DESCRIPTION

TARGET-RESPONSIVE HYDROGELS

GOVERNMENT SUPPORT

The subject invention was made with government support under NIH Grant No. GM- 079359. The government has certain rights in the invention.

BACKGROUND OF INVENTION A hydrogel is a network of polymer chains that are water-insoluble. Hydrogels are superabsorbent and possess a degree of flexibility very similar to natural tissue. Environmentally sensitive hydrogels have the ability to sense changes of, for example, pH, temperature, or the concentration of a metabolite. Such hydrogels can be used to entrap a substance and then release that substance as a result of the environment change. Thus, hydrogels that undergo physicochemical changes in response to their environmental changes or an applied stimuli are promising materials for drug delivery, tissue engineering, and other applications.

How a drug is delivered can have a significant effect on its efficacy. An ideal drug delivery system should carry the drug to the location where it is required and "smartly" release it. Advanced drug delivery is a rapidly expanding section of the global market for therapeutic drugs. Currently there are many drug delivery and drug targeting systems such as micelle and vesicle solution, nanoparticles and polymers (including biodegraded polymers, dendrimers, and hydrogels) under investigation. Among these, hydrogels stand out as a unique material for a number of reasons including the following:

1. A hydrogel is a semi wet, three-dimensional network of polymer chains that are water- insoluble. As noted above, hydrogels are superabsorbent and possess a degree of flexibility very similar to natural tissue.

2. Many hydrogels have inert surfaces that can minimize the effect of nonspecific interactions.

3. Hydrogels have highly tunable mechanical strength. 4. Hydrogels arc highly adaptable to modifications. A wide variety of functionalities such as biological molecules can be incorporated into hydrogel structures.

5. Hydrogels can undergo physicochemical changes in response to applied stimuli, such as pH, temperature and biomolecular binding.

Recent research has established that hydrogels with particular functionalities can offer highly specific bioresponsiveness. Miyata, T., λsami. N., Uragami, T. Nature 1999, 399, 766-769; Miyata, T. , Jige, M. , Nakaminami, T. , Uragami, T. Proc. Natl. Acad. ScL U.S.A. 2006, 103.

1190-1193; Lin, D.C.. Yurke, B., Langrana, N. A. J Biomech. Eng. 2004, 126, 104- 110:

Murakami, Y., Maeda, M. Macromokcules 2005, 38, 1535-1537; Liedl. T., Dietz. H., Yurke, B.,

Simmel, F. Small 2007,5, 1688-1693; Wei, B.; Cheng, L; Luo, K. Q.; Mi, Y. Angew. Chem., Int.

Ed 2008, 47, 331- 333; Li, C, Madsen, J.. Armes, S. P., Lewis, A. L. Angew. Chem., Int. Ed. 2006, 45, 3510-3513; Oh, J. K., Siegwart, D. J., Lee, H., Sherwood, G., Peteanu, L., Hollinger,

J. O., Kataoka, K., Matyjaszewski, K. J. Am. Chem. Soc. 2007, 129, 5939-5945; Thornton, P. D..

Mart, R. J., Ulijn, R. V. AdV. Mater. 2007, 19, 1252-1256; Ehrick, J. D., Deo, S. K., Browning, T.

W., Bachas, L. G., Madou, M. J., Daunert, S. Nat. Mater. 2005, 4, 298-302; and Murphy. W. L.,

Dillmore, W. S., Modica, J., Mrksich, M. Angew. Chem., Int. Ed. 2007, 46, 3066-3069. For example, hydrogels that undergo physicochemical changes via antibody-antigen (Miyata et al. 1999;

Miyata et al. 2006) and DNA-DNA (Lin et al. 2004.; Murakami et al. 2005.; Liedl el al 2008) interactions have been used as drug delivery devices and biosensors. However, in order to design bioresponsive hydrogels able to produce a given expected change, a comprehensive knowledge of the biological material interactions is required. While current designs of hydrogels primarily focus on small molecules or peptides via receptor/ligand interactions, the lack of appropriate screening methods and rational design methods has limited the effectiveness of these approaches.

