TETRAHYDROFURO[3,4-C]ISOQUINOLINES AS INHIBITORS OF PDE4 Field of application of the invention

The invention relates to novel 1 ,3,3a,9b-tetrahydro[3,4-c]isoquinoline compounds, which are used in the pharmaceutical industry for the manufacture of pharmaceutical compositions. Known technical background

In the International patent applications WO2004/018431 and WO2005/077906 1 ,2,3,4,4a, 10b- hexahydrophenanthridin-6-yl-phenyl compounds with a guanidinoyi substituent at the 6-phenyl ring are disclosed as PDE4 inhibitors. In addition, in the International patent applications WO2002/066476 and WO2004/018465 1 ,2,3,4,4a, 10b hexahydro-benzo[c][1 ,6] naphthyridin-6-yl phenyl compounds with a guanidinoyi substituent at the 6-phenyl ring are disclosed as PDE3/4 inhibitors.

Description of the invention It has now been found that the 1 ,3,3a,9b-tetrahydro[3,4-c]isoquinoline compounds, which are described in greater details below, have surprising and particularly advantageous properties.

The invention relates to a compound of formula 1

wherein

R1 is 1-2C-alkoxy, completely or predominantly fluorine substituted 1-2C-alkoxy or 2,2- difluoroethoxy,

R2 is 1-2C-alkoxy, completely or predominantly fluorine substituted 1-2C-alkoxy or 2,2- difluoroethoxy, R3 is a group of formula (a)

wherein

R4, R5, R6 and R7 all are hydrogen, methyl or ethyl,

or

R4, R5, R6 and R7 independently of one another are hydrogen, methyl or ethyl, with the proviso that not all of R4, R5, R6 and R7 have identical meanings,

or

R4 and R5 independently of one another are hydrogen, methyl or ethyl, and R6 and R7, together with the nitrogen atom to which both are bonded form a pyrrolidin-1-yl, piperidin-1-yl, azepan-1- yl, 4-morpholinyl, 4-(1-4C-alkoxy)-piperidin-1-yl or 4-(1-4C-alkyl-)piperazin-1-yl ring,

or a salt of this compound.

1-4C-Alkyl is a straight-chain or branched alkyl group having 1 to 4 carbon atoms. Examples are butyl, isobutyl, sec-butyl, tert-butyl, propyl, isopropyl, ethyl and methyl.

1-2C-Alkyl is a straight-chain alkyl group having 1 to 2 carbon atoms. Examples are ethyl and methyl.

1-4C-Alkoxy is a group which, in addition to the oxygen atom, contains a straight-chain or branched alkyl group having 1 to 4 carbon atoms. Alkoxy groups having 1 to 4 carbon atoms which may be mentioned in this context are, for example, butoxy, isobutoxy, sec-butoxy, tert-butoxy, propoxy, isopropoxy, ethoxy and methoxy.

1-2C-Alkoxy is a group, which in addition to the oxygen atom, contains a straight-chain alkyl group having 1 to 2 carbon atoms. Examples are ethoxy and methoxy.

1-2C-Alkoxy which is completely or predominantly substituted by fluorine is, for example, the perfluoro- ethoxy, the 1 ,2,2-trifluoroethoxy, the 1 , 1 ,2,2-tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifluoro- methoxy and the difluoromethoxy radical, of which the difluoromethoxy radical is preferred. "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-2C-alkoxy group are replaced by fluorine atoms. In a preferred embodiment, the invention relates to a compound of formula 1 , wherein R1 is 1-2C-alkoxy or completely or predominantly fluorine substituted 1-2C-alkoxy,

R2 is 1-2C-alkoxy or completely or predominantly fluorine substituted 1-2C-alkoxy,

R3 is a group of formula (a)

wherein

R4, R5, R6 and R7 all are hydrogen,

or

R4, R5, R6 and R7 all are methyl,

or

R4, R5, R6 and R7 all are ethyl,

or

R4 and R5 are hydrogen and R6 and R7 are methyl,

or

R4 and R5 are hydrogen and R6 and R7 are ethyl,

or

R4 and R5 are hydrogen, and R6 and R7, together with the nitrogen atom to which both are bonded form a pyrrolidin-1-yl, piperidin-1-yl, azepan-1-yl, morpholin-4-yl,

4-(1-4C-alkoxy-)piperidin-1-yl or 4-(1-4C-alkyl-)piperazin-1-yl ring,

or

R4 and R5 are methyl, and R6 and R7, together with the nitrogen atom to which both are bonded form a pyrrolidin-1-yl, piperidin-1-yl, azepan-1-yl, morpholin-4-yl,

4-(1-4C-alkoxy-)piperidin-1-yl or 4-(1-4C-alkyl-)piperazin-1-yl ring,

or

R4 and R5 are ethyl, and R6 and R7, together with the nitrogen atom to which both are bonded pyrrolidin-1-yl, piperidin-1-yl, azepan-1-yl, morpholin-4-yl,

4-(1-4C-alkoxy-)piperidin-1-yl or 4-(1-4C-alkyl-)piperazin-1-yl ring,

or a salt of this compound.

In another preferred embodiment, the invention relates to a compound of formula 1 , wherein

R1 is methoxy or ethoxy,

R2 is methoxy or ethoxy,

R3 is a group of formula (a)

wherein

R4, R5, R6 and R7 all are methyl,

or

R4 and R5 are hydrogen and R6 and R7 are methyl,

or

R4 and R5 are hydrogen, and R6 and R7, together with the nitrogen atom to which both are bonded form a piperidin-1-yl, morpholin-4-yl or 4-methoxypiperidin-1-yl ring,

or

R4 and R5 are methyl, and R6 and R7, together with the nitrogen atom to which both are bonded form a piperidin-1-yl, morpholin-4-yl or 4-methoxypiperidin-1-yl ring,

or a salt of this compound.

In another preferred embodiment, the invention relates to a compound of formula 1 , wherein

R1 is methoxy,

R2 is ethoxy,

R3 is a group of formula (a)

wherein

R4, R5, R6 and R7 all are methyl,

or

R4 and R5 are hydrogen and R6 and R7 are methyl,

or

R4 and R5 are hydrogen, and R6 and R7, together with the nitrogen atom to which both are bonded form a piperidin-1-yl, morpholin-4-yl or 4-methoxypiperidin-1-yl ring,

or

R4 and R5 are methyl, and R6 and R7, together with the nitrogen atom to which both are bonded form a piperidin-1-yl, morpholin-4-yl or 4-methoxypiperidin-1-yl ring,

or a salt of this compound. In another preferred embodiment, the invention relates to a compound of formula 1 , selected from

N-[Amino(piperidin-1-yl)methylidene]-4-[(3aS,9bR)-8-ethox y-7-methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4- c]isoquinolin-5-yl]benzamide;

N-[Amino(morpholin-4-yl)methylidene]-4-[(3aS,9bR)-8-ethoxy-7 -methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4- c]isoquinolin-5-yl]benzamide;

N-[Amino(4-methoxypiperidin-1-yl)methylidene]-4-[(3aS,9bR)-8 -ethoxy-7-methoxy-1 ,3,3a,9b- tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide;

N-[(Dimethylamino)(morpholin-4-yl)methylidene]-4-[(3aS,9bR)- 8-ethoxy-7-methoxy-1 ,3,3a,9b- tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide;

N-[(Dimethylamino)(4-methoxypiperidin-1-yl)methylidene]-4 -[(3aS,9bR)-8-ethoxy-7-methoxy-1 ,3,3a,9b- tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide;

N-[(Dimethylamino)(4-methylpiperazin-1-yl)methylidene]-4-[(3 aS,9bR)-8-ethoxy-7-methoxy-1 ,3,3a,9b- tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide;

N-[Amino(dimethylamino)methylidene]-4-[(3aS,9bR)-8-ethoxy-7- methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4- c]isoquinolin-5-yl]benzamide;

N-[Bis(dimethylamino)methylidene]-4-[(3aS,9bR)-8-ethoxy-7-me thoxy-1 ,3,3a,9b-tetrahydrofuro[3,4- c]isoquinolin-5-yl]benzamide

or a salt of one of these compounds. In a further preferred embodiment, the invention relates to a compound of formula 1 or a salt thereof, wherein R1 is methoxy, R2 is methoxy, and R3, R4, R5, R6 and R7 are as defined above.

In a further preferred embodiment, the invention relates to a compound of formula 1 or a salt thereof, wherein R1 is methoxy, R2 is ethoxy, and R3, R4, R5, R6 and R7 are as defined above.

In a further preferred embodiment, the invention relates to a compound of formula 1 or a salt thereof, wherein R1 is ethoxy, R2 is ethoxy, and R3, R4, R5, R6 and R7 are as defined above.

It is to be understood that the invention covers all combinations of substituent groups referred to here- inabove. In particular, the invention covers all combinations of preferred groups described herein.

Salts of the compounds of formula 1 include all inorganic and organic acid addition salts, especially all pharmaceutically acceptable inorganic and organic acid addition salts, particularly all pharmaceutically acceptable inorganic and organic acid addition salts customarily used in pharmacy.

Examples of acid addition salts include, but are not limited to, hydrochlorides, hydrobromides, phosphates, nitrates, sulfates, acetates, trifluoroacetates, citrates, D-gluconates, benzoates, 2-(4- hydroxybenzoyl)benzoates, butyrates, subsalicylates, maleates, laurates, malates, lactates, fumarates, succinates, oxalates, tartarates, stearates, benzenesulfonates (besilates), toluenesulfonates (tosilates), methanesulfonates (mesilates), laurylsulfonates, 3-hydroxy-2- naphthoates, lactobionates, galactarates, pyroglutamates, embonates and ascorbates.

The salts include water-insoluble and, particularly, water-soluble salts.

The compounds and the salts according to the invention may contain, e.g. when isolated in crystalline form, varying amounts of solvents. Included within the scope of the invention are, therefore, all solvates of the compounds and the salts according to the invention. Hydrates are a preferred example of said solvates.

The compounds according to the invention are chiral compounds having chiral centers in positions 3a and 9b. The configuration of the compounds of the invention - according to the rules of Cahn, Ingold and Prelog - is S in the position 3a and R in the position 9b.

Numbering

Some of the compounds of formula 1 or salts thereof may exist in different crystalline forms

(polymorphs); the pure polymorphs as well as any mixture of these polymorphs are within the scope of the invention.

The compounds of formula 1 can be prepared, for example, as shown in the reaction schemes below and according to the following specified reaction steps, or, particularly, in a manner as described in the following examples.

