Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
TIP-1 AND GRP-78 BINDING PEPTIDES AND METHOD OF IDENTIFYING PEPTIDE RECEPTORS
Document Type and Number:
WIPO Patent Application WO/2013/049830
Kind Code:
A2
Inventors:
HALLAHAN, Dennis (One Brookings Drive, St. Louis, Missouri, 63130, US)
WILDMAN, Scott (One Brookings Drive, St. Louis, Missouri, 63130, US)
FERRARO, Daniel (One Brookings Drive, St. Louis, Missouri, 63130, US)
Application Number:
US2012/058329
Publication Date:
April 04, 2013
Filing Date:
October 01, 2012
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
THE WASHINGTON UNIVERSITY (One Brookings Drive, St. Louis, Missouri, 63130, US)
HALLAHAN, Dennis (One Brookings Drive, St. Louis, Missouri, 63130, US)
WILDMAN, Scott (One Brookings Drive, St. Louis, Missouri, 63130, US)
FERRARO, Daniel (One Brookings Drive, St. Louis, Missouri, 63130, US)
International Classes:
C12P21/06
Attorney, Agent or Firm:
RILEY-VARGAS, Rebecca et al. (Polsinelli Shughart PC, Mark Twain Plaza III105 West Vandalia, Suite 40, Edwardsville IL, 62025, US)
Download PDF:
Claims:
CLAIMS

What is claimed is:

1 . A peptide, the peptide consisting of a sequence as listed in Table 1 , Table 2, Table 3, or Table 4.

2. The peptide of claim 1 , wherein the peptide is WQSTTF (SEQ ID NO: 3).

3. The peptide of claim 1 , wherein the peptide is WQSQSQI (SEQ ID NO: 4).

4. The peptide of claim 1 , wherein the peptide is GIRLRG (SEQ ID NO: 8).

5. The peptide of claim 1 , wherein the peptide is GFRFRG (SEQ ID NO: 9).

6. A peptide, wherein the peptide wherein the peptide comprises at least six contiguous amino acids of SEQ ID NO: 5.

7. The peptide of claim 6, wherein the peptide is KTAKKNVFFCSV (SEQ ID NO: 5).

8. A peptide, wherein the peptide comprises at least six contiguous amino acids of SEQ ID NO: 6.

9. The peptide of claim 8, wherein the peptide is RKFLMTTRYSRV (SEQ ID NO: 6).

10. The peptide of claim 9, wherein the peptide is TTRYSRV (SEQ ID NO: 7).

Description:
TIP-1 AND GRP-78 BINDING PEPTIDES AND METHOD OF IDENTIFYING

PEPTIDE RECEPTORS

GOVERNMENTAL RIGHTS

[0001] This invention was made with government support under UL1 RR024992 awarded by the National Center for Research Resources (NCRR), and R01 -CA125757 (DEH) awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF THE INVENTION

[0002] The invention encompasses peptides capable of binding Tip-1 and Grp-78 in irradiated tumors. The invention also encompasses a method of identifying receptors of peptides capable of binding irradiated tumors.

BACKGROUND OF THE INVENTION

[0003] Tumor-targeted drug delivery has the potential to minimize toxicity to normal tissues and improve the bioavailability of therapeutic agents to tumor cells. Targeting ligands include antibodies and peptides that accumulate in tumors by specific binding to molecules present on tumor vasculature, endothelial cells associated with tumor vasculature, and tumor cells. Ideally, a targeting molecule should display sufficient affinity to the irradiated tumor, and specific targeting in the absence of substantial binding to normal tissues.

Biopanning techniques have successfully identified a number of targeting peptides capable of targeting irradiated tumors. However, currently available targeting peptides also bind normal tissues and/or do not bind tumors with sufficient affinity.

[0004] In addition, once a peptide has been identified, the next step is to identify its binding partner. However, routine methods for identification of peptide-protein interactions are time-consuming, require extensive optimization for each identified protein-peptide pair, and are labor-intensive and costly. [0005] Thus, there exists a long-felt need in the art for methods of identifying peptide ligands with site-specific tumoral delivery of therapeutic with sufficient affinity. In addition, there is a need for a simple, efficient, and cost- effective method of identifying the protein receptor for a peptide ligand capable of binding a tumor.

REFERENCE TO COLOR FIGURES

[0006] The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee.

BRIEF DESCRIPTION OF THE FIGURES

[0007] FIG. 1 depicts micrograph images showing Tip-1

translocation to the cell membrane after cell exposure to ionizing radiation.

[0008] FIG. 2 depicts a diagram showing the short peptide phage display biopanning process used to identify the HVGGSSV (SEQ ID NO: 1 ) peptide.

[0009] FIG. 3 depicts a plot showing the relative association of the purified recombinant proteins to the synthetic peptides as evaluated with ELISA. Tip-1 (H90A) is a mutant Tip-1 protein with a dysfunctional PDZ domain.

[0010] FIG. 4 depicts a plot and an image showing anti-Tip-1 antibody blocking HVGGSSV (SEQ ID NO: 1 ) binding both in vitro and in vivo. (A) ELISA-based in vitro competition assay. Serially diluted antibodies were respectively pre-incubated with purified GST/TIP-1 proteins (100 ng/well) before the complex was added to the plates coated with the HVGGSSV (SEQ ID NO: 1 ) peptide (50 ng/well). The GST/TIP-1 protein associated to the immobilized HVGGSSV peptide was detected with GST-specific antibody. (B) Optical images of LLC tumor-bearing mice that were co-administrated with the Alexa Fluor 750- labeled HVGGSSV (SEQ ID NO: 1 ) peptide and antibodies. LLC tumors in the left hind limbs were irradiated at 5 Gy (pointed with arrows). 200 μg of the TIP-1 antibody, or the control antibody, was injected at 2 hours post the IR treatment, followed by injection of Alexa Fluor 750-labeled HVGGSSV (SEQ ID NO: 1 ) peptide at 4 hours post the IR treatment. Optical images were acquired 24 hours after the peptide injection. The presented data represent three independent experiments.

[001 1] FIG. 5 depicts optical images of LLC tumor-bearing mice that were administrated with (A) the Alexa Fluor 750-labeled HVGGSSV (SEQ ID NO: 1 ) peptide, or (B) the Alexa Fluor 750-labeled NQLAWFDTDL (SEQ ID NO: 17) native Tip-1 ligand. LLC tumors in the right hind limbs were irradiated at 3 Gy. The yellow arrows mark examples of the non-specific nature of the native peptide, with binding in the unirradiated tumor as well as in the abdominal region. The red arrow shows that HVGGSSV (SEQ ID NO: 1 ) does have some nonspecific binding.

[0012] FIG. 6 depicts two graphs used to determine affinity of the HVGGSSV (SEQ ID NO: 1 ) peptide to Tip-1 through surface plasmon resonance (SPR) spectroscopy. (A) SPR sensograms. (B) Plot of peptide dissociation phase versus the concentration of the peptide.

[0013] FIG. 7 depicts the atomic structure of Tip-1 demonstrating two distinct binding clefts; a canonical PDZ domain binding site (orange circle), and a hydrophobic binding pocket (purple circle). The image was created using the known structure of Tip-1 with native ligand present in the active site (PDBID 3DIW) using the rendering package included in the Molecular Operating

Environment software package.

[0014] FIG. 8 depicts atomic structures and amino acid

substitutions used for generation of a peptide library based on structural constraints observed in the Tip-1 structure. (A) Atomic structure of the 7-mer version of the binding peptide HVGGSSV (SEQ ID NO: 1 ). (B) Atomic structure of the 6-mer version of the binding peptide HVGGSSV (SEQ ID NO: 1 ). (C) depicts the base sequence (blue) of the 7-mer version of the peptide and possible substitutions at each site. (D) depicts the base sequence (blue) of the 6- mer version of the peptide and possible substitutions at each site. (E) depicts the base sequence (blue) of the Tip-1 control sequence and possible substitutions at each site.

[0015] FIG. 9 depicts sequences and molecular models showing predicted consensus binding sequences for Tip-1 based on computational modeling. (A) sequence of the 6-mer peptide showing top-scoring (highest affinity) residues by position. (B) molecular model of the 6-mer peptide binding to Tip-1 . (C) sequence of the 7-mer peptide showing top-scoring (highest affinity) residues by position. (D) molecular model of the 7-mer peptide binding to Tip-1 .

[0016] FIG. 10 depicts (A) a pseudocolor image of the fluorescence at 635 nm / 700 nm for the Tip-1 binding assay and (B) a scatter plot of in silico predicted binding affinity versus in vitro binding affinity determined using the chip data.

[0017] FIG. 11 depicts sequences showing predicted consensus binding sequences for Grp-78 based on computational modeling. (A) the base sequence (GIRLRG (SEQ ID NO: 8)) of the 6-mer peptide and possible substitutions at each site. (B) sequence of the 6-mer peptide showing top-scoring (highest affinity) residues by position.

[0018] FIG. 12 depicts an image of DNA gel electrophoresis and electropherograms showing analysis of DNA specific to proteins that bind cancer- specific peptides using phage display technology. DNA was analyzed from phage inserts of peptide-specific phage DNA and non-peptide specific phage DNA. Phage insert DNA was obtained from sample specific phage DNA from the fifth round of biopanning following PCR amplification and purification. The DNA was analyzed on the Agilent 2100 Bioanalyzer using the DNA 12000 assay. (A) DNA from phage inserts of peptide-specific phage DNA and non-peptide specific phage DNA. Lane 1 shows DNA from pooled peptide-specific phage inserts. Lane 2 shows control phage inserts from non-peptide specific phage inserts. (B) Electropherogram of phage insert DNA specific to cancer- targeting peptides. This DNA was obtained from equal amounts of phage insert DNA from cancer- targeting peptides biopanned in this study pooled together. (C) Electropherogram of phage insert DNA obtained from control samples without cancer-targeting peptides. DNA was obtained from amplified phage of the fifth round of

biopanning with beads lacking a cancer-targeting peptide.

[0019] FIG. 13 depicts a plot showing distribution of genes based on normalized microarray signal. A cutoff of 4 standard deviations above the mean signal (Log signal of 3.464) was used to prioritize putative binding proteins. A total of 1 13 genes were identified as encoding putative binding proteins based on the microarray analysis.

[0020] FIG. 14 depicts real time PCR signals and threshold cycles of real time PCR of phage DNA. (A) Real-time PCR for all peptides was run in triplicate using primers for TIP-1 . (B) Threshold cycles for TTRYSRV (SEQ ID NO: 7) (peptide 4) and NVFFCSV (SEQ ID NO: 14) (peptide 9) were significantly lower than those of all other peptides and controls with values of 15.0 and 19.8, respectively, suggesting the presence of TIP-1 DNA in the phage recovered from these peptides.

[0021] FIG. 15 depicts computational models of HVGGSSV (SEQ ID NO: 1 ), TTRYSRV (SEQ ID NO: 7), and NVFFCSV (SEQ ID NO: 14) to the PDZ binding site of TIP-1 . (A) HVGGSSV (SEQ ID NO: 1 ) binds in the PDZ binding site of TIP-1 . The peptides NVFFCSV (SEQ ID NO: 14) (B) and

TTRYSRV (SEQ ID NO: 7) (C) are also predicted to favorably interact and bind to the PDZ binding site of TIP-1 . When the modeled peptides are overlaid (D), minimal change in the peptide backbone is predicted.

[0022] FIG. 16 depicts an image of an electrophoretic mobility shift assay (EMSA). RKFLMTTRYSRV (SEQ ID NO: 6) and truncated form TTRYSRV (SEQ ID NO: 7) strongly bind TIP-1 . The EMSA assay demonstrates that the peptides RKFLMTTRYSRV (SEQ ID NO: 6) and TTRYSRV (SEQ ID NO: 7) bind strongly to TIP-1 . The peptide KTAKKNVFFCSV (SEQ ID NO: 5) demonstrated minimal binding to TIP-1 . The positive control peptide HVGGSSV(SEQ ID NO: 1 ) also binds TIP-1. The signal between the region of high molecular weight (representing TIP-1 ) and low molecular weight (representing free peptide) may represent dimerized peptide, likely through the free cysteine.

DETAILED DESCRIPTION OF THE INVENTION

[0023] Peptides ligands capable of binding protein receptors in irradiated tumors have been developed. Importantly, the peptides are capable of binding protein receptors in irradiated tumors with high affinity and specificity.

[0024] In addition, the invention encompasses a method of identifying a protein receptor for a peptide ligand capable of binding a tumor. Advantageously, a method of the invention may be used in parallel with peptide biopanning to facilitate prioritization of peptides capable of binding protein targets specifically expressed in tumor tissues.

I. Peptides

[0025] One aspect of the present invention provides peptide ligands (peptides) capable of specifically binding the Tip-1 protein in an irradiated tumor. Through biopanning, the inventors discovered that the peptide HVGGSSV (SEQ ID NO: 1 ) specifically binds the Tip-1 protein in an irradiated tumor. The Tip-1 protein translocates to the cell surface in tumors after exposure to ionizing radiation. The Tip-1 protein comprises a single PDZ domain. It was discovered that the HVGGSSV (SEQ ID NO: 1 ) peptide binds Tip-1 at the PDZ domain. It was also discovered that the HVGGSSV (SEQ ID NO: 1 ) peptide may be used to identify other peptide sequences capable of binding the PDZ domain of Tip-1 using computational methods, and in vitro binding with Tip-1 . Using these methods, 6 and 7 amino acid peptides that bind Tip-1 were generated.

[0026] Another aspect of the present invention provides peptides capable of specifically binding the Grp-78 protein in an irradiated tumor. The inventors discovered that the peptide GIRLRG (SEQ ID NO: 8) specifically binds the Grp-78 protein in an irradiated tumor. It was also discovered that the GIRLRG (SEQ ID NO: 8) peptide may be used to identify other peptide sequences capable of binding Grp-78 using computational methods, and in vitro binding with Grp-78. Using these methods, 6 amino acid peptides that may bind Grp-78 were generated.

[0027] As used herein, the terms "targeting peptide" or "peptide ligand" each refer to a peptide as defined herein that binds to an irradiated tumor.

[0028] The tumors, the peptides and the sequences of the peptides are described below.

(a) Tip-1 peptides comprising 6 amino acids

[0029] In one embodiment, the peptide of the invention capable of binding Tip-1 comprises the 6 amino acid sequence A1-A2-A3-A4-A5-A6.

[0030] Α Ϊ may be selected from the group consisting of histidine, tyrosine, tryptophan, asparagine, glutamine, and phenylalanine. In some embodiments, Ai is tyrosine. In other embodiments, Ai is asparagine. In yet other embodiments, Ai is glutamine. In other embodiments, Ai is phenylalanine. In preferred embodiments, Ai is histidine. In exemplary embodiments, Ai is tryptophan.

[0031] A 2 may be selected from the group consisting of valine, asparagine, glutamine, cysteine, and glutamic acid. In some embodiments, A 2 is cysteine. In some preferred embodiments, A 2 is valine. In other preferred embodiments, A 2 is asparagine. In yet other preferred embodiments, A 2 is glutamic acid. In exemplary embodiments, A 2 is glutamine.

[0032] A3 may be selected from the group consisting of glycine, alanine, and serine. In some preferred embodiments, A 3 is glycine. In other preferred embodiments, A3 is alanine. In exemplary embodiments, A3 is serine.

[0033] A4 may be selected from the group consisting of serine, threonine, cysteine, asparagine, glutamine, and tyrosine. In some embodiments, A4 is cysteine. In other embodiments, A4 is glutamine. In some preferred embodiments, A 4 is serine. In other preferred embodiments, A 4 is asparagine. In yet other preferred embodiments, A 4 is tyrosine. In exemplary embodiments, A^ is threonine.

[0034] A 5 may be selected from the group consisting of serine, threonine, cysteine, asparagine, glutamine, and tyrosine. In some embodiments, A 5 is cysteine. In other embodiments, A 5 is glutamine. In yet other embodiments, A5 is asparagine. In some preferred embodiments, A5 is serine. In other preferred embodiments, A5 is tyrosine. In exemplary embodiments, A5 is threonine.

[0035] A 6 may be selected from the group consisting of valine, isoleucine, leucine, and phenylalanine. In some embodiments, Ae is leucine. In some preferred embodiments, A 6 is valine. In other preferred embodiments, A 6 is phenylalanine. In exemplary embodiments, Ae is isoleucine.

[0036] In some embodiments, a 6 amino acid peptide capable of binding Tip-1 comprises a sequence as listed in Table 2. In preferred

embodiments, a 6 amino acid peptide capable of binding Tip-1 comprises a sequence as listed in Table 1.

[0037] In some embodiments, a 6 amino acid peptide capable of binding Tip-1 is HVGSSV (SEQ ID NO: 2). In other embodiments, a 6 amino acid peptide capable of binding Tip-1 is WQSTTF (SEQ ID NO: 3).

(b) Tip-1 peptides comprising 7 amino acids

[0038] In one embodiment, the peptide of the invention comprises the sequence A7-A8-A9-A10-A11-A12-A13.

[0039] A 7 may be selected from the group consisting of histidine, tyrosine, tryptophan, asparagine, glutamine, and phenylalanine. In some embodiments, A 7 is asparagine. In other embodiments, A 7 is glutamine. In a preferred embodiment, A 7 is histidine. In another preferred embodiment, A 7 is tyrosine. In yet another preferred embodiment, A 7 is phenylalanine. In an exemplary embodiment, A 7 is tryptophan.

[0040] A 8 may be selected from the group consisting of valine, asparagine, glutamine, cysteine, and glutamic acid. In some embodiments, As is cysteine. In some preferred embodiments, As is asparagine. In other preferred embodiments, As is glutamic acid. In yet other preferred embodiments, As is valine. In exemplary embodiments, A 8 is glutamine.

[0041] A 9 may be selected from the group consisting of glycine, alanine, and serine. In some preferred embodiments, Ag is glycine. In other preferred embodiments, Ag is alanine. In exemplary embodiments, Ag is serine.

[0042] Aio may be selected from the group consisting of glycine, asparagine, glutamine, cysteine, serine, threonine, and proline. In some embodiments, Aio is cysteine. In other embodiments, Aio is serine. In yet other embodiments, Aio is threonine. In other embodiments, Aio is proline. In preferred embodiments, Aio is glycine. In other preferred embodiments, Aio is asparagine. In exemplary embodiments, Ai 0 is glutamine.

[0043] A may be selected from the group consisting of serine, and threonine. In some embodiments, A is threonine. In exemplary embodiments, A is serine.

[0044] A 12 may be selected from the group consisting of serine, threonine, cysteine, asparagine, glutamine, and tyrosine. In some embodiments, Ai 2 is cysteine. In preferred embodiments, Ai 2 is asparagine. In other preferred embodiments, Ai 2 is serine. In more preferred embodiments, Ai 2 is threonine. In other more preferred embodiments, Ai 2 is tyrosine. In exemplary embodiments, Ai 2 is glutamine.

[0045] Ai3 may be selected from the group consisting of valine, isoleucine, leucine, and phenylalanine. In some embodiments, A13 is leucine. In other embodiments, A 13 is phenylalanine. In preferred embodiments, A 13 is valine. In exemplary embodiments, A13 is isoleucine.

[0046] In some embodiments, a 7 amino acid peptide capable of binding Tip-1 comprises a sequence as listed in Table 2. In preferred

embodiments, a 7 amino acid peptide capable of binding Tip-1 comprises a sequence as listed in Table 1. [0047] In some embodiments, a 7 amino acid peptide capable of binding Tip-1 is HVGGSSV (SEQ ID NO: 1 ). In other embodiments, a 7 amino acid peptide capable of binding Tip-1 is WQSQSQI (SEQ ID NO: 4).

(c) other Tip-1 peptides

[0048] In some embodiments, a peptide capable of binding Tip-1 is KTAKKNVFFCSV (SEQ ID NO: 5). In other embodiments, a peptide capable of binding Tip-1 comprises at least 6 contiguous amino acids of SEQ ID NO: 5. For instance, the peptide may comprise 5, 6, 7, 8, 9, 10, 1 1 , or 12 contiguous amino acids of SEQ ID NO: 5.

[0049] In other embodiments, a peptide capable of binding Tip-1 is RKFLMTTRYSRV (SEQ ID NO: 6). In other embodiments, a peptide capable of binding Tip-1 comprises at least 6 contiguous amino acids of SEQ ID NO:6. For instance, the peptide may comprise 5, 6, 7, 8, 9, 10, 1 1 , or 12 contiguous amino acids of SEQ ID NO: 5. In a preferred embodiment, a peptide capable of binding Tip-1 is TTRYSRV (SEQ ID NO: 7).