BRIEF SUMMARY The subject invention provides methods for fast and easy engineering of target-responsive hydrogels based on aptamers. In a preferred embodiment, the hydrogels contain rationally-designed DNA aptamers as a cross-linker. Specifically exemplified herein is a system wherein competitive binding of a target to the aptamer causes a decrease of cross-linking density and, therefore, dissolution of the hydrogel for potential drug release and other applications. Since aptamers have been identified for a broad range of targets, including several cancer biomarkers (Shangguan, D. ₅ Li, Y., Tang, Z. W., Cao, Z. H. C, Chen, H. W., Mallikratchy, P.. Sefah, K., Yang, C. Y. J.. Tan. W. II. Proc. Natl. Acad. ScL U.S.A. 2006, 103, 1 1838-1 1843),

this gel-to-sol transition system has a broad spectrum of applications. For example, this method can be adapted for use in the selective release of therapeutic agents in specific environments where targets are found, thus creating a highly selective controllable release system. In addition, recent development of functional DNA (aptamers. DNAzymes, and aptazymes) can be used to further extend the applications of this strategy.

Thus, the subject invention provides simple, but highly adaptable, methods of constructing very selective target-responsive hydrogels with, for example, controllable drug release capability. In a specific embodiment, linear polyacrylamide chains are used as the hydrogel backbone and a DNA aptamer as the cross-linker. Competitive binding of a target to the aptamer causes a decrease of cross-linking density and, hence, dissolution of the hydrogel and release of the drug. Advantageously, in one embodiment the system of the subject invention provides a highly selective drug release system whereby selective release of therapeutic agents can occur at specific environments in which a target biomarker is found.

The adaptability of this strategy for therapeutic applications has been demonstrated using small molecules as well as large molecules such as proteins.

The subject invention further pertains to the hydrogels obtained using the methods of the subject invention as well as to the use of these hydrogels.

The subject invention provides many advantages, including the following:

1. Polyacrylamide gel has an inert surface which minimized the nonspecific interactions.

2. Both polyacrylamide and aptamers have excellent biocompatibilities and low toxicity.

3. The hydrogel system is stable and does not need special treatments for storage, transport and application. 4. The hydrogel system can be easily prepared in situ, thereby providing great flexibility for utilizing various drugs.

5. Aptamers are purposely selected and can specifically bind to their targets, so that they have greater specificity and lower false positive rates.

6. Aptamer sequences are highly adaptable; therefore, aptamer crosslinked hydrogels can be programmed to respond to a wide variety of targets.

7. Aptamers can be synthesized in large scale easily and economically.

8. Drugs can be efficiently entrapped in the hydrogel matrix; aptamer-target interaction can trigger drug release in a controllable fashion.

BRIEF DESCRIPTION OF DRAWINGS Figure 1 shows a system of the subject invention.

Figure 2 (Fig. 2A) Scheme of DNA-induced formation and adenosine-induced dissolution of hydrogel: (I) Add Linker Adap to bind to Strand A- and Strand B-incorporated polyacrylamide mixture to form the hydrogel. (II) Add adenosine to competitively bind LinkerAdap to dissolve the hydrogel. (Fig. 2B) DNA sequences and linkages in the hydrogel. Optical images of the sol-gel transition: (Fig. 2C) system in the fluid state before LinkerAdap was added; (FIg. 2D) system in the gel state after LinkerAdap was added; and (Fig. 2E) system reverting to the initial fluid state after adenosine was added. In a control experiment a mutated linker with the two mutations, as shown in (Fig. IB) by the two short black arrows, was used.

Figure 3 shows absorption measurements of gold NPs in the gel systems. (Left) Cross-linked hydrogel with entrapped gold NPs disassembles upon addition of the target adenosine and dispenses the gold NPs into the buffer solution. There was little absorption in the beginning because the gold NPs are trapped inside the gel. Increasing absorbance was monitored after adenosine was added to the gel system as the gold NPs were released from the gel into the solution. The absorption was obtained with a spectrometer in constant-wavelength mode. (Right) Photograph of gels with entrapped gold NP is on the left, and the one on the right is the system 15 minutes after the addition of adenosine.

Figure 4 kinetics of the gold nanoparticles release at various concentrations of adenosine.

