wherein the tracer compound comprises a synthetic

oligonucleotide.

The oligonucleotide is often referred to herein as an "identifiable oligonucleotide" on the basis that it can readily be identified by performing standard techniques on the tracer compound such as, for instance qPCR (quantitative polymerase chain reaction) followed by sequencing. Generally, the identifiable oligonucleotide of the tracer compound comprises a sequence of nucleotides which represents particular information about the material that is labelled or tagged with the tracer compound. It typically identifies the material that is labelled or tagged with the tracer compound (in the case of the present invention, a product of wood processing, such as timber, wood pulp or timber-derived biomass or biofuel) as having a particular history or characteristic. This history or characteristic may be that the product of wood processing has originated from a legal and sustainable source, such as a sustainably managed forest. The invention further provides a product of wood processing which comprises a plurality of tracer compounds, wherein each tracer compound in the plurality comprises a synthetic oligonucleotide, and wherein the oligonucleotide of each tracer compound in the plurality comprises a different unique sequence of nucleotides.

Typically, each of the different unique sequences of nucleotides will represent different information. For instance, each of the different unique sequences of nucleotides may provide a different piece of information about the product of wood processing, be it timber or engineered wood, wood pulp, timber-derived biomass or biofuel. These may be different pieces of information about the history of the product in terms of its source and its whereabouts thereafter, e.g. that it is from a particular forest, has been processed at a particular timber mill. The tracer compounds may also provide information about the combining of differently-tagged products of wood processing. The plurality of tracer compounds may allow detailed information to be built up about the history of a particular product, for instance that it contains wood sourced from one, or more than one, particular forests, has been processed in a particular production facility, or more than one different production facilities, that the product contains different components from different batches or sources, or for instance that the product is contaminated with product from a different forest source or factory.

The invention additionally provides a packaged product of wood processing, which comprises (a) at least one product of wood processing, and (b) packaging material, wherein a surface of the packaging material is marked with an ink which comprises a tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide.

The invention further provides a composition which comprises: (a) a tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; and (b) a marker material comprising a detectable label. The composition may further comprise a solvent.

The invention also provides an ink for use in an inkjet printer, wherein the ink comprises a tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide.

The invention further provides an ink cartridge for use in an inkjet printer, wherein the ink cartridge contains at least one ink reservoir which contains an ink of the invention as defined above.

The invention also provides an inkjet printer comprising an ink cartridge of the invention as defined above. The inkjet printer may be a handheld, portable inkjet printer, for example a data gun, or it may be a stationary inkjet printer, for instance an industrial inkjet printer suitable for marking production line timber products.

The invention further provides the use of a tracer compound for labelling a product of wood processing, to enable identification of information about the product of wood processing, wherein the tracer compound comprises a synthetic oligonucleotide.

The invention also provides the use of a tracer compound to identify information about a product of wood processing, wherein the tracer compound comprises a synthetic oligonucleotide.

The tracer compound may for example be used to identify the product of wood processing as originating from a legal and sustainable source, for instance from a sustainably managed forest. Indeed, the identifiable oligonucleotide of the tracer compound typically comprises a sequence of nucleotides which represents such information about the product of wood processing.

The invention also provides a process for producing a product of wood processing which product of wood processing comprises a tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; which process comprises:

treating a product of wood processing with said tracer compound; or

producing a product of wood processing in the presence of said tracer compound.

The product of wood processing may comprise wood and the process may comprise printing an ink of the invention as defined above onto a surface of the wood.

The invention further provides a process for producing a packaged product of wood processing,

which packaged product of wood processing comprises (a) at least one product of wood processing, and (b) packaging material, wherein a surface of the packaging material is marked with an ink which comprises a tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide;

which process comprises:

printing an ink of the invention as defined above onto a surface of the packaging material.

The invention additionally provides a method of identifying information about a product of wood processing, which method comprises:

retrieving a tracer compound from a sample comprising a product of wood processing, which product of wood processing comprises said tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; and analysing the oligonucleotide of the tracer compound to determine the identity of the oligonucleotide.

The product of wood processing may comprise wood, a surface of which is marked with an ink which comprises the tracer compound. The wood surface may for instance be marked with text, a barcode or a data matrix code using the ink. The method of the invention may in that case further comprise reading the text, barcode or data matrix code, to obtain information about the product of wood processing.

The invention further provides a method of identifying information about a packaged product of wood processing of the invention as defined above, which method comprises: retrieving a tracer compound from a sample comprising the packaging material whose surface is marked with an ink comprising said tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; and

analysing the oligonucleotide of the tracer compound to determine the identity of the oligonucleotide.

The surface of the packaging material may be marked with text, a barcode or a data matrix code using the ink. The method of the invention may in that case further comprise reading said text, barcode or data matrix code to obtain information about the packaged product of wood processing.

The invention further provides a process for retrieving a tracer compound from a product of wood processing which comprises the tracer compound, which tracer compound comprises a synthetic oligonucleotide, which process comprises:

(a) obtaining a sample of the product of wood processing; and

(b) extracting the tracer compound from the sample.

The invention further provides a process for retrieving a tracer compound from a packaged product of wood processing of the invention as defined above, which process comprises:

(a) obtaining a sample of the packaging material whose surface is marked with an ink comprising said tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; and

(b) extracting the tracer compound from the sample.

The invention also provides a production line assembly which comprises (i) an inkjet printer of the invention, and (ii) a verification camera capable of reading an optical representation of data that is printed by the printer. The optical representation of data may for instance be text, a barcode or a two-dimensional data matrix code. The optical representation of data may comprise all three of these, i.e. text, a barcode and a two-dimensional data matrix code.

BRIEF DESCRIPTION OF THE FIGURES

Fig. 1 shows the structures of four of the seven 5 '-modified oligonucleotides that were evaluated as described in the Example hereinbelow, namely Zea02-C 12- Amino, Zea02- Stearyl, Zea02-Palmitate, and Zea02-Cholesterol-TEG, where Zea02 is the oligonucleotide of SEQ ID NO: 1.

Fig. 2 shows the structures of the other three of the seven 5 '-modified

oligonucleotides that were evaluated as described in the Example hereinbelow, namely Zea02-Cholesterol, Zea02-Tocopherol and Zea02-Octyl-Tocopherol.

Fig. 3 is a flow chart summarising a method of tagging a product of wood processing with a tracer compound, and subsequently inspecting a product of wood processing to determine if a tracer compound is present, determining the sequence of nucleic acid within the tracer compound, and then comparing that sequence with sequences in a tracer database in order to identify information about the source of the tagged product of wood processing.

Fig. 4 is a photograph of a timber plank printed with a mark containing text, a barcode and a two-dimensional data matrix code by thermal inkjet printing on a production line in accordance with Example 7, using ink containing a tracer compound comprising a synthetic oligonucleotide.

DESCRIPTION OF THE SEQUENCE LISTING

SEQ ID NO: 1 is the nucleotide sequence of the single stranded DNA molecule (oligonucleotide) employed in each of the 5 '-modified oligonucleotides described in the Example hereinbelow. The oligonucleotide was given the code name Zea02.

SEQ ID NO: 2 is the nucleotide sequence of the forward primer used in the quantitative polymerase chain reaction employed to amplify and detect the 5 '-modified oligonucleotides described in the Example hereinbelow.

SEQ ID NO: 3 is the nucleotide sequence of the reverse primer used in the quantitative polymerase chain reaction employed to amplify and detect the 5 '-modified oligonucleotides described in the Example hereinbelow.

SEQ ID NO: 4 is the nucleotide sequence of the minor groove binder (MGB) probe used in the quantitative polymerase chain reaction employed to amplify and detect the 5'- modified oligonucleotides described in the Example hereinbelow. DETAILED DESCRIPTION OF THE INVENTION

Chemical compound and substituent definitions

The term "hydrocarbon", as used herein, takes its normal meaning. Thus, unless it is explicitly said to be a "substituted hydrocarbon", a hydrocarbon is a compound which consists only of carbon and hydrogen. For the avoidance of doubt, hydrocarbons include straight-chained and branched, saturated and unsaturated aliphatic hydrocarbon compounds, including alkanes, alkenes, and alkynes, as well as saturated and unsaturated cyclic aliphatic hydrocarbon compounds, including cycloalkanes, cycloalkenes and cycloalkynes.

Hydrocarbons also include aromatic hydrocarbons, i.e. hydrocarbons comprising one or more aromatic rings. The aromatic rings may be monocyclic or polycyclic. Aliphatic

hydrocarbons which are substituted with one or more aromatic hydrocarbons, and aromatic hydrocarbons which are substituted with one or more aliphatic hydrocarbons, are also of course encompassed by the term "hydrocarbon" (such compounds consisting only of carbon and hydrogen) as are straight-chained or branched aliphatic hydrocarbons that are substituted with one or more cyclic aliphatic hydrocarbons, and cyclic aliphatic hydrocarbons that are substituted with one or more straight-chained or branched aliphatic hydrocarbons.

A "substituted hydrocarbon" is a hydrocarbon as defined above which bears one or more non-hydrocarbon substituents. The one or more non-hydrocarbon substituents may be selected from cyano, amino, nitro, Ci-io alkylamino, di(Ci-io)alkylamino, arylamino, diarylamino, aryl(Ci-io)alkylamino, amido, acylamido, hydroxy, oxo, halo, carboxy, ester, acyl, acyloxy, Ci-io alkoxy, aryloxy, halo(Ci-io)alkyl, sulfonic acid, thiol, Ci-io alkylthio, arylthio, sulfonyl, phosphoric acid, phosphate ester, phosphonic acid and phosphonate ester. Typically, the one or more non-hydrocarbon substituents are selected from cyano, amino, nitro, amido, acylamido, hydroxy, oxo, halo, carboxy, ester, acyl, acyloxy, sulfonic acid, thiol, sulfonyl, phosphoric acid, phosphate ester, phosphonic acid and phosphonate ester When a hydrocarbon is substituted, it may for instance bear from 1 to 20 non-hydrocarbon substituents, for example 1, 2, 3 or 4 non-hydrocarbon substituents. For instance, a substituted hydrocarbon may have 1, 2 or 3 non-hydrocarbon substituents, or for example 1 or 2 non-hydrocarbon substituents.

A "Cn-m hydrocarbon", where n and m are integers, is a hydrocarbon, as defined above, having from n to m carbon atoms. For instance, a Ci-iso hydrocarbon is a hydrocarbon as defined above which has from 1 to 150 carbon atoms, and a Cio-iso hydrocarbon is a hydrocarbon as defined above which has from 10 to 150 carbon atoms. A Ci-ioo hydrocarbon is a hydrocarbon as defined above which has from 1 to 100 carbon atoms, and a Cio-ioo hydrocarbon is a hydrocarbon as defined above which has from 10 to 100 carbon atoms. A Ci-50 hydrocarbon is a hydrocarbon as defined above which has from 1 to 50 carbon atoms, and a Cio-so hydrocarbon is a hydrocarbon as defined above which has from 10 to 50 carbon atoms. A Ci-io hydrocarbon is a hydrocarbon as defined above which has from 1 to 10 carbon atoms, and a Ci-4 hydrocarbon is a hydrocarbon as defined above which has from 1 to 4 carbon atoms.

The term "alkane", as used herein, refers to a linear or branched chain saturated hydrocarbon compound. A "Cn-m alkane" refers to an alkane having from n to m carbon atoms. Thus, for instance, an alkane may be a Ci-20 alkane, i.e. an alkane having from 1 to 20 carbon atoms, or for instance a Ci-10 alkane, i.e. an alkane having from 1 to 10 carbon atoms. It may for instance be a Ci-8 alkane, a Ci-6 alkane, a C1-5 alkane, or a Ci-4 alkane, or for instance a C2-20 alkane, a C2-10 alkane, a C2-8 alkane, a C2-6 alkane, a C2-5 alkane, a C2-4 alkane, or a C2-3 alkane. It is often a Ci-4 alkane, C1-3 alkane or C2-3 alkane in the present invention. Examples of smaller alkanes, e.g. of a Ci-10 alkane, are for instance, methane, ethane, propane, butane, isobutane, pentane, isopentane, hexane, methylpentane, dimethylbutane, heptane, methylhexane, dimethylpentane, octane, methylheptane, dimethylhexane, trimethylpentane, nonane, decane. The term "n-alkane" as used herein, refers to a straight chain alkane. The term "i-alkane" as used herein, refers to a branched chain alkane. Alkanes such as dimethylbutane may be one or more of the possible isomers of this compound. Thus, dimethylbutane includes 2,3-dimethybutane and 2,2-dimethylbutane. This also applies for all hydrocarbon compounds referred to herein including cycloalkane, alkene, cycloalkene.

The term "cycloalkane", as used herein, refers to a saturated cyclic aliphatic hydrocarbon compound. A "Cn-m cycloalkane" refers to a cycloalkane having from n to m carbon atoms. A cycloalkane may for instance be a C3-20 cycloalkane, a C3-10 cycloalkane, a C3-8 cycloalkane, or a C3-4 cycloalkane. Examples of a C3-8 cycloalkane include

cyclopropane, cyclobutane, cyclopentane, cyclohexane, methylcyclopentane, cycloheptane, methylcyclohexane, dimethylcyclopentane and cyclooctane. The terms "cycloalkane" and "naphthene" may be used interchangeably.

The term "alkene", as used herein, refers to a linear or branched chain hydrocarbon compound comprising one or more double bonds. A "Cn-m alkene" refers to an alkene having from n to m carbon atoms. Thus, for instance, an alkene may be a C2-20 alkene, i.e. an alkene having from 2 to 20 carbon atoms, or for instance a C2-10 alkane, i.e. an alkane having from 2 to 10 carbon atoms. It may for instance be a C2-8 alkane, a C2-6 alkane, a C2-5 alkane, a C2-4 alkane, or a C2-3 alkane. It is often a C2-4 alkene or a C2-3 alkene in the present invention. Examples of smaller alkenes, e.g. of C2-12 alkenes are ethene (i.e. ethylene), propene (i.e. propylene), butene, pentene, methylbutene, hexene, methylpentene, dimethylbutene, heptene, methylhexene, dimethylpentene, octene, methylheptene, nonene, decene, undecene and dodecene. Alkenes typically comprise one or two double bonds. The terms "alkene" and "olefin" may be used interchangeably. The one or more double bonds may be at any position in the hydrocarbon chain. The alkenes may be cis- or trans-alkenes (or as defined using E- and Z- nomenclature). An alkene comprising a terminal double bond may be referred to as an "alk-l-ene" (e.g. hex-l-ene), a "terminal alkene" (or a "terminal olefin"), or an "alpha- alkene" (or an "alpha-olefin"). The term "alkene", as used herein also often includes cycloalkenes.

The term "cycloalkene", as used herein, refers to partially unsaturated cyclic hydrocarbon compound. A "Cn-m cycloalkene" refers to a cycloalkene having from n to m carbon atoms. A cycloalkene may for instance be a C3-20 cycloalkene a C3-10 cycloalkene, a C3-8 cycloalkene or a C3-4 cycloalkene. Examples of a C3-8 cycloalkene include cyclopropene, cyclobutene, cyclopentene, cyclohexene, cyclohexa-l,3-diene, methylcyclopentene, cycloheptene, methylcyclohexene, dimethylcyclopentene and cyclooctene. A cycloalkene may comprise one or two double bonds.

The term "aromatic compound", "aromatic hydrocarbon" or "aromatic hydrocarbon compound", as used herein, refers to a hydrocarbon compound comprising one or more aromatic rings. The aromatic rings may be monocyclic or polycyclic. Typically, an aromatic compound comprises a benzene ring. An aromatic compound may for instance be a C6-14 aromatic compound, a C6-12 aromatic compound or a C ₆ -io aromatic compound. Examples of C ₆ -i4 aromatic compounds are benzene, toluene, xylene, ethylbenzene, methyl ethy lb enzene, diethylbenzene, naphthalene, methylnaphthalene, ethylnaphthalene and anthracene. The terms "aromatic compounds", "aromatics" and "arenes" may be used interchangeably.

The terms "hydrocarbyl group" and "hydrocarbyl", as used herein, refer to a radical of a hydrocarbon as defined above, obtainable by removing a hydrogen atom from the hydrocarbon.

A "Cn-m hydrocarbyl group" or "Cn-m hydrocarbyl" refers to a hydrocarbyl group having from n to m carbon atoms. For instance, "Ci-150 hydrocarbyl" refers to a hydrocarbyl group which has from 1 to 150 carbon atoms, and "C5-60 hydrocarbyl" refers to a hydrocarbyl group which has from 5 to 60 carbon atoms. A hydrocarbyl group is, unless otherwise specified an unsubstituted hydrocarbyl group. A hydrocarbyl group may however be substituted. The terms "substituted hydrocarbyl group" and "substituted hydrocarbyl", as used herein, refer to a hydrocarbyl group as defined above which bears one or more non-hydrocarbon substituents. The one or more non- hydrocarbon substituents may be selected from cyano, amino, nitro, Ci-io alkylamino, di(Ci- io)alkylamino, arylamino, diarylamino, aryl(Ci-io)alkylamino, amido, acylamido, hydroxy, oxo, halo, carboxy, ester, acyl, acyloxy, Ci-io alkoxy, aryloxy, halo(Ci-io)alkyl, sulfonic acid, thiol, Ci-io alkylthio, arylthio, sulfonyl, phosphoric acid, phosphate ester, phosphonic acid and phosphonate ester. Typically, the one or more non-hydrocarbon substituents are selected from cyano, amino, nitro, amido, acylamido, hydroxy, oxo, halo, carboxy, ester, acyl, acyloxy, sulfonic acid, thiol, sulfonyl, phosphoric acid, phosphate ester, phosphonic acid and phosphonate ester. When a hydrocarbyl group is substituted, it may for instance bear from 1 to 20 non-hydrocarbon substituents, for example 1, 2, 3 or 4 non-hydrocarbon substituents. For instance, a substituted hydrocarbyl group may have 1, 2 or 3 non-hydrocarbon substituents, or for example 1 or 2 non-hydrocarbon substituents.

However, when a hydrocarbyl group is halo- substituted, for instance fluoro- substituted, the hydrocarbyl group may for example bear from 1 to 20 halo substituents, for instance 1, 2, 3 or 4 halo substituents, or it may bear more than twenty halo substituents, depending on the number of carbon atoms in the hydrocarbyl group that can be substituted. The hydrocarbyl group may for instance be perhalo-substituted, i.e. all hydrogen atoms of the hydrocarbyl group may be replaced by halogen atoms. The hydrocarbyl group may for instance be perfluoro-substituted, i.e. perfluonnated, i.e. all hydrogen atoms of the group may be replaced by fluorine atoms. Accordingly, the term "substituted", as used herein, in the context of substituted hydrocarbyl groups (and substituted hydrocarbylene groups), encompasses the perhalo-substituted groups, in particular the perfluoro-substituted groups. Thus, for example, the term "substituted Cn-m hydrocarbyl" as used herein encompasses Cn-m perfluorohydrocarbyl and the term "substituted Cn-m hydrocarbylene" as used herein encompasses Cn-m perfluorohydrocarbylene.

The term "alkyl", as used herein, refers to a linear or branched chain saturated hydrocarbon radical. A "Cn-m alkyl" refers to an alkyl having from n to m carbon atoms. Thus, an alkyl group may be a Ci-is alkyl group, a Ci-i4 alkyl group, a Ci-io alkyl group, a Ci- 6 alkyl group or a Ci-4 alkyl group. Examples of a Ci-io alkyl group are methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl or decyl. Examples of Ci-6 alkyl groups are methyl, ethyl, propyl, butyl, pentyl or hexyl. Examples of Ci-4 alkyl groups are methyl, ethyl, i- propyl, n-propyl, t-butyl, s-butyl or n-butyl. If the term "alkyl" is used without a prefix specifying the number of carbons anywhere herein, it has from 1 to 6 carbons.

The term "cycloalkyl", as used herein, refers to a saturated or partially unsaturated cyclic hydrocarbon radical. A "Cn-m cycloalkyl" refers to a cycloalkyl having from n to m carbon atoms. Thus, a cycloalkyl group may be a C3-10 cycloalkyl group, a C3-8 cycloalkyl group or a C3-6 cycloalkyl group. Examples of a C3-8 cycloalkyl group include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, cyclohex-l,3-dienyl, cycloheptyl and cyclooctyl. Examples of a C3-6 cycloalkyl group include cyclopropyl, cyclobutyl,

cyclopentyl, and cyclohexyl.

The term "alkenyl", as used herein, refers to a linear or branched chain hydrocarbon radical comprising one or more double bonds. A "Cn-m alkenyl" refers to an alkenyl having from n to m carbon atoms. Thus, an alkenyl group may be a C2-18 alkenyl group, a C2-14 alkenyl group, a C2-10 alkenyl group, a C2-6 alkenyl group or a C2-4 alkenyl group. Examples of a C2-10 alkenyl group are ethenyl (vinyl), propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl or decenyl. Examples of C2-6 alkenyl groups are ethenyl, propenyl, butenyl, pentenyl or hexenyl. Examples of C2-4 alkenyl groups are ethenyl, i-propenyl, n-propenyl, s- butenyl or n-butenyl. Alkenyl groups typically comprise one or two double bonds.

The term "alkynyl", as used herein, refers to a linear or branched chain hydrocarbon radical comprising one or more triple bonds. A "Cn-m alkynyl" refers to an alkynyl having from n to m carbon atoms. Thus, an alkynyl group may be a C2-18 alkynyl group, a C2-14 alkynyl group, a C2-10 alkynyl group, a C2-6 alkynyl group or a C2-4 alkynyl group. Examples of a C2-10 alkynyl group are ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl or decynyl. Examples of Ci-6 alkynyl groups are ethynyl, propynyl, butynyl, pentynyl or hexynyl. Alkynyl groups typically comprise one or two triple bonds.

