TARGETING CANCER WITH FTO-IT1 LONG NONCODING RNA ANTISENSE OLIGONUCLEOTIDES

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No. 63/410,865, filed on September 28, 2022. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application.

Sequence Listing

This application contains a Sequence Listing that has been submitted electronically as an XML file named 07039-2161 W01_SL_ST26.xml. The XML file, created on September 26, 2023, is 85,321 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.

TECHNICAL FIELD

This document relates to methods and materials involved in assessing and/or treating mammals (e.g., humans) having cancer. For example, materials and methods provided herein can be used to determine whether or not a cancer is likely to be responsive to a particular cancer treatment (e.g., one or more antisense oligonucleotides targeted to the FTO-IT1 long noncoding RNA). In some cases, the methods and materials provided herein can be used to treat a mammal by administering to the mammal one or more cancer treatments (e.g., one or more antisense oligonucleotides targeted to the FTO- IT1 long noncoding RNA) that is/are selected based, at least in part, on whether or not the mammal is likely to be responsive to a particular cancer treatment.

BACKGROUND

Prostate cancer (PCa) is the most commonly diagnosed cancer among men in the United States and other Western countries. Androgen deprivation therapy (ADT) is the mainstay treatment for most advanced PCas because of their dependency on androgen/androgen receptor (AR) signaling for growth and survival (Grossman et al., J Natl Cancer Inst 93: 1687-1697, 2001; and Watson et al., Nat Rev Cancer 15:701-711, 2015). However, the majority of these tumors relapse after ADT and become castrationresistant prostate cancer (CRPC), which usually are treated with second generation antiandrogens such as enzalutamide (ENZ) or the first-line chemotherapeutic agent taxane (e.g., docetaxel (DTX); Petrylak et al., NEnglJMed 351 : 1513-1520, 2004; Scher et al., N Engl J Med 367: 1187-1197, 2012; Tannock et al., N Engl JAfet/ 351: 1502-1512, 2004; and Tran et al., Science 324:787-790, 2009. Since CRPC patients often progress on the treatment of ENZ or taxane in the clinic, it is conceivable that CRPC tumors may acquire previously undefined mechanisms to become therapy resistant.

TP53 is an essential tumor suppressor gene that inhibits oncogenic transformation and tumor development and progression. The TP53 gene is the most frequently mutated gene in human cancers, including advanced PCa (Kastenhuber and Lowe, Cell 170: 1062- 1078, 2017; Lane, Science 365:539-540, 2019; Muller and Vousden, Cancer Cell 25:304- 317, 2014; and Robinson, Cell 161: 1215-1228, 2015). TP53 gene inactivation in combination with other genetic lesions can promote PCa progression and resistance to antiandrogens (Ku et al., Science 355:78-83, 2017; and Mu et al., Science 355:84-88, 2017). Regulation of p53 tumor suppression functions by epigenetic mechanisms, especially through epitranscriptomic modifications, and understanding of the role of such modifications in cancer therapy resistance is limited.

A^-methyladenosine (m ⁶ A) is the most prevalent post-transcriptional modification of RNAs in vertebrate cells (Frye et al., Science 361 :1346-1349, 2018; and Shi et a ., Mol Cell 74:640-650, 2019). The m ⁶ A modification is catalyzed by a writer complex consisting of the METTL3-METTL14 core component, regulators/facilitators, RNA recruiters including WTAP, VIRMA, ZC3H13, HAKAI, and RNA binding motif protein 15/15B (RBM15/15B) (Liu et al., Nat Chem Biol 10:93-95, 2014; and Ping et al., Cell Res 24: 177-189, 2014). RNA m ⁶ A methylation and the associated biological processes are antagonized or reversed completely due to active demethylation caused by m ⁶ A demethylases FTO and AlkB homolog 5 (ALKBH5) (Jia et al., Nat Chem Biol 7:885-887, 2011; Wei et al., Mol Cell 71 :973-985 e975, 2018; and Zheng et al., Mol Cell 49: 18-29, 2013).

SUMMARY

This document provides antisense oligonucleotides (ASOs) that can be used to treat mammals (e.g., humans) having cancer (e.g., PCa, breast cancer, or lung cancer). This document also provides materials and methods for treating mammals having cancer, methods and materials involved in assessing mammals having cancer, and methods and materials involved in assessing and treating mammals having cancer. In some cases, for example, this document provides methods and materials for determining whether or not a mammal having cancer is likely to be responsive to a particular cancer treatment and, optionally, administering one or more cancer therapies selected based, at least in part, on whether or not the mammal is likely to be responsive to a particular treatment. For example, this document provides methods and materials involved in treating mammals having cancer, where the methods include administering an agent targeted to FTO intronic transcript 1 (FTO-IT1), which is a long non-coding RNA (IncRNA) transcribed from an intron of the FTO gene. FTO encodes FTO (fat mass and obesity-associated protein), which has been linked to cancer and obesity due, at least in part, to its role in regulating RNA m ⁶ A demethylation (see, e.g., Gulati et al., Proc Natl Acad Set USA 110 2557-2562, 2013; and Jia et al., supra). In some cases, a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human) having cancer can be assessed to determine if the mammal is likely to be responsive to a particular cancer treatment based, at least in part, on the presence, absence, or level of FTO-IT1 expression in the sample.

As demonstrated herein, FTO-IT1, which is a IncRNA transcribed from the last intron (intron 8) of the FTO gene, is upregulated by treatment of antiandrogen ENZ and DTX in PCa cells. The results described herein also demonstrate that FTO-IT1 is upregulated during PCa progression, and that its overexpression is associated with poor overall survival of patients with tumors harboring wild-type (WT) p53. In addition, the results described herein demonstrate that RBM15, a component of the m ⁶ A methyltransferase complex, binds p53 protein and mediates mRNA m ⁶ A methylation and stabilization of p53 transcriptional target genes, but m ⁶ A-mediated p53 tumor suppression is abolished by FT0-IT1 binding of RBM15. Further, therapeutic targeting of FTO-ITl was found to restore p53 signaling and inhibit PCa tumor growth in mice. Thus, the results described herein identify a role of a IncRNA in the FTO gene locus that inhibits mRNA m ⁶ A and p53 tumor suppression signaling, and reveal FTO-ITl as a biomarker and cancer therapeutic target.

Having the ability to determine whether or not a particular mammal is likely to respond to a particular cancer treatment (e.g., an ASO targeted to FTO-ITl) can allow clinicians to provide an appropriate approach in selecting cancer treatments for that patient. For example, the cancer treatments provided herein (e g., ASOs that bind to FTO- ITl) can be used to treat cancer patients identified as having elevated expression of FTO- ITl.

In general, one aspect of this document features an antisense oligonucleotide (ASO) for reducing the level of a long noncoding RNA of fat mass and obesity- associated protein (FTO-ITl) within a cell, where the ASO is from about 12 to about 40 nucleotides in length, where at least a portion of the nucleotide sequence of the ASO is (i) complementary to the DNA sequence encoding FTO-ITl or (ii) complementary to the RNA sequence of FTO-ITl, and where the ASO has the ability to reduce the level of FTO-ITl in the cell. The portion of the nucleotide sequence of the ASO can be complementary to the DNA sequence encoding FTO-ITl. The portion of the nucleotide sequence of the ASO can be complementary to the RNA sequence of FTO-ITl. The ASO can be from about 15 to about 30 nucleotides in length. The ASO can include, consist essentially of, or consist of the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO: 84) or CACTGCATCTTGCATCCCTA (SEQ ID NO: 87). For example, the ASO can include the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84), or the ASO can include the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO:87).

In another aspect, this document features a pharmaceutical composition containing an ASO described herein. In another aspect, this document features a method of treating a mammal identified as having cancer. The method can include, or consist essentially of, administering an ASO to a mammal identified as having cancer, where the ASO is from about 12 to about 40 nucleotides in length, where at least a portion of the nucleotide sequence of the ASO is (i) complementary to the DNA sequence encoding FTO-IT1 or (ii) complementary to the RNA sequence of FTO-IT1, where the ASO has the ability to reduce the level of FTO-IT1 in a cell of the cancer, and where the ASO is administered in an amount effective to reduce the level of FTO-IT1 within the mammal. The portion of the nucleotide sequence of the ASO can be complementary to the DNA sequence encoding FTO-IT1. The portion of the nucleotide sequence of the ASO can be complementary to the RNA sequence of FTO-IT1. The ASO can include, consist essentially of, or consist of the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO: 84) or CACTGCATCTTGCATCCCTA (SEQ ID NO: 87). For example, the ASO can include the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO: 84), or the ASO can include the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO:87). The mammal can be a human. The cancer can be prostate cancer, breast cancer, or lung cancer.

In another aspect, this document features a method for assessing a mammal having cancer. The method can include, or consist essentially of, (a) detecting a presence or absence of an increased level of FTO-IT1 expression in a sample from the mammal; (b) classifying the mammal as being likely to respond to an ASO targeted to FTO-IT1 if the presence of the increased level is detected, or (c) classifying the mammal as not being likely to respond to an ASO targeted to FTO-IT1 if the absence of the increased level is not detected. The mammal can be a human. The ASO can include, consist essentially of, or consist of the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84) or CACTGCATCTTGCATCCCTA (SEQ ID NO:87). For example, the ASO can include the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO: 84), or the ASO can include the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO: 87). The sample can include cancer cells of the cancer. The cancer can be selected from the group consisting of prostate cancer, breast cancer, and lung cancer. The method can include detecting the presence of the increased level, and in some cases, classifying the mammal as being likely to respond to the ASO. The method can include detecting the absence of the increased level, and in some cases, classifying the mammal as not being likely to respond to the ASO. The detecting step can include performing a method that detects FT0-IT1.

In still another aspect, this document features a method for treating a mammal having cancer, where the method includes, or consists essentially of, (a) detecting an increased level of FT0-IT1 expression in a sample obtained from the mammal; and (b) administering a cancer treatment to the mammal, where the cancer treatment includes an ASO targeted to FT0-IT1. The mammal can be a human. The ASO can include, consist essentially of, or consist of the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84) or the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO:87). For example, the ASO can include the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO: 84), or the ASO can include the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO: 87). The sample can include cancer cells of the cancer. The cancer can be selected from the group consisting of prostate cancer, breast cancer, and lung cancer.

This document also features a method for treating cancer, where the method includes, or consists essentially of, administering a cancer treatment to a mammal identified as having an increased level of FT0-IT1 expression in a sample obtained from the mammal, where the cancer treatment includes an ASO targeted to FT0-IT1. The mammal can be a human. The ASO can include, consist essentially of, or consist of the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84) or the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO:87). For example, the ASO can include the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84), or the ASO can include the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO: 87). The sample can include cancer cells of the cancer. The cancer can be selected from the group consisting of prostate cancer, breast cancer, and lung cancer.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

DESCRIPTION OF DRAWINGS

FIGS. 1A-1 J show that increased expression of FT0-IT1 is associated with PCa progression and growth. FIG. 1A is a heatmap showing the upregulated noncoding RNAs defined by RNA-seq in C4-2R versus C4-2C cells. FIG. IB is a Venn diagram showing the overlap of upregulated noncoding RNAs in C4-2R and the noncoding RNAs located in known m ⁶ A modifier gene loci. FIG. 1C is graph plotting tracks of RNA-seq profile showing the sequencing signal in the FTO-ITI locus in C4-2R versus C4-2C cells. FIG. ID includes representative images showing RNA Fluorescent in situ hybridization (FISH) of FTO-ITI using FAM-labeled FTO-ITI specific probes in C4-2C and C4-2R. Scale bar, 10 pm. FIG. IE is a graph plotting quantification of the FTO-ITI FISH signal in C4-2C and C4-2R cells. FIG. IF is a graph plotting relative FTO-ITI expression as determined by RT-qPCR of FTO-ITI in control and Docetaxel resistant 22Rvl, C4-2, and LNCaP cells. Data are plotted as mean ± SD. FIG. 1G is a graph plotting FTO-ITI expression levels in different stages of prostate tumors in patients from the TCGA dataset (firehose legacy 499). Data are shown as means ± SD. FIG. 1H is a graph plotting the results of RT-qPCR analysis of FTO-ITI expression in primary PCa (n = 12) and CRPC (n = 16) patient samples. FIG. II is a graph plotting the probability of progression-free survival (PFS) for FTO-IT -high and FTO-IT1-{OSN patients of the TCGA cohort with tumors expressing WT TP53 (firehose legacy 499). The P values were calculated using logrank test. FIG. 1 J is a graph plotting the probability of overall survival (OS) for FTO- 777 -high and FTO-777-low patients of the WCDT cohort with tumors expressing WT TP53. The P values were calculated using logrank test. For the data presented in FIGS. IE, IF, 1G, and 1H, the P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, ***P < 0.01, *** < 0.001.

FIGS. 2A-2F show an increase of FTO-IT1 in ENZ-resistant prostate cancer cells. FIG. 2A is a graph plotting levels of FTO-JT1 expression from RNA-seq data in C4-2C and C4-2R cells. FIG. 2B is a graph plotting copy number of FTO-IT1 in C4-2C, C4-2R. and 22Rvl cells. FIGS. 2C and 2D are tracks of AR ChlP-seq on FTO-ITl gene locus in C4-2 cells after the indicated treatments (GSE55032, GSE136130). CSS, charcoal stripped serum. Mib, Mibolerone. ENZ, Enzalutamide. FIG. 2E is a graph plotting the results of RT-qPCR analysis of FTO-IT1 in C4-2 cells treated with CSS or ENZ for the indicated times. FIG. 2F is a graph plotting the results of RT-qPCR analysis o FTO-ITl in C4-2 cells treated with AR Proteolysis targeting chimeric (PROTAC) ARV-110 (image in the right panel). The data shown are means ± SD (n = 3 biological replicates). Statistical significance was determined by unpaired two-tailed Student's /-test; *P < 0.05, **P < 0.01.