Figure 5 shows DNA sequences and linkages used according to the subject invention. Figure 6 shows crosslinked hydrogel with entrapped gold nanoparticles disassembles upon addition of the target thrombin and dispenses the gold nanoparticles into the buffer solution. The increasing absorbance was monitored with a spectrometer in constant- wavelength mode.

BRIEF DESCRIPTION OF THE SEQUENCE LISTING

SEQ ID NOs.1-4 are nucleotide sequences of acrydite modified oligonucleotides (also referred to herein as aptamers) that are used for obtaining hydrogels of the invention.

SEQ ID NO.5 is the nucleotide sequence of a cross-linking aptamcr of the invention. SEQ ID NOs. 6-8 are nucleotide sequences three different segments of the cross- linking aptamer of SEQ ID N0.5.

DETAILED DISCLOSURE

The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry and biochemistry within the skill of the art. Such techniques are explained fully in the literature.

The subject invention provides methods for efficient engineering of target-responsive hydrogels. In a preferred embodiment, the hydrogels contain rationally-designed DNA aptamers as a cross-linker. Competitive binding of a target to the aptamer causes a decrease of cross-linking density and, therefore, dissolution of the hydrogel for drug release and other applications.

The subject invention provides a novel approach for engineering highly selective target- responsive hydrogels. The basic principle is that creating such bioresponsive hydrogels requires a change in their cross-linking density in response to targets. In a preferred embodiment, the approach of the subject invention is based on the use of DNA aptamers that cross-link with linear polyacrylamide chains. An embodiment of the system of the subject invention is shown in Figure 1.

APTAMER Aptamers are single-stranded oligo nucleotides that can specifically bind to their targets

(Ellington, A. D., Szostak, J. W. Nature 1990,346, 8 18-822; Tuerk, C, Gold, L. Science 1990, 249, 505-510; and Shamah, S. M., Healy, J. M., Cload, S. T. Ace. Chem. Res. 2008, 41, 130- 138), enabling them to selectively recognize a variety of molecules ranging from macromolecules to small compounds. In comparison with antibodies, aptamers, particularly DNA aptamers., are relatively easy to obtain and easily adaptable to modification. Bunka, D. H. J.. Stockley, P. G. Nat. ReV. Microbiol. 2006, 4, 588-596; and Famulok, M., Hartig, J. S., Mayer, G. Chem. ReV. 2007, 107, 3715-3743. Since the use of the DNA aptamer as cross-linker meets the requirements in terms of hydrogel cross-linking density, hydrogels can be programmed to respond to a wide variety of targets. The term ''aptamer" is used herein to refer to a single- or double-stranded DNA molecule (or fragment thereof), a single-stranded RNA molecule (or fragment thereof), polynucleotide, or oligonucleotide, and any synthetic or partially synthetic modification of

any nucleic acid that recognizes and has a specific binding affinity for to a target compound or molecule of interest. See, e.g., PCT Publication Nos. WO92/14843, WO91/19813, and WO92/05285, the disclosures of which are herein incorporated by reference in their entirety. Aptamers include nucleic acids that are identified from a candidate mixture of nucleic acids. According to this invention, an aptamer desirably is incorporated in a hydrogel (e.g., a polyacrylamide hydrogel), using the methods of the invention.

APTAMER-TNCORPORATED POLYMERS

According to this invention, an "aptamer-incorporated polymer" is a particular kind of "prepolymer." Namely, a "prepolymer" is a partially polymerized product that typically contains at least one group available for further reaction to participate in producing yet another polymer, or polymeric network structure. As used herein, a "polymer" is comprised of many monomers, and includes "oligomers," which comprise more than one monomer. The aptamer-incorporated polymer is the prepolymer that typically precedes polymerization or co-polymerization into gel matrix in a reaction scheme, and from which the hydrogel of the subject invention is obtained by crosslinking of separate aptamer-incorporated polymers.

Preferably, an aptamer-incorporated polymer is a polymerized or co-polymerized form of monomer, where the polymer has linked thereto an aptamer. The aptamer is capable of functioning as "crosslinking groups" or "crosslinkers." In particular, desirably an aptamer- incorporated polymer is a polymerized form of polyacrylamide containing an aptamer. The aptamer can be present in the aptamer-incorporated polymer attached by way of a linker or spacer region.