The term "aryl", as used herein, refers to a monocyclic, bicyclic or polycyclic aromatic ring which contains from 6 to 14 carbon atoms, typically from 6 to 10 carbon atoms, in the ring portion. Examples include phenyl, naphthyl, indenyl and indanyl groups. The term "aryl group", as used herein, includes heteroaryl groups. The term "heteroaryl", as used herein, refers to monocyclic or bicyclic heteroaromatic rings which typically contains from six to ten atoms in the ring portion including one or more heteroatoms. A heteroaryl group is generally a 5- or 6-membered ring, containing at least one heteroatom selected from O, S, N, P, Se and Si. It may contain, for example, one, two or three heteroatoms. Examples of heteroaryl groups include pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, furanyl, thienyl, pyrazolidinyl, pyrrolyl, oxazolyl, oxadiazolyl, isoxazolyl, thiadiazolyl, thiazolyl, isothiazolyl, imidazolyl, pyrazolyl, quinolyl and isoquinolyl.

The terms "hydrocarbylene", "alkylene", "cycloalkylene", "alkenylene",

"alkynylene", and "arylene", as used herein, refer to bivalent groups obtained by removing a hydrogen atom from a hydrocarbyl, alkyl, cycloalkyl, alkenyl, alkynyl, or aryl group, respectively. Such bidentate groups may be substituted or unsubstituted. An alkylene group may be a Ci-is alkylene group, a Ci-i4 alkylene group, a Ci-io alkylene group, a Ci-6 alkylene group or a Ci-4 alkylene group. Examples of Ci-6 alkylene groups are methylene, ethylene, propylene, butylene, pentylene and hexylene. A cycloalkylene group may be a C3-10 cycloalkylene group, a C3-8 cycloalkylene group or a C3-6 cycloalkylene group. Examples of C3-6 cycloalkylene groups include cyclopentylene and cyclohexylene. An alkenylene group may be a C2-18 alkenylene group, a C2-14 alkenylene group, a C2-10 alkenylene group, a C2-6 alkenylene group or a C2-4 alkenylene group. Examples of a C2-4 alkenylene group include ethenylene (vinylene), propenylene and butenylene. An alkynylene group may be a C2-18 alkynylene group, a C2-14 alkynylene group, a C2-10 alkynylene group, a C2-6 alkynylene group or a C2-4 alkynylene group. Examples of a C2-4 alkynylene group include ethynylene and propynylene. Examples of arylene groups include phenylene and encompass heteroarylene groups such as, for instance, a diradical derived from thiophene, a diradical derived from chromane, and a diradical derived from chromanol. For alkylene, cycloalkylene, alkenylene, alkynylene, and arylene, these groups may be bonded to other groups at any two positions on the group. Thus, propylene includes -CH2CH2CH2- and -CH2CH(CH3)-, and phenylene includes ortho-, meta- and para-phenylene.

The term "substituted", as used herein, in the context of substituted organic compounds and groups, refers to an organic compound or group, e.g. an alkane, an alkyl group, or an alkylene group, which bears one or more substituents selected from Ci-10 alkyl, aryl (as defined herein), cyano, amino, nitro, Ci-10 alkylamino, di(Ci-io)alkylamino, arylamino, diarylamino, aryl(Ci-io)alkylamino, amido, acylamido, hydroxy, oxo, halo, carboxy, ester, acyl, acyloxy, Ci-10 alkoxy, aryloxy, halo(Ci-io)alkyl, sulfonic acid, thiol, Ci-10 alkylthio, arylthio, sulfonyl, phosphoric acid, phosphate ester, phosphonic acid and phosphonate ester. Typically, the one or more substituents are selected from cyano, amino, nitro, amido, acylamido, hydroxy, oxo, halo, carboxy, ester, acyl, acyloxy, sulfonic acid, thiol, sulfonyl, phosphoric acid, phosphate ester, phosphonic acid and phosphonate ester When a compound or group is substituted, it typically bears 1, 2, 3 or 4 substituents. For instance, a substituted compound or group may have 1, 2 or 3 substituents, or for example 1 or 2 substituents.

However, when a group is halo-substituted, for instance fluoro-substituted, the group may bear 1, 2, 3 or 4 halo substituents, or it may bear more than four halo substituents. In fact, the group may be perhalo-substituted, i.e. all hydrogen atoms of the group may be replaced by halogen atoms. The group may for instance be perfluoro-substituted, i.e.

perfluorinated, i.e. all hydrogen atoms of the group may be replaced by fluorine atoms.

Accordingly, the term "substituted", as used herein, in the context of substituted organic groups, for instance in the context of substituted hydrocarbyl groups, substituted alkyl groups, substituted cycloalkyl groups, substituted alkenyl groups, substituted alkynyl groups, substituted aryl groups, substituted hydrocarbyl ene groups, substituted alkylene groups, substituted cycloalkylene groups, substituted alkenylene groups, substituted alkynylene groups, and substituted arylene (including substituted heteroarylene) groups, encompasses the perhalo-substituted groups, in particular the perfluoro-substituted groups. Thus, for example, the term "substituted Cn-m alkyl" as used herein encompasses Cn-m perfluoroalkyl, the term "substituted Cn-m alkylene" as used herein encompasses Cn-m perfluoroalkylene, the term "substituted Cn-m hydrocarbyl" as used herein encompasses Cn-m perfluorohydrocarbyl and the term "substituted Cn-m hydrocarbylene" as used herein encompasses Cn-m

perfluorohydrocarbylene, and so-on.

Tracer compound and oligonucleotide

The product of wood processing of the present invention comprises a tracer compound.

The tracer compound comprises a synthetic oligonucleotide. Oligonucleotides may be synthesised using well-established methods, for example by solid-phase synthesis using the phosphoramidite method and by using phosphoramidite building blocks derived from protected 2'-deoxynucleosides (dA, dC, dG, and T), ribonucleosides (A, C, G, and U), or chemically modified nucleosides, e.g. LNA or BNA. Oligonucleotide synthesis is typically carried out automatically, using commercially available, computer-controlled oligonucleotide synthesizers. Synthetic oligonucleotides are themselves available commercially from oligonucleotide synthesis companies such as ATDBio Ltd. (www.atdbio.com).

The synthetic oligonucleotide employed in the present invention is often referred to herein as an "identifiable oligonucleotide" on the basis that the oligonucleotide can readily be identified by performing standard techniques on the tracer compound such as, for instance amplification (typically by PCR) followed by sequencing. The synthetic oligonucleotide is generally deoxyribonucleic acid (DNA). Accordingly, the nucleotides present in the oligonucleotide are typically independently selected from: deoxyadenosine monophosphate (dAMP), deoxyguanosine monophosphate (dGMP), deoxythymidine monophosphate (dTMP) and deoxycytidine monophosphate (dCMP).

The synthetic oligonucleotide is generally single-stranded. However, as will be appreciated by the skilled person, a single stranded oligonucleotide may have one or more primers or probes hybridised thereto. Accordingly, depending on the nature of the

environment or composition in which the synthetic oligonucleotide is present, and in particular depending on whether or not the environment or composition further comprises one or more additional oligonucleotides which have a sequence that is complementary to a sequence of nucleotides in the synthetic oligonucleotide (for instance one or more primers or probes), the synthetic oligonucleotide may comprise one or more regions of double stranded oligonucleotide. These are generally relatively short regions compared to the length of the synthetic oligonucleotide. Where the oligonucleotide is bonded to a hydrophobic group or a hydrophilic group, only one stand (the "principal strand") will be bonded directly to the hydrophobic or hydrophilic group. As discussed further herein, the direct bond to the hydrophobic or hydrophilic group is generally a covalent bond between the hydrophobic or hydrophilic group and the 5' or 3' end of the principle strand, and it is usually a covalent bond between the hydrophobic or hydrophilic group and the 5' end of the principle strand.

The length of the synthetic oligonucleotide in the tracer compound is defined herein in terms of the number of nucleotides in the principal oligonucleotide strand. Thus, any further nucleotides which are hybridised to that strand (i.e. in cases where the oligonucleotide comprises one or more double stranded regions) are discounted; only the nucleotides in the principal strand are counted.

Typically, the length of the synthetic oligonucleotide is from 25 to 200 nucleotides. The length of the oligonucleotide may for instance be from 30 to 150 nucleotides, or for instance from 35 to 120 nucleotides. Often, however, the length of the oligonucleotide is from 40 to 110 nucleotides, for instance from 45 to 100 nucleotides, or for example from 50 to 90 nucleotides. The length of the oligonucleotide may for instance be from 60 to 80 nucleotides.

Generally, the synthetic oligonucleotide of the tracer compound comprises a unique sequence of nucleotides, which provides information about a product of wood processing that is labelled with the tracer compound (a "labelled" or "tagged" product of wood processing).

Accordingly, typically the oligonucleotide comprises a sequence of nucleotides which represents information about the product of wood processing. The unique sequence of nucleotides may for instance denote a particular source, for instance a sustainably managed forest, so that a product of wood processing which was tagged with the tracer compound can subsequently be identified as originating from that source. The source may for instance be a sustainable source, for instance a sustainably managed forest. The source may for instance be a legal and sustainable source. It may for instance be a sustainably managed forest which has been approved or certified as such.

Accordingly, said oligonucleotide typically comprises a sequence of nucleotides which identifies the source of the wood from which the product of wood processing was produced. A product of wood processing which was tagged with the tracer compound can then subsequently be identified as originating from that source. The source is typically, for instance, a sustainably managed forest, for example a forest that has been approved or certified as being sustainably managed. The oligonucleotide may additionally indicate, for instance, the batch of the wood from which the product of wood processing was produced, and/or the time of harvesting of the wood from which the product of wood processing was produced.

The oligonucleotide typically comprises a sequence of nucleotides which identifies the product of wood processing as originating from a legal and sustainable source.

The oligonucleotide may for instance comprise a sequence of nucleotides which identifies the product of wood processing as originating from a sustainably managed forest.

The unique sequence of nucleotides may for instance denote a particular location. A product of wood processing which was tagged with the tracer compound can then subsequently be identified as having been present at that particular location. The unique sequence of nucleotides may for instance denote a particular location at a particular point in time. A product of wood processing which was tagged with the tracer compound can then subsequently be identified as having been present at that particular location at the particular point in time. The unique sequence of nucleotides may for example denote a particular batch of products. A product of wood processing which was tagged with the tracer compound can then subsequently be identified as being from that particular batch. The unique sequence of nucleotides may for instance denote a particular batch of products produced at a particular location. A product of wood processing which was tagged with the tracer compound can then subsequently be identified as being from that particular batch of products produced at that particular location. The unique sequence of nucleotides may for instance denote a particular batch of products produced at a particular location at a particular point in time. A product of wood processing tagged with the tracer compound can then subsequently be identified as having been from that particular batch of products which was produced at the particular location at the particular point in time.

The particular location may for example be a forest, a timber yard, a sawmill, a planing mill, a pulp mill, or a factory or production facility, for example a biomass or biofuel production facility. The particular location may be one that has been certified as following legal and sustainable practices. It may for instance be a sustainably managed forest. It may for instance be a sustainably managed: timber yard, sawmill, planing mill, pulp mill, factory or production facility, or for example a sustainably managed biomass or biofuel production facility.

Accordingly, said oligonucleotide typically comprises a sequence of nucleotides which identifies the product of wood processing as: having been present at a particular location, having been present at a particular location at a particular point in time, being from a batch of products produced at a particular location, or being from a batch of products produced at a particular location at a particular point in time, wherein the location is one that has been certified as following legal and sustainable practices. The location may be a forest, a production facility, a factory, a timber yard, a sawmill, a planing mill, a pulp mill, or a biomass or biofuel production facility.

The unique sequence of nucleotides, which represents information about a product of wood processing that is labelled (or is to be labelled) with the tracer compound, will of course vary depending on the information about the tagged product of wood processing that is to be represented by that part of the sequence. For example, the unique sequence of nucleotides, which provides information about a product of wood processing that is tagged with the tracer compound, will generally vary depending on the particular source of the wood from which the product of wood processing was produced. It may also vary depending on the particular batch of wood from which the product of wood processing was produced. It may also vary depending on the particular time at which the wood, from which the product of wood processing was produced, was harvested at the source.

The unique sequence of nucleotides in the oligonucleotide, which provides information about a product of wood processing that is labelled (or is to be labelled) with the tracer compound, is typically in a central region of the oligonucleotide (as opposed to at either of the 5' or 3' ends of the oligonucleotide). This is because the oligonucleotide generally also comprises a sequence of nucleotides at or near the 5' end, and a sequence of nucleotides at or near the 3' end, which carry predetermined sequences that will recognise appropriate complementary primers for use in PCR amplification and in sequencing of the PCR amplified nucleic acid.

The oligonucleotide may for instance be represented as follows:

1 1 1 1

A B C D

wherein:

region AB comprises a predetermined sequence for recognising a complementary primer suitable for amplifying nucleic acid in the oligonucleotide;

region BC comprises said sequence of nucleotides as defined herein which represents information about the product of wood processing; and

region CD comprises a predetermined sequence for recognising a complementary primer suitable for amplifying nucleic acid in the oligonucleotide.

The regions AB and CD, respectively, typically comprise predetermined sequences that will recognise complementary primers for use in PCR amplification (e.g. qPCR

amplification). Regions AB and CD optionally additionally comprise complementary primers for use in sequencing of the amplified nucleic acid.

The regions AB and CD generally will not vary from product to product. Rather, they will generally be constant for all tracer compounds in a particular batch, or "library", of tracer compounds to be employed in accordance with the present invention. Each of the regions AB and CD of the oligonucleotide typically has a length of from 8 to 50 nucleotides, for instance from 10 to 40 nucleotides, or for instance from 15 to 30 nucleotides.

The region BC, on the other hand, comprises a unique sequence of nucleotides that represents information about the product of wood processing that is labelled (or is to be labelled) with the tracer compound. This is the region that gives each tracer compound its unique, characteristic signal, and will vary as the information about the product of wood processing to be labelled with the tracer compound varies. The uniqueness of the sequence of nucleotides that represents information about the product of wood processing is generally known only to the individuals using the tracer in accordance with the invention, thereby guaranteeing security of the information.

The region BC may for instance comprise a sequence of nucleotides which identifies the source of the wood from which the product of wood processing was produced. This is generally a source that has been certified as following legal and sustainable practices, for instance a sustainably managed forest. The region BC may for instance comprise a sequence of nucleotides which identifies the product of wood processing as: having been present at a particular location, having been present at a particular location at a particular point in time, being from a batch of products produced at a particular location, or being from a batch of products produced at a particular location at a particular point in time, wherein the location is one that has been certified as following legal and sustainable practices. The location may for instance be a forest, a production facility, a factory, a timber yard, a sawmill, a planing mill, a pulp mill, or a biomass or biofuel production facility.

The region BC of the oligonucleotide may have a length of, for instance, from 5 to 120 nucleotides. It may for instance have a length of from 10 to 80 nucleotides, or for example from 15 to 50 nucleotides, for instance from 20 to 40 nucleotides. Indeed, if the BC region is 10 nucleotides in length then with the four bases available for a DNA molecule, there will be 1.048 x 10 ⁶ unique molecules capable of being synthesised. If the BC region is 15 bases long, then 1.07 x 10 ⁹ unique molecules can be synthesised. If the BC region is 30 bases long, 1.15 x 10 ¹⁸ unique molecules can be synthesised. Each of these unique molecules can potentially represent different information about a product of wood processing to be labelled.

SEQ ID NO: 1, which contains 60 nucleotides, is an example of a suitable

oligonucleotide that may be employed as a tracer compound in accordance with the invention.

The oligonucleotide (denoted Tag in formula I) is often referred to herein as an "identifiable oligonucleotide" on the basis that it can readily be identified by performing standard techniques on the tracer compound. The identity of the oligonucleotide of the tracer compound can readily be determined by (a) amplifying the oligonucleotide; and (b) sequencing the amplified oligonucleotide.

The oligonucleotide may be amplified by performing PCR (the polymerase chain reaction) on the tracer compound. Accordingly, step (a) may comprise performing PCR on the tracer compound. PCR and sequencing are both very well known techniques. The PCR may for instance be qPCR (quantitative polymerase chain reaction), which is also well known. The sequencing in step (b) may be by any suitable method. Methods for sequencing oligonucleotides are well known in the art.

Often, analysing the identifiable oligonucleotide of the tracer compound to determine the identity of the oligonucleotide comprises:

(a) amplifying the oligonucleotide in the presence of an intercalating reporter dye to determine that an oligonucleotide is present;

(b) optionally further amplifying the oligonucleotide; and (c) sequencing the amplified oligonucleotide and thereby determining the identity of the oligonucleotide.

The amplifying in steps (a) and (b) is typically achieved by performing PCR, for instance qPCR. The sequencing in step (c) may be by any suitable method; such methods for sequencing are well known in the art.

Unmodified and modified tracer compounds

Typically, the tracer compound employed in the product of wood processing is the synthetic oligonucleotide. In other words, the synthetic oligonucleotide of the tracer compound is typically not modified with any additional hydrophobic or hydrophilic group. Thus, the tracer compound may consist of the synthetic oligonucleotide.

In another embodiment, however, the tracer compound comprises the synthetic oligonucleotide and a hydrophobic group or a hydrophilic group. The tracer compound may also optionally be modified with a fluorescent moiety, in addition to the hydrophobic or hydrophilic group.

A hydrophobic or hydrophilic group may be employed in order to improve the stability of the tracer compound in hydrophobic and hydrophilic environments respectively, or to reduce the tendency of the tracer compound to leach out of a product of wood processing. For instance employing a hydrophobic group may reduce the tendency of the tracer compound to leach out from a product of wood processing which contains the tracer into a hydrophilic environment such as an aqueous environment, e.g. rain water to which the product is exposed. Likewise, employing a hydrophilic group may reduce the tendency of the tracer compound to leach out from a product of wood processing which comprises the tracer into a hydrophobic environment, such as an oil.

Generally, the hydrophobic group or the hydrophilic group is covalently attached to the oligonucleotide. More specifically, the hydrophobic group or the hydrophilic group is typically covalently bonded to one end of the oligonucleotide.

The hydrophobic or hydrophilic group is usually attached to the 5' end of the oligonucleotide because it has thus far been found that attachment to the 5' end improves the ability to amplify the oligonucleotide using qPCR.

When the hydrophobic or hydrophilic group is attached to the 5' end of the

oligonucleotide, it is typically covalently bonded to an oxygen atom of the phosphate group at the 5' end of the oligonucleotide. This is the phosphate group of the final nucleotide at the 5' end of the oligonucleotide. Figures 1 and 2 show how various different hydrophobic groups were bonded to the 5' end of an oligonucleotide (the oligonucleotide of SEQ ID NO: 1) in this way.

In another embodiment, however, the hydrophobic or hydrophilic group is attached to the 3 ' end of the oligonucleotide. The hydrophobic group may for instance be attached to the deoxyribose ring of the final nucleotide at the 3 ' end of the oligonucleotide, e.g. via a phosphate group.

Any suitable hydrophobic or hydrophilic group may be employed and the skilled person will be aware of suitable groups. Hydrophobic groups are described in more detail below.

Hydrophilic groups are known to the skilled person and include hydroxy, oxo, amino, carboxy, ester, acyl, acyloxy, sulfonic acid, thiol, sulfonyl, phosphoric acid, phosphate (e.g. phosphate ester), phosphonic acid, phosphonate (e.g. phosphonate ester) groups. Hydrophilic groups also include hydrocarbyl groups provided that the hydrocarbyl group in question is substituted with an adequate number of hydrophilic substituent groups, such that the resulting group is hydrophilic rather than hydrophobic. A hydrophilic hydrocarbyl group (for instance a Ci-20 hydrocarbyl, preferably a Ci-io hydrocarbyl or, for instance, a Ci-6 hydrocarbyl) may for instance be substituted with from 1 to 3, or from 1 to 10, hydrophilic substituent groups selected from hydroxy, oxo, amino, carboxy, ester, acyl, acyloxy, sulfonic acid, thiol, sulfonyl, phosphoric acid, phosphate, phosphonic acid and phosphonate groups, in order to render the group hydrophilic. Hydrophilic groups also for instance include hydrophilic polymers. Hydrophilic polymers contain polar or charged functional groups, rendering them soluble in water. Hydrophilic polymers include acrylics (for instance acrylic acid, acrylamide, and maleic anhydride polymers and copolymers), amine-functional polymers (for instance allylamine, ethyleneimine, oxazoline, and other polymers containing amine groups in their main- or side-chains). The hydrophilic group may be a water-soluble, hydrophilic polymer selected from polyethers, poly(N-isopropylacrylamide) (PNIPAM), polyacrylamide (PAM), poly(2-oxazoline), polyethylenimine (PEI), poly(acrylic acid), polymethacrylate and other acrylic polymers, poly(ethylene glycol), poly(ethylene oxide), poly(vinyl alcohol) (PVA), poly(vinylpyrrolidone) (PVP), poly(styrenesulfonate) (PSS), polyacrylamide (PAM), polyelectrolytes, poly(acrylic acid) (PAA), poly(allylamine hydrochloride),

poly(diallyldimethylammonium chloride), poly(vinyl acid) and copolymers thereof.