FIGS. 3A-3F show the results of studies conducted to assess the survival of patients with tumors expressing high or low levels of FTO-TT1 and effect of FTO-IT1 on m ⁶ A modification. FIG. 3A is a graph plotting the probability of progression free survival (PFS) of /'7'( -/77-high and -low patients in the TCGA cohort (firehose legacy 499). P values were calculated using logrank test. FIG. 3B is a graph plotting the probability of overall survival (OS) of /’7O-//7-high and -low patients in the PCa WCDT cohort. P values were calculated using logrank test. FIG. 3C includes a diagram showing the location in the FTO gene locus of FTO-IT1 and the targeting positions of 2 pairs of sgRNAs used to knock out FTO-IT1 (top panel), and the results of PCR analysis of genomic DNA in the FTO-IT1 locus in mock KO and FTO-IT1 KO C4-2R and 22Rvl cells using indicated primers (bottom panel). FIG. 3D includes graphs plotting the results of RT-qPCR analysis of FTO-IT1 expression levels in mock KO and FTO-IT1 KO C4-2R (left) and 22Rvl (right) cells. FIG. 3E includes representative images showing dot blot detection of m ⁶ A modification on mRNAs from mock KO and FTO-IT1 KO C4-2R and 22Rvl cells. FIG. 3F includes graphs plotting m ⁶ A _m levels on mRNAs from mock KO and FTO-IT1 KO C4-2R and 22Rvl cells, detected by mass spectrometry. For FIGS. 3D and 3F, data are shown as means ± SD (n = 3 biological replicates). P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, **P < 0.01, ***P < 0.001.

FIGS. 4A-4L show that FTO-JTl downregulates p53 transcriptional target gene mRNA expression through m ⁶ A modification. FIG. 4A is a graph plotting data from a mass spectrometry analysis of global m ⁶ A levels on mRNAs from mock and FTO-IT1 KO C4-2R and 22Rvl cells. FIG. 4B is a volcano plot of the hypermethylated and hypom ethylated peaks in FTO-IT1 KO versus mock KO 22Rvl cells. FIG. 4C is a graph plotting overall m ⁶ A frequencies along different regions of mRNAs in mock KO and FTO-IT1 KO 22Rvl cells. FIG. 4D is a volcano plot of upregulated and downregulated genes in FTO-IT1 KO versus mock KO 22Rvl cells. FIG. 4E is a scatter plot showing the distribution of m ⁶ A peaks with significant changes in both m ⁶ A levels and expression levels of corresponding genes in FTO-IT1 KO versus mock KO 22Rvl cells. FIG. 4F is a graph plotting an analysis of the enrichment of pathways from three databases (WikiPathways, KEGG Pathway, and Canonical Pathways) in the genes upregulated and hypermethylated in FTO-IT1 KO compared to mock KO 22Rvl cells. FIG. 4G is a heat map showing the expression of p53 transcriptional target genes in mock KO and FTO- ITI KO 22Rvl cells. FIGS. 4H and 41 are tracks showing input RNA-seq and m ⁶ A-seq signal profiles of FAS (FIG. 4H) and TP53INP1 (FIG. 41) loci in mock KO and FTO- IT1 KO 22Rvl cells. FIG. 4J includes a pair of graphs plotting RIP-qPCR results for the indicated genes from m ⁶ A-immunoprecipitated mRNAs in mock KO and FTO-IT1 KO 22Rvl cells. FIG. 4K includes a pair of graphs plotting the stability of the indicated gene mRNAs in 22Rvl cells treated with actinomycin D for different periods of time. FIG. 4L includes images showing Western blots of whole cell lysates (WCL) from mock KO and FTO-ITI KO C4-2R and 22Rvl cells. For FIGS. 4J and 4K, data are shown as means ± SD (n = 3 biological replicates). P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, **P < 0.01, ***p < 0.001.

FIGS. 5A-5I show pathway enrichment and m ⁶ A levels in p53 target gene loci, and expression and half-life of p53 target gene mRNAs in mock and FTO-ITI KO cells. FIG. 5A is a graph plotting enrichment scores for pathways from three databases (WikiPathways, KEGG Pathway, and Canonical Pathways) in the genes upregulated in FTO-IT1 KO compared to mock KO 22Rvl cells. FIG. 5B is a graph plotting enrichment scores for pathways from three databases (WikiPathways, KEGG Pathway, and Canonical Pathways) in the genes downregulated in FTO-ITl KO compared to mock KO 22Rvl cells. FIG. 5C is a plot showing gene set enrichment analysis of the differentially expressed hypermethylated genes in FTO-ITl KO versus mock KO 22Rvl cells. Normalized Enrichment Score (NES) = 1.7, P = 0.004. FIGS. 5D and 5E are tracks showing RNA-seq signal in inputs and m ⁶ A-seq signal profile at the SESN2 (FIG. 5D) and MDM2 (FIG. 5E) gene loci in mock KO and FTO-ITl KO 22Rvl cells. FIG. 5F includes graphs plotting the results of RIP-qPCR for the indicated genes from m ⁶ A- immunoprecipitated mRNAs from mock KO an FTO-ITl KO 22Rvl cells. FIG. 5G includes graphs plotting stability of the indicated mRNAs in 22Rvl cells treated with Actinomycin D for different periods of time. FIGS. 5H and 51 are graphs plotting relative expression levels of the indicated gene mRNAs in mock KO and FTO-ITl KO 22Rvl (FIG. 5H) and C4-2R (FIG. 51) cells, as determined by RT-qPCR. For FIGS. 5F- 51, data are shown as means ± SD (n = 3 biological replicates). P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, **P < 0.01, ***p < 0.001.

FIGS. 6A-6O show that FTO-ITl promotes cell cycle progression and survival via p53 downstream pathways. FIGS. 6A and 6B include images and graphs showing mock and FTO-ITl KO 22Rvl (FIG. 6A) and C4-2R (FIG. 6B) cells subjected to colony formation (top panels) and quantification (bottom panels). Data are shown as means ± SD (n = 3 biological replicates). FIGS. 6C and 6D show the results of cell cycle analysis of mock KO and FTO-ITl KO 22Rvl cells by flow cytometry (FIG. 6C) and quantification (FIG. 6D). FIG. 6E is an image showing a representative Western blot of WCL from mock and FTO-ITl KO 22Rvl cells expressing control or SESN2 specific shRNA. FIGS. 6F and 6G include representative images (FIG. 6F) and corresponding quantification (FIG. 6G) of cell cycle analysis in mock and FTO-ITl KO 22Rvl cells expressing SESN2 specific shRNA. FIGS. 6H and 61 show the results of apoptosis analysis of mock KO and FTO-ITl KO 22Rvl cells by flow cytometry (representative images in (FIG. 6H) and quantification of the apoptotic cells (FIG. 61). FIGS. 6J-6L show the results of western blot analysis (FIG. 6J) and apoptosis assays (FIGS. 6K and 6L) for mock and FT0-IT1 KO 22Rvl cells expressing control or /' S'-specific sgRNA. FIGS. 6M-6O show the results of western blot analysis (FIG. 6M) and apoptosis assays (FIGS. 6N and 60) for mock and FT0-IT1 KO 22Rvl cells expressing control or 7P53/A/P/-specific sgRNA. In FIGS. 6A, 6B, 6D, 6G, 61, 6L, and 60, data are shown as means ± SD (n = 3 biological replicates). P values were calculated using an unpaired two-tailed Student’s t- test; *P < 0.05, **P < 0.01, ***P < 0.001, n.s., not significant.

FIGS. 7A-7C show FTO expression in control an FTO-ITl KO PCa cell lines. FIG. 7A includes graphs plotting FTO-IT1 and FTO relative expression levels in mock cells, as determined by RT-qPCR. FIG. 7B shows tracks of RNA-seq profiles showing the sequencing signal in the FTO locus in FTO-IT1 KO versus mock KO 22Rvl cells. FIG. 7C includes representative images showing western blot analysis of the indicated proteins in WCL from mock KO and FTO- IT1 KO 22Rvl and C4-2R cells. For FIG. 7A, data are shown as means ± SD (n = 3 biological replicates). P values were calculated using an unpaired two-tailed Student’s t- test; *P < 0.05, **P < 0.01, < 0.001.

FIGS. 8A-8K show that FTO-IT1 interacts with the METTL3/14 complex through RBM15. FIG. 8A is a diagram showing the principle of protein-RNA complex pulled down by the biotin-labeled FTO-IT1 RNA. FIG. 8B is a representative image showing silver staining of proteins pulled down by control RNA and FTO-IT1 RNA. FIG. 8C is a Venn diagram showing the FTO-IT1 interacting proteins and known m ⁶ A modifier proteins. FIG. 8D shows a mass spectrometry result for the RBM15 unique peptide. FIG. 8E is an image showing a representative western blot of the indicated proteins in WCL and RNA pulldown samples. FIG. 8F is an image showing a western blot of in vitro translated RBM15 and RNA pulldown samples. FIG. 8G includes a graph plotting the results of CLIP-qPCR analysis of FTO-IT1 in RBM 15 -immunoprecipitated RNA in UV crosslinked cells (left) and an image showing western blot validation of RBM15 immunoprecipitation (right). FIG. 81 includes images showing the results of RNA pulldown using truncated FTO-IT1 RNAs (depicted in FIG. 8H) and in vitro translated RBM15, followed by western blot analysis. FIG. 8K shows the results of GST pulldown using truncated GST-RBM15 proteins (depicted in FIG. 8J) and in vitro transcribed FT0-IT1 RNA, followed by RT-qPCR analysis (FIG. 8K, top) and Coomassie blue staining (FIG. 8K, bottom).

FIGS. 9A-9C show the results of RBM15 CLIP-seq data quality and binding motif analysis. FIG. 9A includes heatmaps showing RBM15 CLIP-seq read intensity around the m ⁶ A peak center at gene regions in 22Rvl cells. FIG. 9B is a graph plotting the density of RBM15 CLIP-seq signals along the gene body, including the 5' untranslated region (UTR), coding sequences (CDS), and 3' UTR. FIG 9C is a table listing the top ten RBM15 binding motifs analyzed from CLIP-seq.

FIGS. 10A-10I show that FTO-IT1 regulates p53 transcriptional target gene expression via binding with RBM15. FIG. 10A is a Venn diagram showing the overlap of RBM15 interacting mRNA and p53 target gene mRNA (P value calculated by hypergeometric probability assuming total gene number 25000). FIG. 10B shows tracks of RBM15 CLIP-seq in combination with m ⁶ A-seq on the indicated gene loci. FIG. 10C is a graph plotting the results of CLIP-qPCR analysis of the indicated mRNA from RBM 15 -immunoprecipitated RNA in UV crosslinked control and FTO-IT1 KO 22Rvl cells expressing the indicated constructs. FIG. 10D is an image showing a representative western blot of WCL for the indicated proteins from 22Rvl cells transfected with NC or ABAL/5-specific siRNA. FIG. 10E is a graph plotting the results of RIP-qPCR for the indicated genes in m ⁶ A-immunoprecipitated mRNAs from 22Rvl cells transfected with NC or ABA/75-specific siRNA. FIG. 10F is a graph plotting the results of RT-qPCR for the indicated genes from 22Rvl cells transfected with NC or RBM15 -specific siRNA. FIG. 10G is an image showing a western blot of WCL for the indicated proteins from control and FTO-IT1 KO 22Rvl cells transfected with NC or RBM 15 -specific siRNA. FIG. 10H is a graph plotting the results of RIP-qPCR for the indicated genes from m ⁶ A- immunoprecipitated mRNAs from control and FT -I'Tl KO 22Rvl cells transfected with NC or RBM 15 -specific siRNA. FIG. 101 is a graph plotting the results of RT-qPCR for the indicated genes from control and FTO-IT1 KO 22Rvl cells transfected with NC or RBM 15 -specific siRNA. For FIGS. 10C, 10E, 10F, 10H, and 101, data are shown as means ± SD (n = 3 biological replicates). P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, **P < 0.01, ***P < 0.001, n.s., not significant.

FIGS. 11A-11F show that FTO-ITJ regulates p53 target genes via METTL3 mediated m ⁶ A modification on mRNA, and that RBM15 binds with p53 target gene loci on chromatin. FIG. 11A is an image showing a western blots of WCL from mock and FTO-IT1 KO 22Rvl cells expressing non-specific control (NC) or ME TTL 3 -specific shRNA. FIG. 11B is a graph plotting the results of RIP-qPCR on the indicated genes from m ⁶ A-immunoprecipitated mRNAs in mock and FTO-IT1 KO 22Rvl cells expressing non-specific control (NC) or METTL3-specific shRNA. FIG. 11C is a graph plotting relative levels of the indicated gene mRNAs in non-specific mock and FTO-IT1 KO 22Rvl cells expressing non-specific control (NC) or METTL 3 -specific shRNA (as determined by RT-qPCR analysis). FIG. 11D includes a Venn diagram showing the overlap of RBM15 binding genes from RBM15 ChlP-seq data (GSE175263) and p53 target gene (left), a Venn diagram showing the overlap of these crossed genes with hypermethylated genes in FTO-IT1 KO 22Rvl cells (middle), and a list of these genes (right). FIG. HE shows tracks of RBM15 ChlP-seq showing the sequencing signal in the TP53INP1,MDM2, and SESN2 gene loci in K562 cells (GSE175263). FIG. HF is a graph plotting the results of using ChlP-qPCR to detect promoters of the indicated genes from RBM 15 -immunoprecipitated chromatin in formaldehyde crosslinked 22Rvl cells. For FIGS. HB, 11C, and HF, data are shown as mean ± SD (n = 3 biological replicates). P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, **P < 0.01, ***P < 0.001, n.s., not significant.

FIGS. 12A-12L show that binding of p53 by RBM15 is important for RBM15 regulating p53 target mRNA m ⁶ A level and expression. FIG. 12A is a Venn diagram showing the overlap of p53 interacting proteins and m ⁶ A modifier proteins. FIG. 12B is an image of a western blot of samples from co-IP analysis using IgG or p53 antibody on cell lysates from 22Rvl cells. FIG. 12C is an image of a western blot of samples from co-IP analysis using IgG or RBM 15 antibody on cell lysates from 22Rvl cells. FIG. 12E shows the results of GST pull down using truncated GST-RBM15 proteins (depicted in FIG. 12D) and in vitro translated p53 protein, followed by western blot analysis and Coomassie blue staining. FIG. 12G shows the results of GST pull down of truncated Myc-tagged p53 proteins (depicted in FIG. 12F) by GST-RBM15-SPOC, followed by western blot analysis and Coomassie blue staining. FIG. 121 shows the results of co-IP of p53 with WT RBM15 and p53 binding region deleted RBM15 (RBM15 p53BR) (depicted in FIG. 12H), followed by western blot analysis. For FIGS. 12J-12L, 22Rvl cells were transfected with the indicated siRNAs and constructs, and then were subjected to western blot (FIG. 12J), m ⁶ A RIP-qPCR (FIG. 12K) and RT-qPCR analysis (FIG. 12L) In FIGS. 12K and 12L, data are shown as means ± SD (n = 3 biological replicates). P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, **P < 0.01, ***P < 0.001, n.s., not significant.