Reaction Scheme 1 :

In a first reaction step, compounds of formula 7, in which R1 and R2 have the meanings given above, are reacted with compounds of formula 6, in which C(0)OR stands for a suitable alkyl ester group, preferably a methyl ester group and X represents a suitable leaving group, preferably a chlorine atom, to yield the compounds of formula 5. The benzoylation is carried out, for example, according to the Einhorn process, the Schotten-Baumann variant or as described in J. Chem. Soc. C, 1971 , 1805-1808. Alternatively, compounds of formula 5 can also be prepared from the corresponding compounds of formula 7 and the corresponding compounds of formula 6, in which X is hydroxyl, by the use of amide bond linking reagents known to the person skilled in the art. Exemplary amide bond linking reagents which may be mentioned here by way of example are the carbodiimides (e.g. dicyclohexylcarbodiimide or preferably, 1-ethyl-3-(3-dimethylaminopropylcarbodiimide hydrochloride), azodicarboxylic acid deriv- atives (e.g. diethyl azodicarboxylate), uranium salts [e.g. 0-(benzotriazol-1-yl)-N,N,N',N'-tetramethyl- uronium tetrafluoroborate or 0-(benzotriazol-1yl)-N,N,N',N'-tetramthyl-uronium-hexafluoro phosphate] and N,N'-carbonyldiimidazole.

The compounds of formula 4 are obtained by cyclocondensation of the compounds of formula 5. The cyclocondensation is carried out in a manner known per se to the person skilled in the art, according to Bischler-Napieralski (e.g. as described in J. Chem. Soc, 1956, 4280-4282) in the presence of a suitable condensing agent, such as, for example, polyphosphoric acid, phosphorus oxychloride, phosphorus pentoxide or preferably phosphorus pentachloride, in a suitable inert solvent, e.g. in a chlorinated hydrocarbon such as dichloromethan, or in a cyclic hydrocarbon such as toluene or xylene, or another inert solvent such as acetonitrile, or without further solvent using an excess of condensing agent, preferably at elevated temperature, in particular at the boiling temperature of the solvent or condensing agent used.

In the next reaction step the compounds of formula 4 are saponified to give the benzoic acid derivatives of formula 3, which then can be activated prior to the reaction with compounds of formula R3-H for example by forming an acid halide or acid anhydride. Compounds of formula 1 finally then can be obtained from the activated compounds of formula 2 by reaction with compounds of formula R3-H, in which R3 has the meanings given above. Alternatively, compounds of formula 4 can be transferred to compounds of formula 1 by using a) coupling agents known to the person skilled in the art, such as, for example, Ν,Ν'-dicyclohexylcarbodiimide, N'-(3-dimethylaminopropyl)-N-ethylcarbodiimide, or preferably 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and b) the compounds of formula R3-H, in which R3 has the meanings given above.

In a further alternative, compounds of formula 4 may also be directly reacted with compounds of formula R3-H, in which R3-H has the meanings given above, in the presence of sodium ethoxide to yield the compounds of formula 1 . Similar reactions are described, for example in Biorganic & Medicinal Chemistry Letters 1 1 (24), 2001 , pp. 3151 -3155.

As shown in reaction scheme 2, it is also possible to obtain compounds of formula 1 from compounds of formula 3 or from compounds of formula 2 by initially reacting the compounds of formula 3 under suitable coupling conditions (using appropriate coupling agents and additives) or, respectively, compounds of formula 2, in which Y is a suitable leaving group, for example a chlorine atom, with suitably substituted S-alkyl-isothioureas and then, in a second step, replacing the S-alkyl group by a suitably substituted amine.

Reaction scheme 2:

Similar reactions are described, for example in Arzneimittel-Forschung 25, No. 10, 1975, pp. 1477- 1482.

A further alternative synthesis route to compounds of formula 1 is described in reaction scheme 3

Starting with a suitably substituted phthalic acid, isophthalic acid or terephthalic acid monoester derivative (compounds of formula 12), the acid group is initially activated, for example by forming acid halide (compound of formula 6). The acid halide (compounds of formula 6) is then reacted with compounds of formula R3-H, in which R3 has the meanings as given above to yield the compounds of formula 1 1. The ester group of the compounds of formula 1 1 is hydrolyzed and the resulting acids (compounds of formula 10) are reacted with compounds of formula 7, in which R1 and R2 have the meanings as given above, preferably by using coupling agents known to the person skilled in the art, such as, for example, Ν,Ν'-dicyclohexylcarbodiimide, N'-(3-dimethylaminopropyl)-N-ethylcarbodiimide or preferably 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) to yield the compounds of formula 2. In an alternative reaction sequence the acids of formula 10 are first activated for example by conversion into an acid halide (Z for example CI; compounds of formula 9) and then reacted with compounds of formula 7, in which R1 and R2 have the meanings as given above, to yield the compounds of formula 2. The benzoylation step is carried out, for example, by the Einhorn process, the Schotten-Baumann variant or as described in J. Chem. Soc. (C), 1971 , 1805-1808.

The final cyclocondensation of the compounds of formula 2 obtained by the benzoylation affords the compounds of formula 1.

The compounds of formula 1 prepared by the processes described above can then, if desired, be con- verted into their salts, or salts of the compounds of formula 1 obtained can then, if desired, be converted into the free compounds. Corresponding processes are known to the person skilled in the art.

Suitably substituted phthalic acid, isophthalic acid or terephthalic acid monoester derivatives (compounds of formula 6 or 12) are either known or can be prepared by methods known to the person skilled in the art. Exemplary compounds of formula 6 which may be mentioned are methyl 4-chlorocar- bonylbenzoate (preparation described in J. Amer. Chem. Soc. 79, 1957, 96 or in Bioorg. Med. Chem. Lett. 1999, 227-232) and methyl 3-chlorocarbonylbenzoate (preparation described in J. Med. Chem. 1999, 2621-2632). The preparation of pure enantiomeres of compounds of formula 7, in which R1 and R2 have the meanings as given above is shown in reaction scheme 4.

The preparation of the (3S,4R) configurated compounds of formula 7, in which R1 and R2 have the meanings as given above, starts for example from 4-bromo-1 ,2-dialkoxybenzene compounds of for- mula 16, in which R1 and R2 have the meanings as given above. In a first reaction step the corresponding intermediate Grignard compound is prepared which subsequently is reacted in the presence of Cul with 3,4-epoxytetrahydrofuran to yield the trans-tetrahydro-3-furanol compounds of formula 15. The compounds of formula 15 are then oxidized, by using a suitable oxidizing agent, such as for example, 2,2,6,6-tetramethylpiperidinyloxyl (TEMPO) or preferably 1 -hydroxy- 1 ,2-benziodoxol-3(1 H)- one-1-oxide (IBX) to yield the ketone compounds of formula 14. To introduce the (3S,4R) configuration into the tetrahydrofurane ring the compounds of formula 14 are then reacted with (R)-(+)-1-phenylethylamine and the resulting imine compounds (enamine/imine tau- tomerism) are reduced by a suitable reduction agent, such as for example, Raney-Nickel or preferably sodium triacetoxyborohydride to yield the (3R,4S) configurated compounds of formula 13. In the final reaction step the phenylethyl group is cleaved by catalytic hydrogen using palladium on carbon as catalyst and acetic acid as solvent to provide the enantiomerically pure compounds of formula 7.

Reaction scheme 4:

It is known to the person skilled in the art that, if there are a number of reactive centers on a starting intermediate compound, it may be necessary to block one or more reactive centers temporarily by protective groups in order to allow a reaction to proceed specifically at the desired reaction center. A detailed description for the use of a large number of proven protective groups is found, for example, in T. W. Greene, Protective Groups in Organic Synthesis, John Wiley & Sons, 1999, 3rd Ed., or in P. Kocienski, Protecting Groups, Thieme Medical Publishers, 2000.

The compounds according to the invention are isolated and purified in a manner known per se, e.g. by distilling off the solvent in vacuo and recrystallizing the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as column chromatography on a suitable support material.

Salts of the compounds of formula 1 can be obtained by dissolving the free compound in a suitable solvent (for example a ketone such as acetone, methylethylketone or methylisobutylketone, an ether such as diethyl ether, tetrahydrofurane or dioxane, a chlorinated hydrocarbon such as methylene chloride or chloroform, a low molecular weight aliphatic alcohol such as methanol, ethanol or isopropanol, a low molecular weight aliphatic ester such as ethyl acetate or isopropyl acetate, or water) which contains the desired acid, or to which the desired acid is then added. The acid can be employed in salt preparation, depending on whether a mono- or polybasic acid is concerned and depending on which salt is desired, in an equimolar quantitative ratio or one differing therefrom. The salts are obtained by filtering, reprecipitating, precipitating with a non-solvent for the salt or by evaporating the solvent. Salts obtained can be converted into the free compounds which, in turn, can be converted into salts. In this manner, pharmaceutically unacceptable salts, which can be obtained, for example, as process products in the manufacturing on an industrial scale, can be converted into pharmaceutically acceptable salts by processes known to the person skilled in the art. As will be appreciated by persons skilled in the art, the invention is not limited to the particular embodiments described herein, but covers all modifications that are within the spirit and scope of the invention as defined by the appended claims.

All patents, patent applications, publications, test methods and other materials cited herein are incorpo- rated by reference in their entireties.

The following examples illustrate the invention in greater detail, without restricting it. Further compounds according to the invention, of which the preparation is not explicitly described, can be prepared in an analogous way.

The compounds, which are mentioned in the examples and the salts thereof represent preferred embodiments of the invention. Examples

The following abbreviations are used: min: minute(s), h: hour(s), DCM: dichloromethane, EA: ethyl acetate, TEA: triethyl amine, DIPEA: diisopropyl ethyl amine, PE: petrol ether (60/80), HOBt: 1- hydroxy-benzotriazole, EDC x HCI: 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride, IBX: 1-hydroxy-1 ,2-benziodoxol-3-(1 /-/)-one 1-oxide, STAB: sodium triacetoxyborohydride, MeOH: methanol, RT: room temperature (20 to 25°C), MS: mass spectrometry, HRMS: high resolution mass spectrometry, calc: calculated, fnd: found and TLC: thin layer chromatography. Final Products

General Procedure 1 (GP1 ) for Examples 1 to 6:

4-[(3aS,9bR)-8-Ethoxy-7-methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoic acid (1 eq, compound B), HOBt x H ₂ 0 (1.2 eq), EDC x HCI (2.2 eq) and N-ethyl-diisopropyl amine (3-4 eq) are dissolved in DCM (20 ml/mmol). After 30 min the appropriate guanidine (compounds M1 -M6, 1.1-1.2 eq) is added and the reaction mixture is stirred for 12-15 h at RT. The reaction mixture is washed with water and the organic layer is dried with sodium sulfate. The solvent is removed under reduced pressure and the residue is purified as described in the specific examples.

1. N-[Amino(piperidin-1 -yl)methylidene]-4-[(3aS,9bR)-8-ethoxy-7-methoxy-1,3,3a,9b- tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide

The title compound was prepared analogously as described for GP1 using 4-[(3aS,9bR)-8-ethoxy-7- methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoic acid (0.5 g, compound B) and piperi- dine-1-carboximidamide hydrobromide (0.3 g, compound M1 ) as starting compounds. The crude product was crystallized from EA/PE/MeOH/TEA: 19/5/1/1 (v/v/v/v). H-NMR (300MHz, DMSO-d ₆ +CD ₃ OD) δ ppm: 1.36 (t, J = 7.0 Hz, 3H), 1.55-1.63 (m, 6H), 3.30-3.42 (m, 6H), 3.59 (s, 3H), 3.66 (brs, 2H), 4.08-4.19 (m, 4H), 4.29-4.41 (m, 2H), 6.75 (s, 1 H), 7.04 (s, 1 H), 7.53 (d, J = 8.2 Hz, 2H), 8.15 (d, J =8.4 Hz, 2H).

