Thermostable alkaline xylanase DESCRIPTION

TECHNICAL FIELD

The present invention relates to a thermostable alkaline active xylanase, free from cellulase activity for use in industrial applications such as pulp treatment and recycling, detergent formulation, feed applications, separation of starch and gluten and waste management.

BACKGROUND OF THE INVENTION

Xylan is a major component of hemicellulose, which is present in both hardwood and annual plants. It is known to be the second most abundant renewable resource in nature. It is a heteropolymer composed of β-1,4 linked D-xylose backbone and branches of arabinose, glucuronic acid, mannose or acetyl residues. Complete hydrolysis of xylan to these monomers usually requires the combined action of various enzymes such as endo-β- 1,4-xylanase, β-xylosidase, α-L-arabinofuranosidase, α-glucuronidase and acetylxylan esterase. These enzymes act together to convert xylan into its constituent sugars. Among these enzymes, xylanases are crucial for xylan depolymerisation in that they randomly hydrolyze β-l,4-glycosidic bonds of xylan to produce xylo-oligosaccharides and xylose. Xylanases have received growing attention during recent years because of application in pulp and paper industries (Subramaniyan S, and Prema P. Cellulase free xylanases from Bacillus and other microorganisms. FEMS Microbiol. Lett. 2000, 183, 1-7; Srinivasan MC, and ReIe MV. Microbial xylanases for pulp and paper industry. Curr. Sci. 1999, 77, 137- 142).

Pulp for paper and paperboard production is conventionally processed by kraft pulping. In this process, free cellulose fibers are obtained by dissolving the cementing lignin in alkaline cooking liquor. The resulting pulp contains residual lignin and lignin derivatives, which can be covalently attached to carbohydrate moieties and give undesirable brownish colour to the pulp. The removal of this characteristic colouration involves a multistage bleaching process, which involves elemental chlorine. Although chlorine-based bleaching of pulp is effective, it results in chlorinated organic by-products which have highly persistent toxic and mutagenic effects. Because of the growing public concern about environment and strict legislations regarding pollution, the search for alternative ways to reduce or avoid the release of chlorogenic compounds with Kraft mill bleaching effluent has been promoted.

Enzymatic treatment of kraft pulp prior to bleaching in order to hydrolyse the xylan component of wood, and in turn to facilitate lignin removal, has resulted in a substantial reduction in the use of chlorine, and has emerged as one of the most promising alternative approaches. With this impetus, many xylanases from a vast array of organisms have been characterised and evaluated for pulp treatment.

Xylanases have been classified into glycosidase families based on sequence similarity and structural homologies. Under such a classification scheme, the great majority of xylanases fall in families 10 and 11. In recent years, xylanases that belong to family-5 and 8 have been reported. The great majority of these xylanases are optimally active in the acidic or neutral pH range, and at or below 60 ⁰ C. Relatively few microorganisms produce xylanases which are optimally active either at elevated temperatures or alkaline conditions. Xylanases which are optimally active and stable both at elevated temperature and pH are rare (Gessesse A. Purification and properties of two thermostable alkaline xylanases from an alkaliphilic Bacillus sp., Appl. Environ. Microbiol. 1998, 64, 3533-3535). Since the incoming pulp for enzymatic bleaching is hot and alkaline, the use of thermostable alkaline xylanases is very attractive from an economical and technical point of view.

Xylanase preparations produced for pulp treatment are often accompanied by cellulase activity which may result in poor fiber mechanical strength. Some initial approaches for overcoming cellulase activity included treatment with mercurial compounds which selectively inhibits cellulase or cloning with selective expression of xylanase genes. However, the most practical approach is screening for naturally occurring strains that are capable of secreting cellulase-free xylanases.

As a result, the search for novel xylanases for pulp and paper industries has continued and resulted in the present invention. In keeping with the requirements of the pulping operations, the search for cellulase-free xylanases from diverse microbial strains that are active under high alkaline pH conditions having high temperature stabilities has resulted in a xylanolytic alkaliphilic Bacillus strain isolated from a soda lake in Ethiopia. The properties of the xylanase produced by this organism, for use especially in pulp treatment, but also other industrial applications are very attractive from an economical and technical point of view.

As an alternative to conventional chemical deinking, the use of enzymatic deinking during the recycling process of wastepaper has increased during the last few years. Cellulases and xylanases have been used to deink waste paper, alone or in combination with conventional deinking chemicals (PCT Int. Appl. WO 91/14819 to Baret et al.; U.S. Pat. No. 6,426,200 to Young et al.).

Enzymes such as proteases, cellulases, lipases and amylases have been incorporated in detergent formulations to increase the efficiency of cleaning. Addition of xylanase to detergents promotes the removal of stains of plant origin (WO9839403 to Herbots et al.; WO9839402) to Herbots et al.).