[0050] The peptides may further comprise conservatively substituted variants of the peptides described above. The term "conservatively substituted variant" may refer to a peptide wherein one or more residues have been conservatively substituted with a functionally similar residue and which displays the targeting activity as described herein. The phrase "conservatively substituted variant" also includes peptides wherein a residue is replaced with a chemically derivatized residue, provided that the resulting peptide displays targeting activity as disclosed herein.

[0051] Examples of conservative substitutions include the substitution of one non-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another; the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and

asparagine, between glycine and serine; the substitution of one basic residue such as lysine, arginine or histidine for another; or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another.

(d) Grp-78 peptides

[0052] In one embodiment, a peptide of the invention is capable of binding Grp-78 in irradiated cancer cells and comprises the sequence A14-A15-

[0053] A 14 may be selected from the group consisting of glycine, alanine, and cysteine. In some embodiments, A14 is alanine. In preferred embodiments, Ai 4 is cysteine. In exemplary embodiments, Ai 4 is glycine.

[0054] Ai 5 may be selected from the group consisting of isoleucine, phenylalanine, tyrosine, cysteine, glutamine, and glutamic acid. In some embodiments, A15 is glutamine. In other embodiments, A15 is glutamic acid. In some preferred embodiments, A15 is isoleucine. In other preferred embodiments, Ai 5 is tyrosine. In still other preferred embodiments, A15 is cysteine. In exemplary embodiments, A 15 is phenylalanine.

[0055] A16 may be selected from the group consisting of arginine, lysine, glutamine, and asparagine. In some embodiments, A16 is asparagine. In some preferred embodiments, A16 is lysine. In other preferred embodiments, A16 is glutamine. In exemplary embodiments, Ai 6 is arginine.

[0056] Ai7 may be selected from the group consisting of leucine, isoleucine, valine, phenylalanine, tyrosine, glutamine, and cysteine. In some embodiments, A17 is tyrosine. In other embodiments, A17 is glutamine. In yet other embodiments, A17 is cysteine. In preferred embodiments, A17 is isoleucine. In other preferred embodiments, A17 is leucine. In yet other preferred

embodiments, A17 is valine. In exemplary embodiments, A17 is phenylalanine.

[0057] A18 may be selected from the group consisting of arginine, lysine, glutamine, and asparagine. In some embodiments, Ai 8 is glutamine. In other embodiments, Ai 8 is asparagine. In preferred embodiments, Ai 8 is lysine. In exemplary embodiments, Ai 8 is arginine. [0058] Ai9 may be selected from the group consisting of glycine, serine, threonine, aspartic acid, glutamic acid, glutamine, and cysteine. In some embodiments, Ai 9 is glutamic acid. In other embodiments, Ai 9 is glutamine. In yet other embodiments, Ai 9 is cysteine. In preferred embodiments, Ai 9 is serine. In other preferred embodiments, Ai 9 is threonine. In yet other preferred

embodiments, Ai 9 is aspartic acid. In exemplary embodiments, Ai 9 is glycine.

[0059] In some embodiments, a peptide the peptide of the invention capable of binding Grp-78 comprises a sequence as listed in Table 4. In preferred embodiments, a peptide capable of binding Tip-1 comprises a sequence as listed in Table 3. In a preferred embodiment, a peptide capable of binding Tip-1 is GIRLRG (SEQ ID NO: 8). In an exemplary embodiment, a peptide capable of binding Tip-1 is GFRFRG (SEQ ID NO: 9).

(e) biopanning

[0060] The peptides of the invention were identified using in vivo biopanning of peptide libraries for isolation of peptides that specifically bind an irradiated tumor. Methods of biopanning ligand libraries for isolation of targeting peptides that specifically bind an irradiated tumor are known in the art, and may be as described in U.S. Pat. No. 7,968,675; U.S. Pat. No. 7,402,392; U.S. Pat. No. 7,906,102; U.S. Pat. No. 7,306,925; Jaboin et al. Methods in Molecular Biology, 542:285-300; Wang et al. PLoS One. 2010; 5(8): e12051 ; and

International Publication WO2005042780, the disclosures of which are

incorporated herein by reference in their entireties.

[0061] In short, biopanning of peptide libraries for isolation of peptides that specifically bind an irradiated tumor may include the steps of (a) exposing a tumor to ionizing radiation; (b) contacting the irradiated tumor with a library of peptides; and (c) identifying peptides of the library capable of specifically binding tumor tissue but not control tissue. Each step of the method may be sequentially repeated to facilitate peptide selection. [0062] The term "in vivo", as used herein to describe methods of panning, refers to contacting of one or more peptides to endogenous candidate target molecules, wherein the candidate target molecules are naturally present in a subject or a tumor biopsy from a subject, and the contacting occurs in the subject or in the biopsied tumor. By contrast, "in vitro" panning refers to contacting a library of candidate ligands with one or more isolated or

recombinantly produced target molecules.

[0063] As used herein, the term "control tissue" as used herein refers to a site suspected to substantially lack binding and/or accumulation of an administered ligand. For example, in accordance with the methods of the present invention, a non-irradiated tumor and a non-cancerous tissue may be control tissues.

[0064] The term "binding" refers to an affinity between two molecules, for example, a peptide and a target protein such as Tip-1 or Grp-78. As used herein, "binding" means a preferential binding of one molecule for another in a mixture of molecules.

[0065] The phrases "specifically binds" and "selectively binds" may be used interchangeably, and refer to the binding capacity of a peptide which is determinative of the presence of the protein in a heterogeneous population of proteins and other biological materials.

[0066] The term "tumor" as used herein refers to both primary and metastasized solid tumors and carcinomas of any tissue, including but not limited to breast; colon; rectum; lung; oropharynx; hypopharynx; esophagus; stomach; pancreas; liver; gallbladder; bile ducts; small intestine; urinary tract including kidney, bladder and urothelium; female genital tract including cervix, uterus, ovaries (e.g., choriocarcinoma and gestational trophoblastic disease); male genital tract including prostate, seminal vesicles, testes and germ cell tumors; endocrine glands including thyroid, adrenal, and pituitary; skin (e.g.,

hemangiomas and melanomas), bone or soft tissues; blood vessels (e.g., Kaposi's sarcoma); brain, nerves, eyes, and meninges (e.g., astrocytomas, gliomas, glioblastomas, retinoblastomas, neuromas, neuroblastomas,

Schwannomas and meningiomas). The term "tumor" also encompasses solid tumors arising from hematopoietic malignancies such as leukemias, including chloromas, plasmacytomas, plaques and tumors of mycosis fungoides and cutaneous T-cell lymphoma/leukemia, and lymphomas including both Hodgkin's and non-Hodgkin's lymphomas. Tumors are described in more detail in section 11(b) below.

[0067] As used herein, the term "peptide library" may be used to describe a collection of peptide molecules. A peptide library may comprise a few or a large number of different molecules. For instance, a peptide library may comprise about ten peptides to about 100 peptides, about 50 to about 1000 peptides, about 500 to about a million or up to several billion peptides or more. A peptide of the peptide library may comprise a naturally occurring peptide, or a synthetic peptide which is not found in nature. In preferred embodiments, the peptide library comprises a synthetic peptide. Optionally, a plurality of peptide libraries may be employed simultaneously for biopanning.

[0068] A peptide library may comprise a random collection of peptides or may comprise a collection of molecules having a bias for a particular sequence, structure, or conformation. See e.g., U.S. Pat. No. 5,264,563.

Methods for preparing libraries containing diverse populations of various types of molecules are known in the art and may be as described in U.S. patents cited herein above. Peptide libraries may also be commercially available.

Representative peptide libraries may be as described in U.S. Pat. Nos.

6, 156,51 1 , 6, 107,059, 5,922,545, and 5,223,409, the disclosures of which are incorporated herein by reference in their entireties.

[0069] The peptides in a peptide library may comprise about three or more amino acids, at least five, six, seven, or eight amino acids, about 50 or 100 amino acids, or about 200 to 300 or more amino acids.

[0070] The peptides in a peptide library may be linear, branched, or cyclic, and may include nonpeptidyl moieties. The peptides may comprise naturally occurring amino acids, synthetic amino acids, genetically encoded amino acids, non-genetically encoded amino acids, and combinations thereof.

[0071] The peptides of a library may be produced in vitro, or may be synthesized in vivo, for example by expression of a peptide in vivo. Also, the molecules of a library may be displayed on any relevant support, for example, on bacterial pili (Lu et al., 1995) or on phage (Smith, 1985).

[0072] In a preferred embodiment of the invention, the method for in vivo panning is performed using a phage peptide library. Phage display is a method to discover peptide ligands while minimizing and optimizing the structure and function of proteins. Phage are used as a scaffold to display recombinant libraries of peptides and provide a means to recover and amplify the peptides that bind to putative receptor molecules in vivo. In vivo phage selection simultaneously provides positive and subtractive screens based on the spatial separation of normal tissues and tumors. Phage that specifically bind to normal tissues are removed while specific phage that bind target molecules present in irradiated tumors are enriched through serial rounds of biopanning.

[0073] In some embodiments, the peptide library is a T7 phage display peptide library. The T7 phage has an icosahedral capsid made of 415 proteins encoded by gene 10 during its lytic phase. The T7 phage display system has the capacity to display peptides up to 15 amino acids in size at a high copy number (415 per phage). Unlike filamentous phage display systems, peptides displayed on the surface of T7 phage are not capable of peptide secretion. T7 phage also replicate more rapidly and are robust when compared to other phage. The stability allows for biopanning selection procedures that require persistent phage infectivity.

[0074] A phage peptide library to be used in accordance with the panning methods of the present invention can also be constructed in a filamentous phage, for example M13 or M13-derived phage. Preferably, the encoded antibodies are displayed at the exterior surface of the phage, for example by fusion to M13 vital protein 8. Methods for preparing M13 libraries are known in the art and may be as described in Sambrook & Russell (2001 ) Molecular Cloning: A Laboratory Manual , 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., among other places.

(f) peptide variations and modifications

[0075] A peptide of the invention may be subject to various changes, substitutions, insertions, and deletions where such changes provide for certain advantages in its use. Thus, the invention encompasses any of a variety of forms of peptide derivatives, that include amides, conjugates with proteins, cyclized peptides, polymerized peptides, conservatively substituted variants, analogs, fragments, peptoids, chemically modified peptides, and peptide mimetics.

[0076] Peptides of the invention may comprise naturally occurring amino acids, synthetic amino acids, genetically encoded amino acids, non- genetically encoded amino acids, and combinations thereof. Peptides may include both L-form and D-form amino acids.

[0077] Representative non-genetically encoded amino acids may include but are not limited to 2-aminoadipic acid; 3-aminoadipic acid; β- aminopropionic acid; 2-aminobutyric acid; 4-aminobutyric acid (piperidinic acid); 6-aminocaproic acid; 2-aminoheptanoic acid; 2-aminoisobutyric acid; 3- aminoisobutyric acid; 2-aminopimelic acid; 2,4-diaminobutyric acid; desmosine; 2,2'-diaminopimelic acid; 2,3-diaminopropionic acid; N-ethylglycine; N- ethylasparagine; hydroxylysine; allo-hydroxylysine; 3-hydroxyproline; 4- hydroxyproline; isodesmosine; allo-isoleucine; N-methylglycine (sarcosine); N- methylisoleucine; N-methylvaline; norvaline; norleucine; and ornithine.

[0078] Representative derivatized amino acids may include for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t- butyloxycarbonyl groups, chloroacetyl groups or formyl groups. Free carboxyl groups can be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups can be derivatized to form O-acyl or O-alkyI derivatives. The imidazole nitrogen of histidine can be derivatized to form N-im-benzylhistidine.

[0079] The term "conservatively substituted variant" refers to a peptide comprising an amino acid residue sequence to a sequence of a reference ligand of radiation inducible target in which one or more residues have been

conservatively substituted with a functionally similar residue and which displays the targeting activity as described herein. The phrase "conservatively substituted variant" also includes peptides wherein a residue is replaced with a chemically derivatized residue, provided that the resulting peptide displays targeting activity as disclosed herein.

[0080] Examples of conservative substitutions include the substitution of one non-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another; the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and

asparagine, between glycine and serine; the substitution of one basic residue such as lysine, arginine or histidine for another; or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another.

[0081] Peptides of the present invention also include peptides comprising one or more additions and/or deletions or residues relative to the sequence of a peptide whose sequence is disclosed herein, so long as the requisite targeting activity of the peptide is maintained. The term "fragment" refers to a peptide comprising an amino acid residue sequence shorter than that of a peptide disclosed herein.

[0082] Additional residues may also be added at either terminus of a peptide for the purpose of providing a "linker" by which the peptides of the present invention can be conveniently affixed to a label or solid matrix, or carrier. Amino acid residue linkers are usually at least one residue and can be 40 or more residues, more often 1 to 10 residues, but do alone not constitute radiation inducible target ligands. Typical amino acid residues used for linking are tyrosine, cysteine, lysine, glutamic and aspartic acid, or the like. In addition, a peptide can be modified by terminal-NH 2 acylation (e.g., acetylation, or thioglycolic acid amidation) or by terminal-carboxylamidation (e.g., with ammonia, methylamine, and the like terminal modifications). Terminal modifications are useful, as is well known, to reduce susceptibility by proteinase digestion, and therefore serve to prolong half life of the peptides in solutions, particularly biological fluids where proteases can be present.

[0083] Peptide cyclization is also a useful terminal modification, and is particularly preferred also because of the stable structures formed by cyclization and in view of the biological activities observed for such cyclic peptides as described herein. An exemplary method for cyclizing peptides is described by Schneider & Eberle (1993) Peptides, 1992: Proceedings of the Twenty-Second European Peptide Symposium, Sep. 13-19, 1992, Interlaken, Switzerland, Escom, Leiden. Typically, tertbutoxycarbonyl protected peptide methyl ester is dissolved in methanol and sodium hydroxide solution are added and the admixture is reacted at 20° C. to hydrolytically remove the methyl ester protecting group. After evaporating the solvent, the tertbutoxycarbonyl protected peptide is extracted with ethyl acetate from acidified aqueous solvent. The

tertbutoxycarbonyl protecting group is then removed under mildly acidic conditions in dioxane cosolvent. The unprotected linear peptide with free amino and carboxyl termini so obtained is converted to its corresponding cyclic peptide by reacting a dilute solution of the linear peptide, in a mixture of dichloromethane and dimethylformamide, with dicyclohexylcarbodiimide in the presence of 1 - hydroxybenzotriazole and N-methylmorpholine. The resultant cyclic peptide is then purified by chromatography.

[0084] The term "peptoid" as used herein refers to a peptide wherein one or more of the peptide bonds are replaced by pseudopeptide bonds including but not limited to a carba bond (CH 2 — CH 2 ), a depsi bond (CO— O), a

hydroxyethylene bond (CHOH— CH 2 ), a ketomethylene bond (CO— CH 2 ), a methylene-oxy bond (CH 2 — O), a reduced bond (CH 2 — NH), a thiomethylene bond (CH 2 — S), a thiopeptide bond (CS— NH), and an N-modified bond (— NRCO— ). See e.g. Corringer et al. (1993) J Med Chem 36:166-172; Garbay- Jauregiuberry et al. (1992) Int J Pept Protein Res 39:523-527; Tung et al. (1992) Pept Res 5:1 15-1 18; Urge et al. (1992) Carbohydr Res 235:83-93; Pavone et al. (1993) Int J Pept Protein Res 41 :15-20.

[0085] Peptides of the present invention, including peptoids, may be synthesized by any of the techniques that are known to those skilled in the art of peptide synthesis. Synthetic chemistry techniques, such as a solid-phase

Merrifield-type synthesis, may be preferred for reasons of purity, antigenic specificity, freedom from undesired side products, ease of production and the like. A summary of representative techniques can be found in Stewart & Young (1969) Solid Phase Peptide Synthesis. Freeman, San Francisco; Merrifield (1969) Adv Enzymol Relat Areas Mol Biol 32:221 -296; Fields & Noble (1990) Int J Pept Protein Res 35: 161 -214; and Bodanszky (1993) Principles of Peptide Synthesis. 2nd rev. ed. Springer-Verlag, Berlin; New York. Solid phase synthesis techniques can be found in Andersson et al. (2000) Biopolymers 55:227-250, references cited therein, and in U.S. Pat. Nos. 6,015,561 , 6,015,881 , 6,031 ,071 , and 4,244,946. Peptide synthesis in solution is described by Schroder & Lubke (1965) The Peptides. Academic Press, New York. Appropriate protective groups usable in such synthesis are described in the above texts and in McOmie (1973) Protective Groups in Organic Chemistry. Plenum Press, London, New York. Peptides that include naturally occurring amino acids can also be produced using recombinant DNA technology. In addition, peptides comprising a specified amino acid sequence can be purchased from commercial sources (e.g., Biopeptide Co., LLC of San Diego, Calif, and PeptidoGenics of Livermore, Calif.).

[0086] Any peptide or peptide mimetic of the present invention may be used in the form of a pharmaceutically acceptable salt. Suitable acids which are capable of forming a pharmaceutically acceptable salt with the peptides of the present invention include inorganic acids such as trifluoroacetic acid (TFA), hydrochloric acid (HCI), hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, phosphoric acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, fumaric acid, anthranilic acid, cinnamic acid, naphthalene sulfonic acid, sulfanilic acid or the like.

[0087] Suitable bases capable of forming salts with the peptides of the present invention include inorganic bases such as sodium hydroxide, ammonium hydroxide, potassium hydroxide and the like; and organic bases such as mono- di- and tri-alkyl and aryl amines (e.g. triethylamine, diisopropyl amine, methyl amine, dimethyl amine and the like), and optionally substituted ethanolamines (e.g. ethanolamine, diethanolamine and the like).

[0088] Additionally, the agents may be formulated into pharmaceutical compositions and administered by a number of different means that may deliver a therapeutically effective dose. Such compositions may be administered orally, parenterally, by inhalation spray, rectally, intradermally, transdermal^, or topically in dosage unit formulations containing conventional nontoxic

pharmaceutically acceptable carriers, adjuvants, and vehicles as desired. Topical administration may also involve the use of transdermal administration such as transdermal patches or iontophoresis devices. The term parenteral as used herein includes subcutaneous, intravenous, intramuscular, or intrasternal injection, or infusion techniques. Formulation of drugs is discussed in, for example, Hoover, John E., Remington's Pharmaceutical Sciences, Mack

Publishing Co., Easton, Pa. (1975), and Liberman, H. A. and Lachman, L, Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y. (1980).

[0089] Injectable preparations and formulations for parenteral administration may be prepared as described above. Solid dosage forms for oral administration may include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the compound is ordinarily combined with one or more adjuvants appropriate to the indicated route of administration. If administered per os, the compound can be admixed with lactose, sucrose, starch powder, cellulose esters of alkanoic acids, cellulose alkyl esters, talc, stearic acid, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acids, gelatin, acacia gum, sodium alginate, polyvinylpyrrolidone, and/or polyvinyl alcohol, and then tableted or encapsulated for convenient administration. Such capsules or tablets may contain a controlled-release formulation as can be provided in a dispersion of active compound in

hydroxypropylmethyl cellulose. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents such as sodium citrate, or magnesium or calcium carbonate or bicarbonate. Tablets and pills may

additionally be prepared with enteric coatings.

[0090] Liquid dosage forms for oral administration may include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs containing inert diluents commonly used in the art, such as water. Such compositions may also comprise adjuvants, such as wetting agents, emulsifying and suspending agents, and sweetening, flavoring, and perfuming agents.

[0091] The amount of the compound of the invention that may be combined with the carrier materials to produce a single dosage of the

composition can and will vary depending upon the subject, the peptide, the formulation, and the particular mode of administration. Those skilled in the art will appreciate that dosages may also be determined with guidance from Goodman & Goldman's The Pharmacological Basis of Therapeutics, Ninth Edition (1996), Appendix II, pp. 1707-171 1 and from Goodman & Goldman's The

Pharmacological Basis of Therapeutics, Tenth Edition (2001 ), Appendix II, pp. 475-493.

[0092] Methods of administration are described in further detail in

Section ll(e).

II. Method of targeting a complex

[0093] Another aspect of the present invention is a method of targeting a complex to Tip-1 protein or Grp-78 protein. In some preferred embodiments, the method comprises targeting a complex to Tip-1 protein. In other preferred embodiments, the method comprises targeting a complex to Grp-78 protein. In some exemplary embodiments, the method comprises targeting a complex to Tip-1 protein in an irradiated tumor. In other exemplary embodiments, the method comprises targeting a complex to Grp-78 protein in an irradiated tumor.