2. N-[Amino(morpholin-4-yl)methylidene]-4-[(3aS,9bR)-8-ethoxy-7 -methoxy-1,3,3a,9b- tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide

The title compound was prepared analogously as described for GP1 using 4-[(3aS,9bR)-8-ethoxy-7- methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoic acid (0.5 g, compound B) and 4- morpholinecarboximidamide hydrobromide (0.3 g, compound M2) as starting compounds. The crude product was purified by column chromatography [silica gel; 70-230 mesh; EA/PE/MeOH/TEA: 4/5/1/1 (v/v/v/v)] and crystallized from EA/PE: 1/1 (v/v). H-NMR (300MHz, DMSO-d ₆ ) δ ppm: 1.35 (t, J = 7.0 Hz, 3H), 3.29-3.39 (m, 2H), 3.58 (s, 3H), 3.67 (brs, 8H), 4.06-4.20 (m, 4H), 4.27-4.35 (m, 1 H), 4.35-4.43 (m, 1 H), 6.73 (s, 1 H), 7.06 (s, 1 H), 7.53 (d, J = 8.3 Hz, 2H), 8.12-8.19 (m, 2H).

3. N-[Amino(4-methoxypiperidin-1 -yl)methylidene]-4-[(3aS,9bR)-8-ethoxy-7-methoxy- 1,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide

The title compound was prepared analogously as described for GP1 using 4-[(3aS,9bR)-8-ethoxy-7- methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoic acid (415 mg, compound B), and 4- methoxypiperidine-1-carboximidamide hydrochloride (241 mg, compound M3) as starting compounds. The crude product was purified by column chromatography [silica gel; 70-230 mesh;

EA/PE/MeOH TEA: 4/4/1/1 (v/v/v/v)] and lyophilized from acetonitrile/water. H-NMR (400MHz, DMSO-d ₆ + CD ₃ OD) δ ppm: 1.36 (t, J = 7.0 Hz, 3H), 1.46-1.49 (m, 2H), 1.88-1.99 (m, 2H), 3.29-3.46 (m, 10H), 3.59 (s, 3H), 4.10-4.18 (m, 4H), 4.30-4.33 (m, 1 H), 4.39-4.42 (m, 1 H), 6.75 (s, 1 H), 7.04 (s, 1 H), 7.52 (d, J = 8.2 Hz, 2H), 8.15 (d, J =8.3 Hz, 2H).

4. N-[(Dimethylamino)(morpholin-4-yl)methylidene]-4-[(3aS,9bR)- 8-ethoxy-7-methoxy- 1,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide

The title compound was prepared analogously as described for GP1 using 4-[(3aS,9bR)-8-ethoxy-7- methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoic acid (0.5 g, compound B) and N,N- dimethylmorpholine-4-carboximidamide hydrochloride (0.31 g, compound M4) as starting compounds. The crude product was crystallized from EA. H-NMR (300MHz, DMSO-d ₆ + CD ₃ OD) δ ppm: 1.36 (t, J = 7.0 Hz, 3H), 2.90 (s, 6H), 3.23-3.26 (m, 4H), 3.30-3.37 (m, 2H), 3.60 (s, 3H), 3.64-3.67 (m, 4H), 4.08-4.17 (m, 4H), 4.29-4.41 (m, 2H), 6.78 (s, 1 H), 7.05 (s, 1 H), 7.55 (d, J = 8.3 Hz, 2H), 8.09 (d, J =8.3 Hz, 2H).

5. N-[(Dimethylamino)(4-methoxypiperidin-1 -yl)methylidene]-4-[(3aS,9bR)-8-ethoxy-7- methoxy-1,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benz amide

The title compound was prepared analogously as described for GP1 using 4-[(3aS,9bR)-8-ethoxy-7- methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoic acid (0.5 g, compound B) and 4- methoxy-N,N-dimethylpiperidine-1-carboximidamide hydrochloride (0.36 g, compound M5) as starting compounds. The crude product was purified by column chromatography [silica gel; 70-230 mesh; DCM/MeOH: 9/1 , (v/v); R _f = 0.43] and lyophilized from dioxane/water. H-NMR (300MHz, DMSO-d ₆ ) δ ppm: 1.35 (t, J = 7.0 Hz, 3H), 1.50-1.53 (m, 2H), 1.86-1.97 (m, 2H), 2.88 (s, 6H), 2.99-3.06 (m, 2H), 3.27-3.40 (m, 8H), 3.60 (s, 3H), 4.08-4.16 (m, 4H), 4.28-4.30 (m, 1 H), 4.31-4.39 (m, 1 H), 6.78 (s, 1 H), 7.06 (s, 1 H), 7.54 (d, J = 8.2 Hz, 2H), 8.07 (d, J =8.3 Hz, 2H).

6. N-[(Dimethylamino)(4-methylpiperazin-1 -yl)methylidene]-4-[(3aS,9bR)-8-ethoxy-7- methoxy-1,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benz amide

The title compound was prepared analogously as described for GP1 using 4-[(3aS,9bR)-8-ethoxy-7- methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoic acid (0.5 g, compound B) and N,N,4- trimethylpiperazine-1-carboximidamide hydrochloride (0.33 g, compound M6) as starting compounds. The crude product was purified by column chromatography [silica gel; 70-230 mesh;

EA PE/MeOH/TEA: 5/4/1/1 (v/v/v/v) and DCM/MeOH: 9/1 , (v/v)] and lyophilized from acetonitrile/water. H-NMR (300MHz, DMSO-c/ ₆ +CD ₃ OD) δ ppm: 1.36 (t, J = 7.0 Hz, 3H), 2.22 (s, 3H), 2.39-2.41 (m, 4H),

2.89 (s, 6H), 3.23-3.37 (m, 6H), 3.61 (s, 3H), 4.12-4.18 (m, 4H), 4.29-4.42 (m, 2H), 6.78 (s, 1 H), 7.05 (s, 1 H), 7.54 (d, J = 8.3 Hz, 2H), 8.08 (d, J =8.3 Hz, 2H).

Examples 7 and 8 were synthesized using a different synthesis route as described above for Examples 1 to 6. 7. N-[Amino(dimethylamino)methylidene]-4-[(3aS,9bR)-8-ethoxy-7- methoxy-1,3,3a,9b- tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide

Sodium hydroxide (136 mg) was dissolved in MeOH (15 ml) and 1 , 1 -dimethyl guanidine hemisulfate (compound M7, 463 mg) was added. After stirring at RT for 2 h the solvent was removed under re- duced pressure. The residue was suspended twice in acetonitrile and the solvent was again removed under reduced pressure. Acetonitrile (20 ml) was again added to the residue and the suspension was cooled to 0 °C. A suspension of 4-[(3aS,9bR)-8-ethoxy-7-methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4- c]isoquinolin-5-yl]benzoyl chloride hydrochloride (575 mg, compound A) in acetonitrile (15 ml) was added and the reaction mixture was stirred for 1.5 h at 0 °C and 1 h at RT. The reaction mixture was filtered with suction and the solvent was removed under reduced pressure. The residue was dissolved in DCM and extracted with saturated bicarbonate solution and water. The organic layer was dried with sodium sulfate and the solvent is removed under reduced pressure. The residue was purified by column chromatography [silica gel; 70-230 mesh; EA/PE/MeOH/TEA: 6/3/0.5/0.5 (v/v/v/v)] and crystallized from MeOH. H-NMR (300MHz, DMSO-c/ ₆ ) δ ppm: 1.35 (t, J = 7.0 Hz, 3H), 3.09 (s, 6H), 3.30-3.41 (m, 2H), 3.58 (s, 3H), 4.08-4.17 (m, 4H), 4.28-4.42 (m, 2H), 6.75 (s, 1 H), 7.05 (s, 1 H), 7.53 (d, J = 8.3 Hz, 2H), 8.17 (d, J =8.4 Hz, 2H). 8. N-[Bis(dimethylamino)methylidene]-4-[(3aS,9bR)-8-ethoxy-7-me thoxy-1,3,3a,9b- tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzamide

Phosphorous pentachloride (500 mg) was dissolved in 30 ml DCM at RT. After addition of N- [bis(dimethylamino)methylidene]-N'-[(3S,4R)-4-(3-ethoxy-4-me thoxyphenyl)tetrahydrofuran-3- yl]benzene-1 ,4-dicarboxamide (compound J, 500 mg) the reaction mixture was stirred for 2 h at RT and subsequently added into 5 N sodium hydroxide solution (15 ml). The organic layer was separated and dried with sodium sulfate. The solvent was evaporated under reduced pressure and the residue was purified by column chromatography [silica gel; 70-230 mesh; EA/PE/MeOH/TEA: 6/2/1/1 (v/v/v/v)]. H-NMR (300MHz, DMSO-c/ ₆ +CD ₃ OD) δ ppm: 1.36 (t, J = 6.9 Hz, 3H), 2.87 (s, 12H), 3.29-3.41 (m, 2H), 3.60 (s, 3H), 4.10-4.18 (m, 4H), 4.28-4.41 (m, 2H), 6.78 (s, 1 H), 7.05 (s, 1 H), 7.54 (d, J = 8.3 Hz, 2H), 8.09 (d, J =8.3 Hz, 2H). Starting materials and Intermediates

A. 4-[(3aS,9bR)-8-Ethoxy-7-methoxy-1,3,3a,9b-tetrahydrofuro[3,4 -c]isoquinolin-5-yl]benzoyl chloride hydrochloride 4-[(3aS,9bR)-8-Ethoxy-7-methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoic acid (3.0 g, compound B) and thionyl chloride (2.5 ml) were dissolved in acetonitrile (80 ml) and refluxed for 3.5 h. The reaction mixture was cooled to RT and the solvent wass removed under reduced pressure. The residue was suspended in acetonitrile and the solvent was again removed under reduced pressure to afford 4-[(3aS,9bR)-8-Ethoxy-7-methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoyl chlo- ride hydrochloride (compound A) which was used for subsequent reactions without further purification.