Chicken feed containing grains like wheat and rye become too viscous and are difficult to be completely digested in the guts of chickens. Addition of xylanase to the chicken feed decreases the viscosity of the gut contents when grains are fed and increases nutrient absorption during the digestion (Silversides, F. G., Bedford, M. R. (1999) Poultry Science 78(8): 1184-1190).

Xylanase in combination with β-glucanase and cellulase effectively increases the yield of starch and gluten in the separation process (WO0200911).

Enzymes such as xylanase are used to get value added products from wastes such as agricultural residues. Xylanases have been used in processes such as the release of fermentable sugars for the production of fuel ethanol (Leathers, T. D. (2002) FEMS Yeast Research 3:133-140) and the release of xylose from xylan for xylitol production (Tada, K,, et al. (2004) Journal of Bioscience and Bioengineering 98(3): 228-230).

SUMMARY OF THE PRESENT INVENTION

In particular the present invention relates to a isolated xylanase characterized by having activity at a pH-range of 5-12, at temperatures of above 50 ⁰ C to 85 °C, with a capacity of hydrolyzing birchwood xylan, and being free from cellulase activity and a cellulose binding domain.

In a further preferred embodiment of the invention the xylanase is obtained from a strain belonging to the genus Bacillus.

In another embodiment of the invention the xylanase is obtained from a strain of Bacillus halodurans.

In a preferred embodiment of the invention the xylanase is obtained from Bacillus halodurans S7.

In a further preferred embodiment of the invention the xylanase has the nucleotide sequence as AY687345.

In another embodiment of the invention the xylanase has over 80 % peak activity between pH 6 and 10.5.

In a preferred embodiment of the invention the xylanase has over 80 % peak activity between pH 8 and 10.5.

In a further preferred embodiment of the invention the xylanase has over 80 % peak activity between temperatures of 65 °C to 82 ⁰ C.

In an another further preferred embodiment of the invention the xylanase has full activity for 12 h from pH 5.5 to 10.5 at 50 ⁰ C.

In a further preferred embodiment of the invention the xylanase is optimally active at 75 ⁰ C and 70 °C at pH 9 and 10, respectively.

In a preferred embodiment of the invention the xylanase has no detectable activity with the substrates CMC, avicel, laminarin, p-nitrophenyl (pNP)-β-galactopyranoside, pNP-α-glucopyranoside, pNP-β-xylopyranoside, pNP-α-L-arabinofuranoside, pNP- acetate or pNP-α-D-xylopyranoside.

In a further preferred embodiment of the invention the xylanase has no binding domain to avicel or xylan.

In another preferred embodiment of the invention the xylanase is sensitive to Mn ²⁺ - ions.

In a preferred embodiment of the invention the xylanase is insensitive to Hg ²⁺ -ions.

In another further preferred embodiment of the invention the xylanase is insensitive to EDTA.

In a preferred embodiment of the invention the xylanase is used in pulp treatment.

In a further preferred embodiment of the invention the xylanase is used as a detergent component for cleaning fruit and vegetable soils and grass stains.

In an another preferred embodiment of the invention the xylanase is used for deinking during paper recycling.

In a further preferred embodiment of the invention the xylanase is used for waste management.

In a preferred embodiment of the invention the xylanase is used as a feed supplement.

In a further preferred embodiment of the invention the xylanase is used for separation of gluten from starch.

DETAILED DESCRIPTION OF THE INVENTION

Characterization of Bacillus halodurans S7 xylanase

The Bacillus isolate S7 from an Ethiopian soda lake is aerobic, motile, rod-shaped, catalase-positive and endospore-forming.

The xylanase was purified from the culture supernatant of the Bacillus isolate S7 following the steps indicated in Table 1.

Tablel. Summary of Bacillus halodurans S7 xylanase purification

Volume Total Total Specific Recovery

Purification step (ml) Activity Protein Activity (%)

(U) (mg) (U/mg)

Culture 900 4590 517 8.9 100 supernatant

Ammonium 40 3052 232 13.2 66.5 sulfate ppt.

Ion exchange 85 2219 127 17.5 48.3

Chromatography

1 ^st gelfiltration 80 1176 16.3 72.1 25.6

2 ^nd gelfiltration 60 582 1.7 342 12.7

A homogenous enzyme preparation was obtained as analysed by SDS-PAGE (Fig. 1). The molecular weight (43 kDa) and low acidic pi (4.5) suggested that the xylanase belongs to the group of high molecular weight xylanases.