[0094] The method comprises conjugating a complex to a peptide. A peptide of the invention may be as described in Section I. In some

embodiments, the complex is conjugated to a peptide listed in Table 2. In other embodiments, the complex is conjugated to a peptide listed in Table 2. In yet other embodiments, the complex is conjugated to a peptide listed in Table 4. In preferred embodiments, the complex is conjugated to a peptide listed in Table 1. In other preferred embodiments, the complex is conjugated to a peptide listed in Table 1. In yet other preferred embodiments, the complex is conjugated to a peptide listed in Table 3. In exemplary embodiments, the complex is conjugated to the HVGSSV (SEQ ID NO: 2) peptide. In other exemplary embodiments, the complex is conjugated to the WQSTTF (SEQ ID NO: 3) peptide. In yet other exemplary embodiments, the complex is conjugated to the HVGGSSV (SEQ ID NO: 1 ) peptide. In additional exemplary embodiments, the complex is conjugated to the WQSQSQI (SEQ ID NO: 4) peptide. In other exemplary embodiments, the complex is conjugated to the KTAKKNVFFCSV (SEQ ID NO: 5) peptide. In still other exemplary embodiments, the complex is conjugated to the

RKFLMTTRYSRV (SEQ ID NO: 6) peptide. In additional exemplary

embodiments, the complex is conjugated to the TTRYSRV (SEQ ID NO: 7) peptide. In other exemplary embodiments, the complex is conjugated to the GIRLRG (SEQ ID NO: 8) peptide. In yet other exemplary embodiments, the complex is conjugated to the GFRFRG (SEQ ID NO: 9) peptide.

[0095] The term "complex" as used herein refers to any substance having biological or detectable activity. Thus, the term "complex" includes a therapeutic agent, a diagnostic agent, or a combination thereof. The term

"complex" also includes any substance that is desirably delivered to a tumor.

[0096] Methods of conjugating a peptide to a therapeutic or diagnostic agent can and will vary depending on the therapeutic or diagnostic agent, or the intended use of the peptide/conjugate. The complex may be conjugated to the peptide of the invention by either adsorbtion through ionic, electrostatic, hydrophobic or other non-covalent means to the complex, or chemical linkage through covalent bonds. The peptide also may be directly conjugated to the complex via a linker molecule. A linker molecule comprises at least two functional groups such that the linker molecule is disposed between the complex and the peptide.

[0097] In some embodiments, a peptide of the present invention, as described above, may be used in treating and preventing cancer and associated diseases in a subject. The peptides of the present invention may be conjugated to radioisotopes or chemotherapeutic compounds in order to provide specific delivery of radiation and chemotherapy to the site of a tumor. Further, the peptides of the present invention may be part of a combination therapy.

Preferably, a combination therapy would include the use of the peptide of the present invention along with a radiation therapy or chemotherapy course of treatment.

[0098] In other embodiments, a peptide of the present invention, as described above, may be used in imaging a tumor. As such, a peptide of the invention may be conjugated to an imaging agent. Suitable imaging agents may include, but are not limited to, imaging/tracking agents that may be used for microscopy, e.g. fluorescent microscopy, confocal microscopy, or electron microscopy, magnetic resonance imaging, tomography, such as gamma

(SPECT/CT, planar) and positron emission tomography (PET/CT), radiography, or ultrasound. Imaging/tracking agents may be detectable in situ, in vivo, ex vivo, and in vitro.

[0099] The compositions of the presently disclosed subject matter may further comprise a drug carrier to facilitate drug preparation and administration. Any suitable drug delivery vehicle or carrier may be used, including but not limited to a gene therapy vector (e.g., a viral vector or a plasmid), a

microcapsule, for example a microsphere or a nanosphere (Manome et al., 1994; Hallahan, 2001a; Saltzman & Fung, 1997), a peptide (U.S. Patent Nos.

6,127,339 and 5,574,172), a glycosaminoglycan (U.S. Patent No. 6,106,866), a fatty acid (U.S. Patent No. 5,994,392), a fatty emulsion (U.S. Patent No.

5,651 ,991 ), a lipid or lipid derivative (U.S. Patent No. 5,786,387), collagen (U.S. Patent No. 5,922,356), a polysaccharide or derivative thereof (U.S. Patent No. 5,688,931 ), a nanosuspension (U.S. Patent No. 5,858,410), a polymeric micelle or conjugate (Goldman et al., 1997 and U.S. Patent Nos. 4,551 ,482, 5,714,166, 5,510,103, 5,490,840, and 5,855,900), and a polysome (U.S. Patent No.

5,922,545).

[0100] The subject, the tumor, the therapeutic agent, the imaging agent, and the administration of the peptides-complex conjugates are described below.

(a) subject

[0101] A method of the invention may be used to detect or treat a tumor in a subject that is a human, a livestock animal, a companion animal, a lab animal, or a zoological animal. In one embodiment, the subject may be a rodent, e.g. a mouse, a rat, a guinea pig, etc. In another embodiment, the subject may be a livestock animal. Non-limiting examples of suitable livestock animals may include pigs, cows, horses, goats, sheep, llamas and alpacas. In yet another embodiment, the subject may be a companion animal. Non-limiting examples of companion animals may include pets such as dogs, cats, rabbits, and birds. In yet another embodiment, the subject may be a zoological animal. As used herein, a "zoological animal" refers to an animal that may be found in a zoo. Such animals may include non-human primates, large cats, wolves, and bears. In preferred embodiments, the animal is a laboratory animal. Non-limiting examples of a laboratory animal may include rodents, canines, felines, and non-human primates. In certain embodiments, the animal is a rodent. Non-limiting examples of rodents may include mice, rats, guinea pigs, etc. (b) tumor

[0102] A peptide of the invention may be used to treat or recognize tumor derived from a neoplasm or a cancer. The neoplasm may be malignant or benign, the cancer may be primary or metastatic; the neoplasm or cancer may be early stage or late stage. Non-limiting examples of neoplasms or cancers that may be treated include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytomas (childhood cerebellar or cerebral), basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brainstem glioma, brain tumors (cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, visual pathway and hypothalamic gliomas), breast cancer, bronchial adenomas/carcinoids, Burkitt lymphoma, carcinoid tumors (childhood,

gastrointestinal), carcinoma of unknown primary, central nervous system lymphoma (primary), cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma in the Ewing family of tumors, extracranial germ cell tumor (childhood), extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancers (intraocular melanoma, retinoblastoma), gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, germ cell tumors (childhood extracranial, extragonadal, ovarian), gestational trophoblastic tumor, gliomas (adult, childhood brain stem, childhood cerebral astrocytoma, childhood visual pathway and hypothalamic), gastric carcinoid, hairy cell leukemia, head and neck cancer, hepatocellular (liver) cancer, Hodgkin lymphoma,

hypopharyngeal cancer, hypothalamic and visual pathway glioma (childhood), intraocular melanoma, islet cell carcinoma, Kaposi sarcoma, kidney cancer (renal cell cancer), laryngeal cancer, leukemias (acute lymphoblastic, acute myeloid, chronic lymphocytic, chronic myelogenous, hairy cell), lip and oral cavity cancer, liver cancer (primary), lung cancers (non-small cell, small cell), lymphomas (AIDS-related, Burkitt, cutaneous T-cell, Hodgkin, non-Hodgkin, primary central nervous system), macroglobulinemia (Waldenstrom), malignant fibrous histiocytoma of bone/osteosarcoma, medulloblastoma (childhood), melanoma, intraocular melanoma, Merkel cell carcinoma, mesotheliomas (adult malignant, childhood), metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome (childhood), multiple myeloma/plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes,

myelodysplastic/myeloproliferative diseases, myelogenous leukemia (chronic), myeloid leukemias (adult acute, childhood acute), multiple myeloma,

myeloproliferative disorders (chronic), nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma/malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer (surface epithelial-stromal tumor), ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, pancreatic cancer (islet cell), paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pineoblastoma and supratentorial primitive neuroectodermal tumors (childhood), pituitary adenoma, plasma cell neoplasia, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (kidney cancer), renal pelvis and ureter transitional cell cancer, retinoblastoma, rhabdomyosarcoma (childhood), salivary gland cancer, sarcoma (Ewing family of tumors, Kaposi, soft tissue, uterine), Sezary syndrome, skin cancers

(nonmelanoma, melanoma), skin carcinoma (Merkel cell), small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer with occult primary (metastatic), stomach cancer, supratentorial primitive neuroectodermal tumor (childhood), T-Cell lymphoma (cutaneous), testicular cancer, throat cancer, thymoma (childhood), thymoma and thymic carcinoma, thyroid cancer, thyroid cancer (childhood), transitional cell cancer of the renal pelvis and ureter, trophoblastic tumor (gestational), enknown primary site (adult, childhood), ureter and renal pelvis transitional cell cancer, urethral cancer, uterine cancer (endometrial), uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma (childhood), vulvar cancer, Waldenstrom macroglobulinemia, and Wilms tumor (childhood).

(c) therapeutic agent

[0103] The therapeutic agent of the invention may be a small molecule therapeutic, a therapeutic nucleic acid, or a chemotherapeutic agent. A

representative therapeutic nucleic acid may encode a polypeptide having an ability to induce an immune response and/or an anti-angiogenic response in vivo. Representative therapeutic proteins with immunostimulatory effects include but are not limited to cytokines (e.g., an interleukin (IL) such as IL2, IL4, IL7, IL12, interferons, granulocyte-macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor alpha (TNF-a)), immunomodulatory cell surface proteins (e.g., human leukocyte antigen (HLA proteins), co-stimulatory molecules, and tumor- associated antigens. See Kirk & Mule, 2000; Mackensen et al., 1997; Walther & Stein, 1999; and references cited therein. Representative proteins with anti- angiogenic activities that can be used in accordance with the presently disclosed subject matter include: thrombospondin I (Kosfeld & Frazier, 1993; Tolsma et al., 1993; Dameron et al., 1994), metallospondin proteins (Carpizo & Iruela-Arispe, 2000), class I interferons (Albini et al., 2000), IL12 (Voest et al., 1995), protamine (Ingber et al., 1990), angiostatin (O'Reilly et al., 1994), laminin (Sakamoto et al., 1991 ), endostatin (O'Reilly et al., 1997), and a prolactin fragment (Clapp et al., 1993). In addition, several anti-angiogenic peptides have been isolated from these proteins (Maione et al., 1990; Eijan et al., 1991 ; Woltering et al., 1991 ). Representative proteins with both immunostimulatory and anti-angiogenic activities may include IL12, interferon-γ, or a chemokine. Other therapeutic nucleic acids that may be useful for cancer therapy include but are not limited to nucleic acid sequences encoding tumor suppressor gene products/antigens, antimetabolites, suicide gene products, and combinations thereof.

[0104] A chemotherapeutic agent refers to a chemical compound that is useful in the treatment of cancer. The compound may be a cytotoxic agent that affects rapidly dividing cells in general, or it may be a targeted therapeutic agent that affects the deregulated proteins of cancer cells. The chemotherapeutic agent may be an alkylating agent, an anti-metabolite, an anti-tumor antibiotic, an anti-cytoskeletal agent, a topoisomerase inhibitor, an anti-hormonal agent, a targeted therapeutic agent, a photodynamic therapeutic agent, or a combination thereof.

[0105] Non-limiting examples of suitable alkylating agents may include altretamine, benzodopa, busulfan, carboplatin, carboquone, carmustine (BCNU), chlorambucil, chlornaphazine, cholophosphamide, chlorozotocin, cisplatin, cyclosphosphamide, dacarbazine (DTIC), estramustine, fotemustine, ifosfamide, improsulfan, lipoplatin, lomustine (CCNU), mafosfamide, mannosulfan, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan,

meturedopa, mustine (mechlorethamine), mitobronitol, nimustine, novembichin, oxaliplatin, phenesterine, piposulfan, prednimustine, ranimustine, satraplatin, semustine, temozolomide, thiotepa, treosulfan, triaziquone, triethylenemelamine, triethylenephosphoramide (TEPA), triethylenethiophosphaoramide (thiotepa), trimethylolomelamine, trofosfamide, uracil mustard and uredopa.

[0106] Suitable anti-metabolites may include, but are not limited to aminopterin, ancitabine, azacitidine, 8-azaguanine, 6-azauridine, capecitabine, carmofur (1 -hexylcarbomoyl-5-fluorouracil), cladribine, clofarabine, cytarabine (cytosine arabinoside (Ara-C)), decitabine, denopterin, dideoxyuridine, doxifluridine, enocitabine, floxuridine, fludarabine, 5-fluorouracil, gemcetabine, hydroxyurea (hydroxycarbamide), leucovorin (folinic acid), 6-mercaptopurine, methotrexate, nafoxidine, nelarabine, oblimersen, pemetrexed, pteropterin, raltitrexed, tegofur, tiazofurin, thiamiprine, tioguanine (thioguanine), and trimetrexate. [0107] Non-limiting examples of suitable anti-tumor antibiotics may include aclacinomysin, aclarubicin, actinomycins, adriamycin, aurostatin (for example, monomethyl auristatin E), authramycin, azaserine, bleomycins, cactinomycin, calicheamicin, carabicin, caminomycin, carzinophilin,

chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- norleucine, doxorubicin, epirubicin, epoxomicin, esorubicin, idarubicin, marcellomycin, mitomycins, mithramycin, mycophenolic acid, nogalamycin, olivomycins, peplomycin, plicamycin, potfiromycin, puromycin, quelamycin, rodorubicin, sparsomycin, streptonigrin, streptozocin, tubercidin, valrubicin, ubenimex, zinostatin, and zorubicin.

[0108] Non-limiting examples of suitable anti-cytoskeletal agents may include cabazitaxel, colchicines, demecolcine, docetaxel, epothilones, ixabepilone, macromycin, omacetaxine mepesuccinate, ortataxel, paclitaxel (for example, DHA-paclitaxel), taxane, tesetaxel, vinblastine, vincristine, vindesine, and vinorelbine.

[0109] Suitable topoisomerase inhibitors may include, but are not limited to, amsacrine, etoposide (VP-16), irinotecan, mitoxantrone, RFS 2000, teniposide, and topotecan.

[0110] Non-limiting examples of suitable anti-hormonal agents may include aminoglutethimide, antiestrogen, aromatase inhibiting 4(5)-imidazoles, bicalutamide, finasteride, flutamide, fluvestrant, goserelin, 4-hydroxytamoxifen, keoxifene, leuprolide, LY1 17018, mitotane, nilutamide, onapristone, raloxifene, tamoxifen, toremifene, and trilostane.

[011 1] Examples of targeted therapeutic agents may include, without limit, monoclonal antibodies such as alemtuzumab, cartumaxomab,

edrecolomab, epratuzumab, gemtuzumab, gemtuzumab ozogamicin,

glembatumumab vedotin, ibritumomab tiuxetan, reditux, rituximab, tositumomab, and trastuzumab; protein kinase inhibitors such as bevacizumab, cetuximab, crizonib, dasatinib, erlotinib, gefitinib, imatinib, lapatinib, mubritinib, nilotinib, panitumumab, pazopanib, sorafenib, sunitinib, toceranib, and vandetanib. [0112] Non limiting examples of angiogeneisis inhibitors may include angiostatin, bevacizumab, denileukin diftitox, endostatin, everolimus, genistein, interferon alpha, interleukin-2, interleukin-12, pazopanib, pegaptanib,

ranibizumab, rapamycin (sirolimus), temsirolimus, and thalidomide.

[0113] Non limiting examples of growth inhibitory polypeptides may include bortazomib, erythropoietin, interleukins (e.g., IL-1 , IL-2, IL-3, IL-6), leukemia inhibitory factor, interferons, romidepsin, thrombopoietin, TNF-a, CD30 ligand, 4-1 BB ligand, and Apo-1 ligand.

[0114] Non-limiting examples of photodynamic therapeutic agents may include aminolevulinic acid, methyl aminolevulinate, retinoids (alitretinon, tamibarotene, tretinoin), and temoporfin.

[0115] Other antineoplastic agents may include anagrelide, arsenic trioxide, asparaginase, bexarotene, bropirimine, celecoxib, chemically linked Fab, efaproxiral, etoglucid, ferruginol, lonidamide, masoprocol, miltefosine,

mitoguazone, talapanel, trabectedin, and vorinostat.

[0116] Also included are pharmaceutically acceptable salts, acids, or derivatives of any of the above listed agents. The mode of administration of the chemotherapeutic agent can and will vary depending upon the agent and the type of tumor or neoplasm. Suitable modes of administration were detailed below in section ll(e). A skilled practitioner will be able to determine the appropriate dose of the chemotherapeutic agent.

[0117] Other therapeutic agents may comprise a virus or a viral genome such as an oncolytic virus. An oncolytic virus comprises a naturally occurring virus that is capable of killing a cell in the target tissue (for example, by lysis) when it enters such a cell.

(d) imaging agent

[0118] In general, imaging/tracking agents may include luminescent molecules, chemiluminescent molecules, fluorochromes, fluorophores,

fluorescent quenching agents, colored molecules, radioisotopes, sradionuclides, cintillants, massive labels such as a metal atom (for detection via mass changes), biotin, avidin, streptavidin, protein A, protein G, antibodies or fragments thereof, Grb2, polyhistidine, Ni 2+ , Flag tags, myc tags, heavy metals, enzymes, alkaline phosphatase, peroxidase, luciferase, electron

donors/acceptors, acridinium esters, and colorimetric substrates. The skilled artisan would readily recognize other useful labels that are not mentioned above, which may be employed in the operation of the present invention.

[0119] Non-limiting examples of suitable radionuclides may include technetium-99m, ilodine-123 and 131 , thallium-201 , gallium-67, fluorine-18, fluorodeoxyglucose, and indium-1 11 . Suitable fluorophores include, but are not limited to, fluorescein isothiocyante (FITC), fluorescein thiosemicarbazide, rhodamime, Texas Red, CyDyes (e.g., Cy3, Cy5, Cy5.5), Alexa Fluors (e.g., Alexa488, Alexa555, Alexa594; Alexa647), and near infrared (NIR) (700-900 nm) fluorescent dyes.

[0120] A variety of metal atoms may be used as an imaging agent. The metal atom may generally be selected from the group of metal atoms comprised of metals with an atomic number of twenty or greater. For instance, the metal atoms may be calcium atoms, scandium atoms, titanium atoms, vanadium atoms, chromium atoms, manganese atoms, iron atoms, cobalt atoms, nickel atoms, copper atoms, zinc atoms, gallium atoms, germanium atoms, arsenic atoms, selenium atoms, bromine atoms, krypton atoms, rubidium atoms, strontium atoms, yttrium atoms, zirconium atoms, niobium atoms, molybdenum atoms, technetium atoms, ruthenium atoms, rhodium atoms, palladium atoms, silver atoms, cadmium atoms, indium atoms, tin atoms, antimony atoms, tellurium atoms, iodine atoms, xenon atoms, cesium atoms, barium atoms, lanthanum atoms, hafnium atoms, tantalum atoms, tungsten atoms, rhenium atoms, osmium atoms, iridium atoms, platinum atoms, gold atoms, mercury atoms, thallium atoms, lead atoms, bismuth atoms, francium atoms, radium atoms, actinium atoms, cerium atoms, praseodymium atoms, neodymium atoms, promethium atoms, samarium atoms, europium atoms, gadolinium atoms, terbium atoms, dysprosium atoms, holmium atoms, erbium atoms, thulium atoms, ytterbium atoms, lutetium atoms, thorium atoms, protactinium atoms, uranium atoms, neptunium atoms, plutonium atoms, americium atoms, curium atoms, berkelium atoms, californium atoms, einsteinium atoms, fermium atoms, mendelevium atoms, nobelium atoms, or lawrencium atoms. In some

embodiments, the metal atoms may be selected from the group comprising alkali metals with an atomic number greater than twenty. In other embodiments, the metal atoms may be selected from the group comprising alkaline earth metals with an atomic number greater than twenty. In one embodiment, the metal atoms may be selected from the group of metals comprising the lanthanides. In another embodiment, the metal atoms may be selected from the group of metals comprising the actinides. In still another embodiment, the metal atoms may be selected from the group of metals comprising the transition metals. In yet another embodiment, the metal atoms may be selected from the group of metals comprising the poor metals. In other embodiments, the metal atoms may be selected from the group comprising gold atoms, bismuth atoms, tantalum atoms, and gadolinium atoms. In preferred embodiments, the metal atoms may be selected from the group comprising metals with an atomic number of 53 (i.e. iodine) to 83 (i.e. bismuth). In an alternative embodiment, the metal atoms may be atoms suitable for magnetic resonance imaging. In another alternative embodiment, the metal atoms may be selected from the group consisting of metals that have a K-edge in the x-ray energy band of CT. Preferred metal atoms include, but are not limited to, manganese, iron, gadolinium, gold, and iodine.