FIGS. 13A-13J show that IGF2BP1-3 mediated FTO-IT1 regulated p53 target gene mRNAs stability and cell cycle and apoptosis. FIGS. 13A-13C are graphs plotting the results of CLIP-qPCR of the indicated genes from IGF2BP1 (FIG. 13A), IGF2BP2 (FIG. 13B), and IGF2BP3 (FIG. 13C)-immunoprecipitated RNA in UV crosslinked 22Rvl cells. FIG. 13D is an image showing a representative western blot of WCL from mock and FTO-IT1 KO 22Rvl cells expressing non-specific control (NC) or IGF2BP1-3- specific sgRNA. FIG. 13E is a graph plotting relative levels of the indicated gene mRNAs from mock and FTO-IT1 KO 22Rvl cells expressing non-specific control (NC) or /GT’A/t/'/G-specific sgRNA (determined by RT-qPCR analysis). FIG. 13F includes graphs plotting stability of the indicated mRNAs in mock nd FTO-ITl KO 22Rvl cells expressing non-specific control (NC) or IGF2BP /-3-specific sgRNAs. FIGS. 13G and 13H include a representative image (FIG. 13G) and corresponding quantification (FIG. 13H) of cell cycle analysis in mock and FTO-IT1 KO 22Rvl cells expressing nonspecific control (NC) or IGF2BP /-3-spccific sgRNA. FIGS. 131 and 13 J include a representative image (FIG. 131) and corresponding quantification (FIG. 13J) of apoptosis analysis in mock and FTO-IT1 KO 22Rvl cells expressing non-specific control (NC) o IGF2BP1-3- specific sgRNA. For FIGS. 13A-13C, 13E, 13F, 13H, and 13J, data are shown as mean ± SD (n = 3 biological replicates). P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, **P < 0.01, ***P < 0.001. n.s., not significant. FIGS. 14A-14M show that the FTO-IT1 axis is essential for PCa growth in vitro and in mice. FIG. 14A is a graph plotting the volume of tumors established by s.c. injection of mock and FT0-IT1 KO C4-2R cells into SCID male mice, with tumor volumes measured at the indicated time points. FIG. 14B is an image showing tumors harvested at day-24. FIG. 14C is a graph plotting tumor weights for the different groups. FIG. 14D is a graph plotting the results of RT-qPCR analysis of FTO-IT1 in 22Rvl cells transfected with control or FTO-ITI -specific antisense oligos (ASOs). For FIGS. 14E- 14G, 22Rvl cells transfected with control or FZO-777-specific ASOs were subjected to western blot (FIG. 14E), colony formation (FIG. 14F), and MTS assay (FIG. 14G). For FIG. 14H is a graph plotting tumor volume at the indicated time points after 22Rvl cells were injected s.c. into SCID male mice and the mice were treated with control ASO or FTO-IT1 specific ASOs. FIG. 141 is a graph plotting the weight of tumors dissected from the mice after 24 days of ASO treatment, and FIG. 14 J includes images of harvested tumors. FIG. 14K is a graph plotting body weight change of the mice during treatment. FIG. 14L is a graph plotting the results of RT-qPCR analysis of the indicated gene mRNAs in 22Rvl xenografts from the mice treated with control or FTO-ITI -specific ASOs. FIG. 14M includes images showing dot blot detection of m ⁶ A modification on mRNAs in 22Rvl xenografts from the mice treated with control or FTO-ITI -specific ASOs. For FIGS. 14A, 14C, 14H, 141, and 14K, the data are shown as means ± SD (n = 8 biological replicates). For FIGS. 14D, 14F, and 14L, data are shown as means ± SD (n = 3 biological replicates). For FIG. 14G, data are shown as means ± SD (n = 5 biological replicates). P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, **P < 0.01, ***P < 0.001, n.s., not significant.

FIGS. 15A-15G show the effect of FTO-IT1 on p53 target gene expression and PCa cell growth. FIG. 15A includes representative images showing immunohistochemistry (IHC) staining of Ki67 and cleaved Caspase 3 from C4-2R xenografts. Scale bar, 50 pm. FIG. 15B includes graphs plotting quantification of the staining shown in FIG. 15A. FIG. 15C includes representative images and a graph plotting colony formation in C4-2R cells transfected with control or FTO-IT1 -specific ASOs. FIG. 15D is a graph plotting viability (determined by MTS assay) of C4-2R cells transfected with control or FT0-IT1 -specific ASOs. FIG. 15E includes images showing dot blot detection of m ⁶ A modification on mRNAs from 22Rvl and C4-2R cells transfected with control or FZO-7Z7-specific ASOs. FIG. 15F includes representative images showing IHC analysis of the indicated proteins in control and F7D-777-specific ASO treated xenografts. FIG. 15G includes graphs plotting quantification of the staining shown in FIG. 15F. For FIGS. 15B, 15C, and 15G, data are shown as mean ± SD (n = 3 biological replicates). For FIG. 15D, data are shown as mean ± SD (n = 5 biological replicates). P values were calculated using an unpaired two-tailed Student’s /-test; *P < 0.05, **P < 0.01, ***p < 0.001. n.s., not significant.

FIGS. 16A and 16B show a working model for FTO-IT1 in regulating mRNA methylation. In the situation where no/low FTO-IT1 is expressed, RBM15 mediates the methylation of p53 target transcripts and promotes stability of the mRNAs to increase p53 signaling pathway (FIG. 16A). In the presence of FTO-IT1, RBM15-mediated p53 target gene mRNA methylation is blocked and mRNA stability is decreased, hampering the p53 signaling pathway (FIG. 16B).

DETAILED DESCRIPTION

FTO has been linked to cancer and obesity due, at least in part, to its role in regulating RNA m ⁶ A demethylation (see, e.g., Gulati et al., supra, and lia et al., supra). As described herein, cancer cells can be targeted by reducing the level of FTO-IT1 present within the cells using, for example, nucleic acid-based methods such as ASOs, RNA interference, sgRNAs, and ribozymes . In some cases, the level of FTO-IT1 can be reduced using an ASO in which at least a portion of the nucleotide sequence of the ASO is complementary to the DNA encoding FTO-IT1 and can bind to that DNA and reduce the level of FTO-IT1 present in the cell. In some cases, the level of FTO-IT1 can be reduced using an ASO in which at least a portion of the nucleotide sequence of the ASO is complementary to FTO-IT1 itself, and can bind to FTO-IT1 and reduce the level of FTO-IT1 present in the cell. ASOs for use as described herein can be designed to be any appropriate length. For example, an ASO targeting FTO-IT1 can be at least 8 nucleotides in length (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 10 to 50, 12 to 50, 12 to 40, 15 to 20, 18 to 30, 18 to 25, or 20 to 50 nucleotides in length). In some cases, an ASO greater than 50 nucleotides in length can be used, including up to the full-length of FTO-IT1. An “oligonucleotide” is an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or analogs thereof. Nucleic acid analogs can be modified at one or more of the base moiety, sugar moiety, and phosphate backbone to improve, for example, stability, hybridization, or solubility of a nucleic acid.

In some embodiments, the phosphodiester backbone of an ASO described herein can be replaced with one or more phosphorothioate, methoylphosphonate, or phosphoroamidate linkages.

In some embodiments, an ASO described herein can include one or more nucleotides modified at the 2' position of the pentose sugar such, as 2'-O-methyl, 2'-O- methoxy ethyl (MOE), or 2-fluoro compounds. See, e.g., U.S. Publication No. 2021/0214727; Freier and Altmann, Nucleic Acids Res., 25(22):4429-4443, 1997; and Roberts et al., Nat Reviews Drug Discovery, 19:673-694, 2020. In some embodiments, an ASO described herein can include 2'-O-methyl or MOE nucleotides with a phosphodiester backbone or a phosphorothioate backbone, or an ASO can include 2'-O- methyl or MOE nucleotides with a mix of phosphodiester and phosphorothioate linkages. See, e.g., Scoles et al., Neurol Genet., 5:e323, 2019.

In some cases, an ASO described herein can include one or more nucleotides modified to replace the sugar moiety with methylenemorpholine rings and replace the phosophodiester linkage with non-ionic phosphorodiamidate linkages (phosphorodiamidate morpholino). See, e.g., Scoles et al., supra.

In some cases, an ASO described herein can contain one or more bridged nucleotides. For example, an ASO can include one or more methylene bridge connections between the 2'-oxygen and the 4' carbon of a pentose sugar (a 4' CH2-O-2' bridge). An ASO containing one or more methylene bridges can be referred to as a locked nucleic acid (LNA). In some cases, a LNA also can include one or more MOE modifications. A LNA can contain a phosphodiester backbone or a phosphorothioate backbone. In some cases, a LNA described herein can have a backbone containing a mixture of phosphodiester and phosphorothioate linkages. See, e.g., Soler-Bistue et al., Molecules, 24(12):2297, 2019.

In some cases, an ASO described herein can include one more ethylene bridge connections between the 2'-oxygen and the 4' carbon of the pentose sugar, or one or more aminoethylene bridged nucleic acids between the 2'-oxygen and the 4' carbon of the pentose sugar. An ASO described herein containing one or more ethylene bridges can be referred to as an ethylene bridged nucleic acid (ENA). See, e.g., Soler-Bistue et al., supra.

Any appropriate method can be used to make an ASO described herein. For example, methods for synthesizing ASOs include solid phase synthesis techniques. Equipment for such synthesis is commercially available from several vendors including, for example, Applied Biosystems (Foster City, CA). See, e.g., PCT Publication No. WO9914226 (e.g., at pages 51-55 and 67-146) for synthesis of LNAs. In some cases, expression vectors that contain a regulatory element that directs production of an ASO can be used to produce an ASO.

ASOs described herein can bind to the DNA encoding FTO-IT1 and/or to FTO- IT1 itself that was transcribed from such DNA, under physiological conditions (i.e., physiological pH and ionic strength). The sequence of an ASO need not be 100% complementary to that of its target nucleic acid in order to hybridize under physiological conditions. In some cases, an ASO can hybridize under physiological conditions to DNA encoding FTO-IT1 and/or to FTO-IT1 itself in a manner that reduces the level of FTO- ITl present within a cell, with non-specific binding to non-target sequences being minimal. In some cases, an ASO described herein includes a contiguous sequence of between 12 and 50 nucleotides that is at least 85% complementary (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary) with a region of FTO-IT1 and/or of the DNA encoding FTO-IT1. A representative human FTO-IT1 sequence is set forth in SEQ ID NO:94:

GCAAGAAGCTATAGAGATCAAGAAGGAAACATAGGGATGGAGACTAC TACTAAGCATCTTCGACTATGCTAAGTCCTGAGCAGACAGTGAAGAACTAGA AAGACATGGCCCCGCCCTCATGAAGATTACAAGTTAGGCCTATTCTCCACAC

TTGTTCTAACTCAATCTGCTACATATACCTTGAGTACCCAGTATGCGTTAGGT ACTAAAAGGAGCTACAAAGATGAACCAGACACAGTCTTCAAGAACTTCAGG GATCAGGGAAGGTTTATCCTGATTGTAATCCCTCCAGAGGTTTTGATCATTTC TCTAATCACTTATTAGGCCTCTTGCTTCCTGTAGGAATTTGTTCTCTATATTAG ATTGAAATCTGCCTGTTCTAATTTCAACTTCCTTTCTTCTGGCCCTGGCTAGTC CTCAGTGTACAGAATTGCCATTGGTACCTGCTGGTCAAGGCCAAGTGTTGTGA GCCAAGGTTTCTAACCTTGGCTGCAGTTACACTTAACTGCTCCTCTCCGAAGC TGGATTTAGCAGAGATTTGA7GGA4GCCC7GC4A4CCZCGATTCAAATCAAAG TTCAAACCTAGTGACTGGTTGAGTGAACTGCTTTAATAATAACAGTGCAAAA ATTGAATTTAAAATAATCCTTTTAGGGATGCAAGATGCAGTGGTTTAGCCTTT TATTAATATTCTTTTCTTTCCACTAATAAAGATTTTAAGTCAACATCTCCTTAA ATTTGATTAATTCCATTAGGATCACTCCAAAAAAAGGTTTATCAGTGGCTTTG AAATCCAAATGGGATGAAGAAAAAATCATTTATATGGCAAAATCTCAGTTAC ACTAACTAGATTAAAGACCTTCTGCTGAATT (SEQ ID NO:94)

Target sites for FT0-IT1 ASOs can include, for example, regions lacking secondary structure and regions left unbound by proteins or other nucleic acids. Further criteria that can be applied to the design of ASOs include, for example, the lack of predicted secondary structure of a potential ASO, an appropriate G and C nucleotide content (e.g., about 50%, such as 50±9%, 50±8%, 50±7%, 50±6%, 50±5%, 50±4%, 50±3%, 50±2%, or 50±l%), and the absence of sequence motifs such as single nucleotide repeats (e.g., GGGG runs). The effectiveness of ASOs at reducing the level of FTO-IT1 within cells can be evaluated by, for example, measuring levels of FTO-IT1 in the cells after treatment (e.g., by RNA sequencing or Northern blotting).

In some embodiments, an ASO described herein can include one of the following sequences: CTTGTAATCTTCATGAGGGC (ASO#1; SEQ ID NO 82), CTGATAAACCTTTTTTTGGAGTGA (ASO#2; SEQ ID NO:83), ATCGAGGTTTGCAGGGCTTC (ASO#3; SEQ ID NO:84), GTAGTCTCCATCCCTATGTT (ASO#4; SEQ ID NO:85), GAGGTTTGCAGGGCTTCCAT (ASO#5; SEQ ID NO: 86), CACTGCATCTTGCATCCCTA (ASO#6; SEQ ID NO:87), or CACTGTCTGCTCAGG (ASO#7; SEQ ID NO:88). For example, an ASO can include the sequence set forth in SEQ ID NO:84 or the sequence set forth in SEQ LD NO:87. The targets of each of SEQ ID NOS:82-87 in the FT0-IT1 sequence are underlined in SEQ ID NO:94 above, except that the target site for SEQ ID NO: 86 (ASO#5) is italicized because it overlaps with the target sequence for SEQ ID NO:84 (ASO#3). In some cases, such ASOs can contain one or more nucleic acid analogs (e.g., LNA, MOE, and/or phosphorothioate linkages). In some embodiments, the ASO can be a mixmer, in which LNA residues and other residues are interspersed in different configurations throughout the sequence. See, e.g., Soler- Bistue et al., supra. In some cases, an ASO can be a gapmer, in which LNA or MOE residues are on the ends of the oligonucleotide. For example, in some cases, an ASO provided herein can include SEQ ID NO:84 or SEQ ID NO:87 with the first one to four outermost bases being LNA or MOE (denoted by the + in the below sequences), and the backbone can have phosphorothioate linkages (denoted by the * in the below sequences). For example, in some cases, an ASO provided herein can have the following sequence and modifications to the sugar and phosphate backbone: _A+T * _+C * ₊ Q* _A *G*G*TM* _T *G*C*A*G*G*G*C*-M*+T*+C (SEQ ID NO:84), or C+A*+C*+T*G*C*A*T*C*T*T*G*C*A*T*C*C*+C*+T*+A (SEQ ID NO:87).