A DNA fragment (2155 nucleotide-long) containing the xylanase encoding gene of B. halodurans S7 was PCR amplified using a pair of primers SEQ ID No. 1 (XyIAF- GGCATAGAGCATGTATTTAG and SEQ ID No. 2 XyIAR-GGCCTAATTGAATGTTGG). Sequence analysis of the fragment has shown that it contains an open reading frame of 1188 nucleotides, encoding 396 amino acids. A consensus ribosome binding site (AGGAG) has been identified 8 nucleotides up stream of the translation initiation codon ATG. The potential promoter regions which can be recognised by σ ⁴³ , the -10 (TATAAT) and -35 (GGATCA) elements are located upstream of the ribosome binding site from nucleotide position 139 to 168. A 13-base inverted repeat sequence, SEQ ID No. 3 (AATAAACTTAGTTtgttcactggatcAACTAAGTTTATT) is located 5 nucleotides upstream of the -10 promoter. The inverted repeat sequence SEQ ID No. 4 (AGCTGCCTcaaaggtctatcttttaAGGCAGCT) located between the positions 70 and 103 downstream of the stop codon TAA might serve as transcription terminator. The translated protein contains 396 amino acids of which the first 28 amino acids show high similarity to bacterial leader peptide. The remaining 368 amino acids, SEQ ID No. 5, form the mature peptide.

Similarity searches were performed by comparing the deduced amino acid sequence of B. halodurans S7 xylanase with entries in GenBank and SWISS-PROT databases which disclosed that it contained a single domain with high homology to the family-10 xylanases. . The B. halodurans S7 xylanase has shown the highest homologies, 99 and 97 % identities with XynlOA (Acc.No. AAQ83582) of B. firmus and xynlOA (Acc.No. D00087) of β. halodurans, respectively. Xylanases of Bacillus sp. NG-27 (Acc.No. AAB70918), B. stearothermophilus (Acc.No. CAA82319) and Clostridium stercorarium (Acc.No. CAD48313) have shown 75, 62 and 54 % identity with S. halodurans S7 xylanase, respectively. A multiple sequence alignment analysis revealed the presence of insert amino acids between positions 146-164 in B. halodurans S7 xylanase as in other family-10 xylanases of B. firmus, B. halodurans C-125, Bacillus sp NG-27, B. stearothermophilus 1-6 and C. stercorarium (Fig. 2). The high sequence homology and the insert amino acids show a close evolutionary relationship. The enzymes are optimally active around 70-80 ⁰ C (depending on the pH) and display a good degree of heat stability. These xylanases are optimally active at or above pH 6.5 and exhibit over 50 % of the optimum activity at pH 9. There is no information available so far if the insert amino acids have effect on alkaline activity and stability.

The expressed xylanase activity of B. halodurans S7 was detected in the cytoplasm, periplasm and cell free culture medium. The relative distribution of the enzyme in these locations varies with the age of the culture (Fig. 3). Although the extracellular xylanase activity had been increasing with the age of the culture, cytoplasmic xylanase activity remained higher than the extracellular level. This shows that expression of B, halodurans S7 xynlOA under pelB leader peptide resulted in only partial secretion of the translated

protein. Analysis of an 18 h old culture revealed that about 39 % of the active xylanase was secreted to the medium while 51 % remained in the cytoplasm.

Bacillus halodurans S7 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH on 2005-03-14 according to the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and has the accession number: DSM 17179.

Characterization of the optimum pH and temperature ranges of Bacillus halodurans S7 xylanase.

The use of alkaline active xylanases in pulp delignification would allow direct enzymatic treatment of the alkaline pulp and avoids the cost incurring and time consuming steps of pH re-adjustment. In particular, alkaline xylanases which are operationally stable at higher temperatures are more beneficial because of savings in cooling cost and time. Determination of the B. halodurans S7 xylanase enzyme activity at 70 ⁰ C at pH values ranging from 4 to 12 showed the xylanase to be active in a wide pH range (Fig. 4) with over 80 % of the peak activity displayed between at pH 6.0 and 10.5, respectively. The enzyme was fully stable from pH 5.5 to 10.5 at 50 ⁰ C after 12 h of incubation (Fig. 5). The enzyme was optimally active at 75 ⁰ C and 70 ⁰ C at pH 9 and 10, respectively (Fig. 6). The thermal stability of the enzyme was determined at 60 ⁰ C and 65 ⁰ C at the same pH values. At 60 ⁰ C, the enzyme was fully stable after 4 h incubation at pH 9 while it retained about 45 % of the original activity at pH 10 (Fig. 7). At 65 ⁰ C, the enzyme retained over 60 % of its initial activity after 3 h at pH 9, but there was no detectable activity after 1 h at pH 10.

In this regard, the present xylanase is able to operate under conditions close to those of most mills, i.e. high pH and temperature. So far, only few xylanases with an optimum temperature for activity exceeding 70 ⁰ C at or above pH 9 have been reported (Gessesse A. Purification and properties of two thermostable alkaline xylanases from an alkaliphilic Bacillus sp. Appl. Environ. Microbiol. 1998, 64, 3533-3535). Due to better solubility of xylan under alkaline conditions, alkaline active xylanases may also find other potential applications in addition to pulp bleaching. In waste management programs xylanases can be used to hydrolyse xylan in industrial and municipal waste.