The tracer compound may for instance be a compound of formula (X):

X-Tag (X)

wherein X is a hydrophilic group; and Tag is the synthetic oligonucleotide. The hydrophobic or hydrophilic group to which the synthetic oligonucleotide may be attached may be a hydrophobic or hydrophilic nanoparticle.

The tracer compound may comprise the synthetic oligonucleotide and a fluorescent moiety. The fluorescent moiety may be covalently bonded to the synthetic oligonucleotide. The fluorescent moiety can act as a "flag" for enabling detection of the presence of a tracer compound in a product of wood processing, prior to recovering, amplifying and sequencing the tracer compound. The fluorescent moiety may for instance be fluorescein, FAM (6- Carboxyfluorescein), HEX™ (6-carboxy-2',4,4',5',7,7'-hexachloro fluorescein), JOE™ (6- Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein, Succinimidyl Ester), ROX™ (6- Carboxy-X-Rhodamine), TAMRA™ (6-Carboxytetramethylrhodamine), TET™ (6- Tetrachlorofluorescein), NED™, Texas Red® (sulforhodamine 101 acid chloride), VIC®, PET®, Fluorescein dT and Tamra dT, or a cyanine dye. A wide range of fluorophores, including these specific ones, can be incorporated into oligonucleotides at the 5 '-end, at the 3 '-end using known methods, and such modified oligonucleotides are commercially available from companies such as ATDBio (www.atdbio.com).

Accordingly, the tracer compound may be unmodified, or it may be modified with: (i) a hydrophobic or hydrophilic group and/or (ii) a fluorescent moiety.

Hydrophobic tracer compounds

The tracer compound may comprise a hydrophobic group and the synthetic

oligonucleotide. The hydrophobic group is typically covalently attached to the

oligonucleotide. More specifically, the hydrophobic group is typically covalently bonded to one end of the oligonucleotide. The hydrophobic group is usually attached to the 5' end of the oligonucleotide because it has thus far been found that attachment to the 5' end improves the ability to amplify the oligonucleotide using qPCR. When the hydrophobic group is attached to the 5' end of the oligonucleotide, it is typically covalently bonded to an oxygen atom of the phosphate group at the 5' end of the oligonucleotide. This is the phosphate group of the final nucleotide at the 5' end of the oligonucleotide. In another embodiment, however, the hydrophobic group is attached to the 3' end of the oligonucleotide. The hydrophobic group may for instance be attached to the deoxyribose ring of the final nucleotide at the 3' end of the oligonucleotide, e.g. via a phosphate group.

The tracer compound may for instance be a compound of formula (I):

R-Tag (I)

wherein R is the hydrophobic group; and Tag is the synthetic oligonucleotide. R is typically bonded to the 5' end of the identifiable oligonucleotide (i.e. to the 5' end of Tag). Usually, R is covalently bonded to the 5' end of Tag.

The bond (-) between R and Tag shown in formula (I) is covalent. It is generally a covalent single bond. It is usually a single bond between an atom (typically a carbon atom) of the hydrophobic group, R, and an oxygen atom of the phosphate group at the 5' end of the identifiable oligonucleotide.

The hydrophobic group (denoted R in formula I) is any group which is hydrophobic such that, if a tracer compound of formula I were introduced into a liquid comprising water and an immiscible apolar medium, the tracer compound would preferentially associate with (i.e. dissolve in) the apolar phase rather than the aqueous phase. It is possible for the hydrophobic group to comprise one or more substituents or moieties that on their own might not be considered hydrophobic. However, in that case, the hydrophobic group will comprise at least one other substituent or moiety (for instance a long hydrocarbon chain) which renders the group hydrophobic "overall". Indeed, it has been found that the hydrophobic group ensures that the tracer compound is retained within an apolar medium if and when it comes into contact with water, i.e. it is resistant to leaching out into the water.

Tracer compounds of formula (I) which comprise a hydrophobic medium can advantageously ensure that a product of wood processing which comprises the compound will remain "tagged" with the unique fingerprint of the synthetic oligonucleotide even if comes into frequent contact with aqueous environments, for instance rainwater.

The hydrophobic group, R, may be an unsubstituted or substituted hydrocarbyl group.

R may for instance be an unsubstituted or substituted Ci-200 hydrocarbyl group, or for instance an unsubstituted or substituted C2-200 hydrocarbyl group. R may for example be an unsubstituted or substituted C6-200 hydrocarbyl group, an unsubstituted or substituted C4-200 hydrocarbyl group, or for instance an unsubstituted or substituted C 10-200 hydrocarbyl group, or an unsubstituted or substituted C 12-200 hydrocarbyl group.

R may for instance be an unsubstituted or substituted Ci-50 hydrocarbyl group, or for instance an unsubstituted or substituted C2-50 hydrocarbyl group. R may for example be an unsubstituted or substituted C6-50 hydrocarbyl group, or for instance an unsubstituted or substituted C 10-50 hydrocarbyl group, or an unsubstituted or substituted C 12-50 hydrocarbyl group.

R may for instance be an unsubstituted or substituted Ci-30 hydrocarbyl group, or for instance an unsubstituted or substituted C2-30 hydrocarbyl group. R may for example be an unsubstituted or substituted C6-30 hydrocarbyl group, or for instance an unsubstituted or substituted C 10-30 hydrocarbyl group, or an unsubstituted or substituted C 12-30 hydrocarbyl group.

The unsubstituted or substituted hydrocarbyl group as defined above may be an alkyl, cycloalkyl, alkenyl, alkynyl or aryl group, or it may comprise more than one of these group types. It may for instance consist of an alkyl, cycloalkyl, alkenyl, alkynyl or aryl group which is substituted with one or more other groups independently selected from alkyl, cycloalkyl, alkenyl, alkynyl and aryl groups.

Often, R is an unsubstituted or substituted C 1-200 alkyl group, for instance an

unsubstituted or substituted C2-200 alkyl group, for example an unsubstituted or substituted C ₄ - 200 alkyl group, an unsubstituted or substituted C6-200 alkyl group, an unsubstituted or substituted C 10-200 alkyl group, an unsubstituted or substituted C 12-200 alkyl group, or an unsubstituted or substituted C16-200 alkyl group. R may for instance be an unsubstituted or substituted Ci-50 alkyl group, or for instance an unsubstituted or substituted C6-50 alkyl group. R may for example be an unsubstituted or substituted Cio-50 alkyl group, or for instance an unsubstituted or substituted C12-50 alkyl group, or an unsubstituted or substituted C15-50 alkyl group. R may for instance be an unsubstituted or substituted Ci-30 alkyl group, or for instance an unsubstituted or substituted C2-30 alkyl group. R may for example be an unsubstituted or substituted C6-30 alkyl group, or for instance an unsubstituted or substituted Cio-30 alkyl group, or an unsubstituted or substituted C 12-30 alkyl group.

Alternatively, R may be an unsubstituted or substituted C2-200 alkenyl or alkynyl group, for instance an unsubstituted or substituted C4-200 alkenyl or alkynyl group, for example an unsubstituted or substituted C 10-200 alkenyl or alkynyl group, an unsubstituted or substituted C 12-200 alkenyl or alkynyl group, an unsubstituted or substituted C16-200 alkenyl or alkynyl group, or an unsubstituted or substituted C18-200 alkenyl or alkynyl group. R may for instance be an unsubstituted or substituted C2-50 alkenyl or alkynyl group, or for instance an unsubstituted or substituted C6-50 alkenyl or alkynyl group. R may for example be an unsubstituted or substituted C 10-50 alkenyl or alkynyl group, or for instance an unsubstituted or substituted C12-50 alkenyl or alkynyl group, or an unsubstituted or substituted C15-50 alkenyl or alkynyl group. R may for instance be an unsubstituted or substituted C2-30 alkenyl or alkynyl group, or for instance an unsubstituted or substituted C6-30 alkenyl or alkynyl group. R may for example be an unsubstituted or substituted Cio-30 alkenyl or alkynyl group, or for instance an unsubstituted or substituted C 12-30 alkenyl or alkynyl group, or an unsubstituted or substituted C16-30 alkenyl or alkynyl group. R may be an unsubstituted or substituted cycloalkyl group, for instance an unsubstituted or substituted C4-30 cycloalkyl, an unsubstituted or substituted C5-20 cycloalkyl or an unsubstituted or substituted C5-10 cycloalkyl group. Alternatively, R may be an unsubstituted or substituted C ₆ -i6 aryl group (for instance phenyl, tolyl, xylyl, ethylphenyl,

methylethylphenyl, diethylphenyl, naphthyl, methylnaphthyl, ethylnaphthyl, anthracenyl, methylanthracenyl or ethylanthracenyl).

R may for instance be an unsubstituted or substituted C4-200 alkyl group, an

unsubstituted or substituted C4-200 alkenyl group, an unsubstituted or substituted C4-200 alkynyl group, an unsubstituted or substituted C4-30 cycloalkyl group, or an unsubstituted or substituted C ₆ -i6 aryl group.

R may for instance be an unsubstituted Cio-50 alkyl group or an amino-substituted Cio-50 alkyl group.

In some embodiments, R is an unsubstituted hydrocarbyl group as defined above. For instance, R may be an unsubstituted alkyl group as defined above. An example of an unsubstituted hydrocarbyl group is the following unsubstituted linear Cis alkyl group, which is a stearyl group:

Alternatively, R may be a substituted hydrocarbyl group as defined above. For instance, R may be a substituted alkyl group as defined above. R may for instance be a substituted hydrocarbyl group as defined above which comprises one amino group substituent. An example of an amino-substituted hydrocarbyl group is the following amino-substituted alkyl group, which is referred to in the Example herein as "C12-amino":

Advantageously, tracer compounds comprising a substituted hydrocarbyl group, and particularly an amino-substituted hydrocarbyl group, as the hydrophobic group showed a particularly high propensity for remaining within apolar environments even when extensively and vigorously water washed.

R may be a substituted hydrocarbyl group as defined above which is perfluoro- substituted. R may for instance be a Ci-200 perfluorohydrocarbyl group, or for instance a C2-200 perfluorohydrocarbyl group. R may for example be a C4-200 perfluorohydrocarbyl group, a C ₆ - 200 perfluorohydrocarbyl group, or for instance a C 10-200 perfluorohydrocarbyl group, or a C12- 200 perfluorohydrocarbyl group. R may for instance be a Ci-50 perfluorohydrocarbyl group, or for instance a C2-50 perfluorohydrocarbyl group. R may for example be a C6-50 perfluorohydrocarbyl group, or for instance a C 10-50 perfluorohydrocarbyl group, or a C 12-50 perfluorohydrocarbyl group. R may for instance be a Ci-30 perfluorohydrocarbyl group, or for instance a C2-30 perfluorohydrocarbyl group. R may for example be a C6-30

perfluorohydrocarbyl group, or for instance a C 10-30 perfluorohydrocarbyl group, or a C 12-30 perfluorohydrocarbyl group.

The perfluorohydrocarbyl group defined above may be a perfluoroalkyl,

perfluorocycloalkyl, perfluoroalkenyl, perfluoroalkynyl or perfluoroaryl group, or it may comprise more than one of these group types. It may for instance consist of a perfluoroalkyl, perfluorocycloalkyl, perfluoroalkenyl, perfluoroalkynyl or perfluoroaryl group which is substituted with one or more other groups independently selected from perfluoroalkyl, perfluorocycloalkyl, perfluoroalkenyl, perfluoroalkynyl and perfluoroaryl groups.

Often, R is a Ci-200 perfluoroalkyl group, for instance a C2-200 perfluoroalkyl group, for example a C4-200 perfluoroalkyl group, a C6-200 perfluoroalkyl group, a Cio-200 perfluoroalkyl group, a C12-200 perfluoroalkyl group, or a C16-200 perfluoroalkyl group. R may for instance be a Ci-50 perfluoroalkyl group, or for instance a C6-50 perfluoroalkyl group. R may for example be a Cio-50 perfluoroalkyl group, or for instance a C12-50 perfluoroalkyl group, or a C15-50 perfluoroalkyl group. R may for instance be a Ci-30 perfluoroalkyl group, or for instance a C2- 30 perfluoroalkyl group. R may for example be a C6-30 perfluoroalkyl group, or for instance a C 10-30 perfluoroalkyl group, or a C 12-30 perfluoroalkyl group.

In some embodiments, the hydrophobic group, R, comprises an unsubstituted or substituted hydrocarbyl group, denoted R ^HC , which is spaced apart from the identifiable oligonucleotide Tag by a linker group, denoted L.

Thus, in some embodiments, the hydrophobic group, R, is a group of formula (II)

R ^HC -L- (II)

wherein

L is bonded to Tag (typically to the 5' end of Tag) and is a linker group; and

_R HC is an unsubstituted or substituted hydrocarbyl group.

Typically, R ^HC is an unsubstituted or substituted Ci-200 hydrocarbyl group, or for instance an unsubstituted or substituted C2-200 hydrocarbyl group. R ^HC may for example be an unsubstituted or substituted C6-200 hydrocarbyl group, or for instance an unsubstituted or substituted C 10-200 hydrocarbyl group, or an unsubstituted or substituted C 12-200 hydrocarbyl group.

R ^HC may for instance be an unsubstituted or substituted Ci-50 hydrocarbyl group, or for instance an unsubstituted or substituted C2-50 hydrocarbyl group. R ^HC may for example be an unsubstituted or substituted C ₆ -5o hydrocarbyl group, or for instance an unsubstituted or substituted C 10-50 hydrocarbyl group, or an unsubstituted or substituted C 12-50 hydrocarbyl group.

R ^HC may for instance be an unsubstituted or substituted Ci-30 hydrocarbyl group, or for instance an unsubstituted or substituted C2-30 hydrocarbyl group. R ^HC may for example be an unsubstituted or substituted C6-30 hydrocarbyl group, or for instance an unsubstituted or substituted C 10-30 hydrocarbyl group, or an unsubstituted or substituted C 12-30 hydrocarbyl group.

The unsubstituted or substituted hydrocarbyl group R ^HC as defined above may be an alkyl, cycloalkyl, alkenyl, alkynyl or aryl group, or it may be comprise more than one of these group types. It may for instance consist of an alkyl, cycloalkyl, alkenyl, alkynyl or aryl group which is substituted with one or more other groups independently selected from alkyl, cycloalkyl, alkenyl, alkynyl and aryl groups.

Often, R ^HC is an unsubstituted or substituted Ci-200 alkyl group, for instance an unsubstituted or substituted C2-200 alkyl group, an unsubstituted or substituted C4-200 alkyl group, for example an unsubstituted or substituted C6-200 alkyl group, an unsubstituted or substituted C 10-200 alkyl group, an unsubstituted or substituted C 12-200 alkyl group, or an unsubstituted or substituted C16-200 alkyl group. R ^HC may for instance be an unsubstituted or substituted Ci-50 alkyl group, or for instance an unsubstituted or substituted C6-50 alkyl group.

_R HC may for example be an unsubstituted or substituted Cio-50 alkyl group, or for instance an unsubstituted or substituted C12-50 alkyl group, or an unsubstituted or substituted C15-50 alkyl group. R ^HC may for instance be an unsubstituted or substituted Ci-30 alkyl group, or for instance an unsubstituted or substituted C2-30 alkyl group. R ^HC may for example be an unsubstituted or substituted C6-30 alkyl group, or for instance an unsubstituted or substituted C 10-30 alkyl group, or an unsubstituted or substituted C 12-30 alkyl group.

Alternatively, R ^HC may be an unsubstituted or substituted C2-200 alkenyl or alkynyl group, for instance an unsubstituted or substituted C4-200 alkenyl or alkynyl group, an unsubstituted or substituted C6-200 alkenyl or alkynyl group, for example an unsubstituted or substituted C 10-200 alkenyl or alkynyl group, an unsubstituted or substituted C 12-200 alkenyl or alkynyl group, an unsubstituted or substituted C16-200 alkenyl or alkynyl group, or an unsubstituted or substituted C18-200 alkenyl or alkynyl group. R may for instance be an unsubstituted or substituted C2-50 alkenyl or alkynyl group, or for instance an unsubstituted or substituted C6-50 alkenyl or alkynyl group. R ^HC may for example be an unsubstituted or substituted C 10-50 alkenyl or alkynyl group, or for instance an unsubstituted or substituted C12- so alkenyl or alkynyl group, or an unsubstituted or substituted C15-50 alkenyl or alkynyl group.

_R HC may for instance be an unsubstituted or substituted C2-30 alkenyl or alkynyl group, or for instance an unsubstituted or substituted C6-30 alkenyl or alkynyl group. R ^HC may for example be an unsubstituted or substituted Cio-30 alkenyl or alkynyl group, or for instance an unsubstituted or substituted C 12-30 alkenyl or alkynyl group, or an unsubstituted or substituted C 16-30 alkenyl or alkynyl group.

_R HC may be an unsubstituted or substituted cycloalkyl group, for instance an unsubstituted or substituted C4-30 cycloalkyl, an unsubstituted or substituted C5-20 cycloalkyl or an unsubstituted or substituted C5-10 cycloalkyl group. Alternatively, R ^HC may be an unsubstituted or substituted C ₆ -i6 aryl group (for instance phenyl, tolyl, xylyl, ethylphenyl, methylethylphenyl, diethylphenyl, naphthyl, methylnaphthyl, ethylnaphthyl, anthracenyl, methylanthracenyl or ethylanthracenyl).

_R HC may for instance be an unsubstituted or substituted C4-200 alkyl group, an unsubstituted or substituted C4-200 alkenyl group, an unsubstituted or substituted C4-200 alkynyl group, an unsubstituted or substituted C4-30 cycloalkyl group, or an unsubstituted or substituted C ₆ -i6 aryl group.

In some embodiments, R ^HC is an unsubstituted hydrocarbyl group as defined above.

_R HC may for instance be an unsubstituted alkyl group as defined above.

Examples of unsubstituted hydrocarbyl groups R ^HC which may be employed, include the hydrocarbon polycyclic ring moiety of cholesterol, i.e.:

R ^HC may for instance be an unsubstituted C6-50 alkyl group or the hydrocarbon polycyclic ring moiety of cholesterol, shown above.

Examples of unsubstituted alkyl groups R ^HC which may be employed, of course include both linear and branched unsubstituted alkyl groups, for example the following linear unsub

and the following branched unsubstituted Ci6 alkyl group: R ^c may also be a substituted hydrocarbyl group as defined above which is perfluoro- substituted. R ^HC may for instance be a Ci-200 perfluorohydrocarbyl group, or for instance a C2- 200 perfluorohydrocarbyl group. R ^HC may for example be a C4-200 perfluorohydrocarbyl group, a C6-200 perfluorohydrocarbyl group, or for instance a C 10-200 perfluorohydrocarbyl group, or a C12-200 perfluorohydrocarbyl group. R ^HC may for instance be a Ci-50 perfluorohydrocarbyl group, or for instance a C2-50 perfluorohydrocarbyl group. R ^HC may for example be a C6-50 perfluorohydrocarbyl group, or for instance a C 10-50 perfluorohydrocarbyl group, or a C 12-50 perfluorohydrocarbyl group. R ^HC may for instance be a Ci-30 perfluorohydrocarbyl group, or for instance a C2-30 perfluorohydrocarbyl group. R ^HC may for example be a C6-30

perfluorohydrocarbyl group, or for instance a C 10-30 perfluorohydrocarbyl group, or a C 12-30 perfluorohydrocarbyl group.

The perfluorohydrocarbyl group R ^HC defined above may be a perfluoroalkyl, perfluorocycloalkyl, perfluoroalkenyl, perfluoroalkynyl or perfluoroaryl group, or it may comprise more than one of these group types. It may for instance consist of a perfluoroalkyl, perfluorocycloalkyl, perfluoroalkenyl, perfluoroalkynyl or perfluoroaryl group which is substituted with one or more other groups independently selected from perfluoroalkyl, perfluorocycloalkyl, perfluoroalkenyl, perfluoroalkynyl and perfluoroaryl groups.

Often, R ^HC is a Ci-200 perfluoroalkyl group, for instance a C2-200 perfluoroalkyl group, a C4-200 perfluoroalkyl group, for example a C6-200 perfluoroalkyl group, a C 10-200 perfluoroalkyl group, a C 12-200 perfluoroalkyl group, or a C16-200 perfluoroalkyl group. R ^HC may for instance be a Ci-50 perfluoroalkyl group, or for instance a C6-50 perfluoroalkyl group. R may for example be a Cio-50 perfluoroalkyl group, or for instance a C12-50 perfluoroalkyl group, or a C15-50 perfluoroalkyl group. R ^HC may for instance be a Ci-30 perfluoroalkyl group, or for instance a C2-30 perfluoroalkyl group. R ^HC may for example be a C6-30 perfluoroalkyl group, or for instance a C 10-30 perfluoroalkyl group, or a C 12-30 perfluoroalkyl group.

Any suitable linker group may be employed as L.