Monomoers of the invention include, but are not limited to, acrylamide (AM), acrylic acid (AA), 2-hydroxyethylmethacrylatc (HEMA), N-vinyl 2-pyrrolidone (NVP), l-vinyl-2- pyrrolidone (VP), methyl methacrylate (MMA), glycidal methacrylate, methacrylic acid (MAA), acetone acrylamide, vinyl acetate, 2-ethyl-2-(hydroxymethyl)- 1,3 -propanediol trimethacrylate, N-(l,l-dimethyl-3-oxobutyl)acrylamide, 2-ethyl-2-(hydroxymethyl)-l,3- propanediol trimethacrylate, 2,3-dihydroxypropyl methacrylate, allyl methacrylate, 3- [3.3,5.5.5-pentamethyl- 1.1 -bis[pentamcthyldisiloxanyl)oxy]trisiloxanyl]- propyl methacrylate, 3 - [3 ,3 ,3 -trimethyl- 1 , 1 -bis(trimethylsiloxy)disiloxanyl]propyl methacrylate (TRIS), N-(I J -dirnethyl-3-oxybutyl)acrylamide, dimethyl itaconate, 2,2,2,-trifluoro-l- (trifluoromethyl)ethyl methacrylate. 2,2,2-trifluoroethyl methacrylate,

mcthacryloxypropylbis(trimethylsiloxy)methylsilane. methacryloxypropylpentamethyldisiloxane, (3-methacryloxy-2- hydroxypropyloxy)propylbis(trimethylsiloxy)methylsilane, citraconimide, 4-t-butyl-2- hydroxycyclohexyl methacrylate. dimethylacrylamide, glycerol methacrylate and dielhylaminoethyl methacrylate (DEAEM).

METHODS OF MAKING APTAMER-INCORPORATED POLYMERS

According to the subject invention, one method for preparing aptamer-incorporated polymers is by chemical modification of the polymer to attach the aptamer through the formation of amide, ester, or disulfide bonds after polymerization and crosslinking of the hydrogel. Another approach that has been employed is the polymerization of a suitable "attachment co-monomer ^" ' into the polymer matrix that is capable of reacting with the aptamer.

Another method employs direct co-polymerization of an monomer-derivatized aptamer. For instance, Acrydite (Mosaic Technologies, Boston, Mass.) is an acrylamide phosphoramidite that contains an ethylene group capable of free radical polymerization with acrylamide. Acrydite-modified aptamers are mixed with monomer (e.g., acrylamide) solutions and polymerized directly into the gel matrix (Rehman et a!.. Nucleic Acids Research, 27, 649-655 (1999).

METHODS OF MAKING TARGET RESPONSIVE HYDROGEL

The invention sets forth various means by which the target responsive hydrogel can be obtained. In a preferred fabrication route according to the invention, desirably the aptamer-incorporated polymer is a polyacrylamide-aptamer that is obtained by reaction of an acrylamide monomer or polymer with an acrydite-modified aptamer. The polyacrylamide- aptamer is then reacted with a crosslinking aptamer or another complementary polyacrylamide-aptamer (where the aptamers would hybridize), which optimally is followed by crosslinking (e.g.. spontaneous, UV, thermal, chemical, etc. crosslinking).

λ hydrogel product of the invention can be obtained by crosslinking complementary aptamer-incorporated polymers to obtain the polymer network structure (i.e., without incorporation of a crosslinker into the resultant hydrogel), or can be crosslinked by way of a crosslinkcr or crosslinking aptamer, to obtain a polymer network structure that incorporates

the crosslinking aptamcr. Polymerization or copolymerization of monomers or aptamer- incorporated polymers can be initiated by chemicals, irradiation, or any other techniques known to those skilled in the art, or any combination of techniques.

In one embodiment, initiation of polymerization will be by UV irradiation or thermal initiation. Similarly, desirably crosslinking will involve either UV irradiation or thermal initiation. Such techniques are well known in the art and can be done using well described protocols that have been optimized for use with a particular initiator. Thus, crosslinking of aptamer to monomer or polymer or of aptamer-incorporated polymers can be carried out by a variety of means, enerally, crosslinking is done by placing the reaction composition under a UV light source, e.g., a UV transilluminator. In terms of UV exposure, crosslinking desirably can be carried out at any wavelength having sufficient energy to produce a crosslink in the particular polymerization reaction being employed. Of course, the inclusion in such a polymerization reaction of a photosensitizer increases the useful range of wavelengths according to the invention. Similarly, thermal crosslinking can be done with use of a temperature-controlled chamber, e.g., glass chamber or oven.