In some cases, an ASO described herein can be conjugated to a sugar such as N- acetylgalactosamine, a cell surface receptor ligand, a drug, a hormone, a lipid, a polymer (e g., a cationic polymer), a polypeptide, a toxin, a vitamin, or a viral polypeptide.

In some cases, an ASO described herein can be formulated as a pharmaceutical composition for administration to a mammal (e.g. a human). A pharmaceutical composition provided herein can include, for example, a pharmaceutically acceptable carrier such as a buffer, a salt, a surfactant, a sugar, a tonicity modifier, or combinations thereof. In some embodiments, an ASO described herein can be conjugated to a lipid (e.g., cholesterol), polypeptides (e.g., cell-penetrating polypeptides), aptamers, antibodies, sugars (e.g., N-acetylgalactosamine), cationic polymers (e.g., polyethyleneimine), exosomes, or nanoparticles to improve, for example, intracellular uptake, reduce clearance, or target particular tissues as, for example, described in Roberts et al., Nat. Reviews Drug Discovery, 19:673-694, 2020. In some cases, when a pharmaceutical composition is formulated to include one or more ASOs described herein, any appropriate concentration of the ASO can be used. For example, a pharmaceutical composition provided herein can be formulated to be a liquid that includes from about 1 mg to about 500 mg (e.g., from about 1 mg to about 500 mg, from about 10 mg to about 500 mg, from about 50 mg to about 500 mg, from about 100 mg to about 500 mg, from about 0.5 mg to about 250 mg, from about 0.5 mg to about 150 mg, from about 0.5 mg to about 100 mg, from about 0.5 mg to about 50 mg, from about 1 mg to about 300 mg, from about 2 mg to about 200 mg, from about 10 mg to about 300 mg, from about 25 mg to about 300 mg, from about 50 mg to about 150 mg, or from about 150 mg to about 300 mg) of an ASO described herein per m . In another example, a pharmaceutical composition provided herein can be formulated to be a solid or semi-solid that includes from about 0.5 mg to about 500 mg (e.g., from about 1 mg to about 500 mg, from about 10 mg to about 500 mg, from about 50 mg to about 500 mg, from about 100 mg to about 500 mg, from about 0.5 mg to about 250 mg, from about 0.5 mg to about 150 mg, from about 0.5 mg to about 100 mg, from about 0.5 mg to about 50 mg, from about 1 mg to about 300 mg, from about 10 mg to about 300 mg, from about 25 mg to about 300 mg, from about 50 mg to about 150 mg, or from about 150 mg to about 300 mg) of an ASO described herein.

A pharmaceutical composition provided herein can be in any appropriate form. For example, a pharmaceutical composition provided herein can designed to be a liquid, a semi-solid, or a solid. In some cases, a pharmaceutical composition provided herein can be a liquid solution (e.g., an injectable and/or infusible solution), a dispersion, a suspension, a tablet, a pill, a powder, a microemulsion, a liposome, or a suppository. In some cases, a pharmaceutical composition provided herein can be lyophilized. In some cases, a pharmaceutical composition provided herein (e.g., a pharmaceutical composition that includes one or more ASOs described herein can be formulated with a carrier or coating designed to protect against rapid release. For example, a pharmaceutical composition described herein can be formulated as a controlled release formulation or as a regulated release formulation as described elsewhere (see, e.g., U.S. Publication Nos. 2019/0241667, 2019/0233522, and 2019/0233498). Any appropriate cancer can be treated using a composition (e.g., a pharmaceutical composition provided herein) containing one or more ASOs described herein. For example, a mammal (e.g., a human) having cancer can be treated by administering a composition (e.g., a pharmaceutical composition) containing one or more ASOs described herein to that mammal. Examples of cancers that can be treated as described herein include, without limitation, PCa, breast cancer, lung cancer, kidney cancer, malignant mesothelioma, and acute myeloid leukemia (AML).

This document also provides methods for administering a composition (e.g., a pharmaceutical composition described herein) containing one or more ASOs to a mammal (e.g., a human). For example, a composition (e.g., a pharmaceutical composition described herein) containing one or more ASOs can be administered to a mammal (e.g., a human) identified as having cancer to treat that mammal. In some cases, a composition (e.g., a pharmaceutical composition provided herein) containing one or more ASOs described herein can be administered to a mammal (e.g., a human) to reduce the level of FTO-IT1 within the mammal and/or to decrease symptoms of the cancer, reduce the number of tumor cells in the mammal, and/or reduce the size of a tumor in the mammal.

Any appropriate method can be used to administer a composition (e.g., a pharmaceutical composition) provided herein to a mammal (e.g., a human). For example, a composition provided herein (e.g., a pharmaceutical composition containing one or more ASOs described herein) can be administered to a mammal (e.g., a human) intravenously (e.g., via an intravenous injection or infusion), subcutaneously (e.g., via a subcutaneous injection), intraperitoneally (e.g., via an intraperitoneal injection), orally, via inhalation, or intramuscularly (e g., via intramuscular injection). In some cases, the route and/or mode of administration of a composition (e.g., a pharmaceutical composition provided herein) can be adjusted for the mammal being treated.

This document provides methods and materials for assessing and/or treating a mammal (e.g., a human) having cancer. For example, the methods and materials provided herein can be used to determine whether or not a mammal having cancer is likely to be responsive to a particular cancer treatment (e.g., an ASO targeted to FTO-ITF). In some cases, the methods and materials provided herein also can include administering one or more cancer treatments (e.g., one or more ASOs targeted to FTO-ITF) to a mammal having cancer to treat the mammal.

Any appropriate mammal having a cancer can be assessed and/or treated using the methods described herein. Examples of mammals having a cancer that can be assessed and/or treated as described herein include, without limitation, humans, non-human primates (e.g., monkeys), dogs, cats, horses, cows, pigs, sheep, mice, and rats. In some cases, a human having a cancer can be assessed and/or treated as described herein.

When assessing and/or treating a mammal (e.g., a human) having a cancer as described herein, the cancer can be any type of cancer. In some cases, a cancer can include one or more solid tumors. In some cases, a cancer can be a luminal cancer. In some cases, a cancer can be a primary cancer. In some cases, a cancer can be a metastatic cancer. Examples of cancers that can be assessed and/or treated as described herein include, without limitation, prostate cancers (e.g., prostate adenocarcinoma), breast cancers (e.g., breast invasive carcinomas and TNBCs), lung cancers (e.g., lung adenocarcinomas, lung squamous cell carcinomas, and mesotheliomas), kidney cancers, and AML.

In some cases, the methods described herein can include identifying a mammal (e.g., a human) as having a cancer. Any appropriate method can be used to identify a mammal as having a cancer. For example, imaging techniques and/or biopsy techniques can be used to identify mammals (e.g., humans) having cancer.

A mammal having cancer can be assessed to determine whether or not the cancer is likely to respond to a particular cancer treatment (e.g., one or more ASOs targeted to FTO-IT1). In some cases, a sample (e g., a sample containing one or more cancer cells) obtained from a mammal having cancer can be assessed for the presence, absence, or level of FT0-IT1 expression. As described herein, the level of FT0-IT1 expression in a sample obtained from a mammal having a cancer can be used to determine whether or not the mammal is likely to respond to a particular cancer treatment (e.g., one or more ASOs targeted to FTO-IT1). For example, the presence of an increased level of FT0-IT1 expression in a sample obtained from a mammal having cancer (a mammal having castration-resistant prostate cancer) can indicate that the mammal is likely to be responsive to treatment with one or more ASOs targeted to FTO-IT1. The term “increased level” as used herein with respect to FT0-IT1 expression refers to any level that is higher than a reference level of FT0-IT1 expression. The term “reference level” as used herein with respect to FTO-JT1 expression can refer to the level of FT0-IT1 expression typically observed in a sample (e.g., a control sample) from one or more healthy mammals (e.g., mammals that do not have a cancer). In some cases, an increased level of FT0-IT1 can be a level that is at least >1 (e.g., at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold greater relative to a reference level of FTO-IT1 expression. In some cases, a reference level can be a cutoff level. For example, based on the cell line data discussed herein, the expression level of FTO-IT1 in parental C4-2 cells was about 30 copies per cell, while the level in ENZ-resistant C4-2 cells was about 100 copies per cell. Thus, in such cases, an increased level of FTO-IT1 expression can be any level greater than the cutoff value of about 30 copies per cell. For example, in such cases, an increased level can be about 32 copies per cell, about 35 copies per cell, about 40 copies per cell, about 45 copies per cell, or about 50 copies per cell. In some cases, when control samples have an undetectable level of FTO-IT1 expression, an increased level can be any detectable level of FTO-IT1 expression. It will be appreciated that levels from comparable samples are used when determining whether or not a particular level is an increased level. For example, the level of FTO-IT1 expression present in primary prostate cancer cells that are resistant to androgen deprivation therapy or second generation AR pathway inhibitors (e.g., abiraterone or ENZ) can be compared to a reference level of FTO-IT1 expression in hormone-sensitive primary prostate cancer specimens.

Any appropriate sample from a mammal (e.g., a human) having cancer can be assessed as described herein (e.g., for the presence, absence, or level of FTO-IT1 expression). In some cases, a sample can be a biological sample. In some cases, a sample can contain one or more cancer cells. In some cases, a sample can contain one or more biological molecules (e.g., nucleic acids such as DNA and RNA, polypeptides, carbohydrates, lipids, hormones, and/or metabolites). Examples of samples that can be assessed as described herein include, without limitation, tissue samples (e.g., tumor tissues such as those obtained by biopsy), fluid samples (e.g., whole blood, serum, plasma, urine, and saliva), cellular samples (e.g., buccal samples), and samples from surgery. A sample can be a fresh sample or a fixed sample (e.g., a formaldehyde-fixed sample or a formalin-fixed sample). In some cases, a sample can be a processed sample (e.g., an embedded sample such as a paraffin or OCT embedded sample). In some cases, one or more biological molecules can be isolated from a sample. For example, nucleic acid (e.g., DNA and RNA such as messenger RNA (mRNA)) can be isolated from a sample and can be assessed as described herein.

Any appropriate method can be used to detect the presence, absence, or level of FT0-IT1 expression within a sample (e.g., a sample containing one or more cancer cells) obtained from a mammal (e.g., a human). In some cases, the presence, absence, or level of FTO-IT1 expression within a sample can be determined by detecting the presence, absence, or level of FTO-IT1 RNA in the sample. For example, polymerase chain reaction (PCR)-based techniques such as quantitative RT-PCR techniques, gene expression panel (e.g., next generation sequencing (NGS) such as RNA-seq), in situ hybridization, and microarray gene expression profiling can be used to determine the presence, absence, or level oiFTO-ITl in the sample.

Methods for treating a mammal (e.g., a human) having increased FT0-IT1 expression can include administering, to the mammal, an effective amount of a composition containing one or more ASOs that can bind to FTO-INl. In some cases, an effective amount of a composition (e.g., a pharmaceutical composition provided herein) containing one or more ASOs described herein can be an amount that reduces one or more symptoms associated with a cancer within a mammal, reduces the number of tumor cells within a mammal, or reduces the size of a tumor within a mammal, without producing significant toxicity to the mammal. In some cases, an effective amount of a composition containing one or more ASOs described herein (e.g., a pharmaceutical composition provided herein) can be an amount that reduces one or more symptoms associated with a cancer in a mammal as compared to a control mammal having a comparable cancer and not treated with the composition. For example, an effective amount of an ASO described herein can be from about 0.001 mg/kg to about 100 mg/kg (e g., from about 0.001 mg/kg to about 90 mg/kg, from about 0.001 mg/kg to about 80 mg/kg, from about 0.001 mg/kg to about 70 mg/kg, from about 0.001 mg/kg to about 60 mg/kg, from about 0.001 mg/kg to about 50 mg/kg, from about 0.001 mg/kg to about 40 mg/kg, from about 0.001 mg/kg to about 30 mg/kg, from about 0.005 mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 100 mg/kg, from about 0.05 mg/kg to about 100 mg/kg, from about 0.1 mg/kg to about 100 mg/kg, from about 0.5 mg/kg to about 100 mg/kg, from about 1 mg/kg to about 100 mg/kg, from about 5 mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 25 mg/kg, from about 0.1 mg/kg to about 30 mg/kg, from about 0.15 mg/kg to about 25 mg/kg, from about 0.2 mg/kg to about 20 mg/kg, from about 0.5 mg/kg to about 20 mg/kg, from about 1 mg/kg to about 30 mg/kg, from about 1 mg/kg to about 25 mg/kg, from about 1 mg/kg to about 20 mg/kg, from about 2 mg/kg to about 20 mg/kg, from about 5 mg/kg to about 30 mg/kg, from about 10 mg/kg to about 30 mg/kg, from about 15 mg/kg to about 30 mg/kg, from about 20 mg/kg to about 30 mg/kg, from about 3 mg/kg to about 30 mg/kg, from about 0.5 mg/kg to about 10 mg/kg, from about 1 mg/kg to about 10 mg/kg, from about 1 mg/kg to about 5 mg/kg, or from about 1 mg/kg to about 3 mg/kg). The effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal’ s response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, the severity of the cancer when treating a mammal having such a disease, the route of administration, the age and general health condition of the mammal, excipient usage, the possibility of co-usage with other therapeutic or prophylactic treatments such as use of other anti-cancer agents (e.g., chemotherapy drugs), and the judgment of the treating physician may require an increase or decrease in the actual effective amount of a composition provided herein (e.g., a pharmaceutical composition containing one or more ASOs described herein) that is administered.