The linker group, L, may for instance comprise a hydrocarbylene, alkylene,

cycloalkylene, alkenylene, alkynylene or arylene (including heteroarylene) group as defined hereinbefore which may be unsubstituted or substituted (but is typically unsubstituted). The linker group may comprise one such group. Alternatively, it may comprise more than one such group, for instance two, three, four or five, hydrocarbylene, alkylene, cycloalkylene, alkenylene, alkynylene or arylene groups, as defined herein, bonded to one another, each of which may be unsubstituted or substituted (but is typically unsubstituted). The linker group may additionally or alternatively comprise one or more ether (-0-) linkages, one or more thio (-S-) linkages, one or more amino (- R'-) linkages, one or more keto (-C(O)-) linkages, one or more ester (-OC(O)-) linkages, one or more amide (-C(O)- R'-) linkages, or for instance one or more linkages of formula -0-C(0)- R'-. Such linkages may for instance be present at one end of a hydrocarbylene, alkylene, cycloalkylene, alkenylene, alkynylene or aiylene (including heteroarylene) group in the linker. R' in such linkages is generally H,

unsubstituted Ci-4 alkyl or unsubstituted phenyl, and is usually H. The linker group may additionally or alternatively comprise a polyalkyleneglycol linkage of formula [-0-alk-] _n wherein alk is C2-4 alkylene (which C2-4 alkylene may be linear or branched, and is typically unsubstitited) and n is from 2 to 200. Often, alk is ethylene, i.e. -CH2-CH2-. Typically, n is from 2 to 30, for instance from 2 to 20. More typically, alk is ethylene and n is from 2 to 10, for instance from 2 to 5.

Examples of linker groups, L, which are combinations of the above-listed groups include, but are by no means limited to linker groups of the following formulae:

(an example of a linker comprising an alkylene group bonded to a linkage of formula -O-C(O)- H-);

(an example of a linker comprising an alkylene group bonded to an amide linkage)

example of an aiylene linker);

O

N O O — ⁷

H

(an example of a linker comprising a polyethyleneglycol group bonded to an alkylene group bonded to a linkage of formula -O-C(O)- H-);

(an example of a linker comprising an alkylene group bonded to a linkage of formula -O-bonded to an arylene group).

L is typically therefore unsubstituted or substituted Ci-200 hydrocarbylene, unsubstituted or substituted Ci-200 alkylene, unsubstituted or substituted C4-30 cycloalkylene, unsubstituted or substituted C2-200 alkenylene, unsubstituted or substituted C2-200 alkynylene, unsubstituted or substituted C ₆ -i6 arylene (including heteroarylene), -0-, -S-, - R'-, -C(O)-, -OC(O)-, - C(0)-NR'-, -0-C(0)- R'-, or [-0-alk-] _n , or is two or more of these groups (for instance from two to ten of these groups), which may be the same or different, bonded to one another, wherein alk is C2-4 alkylene (which C2-4 alkylene may be linear or branched, and is typically unsubstitited) and n is from 2 to 200.

When a substituted Ci-200 hydrocarbylene, substituted Ci-200 alkylene, substituted C4-30 cycloalkylene, substituted C2-200 alkenylene, substituted C2-200 alkynylene or substituted C ₆ -i6 arylene (including heteroarylene), is present in L, it may be a perfluoro-substituted group, i.e. it may be C 1-200 perfluorohydrocarbylene, C 1-200 perfluoroalkylene, C4-30

perfluorocycloalkylene, C2-200 perfluoroalkenylene, C2-200 perfluoroalkynylene or C ₆ -i6 perfluoroarylene (including perfluoroheteroarylene).

Often, alk is ethylene, i.e. -CH2-CH2-. Typically, n is from 2 to 30, for instance from 2 to 20. More typically, alk is ethylene and n is from 2 to 10, for instance from 2 to 5. R' is generally H, unsubstituted Ci-4 alkyl or unsubstituted phenyl, and is usually H.

L may for instance be unsubstituted or substituted C1-60 hydrocarbylene, unsubstituted or substituted Ci-40 alkylene, unsubstituted or substituted C4-30 cycloalkylene, unsubstituted or substituted C2-60 alkenylene, unsubstituted or substituted C ₆ -i6 arylene (including

heteroarylene), -0-, -S-, -NR'-, -C(O)-, -OC(O)-, -C(0)-NR'-, -0-C(0)-NR'-, or [-0-alk-] _n , or L may be two or more of these groups (for instance from two to ten of these groups), which may be the same or different, bonded to one another, wherein alk is C2-4 alkylene (which C2-4 alkylene may be linear or branched, and is typically unsubstitited) and n is from 2 to 200. Often, alk is ethylene, i.e. -CH2-CH2-. Typically, n is from 2 to 30, for instance from 2 to 20. More typically, alk is ethylene and n is from 2 to 10, for instance from 2 to 5. R' is generally H, unsubstituted Ci-4 alkyl or unsubstituted phenyl, and is usually H. L may for instance be unsubstituted Ci-20 hydrocarbylene, unsubstituted Ci-20 alkylene, unsubstituted or substituted C4-30 cycloalkylene, unsubstituted or substituted C ₆ -i6 arylene (including heteroarylene), -0-, -S-, - R'-, -C(O)-, -OC(O)-, -C(0)- R'-, -0-C(0)- R'-, or [-0-alk-]n, or two or more of any of these groups (for instance from two to five of these groups), which may be the same or different, bonded to one another, wherein alk is C2-4 alkylene (which C2-4 alkylene may be linear or branched, and is typically unsubstitited) and n is from 2 to 20. Often, alk is ethylene, i.e. -CH2-CH2-. Typically, n is from 2 to 10, for instance from 2 to 5. More typically, alk is ethylene and n is from 2 to 10, for instance from 2 to 5. R' is generally H, unsubstituted Ci-4 alkyl or unsubstituted phenyl, and is usually H.

In some embodiments, the linker group, L, is a group of formula -L ³ -L ² -L ^x - wherein:

L ¹ is bonded to Tag and is unsubstituted or substituted Ci-200 hydrocarbylene, unsubstituted or substituted C ₆ -i6 arylene or heteroarylene, or [-0-alk-] _n , wherein alk is linear or branched unsubstituted C2-4 alkylene and n is from 2 to 200;

L ² is a single bond, unsubstituted or substituted Ci-200 hydrocarbylene, -0-, -N(R')-, - C(O)-, -C(0)-N(R')- or -0-C(0)- R'-; and

L ³ is a single bond, -0-C(0)- R'-, unsubstituted or substituted C ₆ -i6 arylene or heteroarylene,

wherein R' is H, unsubstituted Ci-4 alkyl or unsubstituted phenyl.

Thus, the linker group, L, may be a group of formula -L ³ -L ² -L ^x - wherein:

L ¹ is bonded to Tag and is unsubstituted or substituted Ci-50 hydrocarbylene, unsubstituted or substituted C ₆ -i6 arylene or heteroarylene, or [-0-alk-] _n , wherein alk is linear or branched unsubstituted C2-4 alkylene and n is from 2 to 50;

L ² is a single bond, unsubstituted or substituted Ci-50 hydrocarbylene, -0-, -N(R')-, - C(O)-, -C(0)-N(R')- or -0-C(0)- R'-; and

L ³ is a single bond, -0-C(0)- R'-, unsubstituted or substituted C ₆ -i6 arylene or heteroarylene,

wherein R' is H, unsubstituted Ci-4 alkyl or unsubstituted phenyl.

The linker group, L, may for instance be a group of formula -L ³ -L ² -L ^x - wherein:

L ¹ is bonded to Tag and is unsubstituted or substituted Ci-20 alkylene, unsubstituted or substituted C ₆ -i6 arylene or heteroarylene, or [-0-alk-] _n , wherein alk is -CH2CH2- and n is from 2 to 50, for instance from 2 to 10, or from 2 to 6;

L ² is a single bond, unsubstituted or substituted Ci-20 alkylene, -0-, -N(R')-, -C(O)-, - C(0)-N(R')- or -0-C(0)- R'-; and L ³ is a single bond, -0-C(0)-NR'-, unsubstituted or substituted C ₆ -i6 arylene or heteroarylene,

wherein R' is H, unsubstituted Ci-4 alkyl or unsubstituted phenyl.

R' is typically H.

The hydrophobic group, R, in the tracer compound may for instance be a group of any one of the following formulae:

In some embodiments, the hydrophobic group, R, is a group of formula (III)

X-Y-Z- (III) wherein:

Z is unsubstituted or substituted C2-60 alkylene;

Y is N(R') or -C(0)N(R')-, wherein R' is H, unsubstituted or substituted Ci-4 alkyl or unsubstituted or substituted phenyl; and

X is H or unsubstituted or substituted Ci-200 alkyl.

Typically, when R is a group of formula (III):

Z is bonded to the 5' end of Tag and is unsubstituted or substituted C4-20 alkylene;

Y is N(R') or -C(0)N(R')-, wherein R' is H, unsubstituted Ci-4 alkyl or unsubstituted phenyl; and

X is H or unsubstituted or substituted Ci-40 alkyl.

More typically, when R is a group of formula (III):

Z is bonded to the 5' end of Tag and is unsubstituted C3-20 alkylene;

Y is -N(H)- or -C(0)N(H)-; and

X is H or unsubstituted C4-30 alkyl.

Advantageously, tracer compounds comprising a hydrophobic group, R, of formula (III) showed a high tendency to remain with fuel oil hydrocarbons even when extensively and vigorously water washed, and yet could easily be extracted from the fuel oil hydrocarbons for analysis, if required, using an aqueous buffer solution comprising surfactants, for instance a non-ionic surfactant.

The hydrophobic group, R, of formula (III), may for instance be:

In another embodiment, the hydrophobic group, R, comprises a hydrophobic polymer. The polymer may be a synthetic conjugated polymer, which is hydrophobic.

R in this embodiment may be a polymer which is bonded to Tag directly, e.g. via a covalent bond. The polymer is often covalently bonded to the 5' end of Tag, usually to an oxygen atom of the terminal phosphate group at the 5' end of Tag.

Alternatively, the polymer may be bonded to Tag via a linker group, which may be a linker group, L, as defined hereinbefore. The linker is often covalently bonded to the 5' end of Tag, usually to an oxygen atom of the terminal phosphate group at the 5' end of Tag. Accordingly, R may comprise said hydrophobic polymer and a linker group, L, as defined hereinbefore.

Any suitable polymer may be employed, as long as it is hydrophobic so that it may aid dissolution of the tracer compound into the apolar medium. Hydrophobic polymers are well known in the art and include, hydrocarbon polymers. Accordingly, the hydrophobic polymer may be a hydrocarbon polymer. The hydrocarbon polymer may, for example, be a hydrocarbon polymer which has a molecular weight of at least 1,800 Da. The hydrocarbon polymer may, for instance, be a polyolefin, for instance polyethylene, polypropylene, polymethylpentene, polybutene-1; or a polyolefin elastomer, such as, for example, polyisobutylene, ethylene propylene rubber, and ethylene propylene diene monomer (M- class) rubber.

Encapsulation of the tracer compound

The tracer compound employed in the present invention, whether it be unmodified, or modified with (i) a hydrophobic or hydrophilic group and/or (ii) a fluorescent moiety, may be encapsulated within an encapsulation material in order to protect the tracer. Encapsulation may for instance be used to protect the tracer compound when the product of wood processing is being produced in the presence of the tracer, and relatively harsh reaction conditions are necessary in order to produce the product of wood processing. Alternatively, encapsulation may protect the tracer compound whilst it is present in the product of wood processing, and, for example, the product is exposed to harsh conditions.

The encapsulation material may be a protective polymer, a hydrocarbon wax or a resin. The protective polymer may, for instance, be gelatin. Alternatively, the protective polymer may be a high melting acrylate, methacrylate or styrene based polymer.

The protective polymer may for instance be an acrylate-, methacrylate- or styrene- based polymer, a methyl methacrylate polymer, a vinylpyrrolidone polymer, a polyurethane polymer, a polystyrene polymer, a polyethylene oxide polymer, a polyethylene glycol polymer, an alkylpolyether polymer, or an epoxy polymer, any of these polymers optionally being cross-linked. As described in WO 2012/136734, encapsulation with such polymers may be achieved by interfacial polymerisation in emulsions. This may take place at ambient conditions, so as to avoid exposure of the oligonucleotide of the tracer compound to high temperatures during encapsulation, and the capsule size may be varied from nanometres to microns by choosing either (nano) emulsions or suspensions at the starting point. A disulphide cross-linker may be used to increase the solvent and thermal resistance of the coating. Moreover, the cross-links can be reduced under relatively mild conditions by, for example, dithiothreitol (DTT) reagents, which provides a means for selectively degrading the coating of the particles and so releasing the tracer compound comprising the synthetic oligonucleotide. The capsule may in this way be adapted to be degradable in order selectively to release the tracer compound therefrom for analysis.

Thus, the encapsulation material (protective polymer) may comprise a linear polymer containing degradable co-monomers or a cross-linked polymer containing degradable cross- linkers. The encapsulating polymer may include a chemical grouping adapted to be selectively broken thereby to degrade the particle to release the tracer compound therefrom for analysis. The breakable chemical grouping may for instance be an ester, urethane, carbonate, disulphide or amine group, and/or may be adapted to be reduced using a reagent thereby to degrade the particle to release the tracer compound therefrom for analysis. The breakable chemical grouping may for instance be a disulphide adapted to be reduced using a dithiothreitol (DTT) reagent (thereby to degrade the encapsulation material to release the tracer therefrom for analysis).

Marker material ("flag") comprising a detectable label

The product of wood processing typically further comprises a marker material (also termed a "flag") which comprises a detectable label, for instance a fluorescent molecule. The marker material is different from the tracer compound and generally does not itself comprise a nucleic acid. The marker material is one whose presence in a product of wood processing can easily be detected, for instance within a few seconds or minutes, and preferably by using a dedicated, portable reader. The marker material is typically present at a surface of the product of wood processing, for instance at the surface of a wood (e.g. timber or engineered wood) product, so that the presence of the marker can easily be detected.

Such a marker material can be included in a product of wood processing whenever a tracer compound is included. The presence of the marker material can thereby allow for quick and easy confirmation, at a later point in time, e.g. using a portable reader, that a tracer compound comprising an oligonucleotide encoding information is present in the product. If the marker material is detected, the person detecting the marker can then decide to go ahead and have the tracer compound recovered from the product and analysed, if desired, so that the encoded information can be recovered. The marker material is typically present in the same portion or portions of the product of wood processing as the tracer compound, allowing for the location of the tracer compound in the product to be determined readily. The detectable label is preferably of the type that will allow the person testing the product of wood processing to determine the presence or absence of the marker material relatively quickly, preferably within a few seconds or minutes. The detection procedure preferably does not involve the use of complex analytical procedures and techniques. The testing procedure is preferably such that it can be conducted on site, i.e., without sending samples to a laboratory.

The detectable label may for instance be a luminescent, for instance a fluorescent or phosphorescent, label. It may for instance be a luminescent, fluorescent or phosphorescent compound, or another label providing a photometric signal. The detectable label may for instance emit visible light upon excitation such that the label may readily be detected by the human eye, upon illumination of the detectable label using light of the appropriate wavelength.

Suitable detectable labels are fluorescent substances, especially fluorescent dyes.

Suitable fluorescent dyes include (but are not limited to): allophycocyanine, phycocyanine, phycoerythrine, rhodamine, oxazine, coumarin, fluoroscein derivatives, e.g., fluorescein isothiocyanate and carboxyfluoroscein diacetate, as well as Texas red, acridine

yellow/orange, ethidium bromide, propidium iodide, bis-benzamide etc.

The marker material may contain two (or more) types of detectable labels, each type bearing a differently coloured label. Qualitative differences in the signals from the labels, e.g., fluorescence wavelength, will distinguish the respective label populations. The distribution of the label types may be selected such that it is possible, by examining the frequency of each label in a given sample, to identify a particular labelled product's source or batch.

The marker material typically comprises particles which comprise a matrix material and the detectable label. The matrix material may be polymeric, for instance

poly(methylmethacrylate), polystyrene, polyethylene or polypropylene, or the matrix material may be glass, metal, or a metal oxide such as zirconia.

The particles may be microparticles, e.g. microbeads or microspheres. The term

"microparticle", as used herein, means a microscopic particle whose size is typically measured in micrometres (μιη). A microparticle usually has a particle size of greater than 0.1 μιη, and more typically has a particle size of greater than 0.5 μιη. The particle size of a microparticle is typically up to 500 μιη. Often, however, a microparticle has a particle size of up to 100 μιη. A microparticle may for instance have a particle size of from greater than 0.1 μιη to 500 μιη, for instance from 0.5 μιη to 500 μιτι, or from greater than 0.5 μιη to 500 μιη. For instance, a microparticle may have a particle size of from greater than 0.1 μιη to 100 μιη. A microparticle may for example be a particle having a particle size of from greater than 0.5 μπι to 100 μπι.

A particle, for instance a microparticle, may have a high sphericity, i.e. it may be substantially spherical or spherical. A particle with a high sphericity may for instance have a sphericity of from 0.8 to 1.0. The sphericity may be calculated as π* where V _P is the volume of the particle and ^ is the area of the particle. Perfectly spherical particles have a sphericity of 1.0. All other particles have a sphericity of lower than 1.0. A particle may alternatively be non- spherical. It may for instance be in the form of an oblate or prolate spheroid, and it may have a smooth surface. Alternatively, a non-spherical may be plate- shaped, needle-shaped or tubular. Microparticles which have a high sphericity, i.e. are substantially spherical are referred to herein as "microspheres". A plurality of such microparticles, for instance a plurality of the microparticles of the marker material described herein, may have an average (mean) sphericity of from 0.8 to 1.0.

The term "particle size", as used herein, means the diameter of the particle if the particle is spherical or, if the particle is non- spherical, the volume-based particle size. The volume-based particle size is the diameter of the sphere that has the same volume as the non- spherical particle in question.

Accordingly, the marker material typically comprises microparticles, for instance microspheres, which comprise a matrix material and the detectable label.

The detectable label is typically fluorescent, as explained above. Exemplary fluorescent microspheres include, but are not limited to FluoSpheres® and TransFluoSpheres®, which are polystyrene fluorescent microspheres commercially available from ThermoFisher Scientific. Fluorescent and phosphorescent polymer microspheres, including microspheres which emit bright colors when illuminated by UV light are available from Cospheric

(www.cospheric.com/UV_fluorescent_microspheres_beadsj3owd ers.htm), and are available in many particle sizes, colors, densities, and excitation and emission wavelength.

Other labels providing a photometric signal, including colloidal gold particles etc., may also be used. WO 94/04918 and WO 95/02702, the contents of which are incorporated by reference describe the use of marker materials comprising detectable labels, including fluorescent beads. Product of wood processing

The term "wood processing" as used herein, refers to the production of forest products, starting from felled trees, and progressing through to logs, sawn and planed timber, and engineered wood and wood pulp, and including products or by-products such tree sap and tall oil, and downstream products that can be produced from the by-products such as liquid biofuels produced from tree sap or tall oil, and lignocellulosic biomass products (such as pellets or briquettes) produced from residuals of timber processing (or as first step of mass processing) e.g. from wood chips, sawdust, bark chips, twigs, and wood shavings.

The product of wood processing of the invention, which comprises the tracer compound, and which optionally further comprises the marker material, may be any such forest product, including "upstream" products, which include, for instance, a felled tree or a log which has not yet been debarked, a debarked log or a timber product produced from such a tree or log, such as round timber or sawn timber (a subset of which is planed timber);

"midstream" products such as speciality timber products including constructions materials and furniture and timber components for furniture, engineered wood such as plywood or fibreboard; by-products such as wood chips, sawdust, bark chips, twigs, wood shavings and tree sap, and "downstream" products, which may be produced from by-products, such as for instance wood pulp and tall oil, lignocellulosic biomass, and biofuels.

Typically, the product of wood processing comprises wood, wherein the wood comprises said tracer compound. Optionally, the wood further comprises said marker material comprising a detectable label.

The tracer compound is typically present at a surface of said wood. When the product of wood processing further comprises said marker material, the marker material is also typically present at said surface of the wood, allowing for easy in situ detection of the marker material.

Preferably, the tracer compound is present at a surface of the wood and within the wood, beneath said surface. Embedding the tracer compound within the fabric of the wood beneath the surface ensures that the tracer compound may not easily be removed from the wood, e.g. by sanding its surface. When the product of wood processing further comprises said marker material, the marker material may or may not also be within the wood, beneath the surface.

The tracer compound may be present at a surface of the wood and within the wood, beneath said surface, up to a depth below the surface which is on average at least x cm. The value x may be 0.1 cm, for instance 0.5 cm, or 1 cm. Thus, the tracer compound may be present at a surface of the wood and within the wood, beneath said surface, up to a depth below the surface which is on average at least 1 cm. The value x may, for instance be 2 cm, for instance 5 cm or 10 cm. Thus, in some embodiments, the tracer compound is present at a surface of the wood and within the wood, beneath said surface, up to a depth below the surface which is on average at least 10 cm.

When the wood further comprises said marker material, the marker material may or may not also be within the wood, beneath the surface, up to a depth below the surface which is on average at least x cm as defined above.

In some embodiments, the tracer compound is present throughout said wood. It may for instance be distributed throughout the wood. Alternatively, the tracer compound may be present (i.e. distributed) throughout only a portion of the wood. The remainder of the wood may not contain any tracer compound or it may contain a different tracer compound, for instance one with a different unique sequence of nucleotides.

The product of wood processing may be timber, wherein the timber comprises said tracer compound. Optionally, the timber further comprises said marker material comprising a detectable label. The timber may be sawn timber (for instance planed timber), round timber, a felled tree, a log, or a speciality timber product.

The timber may for instance be sawn timber. Sawn timber is manufactured in a range of lengths and dimensions. High grade sawn and planed construction materials are typically produced at sawmills, and interior wood products including moulding, panelling, flooring and posts are typically produced at planing mills. Timber products are typically available as sawn, planed and treated (e.g. by pressure impregnation) to meet the needs of all types of construction and building operations. Sawn timber may be planed all round, i.e. regularised to a consistent finish. Timber, for instance sawn timber, may also be kiln dried, to make it lighter in weight and stronger. This also helps protect against decay, improves dimensional stability. The sawn timber may be planed timber.