B. 4-[(3aS,9bR)-8-Ethoxy-7-methoxy-1,3,3a,9b-tetrahydrofuro[3,4 -c]isoquinolin-5-yl]benzoic acid Methyl 4-[(3aS,9bR)-8-ethoxy-7-methoxy-1 ,3,3a,9b-tetrahydrofuro[3,4-c]isoquinolin-5-yl]benzoate (4.0 g, compound C) was dissolved in ethanol. 2M sodium hydroxide solution (6.0 ml) was added and the reaction mixture was stirred at 50 °C for 2 h. The mixture was diluted with water (20 ml) and the ethanol was removed under reduced pressure. The aqueous phase was adjusted to pH 6-7 with 2N hydrochloric acid solution and extracted with ethyl acetate. The organic layer was dried with sodium sulfate and the solvent was removed under reduced pressure to yield the title compound as light yellow crystals. C. Methyl 4-[(3aS,9bR)-8-ethoxy-7-methoxy-1,3,3a,9b-tetrahydrofuro[3,4 -c]isoquinolin-5- yl]benzoate

Phosphorus pentachloride (12.5 g) was dissolved in DCM (250 ml). Methyl 4-{[(3S,4R)-4-(3-ethoxy-4- methoxyphenyl)tetrahydrofuran-3-yl]carbamoyl}benzoate (16.2 g, compound D) was added in portions and the reaction mixture was stirred for 3 h at RT. Water (50 ml) was added with cooling and the mixture was adjusted to pH 7-8 with 10M sodium hydroxide solution. The organic layer was separated, washed with saturated sodium bicarbonate solution and water and dried with sodium sulfate. The solvent was removed under reduced pressure to yield the title compound which was used for subsequent reactions without further purification.

D. Methyl 4-{[(3S,4R)-4-(3-ethoxy-4-methoxyphenyl)tetrahydrofuran-3- yl]carbamoyl}benzoate (3S,4R)-4-(3-Ethoxy-4-methoxyphenyl)tetrahydrofuran-3-amine (12.0 g, compound E) was dissolved in DCM (250 ml) and N-ethyl-diisopropyl-amine (20 ml). Methyl-4-chlorcarbonylbenzoat (10.0 g) was added in portions and the reaction mixture was stirred for 12-15 h at RT. The reaction mixture was extracted with water and the organic layer was dried with sodium sulfate. The solvent was removed under reduced pressure and the residue was washed with ethyl acetate to yield the title compound as white crystalline solid.

E. (3S,4R)-4-(3-Ethoxy-4-methoxyphenyl)tetrahydrofuran-3-amine

(3S,4R)-4-(3-Ethoxy-4-methoxyphenyl)-N-[(1 R)-1-phenylethyl]tetrahydrofuran-3-amine (21.0 g, com- pound F) was dissolved in acetic acid (250 ml). Palladium on carbon (5 %, 2.0 g) was added and the reaction mixture was hydrogenated for 2 h at 50 °C (100 mbar H ₂ ) and for 12-15 h at RT. The reaction mixture was filtered, the solvent was evaporated under reduced pressure and the residue was dissolved in ethyl acetate (250 ml) and extracted with diluted sodium hydroxide solution (pH 8-9). The organic layer was washed with water, dried with sodium sulfate and the solvent was removed under reduced pressure to yield the title compound as pale yellow oil.

F. (3S,4R)-4-(3-Ethoxy-4-methoxyphenyl)-N-[(1 R)-1 -phenylethyl]tetrahydrofuran-3-amine

3-(3-Ethoxy-4-methoxyphenyl)-tetrahydrofuran-4-one (26.0 g, compound G), (R)-(+)-1- phenylethylamine (16.5 ml) and acetic acid (20 ml) were dissolved in tetrahydrofuran (400 ml) and stirred for 2 h at RT. Sodium triacetoxyborohydride (54.0 g, STAB) was added in portions and the reaction mixture was stirred for 12-15 h at RT. The solvent was removed under reduced pressure and the residue was dissolved in ethyl acetate (300 ml) and extracted with citric acid solution (20%, 3 x 300 ml). The combined aqueous solutions were adjusted to pH 7 with 10 M sodium hydroxide solution and extracted with ethyl acetate (2 x 200 ml). The combined organic layers were dried with sodium sulfate and the solvent was removed under reduced pressure. The residue was purified by column chromatography [silica gel; 70-230 mesh; EA PE/TEA: 1/8/1 (v/v/v)] to afford the title compound as pale yellow oil.

G. 3-(3-Ethoxy-4-methoxyphenyl)-tetrahydrofuran-4-one irans-4-(3-Ethoxy-4-methoxyphenyl)tetrahydro-3-furanol (38.0 g, compound H) was dissolved in ethyl acetate and 1-hydroxy-1 ,2-benziodoxol-3(1 H)-one-1-oxide (IBX, 170.0 g) was added. The reaction mixture was refluxed for 5 h and stirred for 12-15 h at RT. The reaction mixture was filtered with suction, the solvent was evaporated under reduced pressure and the residue was purified by column chromatography [silica gel; 70-230 mesh; EA/PE: 3/7 (v/v)] to afford the title compound as light yellow oil.

H. trans-4-(3-Ethoxy-4-methoxyphenyl)tetrahydro-3-furanol trans-4-(3-Ethoxy-4-methoxyphenyl)tetrahydro-3-furanol can be synthesized according to

WO2007/090840 or as described below.

Step 1 : Activation of Mg turnings (optional)

Magnesium turnings (10 g) were stirred in 20 ml 1 N HCI for 30 seconds. HCI was decanted and the process was repeated twice. Then the stirring/decanting process was repeated with 3 x 40 ml water, 3 x 20 ml ethanol and 3 x 20 ml tetrahydrofuran for 2 min each. Finally the magnesium turnings were dried at 50°C under reduced pressure and stored under an argon atmosphere.

Step 2: Preparation of the Grignard compound

The reaction was performed under a nitrogen atmosphere. Freshly activated magnesium turnings (3.0 g) were suspended in 250 ml dry tetrahydrofuran. Iodine (20 mg) was added and the reaction mixture was heated to reflux. 4-Bromo-2-ethoxy-1-methoxybenzene (compound I, 28.0 g) was dissolved in 60 ml dry tetrahydrofuran. About 20 ml of this solution were added within 15 min under reflux. After start of the Grignard reaction (about 45 min reflux) the remaining solution was added within 45 min. The reac- tion mixture was refluxed until nearly no magnesium was left over.

Step 3: Grignard reaction

The reaction was performed under a nitrogen atmosphere. The in step 2 prepared Grignard solution was cooled to RT, Cul (1 .0 g) was added and the reaction mixture was stirred for 15 min and subse- quently cooled with an ice bath. A solution of 3,4-epoxytetrahydrofuran (12.0 g) in 30 ml dry tetrahydrofuran was added within 30 min. The reaction mixture was stirred for additional 30 min in the ice bath and for 1 h at RT. Cold water (250 ml) was added, the solution was stirred for 15 min and the organic solvent was removed under reduced pressure. Ethyl acetate (300 ml) and 2N hydrochloric acid solution (60 ml) were added with stirring to the aqueous phase. After separation of the organic layer, the aque- ous solution was extracted again with 2 x 200 ml ethyl acetate. The organic layers were combined, washed with 100 ml water, dried with sodium sulfate and the solvent was removed under reduced pressure. The residue was purified by column chromatography [silica gel; 70-230 mesh; EA PE: 6/4 (v/v), R _f = 0.43] to yield trans-4-(3-ethoxy-4-methoxyphenyl)tetrahydro-3-furanol (title compound; compound H) as light yellow oil.

I. 4-Bromo-2-ethoxy-1 -methoxybenzene

The title compound is commercially available [CAS52849-52-2]. J. N-[Bis(dimethylamino)methylidene]-N'-[(3S,4R)-4-(3-ethoxy-4- methoxyphenyl)tetrahydrofuran-3-yl]benzene-1,4-dicarboxamide

(3S, 4R)-4-(3-ethoxy-4-methoxyphenyl)tetrahydrofuran-3-amine (1.0 g, compound F) was dissolved in DCM (25 ml). 4-{[Bis(dimethylamino)methylidene]carbamoyl}benzoic acid (1.3 g, compound K), EDC x HCI (1.8 g) and HOBt (770 mg) was added. The reaction mixture was stirred for 12-15 h at RT. The organic layer was washed with water and dried with sodium sulfate. The solvent was evaporated under reduced pressure and the residue was purified by column chromatography [silica gel; 70-230 mesh; EA PE/MeOH: 6/2/1 (v/v/v); R _f = 0.36] to yield the title compound as white crystalline solid. K. 4-{[Bis(dimethylamino)methylidene]carbamoyl}benzoic acid

Methyl 4-{[bis(dimethylamino)methylidene]carbamoyl}benzoate (5.5 g, compound L) was suspended in water (40 ml). Concentrated hydrochloric acid solution (5 ml) was added and the reaction mixture was stirred at 90 °C for 12-15 h. The solvent was evaporated under reduced pressure. The residue was washed with acetone, filtered with suction and dried.

L. Methyl 4-{[bis(dimethylamino)methylidene]carbamoyl}benzoate)

Methyl-4-chlorcarbonylbenzoat (6.27 g) was added in portions to a suspension of potassium carbonate (6.9 g) and 1 , 1-3,3-tertramethylguanidine (3.8 ml, compound M8) in DCM (200 ml) at RT. After 1 h the organic layer was washed with water and dried with sodium sulfate. The solvent was evaporated under reduced pressure and the residue was purified by column chromatography [silica gel; 70-230 mesh; EA PE/TEA: 6/3/1 (v/v/v)] Preparation of guanidines M1 - M8

M1. Piperidine-1 -carboximidamide hydrobromide

The title compound is commercially available [CAS332367-56-3]. M2. 4-Morpholinecarboximidamide hydrobromide

The title compound is commercially available [CAS157415-17-3]. M3. 4-Methoxypiperidin-1 -carboximidamide

The title compound is commercially available [CAS 1096329-72-4]. General procedure 2 (GP2) for the synthesis of guanidine compounds M4 and M5 Reaction Scheme for General Procedure 2

R' R'^ \ ^ ^CN Step 1 ^NT Step 2 ^N'

'N H + ^N H x HCI + N x HCI

N M

General procedure 2, step-1

To a 100 ml three necked round-bottomed flask under a nitrogen atmosphere equipped with reflux condenser is added amine P (1.0 eq), the amine hydrochloride O (1.0 eq) and dimethylcyanamide (1.0 eq); the mixture is heated at 100 °C for 12 h. The reaction is monitored with TLC/LC-MS. After completion of the reaction, the reaction mixture is cooled to RT and a solution of 35% aqueous sodium hydroxide solution is added under vigorous stirring. The solution is then extracted with DCM. The combined organic layers are dried with sodium sulfate, filtered and evaporated under reduced pressure. The residue is purified by high vacuum distillation (0.01 torr) to separate the unreacted dimethylcyanamide. The residue is further purified by flash column chromatography to afford compounds of formula N.

General procedure 2, step-2

To a solution of compound N (1.0 eq) in dioxane (10V) at 0 °C is slowly added 4M HCI in dioxane (1.0 eq). The reaction mixture is allowed to attain RT and stirred at this temperature for further 2-3 h. The solvent is evaporated under reduced pressure to afford compounds of formula M.

["10V" means 10 ml/mmol, i.e. for every mmol of compound N 10 ml of dioxane should be used].