Substrate specificity and binding properties of Bacillus halodurans S7 xylanase

The substrate specificity of the enzyme was determined by performing the assay with different substrates. The apparent Km and Vmax at 70 ⁰ C and pH 10 on birchwood xylan were estimated to be 2.7 + 0.4 mg/ml and 598.9 ± 35.9 μmol/min.mg. There was no detectable activity on Carboxymethyl cellulose, avicel, laminarin, p-nitrophenyl -β- galactopyranoside, p-nitrophenyl-α-glucopyranoside, p-nitrophenyl-β-xylopyranoside, p- nitrophenyl-α-L-arabinofuranoside, p-nitrophenyl-acetate or p-nitrophenyl-α-D- xylopyranoside. As cellulase activity may result in poor fiber mechanical strength, xylanases produced for pulp treatment should be free from cellulolytic activity. Thus, the cellulase-free nature of S7 xylanase would allow production of high quality pulp.

Since B. halodurans Sl xylanase bound neither to insoluble xylan nor avicel, it is expected to freely diffuse within the pulp and result in a uniform bleaching. This property is especially interesting in applications that need maximum removal of xylan for production of high quality cellulose such as Rayon grade textile fibers. On the other hand, many xylanases are known to have binding domains for cellulose or xylan, by way of which they bind to the surface of pulp fibers or reprecipitated xylan and may result in local bleaching. Moreover, the binding of such enzymes to cellulose fibers may lead to cellulose disruption.

As shown in Table 2, the activity of B, halodurans S7 xylanase was not significantly inhibited by the presence of different metal ions. However, it was strongly inhibited by Mn ²⁺ , an observation reported earlier for Bacillus sp. strain K-I xylanase. On the other hand, Hg ²⁺ did not significantly affect the activity of S7 xylanase even at 5 mM concentration, which might be due to the absence of the catalytically important cystine.

Table 2. Effect of metal ions, EDTA and dithiothreitiol on S7 xylanase activity

Metal % of activity displayed in the % of activity displayed in the presence of 1 mM of the metal presence of 5 mM of the metal

None ΪCJO fob ^"

MnCI ₂ 36 3

CuCI ₂ 107 13

CoCI ₂ 119 63

CaCI ₂ 103 81

FeCI ₂ 110 103

ZnCI ₂ 86 73

SnCI ₂ 109 125

NiSO ₄ 107 122

RuCI ₂ 95 105

KCI 100 103

MgCI ₂ 104 90

NaCI 102 101

HgCI ₂ 90 75

Dithiothreitol 94 90

EDTA 109 61

A similar observation has been reported for a xylanase produced by Bacillus sp. NG-27, while the majority of xylanases from different sources are sensitive to this metal ion. Impurities, like metal ions in industrial wastes can potentially inhibit the activity of

xylanases. Thus, in view of processing impure pulp and other environmental applications, the resistance of S7 xylanase to different metal ions and a chelating agent (EDTA) is attractive.

The release of xylooligosaccharides from xylan by S7 xylanase indicates that its mode of action is endotype. Like many xylanases, xylobiose and xylotriose were the major end products of the hydrolysis. These sugars selectively favour the growth of Brevibacterium bacteria which are known to inhibit the growth of intestinal pathogens. So far, production of xylobiose and xylotriose has been tried using neutral xylanases. However, the use of alkaline active xylanases may improve the yield due to high solubility of xylan in alkaline solutions.

Below are some examples of applications for the use of the Bacillus halodurans S7 xylanase of the invention. However, it should be clear that these examples are presented for illustrative purpose only and are in no way intended to limit the scope of the invention.

The use of Bacillus halodurans S7 xylanase in pulp bleaching

In the process of chemical pulping, a water suspension of furnish (or feed stock), primarily consisting of materials such as wood chips, are added to a reaction chamber known as digester, and is treated with chemicals to dissolve lignin. After delignification the brownish pulp is washed and ready for bleaching.

According to the invention, the furnish, which can be virgin or secondary fiber, woody or nonwoody fiber, softwood or hardwood, or a mixture thereof is resuspended preferably to 10% pulp consistency. The pH is adjusted preferably to 5-11, and the xylanase solution is added. The xylanase dosage is preferably 1-10 U (1 U of xylanase equals the amount of enzyme which releases 1 μmol of reducing sugar (xylose) per minute) per gram of pulp. The mixture is incubated at 70-75 ⁰ C for 30-90 min. In comparison to the conventional use of xylanases in a delignification process, the properties (i.e. the high temperature and high alkaline optimum) of the xylanase of this invention allow enzymatic treatment during the pulping process and/or right after the pulping process in the brownstock storage tower.