The sawn timber may, for instance, be a saw log, planed timber, timber for use in construction, timber for use in an interior or exterior wood product, strength-graded timber, Canadian Lumber Standard (CLS), truss timber, roof truss timber, a joist, a post, a beam, timber framing, carcassing, studwork timber, a site peg, a batten, a plank, or a board. The sawn timber may for instance be a plank.

Alternatively, the timber may be round timber, i.e. timber which retains the round (i.e. substantially cylindrical) shape of a log or tree trunk, as opposed to being sawn into cuboid planks or boards. The round timber may for instance be a pole, a pile, a girder, a post, a corbel, a house stump, natural round softwood, natural round hardwood, and desapped hardwood.

The timber may, on the other hand, be a speciality timber product. It may for instance be furniture, a furniture component, a joinery product, skirting, an architrave, a matching, flooring, cladding, a lining board, shiplap, a decorative moulding, an architectural moulding, a section moulding, fencing, a porch canopy, a door lining, a door casing, a tongue and groove board; a floor board, a decking board, a scaffold board or a timber railway sleeper.

Another possibility is that the timber is a felled tree, for instance a felled tree in a forest clearing, or a log. The log may be a log bearing bark (i.e. a log that has not yet been debarked), for instance a log in a forest clearing or in a saw mill awaiting debarking. In such cases the tracer compound will typically be present at a surface of an exposed cross section of the trunk of the tree or at a surface of an exposed cross section of the log, for instance at one or both ends of the log.

Typically, the tracer compound is present at a surface of the timber. When the timber further comprises said marker material, the marker material is also typically present at said surface of the timber, allowing for easy in situ detection of the marker material.

Preferably, the tracer compound is present at a surface of the timber and within the timber, beneath said surface. Embedding the tracer compound within the timber ensures that the compound may not easily be removed from the timer, e.g. by sanding or planing its surface. When the timber further comprises said marker material, the marker material may or may not also be within the timber, beneath the surface.

The tracer compound may be present at a surface of the timber and within the timber, beneath said surface, up to a depth below the surface which is on average at least x cm. The value x may be 0.1 cm, for instance 0.5 cm, or 1 cm. Thus, the tracer compound may be present at a surface of the timber and within the timber, beneath said surface, up to a depth below the surface which is on average at least 1 cm. The value x may, for instance be 2 cm, for instance 5 cm or 10 cm. Thus, in some embodiments, the tracer compound is present at a surface of the timber and within the timber, beneath said surface, up to a depth below the surface which is on average at least 5 cm, for instance on average at least 10 cm, or, for example, on average at least 20 cm.

When the timber further comprises said marker material, the marker material may or may not also be within the timber, beneath the surface, up to a depth below the surface which is on average at least x cm as defined above. In one embodiment, the timber is a felled tree and said surface is a surface of an exposed cross section of the trunk of the tree. Alternatively, the timber may be a log, for instance a log bearing bark, and said surface may be a surface of an exposed cross section of the log.

In some embodiments, the tracer compound is present throughout the timber. It may for instance be distributed throughout the timber, evenly or unevenly. Alternatively, the tracer compound may be present (i.e. evenly or unevenly distributed) throughout only a portion of the timber. The remainder of the timber may not contain any tracer compound or it may contain a different tracer compound, for instance one with a different unique sequence of nucleotides.

The timber may be untreated or treated. One method of adding the tracer compound and/or the marker material to timber or any other wood product is by including the tracer compound and/or the marker material in the treatment material, for instance, in a

preservative.

The timber may for instance have been treated for protection against insect or fungal attack. Both low pressure and high pressure treatment processes are currently used for impregnation of timber to protect against insect and fungal attack.

Timber is often treated with a preservative to improve the timber's resistance to attack by wood destroying fungi and wood destroying insects. Durability is enhanced to a level suitable for the intended use. Often, such "treatment" does not afford the timber protection against weathering.

However, the timber may in some embodiments also have been treated for protection from the effects of weathering. Both untreated and treated timber (e.g. that is to be used externally) may be protected from the affects of weathering, for instance by the application of a coating or oil.

Preservative compositions that may be used for the treatment of timber to protect against insect or fungal attack (which may include the tracer compound and optionally the marker material, so that these are applied to the timber) include: water-borne preservatives (e.g. Copper Chrome Arsenate (CCA), Alkaline Copper Quaternary (ACQ), Copper azole), which are carried into the wood mixed in water; light organic solvent-borne preservatives (commonly called LOSPs, e.g. tributyl tin naphthenate (TBTN), azoles and the synthetic pyrethroids (e.g. permethrin)), which are carried into the wood mixed in a light organic solvent such as white spirit; envelope treatments - (e.g. blue pine) which are synthetic pyrethroids (e.g. bifenthrin, permethrin) dissolved in water or oil such as linseed oil and are applied by spraying or dipping to cover the timber in the preservative; oil-borne preservatives (e.g. pigment emulsified creosote (PEC)), which are carried into the wood as oil or mixed in oil and are used primarily for heavy duty timber construction and in the marine environment including utility poles, rail sleepers and marine piles.

The timber may be hardwood or softwood. Common softwood timbers which may be tagged with a tracer compound in accordance with the present invention include spruce and pine, although any softwood timber may in principle be tagged. Similarly, common hardwood timbers which may be tagged with a tracer compound include birch. Accordingly, the timber may be softwood, for instance spruce or pine. Alternatively, the timber may be hardwood, for instance birch.

As described hereinbefore, the product of wood processing typically comprises wood, wherein the wood comprises said tracer compound. Optionally, the wood further comprises said marker material comprising a detectable label.

In some embodiments of the present invention, the wood is engineered wood.

Engineered wood, also called composite wood, man-made wood, or manufactured board, includes a range of derivative wood products which are typically manufactured by binding or fixing the strands, particles, fibres, or veneers or boards of wood, together with adhesives, or other methods of fixation to form composite materials. Engineered wood products are used in a range of applications, including home construction to commercial buildings to industrial products, even for instance for joists and beams. Typically, engineered wood products are made from the same hardwoods and softwoods that can be used in timber manufacture.

Sawmill scraps and other wood waste can be used for engineered wood composed of wood particles or fibres, but whole logs are usually used for veneers, such as plywood, MDF or particle board. Some engineered wood products, like oriented strand board (OSB), can use trees from the poplar family, a common but non- structural species.

The tracer compound (and optionally said marker material comprising a detectable label) can be introduced into the wood raw materials before they are bound together, or for example can be introduced into a binder material that is used to bind the raw materials together, or for instance can be applied to the finished engineered wood product.

The engineered wood may for instance be plywood; chipboard; fibreboard; dry- processed fibreboard (for instance, MDF); wet-processed fibreboard (for instance softboard or hardboard); oriented strand board (OSB); particleboard; a reconstituted wood panel; an I- beam; glued laminated timber (glulam); laminated veneer lumber (LVL); or laminated strand lumber (LSL). Wood constitutes the majority of biomass that is burned for fuel and comes in the forms firewood, chips, pellets, and sawdust.

Accordingly, the product of wood processing may be lignocellulosic biomass, wherein the lignocellulosic biomass comprises said tracer compound. Optionally, the lignocellulosic biomass further comprises said marker material comprising a detectable label.

The product of wood processing, lignocellulosic biomass, employed in the present invention, is wood-derived biomass. It typically comprises wood (including bark), which is often in mechanically broken-down form, e.g. in the form of chips, shavings, sawdust. The mechanically broken-down wood may have been obtained from twigs, small branches or bark. This woody material is typically reconstituted into pellets or briquettes, optionally with the aid of a binder which binds the woody material together, or simply by mechanically compressing the woody material together.

Accordingly, when the product of wood processing is lignocellulosic biomass, the lignocellulosic biomass typically comprises reconstituted wood. Often, the lignocellulosic biomass comprises reconstituted wood from wood chips, wood shavings, sawdust, bark or twigs. Typically, the lignocellulosic biomass is in pellet form or in the form of a briquette. However, it may take any other suitable form.

Lignocellulosic biomass is the feedstock for the pulp and paper industry. This energy- intensive industry focuses on the separation of the lignin and cellulosic fractions of the biomass.

The product of wood processing may be wood pulp, wherein the wood pulp comprises said tracer compound. Optionally, the wood pulp further comprises said marker material which comprises a detectable label.

In addition to water, wood (used to make wood pulp) contains three main

components, namely cellulose fibres (desired for papermaking), lignin (a polymer which binds the cellulose fibres together) and hemicelluloses (shorter branched carbohydrate polymers). The pulping process breaks down the bulk structure of the fibre source, i.e. the wood raw material, which is typically in the form of wood chips, softwood thinnings, and roundwood, into the constituent fibres. Chemical pulping achieves this by selectively degrading and washing away the lignin and hemicellulose components, leaving behind the desired cellulose fibres. Mechanical pulping, on the other hand, physically tears the cellulose fibres one from another (and as a result much of the lignin then remains adhered to the fibres). Other pulping methods, including hybrids of the above, are also known, for instance thermomechanical pulping, also known as TMP, and chemithermomechanical pulping, also known as CTMP. Thus, wood pulp can be manufactured using mechanical, semi-chemical or fully chemical methods (kraft and sulfite processes). The finished product may be either bleached or non-bleached, depending on the customer requirements. Bleaching may be TCF (total chlorine free) or ECF (elementary chlorine free).

Wood pulp typically comprises cellulose fibres from wood (e.g. at about 90 wt. %) and moisture (e.g. at about 10 wt. %).

The tracer compound may be incorporated into the wood pulp by adding it to the wood raw material prior to the pulping process, adding it during the pulping process, or by adding it at the end of the pulping process, once the wood pulp has been produced. If the pulping process is a chemical or thermal process that involves harsh conditions (e.g.

bleaching or high temperatures) the tracer compound may be encapsulated by an

encapsulation material, as described hereinbefore, before it is added in order to protect the tracer compound from degradation under the harsh conditions.

A marker material as defined herein which comprises a detectable label, may be added at the same stage as the tracer compound. Alternatively, it may be added at the end of the pulping process, once the wood pulp has been produced, irrespective of when the tracer was added.

The wood pulp may be pulp for making paper ("paper pulp") or it may be dissolving pulp.

Paper pulp is generally used to make paper or cardboard, for example fine paper, printer paper, coloured paper, toilet paper, coffee filters, packaging paper, facial tissues, kitchen paper, sterile paper, labels and cardboard.

Dissolving pulp is used in the textile industry for the production of viscose and lyocell (and the cellulose in the pulp must be dissolved when such products are produced). Viscose is both a semi-synthetic fibre, called viscose rayon, and a solution of cellulose xanthate. The latter is produced by treating dissolving pulp with aqueous sodium hydroxide and carbon disulfide which is used to spin the viscose rayon fibre. Clothing, upholstery fabric, sponge cloths or wet wipes may be made from viscose. Lyocell (a cellulosic fibre) is a form of rayon which consists of cellulose fibre made from dissolving pulp (bleached wood pulp). Products such as clothing, bedding, textiles or duvets may contain lyocell.

The product of wood processing may in one embodiment be fibre from forest raw material, wherein the fibre comprises said tracer compound. The fibre may for instance be viscose or lyocell. Optionally, the fibre further comprises said marker material which comprises a detectable label. A well known by-product of the pulping process, and in particular of the Kraft process of wood pulp manufacture, is tall oil. Indeed, tall oil is the third largest chemical byproduct in a Kraft mill after lignin and hemicellulose. During pulping, tall oil is produced from the soap formed during the step of cooking the wood raw material (e.g. wood chips). Tall oil contains resin acids (including abietic acid and its isomers), fatty acids (including palmitic acid, oleic acid and linoleic acid), fatty alcohols, unsaponifiable sterols (5-10%), some sterols, and other alkyl hydrocarbon derivates. By fractional distillation the rosin (resin acid) content can be reduced to 10-35%, to obtain "tall oil rosin". By further reduction of the rosin content to 1-10%, "tall oil fatty acid" (TOFA) can be obtained, which is cheap, mostly comprise of oleic acid, and is a source of volatile fatty acids.

The product of wood processing may in one embodiment be an oil which comprises a fatty acid, wherein the oil comprises said tracer compound. Optionally, the oil further comprises said marker material which comprises a detectable label.

The fatty acid is generally a compound of formula R ^FA -C(0)OH, wherein R ^FA is unsubstituted C4-24 alkyl or unsubstituted C4-24 alkenyl. More typically, R ^FA is unsubstituted C13-21 alkyl or unsubstituted C13-21 alkenyl. The oil may comprise two or more different fatty acids selected from fatty acids of formula R ^FA -C(0)OH, wherein R ^FA is unsubstituted C4-24 alkyl or unsubstituted C4-24 alkenyl and is more typically unsubstituted C13-21 alkyl or unsubstituted C13-21 alkenyl. The oil may for instance comprise three or more different such fatty acids. It may for instance comprise palmitic acid, oleic acid and linoleic acid.

The product of wood processing may in one embodiment be tall oil, wherein the tall oil comprises said tracer compound. Optionally, the tall oil further comprises said marker material which comprises a detectable label. The tall oil may be crude tall oil, tall oil rosin, or tall oil fatty acid.

The product of wood processing is often other than paper. The product of wood processing may for instance be other than paper and other than cardboard.

The product of wood processing may in one embodiment be tree sap, wherein the tree sap comprises said tracer compound. Optionally, the tree sap further comprises said marker material which comprises a detectable label.

Interest in lignocellulosic biomass as a precursor to liquid fuels has increased over recent years. In particular, the fermentation of lignocellulosic biomass, or tree sap, to ethanol is an attractive route to fuels that supplements the fossil fuels. Ethanol fuel is the most common biofuel worldwide, particularly in Brazil. Aside from ethanol, many other lignocellulose-derived fuels are of potential interest, including butanol, dimethylfuran, and gamma- Valerolactone. The production of ethanol from tree sap is described in US2011/0008859, the contents of which are incorporated herein by reference.

The production of biodiesel from tall oil is also of considerable interest. Some wood pulp producing companies already supply tall oil from their pulping process for the production of biodiesel. Biodiesel comprises unsubstituted C1-3 alkyl (typically methyl) esters of fatty acids, and biodiesel can therefore be produced by esterifying the fatty acids in tall oil (which include palmitic acid, oleic acid and linoleic acid). Biodiesel from tall oil usually comprises a fatty acid ester of formula R ^FA C(0)OR ^E , wherein R ^FA is unsubstituted C4-24 alkyl or unsubstituted C4-24 alkenyl, and R ^E is unsubstituted C1-3 alkyl. More typically, R ^FA is unsubstituted C13-21 alkyl or unsubstituted C13-21 alkenyl. More typically, R ^E is methyl. The biodiesel may comprise two or more different fatty acid esters selected from fatty acid esters of formula R ^FA C(0)OR ^E , wherein R ^FA is unsubstituted C4-24 alkyl or unsubstituted C4-24 alkenyl and is more typically unsubstituted C13-21 alkyl or unsubstituted C13-21 alkenyl, and wherein R ^E is unsubstituted C1-3 alkyl and is more typically methyl. The oil may for instance comprise three or more different such fatty acid esters. Biodiesel from tall oil usually comprises a C1-3 alkyl ester, and more typically a methyl ester, of palmitic acid, oleic acid or linoleic acid. It typically for instance comprises a C1-3 alkyl ester of oleic acid, for instance methyl oleate. Biodiesel from tall oil may for instance comprise a mixture of methyl palmitate, methyl oleate and methyl linoleate.

Turpentine may also be recovered from the wood pulping process, from gases that are formed during the cooking step. A major component of turpentine is pinene. Generally, turpentine comprises terpenes, including the monoterpenes alpha-pinene and beta-pinene, and (lesser amounts of) carene, camphene, dipentene, and terpinolene.

The tracer compound may be incorporated into biofuel by inclusion in a starting material used in the biofuel production process (e.g. via its inclusion in tall oil,

lignocellulosic biomass, or tree sap that is converted into biofuel), by adding it during the biofuel production process, or by adding it at the end of the biofuel production process, once the biofuel has been produced. If the biofuel production process involves harsh conditions the tracer compound may be encapsulated beforehand by an encapsulation material, as described hereinbefore, in order to protect the tracer compound from degradation under the harsh conditions.

A marker material as defined herein which comprises a detectable label, may be added at the same stage as the tracer compound. Alternatively, it may be added at the end of the biofuel production process, once the biofuel has been produced, irrespective of when the tracer was added.

Accordingly, in one embodiment the product of wood processing is a biofuel, wherein the biofuel comprises said tracer compound. Optionally, the biofuel further comprises said marker material which comprises a detectable label.

The biofuel is typically a liquid biofuel. This means that the biofuel is in the liquid state at standard ambient temperature and pressure (SATP), i.e. at a temperature of 298.15 K (25 °C) and at 100,000 Pa (1 bar, 14.5 psi, 0.9869 atm).

The liquid biofuel may comprise an alcohol, for instance ethanol or butanol;

biodiesel; turpentine, dimethylfuran; or gamma- Valerolactone. Typically, the liquid biofuel comprises an alcohol, for instance ethanol or butanol; biodiesel; or turpentine. More typically, the liquid biofuel comprises an alcohol, for instance ethanol, or biodiesel.

The liquid biofuel may for instance comprise ethanol, which may be ethanol obtained from tree sap.

Alternatively, the liquid biofuel may be biodiesel, for instance biodiesel obtained from an oil as defined above which comprises a fatty acid of formula R ^FA -C(0)OH, wherein R ^FA is unsubstituted C4-24 alkyl or unsubstituted C4-24 alkenyl. The liquid biofuel may for instance be biodiesel obtained from tall oil.

The biodiesel may comprise a fatty acid ester of formula R ^FA C(0)OR ^E , wherein R ^FA is unsubstituted C4-24 alkyl or unsubstituted C4-24 alkenyl, and R ^E is unsubstituted C1-3 alkyl. More typically, R ^FA is unsubstituted C13-21 alkyl or unsubstituted C13-21 alkenyl. More typically, R ^E is methyl. The biodiesel typically comprises a plurality of such fatty acid esters, for instance two, three, or more different such fatty acid esters. The biodiesel may for instance comprises a C1-3 alkyl ester, and more typically a methyl ester, of palmitic acid, oleic acid or linoleic acid. It typically for instance comprises a C1-3 alkyl ester of oleic acid, for instance methyl oleate. The biodiesel may for instance comprise one of, two of, or all three of, methyl palmitate, methyl oleate and methyl linoleate.

The product of wood processing, which comprises said tracer compound, and optionally further comprises the marker material as defined herein, may for instance be: a product from pulp other than paper, for instance containerboard, viscose, lyocell, a cellulose ether, or a cellulose ester; a by-product of pulp production, including for instance tar, a phenol, a pinene, or pine soap; or a by-product of wood processing, for instance, wood chips, bark chips, wood pellets or wood shavings. Products of wood processing marked with an ink comprising the tracer compound

As described hereinbefore, the product of wood processing may comprise wood, wherein the wood comprises said tracer compound. In such embodiments, the tracer compound may be present in an ink with which a surface of the wood is marked. This allows for products of wood processing to be marked with information, such as text, a bar code, and/or a two-dimensional (2D) data matrix code in order to provide useful data about the product, as well as to mark the product with the tracer compound.

Accordingly, in one embodiment the invention provides a product of wood processing which comprises wood, wherein the surface of the wood is marked with an ink which comprises the tracer compound. The tracer compound may be as further defined anywhere herein. The product of wood processing whose surface is marked with the ink may for instance be timber or engineered wood, and is typically timber, which timber may be as further defined anywhere herein.

In such embodiments, a surface of the wood bears an ink mark, and the tracer compound is present at the same surface of the wood. This is because the ink mark is generally produced by printing ink comprising the tracer compound onto the surface of the wood in question, usually by an inkjet printer. Any solvent present in the ink being printed may evaporate on or shortly after printing, but the other components of the ink, in particular the tracer compound and any colouring agent that is present, e.g. any pigment or dye in the case of a visible ink, or in the case of a so-called "invisible ink" any material which is invisible unless exposed to a stimulus such as ultraviolet light (e.g. any fluorescent material), will remain present together at the same surface of the wood, i.e. at the surface of the wood which is marked with the ink. The ink thereby reveals the particular location of the tracer compound on the wood product to those who know that the ink in question is associated with a tracer compound. The tracer compound can then be retrieved and analysed, if desired, to obtain information therefrom about the wood product. Also, the ink mark can itself provide useful information about the product to a reader, e.g. in the form of text, a symbol, a picture, a logo, a barcode and/or a data matrix code, whether or not the person viewing the mark knows that the ink is associated with a tracer compound. Indeed, the inventors have found that a very high quality, durable print can be achieved on rough, planed or finished timber using ink containing the tracer compound, such that any text, symbol, picture, logo, barcode or a data matrix code printed on the timber using the ink can easily be read thereafter, and also such that the tracer compound can be retrieved therefrom and analysed thereafter.