In one embodiment of the invention, a hydrogel is provided, having at least two aptamer-incorporated polymers. The first aptamer-incorporated polymer comprises one or more polymerized or copolymerized monomer that is cross-linked with a first aptamer. The second second aptamer-incorporated polymer comprises one or more polymerized or copolymerized monomer that is cross-linked with a second aptamer. The cross-link between the first and second polymer to polymerize into a gel matrix (hydrogel) is the result of hybridization of the first aptamer to the second aptamer, wherein a first segment of the first aptamer hybridizes to a complementary segment of the second aptamer, wherein a second segment of the first aptamer binds to another complementary segment of the second aptamer, wherein the second segment of the first aptamcr preferentially hybridizes to a target analyte over the complementary segment of the second aptamer when in the presence of the target analyte. By "preferentially hybridize" is meant that the aptamer hybridizes preferentially to the target of interest or binds with greater affinity to the target than to other molecules. For example, an aptamer will bind to a substantially complementary sequence and not to unrelated sequences. As such, when in the presence of a target molecule, the first and second aptamers will dissociate from each other, resulting in the dissolution of the hydrogel.

In another embodiment of the invention, a hydrogel is provided, having at least two aptamcr-incorporated polymers and a cross-linking aptamer. The first aptamer-incorporated polymer comprises one or more polymerized or copolymerized monomer that is cross-linked with a first aptamer. The second aptamer-incoporated polymer comprises one or more polymerized or copolymerized monomer that is cross-linked with a second aptamer. The cross-linking aptamer comprises several segments complementary to the first and second aptamers, as well as preferential binding affinity to a target molecule. The cross-link between the first and second polymer is the result of hybridization of the first aptamer and the second aptamer to the cross-linking aptamer. A segment of the first aptamer hybridizes to a complementary segment of the cross-linking aptamer. A segment of the second aptamer hybridizes to a complementary segment of the cross-linking aptamer. Another segment of the cross-linking aptamer binds to the second aptamer, however, this segment of the cross-linking aptamer preferentially hybridizes to a target analyte over the second segment of the second aptamer when in the presence of the target analyte. As such, when in the presence of a target molecule, the cross-linking aptamer will dissociate from the second aptamer, resulting in the dissolution of the hydrogel.

APPLICATIONS

The hydrogels of the invention are well suited to numerous applications, including biomedical applications such as tissue engineering cell transplantation and drug delivery.

Further discussion of useful applications is provided by reference to WO 98/12228 published

Mar. 26, 1998, which is incorporated herein by reference in its entirety. For example, the hydrogels described herein are useful for delivering a therapeutic dose of a drug. A method in accordance with the present invention includes administering a target-responsive hydrogel with therapeutic agents incorporated therein.

Therapeutic agents in accordance with the subject invention include cytokines, antibacterial agents, anti-neoplastic agents, anti-fungal agents, immunomodulators, antiparasitic agents, and CNS agents. Preferred pharmaceutical agents thus include taxane- related antineoplastic agents, anthracyclines (including doxorubicin, daunorubicin, epirubicin, idarubicin, mithoxanthrone and carminomycin), mitomycin-type antibiotics, polyene antifungals such as amphotericin B. immunomodulators including tumor necrosis factor alpha (TNF-α). and interferons.