Optionally, during or after the xylanase treatment the pulp can be chemically bleached the conventional way. The chemicals used in the bleaching process can include, but are not limited to hydrogen peroxide, oxygen, ozone, chlorine, chlorine dioxide, nitrogen dioxide, hypochlorites, etc. Those skilled in the art of pulp processing will understand that it may be necessary to optimize the conditions in the method described above, for each particular process to achieve optimal effect.

The use of Bacillus halodurans S7 xylanase in deinking and pulp recycling

The increasing environmental awareness and legislative pressures have generated considerable interest in waste paper recycling in the pulp and paper industry. The quality of recycled pulp depends on the method of recycling. One of the important steps affecting the quality of recycled paper is the deinking. Conventional deinking processes use alkaline conditions and/or surfactants to detach toners from fibers, high temperatures to make

toner surfaces form aggregates and vigorous and high intensity dispersion for size reduction. The cost of chemicals and energy consumption make the deinking step expensive. Moreover, the release of chemicals used in the deinking process raises a serious environmental concern. Thus, minimization of chemical and energy consumption in the deinking process will give an environmental and economic advantage. As an alternative to conventional chemical deinking, enzymatic deinking of wastepaper has received increasing attention during the last few years. For example, cellulases and xylanases have been used to deink waste paper, alone or in combination with conventional deinking chemicals.

Many enzymes which are active and stable are evaluated for waste paper deinking. Compared to neutral or acid active enzymes, alkaline active enzymes have superior deinking properties of mixed office waste. The Bacillus xylanase of this invention can be used in the deinking process. The xylanase is preferably added in a range of 0.5-5 U/g of dry waste paper and incubated at 40 to 65 ⁰ C. It can be used together with conventional chemical deinking chemicals or alone in a pure enzymatic process. The type of deinking, the nature of paper furnish, the operating temperature, pulp consistency, treatment duration, the mixture and dose of enzymes, etc. affect the efficiency of deinking. Thus, it may be necessary to optimize these parameters for each particular recycling facility.

In addition to deinking, enzymatic treatment plays an important role in improving the properties of recycled pulp. Recycled pulp has much lower drainage rate (rate of water removal during paper formation) which greatly slows down paper formation process. In the last few years, improved drainage has been reported when the recycled pulp has been treated with xylanases and cellulases Moreover, xylanases are known to improve "enzyme beating" during conventional chemical deinking

The use of Bacillus halodurans S7 xylanase in detergent Formulation

Hydrolytic alkaline active enzymes such as proteases, cellulases, lipases and amylases have been incorporated in detergent formulations to increase the efficiency of cleaning. Vegetable, fruit, grass, coffee, tea, and tobacco derived stains are known to be very difficult to solubilize and remove during washing. Addition of xylanase to detergents promotes the removal of stains of plant origin. The Bacillus halodurans xylanase of this invention is active and stable under high temperature and alkaline washing conditions and can be dosed from 0.0001% to 2% of the detergent composition weight.

The use of Bacillus halodurans S7 xylanase in feed applications

Chicken feed containing grains like wheat and rye become too viscous and are difficult to be completely digested in the guts of chickens. Addition of xylanase to the feed, with a dosage of 100-5000 U (depending on the feed ingredient) of xylanase per kg of any xylan containing feed, decreases the viscosity of the gut contents and increases nutrient absorption and diffusion of pancreatic enzymes in the digesta hydrolysis. It also changes hemicellulose to sugars so that nutrients formerly trapped within the cell walls are released. The chickens absorb more energy from less feed and grow better. The barn is

cleaner because the feed is more thoroughly digested resulting in drier and less sticky chicken waste. In addition, the eggs are cleaner due to the drier laying area. This application requires a thermostable xylanase as the feed processing and pasteurization involves a high temperature. The xylanase of the present invention is stable at elevated temperatures and can digest the xylan component of the feed during preparation and storage.

The use of Bacillus halodurans S7 xylanase in the separation of starch and gluten

Xylanase in combination with β-glucanase and cellulase effectively increases the yield of starch and gluten in the separation process. A Bacillus halodurans S7 xylanase enzyme addition of 0.001-1% of the flour weight gives a good separation of gluten and starch depending on the botanical source. Moreover the use of these enzymes proved to reduce water and energy consumption, and shorten processing time. It also decreases the pentosan fraction viscosity and cut down the cost of energy required for drying.

The use of Bacillus halodurans S7 xylanase in waste treatment

Enzymes are used to get value added products from wastes such as agricultural residues. Xylanases alone or together with other hydrolytic enzymes can be used in the treatment of agricultural residues to release fermentable sugars for the production of fuel ethanol. Xylose released from xylan by xylanases is also used for xylitol production. Xylanase addition in the biological treatment process of xylan containing industrial or municipal waste could be attractive. These applications require the use of enzymes which are resistant to various organic and inorganic substances and which are able to maintain their activity and stability in wider pH ranges, etc. Impurities, like metal ions in industrial wastes can potentially inhibit the activity of xylanases. The activity of B. halodurans S7 xylanase was not significantly inhibited by the presence of different metal ions or the chelating agent (EDTA). In this regard, the properties of Bacillus halodurans S7 xylanase are attractive. Due to impurities, xylanase inhibitors, and possible low mixing etc waste treatment need higher enzyme dose. It is advisable to add Bacillus halodurans S7 xylanase at a dose of more than 0.1% of the waste weight.