The ink may be visible ink or so-called "invisible ink". The term "invisible ink", as used herein, refers to an ink which, after it has been printed onto a surface, is not visible to the naked eye but can be detected by other means. Typically, it is ink which, after it has been printed onto a surface, is invisible unless exposed to a stimulus. Often, the stimulus is non-visible light of a particular wavelength, for instance ultraviolet light. Thus, instead of containing a colouring agent such as a visible pigment or dye, an invisible ink may contain a fluorescent material that is colourless unless excited by non-visible light of a particular wavelength, typically ultraviolet light, in which case it fluoresces. Such ink can be revealed using a standard "UV scanner", i.e. a device which shines UV light on a product to reveal invisible ink markings, or for instance, if the invisible ink mark is in the form of a bar code, using a standard covert bar code scanner (see for instance www.uvreaders.com). When the stimulus is ultraviolet (UV) light, the invisible ink may be referred to as an invisible UV ink. This is not to be confused with a UV-curable ink, which is an ink that contains a curable monomer instead of a solvent, wherein the cure (drying) takes place through the polymerisation of the monomers under a UV (ultra violet) light. This avoids the need for solvent evaporation during the curing phase.

In one embodiment, therefore, the ink is visible ink. The ink may for instance be black ink.

In another embodiment, the ink is invisible ink. In other words, the ink may be ink which is invisible, or colourless, unless exposed to a stimulus. The stimulus may be non- visible light, or heat. Often, the stimulus is non-visible light of a particular wavelength, usually ultraviolet light. Thus, the invisible ink may be an invisible UV ink. The invisible ink may comprise a luminescent, for instance a fluorescent or phosphorescent, material. The material may be one which glows upon illumination using light of the appropriate

wavelength. The material may be as further defined hereinbefore for the detectable label. Thus, the invisible ink may comprise a luminescent, fluorescent or phosphorescent material. The material may be one which emits visible light upon excitation, such that the ink may readily be viewed by the human eye upon illumination of the ink using light of the appropriate wavelength. Suitable fluorescent substances and materials (e.g. particles) which could be employed in an invisible ink are discussed above in relation to the detectable label.

As discussed above, in these embodiments, the surface of the wood is marked with an ink which comprises the tracer compound. Usually, the surface of the wood is marked with an optical representation of data using the ink. The data typically comprises information about the wood product, for instance as discussed herein under the heading "track and trace concept. The optical representation of data may be readable by a human, i.e. for instance it may be text, a symbol, sign or picture. Alternatively, the optical representation of data may be a machine-readable optical representation of data, for instance a barcode or a two- dimensional data matrix code. Barcodes and two-dimensional data matrix codes are well- known, and may be read using a scanner (e.g. a barcode scanner or a camera on a

smartphone) in conjunction with appropriate software. A two-dimensional data matrix code can advantageously provide a link to a website, such that a person scanning the code, for instance using a smartphone, will be taken to the website in question to retrieve information about the product.

Usually, the surface of the wood is marked with one or more of text, a barcode and a data matrix code (i.e. a two-dimensional data matrix code), using the ink.

The surface of the wood may for instance be marked using the ink with: text and a barcode, text and a data matrix code, or a barcode and a data matrix code.

The surface of the wood is often marked with all three of text, a barcode and a data matrix code, using the ink. An example of this is shown in Figure 4.

Typically, the data matrix code provides a link to a website. The website typically provides information about the wood product.

Packaged product of wood processing

The inventors have found that ink of the invention containing a tracer compound can also be printed, e.g. using an inkjet printer, onto packaging material such as plastic, to form a high-quality optical representation of data on the packaging, using the ink. The data typically comprises information about the packaged product, for instance as discussed herein under the heading "track and trace concept' . This allows for a packaged product of wood processing to be marked with information, such as text, a bar code, and/or a two-dimensional (2D) data matrix code, in order to provide useful data about the product contained within the packaging, as well as to mark the packaged product with the tracer compound. The packaged product of wood processing may for instance be a batch of sawn timber planks packaged in a sawmill.

Accordingly, the invention provides a packaged product of wood processing, which comprises (a) at least one product of wood processing, and (b) packaging material, wherein a surface of the packaging material is marked with an ink which comprises a tracer compound comprising a synthetic oligonucleotide. The tracer compound may be as further defined anywhere herein.

The at least one product of wood processing is packaged in the packaging material. Usually, a plurality of products of wood processing, for instance a plurality of wood products, are packaged in the packaging material. Thus, a batch of products of wood processing, for instance a batch of wood products (e.g. timber planks), may be packaged in the packaging material.

Each product of wood processing that is packaged may be a product of wood processing as defined anywhere herein, and is typically a wood product, more typically a timber product, for instance a sawn timber product such as a board or plank. The packaged product of wood processing may for instance comprise sawn timber planks or boards within the packaging material.

Each product of wood processing that is packaged need not comprise a tracer compound itself. Thus, the packaged product of wood processing of the invention may comprise (a) said at least one product of wood processing, wherein the at least one product of wood processing does not comprise a tracer compound, and (b) said packaging material, wherein a surface of the packaging material is marked with an ink which comprises a tracer compound comprising a synthetic oligonucleotide.

Often, however, the product or products of wood processing that are packaged do comprise a tracer compound as defined herein. Thus, often, the packaged product of wood processing of the invention comprises (a) at least one product of wood processing which comprises a tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide, and (b) packaging material, wherein a surface of the packaging material is marked with an ink which comprises a tracer compound comprising a synthetic

oligonucleotide. In this embodiment, the or each product of wood processing which is packaged may be a product of wood processing as defined anywhere herein which comprises a tracer compound.

In the packaged product of wood processing of the invention, the packaging material may be any suitable packaging material for the at least one product of wood processing. The at least one product of wood processing is typically a wood product, for instance timber; the packaging material may therefore be any suitable packaging material for packaging timber. Hard-wearing plastic is typically employed. The packaging material often therefore comprises plastic.

A surface of the packaging material is marked with an ink which comprises a tracer compound comprising a synthetic oligonucleotide. Thus, a surface of the packaging material bears an ink mark, and the tracer compound is present at the same surface of the packaging material. The ink may be visible ink or invisible ink, as defined above for the product of wood processing marked with an ink comprising the tracer compound. It may for instance be visible black ink, or it may be UV ink, visible upon illumination with ultraviolet light.

Usually, the surface of the packaging material is marked with an optical

representation of data using the ink. The data typically comprises information about the wood product, for instance as discussed herein under the heading "track and trace concept'. The optical representation of data may be readable by a human, i.e. for instance it may be text, a symbol, sign or picture. Alternatively, the optical representation of data may be a machine- readable optical representation of data, for instance a barcode or a two-dimensional data matrix code (both of which may be readable by a camera or scanner, in conjunction with appropriate software).

Usually, the surface of the packaging material is marked with one or more of text, a barcode and a data matrix code (i.e. a two-dimensional data matrix code), using the ink.

The surface of the packaging material may for instance be marked using the ink with: text and a barcode, text and a data matrix code, or a barcode and a data matrix code.

The surface of the packaging material is often marked with all three of text, a barcode and a data matrix code, using the ink.

The data matrix code typically provides a link to a website. The website typically provides information about the product or products of wood processing (e.g. wood products) that are packaged.

Track and trace concept

Marking both unpackaged and packaged wood products with an ink comprising the tracer compound allows for the wood products to be marked with readable information, such as text, a barcode and a two-dimensional (2D) data matrix code, in order to provide useful data about the product, as well as to mark the product with the tracer compound. Marking can start in the forest, if desired, e.g. on a cross section, or a de-barked portion, of a felled tree trunk or log, using a handheld inkjet printer (data gun) with ink containing the tracer compound. Further marking can then occur at the saw mill, and also during subsequent storage, packaging, transportation and distribution of the wood product, all the way through to the customer and retailer. In this way a "track and trace" system can be implemented for wood products, whereby the wood's origin and subsequent processing history, from forest to customer, can be identified by reading the information printed by the ink, e.g. in the text, barcode, or 2D data matrix code, or indeed by analysing the information encoded in the synthetic oligonucleotide of the tracer compound. As mentioned above, tracking may start at the harvester site, e.g. in a forest where trees are felled to produce logs. At the harvester site, timber may be printed with information, such as text, a barcode and/or a data matrix code, using ink which comprises a tracer compound. The printed information (text, barcode and/or data matrix code) may usefully (i) identify the wood's origin, (ii) allow the timber to be "booked out" electronically when it leaves the harvester site, (iii) trigger payment of the harvester by the harvester's customer upon reception of the timber at the customer's sawmill or timber mill, and/or (iv) assist the customer with stock-in management at the mill. The oligonucleotide of the tracer compound in the ink can encode information which identifies the wood's origin, for instance by identifying the harvester that harvested the wood and the harvester site at which the wood was harvested.

Track and trace may then continue at the sawmill, after the logs are "booked in", when logs are cut into sawn timber, such as planks. The sawn timber may be marked at the sawmill, for instance on a production line at the mill, by printing information such as text, a barcode and/or a data matrix code, using ink which comprises a tracer compound. An example of such marking using inkjet printing technology in a sawmill is detailed in Example 7 herein. The printed information (text, barcode and/or data matrix code) and the tracer compound may usefully then create a link between the sawn timber produced and the logs from which the product came, so that the origin of the timber, e.g. the location and the harvester, may be identified on the sawn timber, as well as information on subsequent processing such as the sawmill and manufacturer.

The printed information (text, barcode and/or data matrix code) can also aid with serialization of the sawn timber at the mill, and categorization of the sawn timber by its production data. Information such as a serial number, production run data, and product characteristics, may all be specified or encoded within the text, barcode or data matrix code. Subsequent item aggregation into batches, and subsequent packaging of batches, can in this way be streamlined and simplified by electronic processing. The information in the text, barcode and/or data matrix code may also facilitate communication with the consumers of the product, in that full details of the product, including its origin, subsequent processing history, product characteristics and data, can be provided in a website that a consumer can easily access, for instance by scanning the data matrix code or barcode, or reading a text url.

Marketing data (consumer names, contact details, geographical locations) may then be fed back to the manufacturer based on consumer interaction with such websites. Geographical location of product may also be tracked. The information on the origin of the wood and its subsequent processing history may at the same time be encoded within the oligonucleotide in the ink, to provide a way to check, prove or certify that the product originates from a legal and sustainable source, and thereby deter counterfeiting and illegal deforestation.

Product of wood processing comprising more than one different tracer

The invention further provides a product of wood processing which comprises a plurality of tracer compounds, wherein each tracer compound in the plurality comprises a synthetic oligonucleotide, and wherein the oligonucleotide of each tracer compound in the plurality comprises a different unique sequence of nucleotides. Each tracer compound in the plurality may be as further defined herein, the product of wood processing may itself be as further defined herein, and the product of wood processing may optionally further comprise a marker material as defined herein which comprises a detectable label, or a plurality of different such marker materials as defined herein.

The product of wood processing which comprises a plurality of tracer compounds may for instance comprise wood, wherein the wood comprises said plurality of tracer compounds, and optionally further comprises a marker material as defined herein which comprises a detectable label.

The product of wood processing which comprises a plurality of tracer compounds may for instance be timber or engineered wood, wherein the timber or engineered wood comprises said plurality of tracer compounds, and optionally further comprises a marker material as defined herein which comprises a detectable label.

The product of wood processing which comprises a plurality of tracer compounds may for instance be wood pulp, wherein the wood pulp comprises said plurality of tracer compounds, and optionally further comprises a marker material as defined herein which comprises a detectable label.

The product of wood processing which comprises a plurality of tracer compounds may for instance be lignocellulosic biomass, wherein the lignocellulosic biomass comprises said plurality of tracer compounds, and optionally further comprises a marker material as defined herein which comprises a detectable label.

The product of wood processing which comprises a plurality of tracer compounds may for instance be a biofuel, wherein the biofuel comprises said plurality of tracer compounds. The product of wood processing which comprises a plurality of tracer compounds may for instance comprise wood, wherein a surface of the wood is marked with an ink which comprises at least one of said tracer compounds in the plurality, or indeed each of said tracer compounds in the plurality. Typically, the surface of the wood is marked with at least one optical representation of data using the ink. The data typically comprises information about the wood product, for instance as discussed herein under the heading "track and trace concept. The optical representation of data may be readable by a human, i.e. for instance it may be text, a symbol, sign or picture. Alternatively, the optical representation of data may be a machine-readable optical representation of data, for instance a barcode or a two- dimensional data matrix code (both of which may be readable by a camera or scanner, in conjunction with appropriate software). Usually, the surface of the packaging material is marked with one or more of text, a barcode and a data matrix code (i.e. a two-dimensional data matrix code), using the ink, and is often marked with all three of these using the ink. The surface of the wood may be marked with an ink, in this way, wherein the ink comprises said plurality of tracer compounds. The product of wood processing whose surface is marked with the ink may for instance be timber or engineered wood, wherein the timber or engineered wood comprises said plurality of tracer compounds. It is typically timber, which timber may be as further defined anywhere herein. The ink may be as further defined herein for the products of wood processing marked with an ink comprising the tracer compound. It may for instance be a visible ink, such as black ink, or an invisible ink, such as a UV ink.

The oligonucleotide of each tracer compound in the plurality comprises a different unique sequence of nucleotides. Typically, each of the different unique sequences of nucleotides will represent different information. For instance, each of the different unique sequences of nucleotides may provide a different piece of information about the product of wood processing, be it timber or engineered wood, wood pulp, timber-derived biomass or biofuel. These may be different pieces of information about the history of the product in terms of its source and its whereabouts thereafter, e.g. that it is from a particular forest, has been processed at a particular timber mill. The tracer compounds may also provide information about the combining of differently-tagged products of wood processing. The plurality of tracer compounds may allow detailed information to be built up about the history of a particular product, for instance that it contains wood sourced from one, or more than one, particular forests, has been processed in a particular production facility, or more than one different production facilities, that the product contains different components from different batches or sources, or for instance that the product is contaminated with product from a different forest source or factory.

Often, the oligonucleotide of each tracer compound in the plurality further comprises one or more sequences that do not vary from tracer compound to tracer compound in the plurality. These are typically sequences that will recognise complementary primers for use in amplification (e.g. PCR amplification) or in sequencing of the amplified nucleic acid.

Composition

The invention further provides a composition which comprises: (a) a tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; and (b) a marker material comprising a detectable label. The tracer compound and marker material may be as further defined herein. The composition is typically a liquid, so that it can easily be applied to a product of wood processing, or to a precursor raw material that is used to produce a product of wood processing, or indeed can easily be added at an appropriate point during a process for producing a product of wood processing. The composition typically therefore further comprises a solvent. Often, the solvent is water. Such a composition can, for instance, be sprayed onto a product of wood processing.

Ink

The invention further provides an ink suitable for use in an inkjet printer, wherein the ink comprises a tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide. The tracer compound may be as further defined anywhere herein.

The ink is one which is suitable for use in an inkjet printer. The inkjet printer may be a thermal inkjet printer. A thermal inkjet printer typically works by using heat to eject droplets from ink from chambers in the print cartridge, causing vaporization of the ink in the chamber and the formation of a bubble, which causes a large pressure increase, propelling a droplet of ink onto the surface being printed. Such thermal inkjet printers are also known as bubble jet printers. Alternatively, the inkjet printer may be a piezoelectric inkjet printer, which works by having a piezoelectric crystal compress a chamber full of ink so that the ink is squirted out of a nozzle onto the surface being printed. Typically, the printer is a thermal inkjet printer and the ink is an ink which is suitable for use in a thermal inkjet printer.

The ink typically comprises said tracer compound, a colouring agent, and a solvent or monomer. The ink may be a visible ink, for instance a dark-coloured ink such as black ink or dark blue ink, or it may be a so-called "invisible ink". In a visible ink the colouring agent is typically a pigment or dye. Visible inks suitable for use in a thermal inkjet printer include solvent inks from the HP Thermal Inkjet 2.5 (TIJ) Industrial Ink portfolio which include a pigment or dye, including for instance: HP Black 4500 Ink, HP Versatile Black Ink, HP Fast Dry Black Ink, HP Black 1918 Ink, HP Durable Black Ink, HP Black 2531 Ink, HP Black 2560 Ink, HP Black 2570 Ink, HP Black 2580 Ink, HP Non-fluorescent Red Ink, HP Blue 2242 Ink, HP Spot Color Blue Ink, and HP Spot Color Red Ink. Thus, the ink employed may be any of the aforementioned solvent inks to which a tracer compound as defined herein has been added, in which case the ink is a visible ink which comprises a solvent, the tracer compound and a pigment or dye. Black visible inks are preferred.

Alternatively, the visible ink may be a UV-curable ink suitable for use in an inkjet printer. An example of a UV-curable ink that is suitable for use in an inkjet printer is EvoJet 1700 UV ink. Thus, the UV-curable ink may be EvoJet 1700 UV ink to which a tracer compound as defined herein has been added.

In an invisible ink, the colouring agent is a material which is invisible (i.e. colourless) unless exposed to a stimulus. The stimulus may be non-visible light, or heat. Often, the stimulus is non-visible light of a particular wavelength, usually ultraviolet light. Thus, the invisible ink may be an invisible UV ink. The invisible ink may comprise a luminescent, for instance a fluorescent or phosphorescent, material as the colouring agent. The material may be one which glows upon illumination using light of the appropriate wavelength, for instance upon illumination with ultraviolet light. The material used for the colouring agent may be as further defined hereinbefore for the detectable label. Thus, the colouring agent in the invisible ink may comprise a luminescent, fluorescent or phosphorescent material. The material may be one which emits visible light upon excitation, e.g. by ultraviolet light, such that the ink may readily be viewed by the human eye upon illumination of the ink using light of the appropriate wavelength. Suitable fluorescent substances and materials (e.g. particles) which could be employed in an invisible ink as the colouring agent are discussed above in relation to the detectable label. Thus, in the invisible ink, the colouring agent is typically a fluorescent material. It may be a fluorescent material which is invisible (i.e. colourless) unless exposed to ultraviolet light.

Invisible inks are useful for customer or market compliance reasons, for instance because the customer or market requires the wood product not to be visibly marked. Invisible inks are also useful if the printed information is to be covert. The ink suitable for use in an inkjet printer may be an aqueous ink, a solvent ink, or a UV-curable ink. Typically it is a solvent ink or a UV-curable ink. Most often, it is a solvent ink.

An aqueous ink comprises (i) a solvent which comprises water, (ii) a colouring agent and (iii) said tracer compound. In an aqueous ink, the solvent may consist of water, or the solvent may comprise both water and one or more organic solvents (i.e. a mixture thereof), provided that water makes up at least 50% of the volume of the solvent, more typically at least 70% of the volume of the solvent. The tracer compound in the aqueous ink may be as defined anywhere herein. The colouring agent may be a pigment or dye (and the aqueous ink may be a visible ink, for instance a black ink) or the colouring agent may be a material which is invisible (i.e. colourless) unless exposed to a stimulus, as defined hereinbefore (and the aqueous ink may be an invisible ink). The colouring agent may for instance be a fluorescent material, e.g. a fluorescent material which is invisible (i.e. colourless) unless exposed to ultraviolet light.

A solvent ink comprises (i) an organic solvent, (ii) a colouring agent and (iii) said tracer compound. In a solvent ink, the organic solvent may be any suitable organic solvent or mixture of organic solvents. Typically, the organic solvent comprises ethanol. It may for example consist of ethanol. Water may also be present in the solvent ink, but typically the volume of water is less than 50% of the total volume of the water and the organic solvent. More typically, water is less than 30% of the total volume of the water and the organic solvent, for instance less than 5% of the total volume of the water and the organic solvent, or less than 1 % of the total volume of the water and the organic solvent. The tracer compound in the solvent ink may be as defined anywhere herein. The colouring agent may be a pigment or dye (and the solvent ink may be a visible ink, for instance a black ink) or the colouring agent may be a material which is invisible (i.e. colourless) unless exposed to a stimulus, as defined hereinbefore (and the solvent ink may be an invisible ink). The colouring agent may for instance be a fluorescent material, e.g. a fluorescent material which is invisible (i.e.

colourless) unless exposed to ultraviolet light.

A UV curable ink comprises (i) a curable monomer, (ii) an initiator, (iii) a colouring agent, and (iv) a tracer compound as defined herein. The curable monomer may be any monomer which polymerises (cures) upon exposure to ultraviolet light in the presence of the initiator. The initiator is generally a photoinitiator, i.e. a molecule that creates reactive species (free radicals, cations or anions) when exposed to ultraviolet radiation. Acrylic monomers may for instance be employed. The UV curable ink may for instance comprise (i) acrylic monomers, (ii) an initiator, (iii) a colouring agent, and (iv) a tracer compound as defined herein. A solvent need not be present in a UV curable ink, which means that there is no need for solvent evaporation or drying on the curing step. The tracer compound in the UV curable ink may be as defined anywhere herein. The colouring agent may be a pigment or dye (and the solvent ink may be a visible ink, for instance a black ink) or the colouring agent may be a material which is invisible (i.e. colourless) unless exposed to a stimulus, as defined hereinbefore (and the solvent ink may be an invisible ink). The colouring agent may for instance be a fluorescent material, e.g. a fluorescent material which is invisible (i.e.

colourless) unless exposed to ultraviolet light.

The ink generally does not comprise biological cells. The ink is not a "bio-ink" of the kind which is suitable for bioprinting of cells, e.g. to form cell-laden tissue scaffolds. Any biological cells that are present in the ink are not intentionally present. Thus, the

concentration of cells biological in the ink is generally less than 1000 cells/mL, for instance less than 10 cells/mL, and may be less than 1 cell/mL.

Inks of the invention may be produced by adding a tracer compound as defined herein to a known ink which is suitable for use in an inkjet printer. Typically, when the ink is a solvent ink or an aqueous ink, the tracer compound is first added to a carrier liquid comprising the solvent employed in the solvent ink (e.g. ethanol) or to water as employed in the aqueous ink, respectively, to form a dispersion of the tracer compound in the carrier liquid. The dispersion is then simply added to the ink. Only a very low concentration of the tracer compound is needed in practice, because even very low concentrations of

oligonucleotide may easily be extracted from a printed wood product, amplified by PCR and sequenced later on. Typically, only a few droplets of the dispersion of the tracer compound may be added, to achieve a concentration of a few (i.e. between 1 and 10) millilitres of the oligonucleotide dispersion per litre of ink, as detailed in Example 7.