Additional suitable therapeutic agents include antibacterial agents such as penicillin- related compounds including 9-lactam antibiotics, broad spectrum penicillins, and penicillinasc-resistant penicillins (such as ampicillin, ampicillin-sublactam, nafcillin. amoxicillin, cloxacillin, methicillin, oxacillin, dicloxacillin, azocillin, bacampicillin, cyclacillin, carbenicillin, carbenicillin indanyl, mezlocillin, penicillin G, penicillin V, ticarcillin, piperacillin, aztreonam and imipenem, cephalosporins (cephalosporins include first generation cephalosporins such as cephapirin, cefaxolin, cephalexin, cephradine and cefadroxil; second generation cephalosporins such as cefamandole, cefoxitin, cefaclor, cefuroxime, cefuroxime axetil, cefonicid, cefotetan and ceforanide; third generation cephalosporins such as cefotaxime, ceftizoxime, ceftriaxone, cefoperazone and ceftazidime), tetracyclines (such as demeclocytetracycline, doxycycline, methacycline, minocycline and oxytetracycline), beta-lactamase inhibitors (such as clavulanic acid), aminoglycosides (such as amikacin, gentamicin C, kanamycin A, neomycin B, netilmicin, streptomycin and tobramycin), chloramphenicol, erythromycin, clindamycin, spectinomycin, vancomycin, bacitracin, isoniazid, rifampin, ethambutol, aminosalicylic acid, pyrazinamide, ethionamide, cycloserine, dapsone. sulfoxone sodium, clofazimine, sulfonamides (such as sulfanilamide, sulfamethoxazole, sulfacetamide, sulfadiazine, and siilfisoxazole), trimethoprim- sulfamethoxazole, quinolones (such as nalidixic acid, cinoxacin, norfloxacin and ciprofloxacin), methenamine, nitrofurantoin and phenazopyridine. Such agents further include agents active against protozoal infections such as chloroquine, diloxanide furoate, emetine or dehydroemetine, 8 -hydroxy quinolines, metronidazole, quinacrine, melarsoprol, nifurtimox, pentamidine, sodium stibogluconate and suramin.

Suitable therapeutic agents also include antifungal agents such as amphotericin-B, flucytosine, ketoconazole, miconazole, itraconazole, griseofulvin, clotrimazole, econazole, terconazole, butoconazole, ciclopirox olamine, haloprogin, toinaftate, naftifme, nystatin, natamycin, undecylenic acid, benzoic acid, salicylic acid, propionic acid and caprylic acid. Suitable agents further include antiviral agents such as zidovudine, acyclovir, ganciclovir, vidarabine, idoxuridine, trifiuridinc, foxcarnet, amantadine, rimantadine, and ribavirin.

The hydro gels of the invention can further comprise a variety of polypeptides including antibodies, immunomodulators or cytokines (including interferons or interleukins). peptide hormones (such as colony stimulating factors and tumor necrosis factors), hormone receptors, neuropeptides, lipoproteins (such as .alpha. -lipoprotein), erythropoietins, growth

hormones, thyroid hormones, toxins such as diphtheria toxin, proteoglycans such as hyaluronic acid, and glycoproteins such as gonadotropin hormone.

Chemotherapeutic agents appropriate for use in the invention also include, vinca alkaloids (such as vincristine and vinblastine), mitomycin-type antibiotics (such as mitomycin-C and N-methyl mitomycin-C), bleomycin-type antibiotics such as bleomycin A2, antifolates such as methotrexate, aminopterin, and dideaza-tetrahydro folic acid, colchicine, demecoline, etoposide, taxancs, and anthracycline antibiotics. Suitable tetracycline antibiotics include, without limitation, doxorubicin, daunorubicin, carminomycin, epirubicin, idarubicin, mithoxanthrone, 4-demethoxy-daunomycin, 11 -deoxydaunorubicin. 13-deoxydaunorubiein, adriamycin-14-benzoate. adriamycin-14-octanoate, or adriamycin-14-naphthaleneacetate.

Tissue engineering is directed towards creating biological tissue rather than relying on scarce transplantable organs. An extracellular matrix (ECM) of noncellular material has been identified in many multi-cellular organisms, including human beings. ECM molecules include specialized glycoproteins, proteoglycans, and complex carbohydrates. A wide variety of ECM structures have been identified, and ECM has been implicated in tissue formation. Simply put, the method of tissue engineering is tissue and organ reconstruction using synthetic (e.g., polymeric), three-dimensional matrices (e.g., hydrogels), also referred to as "scaffolds", which mimic a body's ECM to provide a space for new tissue formation in vivo.