In some cases, an effective frequency of administration of a composition (e.g., a pharmaceutical composition provided herein) containing one or more ASOs described herein can be a frequency that reduces one or more symptoms associated with a cancer in the mammal, reduces the number of tumor cells within the mammal, or reduces the size of a tumor within the mammal, without producing significant toxicity to the mammal. In some cases, an effective frequency of administration of a composition containing one or more ASOs described herein (e.g., a pharmaceutical composition provided herein) can be a frequency that reduces one or more symptoms associated with a cancer in a mammal as compared to a control mammal having a comparable cancer and not treated with the composition. For example, an effective frequency of administration of a pharmaceutical composition described herein can be from about twice daily to about three times a year (e.g., from about every other day to about once a month, from about once daily to about once a month, from about twice daily to about once a week, or from once daily to about once a week). The frequency of administration of a pharmaceutical composition described herein such as a pharmaceutical composition containing one or more ASOs described herein can remain constant or can be variable during the duration of treatment. Various factors can influence the actual effective frequency used for a particular application. For example, the effective amount, the severity of the cancer when treating a mammal having such a cancer, the route of administration, the age and general health condition of the mammal, excipient usage, the possibility of co-usage with other therapeutic or prophylactic treatments such as use of other anti-cancer agents (e.g., chemotherapy drugs), and the judgment of the treating physician may require an increase or decrease in the actual effective frequency of administration of a composition provided herein (e.g., a pharmaceutical composition containing one or more ASOs described herein).

In some cases, an effective duration of administration of a composition (e.g., a pharmaceutical composition provided herein) containing one or more ASOs described herein can be a duration that reduces one or more symptoms associated with a cancer in a mammal, reduces the number of tumor cells within a mammal, or reduces the size of a tumor within a mammal, without producing significant toxicity to the mammal. In some cases, an effective duration of administration of a composition containing one or more ASOs described herein (e.g., a pharmaceutical composition provided herein) can be a duration that reduces one or more symptoms associated with a cancer in a mammal having such cancer as compared to a control mammal having a comparable cancer and not treated with the composition. For example, an effective duration of administration of a pharmaceutical composition provided herein, such as a pharmaceutical composition containing one or more ASOs described herein, can vary from a single time point of administration to several weeks to several months (e.g., 4 to 12 weeks). Multiple factors can influence the actual effective duration used for a particular application. For example, the severity of the cancer, the effective frequency, the effective amount, the route of administration, the age and general health condition of the mammal, excipient usage, the possibility of co-usage with other therapeutic or prophylactic treatments such as use of other anti-cancer agents (e.g., chemotherapeutic agents), and the judgment of the treating physician may require an increase or decrease in the actual effective duration of administration of a composition provided herein (e.g., a pharmaceutical composition containing one or more ASOs described herein).

In some cases, the methods provided herein can include monitoring a mammal after treatment with an ASO to assess the effectiveness of the treatment. For example, a biological sample can be obtained from a mammal at one or more suitable time points after treatment with an ASO, and the level of FT0-IT1 in the sample can be measured to determine whether it is decreased as compared to a level measured prior to treatment. Any suitable method can be used to determine an FT0-IT1 level, including the RNA detecting and quantifying methods described in the Examples herein.

Exemplary Embodiments

Embodiment 1 is an antisense oligonucleotide (ASO) for reducing the level of a long noncoding RNA of fat mass and obesity-associated protein (FT0-IT1) within a cell, wherein said ASO is from about 12 to about 40 nucleotides in length, wherein at least a portion of the nucleotide sequence of said ASO is (i) complementary to the DNA sequence encoding said FTO-IT1 or (ii) complementary to the RNA sequence of said FTO-IT1, and wherein said ASO comprises the ability to reduce the level of said FTO- IT1 in said cell.

Embodiment 2 is the ASO of embodiment 1, wherein said portion of the nucleotide sequence of said ASO is complementary to the DNA sequence encoding said FTO-IT1. Embodiment 3 is the ASO of embodiment 1, wherein said portion of the nucleotide sequence of said ASO is complementary to the RNA sequence of said FTO- IT1.

Embodiment 4 is the ASO of any one of embodiments 1 to 3, wherein said ASO is from about 15 to about 30 nucleotides in length.

Embodiment 5 is the ASO of any one of embodiments 1 to 4, wherein said ASO comprises the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84) or CACTGCATCTTGCATCCCTA (SEQ ID NO:87).

Embodiment 6 is the ASO of embodiment 5, wherein said ASO comprises the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84).

Embodiment 7 is the ASO of embodiment 5, wherein said ASO comprises the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO: 87).

Embodiment 8 is a pharmaceutical composition comprising the ASO of any one of embodiments 1 to 7.

Embodiment 9 is a method of treating a mammal identified as having cancer, said method comprising administering an ASO to said mammal identified as having said cancer, wherein said ASO is from about 12 to about 40 nucleotides in length, wherein at least a portion of the nucleotide sequence of said ASO is (i) complementary to the DNA sequence encoding said FTO-IT1 or (ii) complementary to the RNA sequence of said FTO-IT1, and wherein said ASO comprises the ability to reduce the level of said FTO- IT1 in a cell of said cancer, and wherein said ASO is administered in an amount effective to reduce the level of said FTO-IT1 within said mammal.

Embodiment 10 is the method of embodiment 9, wherein said portion of the nucleotide sequence of said ASO is complementary to the DNA sequence encoding said FTO-IT1.

Embodiment 11 is the method of embodiment 9, wherein said portion of the nucleotide sequence of said ASO is complementary to the RNA sequence of said FTO- IT1. Embodiment 12 is the method of any one of embodiments 9 to 11, wherein said ASO comprises the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84) or CACTGCATCTTGCATCCCTA (SEQ ID NO:87).

Embodiment 13 is the method of embodiment 12, wherein said ASO comprises the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84).

Embodiment 14 is the method of embodiment 12, wherein said ASO comprises the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO:87).

Embodiment 15 is the method of any one of embodiments 9 to 14, wherein said mammal is a human.

Embodiment 16 is the method of any one of embodiments 9 to 15, wherein said cancer is prostate cancer, breast cancer, or lung cancer.

Embodiment 17 is a method for assessing a mammal having cancer, wherein said method comprises: (a) detecting a presence or absence of an increased level of FT0-IT1 expression in a sample from said mammal; (b) classifying said mammal as being likely to respond to an ASO targeted to FT0-IT1 if said presence of said increased level is detected, or (c) classifying said mammal as not being likely to respond to an ASO targeted to FT0-IT1 if said absence of said increased level is not detected.

Embodiment 18 is the method of embodiment 17 wherein said mammal is a human.

Embodiment 19 is the method of embodiment 17 or embodiment 18, wherein said ASO comprises the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84) or CACT GCATCTTGCATCCCTA (SEQ ID NO: 87).

Embodiment 20 is the method of embodiment 19, wherein said ASO comprises the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84).

Embodiment 21 is the method of embodiment 19, wherein said ASO comprises the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO:87).

Embodiment 22 is the method of any one of embodiments 17 to 21, wherein said sample comprises cancer cells of said cancer. Embodiment 23 is the method of any one of embodiments 17 to 22, wherein said cancer is selected from the group consisting of prostate cancer, breast cancer, and lung cancer.

Embodiment 24 is the method of any one of embodiments 17 to 23, wherein said method comprises detecting the presence of said increased level.

Embodiment 25 is the method of embodiment 24, wherein said method comprises classifying said mammal as being likely to respond to said ASO.

Embodiment 26 is the method of any one of embodiments 17 to 23, wherein said method comprises detecting the absence of said increased level.

Embodiment 27 is the method of embodiment 26, wherein said method comprises classifying said mammal as not being likely to respond to said ASO.

Embodiment 28 is the method of any one of embodiments 17 to 27, wherein said detecting step comprises performing a method that detects said FT0-IT1.

Embodiment 29 is a method for treating a mammal having cancer, wherein said method comprises: (a) detecting an increased level of FTO-IT1 expression in a sample obtained from said mammal; and (b) administering a cancer treatment to said mammal, wherein said cancer treatment comprises an ASO targeted to said FTO-IT1.

Embodiment 30 is a method for treating cancer, wherein said method comprises administering a cancer treatment to a mammal identified as having an increased level of FTO-IT1 expression in a sample obtained from said mammal, wherein said cancer treatment comprises an ASO targeted to FTO-IT1.

Embodiment 31 is the method of embodiment 29 or embodiment 30, wherein said mammal is a human.

Embodiment 32 is the method of any one of embodiments 29 to 31, wherein said ASO comprises the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84) or CACTGCATCTTGCATCCCTA (SEQ ID NO:87).

Embodiment 33 is the method of embodiment 32, wherein said ASO comprises the sequence ATCGAGGTTTGCAGGGCTTC (SEQ ID NO:84).

Embodiment 34 is the method of embodiment 32, wherein said ASO comprises the sequence CACTGCATCTTGCATCCCTA (SEQ ID NO:87). Embodiment 35 is the method of any one of embodiments 29 to 34, wherein said sample comprises cancer cells of said cancer.

Embodiment 36 is the method of any one of embodiments 29 to 35, wherein said cancer is selected from the group consisting of prostate cancer, breast cancer, and lung cancer.

The invention will be further described in the following example, which does not limit the scope of the invention described in the claims.

EXAMPLE

Example 1 - A IncRNA from the FTP locus antagonizes mRNA m ⁶ A methylation and p53 tumor suppression

Methods

Materials'. Sources of materials and supplies are listed in TABLE 1A.

Plasmids'. GST-tagged RBM15 and Myc-tagged RBM15 were generated by cloning the corresponding cDNA into the pGEX-4T-l and pCMV vectors, respectively. Myc-tagged p53 and FLAG-tagged p53 plasmids were generated by cloning the coding region of the TP53 gene into the pCMV vector and the pcDNA3.1 vector, respectively. An FTO-ITl expression plasmid was generated by cloning the cDNA into the pCDNA- 3.1 or pTsin vector. The cDNA fragments were amplified by Phusion polymerase (NEB) using Phusion High-Fidelity PCR Master Mix. The primers used for plasmid construction and knock out test are listed in TABLE IB.

Cell culture, transfection, and lentivirus infection. 22Rvl, LNCaP and 293T cells were obtained from the American Type Culture Collection (ATCC). C4-2 cells were purchased from Uro Corporation. 22Rvl, C4-2 and LNCaP cells were maintained in RPMI1640 supplemented with 10% FBS. 293T cells were maintained in DMEM supplemented with 10% FBS. C4-2R cells were generated by treating C4-2 cells with 10 pM enzalutamide for 1 month as described elsewhere (Zhao et al., Oncotarget 7:38551- 38565, 2016). For transient transfection, cells were transfected with LIPOFECT AMINE® 2000 (Thermo Fisher) according to the manufacturer’s instructions. For lentivirus production, the pLenti-CRISPR-V2 plasmid containing corresponding sgRNA sequence or pLKO-based gene shRNA knockdown plasmids or pTsin plasmid containing corresponding gene CDS were mixed with pMD2.G and psPAX2 and transfected into 293T cells. The virus-containing supernatant was harvested 48 hours after transfection to infect PCa cells in the presence of 10 pg/mL polybrene. Successfully infected cells were selected with 1 pg/mL puromycin. The shRNA plasmids were purchased from Sigma- Aldrich. The shRNA/siRNA sequences targeting METTL3, SESN2 and RBM15, and the sgRNA sequences targeting FTO-IT1, IGF2BP1, IGF2BP2, IGF2BP2, FAS, TP53INP1 are listed in TABLE 1C.

ASO design and screening'. ASOs were designed based on the complementary sequence of FTO-IT1 with a phosphorothioate (PS) backbone and MOE modification on the flanking 6 nucleotides (Integrated DNA Technologies; “IDT”). ASOs were screened by transfecting into 22Rvl cells followed by RT-qPCR analysis and the highly efficient ASOs were used for further studies. ASO sequences are listed in TABLE 1C.

RNA isolation from human prostate cancer specimens'. Formalin-fixed paraffin- embedded (FFPE) hormone-naive primary PCa and CRPC tissues were randomly selected from the Mayo Tissue Registry. RNAs were isolated using a RECOVERALL™ Total Nucleic Acid Isolation Kit (Invitrogen).

FTO-IT1 RNA copy number measurement. RNA copy number measurement was performed as described elsewhere (Zhao et al., Cell Rep 15:599-610, 2016). Briefly, FTO-IT1 was cloned into the pcDNA3.1 backbone vector. The cDNA copy number and dilution calculation were performed using a method described elsewhere (see, (lifetechnologies.com/us/en/home/brands/thermo-scientific/mo lecular-biology/ molecularbiology-leaming-center/molecular-biology-resource-l ibrary/thermo-scientific- web-tools/dna-copy-numbercal culator.html). P I O ⁵ cells were used for RNA extraction and the total RNA was diluted in 100 pl H2O. 1 pl of RNA was used for reverse transcription, and 1% of the resulting cDNA was used for qPCR. The final Ct value corresponded to the copy number in 10 cells. A standard curve was used to correspond the Ct value with the actual copy number. Copy number was calculated using equation derived from the standard curve. RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)'. Total RNA was isolated using TRIZOL® reagent (Thermo Fisher Scientific) and reverse- transcribed to cDNA using a superscript RT kit (Promega GOSCRIPT™) according to the manufacturer’s instruction. Quantitative PCR was performed using the SYBR™ Green Master Mix Kit (Bio-Rad) in Bio-Rad CFX manager 3.1. The quantification of gene expression was normalized to that of endogenous control GAPDH. The primers for RT-qPCR are listed in TABLE IB. m ⁶ A dot blot. Dot blot of m ⁶ A was carried out as described elsewhere (Jia et al., supra). Briefly, mRNA was purified from total RNA using a DYNABEADS™ mRNA Purification Kit (Thermo Fisher). The isolated mRNA was first denatured at 95°C for 3 minutes and then chilled on ice directly. Two-fold serial dilutions of the mRNA were spotted on Biodyne B nylon membrane (PALL) and crosslinked by UV Stratalinker. The membrane was blocked with 5% non-fat milk and incubated with anti-m ⁶ A antibody (Synaptic Systems, 1 :2,000) overnight at 4°C. Horseradish peroxidase (HRP)-conjugated secondary antibody was incubated with the membrane and ECL was used to visualize the signal. A copy of the spotted membrane was stained with 0.02% methylene blue in 0.3 M sodium acetate (pH 5.2) to ensure that an equal amount of mRNA was loaded. m ⁶ A RNA immunoprecipitation'. Purified mRNA was incubated with 2 pg m ⁶ A antibody and protein A/G beads in IPP buffer (10 mM Tris pH 7.5, 150 mM NaCl, 0.1% NP-40) supplemented with RNase inhibitor at 4°C overnight. The beads were washed 6 times and the RNA was extracted using TRIZOL® reagent. RT-qPCR was performed to detect the enrichment of m ⁶ A modified RNA. mRNA m ⁶ A and m ⁶ Am methylation level quantified by LC-MS MS'. LC-QqQ- MS/MS measurements were performed as described elsewhere (Wei et al., supra). In brief, total RNA was purified with TRIZOL® reagents (Thermofisher Scientific, #15596018) from fresh cells. mRNA was isolated using DYNABEADS ¹ ® mRNA DIRECT kit (Thermofisher Scientific, #61006) twice. After that, rRNA was further removed using a RIBOMINUS™ Eukaryote kit (Thermofisher Scientific, #A1083708). The purified mRNA was further digested into nucleotides with nuclease Pl (Sigma, #N8630) in 20 mL of buffer containing 25 mM NaCl and 2.5 mM ZnCh for 1 hour at 42°C, and then 1 unit of FASTAP™ Thermosensitive Alkaline Phosphatase (1 U/pL, Thermofisher Scientific, #EF0651) in FASTAP™ buffer for another 4 hours at 37°C. Samples were then filtered (0.22 mm, Millipore) and injected into a Cl 8 reverse phase column coupled online to Agilent 6460 LC-MS/MS spectrometer in positive electrospray ionization mode. The nucleosides were quantified by using retention time and the nucleoside to base ion mass transitions (268-to-136 for A; 296-to-150 for m ⁶ Am, and 282-to-150 for m ⁶ A). Quantification was performed by comparing with the standard curve obtained from pure nucleoside standards running with the same batch of samples.