Inkjet Cartridge

The invention also provides an ink cartridge for use in an inkjet printer, wherein the ink cartridge contains at least one ink reservoir which contains an ink of the invention as defined above. Any known inkjet cartridge which is suitable for use in an inkjet printer may be employed, provided that at least one ink reservoir in the cartridge contains an ink of the invention as defined above instead of a conventional ink without a tracer compound. Usually each and every ink reservoir in the ink cartridge contains an ink of the invention as defined above, and this is typically the same ink of the invention. Often, a thermal inkjet printer is used in the present invention and the ink cartridge is therefore one which is suitable for use in a thermal inkjet printer. Alternatively, a piezoelectric inkjet printer may be employed in the present invention, in which case the ink cartridge is one which is suitable for use in a piezoelectric inkjet printer. Ink cartridges suitable for use in inkjet printers, for instance thermal or piezoelectric inkjet printers, are well known in the art. Ink cartridges of the invention may therefore be prepared by replacing the ink in such a known cartridge with an ink of the invention, or indeed by adding a tracer compound as defined herein to the ink already present in a known cartridge.

Advantageously, the cartridge of the invention further comprises a built-in print head. Then, every time the ink runs out and a new cartridge is introduced, a new print head is also introduced. This minimises blockages occurring in the print head.

Inkjet printer

The invention also provides an inkjet printer comprising an ink cartridge of the invention as defined above. In other words, the inkjet printer is fitted with the ink cartridge of the invention. The inkjet printer of the invention is thereby equipped to print ink of the invention which comprises a tracer compound as defined herein.

The inkjet printer of the invention may be a thermal inkjet printer, in which case the ink and ink cartridge employed are both suitable for use in a thermal inkjet printer, as discussed hereinbefore. Alternatively, the inkjet printer of the invention may be a

piezoelectric inkjet printer, in which case the ink and ink cartridge employed are both suitable for use in a piezoelectric inkjet printer, as discussed hereinbefore.

The inkjet printer of the invention may be a handheld one. Handheld inkjet printers, which are also referred to herein as data guns, are known in the art and may be fitted with an ink cartridge of the invention in order to print an ink of the invention which comprises a tracer compound as defined herein. Handheld inkjet printers are particularly useful for printing wood at the site of harvesting, e.g. in a forest. A cross section, or a de-barked portion, of a felled tree trunk or log may be printed using a handheld inkjet printer with ink of the invention containing a tracer compound as defined herein. The surface of the wood may be marked using the data gun with an optical representation of data using the ink. The data typically comprises information about the wood product, for instance as discussed herein under the heading "track and trace concept'. The optical representation of data may be readable by a human, i.e. it may for instance be text, a symbol, sign or picture. Alternatively, the optical representation of data may be a machine-readable optical representation of data, for instance a barcode or a two-dimensional data matrix code. Typically, it is one or more of text, a barcode and a data matrix code (i.e. a two-dimensional data matrix code), and is often all three of these.

Alternatively, for instance, the inkjet printer of the invention may not be handheld. It may for instance be a stationary inkjet printer, for instance an industrial inkjet printer. It may be an industrial inkjet printer suitable for marking timber products on a production line. Thus, the inkjet printer may be part of a production line assembly. It may for example be part of a production line assembly in a sawmill or timber mill. The assembly may for instance comprise (i) an inkjet printer of the invention, and (ii) a verification camera capable of reading an optical representation of data which may be printed by the printer.

The invention also therefore provides a production line assembly which comprises (i) an inkjet printer of the invention, and (ii) a verification camera capable of reading an optical representation of data that is printed by the printer. The data typically comprises information about the wood product, for instance as discussed herein under the heading "track and trace concept. The optical representation of data may for instance be text, a barcode or a two- dimensional data matrix code. The optical representation of data may comprise all three of these, i.e. text, a barcode and a two-dimensional data matrix code.

Uses

The invention further provides the use of a tracer compound for labelling a product of wood processing, to enable (subsequent) identification of information about the product of wood processing, wherein the tracer compound comprises a synthetic oligonucleotide.

The tracer compound may be as further defined herein. The tracer compound may be used for the labelling of said product in combination with a marker material comprising a detectable label, which marker material comprising a detectable label may also be as further defined herein. Thus, the product of wood processing may further comprise a marker material comprising a detectable label, as defined herein.

The synthetic oligonucleotide typically comprises a unique sequence of nucleotides which represents information about the product of wood processing. The unique sequence of nucleotides may for instance denote a particular source, for instance a sustainably managed forest, so that a product of wood processing which was tagged with the tracer compound can subsequently be identified as originating from that source. The source may for instance be a sustainable source, for instance a sustainably managed forest. The source may for instance be a legal and sustainable source. It may for instance be a sustainably managed forest which has been approved or certified as such. The unique sequence of nucleotides may for instance identify the product of wood processing as: originating from a legal and sustainable source; originating from a sustainably managed forest; having been present at a particular location; having been present at a particular location at a particular point in time; being one of a particular batch of products; being one of a particular batch of products produced at a particular location; being one of a particular batch of products produced at a particular location at a particular point in time. The particular location may for example be a forest, a timber yard, a sawmill, a planing mill, a pulp mill, or a factory or production facility, for example a biomass or biofuel production facility. The particular location may be one that has been certified as following legal and sustainable practices. It may for instance be a sustainably managed forest. It may for instance be a sustainably managed: timber yard, sawmill, planing mill, pulp mill, factory or production facility, or for example a sustainably managed biomass or biofuel production facility.

The invention also provides the use of a tracer compound to identify information about a product of wood processing, wherein the tracer compound comprises a synthetic oligonucleotide. As discussed above, the synthetic oligonucleotide typically comprises a unique sequence of nucleotides which represents information about the product of wood processing. The use of the invention typically therefore comprises the use of the tracer compound to identify that particular information.

Thus, the use of the invention typically comprises the use of the tracer compound to identify one or more of:

- the source of the wood from which the product of wood processing was produced or originated. This is typically a sustainably managed forest, for example a forest that has been approved or certified as being sustainably managed.

The batch of the wood from which the product of wood processing was produced or originated.

The time of harvesting of the wood from which the product of wood processing was produced.

A particular location at which the product of wood processing was present.

A particular location at which the product of wood processing was produced. A particular location and a particular point in time, at which the product of wood processing was present.

A particular location and a particular point in time, at which the product of wood processing was produced. A particular batch of products to which the product of wood processing belonged. A particular batch of products produced at a particular location, to which the product of wood processing belonged.

A particular batch of products produced at a particular location at a particular point in time, to which the product of wood processing belonged.

The particular location may for example be a forest, a timber yard, a sawmill, a planing mill, a pulp mill, or a factory or production facility, for example a biomass or biofuel production facility. The particular location may be one that has been certified as following legal and sustainable practices. It may for instance be a sustainably managed forest. It may for instance be a sustainably managed: timber yard, sawmill, planing mill, pulp mill, factory or production facility, or for example a sustainably managed biomass or biofuel production facility.

The tracer compound may be as further defined herein. The product of wood processing may further comprise a marker material comprising a detectable label, as defined herein. Thus, the tracer compound may be used in combination with a marker material comprising a detectable label, to identify the information about the product of wood processing. The marker material comprising the detectable label, which may itself be as further defined herein, may be used to indicate that the tracer compound is present in the product of wood processing, and the tracer compound may be used to identify said information about the product of wood processing.

In the uses of the invention the product of wood processing may comprise wood, wherein the wood comprises said tracer compound. Furthermore, the surface of the wood may be marked with an ink which comprises the tracer compound, as discussed hereinbefore under the heading "products of wood processing marked with an ink comprising the tracer compound'. Alternatively, in the uses of the invention, the product of wood processing may be a packaged product of wood processing as described hereinbefore under the heading "packaged product of wood processing" .

Processes for tagging products of wood processing

The product of wood processing of the invention may be produced by treating a product of wood processing with the tracer compound. This may be referred to as labelling or tagging the product of wood processing with the tracer compound.

The tracer compound may be added to the product of wood processing in solid form, or the tracer compound may first be dissolved or suspended in a solvent (for instance in water, or in an organic solvent, e.g. a C5-10 hydrocarbon solvent or tetrahydrofuran), and then added to the product of wood processing. If the product of wood processing is a liquid (for instance a liquid biofuel, or an oil such as tall oil, or tree sap), the tracer compound may readily be added to the product of wood processing in either solid or liquid form, so that it becomes dissolved or suspended in the liquid product of wood processing. If on the other hand the product of wood processing is a solid, for instance if it comprises wood, e.g. if it is timber or engineered wood, or for instance if it is wood pulp or lignocellulosic biomass, the tracer compound is preferably added to the product of wood processing in liquid form, i.e. after it has been dissolved or suspended in a solvent as discussed above, i.e. in the form of a composition comprising the tracer compound and a solvent. Usually, the solvent is water. Alternatively, however, the solvent may be an organic solvent, e.g. a C5-10 hydrocarbon solvent or tetrahydrofuran, especially if the tracer compound comprises a hydrophobic group, for instance if it is a compound of formula (I) as defined herein.

Alternatively, the product of wood processing of the invention may be produced by: producing the product of wood processing in the presence of the tracer compound.

Producing the product of wood processing in the presence of the tracer compound may comprise converting a precursor product, which already comprises the tracer compound, into said product of wood processing which comprises the tracer compound. Alternatively, it may comprise introducing the tracer compound during the production of the product of wood processing.

Often, however, the process comprises treating a product of wood processing with said tracer compound (i.e. tagging the already-produced product of wood processing). In such embodiments, the product of wood processing may be as further defined anywhere herein, for instance it may comprise wood, it may be timber, or it may be engineered wood,

lignocellulosic biomass, wood pulp, tree sap, an oil, or a biofuel, any of which may be as further defined herein. The process may comprise treating said product of wood processing with a composition which comprises said tracer compound and a solvent, which solvent may be as defined above. Thus, usually, the solvent is water. Alternatively, however, the solvent may be an organic solvent, e.g. a C5-10 hydrocarbon solvent or tetrahydrofuran, especially if the tracer compound comprises a hydrophobic group, for instance if it is a compound of formula (I) as defined herein.

Often, the product of wood processing comprises wood and the process comprises treating the wood with a composition which comprises said tracer compound and a solvent. The solvent may be as defined above. The solvent often for instance comprises water. The process may comprise spraying the wood with the composition which comprises said tracer compound and a solvent. The composition can then soak into the wood or evaporate, ensuring that the wood is dry when batched. Typically in such embodiments the product of wood processing which is treated is timber or engineered wood. The temperature of timber may be elevated, for instance at from 50 °C to 100 °C, during treatment with the composition.

Alternatively, the process may comprise impregnating the wood with the composition which comprises said tracer compound and a solvent. This may involve applying an elevated pressure to force the composition into the wood (and thereby aid impregnation) and/or applying a vacuum to the wood in order that the composition is drawn deep into the wood (again, aiding impregnation). Typically in these embodiments the product of wood processing which is treated is timber or engineered wood.

The composition often further comprises a marker material, as defined herein, which comprises a detectable label. It may for instance further comprise fluorescent microspheres.

The product of wood processing which is treated with said tracer compound (i.e. the already-produced product of wood processing) may alternatively for instance be wood pulp, lignocellulosic biomass, or biofuel. Indeed, as described in Examples 3, 4, 5 and 6 wood pulp, lignocellulosic biomass, and liquid biofuel may all be treated with a tracer compound at the end of their production processes, i.e. once they have been produced.

Often, the product of wood processing comprises wood and the process comprises printing an ink of the invention as defined herein onto a surface of the wood. The process may for instance comprise printing the ink of the invention onto the surface of the wood using an inkjet printer of the invention as defined herein.

The process often comprises printing with said ink an optical representation of data using the ink. The optical representation of data may be readable by a human, i.e. it may for instance be text, a symbol, sign or picture. Alternatively, the optical representation of data may be a machine-readable optical representation of data, for instance a barcode or a two- dimensional data matrix code. Typically, it is one or more of text, a barcode and a data matrix code (i.e. a two-dimensional data matrix code), and is often all three of these. The data typically comprises information about the wood product, for instance as discussed above under the heading "track and trace concept'.

Usually, the process comprises printing with said ink one or more of text, a barcode and a data matrix code (i.e. a two-dimensional data matrix code). The process often comprises printing with said ink: text and a barcode, text and a data matrix code, or a barcode and a data matrix code. The surface of the wood is often printed with all three of text, a barcode and a data matrix code, using the ink. An example of this is shown in Figure 4 and described in Example 7. Typically, the data matrix code provides a link to a website. The website typically provides information about the wood product, for instance as discussed above under the heading "track and trace concept'.

Alternatively, the product of wood processing of the invention may be produced by: producing a product of wood processing in the presence of said tracer compound. For instance, the tracer compound may be introduced during the production of the product of wood processing, or the product of wood processing may be produced by converting a precursor product which comprises the tracer compound into the product of wood processing.

The process may therefore comprise introducing said tracer compound during the production of the product of wood processing. The process may optionally further comprise introducing a marker material comprising a detectable label, as defined herein, during the production of the product of wood processing.

Typically, in this embodiment, the product of wood processing is wood pulp, a liquid biofuel or lignocellulosic biomass. Indeed, Example 3 explains how a tracer compound, which may be as further defined herein (and may for example be encapsulated by a removable encapsulation material such as a protective polymer coating) may be mixed with any of the process chemicals used in the pulp manufacture process prior to adding the process chemical into the reaction mixture. Similarly, Examples 4, 5 and 6 explain how such a tracer compound may be introduced during reconstituted lignocellulosic biomass production and biofuel production. In a similar manner turpentine, which may be recovered as a by-product from wood pulp manufacture, may be labelled with a tracer by mixing a tracer compound in with any of the process chemicals used in the pulp manufacture process.

In other embodiments, producing a product of wood processing in the presence of said tracer compound comprises converting a precursor product which comprises the tracer compound into the product of wood processing. The precursor product may optionally further comprise a marker material comprising a detectable label, which may be as further defined anywhere herein. In this embodiment, the product of wood processing may, for instance, be biodiesel and the precursor product which already comprises the tracer compound may be tall oil. Alternatively, the product of wood processing may be ethanol and the precursor product which already comprises the tracer compound may be tree sap or lignocellulosic biomass. Another option is that the product of wood processing is reconstituted (a pellet or a briquette of) lignocellulosic biomass and the precursor product which already comprises the tracer compound is (unreconstituted) lignocellulosic biomass, or the product of wood processing may be wood pulp and the precursor product which already comprises the tracer compound may be wood (for instance wood chips).

Generally, the process may further comprise treating the product of wood processing with a marker material comprising a detectable label, as defined herein. This may for instance be done at the end of the process, after the product of wood processing comprising the tracer compound has itself been produced.

The tracer compound may be as defined anywhere herein in the processes and methods of the invention (as may be the product of wood processing).

The tracer compound itself may be produced by synthesising the desired

oligonucleotide. In cases where the oligonucleotide, Tag, is bonded to a hydrophobic group, the production of the tracer compound typically further comprises (ii) coupling the hydrophobic group, R, to the oligonucleotide. Regarding (i), oligonucleotide synthesis methods are very well known in the art. As for (ii), methods for modifying oligonucleotides by coupling compounds, including substituted or unsubstituted hydrocarbons, to the 5' or 3' ends of an oligonucleotide, are also very well known. Examples of some common

oligonucleotide labelling reactions are: reaction of a phosphoramidite derivative of the labelling group with the oligonucleotide during solid phase synthesis; reaction of a free amino group on an oligonucleotide with an N-hydroxysuccinimide ester or other activated carboxyl group such as an isothiocyanate derivative of a luminescent dye or enzyme; reaction of a thiol-modified oligonucleotide with an α,β-unsaturated ketone attached to a luminescent label or activated enzyme; reaction of an amino-modified nucleoside triphosphate with a carboxy-activated label, and subsequent incorporation of the labelled triphosphate into DNA during PCR or other enzyme-catalysed DNA extension reaction; reaction of an alkyne- modified oligonucleotide with an azide-modified label, to form a triazole linkage (click chemistry); reaction of an azide-modified oligonucleotide with an alkyne-modified label, to form a triazole linkage (click chemistry). Such methods are discussed in more detail on the website of ATDBio (www.atdbio.com), from whom the modified oligonucleotides employed in the Example hereinbelow were obtained, and are also well known.

The invention also provides a process for producing a packaged product of wood processing, which packaged product of wood processing comprises (a) at least one product of wood processing, and (b) packaging material, wherein a surface of the packaging material is marked with an ink which comprises a tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; which process comprises: printing an ink of the invention as defined herein onto a surface of the packaging material. The packaged product of wood processing may be as further defined herein, for instance under the above heading "packaged product of wood processing" . The ink of the invention may also be as further defined anywhere herein. The process may for instance comprise printing the ink of the invention onto the surface of the packaging material using an inkjet printer of the invention as defined herein. The inkjet printer of the invention may also be as further defined anywhere herein.

The process often comprises printing with said ink an optical representation of data using the ink. The data typically comprises information about the wood product, for instance as discussed herein under the heading "track and trace concept'. The optical representation of data may be readable by a human, i.e. it may for instance be text, a symbol, sign or picture. Alternatively, the optical representation of data may be a machine-readable optical representation of data, for instance a barcode or a two-dimensional data matrix code.

Typically, it is one or more of text, a barcode and a data matrix code (i.e. a two-dimensional data matrix code), and is often all three of these.

Usually, the process comprises printing with said ink one or more of text, a barcode and a data matrix code (i.e. a two-dimensional data matrix code). The process often comprises printing with said ink: text and a barcode, text and a data matrix code, or a barcode and a data matrix code. The surface of the packaging material is often printed with all three of text, a barcode and a data matrix code, using the ink. Typically, the data matrix code provides a link to a website. The website typically provides information about the products of wood processing packaged in the packaging material, for instance as discussed above under the heading "track and trace concept'.

After the labelling of the product of wood processing, or the packaged product of wood processing, with the tracer compound, and optionally the marker material comprising the detectable label, the tracer compound can be used to identify crucial information about the history of the product of wood processing. Thus, the above-defined process for producing the labelled product of wood processing, may further comprise:

(w) obtaining a sample of the product of wood processing thus produced which comprises the tracer compound;

(x) retrieving the tracer compound from said sample;

(y) analysing the oligonucleotide of the tracer compound to determine the identity of the oligonucleotide; and (z) using the identity of the oligonucleotide to identify information about the product of wood processing.

In embodiments where the product of wood processing comprises wood and the process comprises printing an optical representation of data, using an ink of the invention as defined herein, onto a surface of the wood, the process may further comprise: (v) reading the optical representation of data to obtain information about the product of wood processing. The optical representation of data may for instance comprise text, a barcode or a data matrix code, or indeed all three of these, in which case the process may further comprise reading said text, barcode or data matrix code to obtain information about the product of wood processing. The information about the wood product may be as discussed above under the heading "track and trace concept'. A person may read the data themselves using the eye, for instance when the data comprises text. Additionally or alternatively, the reading may comprise using a machine, for instance using a scanner, barcode reader, or camera, such as a verification camera or a smartphone camera. Additionally or alternatively, where the printed ink is invisible ink, the process may further comprise exposing the ink to a stimulus, which may as further defined herein but is typically ultraviolet light, in order to render the ink visible to the reader (which may be a person or a machine as discussed above).

When a marker material is present, the process may further comprise, prior to steps (w) and (x):

(v) detecting said detectable label to verify the presence of the marker material in the product of wood processing.

The invention also provides a method of identifying information about a product of wood processing, which method comprises:

(x) retrieving a tracer compound from a sample comprising a product of wood processing, which product of wood processing comprises said tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; and

(y) analysing the oligonucleotide of the tracer compound to determine the identity of the oligonucleotide.

In some embodiments of the method of the invention of identifying information about a product of wood processing, the product of wood processing comprises wood and a surface of the wood is marked with an optical representation of data, using an ink which comprises a tracer compound as defined herein, as discussed hereinbefore under the heading "products of wood processing marked with an ink comprising the tracer compound'. In such

embodiments, the method may further comprise: (v) reading the optical representation of data to obtain information about the product of wood processing. The optical representation of data may for instance comprise text, a barcode or a data matrix code, or indeed all three of these, in which case the process may further comprise reading said text, barcode or data matrix code to obtain information about the product of wood processing. The information about the wood product may be as discussed above under the heading "track and trace concept. A person may read the data themselves using the eye, for instance when the data comprises text. Additionally or alternatively, the reading may comprise using a machine, for instance using a scanner, barcode reader, or camera, such as a verification camera or a smartphone camera. Additionally or alternatively, where the printed ink is invisible ink, the process may further comprise exposing the ink to a stimulus, which may as further defined herein but is typically ultraviolet light, in order to render the ink visible to the reader (which may be a person or a machine as discussed above).

In the method of the invention, the product of wood processing may further comprise a marker material which comprises a detectable label, as defined herein, and the method may further comprise, prior to step (x):

(v) detecting the detectable label to verify the presence of the marker material in the product of wood processing.

The method may also further comprise: (z) using the identity of the oligonucleotide to identify information about the product of wood processing.

Typically, step (x) comprises extracting the tracer compound from the sample.