Following are examples that illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

Materials and Methods

Sample preparation: Acrydite (Mosaic Technologies, Boston, Mass.) is an acrylamide phosphoramidite that contains an ethylene group capable of free radical polymerization with acrylamide. Acrydite-modified oligonucleotides (Strand A: 5'-Acrydite- AAAATCACAGATGAGT(SEQ ID NO.l)-3\ Strand B: 5'-Acrydite- AAAACCCAGGTTCTCT(SEQ ID NO.2)-3', Strand C: 5'-Acrydite- ACTGTGGTTGGTGTGGTTGG(SEQ ID NO.3)-3\ Strand D: 5'-Acrydite- ACCAλCCACAGT(SEQ ID NO.4)-3') were supplied by Integrated DNA Technologies

(Coralville, IA). Stock solutions of strand A, B, C and D were prepared separately at 3 mM DNA concentration. The stock solution contained: 10 mM Tris buffer (pH 8.0), 200 mM NaCl, 4% acrylamidc, 3 mM DNA strand A, B, C or D. Directly after mixing, nitrogen was bubbled through this solution for 10 min. To this stock solution was added 1.4% of a freshly prepared initiator-catalyst mixture consisting of 0.5 mL H ₂ O, 0.05 g ammonium persulfate, and 25 mL TEMRD. Nitrogen was bubbled through the mixture for an additional 10 minutes while polymerization proceeded.

In order to form an adenosine responsive hydrogel, the strand A, strands B and a cross-linking aptamer (referred to herein as LinkerAdap: 5'- ACTCATCTGTGAAGAGAACCTGGGGGAGI ATTGCGGAGGAAGGT(SEQ ID NO.5)- 3 ^" ) were mixed in stoichiometric concentrations. After incubation at 25°C for 10 minutes, the mixture became a hydrogel. This adenosine responsive hydrogel was dissociated by immersion in a solution of 2 mM adenosine.

In order to form an thrombin responsive hydrogel, the strand C and strand D were mixed in stoichiometric concentrations. After incubation at 25°C for 10 minutes, the mixture became a hydrogel. This thrombin responsive hydrogel was dissociated by immersion in a solution of 2 mM thrombin.

Absorbance spectroscopy: Approximately 10 μL of the crosslinked gel, loaded with gold nanoparticles, were placed on the bottom of a glass cuvette containing 60 μL Tris buffer (200 mM NaCl). The concentration of gold nanoparticles in hydrogel is about 10 nM. The cuvette was mounted in a spectrometer. In order to collect absorbance only from released nanoparticles, the light was precluded from the gel itself. The absorbance was monitored in constant-wavelength mode at 620 ran. After 30 min, 60 μL of adenosine or thrombin (2 mM) were added. To overcome slow diffusion of the nanoparticles in the comparably large cuvette volume, the cuvette was shaken gently between the measurements.

EXAMPLE 1

First, an adenosinc-rcsponsive polyacrylamide hydrogel was constructed. As shown in Figure 2, two acrydite-modified oligonucleotides. Strand A and Strand B, are separately copolymerized with acrylamide (4%, w/v) and thereby incorporated into the polyacrylamide chains. Detailed DNA sequences and linkages are shown in Figure 2B.

Hie acrydite-modified oligonucleotides are reported to exhibit activity similar to that of acrylamide monomers, and oligonucleotide-based and switchable polyacr>lamide hydrogels have recently been produced by this method (Lin et al. 2004.; Murakami et al. 2005.; Liedl et al. 2008). By mixing these two oligonucleotide-incorporated polyacrylamide solutions in stoichiometric concentrations, a fluid system is obtained . This system can then be gelled by the addition of rationally designed cross linking oligonucleotides, termed LinkerAdap.

LinkerAdap can be divided into three segments. The first segment (denoted ''X' ^' in the figure, 5'-ACTCATCTGTGA(SEQ ID NO.6)-3') can hybridize with Strand A. The second segment (denoted "Y" in the figure, 5'-AGAGAACCTGGG(SEQ ID NO.7)-3 ^" ) can hybridize with the last five nucleotides of Strand B. The third segment (denoted '"Z" in the figure. 5'- GGAGTATTGCGGAGGAAGGT(SEQ ID NO.8)-3'), which is the aptamer sequence for adenosine, can hybridize with the seven nucleotides on Strand B.