N,N-Dimethyl-morpholine-4-carboxamidine hydrochloride

Starting with N,N-dimethyl-morpholine-4-carboxamidine (4.3 g, compound N4) and following the general procedure 2 step-2, the title compound was obtained as colourless solid. M5. 4-Methoxy-N,N-dimethyl-piperidine-1 -carboxamidine hydrochloride

Starting with 4-methoxy-N,N-dimethyl-piperidine-1-carboxamidine (5.0 g, compound N5) and following the general procedure 2, step-2 the title compound was obtained as gummy brown semi solid.

General procedure 3 (GP3) for the synthesis of guanidine compound M6

Reaction Scheme for General procedure 3

General procedure 3, step 1

To a solution of amine P (1.0 eq) in water (10V; "10V" means 10 ml/mmol, i.e. for every mmol of amine P 10 ml of water should be used ) is added 3.25 N aqueous sodium hydroxide solution (1.1 eq) at 0 °C. To this mixture cyanogen bromide (1.1 eq) is added in portions at the same temperature with vigorous stirring. The reaction mixture is then stirred at RT for 12-18 h. The reaction is monitored with TLC/LC- MS. After completion of the reaction DCM is added and the reaction mixture is extracted. The combined organic layers are washed with water and saturated sodium chloride solution, dried over sodium sulfate, filtered and evaporated under reduced pressure. The crude reaction product of formula R is used without further purification in the next reaction step. General procedure 3, step 2

In a sealed tube, nitrile R (1.0 eq) and dimethylamine hydrochloride (2.5 eq) are mixed and heated to 100 °C for 12-14 h. The reaction is monitored with TLC/LC-MS. Upon completion of the reaction, the crude mixture is dissolved in a mixture of water (10V) and 1 ,4-dioxane (5V). To this mixture sodium hydroxide (3.0 eq) in water is added slowly at 0 °C followed by di-ieri-butyldicarbonate (2.5 eq) at the same temperature. The reaction mixture is slowly allowed to attain RT and is further stirred for 12 h. After completion, the mixture is extracted with DCM. The combined organic layer is washed with water and saturated sodium chloride solution, dried over sodium sulfate, filtered and evaporated under reduced pressure. The crude product is purified by flash column chromatography to afford compounds of formula Q. General procedure 3, step 3

To a solution of compound Q (1.0 g) in dioxane (10V) at 0 °C is slowly added 4M HCI in dioxane (30 V). The reaction mixture is allowed to attain RT and further stirred for 14 h. The reaction is monitored with TLC. Upon completion of the reaction, the reaction mixture is evaporated under reduced pressure. The residue is washed with DCM to afford the compounds of formula M in form of its hydrochloride salt.

M6. N,N,4-Trimethyl-piperazine-1 -carboximidamide hydrochloride

The title compound was obtained as pale yellow solid by following the general procedure 3, step-3 using [1-dimethylamino-1-(4-methyl-piperazin-1-yl)-methylidene]-ca rbamic acid ieri-butyl ester (8.5 g, compound Q6) as starting compound.

M7. 1,1 -Dimethylguanidine hemisulfate The title compound is commercially available [CAS 1 186-46-5]. M8. 1,1,3,3-Tetramethylguanidine

The title compound is commercially available [CAS80-70-6].

N4. N,N-Dimethyl-morpholine-carboxamidine

Ν,Ν-Dimethyl-morpholine-carboxamidine was synthesized by following the general procedure 2, step- 1 using morpholine (4.35 g), morpholine hydrochloride (6.15 g) and dimethylcyanamide (3.5 g). The title compound was distilled out under high vacuum and used in the next reaction step without further purification.

N5. 4-Methoxy-N,N-dimethyl-piperidine-1 -carboxamidine 4-Methoxy-N,N-dimethyl-piperidine-1-carboxamidine was synthesized by following the general procedure 2, step-1 using 4-methoxy-piperidine (4.9 g), 4-methoxy-piperidine hydrochloride (6.5 g) and dimethylcyanamide (3.03 g). Column: Neutral alumina. Eluent 2-5 % MeOH in DCM

Compounds of formula O and P are commercially available.

Q6. [1 -Dimethylamino-1 -(4-methyl-piperazin-1 -yl)-methylidene]-carbamic acid tert-butyl ester

By following the general procedure 3, step-2 the title compound was obtained using 4-methyl- piperazine-1-carbonitrile (20.0 g; compound R6) as starting compound. Column: Neutral alumina. Elu- ent: 100 % EA R6. 4-Methyl-piperazine-1 -carbonitrile

The title compound was synthesized by following the general procedure 3, step-1 , using 1-methyl- piperazine (30.0 g) and cyanogen bromide (34.65 g) as starting compounds.

Brief description of the Figures

Figure 1 : Effects of Compound 7 on Corneal fluorescein staining score in CEC+S Dry Eye mice model

Figure 2: Effects of Compound 7 on Corneal fluorescein staining score in CEC+S Dry Eye mice model

Figure 3: Effects of Compound 7 on TNFa gene expression in CEC+S Dry Eye mice model

Figure 4: Effects of Compound 7 on VCA-FFAs (upper panel) and OAHFAs (lower panel) of meibomian gland in CEC + S mice model

Figure 5: Effects of Compound 7 on tear secretion in normal C57BL/6 mice

Figure 6: Inhibitory effect of Compound 7 on TGF-β induced mRNA expression of pro-fibrotic markers in WI-38 human lung fibroblast cell line

Commercial Utility

Medical Uses The compounds of formula 1 and the salts of the compounds of formula 1 are hereinafter referred to as the compounds of the invention. In particular, the compounds of the invention are pharmaceutically acceptable.

The compounds of the invention have - as type 4 phosphodiesterase (PDE4) inhibitors - valuable pharmaceutical properties, which make them commercially utilizable.

PDE4 inhibitors are thought to be useful in the treatment or prophylaxis of a variety of diseases and disorders. They are thought to be suitable on the one hand as bronchial therapeutics (for the treatment of airway obstructions on account of their dilating action but also on account of their respiratory rate- or respiratory drive-increasing action) and for the removal of erectile dysfunction on account of their vascular dilating action, but on the other hand especially for the treatment of disorders, in particular of an inflammatory nature, e.g. of the airways, of the skin, of the intestine, of the eyes, of the CNS and of the joints, which are mediated by mediators such as histamine, PAF (platelet-activating factor), arachidonic acid derivatives such as leukotrienes and prostaglandins, cytokines, interleukins, chemokines, alpha-, beta- and gamma-interferon, tumor necrosis factor (TNF) or oxygen free radicals and proteases.

In particular, PDE4 inhibitors are thought to be useful in the treatment or prophylaxis of a variety of diseases and disorders, such as for example:

acute and chronic airway diseases, such as, but not limited to, chronic bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD (chronic obstructive pulmonary disease) and interstitial lung disease such as idiopathic pulmonary fibrosis (IPF) or pulmonary sarcoidosis;

pulmonary hypertension;

diseases which are based on allergic and/or chronic, immunological false reactions in the region of the upper airways (pharynx, nose) and the adjacent regions (paranasal sinuses, eyes), such as, but not limited to, allergic rhinitis/sinusitis, chronic rhinitis/sinusitis, allergic conjunctivitis and also nasal polyps; ocular inflammatory diseases such as, but not limited to, uveitis, scleritis, keratitis, retinal vasculitis, age-related macula degeneration and chronic and allergic conjunctivitis;

dry eye syndrome or keratoconjunctivitis sicca, meibomian gland dysfunction;

dermatological diseases especially of proliferative, inflammatory and allergic type, such as, but not limited to psoriasis (vulgaris), toxic and allergic contact eczema, atopic dermatitis (eczema), seborrhoe- ic eczema, Lichen simplex, sunburn, pruritus in the anogenital area, alopecia areata, hypertrophic scars, discoid lupus erythematosus, follicular and widespread pyodermias, endogenous and exogenous acne, acne rosacea and other proliferative, inflammatory and allergic skin disorders; diseases which are based on an excessive release of TNF and leukotrienes, such as, for example, diseases of the arthritis type like rheumatoid arthritis, rheumatoid spondylitis, osteoarthritis and other arthritic conditions;

fibrotic diseases, such as, but not limited to, cystic fibrosis, pulmonary fibrosis, hepatic fibrosis, renal fibrosis, myelofibrosis, retroperitoneal fibrosis, endomyocardial fibrosis, mediastinal fibrosis, nephrogenic systemic fibrosis, hypertrophic scars or toxic liver damage;

viral, alcoholic or drug-induced acute and fulminant hepatitis, hepatic steatosis (alcoholic and nonalcoholic steato-hepatitis);

diseases of the immune system, such as, but not limited to, AIDS, multiple sclerosis, graft versus host reaction, allograft rejections;

cachexia, cancer cachexia, AIDS cachexia;

types of shock, such as, but not limited to, septic shock, endotoxin shock, gram-negative sepsis, toxic shock syndrome and ARDS (adult respiratory distress syndrome);

diseases in the gastrointestinal region, such as Crohn ^' s disease and ulcerative colitis;

diseases of the heart which can be treated by PDE inhibitors, such as cardiac insufficiency;

diseases which can be treated on account of the tissue-relaxant action of the PDE inhibitors, such as, for example, erectile dysfunction, colics of the kidneys and of the ureters in connection with kidney stones or oncolytic action (to treat preterm delivery); nephritis such as glomerulonephritis, diabetic nephropathy and urinary tract infections;

diabetes insipidus, diabetes mellitus (type 1 and in particular type 2); cancer (in particular lymphoid and myeloid leukaemia); osteoporosis;

conditions associated with cerebral metabolic inhibition, such as, but not limited to, cerebral senility, senile dementia (Alzheimer's disease), memory impairment associated with Parkinson's disease or multiinfarct dementia;

and also diseases of the central nervous system, such as, but not limited to, depressions, anxiety states, spinal cord injury, schizophrenia or arteriosclerotic dementia.

Accordingly, the invention further relates to the compounds of the invention for use in the treatment or prophylaxis of diseases, especially diseases alleviated by inhibition of type 4 phosphodiesterase, in particular the diseases exemplified above.

Preferably, the invention relates to the compounds of the invention for use in the treatment or prophylaxis of one or more of the following diseases:

acute and chronic airway diseases, such as bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD or idiopathic pulmonary fibrosis;

allergic rhinitis; pulmonary hypertension;

dermatological diseases, such as psoriasis and atopic dermatitis (eczema);

rheumatoid arthritis;

diabetes mellitus type 2, diabetic nephropathy or non-alcoholic steato-hepatitis;

inflammations in the gastrointestinal region, such as Crohn ^' s disease and ulcerative colitis; and eye diseases, such as dry eye syndrome or keratoconjunctivitis sicca and meibomian gland dysfunction.

More preferably, the invention relates to the compounds of the invention for use in the treatment or prophylaxis of one or more of the following diseases:

idiopathic pulmonary fibrosis, diabetes mellitus type 2, diabetic nephropathy, non-alcoholic steato- hepatitis, dry eye syndrome and meibomian gland dysfunction.