[0121] The metal atoms may be metal ions in the form of +1 , +2, or +3 oxidation states. For instance, non-limiting examples include Ba 2+ , Bi 3+ , Cs + , Ca 2+ , Cr 2+ , Cr 3+ , Cr 6+ , Co 2+ , Co 3+ , Cu + , Cu 2+ , Cu 3+ , Ga 3+ , Gd 3+ , Au + , Au 3+ , Fe 2+ , F 3+ , Pb 2+ , Mn 2+ , Mn 3+ , Mn 4+ , Mn 7+ , Hg 2+ , Ni 2+ , Ni 3+ , Ag + , Sr 2+ , Sn 2+ , Sn 4+ , and Zn 2+ . The metal ions may comprise metal complexes, compounds, or chelates. For example, the metal atoms may comprise a complex, chelate, or compound with porphyrin, diethylene triamine pentaacetic acid (DTPA), or tetramethyl heptanedionate (TMHD), 2,4-pentanedione, 1 , 4,7,10-tetraazacyclododecane- 1 ,4,7,10-tetraacetic acid (DOTA), ethylenediamine-tetraacetic acid disodium salt (EDTA), ethyleneglycol-0,0'-bis(2-aminoethyl)-N,N,N',N'-tetraacetic acid

(EGTA), N-(2-hydroxyethyl)ethylenediamine-N,N',N'-triacetic acid trisodium salt (HEDTA), nitrilotriacetic acid (NTA), and 1 ,4,8,1 1 -tetraazacyclotetradecane- N,N',N",N"'-tetraacetic acid (TETA). These metal complexes, compounds, or chelates may be organo soluble or water soluble. Non-limiting examples of suitable organo soluble complexes may include pentanedione-gadolinium (III), bismuthneodecanoate, iohexol and related compounds, and organo soluble complexes of gold. Exemplary water soluble metal chelates or complexes include, but are not limited to, Mn-DTPA, Mn-porphyrin, and Gd-DTPA.

[0122] The metal atoms may comprise a metal oxide. For instance, non-limiting examples of metal oxides may include iron oxide, manganese oxide, or gadolinium oxide. Additional examples may include magnetite, maghemite, or a combination thereof.

(e) administration

[0123] In certain aspects, a pharmacologically effective amount of a peptide of the invention may be administered to a subject. Administration may be performed using standard effective techniques, and include peripheral administration (i.e. not by administration into the central nervous system) or local administration to the central nervous system. Peripheral administration includes but is not limited to intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration. Local administration, including directly into the central nervous system (CNS) includes but is not limited to administration via a lumbar, intraventricular or intraparenchymal catheter or using a surgically implanted controlled release formulation.

[0124] Pharmaceutical compositions for effective administration are deliberately designed to be appropriate for the selected mode of administration, and pharmaceutically acceptable excipients such as compatible dispersing agents, buffers, surfactants, preservatives, solubilizing agents, isotonicity agents, stabilizing agents and the like are used as appropriate. Remington's

Pharmaceutical Sciences, Mack Publishing Co., Easton Pa., 16Ed ISBN: 0- 912734-04-3, latest edition, incorporated herein by reference in its entirety, provides a compendium of formulation techniques as are generally known to practitioners. It may be particularly useful to alter the solubility characteristics of the peptides useful in this discovery, making them more lipophilic, for example, by encapsulating them in liposomes or by blocking polar groups.

[0125] Suitable vehicles for effective peripheral systemic delivery by intravenous or intraperitoneal or subcutaneous injection are straightforward. In addition, however, administration may also be effected through the mucosal membranes by means of nasal aerosols or suppositories. Suitable formulations for such modes of administration are well known and typically include surfactants that facilitate cross-membrane transfer. Such surfactants are often derived from steroids or are cationic lipids, such as N-[1 -(2,3-dioleoyl)propyl]-N,N,N-trimethyl ammonium chloride (DOTMA) or various compounds such as cholesterol hemisuccinate, phosphatidyl glycerols and the like.

[0126] As used herein, the term "effective amount" means an amount of a substance such as a compound that leads to measurable and beneficial effects for the subject administered the substance, i.e., significant efficacy. The effective amount or dose of compound administered according to this discovery will be determined by the circumstances surrounding the case, including the compound administered, the route of administration, the status of the symptoms being treated and similar patient and administration situation considerations among other considerations.

[0127] Although the foregoing methods appear the most convenient and most appropriate and effective for administration of peptides, by suitable adaptation, other effective techniques for administration, such as intraventricular administration, transdermal administration and oral administration may be employed provided proper formulation is utilized herein.

[0128] In addition, it may be desirable to employ controlled release formulations using biodegradable films and matrices, or osmotic mini-pumps, or delivery systems based on dextran beads, alginate, or collagen.

[0129] Typical dosage levels can be determined and optimized using standard clinical techniques and will be dependent on the mode of

administration.

III. Method of biopanning for receptors

[0130] In yet another aspect, the invention comprises a method of identifying receptors for peptides capable of binding the receptor in an irradiated tumor. For cancer-binding peptides, identification of the peptide receptor is necessary to demonstrate mechanism of action and to further optimize specificity and target binding. As is recognized in the art, the process of identifying a peptide receptor is slow, and some peptides may turn out to bind ubiquitous proteins not suitable for further drug development. A high throughput method was developed for identifying receptors of peptides capable of binding the receptor in an irradiated tumor. Advantageously, the method of the invention may be performed in parallel with biopanning methods used to identify peptides capable of binding an irradiated tumor therefore allowing for the ability to prioritize peptide candidates that are most likely to bind actual receptors specific to the irradiated tumor. The method was termed "reverse biopanning."

[0131] The method comprises (a) identifying peptides that may be capable of binding irradiated tumors, (b) contacting the peptides with a library of proteins, (c) isolating proteins of the library capable of binding peptides from (a), (d) sequentially repeating steps (b) and (c), and (e) identifying proteins of the library selected in (d), wherein the proteins are capable of binding the peptides from (a). [0132] The method comprises identifying peptides that may be capable of binding irradiated tumors. For instance, about 1 , 5, 10, 15, 50, 100, 200, 500, 100, 1000, 5000, 1 million or about 1 billion peptides may be identified. In some embodiments, about 1 million or about 1 billion peptides may be identified. In other embodiments, about 100, 1000, or about 5000 peptides may be identified. In preferred embodiments, about 1 , 5, 10, 15, 50, or about 100 peptides may be identified. In other preferred embodiments, about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or about 100 peptides may be identified.

[0133] In preferred embodiments, the peptides may be identified by biopanning peptide libraries. The methods of biopanning, the peptides and the peptide libraries are as described in Section l(b) above.

[0134] The method further comprises contacting the peptides with a library of proteins. A library useful for reverse panning as disclosed herein may comprise about 1 , 10, 100, 1000, 100000, 1 million, or about 1 billion or more proteins.

[0135] A protein library may comprise a random collection of proteins or may comprise a collection of proteins having a bias for a particular sequence, structure, or conformation. For instance, because reverse biopanning may be used to identify receptors of peptides capable of binding an irradiated tumor, a protein library of the invention may comprise a collection of proteins having a bias for proteins that may be expressed in a tumor. In preferred embodiments, the protein library of the invention comprises a collection of proteins having a bias for proteins that may be expressed in a tumor. In exemplary embodiments, the protein library of the invention comprises a collection of proteins expressed in human lung and breast cancer.

[0136] In preferred embodiments, a protein library of the invention may further comprise a library of proteins that is recovered and amplified following reverse panning. Non limiting examples of protein libraries that are recovered and amplified following reverse panning may include phage display libraries. In a preferred embodiment, a protein library of the invention is a phage display protein library. In a particularly preferred embodiment, a protein library of the invention is a 17 phage display protein library.

[0137] The peptides are contacted with the T7 phage display protein library. In preferred embodiments, the peptides are immobilized in order to facilitate selection and recovery of the phage display library expressing a protein capable of binding a peptide. Methods of immobilizing peptides are known in the art and may include covalently linking the peptide to a surface capable of covalently bonding with a modified or unmodified peptide, or by biotinylation of the peptides for immobilization on a surface comprising streptavidin. The peptides may be immobilized on a plate, a resin, a polymer, or a bead. In preferred embodiments, the peptides are biotinilytated and immobilized on streptavidin-coated magnetic beads.

[0138] The method further comprises isolating proteins of the library capable of binding the peptides. In some embodiments, when the proteins of the library are from a phage display library, and the peptides are immobilized, the proteins are isolated by isolating the phage bound to the immobilized peptide. Methods of isolating phage bound to an immobilized peptide are known in the art, and may be as described in Examples 8 and 9.

[0139] The method of the invention further comprises sequentially repeating contacting the peptides with the proteins, and isolating the proteins capable of binding peptides. For instance, the contacting and isolating

procedures may be sequentially repeated about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 or about 50 or more times. In preferred embodiments, the contacting and isolating procedures is sequentially repeated about 4, 5, or about 6 times or more.

[0140] After the proteins are selected and isolated, the proteins may be identified by identifying the sequence encoding the protein in the isolated phage. For instance, the nucleic acids from the isolated phage may be identified by direct sequencing of nucleic acid sequences isolated from individual phage isolates. Alternatively, RT-PCR or nucleic acid arrays may be used to identify nucleic acid sequences from a plurality of isolated phage. In preferred

embodiments, nucleic acid arrays may be used to identify nucleic acid

sequences from a plurality of isolated phage as described in Examples 8 and 9.

[0141] Upon identification of proteins capable of binding peptides, the peptides capable of binding irradiated tumors proteins may be prioritized based on known characteristics of the isolated proteins identified in the present method. For instance, a peptide may be prioritized if the peptide is capable of binding a protein isolated using the present method, wherein the protein is known to be expressed in an irradiated tumor. Conversely, a peptide may not be prioritized if the peptide is capable of binding a protein isolated using the present method, wherein the protein is known to be constitutively expressed in tissues other than a tumor may not be prioritized.

EXAMPLES

[0142] The following examples illustrate various iterations of the invention.

Example 1. Identification of Tip-1 binding peptides.

[0143] The protein Tip-1 , comprising a single PDZ domain, has been shown to translocate to the cell surface on tumors after exposure to ionizing radiation (FIG. 1 ). This phenomenon was discovered using in vivo peptide library biopanning techniques and has been confirmed in vitro. The biopanning process generated a novel binding peptide, HVGGSSV (SEQ ID NO: 1 ), which has been shown to target tumors in vivo (FIG. 2, Jaboin et al. Methods in Molecular Biology; 542:285-300). Tip-1 was identified as the target for the HVGGSSV (SEQ ID NO: 1 ) peptide (FIG. 3 and 4, Wang et al. PLoS One. 2010; 5(8): e12051 ).

Example 2. Specificity of the HVGGSSV (SEQ ID NO: 1) peptide.

[0144] To test whether the HVGGSSV (SEQ ID NO: 1 ) peptide is relatively specific to Tip-1 or had general PDZ domain binding activity, the binding specificity of the HVGGSSV (SEQ ID NO: 1 ) peptide was compared to the binding specificity of a native Tip-1 binding peptide, the C-terminal tail of β- catenin. This native peptide is known to bind a very limited number of other PDZ domain binding proteins other than Tip-1 .

[0145] In short, Nu/nu mice were injected with 1 ,000,000 LLC tumor cells in each hindlimb. After tumors reached ~5mm (-10 days post injection), the right hindlimb was treated with 3 Gy, whereas the left hindlimb was not irradiated. The mice were injected with 250 micrograms of biotinylated peptide-streptavidin- Alexafluor750 complex 3 hours post irradiation, and in vivo near infrared fluorescence imaging was performed beginning 24hours post irradiation.

[0146] The results show that the HVGGSSV (SEQ ID NO: 1 ) peptide is more specific for irradiated tumor than a native Tip-1 ligand (FIG. 5).

Example 3. Determining the affinity of the HVGGSSV (SEQ ID NO: 1) peptide to Tip-1.

[0147] Surface Plasmon resonance (SPR) was used to determine the affinity of the HVGGSSV (SEQ ID NO: 1 ) peptide to Tip-1 . In short, Tip-1 was immobilized to a COOH5 gold chip at 6500 RU. The running buffer was

HBS+0.005% P-20, pH 7.4. The flow and injection scheme were as follows:

• Flow - 50 mL/min

• Injection - 100 mL

• Dissociation - 5 min

• Regeneration - 30 sec

[0148] The double reference method was used for analysis, and the reference channel was activated and blocked with ethanolamine. The plateau region of the peptide dissociation phase was plotted against the concentration of the peptide to obtain the equilibrium binding constant (FIG. 6B). The results of plotting the highest point of association phase were identical and are not shown. Since the sensorgrams were clearly biphasic (FIG. 6A) they were analyzed with a bi-valent analyte binding model using Bioevaluation software. The resulting fits were not statistically better than a single phase kinetic fit.

[0149] The data demonstrated a binding affinity of approximately 1 micromolar (K D =1 .6x10 "6 ) (FIG. 6, Table 5). This binding constant is indicative of specific binding to Tip-1. Given this information, improvements in the affinity of the peptide to Tip-1 are desirable as an optimal targeting system should have an affinity in the nanomolar range.

Table 5.

Molecule MW k a (1/Ms) k d (1/s) K D (M)

HVGGSSV (SEQ ID 641.7 2.31 x ^ 0 ά 2.57 x 10 a 1 .12 x 10

NO: 1 )

k a -association rate constant

k d - dissociation rate constant

KD - equilibrium dissociation constant

Example 4. Generation of library of peptides with improved affinity of the HVGGSSV peptide to Tip-1.

[0150] It was hypothesized that the affinity of the Tip-1 binding peptide HVGGSSV (SEQ ID NO: 1 ) may be improved through in silico rational

engineering techniques. The atomic interactions between Tip-1 and the

HVGGSSV (SEQ ID NO: 1 ) peptide were elucidated. The X-ray crystal structure of Tip-1 (FIG. 7) reveals a peptide binding site that incorporates both a canonical PDZ domain binding sequence allowing for the general recognition PDZ domains, a function of all PDZ binding proteins. A second region confers uniqueness to Tip-1 with respect to other PDZ binding proteins, allowing for discrimination of Tip-1 binding sequences from all other PDZ binding sequences.

[0151] Based on the structure of the Tip-1 binding site, both a 6-mer peptide or a 7-mer peptide could occupy the binding site, depending on the geometry of the internal residues. Thus, a 6-mer and a 7-mer version of the binding peptide HVGGSSV (SEQ ID NO: 1 ) was modeled into the binding site of Tip-1 using structure 3DIW (FIG. 8A, B). Using this structure, substitutions at each position were evaluated for all amino acids for the 6-mer (HVGSSV (SEQ ID NO: 2)) and the 7-mer (HVGGSSV (SEQ ID NO: 1 )) versions of the binding peptide HVGGSSV (SEQ ID NO: 1 ). Substitutions at each position were also evaluated for all amino acids for a 7-mer (VHHHHHG (SEQ ID NO: 10)) Tip-1 control sequence. Amino acids that were felt to be possible substitutions that would increase affinity based on sterics as well as possible H-bond and/or non- polar interactions were recorded. A control dataset was made that chose amino acids that limited favorable interactions or increased unfavorable interactions at each site, limited to similar amino acids found in the sequence HVGGSSV (SEQ ID NO: 1 ), was constructed (FIG. 8C, D, and E).

[0152] From this initial docking, a library of 43,200 peptides was developed that included all possible mutations that were not sterically or electrostatically disallowed.

Example 5. Generation of consensus sequences for optimal Tip-1 binding peptides.

[0153] The 6-mer and 7-mer peptides generated in Example 4 were docked into the binding site of Tip-1 . Each peptide underwent all-atom energy minimization using the assisted model building with energy refinement (AMBER) 1999 force field, and interaction energies were calculated. The general formula for the AMBER 1999 force field energy calculation which takes into consideration the difference between the bound and unbound form of the macromolecular complex with respect to multiple atomic parameters for both the peptide and the protein was: [0154] The peptides were sorted by interaction energy and the most favorable (lowest) were chosen. Residue substitutions were ranked for each position in the peptide and a consensus sequence for an optimal binding peptide was generated. The HVGGSSV (SEQ ID NO: 1 ) peptide demonstrated a favorable binding energy in the PDZ binding site of Tip-1 , which suggests that this is the binding site that results in peptide tumor targeting in vivo. The iterative library generated consensus sequences for an optimized 6-mer peptide,

WQSTTF (SEQ ID NO: 3), and a 7-mer peptide, WQSQSQI (SEQ ID NO: 4) (FIG. 9).

[0155] For Tip-1 (7-mer), the preferred binding characteristics at each position are detailed below:

• H: Deep, narrow pocket, binds W in xray. Choose aromatic or H- bond to ASN44 at bottom of pocket.

• V: Exposed to solvent, backbone H-bond to GLN39, possible H- bond to GLN43. Choose polar.

• G: Facing protein surface, possible H-bond with THR58. Choose small, H-bond donor.

• G: Exposed to solvent, providing backbone flexibility. Choose polar.

• S: Strong H-bond with SER32. Choose small polar.

• S: H-bond acceptor from HIS90. Choose polar.

• V: Large hydrophobic pocket. Choose large hydrophobic.

[0156] In both the 6-mer and 7-mer peptides, tryptophan was

substituted for the histidine in position one, which is consistent with peptides known to bind Tip-1. Also, in the 6-mer peptide, phenylalanine was found to be the most favorable C-terminal residue, which is not a residue usually associated with canonical PDZ binding.

[0157] In conclusion, the irradiated tumor targeting peptide HVGGSSV (SEQ ID NO: 1 ) binds to Tip-1 through a combination of interactions in both the PDZ binding site and an adjacent hydrophobic pocket. In silico iterative libraries have produced candidate peptides with more favorable binding energies and with non-canonical PDZ binding residues, which should both increase affinity for Tip-1 and decrease cross-reactivity with other PDZ-binding proteins.

Example 6. Validation of peptide binding predictions in vitro.

[0158] About 4000 peptides, including 6-mers, 7-mers, and controls were synthesized on a picoliter microfluidic chip (LC Sciences, Houston, TX). The peptide chip used comprised 1506 6-mer peptides, 2015 7-mer peptides, 357 peptides predicted to have poor or no binding, and 41 known controls. The chip was blocked with SuperBlock, 0.05% Tween-20, pH 7.0, 4 °C overnight, washed with 1 ml_ of washing buffer (1X PBS with 0.05% Tween-20 and 0.05% Triton X-100, pH 7.0), and the image scanned at 635 nm excitation and 700 nm emission (background). 1 μg/mLTip-1 in binding buffer (1X PBS, pH 7.0) was allowed to incubate at 25 °C for 1 hour. The chip was washed with 1 ml_ of washing buffer before incubation with 100 ng/mL anti-His Cy5 conjugate in binding buffer at 25 °C for 1 hour. The chip was washed with 1 ml_ of 1 *PBS, pH7.0, and the image scanned at 635 nm excitation and 700 nm emission. A verification of anti-His Cy5 conjugate alone (above steps without Tip-1 present) was performed to verify that the antibody did not bind directly to the peptides. No increased signal above background was observed with the antibody alone.

[0159] The computation docking algorithm predictions demonstrated a trend to predict more favorable binding energies for peptides that had more favorable binding in vitro FIG. 10. In silico predicted binding of the HVGGSSV (SEQ ID NO: 1 ) peptide was 66.5, whereas the experimentally determined in vitro binding affinity of the HVGGSSV (SEQ ID NO: 1 ) was 250.7 U. Peptides that were both predicted to have significantly higher binding through in silico prediction and also demonstrated higher binding in vitro are being synthesized and may be tested in vivo using established mouse tumor models. Example 7. Grp-78 consensus peptide.

[0160] Following the same rationale and methods detailed in the examples above with respect to TIP-1 , GRP-78 binding peptides were

investigated. For Grp-78, the original binding sequence was GIRLRG (SEQ ID NO: 8). The best consensus sequence was GFRFRG (SEQ ID NO: 9) (FIG. 11 ). The preferred binding characteristics for Grp-78 at each position are detailed below:

• G: Tight to protein surface. Choose small.

• I: Large partially hydrophobic pocket, H-bond possible ARG29. Choose large probably hydrophobic.

• R: Deep tight pocket, H-bond to SER365 + GLU293. Choose large, basic.

• L: Large hydrophobic pocket, H-bond to GLN268 at distance. Choose large hydrophobic.

• R: Interacts with ASP257. Choose large basic, possibly polar.

• G: Exposed to solvent, possible interaction with ARG269. Choose polar, acidic.

Introduction for Examples 8-9

[0161] Phage-display peptide biopanning has been used to

successfully identify putative targets for peptide-based imaging agents and therapeutics [1]. Phage-display biopanning can be performed both in vitro and in vivo and allows for a large number of random peptides to be screened in a short amount of time, reducing the number of candidate peptides in the library from 10 9 to 10 1 [2]. Additionally, this technique can be performed under a wide variety of conditions to screen peptides that selectively bind to tumors after specific stimuli, such as chemotherapy or irradiation [3, 4].