Extracting the tracer compound from the sample may for instance comprise contacting the sample with an aqueous extractant composition which comprises water and optionally a surfactant which is suitable for aiding dissolution of the tracer compound in the extractant composition. A non-ionic surfactant may usefully be employed.

The identity of the oligonucleotide of the tracer compound can readily be determined by (a) amplifying the oligonucleotide; and (b) sequencing the amplified oligonucleotide.

Thus, often, step (y) comprises amplifying nucleic acid in the oligonucleotide and sequencing the amplified oligonucleotide.

The oligonucleotide may be amplified by performing PCR (the polymerase chain reaction) on the tracer compound. Accordingly, step (a) may comprise performing PCR on the tracer compound. PCR and sequencing are both very well known techniques. The PCR may for instance be qPCR (quantitative polymerase chain reaction), which is also well known.

Step (y) often comprises: (a) amplifying the oligonucleotide in the presence of an intercalating reporter dye to determine that an oligonucleotide is present;

(b) optionally further amplifying the oligonucleotide; and

(c) sequencing the amplified oligonucleotide and thereby determining the identity of the oligonucleotide.

The amplifying in steps (a) and (b) is typically achieved by performing PCR, for instance qPCR. The sequencing in step (c) may be by any suitable method. Methods for sequencing oligonucleotides are well known in the art.

Step (z) may comprise identifying one or more of:

the source of the wood from which the product of wood processing was produced or originated; the batch of the wood from which the product of wood processing was produced or originated; the time of harvesting of the wood from which the product of wood processing was produced or originated; a particular location at which the product of wood processing was present; a particular location at which the product of wood processing was produced; a particular location and a particular point in time, at which the product of wood processing was present; a particular location and a particular point in time, at which the product of wood processing was produced; a particular batch of products to which the product of wood processing belonged; a particular batch of products produced at a particular location, to which the product of wood processing belonged; a particular batch of products produced at a particular location at a particular point in time, to which the product of wood processing belonged. The location may for example be a forest, a production facility, a factory, a timber yard, a sawmill, a planing mill, a pulp mill, or a biomass or biofuel production facility.

Step (z) may for instance comprise identifying the product of wood processing as: originating from a legal and sustainable source, or originating from a sustainably managed forest.

Step (z) may for instance comprise identifying the product of wood processing as: having been present at a particular location, having been present at a particular location at a particular point in time, being from a batch of products produced at a particular location, or being from a batch of products produced at a particular location at a particular point in time, wherein the location is one that has been certified as following legal and sustainable practices. The location may for example be a forest, a production facility, a factory, a timber yard, a sawmill, a planing mill, a pulp mill, or a biomass or biofuel production facility.

In the method of the invention, the tracer compound may be as defined anywhere herein and/or the product of wood processing may be as defined anywhere herein. The invention further provides a process for retrieving a tracer compound from a product of wood processing which comprises the tracer compound, which tracer compound comprises a synthetic oligonucleotide, which process comprises:

(a) obtaining a sample of the product of wood processing; and

(b) extracting the tracer compound from the sample.

Extracting the tracer compound from the sample typically comprises contacting the sample with an aqueous extractant composition which comprises water and optionally a surfactant suitable for aiding dissolution of the tracer compound in the extractant

composition. The surfactant may be a non-ionic surfactant.

The process for retrieving a tracer compound typically further comprises:

(c) analysing the oligonucleotide of the tracer compound to determine the identity of the oligonucleotide. Step (c) may comprise amplifying nucleic acid in the oligonucleotide and sequencing the amplified oligonucleotide. Step (c) may for instance comprise: amplifying the oligonucleotide in the presence of an intercalating reporter dye to determine that an oligonucleotide is present; optionally further amplifying the oligonucleotide; and sequencing the amplified oligonucleotide and thereby determining the identity of the oligonucleotide.

The invention also provides a method of identifying information about a packaged product of wood processing of the invention as defined herein, which method comprises: (x) retrieving a tracer compound from a sample comprising the packaging material whose surface is marked with an ink comprising said tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; and (y) analysing the oligonucleotide of the tracer compound to determine the identity of the oligonucleotide. Steps (x) and (y) may be as further defined hereinbefore in relation to the methods and method steps discussed hereinbefore for identifying information about a product of wood processing.

The method may further comprise: (v) reading the optical representation of data to obtain information about the packaged product of wood processing. The optical

representation of data may for instance comprise text, a barcode or a data matrix code, or indeed all three of these, in which case the process may further comprise: (v) reading said text, barcode or data matrix code to obtain information about the packaged product of wood processing. The information about the packaged product may be as discussed above under the heading "track and trace concept'. A person may read the data themselves using the eye, for instance when the data comprises text. Additionally or alternatively, the reading may comprise using a machine, for instance using a scanner, barcode reader, or camera, such as a verification camera or a smartphone camera. Additionally or alternatively, where the printed ink is invisible ink, the process may further comprise exposing the ink to a stimulus, which may as further defined herein but is typically ultraviolet light, in order to render the ink visible to the reader (which may be a person or a machine as discussed above).

The invention also provides a process for retrieving a tracer compound from a packaged product of wood processing of the invention as defined herein, which process comprises: (a) obtaining a sample of the packaging material whose surface is marked with an ink comprising said tracer compound, wherein the tracer compound comprises a synthetic oligonucleotide; and (b) extracting the tracer compound from the sample. Steps (a) and (b) may be as further defined hereinbefore in relation to the methods and method steps discussed hereinbefore for retrieving a tracer compound from a product of wood processing.

The invention will be further described in the Examples which follow.

EXAMPLES

Example 1 - Tracer compounds

Short chain length (ca. 80 bases in length) single stranded DNA molecules (oligonucleotides) are readily produced by conventional DNA synthesis methodologies. The sequence of the bases within the oligonucleotide can be varied so that an almost unlimited number of unique oligonucleotide molecules can be generated.

The sequence of bases in the oligonucleotides can be also be varied to allow the identification and quantification of the oligonucleotide through quantitative polymerase chain reaction or variants of next generation sequencing technology.

An unmodified oligonucleotide having the sequence SEQ ID NO: 1 was purchased from ATDBio (www.atdbio.com), and was given the code name Zea02.

Seven modified oligonucleotides were also purchased from ATDBio (www.atdbio.com), in which the 5' end of the Zea02 oligonucleotide had been modified with a hydrophobic moiety. The Zea02 oligo was designed to be detected by quantitative polymerase chain reaction. The forward and reverse primer sequences, and the minor groove binder (MGB) probe sequence, that were employed in the quantitative polymerase chain reaction are SEQ ID NOs: 2, 3 and 4 respectively. The structures of the hydrophobic modifications of Zea02 are shown in Figures 1 and 2. In each of the structures shown in Figures 1 and 2, the structure:

represents the nucleotide at the 5' end of the Zea-02 oligonucleotide, wherein B is the nitrogenous base of that nucleotide, cytosine (C). "DNA" represents the other nucleotides of the Zea-02 oligonucleotide.

The unmodified oligonucleotide and the seven modified oligonucleotides were received from ATDBio (www.atdbio.com) as lyophilised (freeze dried) powders.

The first experiment demonstrated that the hydrophobic modifications allowed the amplification of the oligonucleotides in a conventional qPCR reaction. The conventional qPCR reaction followed standard protocols which can be found in a series of web pages put together by Thermo Fisher, who now own Applied Biosystems (the original developers of the qPCR procedure). These protocols can be found at the following web address:

http://www.thermofisher.com/uk/en/home/life-science/pcr/r eal-time-pcr/real-time-pcr- assays.html

The lyophilised oligos were reconstituted with 1 ml of molecular grade water, serially diluted and then analysed using qPCR. The recovery of the modified oligos during reconstitution was calculated by comparing the amount recovered with those for the unmodified control. The amplification efficiency for each modified oligo was determined using the slope of each standards curve, which was generated from the results obtained from the amplification of the serial dilutions. This experiment showed that the modified oligos all amplified with acceptable amplification efficiencies (85%). The amplification efficiencies of the modified oligos and the unmodified oligo are shown in Table 1.

Table 1. Amplification efficiency for modified and

unmodified oligos following water addition

Oligo modification Amplification

efficiency

(%)

None 98

C12-amino 91

Stearyl 97

Palmitate 94

Cholesterol-TEG 98

Cholesterol 100

Tocopherol 101

Octyl-Tocopherol 93

An aqueous solution of each oligo at a nominal concentration of lel2 copies per ml was prepared. A series of 0.1 ml aliquots of each oligo placed in 3 ml Eppendorf tubes, which were dried under vacuum. One tube of each oligo had either 0.1ml water, ethanol, xylene, tetrahydrofuran (THF) or octane added to it. The tubes were vigorously vortexed and then spun. 90 μΐ of the solution in each tube was taken and added to a separate Eppendorf tube. The solutions were then removed thorough vacuum drying and 100 μΐ of molecular grade water added to each tube, which were then vigorously vortexed. The copy number present in each tube was then determined through qPCR analysis. The results obtained showed excellent recoveries for the palmitate and C12-amino oligos, when water and THF were used as the initial solvents.

The amplified modified oligos can successfully be recovered from solvents and materials using a specific aqueous buffer formulation (a "recovery buffer") which is commercially available from a company called TraceTag (see: www.tracetag.com). The recovery buffer contains surfactants adapted to aid extraction of the oligo. The recovery buffer did not affect the efficiency of amplification during identification and quantification of the oligos by qPCR. Example 2 - Tagging timber

5m long timber planks of varying cross sectional dimensions travel along on a chain conveyor running at 5 metres per minute. The timber planks have a surface temperature of approx. 60 °C at the point of application, having just exited thelOO °C drying oven. Shortly after this a thin coat of a water-based flag and tag liquid is applied, which comprises the unmodified oligonucleotide having sequence SEQ ID NO: 1 and fluorescent microspheres. The liquid is applied by a mechanically driven horizontal reciprocator with a series of automatic compliant technology atomising spray guns. The spray guns are fed via pneumatic fluid pumps drawing the coating fluid from an IBC or similar. The fluid flow is accurately controlled by precision fluid meters. Data including flow rate, atomising pressure, IBC fluid level are recorded in a central control system. The timber planks continue on the conveyor for a further 5 minutes before reaching the automatic batching/off load process. During this time the coating either soaks in to the timber or evaporates ensuring the timber is dry when batched, leaving behind the tag (unmodified oligonucleotide) and flag (fluorescent microspheres).

For recovery of the tag, a sample of timber is removed from the surface of the tagged 5m long timber plank to which the tag is applied, and the sample is contacted with an aqueous buffer formulation (a "recovery buffer") which contains surfactants adapted to aid extraction of the oligo from the timber sample into the aqueous buffer solution. Recovery buffers are commercially available from a company called TraceTag (see: www.tracetag.com) or a suitable recover buffer can readily be formulated by the skilled person. The oligo is then amplified using qPCR, and the amplified oligonucleotide is sequenced in order to

determining the identity of the oligonucleotide.

Alternatively, a 5m long timber plank is treated with a water-borne preservative in a sawmill treatment plant for protection against insect or fungal attack. Prior to the treatment a water- based flag and tag liquid (containing the unmodified oligonucleotide having sequence SEQ ID NO: 1, fluorescent microspheres and water) is mixed with an aqueous treatment fluid containing a water-borne preservative. The treatment fluid is applied to the timber plank under pressure in order to impregnate the treatment fluid (and the oligonucleotide) deeply into the timber plank. A vacuum is also applied to the plank in order to draw the treatment fluid (and the oligonucleotide) deep into the timber. For recovery of the tag, a sample of timber is removed from the surface of, or from within, the tagged timber plank, and the sample is contacted with an aqueous buffer formulation (a "recovery buffer") which may contain surfactants adapted to aid extraction of the oligo from the timber sample into the aqueous buffer solution. The oligo is then amplified using qPCR, and the amplified oligonucleotide is sequenced in order to determine the identity of the oligonucleotide.

Example 3 - Tagging wood pulp

Wood chips enter the presteaming where they are wetted and preheated with steam. The chips are then saturated and impregnated with cooking liquor (comprising a mixture of white liquor, water in chips, condensed steam and weak black liquor) at a temperature below 100 °C. The wood chips are then cooked in the cooking liquor in a pressurized digester to cause delignification, for several hours at 170 to 176 °C. The excess black liquor is concentrated in a multiple effect evaporator, to about 20 - 30% solids, at which point rosin soap rises to the surface and is skimmed off. The collected soap is further processed to tall oil. The weak black liquor is further evaporated to 65% or even 80% solids and burned in the recovery boiler to recover the inorganic chemicals for reuse in the pulping process. The finished cooked wood chips are blown to a collection tank called a blow tank that operates at atmospheric pressure, releasing steam and volatiles. The volatiles, including turpentine, are condensed and collected. Brownstock (cellulose fibres containing approximately 5% residual lignin) produced by the pulping is washed to remove dissolved organic material and further delignified by bleaching. The pulp is then dried and cut into appropriately-sized sheets.

Various process chemicals are added to improve the wood pulp production process, and a water-based tag liquid (containing the unmodified oligonucleotide having sequence SEQ ID NO: 1 preferably encapsulated by a protective polymer coating) is mixed with any of the process chemicals prior to adding. The process chemical to which the tag liquid is added may be: a surfactant (used to improve impregnation of the wood chips with the cooking liquors), a digester additive, an emulsion breaker (added to speed up and improve the separation of soap from the cooking liquors), a defoamer (to remove foam and speed up production), a dispersing agent, detackifiers or complexing agent (to keeping the system clean and reduce necessary maintenance), or a fixation agent. Alternatively, a water-based flag and tag liquid (containing the unmodified oligonucleotide having sequence SEQ ID NO: 1, fluorescent microspheres and water) is applied following the final bleaching step and prior to drying.

For recovery of the tag, a sample of tagged wood pulp is contacted with an aqueous buffer formulation (a "recovery buffer") which may contain surfactants adapted to aid extraction of the oligo from the wood pulp sample into the aqueous buffer solution. The oligo is then amplified using qPCR, and the amplified oligonucleotide is sequenced in order to determine the identity of the oligonucleotide.

Example 4 - Tagging lignocellulosic biomass

Pellets or briquettes of lignocellulosic biomass are soaked in a water-based flag and tag liquid (containing the unmodified oligonucleotide having sequence SEQ ID NO: 1, fluorescent microspheres and water) for half an hour in order to impregnate the lignocellulosic biomass with the liquid. The pellets or briquettes are then dried, to yield tagged lignocellulosic biomass in pellet or briquette form.

Alternatively, a water-based flag and tag liquid (containing the unmodified oligonucleotide having sequence SEQ ID NO: 1, fluorescent microspheres and water) is mixed with a binding agent and with lignocellulosic biomass prior to pelletization. Pellets of lignocellulosic biomass are then produced by compacting the resulting mixture in the presence of heat. The binding agent may for example be starch, molasses, natural paraffin, plant oil, lignin sulfate.

For recovery of the tag, a sample of tagged lignocellulosic biomass is contacted with an aqueous buffer formulation (a "recovery buffer") which may contain surfactants adapted to aid extraction of the oligo from the lignocellulosic biomass sample into the aqueous buffer solution. The oligo is then amplified using qPCR, and the amplified oligonucleotide is sequenced in order to determine the identity of the oligonucleotide. Example 5 - Tagging biodiesel

Tall oil recovered from a wood pulp manufacturing process is mixed with methanol and sulphuric acid, a process called esterification, which results in converting the oil to crude diesel fuel, which is then sent to a refinery for processing.

A water-based flag and tag liquid (containing the unmodified oligonucleotide having sequence SEQ ID NO: 1, fluorescent microspheres and water) is applied following biodiesel production. Alternatively a water-based tag liquid containing the unmodified oligonucleotide having sequence SEQ ID NO: 1 encapsulated by a protective polymer coating is present in the tall oil prior to esterification.

For recovery of the tag, a sample of tagged biodiesel is obtained and the tag is extracted into an aqueous buffer solution. The oligo is then amplified using qPCR, and the amplified oligonucleotide is sequenced in order to determine the identity of the oligonucleotide. If the tag is encapsulated the coating (encapsulation material) is removed prior to extraction, amplification and sequencing.

Example 6 - Tagging bioethanol from tree sap or lignocellulosic biomass

A tap hole is drilled into a tree of any species that is assumed to produce sap. The tap hole is 5/16 of an inch in diameter and approximately two inches deep. A plastic spout is snugly inserted into the tap hole to prevent sap from leaking around the spout. One end of a length of flexible polymer tubing is securely attached to the spout. Other trees are tapped and connected to tubing in a similar manner. The ends of these lengths of tubing not connected to spouts terminate inside a common collection container sized large enough to collect all the sap estimated to flow from the tapped trees. The container is placed lower in elevation than all of the spouts to allow the sap to travel by gravity into the collection container. The tubing from the spouts is installed in a straight line to prevent sags that would result in the entrapment of sap in the sag. When the atmospheric conditions are appropriate, tree sap begins to run. Some of the sap from each tree runs through the collection tubing and into the collection container. Once sap begins to be collected in the container it is pumped through a reverse osmosis (RO) filter and concentrated to a sugar content of fifteen percent. The concentrated sap discharged from the RO filter is directed into a fermentation vat consisting of a 55-gallon plastic drum. The drum is refrigerated to forty degrees Fahrenheit until full of concentrated sap. When this drum is full, the discharge of the RO filter is directed to an empty drum until it is filled, and so on. Once full of sap, yeast is added to each drum to begin the fermentation process, the drum is sealed to prevent air from entering, and a water-trap vent is installed on the top of the drum to permit expanding gases to escape the drum.

The fermentation process continues for several days to completion. The resultant

ethanol/water solution is pumped from a fermentation vat into a distillation system. In the distillation process, the solution is heated to 180 degrees Fahrenheit. This temperature is above the boiling point of ethanol, but below the boiling point of water. The ethanol in solution is boiled out of the water into its gaseous form. The gaseous ethanol is condensed in a separate stage of the distillation system. The condensed (liquid) ethanol is then collected in a final container at 99.5 percent ethanol, 0.5 percent water.

Alternatively, lignocellulosic biomass is fermented to produce ethanol.

A water-based flag and tag liquid (containing the unmodified oligonucleotide having sequence SEQ ID NO: 1, fluorescent microspheres and water) is applied following ethanol production. Alternatively a water-based tag liquid containing the unmodified oligonucleotide having sequence SEQ ID NO: 1 encapsulated by a protective polymer coating is added during the process or added to the tree sap.

For recovery of the tag, a sample of tagged ethanol may be obtained, the ethanol evaporated, and the tag extracted into an aqueous buffer solution. The oligo is then amplified using qPCR, and the amplified oligonucleotide is sequenced in order to determine the identity of the oligonucleotide. If the tag is encapsulated the coating (encapsulation material) is removed prior to extraction, amplification and sequencing.

Example 7 - Marking timber with tracer-containing ink by inkjet printing

A synthetic DNA oligonucleotide provided by TraceTag (see: www.tracetag.com) was dispersed in ethanol, ready for addition to ink for use in an inkjet printer cartridge. Ethanol was chosen as a carrier solvent for the oligonucleotide, to match the solvent base of the ink. The ink employed was a black HP Thermal Inkjet 2.5 (TIJ) Industrial Ink containing ethanol as the solvent base. The ethanol dispersion of oligonucleotide was added to the ink, to achieve a concentration of a few (i.e. between 1 and 10) millilitres of the oligonucleotide dispersion per litre of ink. HP cartridges containing the black ink with added oligonucleotide were employed in a timber production line assembly with the following components: (i) an HP Thermal Inkjet printer, (ii) at least one cartridge containing the ink with added

oligonucleotide (typically, several cartridges were attached to the printer, to provide enough DNA-containing ink to last throughout an entire production shift), and (iii) a verification camera capable of reading barcodes printed by the printer using the ink.

The above assembly was fitted to a conveyor on a sawmill production line for sawing logs into planks. The assembly was used to print marks, each consisting of text, a barcode and a data matrix code, onto sawn planks travelling along the conveyor at high speed, using the oligonucleotide-containing ink. It was found that, even at the higher-than-usual conveyor speed of 200 planks per minute (130 planks per minute is a more typical speed) each plank was successfully printed with the text, barcode and data matrix code, resulting in a very clear and high-quality mark on each plank (see Figure 4). In addition, even at this high conveyor speed it was found that the verification camera could successfully read the passing printed barcodes with an accuracy of 98 %.

A sample of timber was removed from the surface of a timber plank produced by the above process. The sample was removed from the area of the plank surface which bore the printed black mark consisting of text, a barcode and a data matrix code. The removed sample was then contacted with an aqueous buffer formulation for extracting DNA (a "recovery buffer") which is commercially available from TraceTag (see: www.tracetag.com), and the

oligonucleotide was thereby extracted from the sample of marked timber into the aqueous buffer. The oligonucleotide was then amplified using qPCR, and then successfully sequenced. The sequence of the oligonucleotide confirmed that this was the same oligonucleotide that had been added to the inkjet ink prior to printing. SEQUENCE LISTINGS

SEQ ID NO: 1 (Zea02 single-stranded oligonucleotide)

CCCCATCAGCACAAAGCTACAAAGGCCTAATGGGCGCGATTAAGGTCAAGGCTC AGTCCA

SEQ ID NO: 2 (Forward primer)

CCCCATCAGCACAAAGCTACA SEQ ID NO: 3 (Reverse primer)

TGGACTGAGCCTTGACCTTAATC

SEQ ID NO: 4 (minor groove binder (MGB) probe)

AGGCCTAATGGGCG