Immunofluore scent imaging'. Immunofluorescent imaging was performed as reported elsewhere (Wei et al., supra). Cells were transferred to an 8-well chamber (Lab- Tek) 16 hours prior to the following experiments. The cells were washed twice in phosphate buffered saline (PBS) and then fixed in 4% paraformaldehyde in PBST (PBS with 0.05% TWEEN®-20) at room temperature for 15 minutes. The fixing solution was removed, and samples were washed twice with PBS. 0.1% Triton x-100 in PBST at room temperature for 10 minutes was then used to permeabilize the cells. After permeabilization, the cells were rinsed twice with PBS and blocked with 1% BSA with PBST for 1 hour at room temperature. Next, the blocking solution was replaced with the primary antibody (abl26605) for FTO, 1 : 1000 dilution in the blocking solution, and incubated for 1 hour at room temperature. After being washed 4 times with PBST (300 pL, 5-10 minutes for each wash), secondary antibody (1 OO dilution in PBST) was added to the mixture and incubated at room temperature for 1 hour. After washing 4 times with PBST (5-10 minutes for each wash), 300 nm DAPI was added to cover the cells and incubated for 30 minutes in the dark. The DAPI stain solution was then removed and the cells was washed 4 times with PBST (5-10 minutes for each wash). Finally, PROLONG™ Diamond Antifade Mountant (Thermo Fisher) was added to mount the slides. m ⁶ A-seq library preparation and data analysis '. mRNA was purified from total RNA using a DYNABEADS ® mRNA DIRECT kit (Thermofisher Scientific, #61006). 1 pg mRNA in 100 pl RNase free water was fragmented to -200 nt using a BIORUPTOR® Pico Sonication Instrument with 30 cycles of a 30 seconds on / 30 seconds off mode. 5 pl of the fragmented mRNA was saved as input. The remaining fragmented mRNA was subjected to m ⁶ A IP using the EPIMARK®N6-Methyladenosine Enrichment Kit (NEB, #E1610S) following the manufacturer’s protocol. RNA libraries were prepared for both input RNA and m ⁶ A-enriched mRNA after IP using TRUSEQ® Stranded mRNA Library Prep (Illumina, #20020594) following the manufacturer’s protocol. Sequencing was performed at the University of Chicago Genomics Facility on an Illumina HiSeq 2000 machine in single-read mode with 50 bp per reading at around 25 M to 30 M sequencing depth. After obtaining the raw data, single-end reads were harvested and trimmed by Trim Galore to remove adaptor sequences and low-quality nucleotides. High-quality reads were then aligned to UCSC hgl9 reference genome by HISAT2 using default parameters, and only uniquely mapped reads were retained for all downstream analyses. FeatureCounts software was used to count reads mapped to RefSeq genes, and differentially expressed genes analysis was conducted by DESeq 2 Software. m ⁶ A peaks on RefSeq transcripts and differentially methylated m ⁶ A peaks were analyzed by ExomePeak R package. To visualize sequencing signals at specific genomic regions, Deeptools was used to normalize all libraries and imported into the software Integrative Genomics Viewer (IGV).

In vitro transcribed biotin-labeled RNA pulldown'. Full length and fragments of FTO-IT1 were amplified by polymerase chain reaction (PCR) using FTO-IT1 specific primers with the forward primer containing a T7 promoter. Biotin-labeled RNAs were in vitro transcribed using corresponding PCR products as template and Biotin RNA Labeling Mix (Roche) and T7 polymerase (New England Biolabs). Control biotin-labeled RNA was in vitro transcribed using empty pcDNA3.1 (which contains a T7 promoter) as the template. The transcribed RNA products were treated with DNase I to eliminate the template DNA. 22Rvl cells were lysed in modified binding buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% NP-40, 0.1% SDS) supplemented with protease inhibitor and RNase inhibitor. For in vitro translated protein, plasmid containing RBM15 gene sequence and T7 promoter was incubated with TNT* Quick Master Mix (Promega, #PR-L1170) for 90 minutes. Cell lysates or in vitro translated protein were incubated with biotin-labeled RNAs and streptavidin beads at 4°C for 12 hours. The beads were washed with wash buffer (50 mM Tris pH 7.4, 150 mM NaCl, 0.05% NP-40, 1 mM MgCh) 4 times. The samples were resolved in SDS loading buffer and denatured at 95°C. Western blot and mass spectrometry were used to analyze the interacting proteins. The primers for FTO- IT1 fragment PCR are listed in TABLE IB.

In vitro transcription andRNA pulldown by GST proteins. FTO-IT1 RNA was transcribed in vitro using T7 RNA polymerase (New England Biolabs) and NTP Mix (Thermo). The transcribed RNA products were treated with DNase I to eliminate the template DNA. pGEX-4T-l plasmids containing truncated GST-RBM15 proteins were transformed into E. coli (BL21) and induced by 0. 1 mM IPTG at 16°C for 12 hours. The GST-RBM15 proteins were purified with glutathione Sepharose beads (GE Healthcare) using methods described elsewhere (Wang et al., EMBO 732: 1584-1597, 2013). Purified GST-RBM15 proteins with glutathione Sepharose beads were incubated with in vitro transcribed FTO-IT1 RNA in RNA structure buffer (50 mM Tris pH 7.4, 150 mM NaCl,

1 mM MgCh) at 4°C for 4 hours. After 6 washes, the RNAs were purified by TRIZOL® and detected using RT-qPCR.

GST pulldown of ectopically expressed protein and in vitro translated protein. Plasmids encoding p53 truncations were transfected into 293T cells. After 36 hours, the cells were lysed with IP buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.5% NP-40), and the cell lysates were incubated with purified GST-RBM15 protein as described above. For in vitro translated protein, plasmid containing p53 gene sequence and T7 promoter was incubated with TNT® Quick Master Mix (Promega, #PR-L1170) for 90 minutes. The in vitro translated protein was then incubated with GST-RBM15 protein. After 4 hours of incubation and 3 washes, the bound proteins were analyzed by western blot.

RNA Fluorescent in situ hybridization (FISH) -. RNA FISH was performed as described elsewhere (Tripathi et al., Methods Mol Biol 1206: 123-136, 2015). Briefly, C4-

2 cells were seeded on coverslips in 6 well plates. After the cells adhered to the coverslips, 4% paraformaldehyde in PBS was used to fix the cells for 15 minutes at RT. The fixing solution was removed, and samples were washed twice with PBS. 0.5% Triton X-100 in PBS at room temperature for 10 minutes was applied to permeabilize the cells. After washing with PBS 3 times, the samples were rinsed with 2 x SSC (0.3 M NaCl, 0.03 M Nas Citrate, pH 7.0) and hybridization was performed by incubating the samples with 10 nM of FAM-labeled FTO-IT1 specific probe mix in hybridization solution (50% Formamide, 2 x SSC, 10% dextran sulfate, 1 mg/mL yeast tRNA) in a humid box at 37°C for 16 hours. The samples were washed 3 times with 2 x SSC and 3 times with 1 x SSC, and then mounted with VECTASHIELD® mounting medium. Images were acquired using a Zeiss LSM 780 confocal microscope. The intensity of fluorescence signals was quantified and normalized to DAPI using ImageJ. The sequences of the probes used for FISH are listed in TABLE 1C.

Cross-linking immunoprecipitation (CLIP)'. 22Rvl cells at 70% confluence in 2 x 150 mm dishes were crosslinked by UV254 and harvested. The cells were lysed in lysis buffer (50 mM Tris pH 7.4, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate) supplemented with protease inhibitor and RNase inhibitor, and then sonicated for 3 cycles of 30 seconds on / 30 seconds off in a BIORUPTOR®. The cell lysates were centrifuged at 10,000 x g and the supernatants were collected. Protein A/G beads and 2 pg of RBM15 antibody were incubated with the lysates at 4°C for 4 hours. The beads were washed 4 times and subjected for Proteinase K de-crosslinking and RNA extraction. RT-qPCR was used to detect the interacting RNA.

RNA stability assay. Cells were treated with 5 pg/mL Actinomycin D and collected at the indicated time points. Total RNA was extracted, and mRNA level of selected genes was analyzed by RT-qPCR. Linear regression was used to determine the trend line equation based on the changes of mRNA level at different time points. The half-life of each mRNA was calculated through the equation: dC/dt = -KdecayC

The mRNA degradation rate Kdecay was estimated by: ln(C/Co) ⁼ -Kdecayt

To calculate the mRNA half-life (/1/2), the point at which 50% of the NA is decayed (that is, C/Co= 1/2), the equation used was: ln( 1/2) == -Kdecavtl/2

From where: tl/2 "■ In2/K.decay Cell cycle analysis'. 1 x 10 ⁶ 22Rvl cells were suspended in trypsin and washed with cold PBS. The suspended cells were fixed with 50% cold ethanol and kept at -20°C overnight. After washing with cold PBS, the fixed cells were resuspended with 0.5 mL PBS. 0.2 mg/mL RNase A was added and incubated with the fixed cells for 1 hour at 37°C. 10 pg/mL PI (Sigma P4170) was added to the cell suspension, and cells were analyzed by FACS with reading on a cytometer at 488 nm. The data were analyzed by FlowJo_V10.

Apoptosis analysis'. 1 x 10 ⁶ 22Rvl cells were suspended in trypsin and washed twice with cold PBS. The cell pellet was resuspended in 1 mL IX Binding Buffer (BD PHARMINGEN™, BDB559763). 100 pl of cell suspension was transferred to a 5 mL culture tube, and 5 pl PE Annexin V and 5 pl 7-AAD were added (BD PHARMINGEN™, #BDB559763). The cell suspension was gently vortexed and incubated for 15 minutes at RT in the dark. 400 pl of IX Binding Buffer was added to each tube and cells were analyzed by flow cytometry. Unstained cells, single PE Annexin V, and single 7-AAD stained cells were used for controls. The data were analyzed by FlowJo_V10.

Protein co-immunoprecipitation (co-IP)'. Immunoprecipitations were performed as described elsewhere (Zhang et al., Nat Commun 12:5716, 2021). Briefly, cells were lysed with lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% NONIDET® P-40, and freshly added protease inhibitor cocktails) and centrifuged to obtain supernatant. Protein A/G beads and indicated antibody were incubated with the supernatant at 4°C overnight. Beads were washed 3 times with lysis buffer and re-suspended in SDS loading buffer prior to western blot analysis.

Western blot. Whole cell lysates or IP samples were subjected to SDS-PAGE. The proteins were transferred onto nitrocellulose membranes (GE Healthcare sciences). The transferred membranes were blocked using TBST with 5% w/v nonfat milk and incubated with primary antibodies at 4°C overnight. The antibodies used in these studies are listed in TABLE 1A. The next day, the membranes were washed 3 times with TBST, followed by incubation with secondary antibodies at room temperature. After washing in TBST three times, the membranes were visualized using the Enhanced Chemiluminescence (ECL) system (Thermo Fisher Scientific).

Cell proliferation assay. Cells were seeded in 96-well plates at a concentration of 2,000 cells per well. The CELL TITER 96® AQueous One solution Cell Proliferation Assay (MTS) (Promega) was used to measure cell viability at various time points. The MTS was diluted 1 : 10 in PBS, added into the wells, and incubated for 1 hour at 37°C in a cell incubator. A microplate reader was used to measure the absorbance at 490 nm in each well.

Colony formation assay. The procedure was carried out as described elsewhere (Zhang et al., supra). Briefly, the cells were seeded in 6-well plates at a concentration of 5000 cells per well. About 12 days later, the colonies were fixed with 4% paraformaldehyde for 15 minutes and stained with crystal violet (0.5% w/v) for 1 hour. The colonies were gently washed with running tap water and counted for quantification.

Xenograft generation and drug treatment. Six-week-old SCID male mice were housed in standard conditions with a 12-hour light /12-hour dark cycle, and were randomly divided into different groups as indicated. 5 * 10 ⁶ of mock KO or FTO-IT1 KO C4-2R cells were mixed with MATRIGEL® (50 pL PBS plus 50 pL MA TRI GEL ¹ ; BD Biosciences) and injected subcutaneously into mice. For 22Rvl xenografts, 5 * 10 ⁶ cells were mixed with MATRIGEL® (50 pL PBS plus 50 pL MATRIGEL®) and injected subcutaneously into mice. When xenografts reached a size of about 100 mm ³ , vehicle (PBS with 0.3 mg/mL PEI) or drugs (FTO-IT1 specific ASOs at 3 mg/kg in PBS with 0.3 mg/mL PEI) were administered by tail vein injection 4 days a week for 3 weeks. Tumor growth was measured in a blinded fashion by a caliper. The volume of the tumors was calculated using the formula (L x W ² )/2, where L stands for the length of the tumor and W stands for the width. Tumor volumes were compared, and P values were determined by unpaired two-tailed Student’s /-test. After 3-weeks of injection, the tumors were dissected and photographed.