DESCRIPTION OF THE FIGURES

Fig. 1. SDS-PAGE of the purified xylanase. Lane A: purified protein, Lane B: protein molecular weight markers.

Fig. 2. Part of an alignment of amino acid sequences of family 10 xylanases corresponding to positions 146 and 164 of Bacillus halodurans C-125 xylanase (D0087). The accession number for each amino acid sequence is indicated in bracket.

Fig. 3. Growth and xylanase production by recombinant E. coli cells expressing the B. halodurans S7 xylanase gene. The symbols indicate: (♦) OD ₆₀₀ of uninduced culture, (■) ODsoo of induced culture, (Δ) xylanase activity of uninduced culture and (D) xylanase activity of induced culture.

Fig. 4. Effect of pH on the activity of Bacillus halodurans S7 xylanase. The enzyme was incubated at 70 °C with 1 % (w/v) birchwood xyian dissolved in 50 mM sodium acetate (•), sodium phosphate (■), Tris-HCI (±) and Glycine-NaOH (♦). About 0.5 U of the xylanase activity was taken as 100 %.

Fig. 5. The pH stability of Bacillus halodurans S7 xylanase. The enzyme was incubated with 50 mM buffers at 50 ⁰ C for 12 h and residual activity measured under the standard assay conditions. The buffers used were sodium acetate (4-5.5), sodium phosphate (6-7.5), Tris- HCI (8 &. 8.5) and glycine- NaOH (9-12).

Fig. 6. Effect of temperature on Bacillus halodurans S7 xylanase activity. The enzyme activity was determined by incubating the enzyme with 1 % (w/v) birchwood xylan dissolved in 50 mM glycine-NaOH buffer, pH 9 (•) or 10 (■). About 0.4 U of the xylanase activity was taken as 100%.

Fig. 7. Thermal stability of Bacillus halodurans S7 xylanase at pH 9 (♦) and pH 10 (■) at 60 ⁰ C, and at pH 9 (*), 65 °C. The enzyme solution (0.4 U) in 50 mM glycine-NaOH was heated. Samples were taken at different time intervals and residual activity was determined.

MATERIALS AND METHODS

Isolation and characterisation of the organism

A water sample from a soda lake (Shalla, Ethiopia) was added to a 250 ml Erlenmeyer flask containing 25 ml medium composed of (g/l): Bactopeptone (Difco), 5; Xylan (Sigma), 10; NaCI, 2; KH ₂ PO ₄ , 2; MgSO ₄ , 0.1; CaCI ₂ , 0.1; and Na ₂ CO ₃ , 10. The latter was sterilised separately and added to the rest of the medium after cooling. The inoculated medium was incubated at 37 ⁰ C with shaking in an orbital incubator shaker. After 36 h, a loopful of the culture was spread on nutrient agar plates supplemented with 0.5 % (w/v) xylan and incubated. After 48 h, colonies were picked and transferred to fresh plates. Pure colonies obtained through repeated streaking were tested for xylanase production by flooding plates with Congo red. Isolates with clearing zone were considered xylanase positive. Based on the level of production and crude enzyme property, one strain designated as S7 was selected for further study.

Morphological and biochemical characterisation

Some morphological and biochemical tests were carried out following the standard methods (Sneath PHA. Endospore forming Gram-positive rods and cocci. In: Beregy's Manual of Systematic Bacteriology. 1986, 2, 1104-1207).

Bacterial strains and plasmid

The alkaliphilic B. halodurans S7 isolated in our laboratory was used as source of the gene encoding the xylanase (xynlOA). Escherichia coli NovaBlue was used for cloning and E.coli

BL21 (DE3) was used as expression host. The plasmid used for cloning and expression was pET 22b(+). All the items were obtained from Novagen (Novagen Madison, WI, USA).

DM4 extraction, gene amplification and sequencing

Genomic DNA extraction was performed following the method of Sambrook et al. (Sambrook J, Fritsch EF, and Maniatis T. Molecular cloning: a laboratory manual, 2 ^nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, NY, 1989). Plasmid DNA was purified from cells by alkaline lysis method. Plasmids and PCR products were recovered from agarose gel using Qiagen purification kit (Qiagen, Chatsworth, CA) following the manufacturer's instructions.