[0162] Once a peptide has been identified, the next step is to identify its binding partner. Routine methods for identification of peptide-protein interactions include techniques such as yeast two-hybrid; however, yeast two- hybrid is time-consuming and labor-intensive. Co-precipitation and tandem affinity purification followed by proteomic analysis are other methods available to identify potential peptide ligands [5-7]. While these techniques can be scaled to allow for parallel processing of multiple samples, individual conditions for each protein-peptide pair need to be optimized. Additionally, the output from these methods must then be sent for proteomic analysis, which adds another level of complexity and cost. In contrast, phage-displayed protein libraries have been developed using cDNA libraries from cancer cell lines. Phage libraries allow for proteins to be displayed on a bacteriophage and then panned against a candidate peptide ligand. This method has been successfully used to identify protein-binding partners; however, serial identification of peptide-binding partners using this method is time consuming and can become costly [8].

[0163] The inventors have used phage-display biopanning to identify peptides that bind specifically to cancers in the past [9-13], and found that the bottleneck with phage-displayed peptide technology is the step of identifying target protein-binding partners to the peptides discovered through phage display. In an effort to develop an efficient method for the identification of putative binding proteins following phage-display peptide biopanning, a combination of "reverse biopanning" and microarray analysis is described below. Using reverse

biopanning, it was possible to screen many peptides found to have desirable properties in parallel with the purpose of identifying putative binding partners. In the examples below, this method is discussed and the methodology

demonstrated through the identification of two putative novel cancer-targeting peptides, RKFLMTTRYSRV (SEQ ID NO: 6) and KTAKKNVFFCSV (SEQ ID NO: 5), that bind to the protein tax interacting protein 1 (TIP-1 ).

Methods for Examples 8-9.

Peptide and Protein Generation

[0164] Cancer-targeting peptides were identified through in vivo biopanning as described previously [8, 12-14]. The peptides for reverse biopanning were purchased in the PepScreen format from Sigma-Aldrich (Saint Louis, MO). Peptides (>95% HPLC purified) for electrophoretic mobility shift assay (EMSA) were purchased from China Peptide (Shanghai, China).

[0165] A bacterial codon-optimized DNA sequence for TIP-1 , including an N-terminal Strep-ll tag and a C-terminal 6xHis tag, was synthesized in the bacterial expression vector pJexpress41 1 (DNA2.0 Inc., Menlo Park, CA). BL21 DE3 star E. coli competent cells (Invitrogen, CA) were transformed with 5ng of pJexpress41 1 using standard methods. A single colony was selected to inoculate a 100 ml LB miller culture containing 50 mg/L kanamycin as a starter culture and grown overnight. The following day, 0.2% of starter culture was used to inoculate 1 L LB miller containing 50 mg/L kanamycin. The cultures were grown at 37°C with 220 RPM agitation. When the cultures reached an optical density of -0.4, 1 M IPTG was added to the growing cultures at final concentration of 0.5mM to induce protein expression. The cultures were incubated at 37°C with agitation for an additional 3 hours. The cells were centrifuged at 4000 RCF for 30 minutes and the cell pellet was resuspened in 25ml of 50 mM NaPO4, 300 mM NaCI, 0.25% NP-40, pH 8.0. Lysozyme, DNAse I and PMSF were added to give final concentrations of 6.5 mg/ml, 0.01 mg/ml, 0.1 mg/ml, respectively. The cells were lysed by freeze thawing, followed by sonication. Talon CellThru beads (Clontech Laboratories, Mountain View, CA) equilibrated in 50 mM NaPO4, 300 mM NaCI, pH 8.0 were added to the lysate and gently rocked for 2 hours at 4°C to allow binding of the target protein to the beads. The beads were loaded onto 10 ml CellThru columns and washed with 30 bed volumes of 50 mM NaPO4, 300 mM NaCI, pH 8.0, followed by a 10 bed volumes of 50 mM NaPO4, 300 mM NaCI, 10 mM imidazole, pH 8.0. The protein was eluted using 50 mM NaPO4, 300 mM NaCI, 200 mM imidazole, pH 8.0. The protein eluent was then loaded onto a 5ml Strep-Tactin affinity column (IBA, Gottingen, Germany) pre-equilibrated with 100 mM Tris-CI, 150 mM NaCI, 1 mM EDTA, pH 8.0. The column was washed with 5 bed volumes of 100 mM Tris-CI, 150 mM NaCI, 1 mM EDTA, pH 8.0. TIP-1 was eluted using 100 mM Tris-CI, 150 mM NaCI, 1 mM EDTA, 2.5 mM desthiobiotin, pH 8.0. This eluent was buffer exchanged into phosphate buffered saline (PBS) using centrifugal ultrafiltration.

Reverse Biopanning

[0166] N-terminal biotinylated peptides were immobilized on Dynal® MyOne™ Streptavidin magnetic beads (1.05 μηι diameter, Invitrogen, Carlsbad, California) was pre-equilibrated in PBS by adding 100 μg of peptide in DMSO to 2 mg of beads in 100 μΙ of PBS and gently rocking for two hours at room temperature. The beads were then washed five times in 200 μΙ_ of PBS +0.1 % Tween 20 (PBST). The immobilized peptide beads were incubated with 1 ml of 1 .0 X 10 10 pfu/ml T7 select human lung cancer and breast cancer phage display libraries obtained from Novagen (Gibbstown, NJ). Biopanning against the phage- display libraries was performed similar to the manufacturer's instructions. Briefly, the mixture of phage and immobilized peptide beads was rocked overnight at 4°C. The beads were then washed 5 times with PBST to remove non-specific and unbound phage. The target specific phage was isolated by adding PBS containing 1 .0% SDS (200uL) and rocked for 15 minutes at room temperature to remove the phage from the peptide-bead complex, followed by removal of the immobilized peptide beads by magnetic separation.

[0167] The target phages were amplified in E.coli BLT5615 in 35 ml_ LB containing 100 mg/L ampicillin at 37°C with IPTG induction per

manufacturer's instructions. Following bacteriophage lysis of the E.coli, 5M NaCI was added to each culture to achieve a final concentration of 1.25 M in order to stabilize the phage and the cultures were centrifuged at 5,000 x g to remove cell debris. The phage-containing supernatants were stored at 4°C. The input phage for the next round of biopanning was prepared by diluting 100 μΙ_ of the culture broth tenfold with PBS. Freshly prepared immobilized-peptide magnetic beads were used for each round of screening. A total of 5 rounds of biopanning were performed for each sample. Extraction of Phage DNA and Amplification of Insert Sequences Specific to Peptide

[0168] After the final round of biopanning, DNA from the amplified phage was obtained by processing the lysed culture with the QIAmp blood minikit (Qiagen, Valencia, CA). DNA was eluted in 75 μΙ_ of nuclease-free water. The cDNA inserts contained in the phage DNA were amplified in 50 μΙ_ reaction volumes by PCR using the primer pair GGAGCTGTCGTATCCAGTC (SEQ ID NO: 10) and TGGATTGACCGGAAGTAGAC (SEQ ID NO: 11 ). DNA from the PCR reactions was purified using the QIAquick PCR purification kit (Qiagen, Carlsbad, California). Purified DNA was eluted in 70 μΙ_ Tris CI (10 mM, pH 8.5). A master library of all inserts biopanned in this experiment was created by combining 300ng of each amplified insert. Equivalent amounts of the DNA from the two control phage inserts were pooled in a separate micro-centrifuge to serve as a control. These two samples were used for analysis on microarray.

Microarray Analysis

[0169] DNA concentration and purity was determined using UV spectroscopy. DNA sizes were determined using an Agilent 2100 bioanalyzer DNA 12000 assay kit (Agilent Technologies, Santa Clara CA) according to manufacturer's recommendations. To prepare for the microarray, DNAs were chemically labeled using a Kreatech ULS labeling kit (Kreatech Diagnostics, Durham, North Carolina). For each reaction, 2μg of DNA was mixed with

Kreatech 10X labeling buffer and Kreatech cy5-ULS. The reactions were incubated at 85°C for 15 minutes in the dark and placed on ice for 3 minutes. Labeled DNAs were purified with QIAquick PCR purification columns (Qiagen Sciences) and then quantified on a Nanodrop spectrophotometer.

[0170] Labeled DNA (1 μg) was suspended in Agilent 2X Gene

Expression hybridization buffer, Agilent 10X Blocking agent, and Kreatech Kreablock. The hybridization solutions were applied to Agilent Human 4x44Kv2 microarrays. Hybridization was carried out at 65° C for 20 hours. Washing procedures were carried out according to Agilent gene expression protocols. Slides were scanned on an Agilent SureScan microarray scanner to detect Cy5 fluorescence. Gridding and analysis of images was performed using Agilent Feature Extraction v10.7.3.1 .

[0171] Raw data from the microarray was analyzed using Partek Genomics Suite (St. Louis, MO, USA). The processed signal was logarithm base 2 transformed and subsequently quantile normalized to allow for comparisons of signal intensities among both probe runs and control runs. Signal intensities for the same gene probe for the phage genetic insert runs as well as the control insert runs were separately averaged and subtracted from one another. The signal intensities were then ordered from highest signal intensity following subtraction of background. Signal intensities that were 4 standard deviations above the mean were investigated further.

Real-Time PCR Validation

[0172] The TIP-1 forward primer GTCACACGGGTGTCTGAAGGAGG (SEQ ID NO: 12) and the reverse primer TCCAATCTGCAGCCCAGCG (SEQ ID NO: 13) were used for Quantitative Polymerase Chain Reaction (qPCR). A 10 μΙ_ reaction consisting of 5μΙ_ of 2x Applied Biosystems SYBR Green PCR Master Mix, 1 μΙ_ of each forward and reverse primer (final concentration 300nm), 2 μΙ_ of H 2 O, and 1 μΙ_ of purified DNA from each peptide, diluted 1 :100 in H 2 O. Each sample was plated in triplicate on an Applied Biosystems Prism 384-well reaction plate, sealed with Applied Biosystems MicroAmp adhesive film and then centrifuged. qPCR was run on an Applied Biosystems 9700HT using the SDS 2.4 software package. The following PCR conditions were used: 50°C for 2 minutes, an incubation step at 95°C for 10 minutes, and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The samples were analyzed for Ct values using RQ Manager 1 .2.1 . Molecular Modeling

[0173] The peptides of interest were modeled into the peptide-binding site of TIP-1 taken from the crystal structure 3DIW [15]. The crystal structure contains the bound peptide QLAWFDTDL, the last 6 residues of which fit into the binding site of the PDZ domain. We modeled the HVGGSSV peptide into the WFDTDL portion of the bound peptide. While our new sequence is one residue longer, the deep binding pockets for Trp and Leu in the crystal structure lend themselves well to His and Val replacement. A small kink in the bound peptide is introduced between the Gly to accommodate the extra residue. The subsequent peptides TTRYSRV and NVFFCSV were modeled in the same fashion, and the structures were energy minimized with molecular dynamics using the NAMD package [16] and the CHARMM36 forcefield [17]. A pseudo-binding energy was determined as the difference in total energy between the peptide bound and unbound complexes.

Peptide Validation

[0174] The interaction of peptide and TIP-1 protein was determined by EMSA performed by the use of Panomics EMSA kit (Panomics, Fremont, CA), as per manufacturer's instructions. Briefly, each biotin labeled peptide probe was incubated with TIP-1 in the presence of binding buffer (20 mM Hepes, pH 7.6, 100 mM KCI, 10% (vol/vol) glycerol, 0.2mM EDTA, and 4mM dithiothreitol (DTT)) for 1 hour at 37°C. Protein/peptide complexes were separated on a non- denaturing polyacrylamide gel, transferred to a PVDF membrane with 0.5 X TBE buffer, and detected using streptavidin-HRP and a chemiluminescent substrate. The bands were visualized after exposure to a Hyperfilm-MP autoradiography film (Amersham, Piscataway, N J) with a Konica Minolta SRX 101 A Processor.

Example 8. Biopanning and microarray analysis.

[0175] The "reverse biopanning" process was designed to identify target proteins that interact with peptides previously identified through phage- displayed peptide biopanning. This is accomplished by using a second phage- display system containing a cDNA library constructed from the total RNA from specific cancer cell lines. In order to increase the diversity of proteins expressed by the phage-display library, two cDNA libraries, from human lung and human breast carcinomas were used. The libraries were combined after initial expansion and titration in a 1 :1 fashion.

[0176] Thirty-nine peptides were identified from previous in vivo phage display biopanning experiments, explained in detail in Jaboin et. al. [14]. Each peptide was constructed with an N-terminal biotin that served as a linking moiety to magnetic streptavidin beads. As a negative control, the streptavidin beads alone (no added peptide) were brought through the reverse biopanning process in duplicate. After five rounds, enriched phage were collected and stored at 4°C. In order to preserve the heterogeneous nature of the enriched phage, individual colonieswere not selected as detailed in many phage-display protocols. Instead, DNA was extracted from each of the enriched samples, and PCR amplification of the cDNA insert region of the phage genome was performed. The amplified product was pooled and then analyzed for DNA size in preparation for microarray analysis (FIG. 12).

[0177] To identify the specific genes encoded and displayed in the enriched phage samples, the amplified and pooled PCR products were hybridized to Agilent Human 4x44Kv2 microarrays. The controls served to identify any displayed proteins that bound non-specifically, or to components of the biopanning system (beads, plastic, etc.). Signal generated from the streptavidin bead controls was subtracted from the phage samples and the final series of genes was ordered by intensity of signal above background (FIG. 13). The average signal for all genes was 1 .647 x 10 "7 with a standard deviation of 0.866. The list of "putative" hits was limited to genes with normalized signal >4 standard deviations above the mean, resulting in a list of 1 13 "true" hits for the 39 peptides. The assumption was made that each peptide may bind 2-3 different proteins during the biopanning process, and a cutoff of 4 standard deviations fit well with the expected possible true hits of 80-120. At this point, the list of genes was analyzed for proteins that were of interest to the inventors based on known characteristics of the encoded proteins. One of the genes identified by the microarray was TAX3BP1 , which encodes TIP-1 , a protein previously identified to translocate to the cell surface after exposure to ionizing radiation [3, 8]. This protein contains a PDZ binding domain and had been shown to bind the peptide HVGGSSV (SEQ ID NO: 1 ) in vitro and in vivo [12].

[0178] To identify which of the 39 peptides bound to TIP-1 during the reverse biopanning process, primers to TAX1 BP3 were constructed based on the DNA fragment sequence on the microarray. Each phage sample, including controls, was analyzed for the presence of TAX1 BP3 DNA (FIG. 14) using qPCR. The average threshold cycle value for all samples analyzed was 29.6 (SD = 4.49). The control samples had an average threshold cycle value of 26.0 (SD = 0.388). The peptide RKFLMTTRYSRV (SEQ ID NO: 6) had an average threshold cycle value of 15.0 (SD=0.237) and the peptide KTAKKNVFFCSV (SEQ ID NO: 5) had an average threshold cycle value of 19.8 (SEM = 0.188). Each of these peptides demonstrated a significantly lower threshold cycle number compared to the other samples in aggregate (ANOVA, p=<0.001 ), suggesting the presence of TAX3BP1 DNA in these two samples, further suggesting that these peptides bind to TIP-1 - expressing phage during the biopanning process.

Example 9. Peptide Validation

[0179] In order to validate if the peptides identified by qPCR were potential TIP-1 binding peptides, these peptides were modeled in the peptide- binding domain of TIP-1 and computational modeling was compared to the previously identified TIP-1 binding peptide HVGGSSV (SEQ ID NO: 1 ). Based on previous work with PDZ binding peptides, and TIP-1 specifically, peptides bind to TIP1 via the terminal 6-8 amino acids and the c-terminal carboxylate with canonical binding sequence of the terminal 4 amino acids being X-S/T-X-V. For computational modeling, the two identified peptides were truncated from RKFLMTTRYSRV (SEQ ID NO: 6) and KTAKKNVFFCSV (SEQ ID NO: 5) to TTRYSRV (SEQ ID NO: 7) and NVFFCSV (SEQ ID NO: 14), respectively.

[0180] Computational modeling indicated that these peptides bind favorably in the PDZ binding domain of TIP-1 (FIG. 15). While NVFFCSV (SEQ ID NO: 14) contains a cysteine in place of a serine or threonine in the canonical binding site, it did not appear to cause any sterically disallowed conformations of the peptide. Predicted pseudo-binding energies were calculated to be -360.645 kcal/mol, -487.239 kcal/mol, and -595.328 kcal/mol for HVGGSSV (SEQ ID NO: 1 ), TTRYSRV (SEQ ID NO: 7), and NVFFCSV (SEQ ID NO: 14) respectively. While these pseudo-binding energies are not expected to exactly match the experimental values, the relative values are expected to be correct. These values therefore suggest that the two newly identified peptides may bind TIP-1 more favorably than the previously identified HVGGSSV (SEQ ID NO: 1 ) peptide.

[0181] The ability of TTRYSRV and NVFFCSV to bind TIP-1 was qualitatively tested in vitro through the use of an EMSA. HVGGSSV was used as a positive control and as expected HVGGSSV (SEQ ID NO: 1 ) did associate with TIP-1 . The peptide RKFLMTTRYSRV (SEQ ID NO: 6) and the truncated peptide TTRYSRV (SEQ ID NO: 7) showed increased association to TIP-1 when compared to HVGGSSV (SEQ ID NO: 1 ) and very low signal was detected for the peptide KTAKKNVFFCSV (SEQ ID NO: 5) (FIG. 16). Despite the favorable binding predicted by computational modeling, binding of the truncated form of the peptide NVFFCSV (SEQ ID NO: 14) was not detected (data not shown).

Discussion for Examples 8-9.

[0182] Phage-display peptide biopanning is a powerful screening tool for the identification of small peptides that bind in cancer in vivo. However, identification of peptide ligands can give rise to obstacles in the discovery process. Many peptides may bind ubiquitous targets that are not very specific, or bind targets that are inappropriate for use in later applications. Recently, in vitro and in vivo phage-displayed peptide biopanning have resulted in the identification of peptides that target specific diseases. One example is the peptide EHMALTYPFRPP (SEQ ID NO: 15), identified by Zang et. al. [18]. This peptide was discovered by biopanning against NCI-H1299 cells, and was found to bind specifically to NCI-H1299, A549 cells, and lung tumor biopsy specimens, but not normal lung tissue. Similarly, the peptide SATTHYRLQAAN (SEQ ID NO: 16) was identified by biopanning against NG4TL4-tk tumor cells and was found to bind in vivo to sarcoma tumors in mouse models [19]. In both cases, as with many other examples in the literature, tumor specificity of the peptide is demonstrated; yet, the mechanism for binding to the tumor is not known.

[0183] Established methods for identifying the receptor for cancer specific peptides discovered by biopanning can be the bottleneck in the process of prioritizing lead peptides for translation from discovery to pre-clinical testing. In many cases, a single lead peptide must be brought through the process of ligand identification, which can be time and labor intensive. Additionally, further validations may reveal a target that is inevitably not of interest, resulting in loss of time and resources. The method described in Examples 8 and 9 allows for a large number of peptides to be tested in parallel followed by rational selection of putative target proteins based on their characteristics such as cell localization and expression profiles. This method is easily scalable and lead peptides do not need to be selected early in the process. Additionally, because a ranking of putative receptors is generated, one can prioritize candidates based on these results.

[0184] The use of this method was demonstrated by identifying two peptides that bind the radiation-inducible target TIP-1. TIP-1 is a 124 amino acid PDZ domain protein. It has been shown to interact strongly with β-catenin, and because it has a single domain, it is thought to have PDZ scaffold antagonist activity [20]. Overexpression of TIP-1 has also been shown to inhibit the growth of colorectal cells, presumably through a novel regulatory pathway of the WNT/ β-catenin signaling pathway [21]. Moreover, in a study of human breast cancer cell lines, knock-down of TIP-1 expression was shown to suppress cell proliferation [22]. TIP-1 has also been implicated in the activation of the Rho protein Cdc42 by binding the guanidine exchange factor ARHGEF16 [23]. A recent report also suggests that TIP-1 may be alternatively spliced in some cancers, altering the PDZ binding site, and leading to a cancer-specific variant with altered function [24].