TCGA gene expression and survival analysis. Illumina HiSeq (n=550) TCGA Hub level-3 data was downloaded from the TCGA data coordination center. This dataset shows the gene-level transcription estimates, as in log2(x+l) transformed RSEM normalized count. Genes are mapped onto the human genome coordinates using UCSC Xena HUGO probeMap (see ID/Gene mapping link below for details). The TCGA reference method description was from the University of North Carolina Center for Genomic Characterization: DCC description. To make it easier to see differential expression between samples, the default view was set to center each gene or exon independently minus each gene with mean zero or exons. For survival analysis, the cohort was split into high-expression and low-expression group using a function of the X- tile software (Camp et al., Clin Cancer Res 10:7252-7259, 2004) as a method for selection of optimal cutpoint. The P values were calculated by logrank test.

WCDT dataset survival analysis'. Gene expression and clinical information for the PCa West Coast Dream Team (WCDT) dataset were from Quigley et al., Cell 174:758- 769 e759, 2018). For survival analysis, samples were median dichotomized into two groups according to FTO-IT1 expression. Logrank test from the R package Survival (v3.2.11) was used to calculate P value and the result was visualized using the R package BoutrosLab. plotting. general (v5.9.8) (P’ng et al., BMC Bioinformatics 20:42, 2019).

Statistical analysis'. All data are shown as mean ± SD unless otherwise specified. The data were processed using Microsoft Excel version 2008. Differences between two groups were analyzed using unpaired two-tailed Student’s /-tests unless otherwise specified. A P value < 0.05 was considered statistically significant.

Data availability. The RNA-seq data and m ⁶ A-seq data were deposited in the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database with the accession codes GSE189465 and GSE189966 (ncbi.nlm.nih.gov/geo/query/acc.cgi?acc =GSE189465, Token: svkrcwichvglvat; and ncbi.nlm. nih.gov/geo/query/acc. cgi?acc =GSE189966, Token: evsryiymhhmjhox).

TABLE 1A: Resources

REAGENT or RESOURCE SOURCE IDENTIFIER

Attorney Docket No. 07039-2161W01 2021-597

TABLE IB: Primer sequences

Attorney Docket No. 07039-2161W01 2021-597

Attorney Docket No. 07039-2161W01 2021-597

TABLE 1C: shRNA/sgRNA/ASO sequences

Attorney Docket No. 07039-2161W01 2021-597

Results

FTO-IT1 is upregulated during progression ofPCa and negatively correlated with patient survival

Paired control and ENZ-resistant cells were generated from the CRPC cell line C4-2 (hereafter termed C4-2C and C4-2R, respectively) by treating cells with vehicle or the antiandrogen ENZ over a month (Zhao et al., Oncotarget 7:38551-38565, 2016; and Zhao et al., Cell Rep 15:599-610, 2016). To elucidate the molecular mechanisms of disease progression and therapy resistance in PCa, RNA-seq profding was performed in these paired cell lines. Unlike studies of drug resistance mechanisms mediated by coding RNAs and protein posttranslational modifications in PCa (see, e.g., Blatt and Raj, Cancer Drug Resist 2A 9- F1, 2019; and Wen et al., Asian J Urol 7:203-218, 2020), the present studies were focused specifically on noncoding RNAs (ncRNAs) that might be related to RNA m ⁶ A modification. Over 8500 ncRNAs were identified as being differentially expressed in ENZ resistant versus control (mock-treated) C4-2 cells. Among the 178 ncRNAs highly upregulated in C4-2R compared to C4-2C cells (TABLE 2), FTO-IT1 (870 nt in length) was the only IncRNA that was transcribed from the gene loci of the major known m ⁶ A modifiers, which include the components of the writer complex and two m ⁶ A demethylases (FIGS. 1A-1C and 2A, and TABLE 3). FTO-IT1 is 870 nt in length, and the sequence is set forth in SEQ ID NO: 94 herein.

RNA fluorescent in situ (RNA-FISH) analysis showed that FTO-IT1 was localized in both cytoplasm and nucleus of C4-2 cells and that ENZ treatment induced FTO-IT1 expression but had no obvious effect on the cellular distribution of FTO-IT1 (FIGS. ID and IE). Copy numbers of FTO-IT1 also were measured in C4-2C, C4-2R and 22Rvl, another ENZ-resistant cell line (Li et al., Cancer Res 73:483-489, 2013). It was found that FTO-IT levels were low (about 31 copies per cell) in C4-2C cells, but were much higher in C4-2R (about 98 copies per cell) and 22Rvl cells (about 119 copies per cell) (FIG. 2B).

Analysis of AR chromatin immunoprecipitation sequencing (ChlP-seq) data showed that treatment of C4-2 cells with the synthetic androgen mibolerone induced AR binding in the proximity of the FTO-IT1 promoter, but AR binding was abolished by ENZ (FIGS. 2C and 2D). Thus, the RNA-seq and ChlP-seq data suggested FTO-ITl is a putative suppression target of AR. In support of this notion, it was demonstrated that inhibition of the AR by androgen deprivation and treatment of antiandrogen ENZ upregulated FTO-ITl expression in a time dependent manner in C4-2 cells (FIG. 2E). Treatment with the AR proteolysis-targeting chimera (PROTAC) ARV-110 (Neklesa et al., Abstract 5236, Cancer Res 78:2018) also increased FTO-ITl expression in C4-2 cells (FIG. 2F). In agreement with the role of DTX in suppressing AR functions as reported elsewhere (see, e.g., Darshan et al., Cancer Res 71 :6019-6029, 2011; Gan et al., Cancer Res 69:8386-8394, 2009, Kuroda et al., Prostate 69: 1579-1585, 2009; and Zhu et al., Cancer Res 70:7992-8002, 2010), FTO-ITl expression levels were higher in DTX- resistant 22Rvl, C4-2, and LNCaP cells compared to control cells (FIG. IF). These data suggested that transcription of FTO-ITl IncRNA can be repressed by activation of the AR, and that in contrast, its expression is upregulated following treatment with ENZ and DTX, and the effect of DTX may be attributed, at least in part to its inhibitory effect on AR activities.

Meta-analysis of transcriptomic data of primary PCa patient samples from The Cancer Genome Atlas (TCGA) cohort showed that FTO-ITl expression levels were higher in tumors in advanced-stages (T3b and T4) relative to early-stage tumors (T2a to T3a) (FIG. 1G). Reverse transcription quantitative polymerase chain reaction (RT- qPCR) analysis further showed that the FTO-ITl expression levels were significantly higher in metastatic CRPC tissues than in primary tumors in patients (FIG. 1H).

To determine the clinical relevance of the high FTO-ITl levels, the association of FTO-ITl expression with patient survival was examined. It was observed that high FTO- ITl expression significantly associated with poor progression-free survival (PFS) of PCa patients in the TCGA cohort (FIG. 3A). Since FTO-ITl expression was significantly elevated in CRPC, the Prostate Cancer West Coast Dream Team (WCDT) dataset was queried to determine the association of FTO-ITl expression with the overall survival (OS) of metastatic CRPC patients. Surprisingly, there was no obvious difference in OS of CRPC patients with either high or low expression of FTO-ITl (FIG. 3B). To determine whether highly expressed FTO-ITl is associated with PCa progression in a context- dependent manner, tumors with or without frequently occurring gene alterations (such as AR amplification, TMPRSS2-ERG fusion, and/or TP53 gene deletion/mutation) were stratified. A better association of FT0-IT1 high expression with PFS was observed in patients of primary WT TP53 only tumors (FIG. II). Drastically different from the results in all patients (FIG. 3B), high expression of FTO-IT1 was significantly associated with poor OS of TP53 WT CRPC patients (FIG. 1 J). Together, these data indicated that FT0-IT1 IncRNA is upregulated in local advanced PCa and CRPC metastatic patient samples. The finding that high expression of FT0-IT1 strongly associates with disease progression only in TP53 WT PCa indicated that FT0-IT1 overexpression and p53 functionality may be interrelated.

FTO-IT1 downregulates global andp53 target gene mRNA m ⁶ A levels

Since FT0-IT1 is a IncRNA that is transcribed from the FTO demethylase gene locus, studies were conducted to determine whether FT0-IT1 expression regulates m ⁶ A levels in PCa cells. To this end, FT0-IT1 was knocked out by two independent pairs of small guide RNAs (sgRNAs) in two ENZ-resistant cell lines (C4-2R and 22Rvl), and total m ⁶ A levels of mRNAs were measured using both dot blot and mass spectrometry approaches. Results from both analytic methods showed that FT0-IT1 knockout (KO) substantially increased global mRNA m ⁶ A levels in both cell lines (FIGS. 4A and 3C- 3E). As revealed by mass spectrometry in both cell lines, this effect appeared to be m ⁶ A modification-specific, since FT0-IT1 KO had minimal effects on m ⁶ A _m (N6,2'-O- dimethyladenosine, a modification at the cap of mRNAs) (Mauer et al., Nature 541 :371 - 375, 2017) (FIG. 3F).

To define the specific mRNAs for which m ⁶ A levels are affected by FTO-IT1, bulk RNA-seq and m ⁶ A methylated mRNA immunoprecipitation sequencing (MeRIP- seq) were performed in mock and FTO-IT1 KO 22Rvl cells. Consistent with a global increase in m ⁶ A level, a large number of m ⁶ A peaks (n=3,201) were upregulated, but a much smaller number of peaks (n=573) were downregulated in FTO-IT1 KO 22Rvl cells as compared to control cells (FIG. 4B). FTO-IT1 knockout also altered the distribution of m ⁶ A frequency in different regions of transcripts. Compared to control cells, FTO-IT1 KO cells exhibited increased m ⁶ A in CDS and parts of the 3'UTR (FIG. 4C). Consistent with other reports (Dominissini et al., Nature 485:201-206, 2012; and Meyer et al., Cell 149: 1635-1646, 2012), the m ⁶ A frequency reached its peak near the stop codon in both control and FTO-IT1 KO cells and notably, the peak was higher in FTO- Tl KO cells compared to control cells (FIG. 4C). These data indicated that FTO-IT1 not only affects overall levels of m ⁶ A methylation, but also regulates m ⁶ A distribution in different regions of the transcripts.

Bulk RNA-seq revealed 1,229 upregulated and 1,777 downregulated genes with 2- or greater-fold changes in FTO-IT1 KO versus control 22Rvl cells (FIG. 4D). Pathway analysis indicated the upregulated genes were enriched in p53 transcriptional gene networks, FoxO signaling, and EGF/EGFR signaling pathway, while the downregulated genes were enriched in PLK1, AURORA B pathway, cell cycle, and several other pathways (FIGS. 5A and 5B). To define the target genes whose expression are affected by /’7(9-//7-mediated m ⁶ A alterations, clustering analysis was performed between mRNAs with m ⁶ A changes and differentially expressed genes after depletion of FTO-IT1 in 22Rvl cells. 1,226 hypermethylated peaks were identified in 649 upregulated genes (hyper-up), but only 253 hypermethylated peaks were identified in 188 downregulated genes (hyper-down) (FIG. 4E). This result suggested that m ⁶ A hypermethylation is more likely to increase gene expression in 22Rvl cells, prompting further studies to focus on the FTO-ITI KO-induced hyper-up genes.

Pathway analysis showed that the hyper-up genes were highly enriched for p53 transcriptional genes, the FoxO signaling pathway, and a few other cancer-related pathways (FIG. 4F). Given that high level expression of FTO-ITI was associated with poor survival of patients with WT p53 (FIGS. II and 1 J), the p53 pathway was chosen for further studies. Gene Set Enrichment Analysis (GSEA) of the differentially expressed m ⁶ A-hypermethylated mRNAs confirmed the enrichment of p53 pathway as a hallmark change in FTO-ITI KO cells (FIG. 5C). Indeed, a group (n=36) of p53 pathway genes, including those defined by GSEA, were significantly upregulated in FTO-ITI KO cells as compared to control cells (FIG. 4G). This group included typical p53 target genes such as FAS, TP53INP1, MDM2, and SESN2, and their mRNA m ⁶ A levels were significantly increased in FT0-IT1 KO cells (FIGS. 4H, 41, 5D, and 5E). The m ⁶ A modifications on mRNA expressed from these genes were further confirmed by MeRIP-qPCR (FIGS. 4J and 5F). The stability of these mRNAs was increased ' FTO-ITl KO cells (FIGS. 4K and 5G). Consistent with these results, the mRNA and protein levels of these genes also were increased in FTO-IT1 KO cells with little or no obvious changes in expression of p53 itself (FIGS. 4L, 5H, and 51). Taken together, these results indicate that increased expression of FT0-IT1 decreased mRNA m ⁶ A levels and stability of p53 target genes regulating cell cycle and apoptosis.

FT0-IT1 regulates cell growth and survival via m ⁶ A-mediated p53 target gene expression

FTO-IT1 regulation of m ⁶ A levels and expression of p53 target gene mRNAs led to investigations into the functional importance of FTO-ITl expression in cancer cell growth and survival. Colony formation assays showed that /•7G-/7'KO 22Rvl and C4- 2R cells grew much more slowly than control cells (FIGS. 6A and 6B). The SESTRIN (SESN) family proteins play important roles in suppression of mTORl and mT0RC2, activation of which induce upregulation of cell cycle drivers and downregulation of cell cycle inhibitors (Budanov and Karin, Cell 134:451-460, 2008). Consistent with the upregulation of SESN2, a known p53 target gene (Budanov and Karin, supra, and Budanov et al., Oncogene 21 :6017-6031, 2002) and the downregulation of phosphorylation of S6K, a downstream effector of mTORCl m FTO-ITl deficient cells (FIGS. 4G and 4L), FTO-ITl knockout induced G1 cell cycle arrest (FIGS. 6C and 6D). Importantly, SESN2 knockdown largely diminished FTO-ITl KO-induced G1 cell cycle arrest (FIGS. 6E-6G), suggesting a role of SESN2 in contribution to FTO-ITl - induced cell cycle progression. FAS and TP53INP1 are two pro-apoptotic genes that are p53 target genes (Muller et al., J Exp Med 188:2033-2045, 1998; and Okamura et al., Mol Cell 8:85-94, 2001). In agreement with the upregulation of FAS and TP53INP1 gene expression in FTO-ITl KO cells (FIGS. 4G and 4L), FTO-ITl depletion induced apoptotic cell death (FIGS. 6H and 61). This effect was reversed at least partially, however, by KO of FAS or TP53INP1 individually in 22Rvl cells (FIGS. 6J-6O). These results indicated that m ⁶ A-regulated p53 target genes, including SESN2, FAS and TP53INP1, play essential roles in FTO-ITl deficiency -induced PCa cell growth arrest and apoptosis.