The invention also relates to the use of a compound of the invention in the manufacture of a pharma- ceutical composition inhibiting the type 4 phosphodiesterase, in particular a pharmaceutical composition for the treatment or prophylaxis of diseases alleviated by inhibition of type 4 phosphodiesterase, preferably, a pharmaceutical composition for the treatment or prophylaxis of the diseases exemplified above. In particular, the invention relates to the use of a compound of the invention in the manufacture of a pharmaceutical composition for the treatment or prophylaxis of an acute or chronic airway disease, such as, but not limited to, bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD or idiopathic pulmonary fibrosis. Furthermore, the invention relates to the use of a compound of the invention in the manufacture of a pharmaceutical composition for the treatment or prophylaxis of dermatological diseases, such as, but not limited to, psoriasis or atopic dermatitis (eczema).

Additionally, the invention relates to the use of a compound of the invention in the manufacture of a pharmaceutical composition for the treatment or prophylaxis of inflammations in the gastrointestinal region, such as, but not limited to, Crohn ^' s disease or ulcerative colitis.

The invention also relates to the use of a compound of the invention in the manufacture of a pharmaceutical composition for the treatment or prophylaxis of diabetes mellitus type 2, diabetic nephropathy or non-alcoholic steato-hepatitis.

The invention furthermore relates to the use of a compound of the invention in the manufacture of a pharmaceutical composition for the treatment or prophylaxis of dry eye syndrome or meibomian gland dysfunction.

In a particularly preferred embodiment of the invention, in the above-mentioned uses the compound of the invention is a compound of the examples or a pharmaceutically acceptable salt thereof according to the invention. The invention further relates to a method of treating or preventing a disease comprising administering to a patient in need thereof a therapeutically effective amount of at least one of the compounds of the invention. In particular, the invention relates to a method of treating or preventing one of the above mentioned diseases comprising administering to a patient in need thereof a therapeutically effective amount of at least one of the compounds of the invention.

Especially, the invention relates to a method of treating or preventing a disease, which is alleviated by inhibition of the type 4 phosphodiesterase comprising administering to a patient in need thereof a therapeutically effective amount of at least one of the compounds of the invention.

Preferably, the invention relates to a method of treating or preventing an acute or chronic airway disease, for example, but not limited to, bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD or idiopathic pulmonary fibrosis comprising administering to a patient in need thereof a therapeutically effective amount of at least one of the compounds of the invention.

Furthermore, the invention preferably relates to a method of treating or preventing dermatological diseases, such as, but not limited to, psoriasis or atopic dermatitis (eczema) comprising administering to a patient in need thereof a therapeutically effective amount of at least one of the compounds of the invention.

Additionally, the invention preferably relates to a method of treating or preventing diseases in the gastrointestinal region, such as, but not limited to, Crohn ^' s disease or ulcerative colitis comprising administering to a patient in need thereof a therapeutically effective amount of at least one of the compounds of the invention.

The invention relates also to a method of treating or preventing diabetes mellitus type 2, diabetic nephropathy or non-alcoholic steato-hepatitis comprising administering to a patient in need thereof a therapeutically effective amount of at least one of the compounds of the invention.

The invention relates as well to a method of treating or preventing dry eye syndrome or meibomian gland dysfunction comprising administering to a patient in need thereof a therapeutically effective amount of at least one of the compounds of the invention.

In the above methods, the patient is preferably a mammal, more preferably a human. Furthermore, in the above methods, at least one of the compounds of the invention can be used. Preferably, one or two of the compounds of the invention are used, more preferably, one of the compounds of the invention is used. In a particularly preferred embodiment of the invention, the above methods of treating or preventing one of the above mentioned diseases comprise administering to a patient in need thereof a therapeutically effective amount of a compound of the examples or a pharmaceutically acceptable salt thereof according to the present invention.

Pharmaceutical compositions

The invention furthermore relates to a pharmaceutical composition, which comprises at least one of the compounds of the invention together with at least one pharmaceutically acceptable auxiliary.

Preferably, the pharmaceutical composition comprises one or two of the compounds of the invention. More preferably, the pharmaceutical composition comprises one of the compounds of the invention.

In a particularly preferred embodiment of the invention, the pharmaceutical composition comprises a compound of the examples or a pharmaceutically acceptable salt thereof according to the present invention together with at least one pharmaceutically acceptable auxiliary.

The invention furthermore relates to a pharmaceutical composition according to the invention inhibiting the type 4 phosphodiesterase, especially for the treatment or prophylaxis of diseases alleviated by inhibition of type 4 phosphodiesterase, in particular for the treatment or prophylaxis of the diseases exemplified above.

The invention encompasses pharmaceutical compositions according to the invention, as defined above, in particular for the treatment or prophylaxis of one or more of the following diseases: acute and chronic airway diseases, such as bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD or idiopathic pulmonary fibrosis; allergic rhinitis; pulmonary hypertension; dermatological diseases, such as psoriasis and atopic dermatitis (eczema); rheumatoid arthritis; diabetes mellitus type 2, diabetic nephropathy or non-alcoholic steato-hepatitis; inflammations in the gastrointestinal region, such as Crohn ^' s disease and ulcerative colitis; and eye diseases, such as dry eye syndrome or keratoconjunctivitis sicca and meibomian gland dysfunction.

The compounds of the invention respectively the pharmaceutical compositions comprising the compounds of the invention may be administered by any suitable route, for example, by the oral, sublingual, buccal, intravenous, intraarterial, intramuscular, subcutaneous, intracutaneous, topical, transdermal, intranasal, intraocular, intraperitoneal, intrasternal, intracoronary, transurethral, rectal or vaginal route, by inhalation or by insufflation. Oral administration of the compounds of the invention is preferred. Inhalable and intranasal pharmaceutical compositions

Inhaled administration involves topical administration to the lung e.g. by aerosol or dry powder composition.

Formulations for inhalation include powder compositions, which will preferably contain lactose, and spray compositions which may be formulated, for example, as aqueous solutions or suspensions or as aerosols delivered from pressurised packs, with the use of a suitable propellant, e. g. 1 , 1 , 1 , 2-tetrafluorethane, 1 , 1 , 1 , 2, 3, 3, 3-heptafluoropropane, carbon dioxide or other suitable gas.

A class of propellants, which is believed to have minimal ozone-depleting effects in comparison to conventional chlorofluorocarbons comprise hydrofluorocarbons and a number of medicinal aerosol formulations using such propellant systems are disclosed in, for example, EP 0372777, W091/0401 1 , W091/1 1 173, W091/1 1495, W091/14422, W093/1 1743, and EP 0553298. These applications are all concerned with the preparation of pressurised aerosols for the administration of medicaments and seek to overcome problems associated with the use of this new class of propellants, in particular the problems of stability associated with the pharmaceutical formulations prepared. The applications propose, for example, the addition of one or more of excipients such as polar cosolvents or wetting agents (e.g. alcohols such as ethanol), alkanes, dimethyl ether, surfactants (including fluorinated and non-fluorinated surfactants, carboxylic acids such as oleic acid, polyethoxylates etc.) or bulking agents such as a sugar (see for example WO02/30394) and vehicles such as cromoglicic acid and/or nedocromil which are contained at concentrations, which are not therapeutically and prophylactically active (see WO00/07567). The aerosol dosage form can also take the form of a pump-atomizer.

For suspension aerosols, the compound of the invention should be micronised so as to permit inhalation of substantially all of the compound of the invention into the lungs upon administration of the aerosol formulation, thus the compound of the invention will have a mean particle size of less than 100 μιτι, desirably less than 20 μιτι, and preferably in the range of 1 to 10 μιτι (D50 value, e.g. as measured using laser diffraction).

Dry powder inhalable compositions: For pharmaceutical compositions suitable (e.g. adapted for) inhaled administration, the pharmaceutical composition may for example be a dry powder inhalable composition. The dry powder comprises finely divided compound of the invention optionally together with a finely divided pharmaceutically acceptable carrier, which is preferably present and may be one or more materials known as carriers in dry powder inhalation compositions, for example saccharides, including monosaccharides, disaccharides, polysaccharides and sugar alcohols such as arabinose, glucose, fructose, ribose, mannose, sucrose, trehalose, lactose, maltose, starches, dextran or manni- tol. An especially preferred carrier is lactose, particularly in the form of the monohydrate. The dry powder may be in capsules of gelatine or plastic, or in blisters, for use in a dry powder inhalation device, preferably in dosage units of the compound of the invention together with the carrier in amounts to bring the total weight of powder in each capsule to from 5mg to 50mg. Alternatively the dry powder may be contained in a reservoir of a multi-dose dry powder inhalation device. Capsules and cartridges of for example gelatin, or blisters of for example laminated aluminium foil, for use in an inhaler or insulator may be formulated containing a powder mix of the compounds of the invention and a suitable powder base such as lactose or starch, preferably lactose. In this aspect, the compound of the invention is suitably micronised so as to permit inhalation of substantially all of the compound of the invention into the lungs upon administration of the dry powder formulation, thus the compound of the invention will have a particle size of less than ΙΟΟμιη, desirably less than 20μιη, and preferably in the range 1 to 10μιη (D50 value, e.g. as measured using laser diffraction). The solid carrier, where present, generally has a maximum particle diameter of 300μιη, preferably 200μιη, and conveniently has a mean particle diameter of 40 to ΙΟΟμιη, preferably 50 to 75μιη. The particle size of the compound of the invention and that of a solid carrier where present in dry powder compositions, can be reduced to the desired level by conventional methods, for example by grinding in an air-jet mill, ball mill or vibrator mill, microprecipitation, spray drying, lyophilisation or recrystallisation from supercritical media.

Where the inhalable form of the composition of the invention is the finely divided particulate form, the inhalation device may be, for example a dry powder inhalation device adapted to deliver dry powder from a capsule or blister containing a dosage unit of the dry powder or a multi-dose dry powder inhalation device. Such dry powder inhalation devices are known in the art. Examples which may be mentioned are Cyclohaler®, Diskhaler®, Rotadisk®, Turbohaler®, Novolizer®, Easyhaler®, Jethaler®, Clickhaler® or the dry powder inhalation devices disclosed in EP 0 505 321 , EP 407028, EP 650410, EP 691865 or EP 725725 (Ultrahaler®). Formulations for inhalation by nebulization may be formulated with an aqueous vehicle with the addition of agents such as acid or alkali, buffer salts, isotonicity adjusting agents or antimicrobials. They may be sterilised by filtration or heating in an autoclave. Suitable technologies for this type of administration are known in the art. As an example the Mystic® technology is to be mentioned (see for example US6397838, US6454193 and US6302331 ). Preferred unit dosage formulations are those containing a pharmaceutical effective dose, as hereinbe- low recited, or an appropriate fraction thereof, of the active ingredient. Thus, in the case of formulations designed for delivery by metered dose pressurised aerosols, one actuation of the aerosol may deliver half of the therapeutical effective amount such that two actuations are necessary to deliver the therapeutically effective dose. In the dry powder inhalable composition, the compound of the invention can for example be present in about 0.1 % to about 70% (e.g. about 1 % to about 50%, e.g. about 5% to about 40%, e.g.

about 20 to about 30%) by weight of the composition. In case of intranasal administration, for example, sprays and solutions to be applied in drop form are preferred formulations. Intranasal sprays or nasal drops may be formulated with aqueous or nonaqueous vehicles with or without the addition of agents such as thickening agents, buffer salts or acid or alkali to adjust the pH, isotonicity adjusting agents, preservatives or anti-oxidants. Pharmaceutical compositions suitable for external topical administration

"External topical" administration means topical administration to an external body part (i.e. excluding, for example, the lung or mouth, but including the lips or the eye). External topical adminstration (e.g. through the skin / transdermal) can for example be to those parts of the skin affected by or susceptible to a dermatological disease, such as for example, atopic dermatitis or psoriasis.