[0185] It is likely that the peptide KTAKKNVFFCSV (SEQ ID NO: 5) did not bind TIP-1 well enough in vitro due to the cysteine in the canonical binding sequence of the peptide. If the peptide remained a monomer, the cysteine did appear to be able to interact favorably with the binding site of TIP-1 , as demonstrated by computational modeling; however, the peptide is able to dimerize through the cysteines by the formation of a disulfide bond. In this case, binding to TIP-1would be impaired. EMSA assays, showed peptide signal developed between the area of the TIP-1 -peptide complex and free peptide. This may represent dimerized peptide, suggesting that KTAKKNVFFCSV (SEQ ID NO: 5) dimerized under the EMSA conditions. During the initial phage-display process, KTAKKNVFFCSV (SEQ ID NO: 5) might dimerize due to steric constraints as it was displayed on the surface of the phage as a terminal portion of a chimeric protein. In the reverse biopanning process, even a small amount of monomeric peptide would be sufficient to prioritize a lead protein. The

KTAKKNVFFCSV (SEQ ID NO: 5) peptide has to dimerize. Modifications of this peptide, specifically at the cysteine thiol, may eliminate dimerization and retain binding to TIP-1 .

[0186] While this method of reverse biopanning can greatly increase the speed of identification of target proteins, there are some limitations. First, reverse biopanning is based on a phage-display system using the T7

bacteriophage. This system was chosen as it is well described and commercial cDNA libraries from human tumors are available for this platform. Since this system relies on bacteria to produce the proteins displayed on the surface of the bacteriophage, large proteins are not produced efficiently and may be excluded early in the biopanning process whether or not they are candidate receptors for the peptide. Codon bias and lack of glycosylation may also cause some of the proteins to be misfolded, poorly expressed, or not expressed by the bacteria, also biasing the discovery process. Membrane proteins in particular may be difficult targets to identify using this technique; however, some membrane proteins, such as neuromodulin, have been demonstrated to display on the surface of phage [25]. Additionally, this process only identifies the presence of peptide-target interactions and gives no information on the specificity of the peptide for the target. Additional studies need to be performed to confirm peptide selectivity once a suitable peptide candidate is identified.

[0187] In conclusion, the process of identification of putative binding partners for tumor targeting peptides can be the bottleneck in the transition from discovery to target validation. The method of reverse biopanning can

successfully identify peptide receptors despite the limitations of a bacteriophage display system for the display of proteins from a tumor cDNA library. This method allows for parallel processing of peptides and allows researchers to select the lead peptides based on the targeted molecule, rather than forcing the

identification of a lead peptide early in the discovery process.

CITED REFERENCES

1 . Newton J, Deutscher SL: Phage peptide display. Handb Exp Pharmacol 2008(185 Pt 2):145-163.

2. Newton JR, Deutscher SL: In vivo bacteriophage display for the discovery of novel peptide-based tumor-targeting agents. Methods Mol Biol 2009, 504:275- 290.

3. Hariri G, Yan H, Wang H, Han Z, Hallahan DE: Radiation-guided drug delivery to mouse models of lung cancer. Clin Cancer Res 2010, 16(20):4968-4977.

4. Lowery A, Onishko H, Hallahan DE, Han Z: Tumor-targeted delivery of liposome-encapsulated doxorubicin by use of a peptide that selectively binds to irradiated tumors. J Control Release 201 1 , 150(1 ):117-124. 5. Xu X, Song Y, Li Y, Chang J, Zhang H, An L: The tandem affinity purification method: an efficient system for protein complex purification and protein interaction identification. Protein Expr Purif 2010, 72(2):149-156.

6. Collins MO, Choudhary JS: Mapping multiprotein complexes by affinity purification and mass spectrometry. Curr Opin Biotechnol 2008, 19(4):324-330.

7. Rangel R, Guzman-Rojas L, le Roux LG, Staquicini Fl, Hosoya H, Barbu EM, Ozawa MG, Nie J, Jr KD, Langley RR et al: Combinatorial targeting and discovery of ligand-receptors in organelles of mammalian cells. Nat Commun 2012, 3:788.

8. Wang H, Yan H, Fu A, Han M, Hallahan D, Han Z: TIP-1 translocation onto the cell plasma membrane is a molecular biomarker of tumor response to ionizing radiation. PLoS One 2010, 5(8):e12051 .

9. Passarella RJ, Spratt DE, van der Ende AE, Phillips JG, Wu H, Sathiyakumar V, Zhou L, Hallahan DE, Harth E, Diaz R: Targeted nanoparticles that deliver a sustained, specific release of Paclitaxel to irradiated tumors. Cancer Res 2010, 70(1 1 ):4550-4559.

10. Passarella RJ, Zhou L, Phillips JG, Wu H, Hallahan DE, Diaz R: Recombinant peptides as biomarkers for tumor response to molecular targeted therapy. Clin Cancer Res 2009, 15(20):6421 -6429.

1 1 . Diaz R, Passarella RJ, Hallahan DE: Determining glioma response to radiation therapy using recombinant peptides. Expert Rev Anticancer Ther 2008, 8(1 1 ):1787-1796.

12. Han Z, Fu A, Wang H, Diaz R, Geng L, Onishko H, Hallahan DE: Noninvasive assessment of cancer response to therapy. Nat Med 2008, 14(3):343-349.

13. Hallahan D, Geng L, Qu S, Scarfone C, Giorgio T, Donnelly E, Gao X, Clanton J: Integrin-mediated targeting of drug delivery to irradiated tumor blood vessels. Cancer Cell 2003, 3(1 ):63-74.

14. Jaboin JJ, Han Z, Hallahan DE: Using in vivo biopanning for the development of radiation-guided drug delivery systems. Methods Mol Biol 2009, 542:285-300. 15. Zhang J, Yan X, Shi C, Yang X, Guo Y, Tian C, Long J, Shen Y: Structural basis of beta-catenin recognition by Tax-interacting protein-1 . J Mol Biol 2008, 384(1 ):255-263.

16. Phillips JC, Braun R, Wang W, Gumbart J, Tajkhorshid E, Villa E, Chipot C, Skeel RD, Kale L, Schulten K: Scalable molecular dynamics with NAMD. Journal of computational chemistry 2005, 26(16): 1781 -1802.

17. Brooks BR, Brooks CL, 3rd, Mackerell AD, Jr., Nilsson L, Petrella RJ, Roux B, Won Y, Archontis G, Bartels C, Boresch S et al: CHARMM: the biomolecular simulation program. Journal of computational chemistry 2009, 30(10):1545-1614.

18. Zang L, Shi L, Guo J, Pan Q, Wu W, Pan X, Wang J: Screening and identification of a peptide specifically targeted to NCI-H1299 from a phage display peptide library. Cancer Lett 2009, 281 (1 ):64-70.

19. Wu CC, Lin EH, Lee YC, Tai CJ, Kuo TH, Wang HE, Luo TY, Fu YK, Chen HJ, Sun MD et al: Identification of a new peptide for fibrosarcoma tumor targeting and imaging in vivo. J Biomed Biotechnol 2010, 2010:167045.

20. Alewine C, Olsen O, Wade JB, Welling PA: TIP-1 has PDZ scaffold antagonist activity. Mol Biol Cell 2006, 17(10):4200-421 1 .

21 . Kanamori M, Sandy P, Marzinotto S, Benetti R, Kai C, Hayashizaki Y, Schneider C, Suzuki H: The PDZ protein tax-interacting protein-1 inhibits beta- catenin transcriptional activity and growth of colorectal cancer cells. J Biol Chem 2003, 278(40):38758-38764.

22. Han M, Wang H, Zhang HT, Han Z: The PDZ protein TIP-1 facilitates cell migration and pulmonary metastasis of human invasive breast cancer cells in athymic mice. Biochem Biophys Res Commun 2012, 422(1 ):139-145.

23. Oliver AW, He X, Borthwick K, Donne AJ, Hampson L, Hampson IN: The HPV16 E6 binding protein Tip-1 interacts with ARHGEF16, which activates Cdc42. Br J Cancer 201 1 , 104(2):324-331.

24. Menon R, Roy A, Mukherjee S, Belkin S, Zhang Y, Omenn GS: Functional implications of structural predictions for alternative splice proteins expressed in Her2/neu-induced breast cancers. J Proteome Res 201 1 , 10(12):5503-5511 . 25.Vithayathil R, Hooy RM, Cocco MJ, Weiss GA: The scope of phage display for membrane proteins. J Mol Biol 2011 , 414(4):499-510.

TABLE 1

HEGQTNV HFGGSEH HHWGSSV HNATSF HNSSTF HQGGQET HQSYTF HVAYSF HVGRDKV HVNGKYV

HEGSNF HFGGSEV HHYGSSV HNATSI HNSSTI HQGISEV HQSYYF HVAYTF HVGRDSV HVPGHTV

HEGSQF HFGGSHL HHYGTHV HNATSV HNSSTL HQGISSV HQSYYI HVAYYF HVGRSEV HVPGSEH

HEGSQI HFGGSSQ HHYMSSN HNATTF HNSSTV HQGMSTD HQTFDNV HVAYYI HVGRSNQ HVPIDSV

HEGSSF HFGIDSV HHYYSSM HNATTI HNSSYF HQGNSF HQTTLSV HVDLDSQ HVGRSSQ HVPNSDV

HEGSSI HFLGSHV HIGADSV HNATTL HNSSYI HQGNSI HQYMKRA HVDVSSQ HVGSDNV HVPRYSV

HEGSSV HFLGSSV HIGGDFV HNATTV HNSSYV HQGNTF HRFGDSV HVDWSLF HVGSSF HVQDSSV

HEGSTF HFMGSSV HIGGDSV HNATYF HNSTNF HQGNTI HRGESSK HVDWSSV HVGSSI HVQDSVN

HEGSTI HFQGSHV HIGGLKV HNATYI HNSTSF HQGNTV HRGFDFV HVEDSKD HVGSSNL HVQGDSL

HEGSTV HFQSQHV HIGGSEV HNATYL HNSTSI HQGNYI HRGGSSV HVEGDSV HVGSTF HVQLDYV

HEGTSF HFWGDSL HIGRSTV HNATYV HNSTSL HQGPSTF HRGISKQ HVELSNV HVGSTI HVQQVEV

HEGTSI HGDIYQT HIGYSSV HNAYNF HNSTSV HQGQSNI HRGQDLR HVEQSDV HVGTDDV HVQRDSV

HEGTSSV HGGGESH HIHGSMD HNAYNL HNSTTF HQGQTV HRGRSTV HVEQSVP HVGTNL HVQYSEV

HEGTTF HGGNFPV HIHLFDC HNAYQF HNSTTI HQGQYF HRGYSQV HVERDDV HVGTQI HVSGSIV

HEGTTI HGGYDHV HILAQSN HNAYSF HNSTTL HQGRSSV HRHGHSS HVERSSV HVGTSF HVSGSNI

HEGTTV HGLGSFP HIQKDDV HNAYTF HNSTTV HQGSSF HRKITRY HVFFSNW HVGTSI HVSGSVV

HEGTYF HGQDNSV HITGNMV HNAYYF HNSTYF HQGSSI HRLGRSE HVFGWSV HVGTSMQ HVSGTYI

HEGTYI HGVYSDV HIVYSSH HNAYYI HNSTYI HQGSSV HRLGSNV HVFISFS HVGTSSV HVSKQSV

HEGTYV HHEAPSL HKANSDI HNFDSFV HNSTYL HQGSTF HRMESWV HVFMLKV HVGTSTF HVSNSF

HEGYSF HHEFSFV HKDVSSV HNGASEV HNSTYV HQGSTI HRMGSSV HVFQSSV HVGTSV HVSNSI

HEGYTF HHEGSSV HKGGDSQ HNGGSHH HNSYNF HQGSTV HRPASSV HVFQSTV HVGTSYH HVSNSV

HEGYYF HHFGLSV HKGYDSV HNGGSSV HNSYQF HQGTSF HRQYHSC HVGAFSV HVGTTF HVSNTF

HEHRSHN HHFLLSV HKLISLD HNGGYVR HNSYSF HQGTSI HRTGFPN HVGASDQ HVGTTI HVSNTI

HEIMASV HHFLSNY HKQISSH HNGKSAM HNSYTF HQGTTF HRVESVV HVGASSS HVGTTNF HVSNTL

HELNSSV HHFRGSQ HKRINA HNGNSF HNSYYF HQGTTI HRVGSSV HVGDDAF HVGTTTI HVSNTNF

HEMASSV HHGASDV HKTRSWV HNGNSI HNSYYI HQGTTTI HRVNSLV HVGDDSQ HVGTYF HVSNTQI

HENWENH HHGASEV HKWAHSV HNGNTF HPAGSSV HQGTTV HRVYSSV HVGDSGP HVGTYI HVSNTSF

HERWKD HHGDQQV HLARSSV HNGNTI HPGEISV HQGTYF HRWGSSV HVGDSNQ HVGVDSD HVSNTV

HESGSQI HHGDSFV HLGDSKI HNGNTQL HPGGFSA HQGTYI HRWGSSV HVGEDVQ HVGVSHQ HVSNTYL

HESNSF HHGFFSV HLGEDFV HNGNTV HPGGVSV HQGVDSM HSAGQSV HVGGDEV HVGVSSQ HVSPSSF

HESNSI HHGFFSV HLGGSED HNGNTYI HPGVSSV HQGVSTV HSAQSEE HVGGDFV HVGWDQV HVSQSV

HESNSL HHGGDHL HLGGSEV HNGNTYV HPMGSVQ HQGYHAV HSFGSSV HVGGDMV HVGWWYV HVSQTYV

HESNSV HHGGDKL HLGGSEV HNGPSNI HPQGDHV HQGYSF HSGDQSY HVGGDSD HVGYDSV HVSSQF

HESNTF HHGGDSV HLGGSSV HNGPSTI HPSVSEV HQGYTF HSGMDSV HVGGDSV HVGYDVV HVSSSF

HESNTI HHGGHPV HLGGSVH HNGQNF HPYAHMV HQGYYF HSGYHSH HVGGDSV HVGYNV HVSSSI

HESNTL HHGGNSV HLGGSYQ HNGQQV HQANSF HQHFSSV HSWGSQV HVGGDSV HVGYSER HVSSSV

HESNTTI HHGGSDI HLGHQFS HNGQTYF HQANSI HQHVSQV HTDESSV HVGGDSV HVGYSF HVSSTF

HESNTV HHGGSHV HLGRSTV HNGSSF HQANSV HQIGSDV HTDMSEA HVGGDSW HVGYSFH HVSSTI

HESNYI HHGGSQV HLGYLQV HNGSSI HQANTF HQLGSSV HTEGSHV HVGGEKV HVGYSKV HVSSTL

HESPSQV HHGGSSN HLGYSSD HNGSSV HQANTI HQLRSSI HTERKRQ HVGGLSG HVGYSNV HVSSTNL

HESQTF HHGGSSV HLGYSSV HNGSTF HQANTL HQMGSDV HTETDSV HVGGNEV HVGYSNV HVSSTV

HESQTL HHGGSSV HLHNHVV HNGSTI HQANTV HQSGSDV HTGFSSI HVGGPSV HVGYSSH HVSSYF

HESSNF HHGGSSV HLIHITG HNGSTL HQANTYF HQSNNF HTGQSEV HVGGSEV HVGYSSV HVSSYI

HESSNI HHGGSSV HLLASSV HNGSTV HQAQTI HQSNSF HTGYSEN HVGGSEV HVGYSSW HVSSYV

HESSQF HHGGSSV HLWGSSV HNGTSF HQAQTSL HQSNSI HTGYSSV HVGGSEV HVGYTF HVSTSF

HESSSF HHGGSSV HLWVSSV HNGTSI HQAQTTI HQSNSL HTHGMVR HVGGSEV HVGYWSV HVSTSI

HESSSI HHGGSSV HLYASSV HNGTSSL HQAQYF HQSNSQV HTLGSSH HVGGSEV HVGYYF HVSTSV

HESSSL HHGGSSV HLYEQSV HNGTSV HQAQYI HQSNSV HTMSSTV HVGGSEV HVGYYI HVSTTF

HESSSV HHGGSSV HLYGSSV HNGTTF HQASQF HQSNTF HTQGSHV HVGGSFQ HVHGSDV HVSTTI

HESSTF HHGGSSV HMGGSQQ HNGTTI HQASQI HQSNTI HTQQSSV HVGGSFQ HVHGVDV HVSTTL

HESSTI HHGGSSV HMGNSNQ HNGTTV HQASQL HQSNTL HTSGKSV HVGGSGH HVHHSEV HVSTTV

HESSTL HHGHHMV HMGYHFV HNGTYF HQASSF HQSNTSL HTTGSEV HVGGSIV HVHISMQ HVSTYF

HESSTV HHGHSSV HMIGDSN HNGTYI HQASSI HQSNTV HTTYSSV HVGGSQQ HVIGSEV HVSTYI

HESSYF HHGISIS HMIGDSN HNGYNF HQASSV HQSNTYF HTYGSSQ HVGGSSA HVKGSDV HVSTYV

HESSYI HHGISLV HMIGSSH HNGYSF HQASTF HQSPSSF HTYWSSV HVGGSSV HVKGSDV HVSVSSQ

HESSYV HHGISQV HMMVDFS HNGYYF HQASTI HQSQSF HVANNV HVGGSSV HVKSWSH HVSYQF

HESTNF HHGKSSV HMPGDSV HNHDSSV HQASTL HQSRSSE HVANSF HVGGSSV HVLESSV HVSYSF

HESTQF HHGKSSV HMSRSSV HNMGIEM HQASTV HQSSNF HVANSI HVGGTQI HVLGDSV HVSYTF

HESTSF HHGLQSV HMTGTSE HNPQHSV HQASTYL HQSSQF HVANSTV HVGGTSV HVLGDSV HVSYTL

HESTSI HHGMHSH HMVDSSV HNQGSSQ HQASYF HQSSQI HVANSV HVGGWSV HVLGNED HVSYYF

HESTSL HHGMSMV HMVFWSW HNQRSDV HQASYI HQSSSF HVANTF HVGHDSV HVLGQSH HVSYYI

HESTSNI HHGNSSV HNAGSSI HNSFDFV HQATNL HQSSSI HVANTI HVGISEV HVLGSEV HVTAQFV

HESTSSF HHGNSSV HNANQF HNSGSSI HQATQI HQSSSL HVANTL HVGISSQ HVLGSHV HVTDQTH

HESTSV HHGPDSV HNANSF HNSGTTL HQATSF HQSSSQF HVANTV HVGKDSR HVLGSHW HVTDSSQ

HESTTF HHGRDNV H NAN SI HNSINRL HQATSI HQSSSV HVAQNI HVGKSKH HVLGVND HVTGFSV

HESTTI HHGRSSV HNANSNV HNSNSF HQATSV HQSSSYV HVASQF HVGKSSV HVLHHSV HVTGNSQ

HESTTL HHGSLSV HNANSV HNSNSI HQATTF HQSSTF HVASSF HVGKYHV HVLMTSV HVTGVFQ

HESTTV HHGSQEF HNANTF HNSNSL HQATTI HQSSTI HVASSI HVGMFEM HVLNISE HVTKLSV

HESTYF HHGVSSV ΗΝΑΝΤΊ HNSNSV HQATTL HQSSTL HVASSV HVGMFEV HVLRSPQ HVTMSSV

HESTYI HHIGSKV HNANTL HNSNTF HQATTQF HQSSTV HVASTF HVGNDQV HVLSSVV HVTQSHV

HESTYV HHILVKV HNANTV HNSNTI HQATTV HQSSYF HVASTI HVGNDSV HVLTSHI HVTRSTH

HESYNF HHLISQV HNANYF HNSNTL HQATTYI HQSSYI HVASTL HVGNDSV HVMANSV HVTTFSH

HESYSF HHLRVKS HNAQSSV HNSNTSI HQATTYL HQSSYV HVASTQV HVGNNF HVMASTV HVTVESV

HESYYF HHMHHSV HNAQSV HNSNTV HQATYF HQSTSF HVASTV HVGNSEH HVMDSDV HVTVSKN

HESYYI HHPMEHH HNASNF HNSNTYL HQATYI HQSTSI HVASYF HVGNSF HVMGSKH HVTYRSV

HEVMSEV HHPQSGV HNASQF HNSPSSL HQATYL HQSTSV HVASYI HVGNSHQ HVMGSSI HVVDSEV

HEVRSSV HHQGSSK HNASQI HNSPTTV HQATYV HQSTTF HVATSF HVGNSI HVMKSSV HVVESYV

HEVSSSQ HHQRDSE HNASSF HNSQSTI HQAYQF HQSTTI HVATSI HVGNSSQ HVMMSAV HVVGHEV

HEVYSSV HHQRNHH HNASSI HNSQTF HQAYSF HQSTTL HVATSV HVGNSSV HVMNKEV HVVGSVV

HEYDSSQ HHSGRHQ HNASSV HNSQTQV HQAYSV HQSTTNF HVATTF HVGNTF HVMNSDV HVVLSSH

HEYHETD HHSGSDV HNASTF HNSSNF HQAYTF HQSTTV HVATTI HVGNTI HVMNSSV HVWDSSV

HFAYSQV HHSQSPV HNASTI HNSSNI HQAYYF HQSTYF HVATTL HVGPTQF HVMNSSV HVWGHEV

HFDLSSV HHSQSSL HNASTL HNSSQF HQAYYI HQSTYI HVATTQV HVGPTTV HVMQSDV HVWGLHV

HFFGSEI HHSSSPV HNASTTF HNSSQI HQFGHKV HQSTYL HVATTV HVGQDSE HVMTSSV HVWGQEL

HFFLSSH HHTGVSV HNASTV HNSSSF HQFNSST HQSTYV HVATYF HVGQNSQ HVMTSSV HVWGSEH

HFFVHSV HHTQSST HNASYF HNSSSI HQGGDSV HQSYNF HVATYI HVGQQI HVMVSSV HVWGSHH

HFGASYK HHVASID HNASYI HNSSSL HQGGHKV HQSYQF HVATYV HVGQSV HVMYSTF HVWGSMV

HFGGDSW HHWGSSE HNASYV HNSSSV HQGGHSH HQSYSF HVAYSDK HVGRDAT HVNFSSE HVWGSSV HVWGSSV HWQDESV LHATVVS NEGSSL NVAQSNF QNAQSTF RFGGSSR VGLHAGG WEANTTV WEGPTQI