In the presence of adenosine, the aptamer will bind adenosine. As a result, only five base pairs are left to hybridize with Strand B, which is unstable at room temperature. Therefore, Strand B will dissociate from the LinkerAdap, resulting in the dissolution of the hydrogel.

The sol-to-gel and gel-to-sol transitions were examined through the flow behavior. Figure

2C shows that the system of chain A- and chain B-incorporated polyacrylamide mixture was in the fluid state. However, after the LinkerAdap was added, the system gelled (Figure 2D). By further addition of the adenosine with an excess amount relative to Strand A or Strand B, the hydrogel reverted to the initial fluid state (Figure 2E).

A control experiment was performed to support the mechanism of gel dissolution shown in Figure 2. Instead of the original linker (LinkerAdap). a mutated linker was used to form the hydrogel. The sites of mutation are marked in Figure 2B; aptamers with this mutated sequence were shown to be incapable of binding adenosine. Liu, J. W., Lu. Y. Angew. Chem., Int. Ed. 2006, 45, 90-94; and Liu, J. W., Mazumdar, D., Lu, Y. Angew Chem., Int. Ed. 2006, 45, 7955-7959. Hence, no gel-to-sol transition was observed for hydrogel linked by the mutated linker after adding 2mM adenosine solution, which showed that the observed gel-to-sol transition described above was indeed caused by adenosine/aptamer interactions.

EXAMPLE 2

As shown in Example 1, a hydrogel cross-linked with aptamer DNA can be dissolved in the presence of adenosine. Consistent with the nature and properties of hydrogels as noted above, this

suggested that hydrogels could trigger controllable release of encapsulated molecules, including drugs. To demonstrate this principle, water-soluble citrate-modified 13 ran gold nanoparticles (NPs) was used as a model drug. Gold nanostructures can be easily tracked with IR absorption, and they were recently proved to have characteristics adaptable to photothermal therapy, making them ideal for testing biomedical applications. Hirsch, L. R., Stafford, R. J., Bankson, J. A., Sershen, S. R.,

Rivera, B., Price. R. E., Hazle. J. D., Halas, N. J., West, J. L. Proc. Natl. Acad. ScL U.S.A.

2003, 100, 13549-13554.

Accordingly, a cross-linked gel loaded with a high concentration of gold NPs was prepared.

This gel was placed in a buffer solution for 12 hours. As a consequence of the tight trapping of the NPs in the gel matrix, no increase in absorption due to release of NPs into solution could be detected.

After the addition of 2 mM adenosine, however, an increase of absorbance in the solution surrounding the gel could be observed within several minutes, which indicated the release of the trapped gold nanoparticles and dissolution of the gel triggered by adenosine (Figure 3).

It was further observed that the rate of NP release increases with increasing adenosine concentration, whereas no NP release was detected for other ribonucleosides, such as cytidine, undine, and guanosine. This suggests that the high selectivity of the aptamer was maintained in the gel system.

The sensitivity of this controllable release was also investigated. Fifty micromolar adenosine can release detectable gold NPs from the hydrogel (Figure 4).

EXAMPLE 3

To illustrate the generality of this method, the strategy' was tested on a different type of target by constructing a hydrogel based on a reported human thrombin aptamer. Nutiu, R., Li, Y. J. Am.

C hem. Soc. 2003, 125, 4771-4778. Detailed DNA sequences and linkages arc shown in Figure 5. To simplify the design, two acrydite-modified oligonucleotides, Strand C and Strand D, were used to construct the cross-linker. Strand C can be divided into two segments. The first segment

(double-underline in the figure) can hybridize with the last five nucleotides of Strand D. The second segment (single-underline in the figure), which is the aptamer sequence for thrombin, can hybridize with the other seven nucleotides on the Strand D (Nutiu et al. 2003). Mixing these two oligonucleotide-incorporated polyacrylamide solutions in stoichiometric concentrations yields a hydrogel directly. Similar to adenosine-responsive hydrogel, addition of thrombin to this hydrogel transforms the system into a fluid state. The release process of the

thrombin-induced gold NPs is slower (130 min for 90% release) than the adenosine-induced release, which most likely results from the slow diffusion of thrombin in the gel (Figure 6).

All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.