A pair of primers, SEQ ID No. 1, XyIAF (GGCATAGAGCATGTATTTAG) and SEQ ID No. 2, XyIAR (GGCCTAATTGAATGTTGG) were designed based on the sequence of B. halodurans C-125 xylanase A gene and used to amplify the gene. PCR amplification was for 30 cycles of 1 min at 95 ⁰ C, 1.5 min at 55 ⁰ C and 4 min at 70 ⁰ C using a blend of Pfu and Taq polymerases (Promega). Additional extension was carried out for 7 min at 72 ⁰ C and the product was purified using Qiagen PCR purification kit. The purified product was sequenced in both directions with the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems, USA) following the manufacturer's protocol. Sequencing reactions were electrophoresed using ABI 3100 DNA sequencer. The nucleotide sequence of xynlOA has been deposited in Gene Bank under the accession number AY687345. Has this sequence been deposited according to the Budapest convention, and if so at what date?

The xylanase gene sequence was compared to other xylanase sequences available in public databases using the BLAST algorithm (Altschhul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J MoI Biol 215: 403-410). CLUSTAL W program (Thompson 3D, Higgins DG, Gibson, TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence weighing, position-specific gap penalties and weight matrix choice. Nuclic Acids Res 76: 4350-4354) was used for multiple sequence alignment of amino acid sequences. Amino acid positions referred to in this paper are based on positions of B. halodurans C-125 xynlOA (Ace. No. D00087) starting from the first amino acid of the signal peptide.

Recombinant vector construction and cloning

The mature peptide coding region of the gene was amplified using primers, SEQ ID No. 6, AXNcoI (AATGTAGCCATGGCTCAAGGAGGACCACCAAAATC) and SEQ ID No. 7, AXXhoI (AGTAGCTACCTCGAGATCAATAATTCTCCAGTAAGC) which contain restriction sites for the enzymes Ncol and Xh oϊ, respectively. The PCR product was purified, digested by the restriction enzymes (Ncol and Xhoϊ) and cloned in pET 22b(+) vector. The constructed vector contains pelB leader peptide for possible secretion of the enzyme. At the C- terminus, Leu-Glu-(His) ₆ sequence was added before the stop codon for easy metal ion affinity purification of the expressed protein.

Recombinant protein expression and purification

A single colony of recombinant vector harbouring Ecoli BL21 (DE3) cells was cultured overnight, which was then used to inoculate 100 ml of LB broth containing ampicillin (100 μg/ml) and incubated at 37 ⁰ C and shaking rate of 200 rpm in an orbital shaker incubator. When the optical density (OD) of the culture at 600 nm was about 0.7, IPTG was added to a final concentration of 1 mM. Samples were taken periodically to determine the culture OD and xylanase activity.

Cytoplasmic, periplasmic and extracellular xylanase activity was determined as described in Novagen pET System manual (http://www.novagen.com). The extracellular activity is determined from the cell free culture supernanatnt obtained after centrifugation. The pellet was resuspended in 30 mM Tris-HCI pH 8 buffer containing 20% of sucrose and then EDTA was added to a final concentration of 1 mM. After gentle shaking at room temperature for 10 min, cells were harvested by centrifugation at 4 ⁰ C. Cells were subjected to osmotic shock by resuspending in ice cold 5 mM MgSO ₄ and shaken for 10 min on ice. After centrifugation, periplasmic xylanase activity was determined from the cell free supernatant. The remaining pellet was resuspended and the cytoplasmic content was released by sonication. Cytoplasmic xylanase activity was measured from the clarified lysate of sonicated cells after centrifugation.

Immobilized metal ion affinity chromatography (IMAC) was used to purify the recombinant xylanase. Iminodiacetic acid gel was prepared by covalently binding iminodiacetic acid to epoxy activated Sepharose CL-6B. Cu ²⁺ was coupled to the gel, packed in a column and washed extensively with water. After passing 5 volumes of 50 mM imidazole through it, the column was washed with 5 volumes of water and then equilibrated with at least 5 volumes of binding buffer (20 mM Tris-HCI, pH 7.4 containing 20 mM imidazole and 0.5 M NaCI). The clarified cell homogenate was loaded on the equilibrated IMAC column and then unbound protein was washed off with binding buffer. The bound protein was eluted in a linear gradient of 20-250 mM imidazole in 20 mM Tris-HCI (pH 7.4)/ 0.5 M NaCI. The purity of the eluted protein was checked on SDS-PAGE (10 % (w/v) gel).

Enzyme purification from Bacillus halodurans culture

Cells were removed by centrifugation from a 36 h old culture and the liquid supernatant was used as the enzyme source. The protein was precipitated from the cell-free culture supernatant by adding solid ammonium sulfate to 60 % saturation. The pellet was recovered by centrifugation, dissolved in minimal amount of water and dialysed against deionised water with three changes. Finally, the enzyme solution was equilibrated with 50 mM Tris-HCI buffer, pH 8.0. The dialysate was centrifuged and undissolved material was removed. The clear supernatant was put on DEAE Sepharose fast flow (Amersham Pharmacia) column equilibrated with the same buffer. Elution was performed with a linear gradient of 0-0.5 M NaCI. Fractions exhibiting xylanolytic activity were pooled and concentrated. The concentrate was fractionated using Sephadex G-75 column at a flow rate of 10 ml/h. Xylanolytic fractions were pooled,

concentrated and refractionated on the same G-75 column at a flow rate of 5 ml/h. The enzyme obtained after the second gel filtration was used for characterization.