HVWGVEV HWQSSMV LHAVGVT NEGSYV NVATSI QNAQTQF RFSCFHC VGLHAGS WEANTV WEGQSNI

HVWISKD HWRQASY LHAVVGP NEGTQI NVGDSTV QNGNNF RHQGVSQ VGLHGGA WEAPSNF WEGQSNV

HVWKSMV HWRVSKV LHAVVGT NEGTSQL NVGGSYI QNGNSL RIMHAWG VGLHGGP WEAQNF WEGQSQI

HVWKSSI HWSWSSV LHAVVVS NEGTTSL NVGGTTL QNGNTQV RKAGDN VGLHGGT WEAQNV WEGQSQL

HVWLSSV HWTGSVT LHAVVVT NEGTTTF NVGNQV QNGPTTF RKQNDSD VGLHVAG WEAQSF WEGQSQV

HVWMSAV HWVGSSV LHGASSV NESPTQF NVGNTSI QNGQSF RKRVLLD VGLHVGA WEAQSL WEGQSTI

HVWNQFV HWWGSPV LHGGGSV NESPTQV NVGQISV QNGQTTF RLAPITL VGTAHGG WEAQSNI WEGQSTV

HVWNSSV HWYGNSV LHSAGVT NESQNV NVGSSNI QNGSQV RLSYIHA VGTPGHG WEAQSNV WEGQSV

HVWNSSV HWYGSKV LHSAVVP NESQSI NVGSYI QNGTQL RMHNAMD VGVHLAG WEAQSQF WEGQSYI

HVWQSSV HWYSSHV LHSAVVT NESSQV NVGTNV QNGTQV RNPISKS VGVHLAP WEAQSQI WEGQSYV

HVWRSMW HYAQSYV LHSSAVT NESSSF NVGYSL QNGTTTV RPRFIHP VGVHLVP WEAQSQL WEGQTYL

HVWRYPN HYAYSSV LHSSGVT NESSSI NVSGSTI QNGYNF RPTIHI VHLTGVP WEAQSQV WEGQYF

HVWVGDH HYDMSMV LHSSVAT NESSSSF NVSGTYL QNGYNL RTWQNCN VMKIAQS WEAQSSF WEGQYI

HVWVSPQ HYDNGSV LHSSVVT NESSSTV NVSNTSV QNGYYI RVGDDMV VPPAKAH WEAQSSV WEGRSNV

HVWYSSV HYEPNAV LHSTGVP NESTNV NVSPSQL QNSNQF RVHMAGM VPQECGI WEAQSTF WEGRSSD

HVYGDSV HYESHSD LHSTVVP NESTQF NVSQNV QNSNSSL RVLGSGV VRDYSSL WEAQSTI WEGSQF

HVYGSER HYGDFSV LHSTVVS NESYYF NVSQQL QNSNTTF RVVGLSA VRNMELD WEAQSTL WEGSSF

HVYGSSQ HYGGDSV LHSVAVS NHPQTKS NVSSSL QNSNYI RVWQSEI VSCDQMY WEAQSTV WEGSSI

HVYKSSM HYGGQMD LHSVAVT NHTWRM NVSSTSL QNSPSYF RVWWTLY VSHAGVP WEAQSYI WEGSSNI

HVYLSSQ HYGGSEV LHSVGVT NICHVSA NVSSTTI QNSQSNL RWGDSGD VSHPAGG WEAQSYV WEGSSQV

HVYPDSQ HYGGSFV LHSVVAP NIFVGVS NVSSYL QNSQTF RWNTVSH VSHPAVG WEAQTF WEGSSV

HVYQSHV HYGGSHV LHSVVAS IMILISDL NVSTSTL QNSSSI RYFNSV VSHPGLG WEAQTI WEGSTF

HVYRQSE HYGISSV LHSVVAT NINWCR NVSYNF QNSSYI RYPYYGW VSHPLGG WEAQTL WEGSTI

HVYVSSV HYGKPNG LHSVVGP NKAGSIP NWLAQMP QNSTQL RYVDSSV VSLHAGG WEAQTNI WEGSTL

HWAGQPR HYGMFHH LHSVVGT NLLDSKP PANICNH QNSYQV SALSHVT VSLHGGA WEAQTQI WEGSTV

HWAGSQV HYGQHSV LHSVVVT NMPQEK PDAHRFR QNSYYF SANTGLM VSLHGGP WEAQTQV WEGSYF

HWCPLPQ HYGQSHY LHTAGVP NNAGTTL PDYSDHH QPDMTW SCKWTNS VSLHGGT WEAQTTI WEGSYI

HWDGDSV HYGRSSD LHTAVVP NNAGTTV PFGEIAV QPVGEDV SGAPGHG VSLHVAG WEAQTYV WEGTSF

HWDLSPV HYGRSSV LHTSGVP NNAGTYV PIFQSPS QQAGTSF SGGTKCY VSLHVGA WEAQYF WEGTSI

HWDLSSV HYGYSSV LHVAGVP NNANTSV PKKEAPM QQANQI SGHPGAG VSLSEHI WEASNF WEGTSQI

HWEGISV HYIISPQ LHVSAVT A YL PKPLDLK QQANSNI SGSHLAG VSSPLHG WEASNI WEGTSYI

HWEQNSV HYLISSV LHVSGVP NNAQSV PLENFAN QQANTF SGVHALG VSTPGHG WEASNV WEGTTF

HWGAGKV HYLLSSE LHVTGAP AQTV PLRKYNE QQGNNL SGVHLAG VSVHALG WEASQF WEGTTI

HWGASSL HYSDSSQ LHVTGVP NNASQL PNEPKQY QQGNQL SGVHLVP VSVHLAG WEASSF WEGTTSV

HWGASSV HYSLQSI LHVVAVP NNATSSI PNYQMGN QQGQTL SGVPHLG VSVHLVP WEASSI WEGTTV

HWGFDSM HYTLDHV LHVVAVT NNATTSL PSVVTFR QQGTQF SHEFCCP VTGRSSV WEASSNI WEGTYF

HWGGDSY HYVHSDH LHVVGVP NNAYNF PTKWYW QQGTQI SHLSAVS VTHAGGG WEASSQV WEGTYI

HWGGEFV HYVMSHV LHVVVAT N AY SI PTVCYAN QQGTSV SHLSVAS VTHAGVP WEASSV WEGTYV

HWGGHSV HYVPQSW LHVVVVT NNEYSGI PTWSYK QQGTTI SITNSSE VTLHAGG WEASTF WEGYQF

HWGGIEV HYWGHAV LKAECCP NNGNSNL PVGGAVV QQGYYL SKHQCAH VTLHAGS WEASTI WEGYTF

HWGGSEV HYWTKSI LKHLYKK NNGNTNL PVIASSV QQSQNI SKHSRS VTLHGGA WEASTL WEGYYV

HWGGSIV IACCLMV LLTFAFK NNGNTYL PVSGPSV QQSQQL SLHACNI VTLHGGP WEASTV WEMSSSD

HWGGSLV IDTQ LC LPWSRHK NNGPSQL PWGRSSP QQSQYL SRTVELT VTLHVAG WEASYF WESGSNI

HWGGSNV IEIWLVR LQPLLTI NNGPTYV QDHSKGC QQSTTNL SSLSHAT VTLHVGA WEASYI WESGSQI

HWGGSSD IKYTRG LRDCSCK NNGQSI QEANQI QQSTYI SSTEVSN VTLHVGG WEASYL WESGSQL

HWGGSSQ ILGYSHV LRWGDLW NNGSSQL QEANQV QQSYNL SSTPGHG VTLHVVG WEASYV WESGSQV

HWGGSSV ILRVTPF LSINVY NNGSTTI QEANTSV QQSYSV SSVHALG VTQPLHQ WEATNV WESGSSV

HWGGSSV INVSSSG LTGGLSV NNGTTQF QEASQF QRIMKKT SSVHLAG VTVHLAG WEATSF WESGSTI

HWGGSSV IPSLGCC LTQFWPV NNSGSSI QEASSYF QVAGSNV STGGSSV VTVHLGG WEATSI WESGSTL

HWGGSSV IQNNHVH LVGSSSF NNSGTSF QEATSNI QVALHE STSHLGG VTVHLVG WEATSNI WESGSTV

HWGGSSV IQQSEY LYCHKP NNSNSF QEATTV QVANQL SVGKEQV VTVHLVP WEATSQL WESGSYI

HWGGSSV IRSKCKG LYGLDEW NNSNSI QEAYYL QVANTTL SWYGPCS VTVHVLG WEATSQV WESNQF

HWGGVMV ISPAENF MAARSGA NNSNTV QEGGSNV QVAPTTF SYDPKFS VVGGSSV WEATSV WESNQL

HWGIDSI ISWAKKI MCCDIWS NNSQNL QEGNSV QVAQYI TECDDIL VWHWHL WEATSYI WESNSF

HWGLSEV ITTKMWN MDGMGPD STYI QEGNTF QVASNV TIDHLH WADRDLV WEATSYL WESNSI

HWGLSSY IWWQSSH MDSDQTR SYTV QEGPTSL QVASSQL TIYKDDT WCMSYF WEATTF WESNSL

HWGLVSH IYLRDSV MFRVAAF NNVRFC QEGPTYI QVASTF TLDLLF WCQAMYY WEATTI WESNSNI

HWGMDSW IYYDTF MKDLSLG NPQYQHP QEGQNI QVASTYF TLGMYSD WDPFDH WEATTL WESNSNV

HWGMSEA KCQAWSQ MKMFFS NQAGTQF QEGQQF QVASYV TMDSFQE WEAGSNI WEATTSV WESNSQF

HWGNKEV KCYCDTY MLEMDQS NQANSYF QEGQTI QVATQI TNSVDRV WEAGSNL WEATTV WESNSQI

HWGPFSV KDPVTT MLNGSSV NQAPSNI QEGSYV QVATTI TQCEKIH WEAGSQF WEATYF WESNSQL

HWGPSFV KFWMYFK MMDTAPI NQAPTQL QEGTSQL QVGGSLY TRSLQEC WEAGSQI WEATYI WESNSQV

HWGPSSH KHGMFSF MNHSDYN NQAQSTF QEGTYI QVGGSSQ TSVQSFW WEAGSQL WEATYL WESNSSF

HWGRKSY KHYYTD MRSGSLM NQAQYI QEGYYV QVGGSTM TVARFAN WEAGSQV WEATYV WESNSSI

HWGTSSV KKAACCS MTMQWAV NQASSNI QESNTI QVGISLG TVGGASV WEANQL WEAYNF WESNSSL

HWGVDSV KKGQSSV MVFTPFE NQGGVSK QESNTTF QVGQTSV TVGLSAI WEANQV WEAYNI WESNSSV

HWGVSSV KLIIQT MVGLSLP NQGNNI QESNYV QVGQTTF TVRQPWH WEANSF WEAYQF WESNSTF

HWHGHDI KLNGSSV MVRLSSV NQGNSQF QESPTSF QVGSQI VAHPLGG WEANSI WEAYQL WESNSTI

HWHGSGV KM FAG DA MVVCNYW NQGQSYV QESPTSV QVGSYF VALHGGP WEANSL WEAYTF WESNSTL

HWHPSSV KNGQYSY MVYYEVT NQGSSQF QESQSF QVGTTF VALHGGT WEANSNI WEAYTL WESNSTV

HWHWSSV KNRTSWW MYGGSSA NQGTNI QESQTYV QVNQTWV VALHVGG WEANSNV WEAYYF WESNSV

HWIASSV KSTHALE NCDMCDQ NQGTSQF QESSYV QVSESSV VALHVGS WEANSQI WEAYYI WESNSYI

HWIESSV KTSHAYT NDLTQIM NQGYNI QESTQL QVSGSQL VALHVVG WEANSQL WEGGTQL WESNSYL

HWIPDSV KVGGPPV NDNPMI NQMNERF QESTSQI QVSGWSV VALVHGG WEANSQV WEGNSF WESNSYV

HWIWADV KVSGKKI NEAGTSF NQQHIRL QESTTYV QVSNTQV VAVHLGG WEANSSI WEGNSI WESNTF

HWKPYSE KVVIGPE NEANTTI NQRCPSL QFDGHGH QVSQSTV VAVHLVG WEANSSL WEGNSNI WESNTI

HWLGSSV KWRRKC NEANYF NQSGTSL QFELSEQ QVSYTI VAVHLVP WEANSSV WEGNSQI WESNTL

HWMGSSS KYFGSSV NEAPSNL NQSQQF QFIKPNT QVSYYI VAVHVLG WEANSTL WEGNSQL WESNTNI

HWMGSSV LAIVHEM NEAPTSV NQSQSI QITNPRG QVVPHLA VCDSAAE WEANSTV WEGNSQV WESNTQV

HWMKSSV LDEIKCR NEAQSF NQSSTTL QLMVWMD QVYPWLD VCNIDYA WEANSV WEGNSTL WESNTTI

HWM FSW LELDHHV NEAQSSI NQSTTNL QMCMRGH QWQHIRQ VCRIHR WEANSYI WEGNSV WESNTV

HWNESLE LFEDGEI NEAQTTV NRILQKD QMGGSST QYGMGAV VDAIPML WEANSYL WEGNSYI WESNTYV

HWNRSET LFFHAQ NEASNF NSPMHM QNAGSQF RCFCYLN VEATEHV WEANSYV WEGNTF WESPSTL

HWPASSW LGHPGVG NEASSTI NVAGHSH QNAGSSL RCWGWWT VGAPGHG WEANTF WEGNTI WESPTQF

HWPGDSV LHASVVS NEGPSTV NVAGSSI QNANSTV RDCGIRE VGHPAGG WEANTI WEGNTL WESPTYI

HWPGIVV LHASVVT NEGPTQF NVANSL QNAQNI RDQCVPG VGLAHGG WEANTL WEGNTTI WESPTYL

HWPWVSV LHATVVP NEGQNV NVANSTL QNAQSF REGESEV VGLAHVG WEANTQI WEGNTV WESQNF WESQNI WIGRSQV WNDGSSV WNSQSTI WQANSYL WQATTL WQGYQL WQSSSL WVAQSTL WVSNSI