In case of external topical administration (i.e. through the skin / transdermal), suitable pharmaceutical formulations are, for example, ointments, creams (usually an oil-in-water or water-in-oil pharmaceutical composition, usually an emulsion), lotions, pastes, gels, powders, solutions, emulsions, suspensions, oils, sprays and patches (e.g., but not limited to, transdermal therapeutic systems).

In an external-topical pharmaceutical composition, e.g. an ointment or an oil-in-water or water-in-oil composition, the compound of the invention is suitably present in 0.05 to 10%, preferably 0.1 to 5%, more preferably 0.1 to 3%, still more preferably 0.5 to about 2.5 %, by weight of the composition (w/w).

Pharmaceutical compositions for oral or parenteral administration

For parenteral modes of administration such as, for example, intravenous, subcutaneous or intramuscular administration, preferably solutions (e.g., but not limited to, sterile solutions, isotonic solutions) are used. They are preferably administered by injection or infusion techniques.

A pharmaceutical composition suitable for parenteral (e.g. intravenous, subcutaneous or intramuscular) administration can comprise a solution or suspension of the compound of the invention in a sterile par- enterally acceptable carrier (e.g. sterile water) or parenterally acceptable oil. Alternatively, the solution can be lyophilised. A lyophilised pharmaceutical composition suitable for parenteral administration may, in use, optionally be reconstituted with a suitable solvent, e.g. sterile water or a sterile parenterally acceptable aqueous solution, just prior to administration. A pharmaceutical composition for oral administration may be liquid or solid; for example, it may be a syrup, suspension or emulsion; as well it may be, for example, a tablet, coated tablet (dragee), pill, cachet, capsule (caplet), or in form of granules. A liquid formulation may optionally consist of a suspension or solution of the compound of the invention in a pharmaceutically acceptable liquid carrier, for example an aqueous solvent such as water, ethanol or glycerine, or a non-aqueous solvent, such as polyethylene glycol or an oil. The formulation may contain in addition, a suspending agent, a preservative, a flavouring and/or a colouring agent. A pharmaceutical composition for oral administration being a tablet may comprise one or more pharmaceutically acceptable auxiliaries (for example, carriers and/or excipients) suitable for preparing tablet formulations. The carrier may, for example, be or include lactose, cellulose or mannitol. The tablet may also or instead contain one or more pharmaceutically acceptable excipients, for example, a binding agent, a lubricant and/or a tablet disintegrant.

The pharmaceutical compositions according to the invention for oral or parenteral administration preferably contain the compound or compounds of the invention in a total amount of from 0.1 to 99.9%, more preferably 5 to 95%, in particular 20 to 80% by weight of the composition (w/w). In general, as pharmaceutically acceptable auxiliaries, any auxiliaries known to be suitable for preparing a particular pharmaceutical composition can be used. Examples thereof include, but are not limited to, solvents, excipients, dispersants, emulsifiers, solubilizers, gel formers, ointment bases, antioxidants, preservatives, stabilizers, carriers, fillers, binders, thickeners, complexing agents, disintegrating agents, buffers, permeation promoters, polymers, lubricants, coating agents, propellants, tonicity adjusting agents, surfactants, colorants, flavorings, sweeteners and dyes. In particular, auxiliaries of a type appropriate to the desired formulation and the desired mode of administration are used.

The pharmaceutical compositions/formulations can be manufactured in a manner known to a person skilled in the art, e.g. by dissolving, mixing, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Dosages

Generally, the pharmaceutical compositions according to the invention can be administered such that the dose of the compound of the invention is in the range customary for type 4 phosphodiesterase inhibitors.

The pharmaceutically acceptable compounds of the invention are preferably administered in a daily dose (for an adult patient) of, for example an oral or parenteral dose of 0.01 mg to 250 mg per day, preferably 0.05 mg to 100 mg per day, more preferably 0.05 mg to 10 mg per day, or a nasal or inhaled dose of 0.001 mg to 10 mg per day, preferably 0.01 mg to 7.5 mg per day, more preferably 0.01 mg to 5 mg per day, of the compound of the invention, calculated as the free compound (= the unsolvated, unhydrated, non-salt form of the compound). In this respect, it is to be noted that the dose is dependent, for example, on the specific compound used, the species treated, age, body weight, general health, sex and diet of the subject treated, mode and time of administration, rate of excretion, severity of the disease to be treated and drug combination. The pharmaceutical compositions of the invention can be administered in a single dose per day or in multiple subdoses, for example, 2 to 4 doses per day. A single dose unit of the pharmaceutical composition can contain, in case of inhalative administration e.g. from 0.001 mg to 10 mg, preferably 0.01 mg to 7.5 mg, more preferably 0.01 mg to 5 mg of the compound of the invention. Administration of the pharmaceutical composition in a single dose per day is preferred.

Biological investigations

The second messenger cyclic AMP (cAMP) is well-known for inhibiting inflammatory and immunocompetent cells. The PDE4 isoenzyme is broadly expressed in cells involved in the initiation and propaga- tion of inflammatory diseases (H Tenor and C Schudt, in ..Phosphodiesterase Inhibitors", 21-40,„The Handbook of Immunopharmacology", Academic Press, 1996), and its inhibition leads to an increase of the intracellular cAMP concentration and thus to the inhibition of cellular activation (JE Souness et al., Immunopharmacology 47: 127-162, 2000). The antiinflammatory potential of PDE4 inhibitors in vivo in various animal models has been described (MM Teixeira, TiPS 18: 164-170, 1997). For the investigation of PDE4 inhibition on the cellular level (in vitro), a large variety of proinflammatory responses can be measured. Examples are the superoxide production of neutrophilic (C Schudt et al., Arch Pharmacol 344: 682-690, 1991 ) or eosinophilic (A Hatzelmann et al., Brit J Pharmacol 1 14: 821-831 , 1995) granulocytes, which can be measured as luminol-enhanced chemiluminescence, or the synthesis of tumor necrosis factor-a in monocytes, macrophages or dendritic cells (Gantner et al., Brit J Pharmacol 121 : 221-231 , 1997, and Pulmonary Pharmacol Therap 12: 377-386, 1999). In addition, the immunomodulatory potential of PDE4 inhibitors is evident from the inhibition of T-cell responses like cytokine synthesis or proliferation (DM Essayan, Biochem Pharmacol 57: 965-973, 1999). Substances which inhibit the secretion of the afore-mentioned proinflammatory mediators are those which inhibit PDE4. PDE4 inhibition by the compounds according to the invention is thus a central indicator for the suppression of inflammatory processes.

Method for measuring inhibition of PDE4 activity

The PDE4B1 (GB no. L20966) was a gift of Prof. M. Conti (Stanford University, USA). It was amplified from the original plasmid (pCMV5) via PCR with primers Rb18 (5'- CAGACATCCTAAGAGGGGAT -3') and Rb10 (5'- AGAGGGGGATTATGTATCCAC -3') and cloned into the pCR-Bac vector (Invitrogen, Groningen, NL).

The recombinant baculovirus was prepared by means of homologous recombination in SF9 insect cells. The expression plasmids were cotransfected with Baculo-Gold DNA (Pharmingen, Hamburg) using a standard protocol (Pharmingen, Hamburg). Wt virus-free recombinant virus supernatants were selected using plaque assay methods. After that, high-titre virus supernatants were prepared by amplifying 3 times. PDE4B1 was expressed in SF21 cells by infecting 2 x 10 ⁶ cells/ml with an MOI (multiplicity of infection) between 1 and 10 in the serum-free medium Insect Express Sf9-S2 (PAA, Pasching, Austria). The cells were cultured at 28°C for 48 - 72 hours, after which they were pelleted for 5-10 min at 1000xg and 4°C.

The SF21 insect cells were resuspended, at a concentration of approx. 10 ⁷ cells/ml, in ice-cold (4°C) homogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCI, 3.8 mM KCI, 1 mM EGTA, 1 mM MgCI ₂ , 10 mM β-mercaptoethanol, 2 mM benzamidine, 0.4 mM Pefablock, 10 μΜ leupeptin, 10 μΜ pepstatin A, 5 μΜ trypsin inhibitor) and disrupted by ultrasonication. The ho- mogenate was then centrifuged for 10 min at 1 000xg and the supernatant was stored at -80°C until subsequent use (see below). The protein content was determined by the Bradford method (BioRad, Munich) using BSA as the standard. PDE4B1 activity was inhibited by the compounds according to the invention in a modified SPA (scintillation proximity assay) test, supplied by Amersham Biosciences (see procedural instructions "phosphodiesterase [3H]cAMP SPA enzyme assay, code TRKQ 7090"), carried out in 96-well microtitre plates (MTP's). The test volume is 100 μΙ and contains 20 mM Tris buffer (pH 7.4), 0.1 mg /ml of BSA, 5 mM Mg ²⁺ , 0.5 μΜ cAMP (including about 50,000 cpm of [3H]cAMP), 1 μΙ of the respective substance dilution in DMSO and sufficient recombinant PDE (1 000xg supernatant, see above) to ensure that 10-20% of the cAMP is converted under the said experimental conditions. The final concentration of DMSO in the assays (1 % v/v) does not substantially affect the activity of the PDE investigated. After a preincubation of 5 min at 37°C, the reaction is started by adding the substrate (cAMP) and the assays are incubated for a further 15 min; after that, they are stopped by adding SPA beads (50 μΙ). In accord- ance with the manufacturer's instructions, the SPA beads had previously been resuspended in water, but were then diluted 1 :3 (v/v) in water; the diluted solution also contains 3 mM IBMX to ensure a complete PDE activity stop. After the beads have been sedimented (> 30 min), the MTP's are analyzed in commercially available luminescence detection devices. The corresponding IC ₅₀ values of the com- pounds for the inhibition of PDE4B1 activity are determined from the concentration-effect curves by means of non-linear regression.

For the following compounds inhibitory values [measured as -loglC ₅₀ (mol/l)] higher than 8.0 have been determined. The numbers of the compounds correspond to the numbers of the examples.