FTO-ITl binds to RBM15 in the m ⁶ A writer complex

To understand the mechanism of FTO-ITl suppression of m ⁶ A methylation, studies were conducted to examine whether deletion of FTO-ITl affects FTO expression given that FTO-ITl is transcribed from the last intron of the FTO gene. Both RNA-seq and RT-qPCR analyses showed that deletion of FTO-ITl by two pairs of sgRNAs slightly decreased FTO mRNA expression in 22Rvl cell lines (FIGS. 7A and 7B), and similar results were obtained in C4-2R cells (FIG. 7A). However, FTO protein expression was not obviously affected by FTO-ITl KO in either C4-2R or 22Rvl cells (FIG. 7C). Notably, the slight change in FTO mRNA levels in FTO-ITl KO cells was not faithfully reflected in the protein level, but the discrepancy could be explained at least partially by the observation that FTO is a relative long-lived protein (Tai et al., FASEB J 31 :4396- 4406, 2017). Similar to the effects on FTO, FTO-ITl deletion in both cell lines had no obvious impact on the expression of other well-established m ⁶ A modifiers, including ALKBH5 (another m ⁶ A demethylase) and the major components of the m ⁶ A methyltransferase complex, such as METTL3, METTL14, WTAP, RBM15 and RBM15B (FIG. 7C).

Since FTO-ITl manipulation did not drastically affect expression of the m ⁶ A writer and eraser proteins examined, further studies sought to determine whether FTO- ITl binds to these proteins. To this end, an unbiased protein pulldown assay was performed using biotin-labeled non-specific control RNA and FTO-ITl as bait (FIG. 8A), and the pulldown proteins were used for silver staining and mass spectrometry (FIG. 8B). Compared to the control RNA, a total of 280 FTO-ITl uniquely bound proteins were identified (TABLE 4), among which RBM15 was the only one of the eleven major m ⁶ A modifier proteins examined (TABLE 3 and FIGS. 8B-8D), suggesting that FTO-ITl might physically interact with the m6A writer complex. Strong binding of RBM15 by FTO-ITl was validated by biotin pulldown assays (FIG. 8E). In contrast, FT0-IT1 only very weakly interacted with RBM15B (a homolog of RBM15), METTL3, and METTL14, and had no detectable interaction with other members of the writer complex (FIG. 8E). Using hi vitro transcribed and translated RMB 15 for pulldown assays, it was demonstrated that FTO-ITl directly bound RBM15 protein (FIG. 8F). Reciprocally, a CLIP-qPCR assay showed that RBM15 bound to FTO-ITl IncRNA in 22Rvl cells (FIG. 8G). RNA pulldown assay further showed that RBM15 bound preferentially to the 5' portion of FTO-ITl (nt 1-434) as compared to the 3' portion (nt 435-870) (FIGS. 8H and 81). RIP with GST and GST-RBM15 recombinant proteins and in vitro transcribed FTO-ITl showed that FTO-ITl IncRNA directly binds to the RRM1 and SPOC domains in RBM15 (FIGS. 8J and 8K). These data indicated that FTO-ITl can directly bind to RBM15 protein of the m ⁶ A writer complex, and that their interaction is mediated by the 5' portion of FTO-ITl and the RRM1 and SPOC domains of RBM15.

RBM15 selectively binds to p53 target gene mRNAs and augments their m ⁶ A levels

RBM15 is a RNA binding motif-containing protein that binds to U-rich regions of RNAs and facilitates RNA m ⁶ A methylation (Patil et al., Nature 537:369-373, 2016). By performing RMB 15 CLIP-seq in 22Rvl cells, it was found that the RBM15 CLIP binding sites were highly aligned with m ⁶ A sites (GAC motif) (FIGS. 9A-9C). Notably, the 3,498 RBM15-bound gene mRNAs identified by CLIP-seq significantly overlapped with the well-established p53 pathway genes (TABLE 5 and FIG. 10A), and 13 of the overlapping genes (n=68) were hypermethylated upon FTO-ITl KO, including FAS, TP53INP1, SESN2 and MDM2 (TABLE 5). CLIP-seq and m ⁶ A IP data displayed a significant consistency between RBM15 binding sites and m ⁶ A peak sites in the gene regions of FAS, TP53INP1, SESN2 and MDM2 (FIG. 10B). RBM15 binding of these mRNAs was confirmed by CLIP-qPCR (FIG. 10C). Depletion of RBM15 by two independent siRNAs decreased mRNA m ⁶ A levels of these genes, as well as their expression at both mRNA and protein levels (FIGS. 10D-10F). Importantly, it was observed that FTO-ITl KO-induced upregulation of m ⁶ A methylation on these p53 target gene mRNAs, and their expression was completely abolished by knockdown of RBM15 in 22Rvl cells (FIGS. 10G-10I), suggesting that RBM15 plays an essential role in FTO- IT1 regulation of m ⁶ A methylation on these p53 target genes. Given that RBM15 is a key component of the m ⁶ A write complex that regulates m ⁶ A methylation of certain RNAs (Patil et al, supra), studies were conducted to determine whether FT0-IT1 regulates m ⁶ A levels on p53 target gene mRNA through the m ⁶ A methyltransf erase complex. These studies demonstrated that knockdown of METTL3, a catalytic subunit of the m ⁶ A writer complex, decreased the m ⁶ A levels of these mRNAs and their expression at both the mRNA and protein levels (FIGS. 11A-11C). Importantly, METTL3 knockdown completely abolished the effect of FT0-IT1 KO on the m ⁶ A levels and expression of these p53 target genes (FIGS. 11A-11C).

RBM15 binds to p53 protein and regulates p53 target mRNA m ⁶ A level and expression m ⁶ A is co-transcriptionally casted on mRNA (Shi et al. 2019, supra). To investigate how RBM15 regulates p53 target gene mRNA m ⁶ A level, meta-analysis of p53 interacting proteins identified by mass spectrometry was performed. This analysis revealed that RBM15 was the only m ⁶ A modifier bound by p53 in that database (FIG. 12A). Co-IP assay confirmed that at endogenous levels, p53 interacted strongly with RBM15 and marginally with METTL3, but not with other core m ⁶ A writer complex components METTL14, WTAP, or RBM15B (a homolog protein of RBM15) (FIG.

12B) Similar results were obtained by reciprocal co-IP (FIG. 12C). GST pulldown assay using GST-RBM15 recombinant proteins and in vitro transcribed and translated p53 proteins showed that the SPOC domain in the RMB15 C-terminal region directly bound to the p53 protein (FIGS. 12D and 12E). GST pulldown assays further showed that the DNA binding domain (DBD) of p53 was required to bind to the SPOC domain of RBM15 in vitro (FIGS. 12F and 12G). In agreement with these results, deletion of the SPOC domain completely abolished RBM15 binding to p53 (FIGS. 12H and 121). Finally, endogenous RBM15 was knocked down and rescued with WT RBM15 or p53 binding region (SPOC domain) deletion mutant (RBM15Ap53BR). These studies demonstrated that only restored expression of WT RBM15, but not RBM15Ap53BR, reversed RBM15 depletion-induced downregulation of p53 target mRNA m ⁶ A levels and their expression (FIGS. 12J-12L). Collectively, these data indicated that RBM15 directly binds p53 protein and regulates p53 target gene mRNA m ⁶ A modification and p53 target gene expression.

Consistent with the physical interaction between RBM15 and p53, meta-analysis of RBM15 ChlP-seq data (Consortium, Nature 489:57-74, 2012) showed that RBM15 bound to the promoters of about 25% (70 out of 282) of well-recognized p53 target genes, and the mRNA m ⁶ A levels for 20% of the bound genes (14 out of 70), including SESE2, TP53INP1, and MDM2, were upregulated mFTO-ITl KO cells (FIGS. 11D and HE and TABLES 6A and 6B) RBM15 binding of these p53 target gene promoters was further confirmed by ChlP-qPCR (FIG. HF).

IGF2BP proteins bind and stabilize m ⁶ A-modified mRNAs of p53 target genes

The fate of m ⁶ A-methylated RNAs can be either up- or down-regulated due to their recognition by different m ⁶ A “reader” proteins, which include YTH Domaincontaining proteins (YTHDC1-2, YTDHF1-3) (Hsu et al., Cell Res 27: 1115-1127, 2017; Huang et al., Nat Cell Biol 20:285-295, 2018; Roundtree et al., Elife 6, 2017; Shi et al., Cell Res 27:315-328, 2017; Wang et al., Nature 505: 117-120, 2014; Wang et al., Cell 161 : 1388-1399, 2015; and Xiao et al., Mol Cell 61 :507-519, 2016) and IGF2BP proteins (IGF2BP1-3) that can promote stabilization of m ⁶ A-methylated RNAs (Huang et al., supra). Because the data presented herein show ha!tFTO-ITl modulates m ⁶ A levels and stability of p53 target gene mRNAs, further studies sought to determine whether 1GF2BP proteins play a role in FTO-EI '/-mediated regulation of p53 pathway genes. IGF2BP1-3 CLIP-qPCR analysis showed that these reader proteins bound mRNAs of the p53 target genes FAS, TP53INP1, SESN2, and MDM2, and FTO-IT1 KO largely enhanced the binding (FIGS. 13A-13C). Knockout of IGF2BP1-3 by sgRNAs not only decreased expression of these p53 target genes, but also almost completely blocked FTO-IT1 KO- induced upregulation of their expression (FIGS. 13D and 13E). Importantly, FTO-IT1 KO failed to increase the stability of these gene mRNAs when IGF2BP1-3 was depleted (FIG. 13F). Similarly, FTO-IT1 KO-induced G1 cell cycle arrest and apoptosis were completely reversed by IGF2BP1-3 KO in 22Rvl cells (FIGS. 13G-13J). These data indicated that the IGF2BP proteins play a pivotal role in FTO-IT1 KO-caused stabilization of m ⁶ A-modified p53 target gene mRNAs and growth inhibition of PCa cells.

Depletion of FTO-JT1 inhibits PCa cell growth in vitro and in mice

To investigate the functional importance of FTO-IT1 in cancer progression, FTO- ITl was knocked out using two independent pairs of sgRNAs in C4-2R(FIGS. 3C and 3D), and control and FTO-IT1 KO cells were inoculated subcutaneously into SCID mice. These studies demonstrated that FTO-IT1 KO largely inhibited C4-2R tumor growth in mice (FIGS. 14A-14C). Immunohistochemistry (IHC) showed that proliferation was decreased but apoptosis was increased following FTO-IT1 KO in tumors (FIGS. 15A and 15B).

To therapeutically target the expression of FTO-IT1, several /'7(9-/77-specific ASOs were designed. The two most potent ASOs were ASO #3 (SEQ ID NO:84) and ASO #6 (SEQ ID NO:87) (sequences provided in TABLE 1C) resulted in more than 80% of reduction in FTO-IT1 levels (FIGS. 14D). Treatment with these FTO-IT1 ASOs largely increased p53 target gene expression in both 22Rvl and C4-2R cells (FIG. 14E). In agreement with the increased expression of cleaved PARP1 and decreased RB phosphorylation, FTO-IT1 ASO treatment significantly reduced cell proliferation and colony formation in both cell lines (FIGS. 14E-14G, 15C, and 15D). Accordingly, FTO- IT1 ASO treatment increased m ⁶ A levels in both C4-2R and 22Rvl cells (FIG. 15E). Moreover, these studies showed that FTO-IT1 ASO administration largely inhibited tumor growth in mice but had no obvious effect on mouse body weight (FIGS. 14H- 14K). FTO-IT1 ASO treatment also led to a significant reduction in cell proliferation, an increase in apoptotic cell death, and upregulation of p53 downstream target genes and mRNA m ⁶ A levels in tumors (FIGS. 14L, 14M, 15F, and 15G).

Taken together, the studies described above demonstrated that without affecting the mRNA and protein expression of the TP53 gene itself, FTO-IT1 inhibits p53 tumor suppression signaling by selectively decreasing the mRNA m ⁶ A levels of a few key p53 target genes, including FAS, TP53INPI, and SESN2. The studies provided evidence that the RNA binding protein RBM15, a key component of the m ⁶ A methyltransferase complex, directly binds to the p53 protein and induces p53 target gene mRNA m ⁶ A methylation (FIG. 16A), and showed that the m ⁶ A-modified p53 target gene mRNAs can be recognized and stabilized by IGF2BP1-3, which are m ⁶ A reader proteins. However, this effect of RBM15 was abolished by FTO-IT1 binding of RMB15, which leads to p53 target gene mRNA m ⁶ A demethylation and destabilization (FIG. 16B). Thus, these studies revealed an epitranscriptomic mechanism that circumvents the tumor suppressor activity of WT p53 by disrupting its downstream target gene signaling. Importantly, the cell line data were fully corroborated by patient data showing that overexpressed FTO- IT1 associates with overall or progression-free survival of patients with tumors that only express WT p53, but not in tumors where TP53 gene itself is already deleted or mutated. Thus, the data provided herein indicate that overexpressed FTO-TT1 is an important driver for inhibition of p53 target gene expression and mRNA m ⁶ A levels and for enhancing PCa cell growth, and is a viable cancer therapy target. TABLE 2: ncRNAs upregulated in ENZ resistant vs. control C4-2 cells

(FC>2-fold, p<0.05) TABLE 3: ncRNAs transcribed from the gene loci of the major known m ⁶ A modifiers

TABLE 4: Proteins uniquely interacted with FT0-IT1 RNA

TABLE 5: RBM15 binding p53 target gene

(bold genes are hypermethylated upon FT0-IT1 KO) TABLE 6A: p53 signaling genes ( WP_P53_transcriptional gene network, GSEA HALLMARK, KEGG P53 signaling pathway) and overlap with RBM15-ChIP binding genes (bold)

TABLE 6B: Overlap of p53 signaling genes with RBM15 binding genes

OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.