Protein analysis

The homogeneity of the purified enzyme was checked by Sodium dodecyl sulfate- polyacrylamide gel electrophoresis, using 10 % polyacrylamide gel (Laemmli, UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970, 227, 680-685). Protein bands were developed by silver staining (Oakley BR ₇ Kirsch DR, and Morris NR. A simplified ultrasensitive stain for detecting proteins in polyacrylamide gels. Anal. Biochem. 1980, 105, 361-363).

The isoelectric point of the purified protein was determined by Rotofor using broad range ampholytes (Bio-Rad Laboratories, Hercules, CA 94547). Dialysed, (NH ₄ ) ₂ SO ₄ precipitated protein was subjected to isoelectric focusing after addition of ampholytes (IEF 3-10). The pH and xylanase activity of each fraction were determined.

Protein concentration was determined following bicinchoninc acid method using bovine serum albumin as standard (Smith PK ₁ Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, and Klenk DC. Measurement of protein using bicinchoninc acid. Anal. Biochem. 1985, 150, 76-85).

Enzyme assays

The enzyme activity was determined based on the release of reducing sugar from xylan using the dinitrosalicylic acid (DNS) method (Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 1959, 31, 426-428). A mixture of appropriately diluted enzyme and 1 % (w/v) birchwood xylan dissolved in 50 mM Glycine- NaOH buffer, pH 10 was incubated at 70 ⁰ C for 10 min and then the reaction was stopped by adding DNS reagent. One unit of the xylanase activity was defined as the amount of enzyme that releases 1 μmol of reducing sugar equivalent to xylose per minute under the assay condition. Activity on CMC, avicel, laminarin was tested as for xylanase but using 1 % (w/v) low viscosity carboxymethyl cellulose (CMC), avicel and laminarin respectively as substrate, β-xylosidase, β-glucosidase, arabinofuranosidase and acetyl esterase were determined as described by Ratanakhanokchai et al (Ratanakhanokchai K, Kyu KL, and Tanticharoen M. Purification and properties of a xylan-binding endoxylanase from alkaliphilic Bacillus sp. Strain K-I. Appl. Environ. Microbiol. 1999, 65, 694-697). To examine the effect of metal ions a mixture of appropriately diluted enzyme and 1 % (w/v) birchwood xylan dissolved in 50 mM Glycine-NaOH buffer, pH 10 with the metal ion added to a final concentration of 1 mM or 5 mM respectively, was incubated at 70 ⁰ C for 10 min and then the reaction was stopped by adding DNS reagent. The control (i.e. with no metal ion added) is considered to be 100 %

Kinetic study

The kinetic properties of the enzyme were determined using birchwood xylan at a concentration range of 0.5-10 mg/ml. The apparent Km and Vmax values were calculated using EnzFitter program version 2.0.14.0 (Biosoft).

Substrate binding assay

Binding of the purified enzyme to Avicel and insoluble xylan was determined in pH 7 (Phosphate), 8 (Tris-HCI), 9 and 10 (Glycine-NaOH) buffers at 5 and 25 ⁰ C. Insoluble xylan was prepared by the method of Irwin et al (Irwin D, Jung ED, and Wilson DB. Characterization and sequence of a Thermomonospora fusca xylanase. Appl. Environ, Microbiol. 1994, 60, 763-770). Enzyme (10 U) was mixed with 0.5 g of avicel or insoluble xylan suspended in 10 ml buffer. After 2 h of gentle shaking, the preparation was centrifuged at low speed (lOOOxg) for 10 min and activity in the supernatant was determined. Loss of activity in the supernatant was assumed to be due to binding to the substrate.

Analysis of xylan hydrolysis products

The purified xylanase was mixed with 3 % (w/v) xylan in 50 mM GIy-NaOH buffer, pH 10 and incubated at 60 ⁰ C. Samples were taken out at different time intervals and analysed by high performance thin layer chromatography (HPTLC). Samples (8 μl) were deposited on silica gel plates by CAMAG automatic sampler (CAMAG AT53, Switzerland). The plate was then developed in CAMAG Development Chamber (CAMAG ADC) in a solvent system butanol-ethanol-water (5:3:2) with two ascents. The plate was developed by dipping into 15 % (v/v) H ₂ SO ₄ and heating at 110 ⁰ C until spots became visible. D-xylose, xylobiose, xylotriose, xylotetraose and xylopentose were used as standards.