Compounds

In table 1 below, the inhibitory concentrations determined according to the method described above are indicated for a number of compounds according to the invention [inhibitory concentrations as -log IC ₅₀ (mol/l)]. The number of the compounds corresponds to the numbers of the examples in the section Final products:

Table 1 :

Compound PDE4

-loglC50 (mol/l)

1 8.7

2 8.3

3 8.7

4 8.0

5 8.3

6 8.1

7 8.1

8 8.0

Preclinical Studies:

Preclinical studies have been performed with the compound of Example 7 (hereinafter referred to as "Compound 7").

1. In vivo assay for Dry Eye - Efficacy of Compound 7 in the Controlled Environment Chamber + Scopolamine (CEC+S) induced Dry Eye Model in female C57BL/6J mice

Experiment 1 :

Dry eye was induced in 6 week old female C57BL/6J mice by exposure to low humidity environment (humidity: 20 ± 10%) in controlled environment chamber as previously described in [1 ]. The mice in CEC were also treated with subcutaneous injections of 0.1 mL of 5 mg/mL of scopolamine hydrobro- mide three times a day for the entire duration of the experiment. Following 3-day induction of dry eye, topical instillation of 0.1 to 0.3% Compound 7 [formulation A: Compound 7 was suspended in 3 mM (for 0.1 %) or 8 mM (for 0.3%) saline solution and the required amount of HCI for dissolution was added and the solution was used as eye drops; pH5.0) or 0.1 % dex- amethasone eye drops (water-soluble dexamethasone was dissolved in saline) was performed three times a day for seven days (5 [it I eye).

Corneal Fluorescein Staining (CFS)

After 7 days instillation CFS was performed by applying 3 [it of 0.5% fluorescein on the eye. The eye was washed with saline and the cornea was examined with a slit lamp biomicroscope using cobalt blue light. Punctuate Staining was evaluated in a masked fashion using a grading system of 0-3 for each of upper, middle and lower thirds of the cornea. Each area was graded according to the extent of staining as 0, negative; 1 , sparse; 2, moderate; or 3, dense staining. The score was expressed as sum of left and right eye.

The CFS score was significantly increased in dry eye mice (non-treated group) compared to normal mice (control group). Vehicle treatment itself showed slight reduction of the score compared to non- treated group, which was due to fluid supply. In contrast, Compound 7 significantly reduced the score in a dose dependent manner compared to vehicle group (Figure 1 ). Dexamethasone did show only very limited effect.

[1] Barabino S et al; Invest Opthalmol Vis Sci 2005 46 pp. 2766-2771

Experiment 2:

Dry eye was induced in 6 week old female C57BL/6J mice by exposure to low humidity environment (humidity: 20 ± 10%) in controlled environment chamber as previously described in [1]. The mice in CEC were also treated with subcutaneous injections of 0.1 mL of 5 mg/mL of scopolamine hydrobro- mide three times a day for the entire duration of the experiment. Following 6-day induction of dry eye, topical installation of 0.25% Compound 7 eye drops (formulation B; Table 2) or 0.05% cyclosporine eye drop (Restasis®) was performed thre times a day for 7 days (5 μΙ_ / eye).

Table 2: Compositions of eye drops

Compound 7 (pH 5.0) Vehicle (pH 5.0)

Components

Compound 7 2.5 mg/mL -

Sodium dihydrogenphosphate 10 mM 10 mM

Polyvinylpyrrolidone K30 2.0% (w/v) 2.0% (w/v)

Glycerol 1.5% (w/v) 1.5% (w/v)

Benzalkonium chloride 0.005% (w/v) 0.005% (w/v)

Ethylenediaminetetraacetic acid 0.02% (w/v) 0.02% (w/v)

Polysorbate 80 0.5% (v/v) 0.5% (v/v)

NaOH (pH adjuster) q.s. q.s.

Corneal Fluorescein Staining (CFS)

After 7 days instillation CFS was performed by applying 3 μΙ_ of 0.5% fluorescein on the eye. The eye was washed with saline and the cornea was examined with a slit lamp biomicroscope using cobalt blue light. Punctuate Staining was evaluated in a masked fashion using a grading system of 0-3 for each of upper, middle and lower thirds of the cornea. Each area was graded according to the extent of staining as 0, negative; 1 , sparse; 2, moderate; or 3, dense staining. The score was expressed as sum of left and right eye.

Like in Experiment 1 , here too, Compound 7 significantly reduced the CFS score (Figure 2). 0.05% Cyclosporine eye drops did show almost no effect.

Effect on TNFa gene expression

The eyes with conjunctiva were dissected from mice after CFS test and TNFa gene expression was evaluated by Real-time PCR. Real-time PCR was performed using TaqMan Gene Expression Master Mix (Applied Biosystems) and predesigned primers for TNFa (Mm99999068_m1 , Applied Biosystems) and GAPDH (Mm99999915_g1 , Applied Biosystems) as the endogenous reference. The results were normalized by GAPDH and the relative mRNA level of TNFa in the normal mice was used as the normalized control (expressed as 100%). Compound 7 significantly suppressed TNFa gene expression (Figure 3).

2. Effect of Compound 7 on constituents of outer lipid layer from meibomian gland

Tear film consists of three layers, the outer lipid layer from meibomian gland, the intermediate aqueous layer from lacrimal gland, and the inner mucin layer from goblet cells in conjunctiva. Especially the outer lipid layer is most important for tear stability to avoid tear film evaporation [2]. Actually, meibomi- an gland dysfunction (MGD) is the most common cause of dry eye [3, 4]. The lipid layer is classified in lipid sub-layer (non-polar) and amphiphilic lipid sub-layer (polar). Amphiphilic lipid sub-layer functions as anchoring interface between polar aqueous layer and nonpolar lipid layer [2]. This amphiphilic lipid sub-layer layer includes (O-acyl)-omega-hydroxy fatty acids (OAHFAs) and free fatty acids (VLC-FFAs, longer than C28) which are synthesized by elongation of very long chain fatty acids-4 (ELOVL4) enzyme [5]. The OAHFAs and the VLC-FFAs are recently found as major amphiphilic lipids in meibum of human and animals [6]. According to the epidemiological report comparing lipid composition in meibum between normal subjects and dry eye patients, the ratio of OAHFA in meibum is lower in dry eye patients than that of normal subjects. Furthermore, the extent of OAHFA reduction depends on the severi- ty of dry eye [7]. Interestingly, ELOVE4 knockout mice showed abnormal meibum and symptoms resembling dry eye [8]. These data implicate that the OAHFA level largely involved with dry eye disease and increasing OAHFA level in meibum and tear might be a new treatment option for dry eye and/or meibomian gland dysfunction (MGD). To explore the effect of Compound 7 on meibomian gland function, a LC/MS lipid analysis on meibomian glands collected in the efficacy study in CEC+S model mice was conducted. Interestingly enough, OAHFAs and VLC-FFAs were increased in 0.25% Compound 7-treatment group by topical instillation for 7 days compared to vehicle-treatment group (Figure 4). These novel findings on Compound 7 effects on meibomian gland function suggest that Compound 7 has a potential to stabilize tear film.

[2] Butovich, I.A., Tear film lipids. Exp Eye Res, 2013. 1 17: pp. 4-27

[3] Nichols, K.K., et al., The international workshop on meibomian gland dysfunction: executive summary. Invest Ophthalmol Vis Sci, 201 1 . 52(4): pp. 1922-1929

[4] Geerling, G., et al., The international workshop on meibomian gland dysfunction: report of the subcommittee on management and treatment of meibomian gland dysfunction. Invest Ophthalmol Vis Sci, 201 1. 52(4): pp. 2050-2064.

[5] Agbaga, MP., et al., Role of Stargardt-3 macular dystrophy protein (ELOVL4) in the biosynthesis of very long chain fatty acids. Proc Natl Acad Sci U S A, 2008. 105(35): pp. 12843-12488

[6] Butovich, I.A., J.C. Wojtowicz, and M. Molai, Human tear film and meibum. Very long chain wax esters and (O-acyl)-omega-hydroxy fatty acids of meibum. J Lipid Res, 2009. 50(12): pp. 2471-2485 [7] Lam, S.M., et al., Meibum lipid composition in Asians with dry eye disease. PLoS One, 201 1. 6(10): p. e24339

[8] McMahon, A., H. Lu, and I.A. Butovich, A role for ELOVL4 in the mouse meibomian gland and sebocyte cell biology. Invest Ophthalmol Vis Sci, 2014. 55(5): pp. 2832-2840

3. Effects of Compound 7 on tear secretion in healthy mice

Effects of Compound 7 on tear secretion in healthy C57BL/6 mice was evaluated. Tear volume of right eye was measured for 30 seconds with Zone-Quick cotton-threads 0.5, 2 and 4 hours after single topical instillation of 0.25% Compound 7 eye drops (5 μί) (formulation B). Compound 7 significantly showed enhanced tear secretion by single dose in healthy C57BL/6 mice (Figure 5). At the same time, 0.05% cyclosporine eye drop (Restasis®) did not show comparable effect.

4. Effects of Compound 7 on transforming growth factor-β (TGF-P)-induced profibrotic re- sponse in vitro with human lung fibroblast cell line, WI-38

For gene expression assay, WI-38 human lung fibroblasts were suspended in Eagle's minimum essential medium (E-MEM, Invitrogen) containing 10% heat-inactivated fetal bovine serum (FBS) and seeded on 24 well plates as 0.5 x10 ⁵ cells/500 μίΛνβΙΙ. Twenty-four hours after the seeding, medium was re- placed by E-MEM containing 0.5% FBS. Twenty-four hours after medium change, cells were treated with Compound 7 (1 *10 ^~7 M; in E-MEM containing 0.5% FBS). After 1 hour, cells were treated with TGF-β (3 ng/mL) and forskolin (1 μΜ). After the 24-hours incubation, total RNA was extracted from cell lysate using RNeasy 96 Kit (QIAGEN 74182). cDNA was amplified using High-Capacity cDNA Reverse Transcription Kit (ABI 4368813), and target gene mRNA was measured using TaqMan PCR with pre- designed primers for type 1 collagen alpha 1 chain (Hs00164004_m1 , Applied Biosystems), fibronectin (Hs00365052_m1 , Applied Biosystems), connective tissue growth factor (Hs01026927_g1 , Applied Biosystems), plasminogen activator inhibitor-1 (Hs00167155_m1 , Applied Biosystems) and GAPDH (Hs02758991_g1 , Applied Biosystems) as the endogenous reference. The target gene expression levels were normalized by mRNA expression of GAPDH and the data represent the relative mRNA levels to TGF- /forskolin-treated group.

The results are shown in Figure 6. In WI-38 lung fibroblasts, mRNA expression of fibrotic markers including type 1 collagen alpha 1 subunit, fibronectin, connective tissue growth factor and plasminogen activator inhibitor-1 was increased by TGF-β treatment. Compound 7 significantly suppressed expres- sion of fibrotic marker genes induced by TGF-β. These results indicate that Compound 7 has anti- fibrotic effects by inhibition of TGF- -induced profibrotic response.