WESQSF WKIISEV WNGGSQF WNSQSTL WQANSYV WQATT L WQGYSF WQSSSNI WVAQSTV WVSNSQF

WESQSI WKVTDF WNGGTNF WNSQSTV WQANTF WQATTV WQGYSL WQSSSNL WVAQSYI WVSNSQV

WESQSNV WMEAVYL WNGGTTI WNSQSV WQANTI WQATYF WQGYTF WQSSSNV WVAQSYV WVSNSV

WESQSQF WMKRNDE WNGMVC WNSQSYI WQANTL WQATYI WQGYTI WQSSSQI WVAQTI WVSNSYI

WESQSQI WMPESSV WNGNSF WNSQSYV WQANTQI WQATYL WQGYYF WQSSSQV WVASQF WVSNTF

WESQSQL WMWTHMV WNGNSI WNSQTF WQANTQV WQATYV WQGYYI WQSSSSV WVASSF WVSNTI

WESQSQV WNAGSNI WNGNSNI WNSQTYI WQANTV WQAYNF WQSGSNI WQSSSTL WVASSI WVSNTL

WESQSSI WNAGSQV WNGNSNV WNSQYI WQANYI WQAYQL WQSGSNL WQSSSTV WVASSV WVSNTV

WESQSSL WNAGTSF WNGNSQV WNSSNF WQAPSYI WQAYSF WQSGSNV WQSSSV WVASTF WVSNYI

WESQSSV WNANSF WNGNSV WNSSNI WQAPTSV WQAYTF WQSGSQI WQSSSYI WVASTI WVSNYV

WESQSTF WNANSI WNGNSYF WNSSNV WQAQNF WQAYTI WQSGSQL WQSSTF WVASTL WVSPSQI

WESQSTI WNANSL WNGNTF WNSSQF WQAQNV WQAYTL WQSGSQV WQSSTI WVASTNI WVSPSSF

WESQSTL WNANSNV WNGNTI WNSSQL WQAQSF WQAYYF WQSGSTV WQSSTL WVASTV WVSPSYI

WESQSTV WNANSQI WNGNTL WNSSSF WQAQSNI WQAYYI WQSGSYV WQSSTQL WVASYF WVSPTYF

WESQSYF WNA SQL WNGNTV WNSSSI WQAQSNL WQAYYL WQSGTNF WQSSTSI WVASYI WVSQSNV

WESQSYI WNANSQV WNGPTNV WNSSSL WQAQSNV WQGGSKV WQSNQF WQSSTV WVATSF WVSQSQF

WESQSYL WNANSTL WNGQSNI WNSSSNV WQAQSQF WQGGSNI WQSNQL WQSSYF WVATSI WVSQSQI

WESQSYV WNANSTV WNGQSNV WNSSSQV WQAQSQI WQGGSNV WQSNSF WQSSYI WVATSQI WVSQSQL

WESQTNI WNANSV WNGQSQI WNSSSV WQAQSQL WQGNQF WQSNSI WQSSYL WVATSV WVSQSQV

WESQTNV WNANSYI WNGQSQL WNSSTF WQAQSQV WQGNSF WQSNSL WQSSYV WVATTF WVSQSSV

WESQTQI WNANSYV WNGQSQV WNSSTI WQAQSSF WQGNSI WQSNSNI WQSTNF WVATTI WVSQSTL

WESQTQV WNANTF WNGQSSV WNSSTL WQAQSSI WQGNSL WQSNSNV WQSTNI WVATTL WVSQSTV

WESQTSV WNANTI WNGQSTL WNSSTV WQAQSSL WQGNSNI WQSNSQF WQSTNV WVATTV WVSQSYF

WESQTTI WNANTL WNGQSTV WNSSYF WQAQSSV WQGNSNV WQSNSQI WQSTQF WVATYF WVSQSYI

WESQTTL WNANTV WNGQSYI WNSSYI WQAQSTF WQGNSQI WQSNSQL WQSTQV WVATYI WVSQSYV

WESQTTV WNANYL WNGQSYV WNSSYV WQAQSTI WQGNSQL WQSNSQV WQSTSF WVATYL WVSSNF

WESQTYV WNAQS F WNGQTQV WNSTNF WQAQSTL WQGNSQV WQSNSSF WQSTSI WVATYV WVSSNI

WESQYF WNAQSNI WNGQTTV WNSTNI WQAQSTV WQGNSTL WQSNSSI WQSTSL WVAYNF WVSSQF

WESSNF WNAQSNV WNGSQF WNSTQF WQAQSYI WQGNSTV WQSNSSL WQSTSNI WVAYQF WVSSSF

WESSNI WNAQSQF WNGSQI WNSTQI WQAQSYL WQGNSV WQSNSSV WQSTS L WVAYSF WVSSSI

WESSQF WNAQSQI WNGSSF WNSTSF WQAQSYV WQGNSYI WQSNSTF WQSTSNV WVAYTF WVSSSV

WESSSF WNAQSQL WNGSSI WNSTSI WQAQTNI WQGNSYV WQSNSTI WQSTSQI WVAYYF WVSSTF

WESSSI WNAQSQV WNGSSSI WNSTSL WQAQTQI WQGNTF WQSNSTL WQSTSQL WVAYYI WVSSTI

WESSSQV WNAQSSL WNGSSV WNSTSNV WQAQTQV WQGNTI WQSNSTV WQSTSQV WVDMSSV WVSSTL

WESSSSL WNAQSSV WNGSTF WNSTSQI WQAQTTI WQGNTL WQSNSV WQSTSSV WVDQSVW WVSSTV

WESSSSV WNAQSTF WNGSTI WNSTSQV WQAQTTV WQGNTV WQSNSYI WQSTSTV WVEARLN WVSSYF

WESSSTI WNAQSTI WNGSTL WNSTSV WQAQTYL WQGQNI WQSNSYL WQSTSV WVFGDSH WVSSYI

WESSSTL WNAQSTL WNGSTTV WNSTSYI WQAQTYV WQGQSNI WQSNSYV WQSTSYI WVFMSSV WVSSYV

WESSSTV WNAQSTV WNGSTV WNSTTF WQAQYF WQGQSNV WQSNTF WQSTSYV WVGGDGV WVSTSF

WESSSV WNAQSYI WNGSYF WNSTTI WQAQYI WQGQSQF WQSNTI WQSTTF WVGGSAV WVSTSI

WESSTF WNAQSYV WNGSYI WNSTTL WQASNF WQGQSQI WQSNTL WQSTTI WVGGSDE WVSTSQI

WESSTI WNAQTTI WNGTSF WNSTTV WQASNI WQGQSQL WQSNTNI WQSTTL WVGGSSQ WVSTSSV

WESSTL WNASNF WNGTSI WNSTYF WQASNL WQGQSQV WQSNTQV WQSTTQF WVGGSSV WVSTSV

WESSTV WNASNI WNGTSQI WNSTYI WQASNV WQGQSSL WQSNTTI WQSTTV WVGNSF WVSTTF

WESSYF WNASQF WNGTSSL WNSTYL WQASQF WQGQSSV WQSNTV WQSTYF WVGNSI WVSTTI

WESSYI WNASSF WNGTSV WNSTYV WQASQL WQGQSTI WQSNTYV WQSTYI WVGNTF WVSTTL

WESSYV WNASSI WNGTTF WNSYNF WQASQV WQGQSTL WQSPSTV WQSTYL WVGNTI WVSTTV

WESTSF WNASSL WNGTTI WNSYQF WQASSF WQGQSTV WQSPSYI WQSTYV WVGNTV WVSTYF

WESTSI WNASSQV WNGTTL WNSYQI WQASSI WQGQSYI WQSPSYL WQSYNF WVGQQHR WVSTYI

WESTSNF WNASSV WNGTTV WNSYQL WQASSL WQGQSYV WQSQNF WQSYQL WVGQSNI WVSTYV

WESTSQF WNASTF WNGTYF WNSYQV WQASSNV WQGQYF WQSQNI WQSYSF WVGQSQI WVSYNF

WESTSQI WNASTI WNGTYI WNSYSF WQASSQI WQGSNF WQSQNL WQSYSI WVGQSQV WVSYTF

WESTSQL WNASTL WNGTYV WNSYTF WQASSQV WQGSQF WQSQNV WQSYTF WVGQSTV WVSYYF

WESTSQV WNASTSF WNGYQF WNSYYF WQASSSV WQGSSF WQSQSNL WQSYTI WVGQSYI WVSYYI

WESTSSL WNASTV WNGYSL WNSYYI WQASSTL WQGSSI WQSQSNV WQSYTV WVGRSSV WVTESSV

WESTSSV WNASTYL WNGYTF WPMRHMV WQASSTV WQGSSNI WQSQSQF WQSYYF WVGSSF WVVGDKV

WESTSTF WNASYF WNGYYF WPQGDSV WQASSV WQGSSNV WQSQSQI WQSYYI WVGSSI WVYHSSH

WESTSTI WNASYI WNSGSNI WQAGS I WQASSYI WQGSSQV WQSQSQL WRIGFEN WVGSSQL WWGGSLV

WESTSTL WNASYV WNSGSQF WQAGS L WQASTF WQGSSV WQSQSQV WTEQFYY WVGSSQV WWMYNEK

WESTSTV WNATNF WNSGSQV WQAGSNV WQASTI WQGSTF WQSQSSF WTWKDGM WVGSTF WWQDGIV

WESTSV WNATNI WNSNQF WQAGSQI WQASTL WQGSTI WQSQSSI WVAGTSV WVGSTI WYGEISV

WESTSYI WNATQF WNSNSF WQAGSQL WQASTSV WQGSTL WQSQSSL WVAGTYL WVGSTV WYTYSKY

WESTSYV WNATSF WNSNSI WQAGSQV WQASTV WQGSTNF WQSQSSV WVANNI WVGTNF YARMINA

WESTTF WNATSI WNSNSL WQAGSTL WQASYF WQGSTV WQSQSTF WVANQF WVGTSF YCTFKE

WESTTI WNATSL WNSNSNV WQAGSTV WQASYI WQGSYF WQSQSTI WVANQV WVGTSI YEAGSNI

WESTTL WNATSQV WNSNSQI WQANQF WQASYL WQGSYI WQSQSTL WVANSF WVGTSNF YEAGSYV

WESTTV WNATSSL WNSNSQL WQANQI WQASYV WQGSYV WQSQSTV WVANSI WVGTTF YEANNV

WESTYF WNATSV WNSNSQV WQANQL WQATNF WQGTQF WQSQSYI WVANSQI WVGTTI YEANSNV

WESTYI WNATSYI WNSNSSL WQANSF WQAT I WQGTSF WQSQSYL WVANSQV WVGTTQI YEANSQF

WESTYV WNATTF WNSNSTL WQANSI WQATNV WQGTSI WQSQSYV WVANSTF WVGTTTL YEANSQI

WESYNF WNATTI WNSNSTV WQANSL WQATQF WQGTSL WQSQTNI WVANSV WVGTTV YEANSQL

WESYQF WNATTL WNSNSV WQANSNI WQATQV WQGTSNI WQSQTQI WVANSYI WVGTYF YEANSQV

WESYQI WNATTQV WNSNSYV WQANSNV WQATSF WQGTSNV WQSQTSV WVANSYV WVGTYI YEANSTI

WESYQL WNATTV WNSNTF WQANSQF WQATSI WQGTSQI WQSQTTI WVANTF WVGTYV YEANSTL

WESYYF WNATYF WNSNTI WQANSQI WQATSL WQGTSQV WQSQTTV WVANTI WVGYNI YEANSTV

WESYYI WNATYI WNSNTL WQANSQL WQATSNI WQGTSTI WQSQTYV WVANTL WVGYQF YEANSYI

WETGSDN WNATYL WNSNTV WQANSQV WQATSNL WQGTSV WQSQYF WVANTV WVGYSF YEANSYV

WFGDSSV WNATYV WNSNYV WQANSSF WQATSNV WQGTSYI WQSQYI WVAPSYI WVGYSSV YEANTF

WFLACQW WNAYNF WNSQSI WQANSSI WQATSQI WQGTSYL WQSSNF WVAPTSL WVGYSV YEANTI

WGDFDD WNAYQI WNSQSNV WQANSSL WQATSQV WQGTTF WQSSNI WVAPTTF WVGYTF YEAPSYI

WGELDAV WNAYQL WNSQSQF WQANSSV WQATSTL WQGTTI WQSSNV WVAQSI WVGYYF YEAQSI

WGSRSKV WNAYSF WNSQSQI WQANSTF WQATSTV WQGTTL WQSSQF WVAQSNV WVMGLQQ YEAQSNV

WHFGSTV WNAYTF WNSQSQL WQANSTI WQATSV WQGTTV WQSSQI WVAQSQF WVMGSSV YEAQSQF

WHGGSSV WNAYTL WNSQSQV WQANSTL WQATSYI WQGTYF WQSSQL WVAQSQI WVQFSQV YEAQSQI

WHMGSQL WNAYYF WNSQSSL WQANSTV WQATSYV WQGTYI WQSSQV WVAQSQL WVS F YEAQSQL

WHVMDSV WNAYYI WNSQSSV WQANSV WQATTF WQGTYV WQSSSF WVAQSQV WVSNQI YEAQSQV

WIFITQA WNAYYV WNSQSTF WQANSYI WQATTI WQGYNF WQSSSI WVAQSSV WVSNSF YEAQSSL YEAQSTF YESQSSI YNASSI YNSTSTF YQATTI YQSQSSL YVASTI

YEAQSTI YESQSSL YNASTF YNSTSYI YQATTV YQSQSSV YVASTYI

YEAQSTL YESQSSV YNASTI YNSTTF YQATYF YQSQSTF YVASYL

YEAQSTV YESQSTF YNASTNV YNSTTI YQATYI YQSQSTI YVATTI

YEAQSYI YESQSTI YNATQV YNSTTNI YQATYV YQSQSTL YVATYF

YEAQSYV YESQSTL YNATSI YNSTYF YQAYNF YQSQSTV YVATYI

YEAQTNI YESQSTV YNATTF YNSTYI YQAYTF YQSQSYF YVAYQV

YEAQTQV YESQSYL YNATTI YNSTYL YQAYYF YQSQSYL YVAYSL

YEAQTSV YESQSYV YNATYF YNSYNI YQGNS I YQSQSYV YVAYTF

YEASSTV YESQTNI YNAYSF YNSYYF YQGNSQI YQSQTNI YVFYHF

YEASTTI YESQTNV YNAYTF YNSYYL YQGNSQV YQSQTQI YVGDDSV

YEASYI YESQTQF YNAYYF YPGQQSL YQGNSTI YQSQTQV YVGGDSV

YEATQF YESQTQI YNCVTWC YQADSAN YQGNSYI YQSQTTI YVGGQEV

YEATSL YESQTQV YNFGDSL YQAGSNI YQGNTF YQSQTTV YVGGSNF

YEATSQI YESQYF YNGGTNI YQAGSQV YQGNTI YQSQYF YVGGSSF

YEATSTI YESSQF YNGNSI YQAGSYV YQGQQI YQSSQF YVGGSYF

YEATSYI YESSSQI YNGNSTI YQANSF YQGQSQI YQSSSF YVGISMI

YEATTI YESSSQL YNGNTNV YQANSNV YQGQSQL YQSSSQV YVGNTQF

YEAYYF YESSSSV YNGPSNF YQANSQI YQGQSQV YQSSSTL YVGQSQI

YEGGTSI YESSSTI YNGPTTI YQA SQL YQGQSTV YQSSSV YVGSSYI

YEGNSQI YESSSTL YNGQSQI YQANSQV YQGQTI YQSSSYI YVGSTV

YEGNSQV YESSSTV YNGQSQV YQA STL YQGSNF YQSSTF YVGSYL

YEGNSTI YESSSYI YNGQSTI YQANSTV YQGSTF YQSSTI YVGTSI

YEGNSYI YESSTI YNGQSYI YQANSV YQGSTNF YQSSTL YVGTTF

YEGNTL YESTNV YNGQTTF YQANSYI YQGTQL YQSSTV YVGTTI

YEGNTV YESTSNI YNGSSTI YQANSYV YQGTSI YQSSYF YVGTTL

YEGNYV YESTSNV YNGTSTL YQANTF YQGTSQI YQSSYI YVGTYI

YEGQSQI YESTSQI YNGYNV YQANTI YQGTTI YQSTSF YVGYHYV

YEGQTI YESTSQL YNGYTL YQANTL YQGTYF YQSTSI YVGYSL

YEGQTSV YESTSQV YNKCDCF YQANTQI YQGYTF YQSTSNI YVHGVSV

YEGQTYI YESTSSV YNSGSNI YQANTQV YQGYYF YQSTSNV YVIGSDV

YEGSSTI YESTSTL YNSGSYV YQAPSQV YQIQSSW YQSTSQF YVLHSDV

YEGSTSI YESTSTV YNSGTSI YQAPSTF YQSGSNI YQSTSQI YVLRLSH

YEGTNI YESTSYI YNSGTYI YQAQNI YQSGSNV YQSTSQL YVMASSV

YEGTSQI YESTSYV YNSNQI YQAQSNV YQSGSQI YQSTSQV YVMQSSV

YEGTTNL YESTTI YNSNSI YQAQSQF YQSGSQL YQSTSTL YVQMSSV

YENWCSN YESYYF YNSNSL YQAQSQI YQSGSQV YQSTSTV YVSADSV

YESGSNI YEVHGPC YNSNSNV YQAQSQL YQSGSTV YQSTSV YVSGTSV

YESGSNL YFSYACE YNSNSQI YQAQSQV YQSGSYV YQSTSYI YVSNSQI

YESGSNV YFWVRDR YNSNSQL YQAQSSL YQSGTYF YQSTSYV YVSNSQV

YESGSQI YGDTKPK YNSNSQV YQAQSSV YQSNSF YQSTTF YVSNSV

YESGSQL YGLPWED YNSNSTL YQAQSTF YQSNSI YQSTTI YVSNSYI

YESGSQV YGMGSSL YNSNSTV YQAQSTI YQSNSNI YQSTTL YVSNTF

YESGSTV YGPTERR YNSNSYI YQAQSTL YQSNSNV YQSTTV YVSNTI

YESGSYV YHCAQEH YNSNSYV YQAQSTV YQSNSQF YQSTYF YVSNTYI

YESGTNF YHDYSSE YNSNTF YQAQSYV YQSNSQI YQSTYI YVSPSYV

YESNQV YHEVNSV YNSNTI YQAQTI YQSNSQL YQSTYV YVSQNI

YESNSNI YHGGSSV YNSNTQI YQAQTNI YQSNSQV YQSYNV YVSQSNV

YESNSNV YIGDCHL YNSNTV YQAQTQI YQSNSSI YQSYQF YVSQSQI

YESNSQF YIGRSSV YNSNTYI YQAQTQV YQSNSSL YQSYSF YVSQSQL

YESNSQI YIREVQE YNSQQF YQAQTTI YQSNSSV YQSYTF YVSQSQV

YESNSQL YKALIMLF YNSQSNI YQAQTYL YQSNSTF YQSYYF YVSQSTI

YESNSQV YKSTDCY YNSQSNV YQAQYF YQSNSTI YQSYYI YVSQSTL

YESNSSI YLHGHEA YNSQSQF YQASQF YQSNSTL YQVKTI YVSQSTV

YESNSSL YLPGSC YNSQSQI YQASQI YQSNSTV YRFGQRL YVSQSYF

YESNSSV YNAGSNI YNSQSQL YQASSF YQSNSV YRINWCY YVSQSYI

YESNSTF YNAGTNF YNSQSQV YQASSNI YQSNSYI YRWSMGD YVSQSYV

YESNSTI YNAGTNL YNSQSSV YQASSQL YQSNSYL YVAESQD YVSQYI

YESNSTL YNANNV YNSQSTF YQASSQV YQSNSYV YVAGTTI YVSSQV

YESNSTV YNANSQI YNSQSTL YQASSTI YQSNTF YVAISSQ YVSSSYV

YESNSYI YNANSQV YNSQSTV YQASSTV YQSNTI YVANSYI YVSSTF

YESNSYV YNANSYI YNSQSYI YQASTF YQSNTL YVANSYV YVSSTI

YESNTF YNANTF YNSQSYV YQASTI YQSNTQI YVANTI YVSTSL

YESNTI YNANTI YNSQTL YQASTV YQSNTV YVAPTQI YVSTSQI

YESPSQV YNANTNI YNSQTQI YQASYI YQSPSYF YVAPTSL YVSTSYF

YESPSYI YNAQNV YNSQTQV YQAT F YQSPTYI YVAQNV YVSTTI

YESQSI YNAQQV YNSQTYF YQATSF YQSQQL YVAQSNV YVSYTF

YESQSNL YNAQSNF YNSSSI YQATSI YQSQSNV YVAQSQI YVSYYF

YESQSNV YNAQSNI YNSSSQV YQATSQI YQSQSQF YVAQSQV YVVGSSQ

YESQSQF YNAQSQI YNSSTF YQATSQV YQSQSQI YVAQSSV YWDMSEV

YESQSQI YNAQSQV YNSSTI YQATSTI YQSQSQL YVAQSYF YWGEFSV

YESQSQL YNAQSYI YNSTSI YQATSV YQSQSQV YVASNL YWGGSDV

YESQSQV YNAQTQI YNSTSQI YQATSYI YQSQSSF YVASSV YWGGSSV

YESQSSF YNAQTQV YNSTSQV YQATTF YQSQSSI YVASSYF YWGHSSN TABLE 2

AAGASSA AGHTGGG AGLSVHT AGSSHLS AGTSGHP AGVSGHP AHLVGGG AHSTLGS AHTVGLP AHVTLGG

AAGGSGV AGHTGGP AGLTGHG AGSSHLT AGTSGHS AGVSGHT AHLVGGP AHSTLVG AHTVGLS AHVTLGP

AAGGSTF AGHTGGS AGLTGHP AGSSHVP AGTSHGG AGVSHGP AHLVGGS AHSTL P AHTVGVG AHVTLGS

AAGYAM AGHTGLG AGLTGHS AGSSHVT AGTSHGP AGVSHGT AHLVGGT AHSTLVS AHTVGVP AHVTLVG

AAVPSSP AGHTGLP AGLTHGG AGSSLHG AGTSHGS AGVSHLG AHLVGVG AHST GG AHTVGVS AHVTLVP

ADFGSNP AGHTGLS AGLTHGP AGSSLHP AGTSHLG AGVSHLP AHLVGVP AHST GP AHTVLGG AHVTLVS

ADGDRSV AGHTGVG AGLTHGS AGSSLHS AGTSHLP AGVSHLS AHLVGVS AHST GS AHTVLGP AHVTVGG

ADGHSSS AGHTGVP AGLTHVG AGSSLHT AGTSHLS AGVSHLT AHLVGVT AHSTVLG AHTVLGS AHVTVGP

ADGKSSL AGHTGVS AGLTHVP AGSSVHP AGTSHVG AGVSHVP AHLVVGG AHSTVLP AHTVLVG AHVTVGS

ADGTSQV AGHTLGG AGLTHVS AGSSVHT AGTSHVP AGVSHVT AHLVVGP AHSTVLS AHTVL P AHVTVLG

ADPILSV AGHTLGP AGLTVHG AGSTGHG AGTSHVS AGVSLHG AHLVVGS AHSTVVG AHTVLVS AHVTVLP

ADSGSSA AGHTLGS AGLTVHP AGSTGHP AGTSLHG AGVSLHP AHLVVGT AHSTVVP AHTVVGG AHVTVLS

ADSWTSV AGHTLVG AGLTVHS AGSTGHS AGTSLHP AGVSLHS AHLVVVG AHSTVVS AHTVVGP AHVTVVG

AEGGPIV AGHTL P AGLVGHG AGSTHGG AGTSLHS AGVSLHT AHLVVVP AHSVGGP AHTVVGS AHVTVVP

AEGGSMV AGHTLVS AGLVGHP AGSTHGP AGTSVHG AGVSVHP AHLVVVS AHSVGGT AHTVVLG AHVTVVS

AEGSSSV AGHTVGG AGLVGHS AGSTHGS AGTS HP AGVSVHT AHLVVVT AHSVGLG AHTVVLP AHVVGGP

AEPGSSE AGHTVGP AGLVGHT AGSTHLG AGTSVHS AGVTGHG AHNGSIR AHSVGLP AHTVVLS AHVVGGT

AEPISFI AGHTVGS AGLVHGG AGSTHLP AGTVGHG AGVTGHP AHSGQAE AHSVGLS AHTVVVG AHVVGLG

AFFDTSV AGHTVLG AGLVHGP AGSTHLS AGTVGHP AGVTGHS AHSLGGG AHSVGLT AHTVVVP AHVVGLP

AFGDSSI AGHTVLP AGLVHGS AGSTHVG AGTVGHS AGVTHGG AHSLGGP AHSVGVP AHTVVVS AHVVGLS

AFGHSSV AGHTVLS AGLVHGT AGSTHVP AGTVHGG AGVTHGP AHSLGGS AHSVGVT AHVLGGG AHVVGLT

AFG ST AGHTVVG AGLVHVG AGSTHVS AGTVHGP AGVTHGS AHSLGGT AHSVLGG AHVLGGP AHVVGVP

AFPIQSV AGHTVVP AGLVHVP AGSTLHG AGTVHGS AGVTHLG AHSLGVG AHSVLGP AHVLGGS AHVVGVT

AGALYVV AGHTVVS AGLVHVS AGSTLHP AGTVHLG AGVTHLP AHSLGVP AHSVLGS AHVLGGT AHVVLGG

AGGGSSE AGHVGGP AGLVHVT AGSTLHS AGTVHLP AGVTHLS AHSLGVS AHSVLGT AHVLGVG AHVVLGP

AGGHSSG AGHVGGT AGLVVHG AGSTVHG AGTVHLS AGVTHVG AHSLGVT AHSVLVG AHVLGVP AHVVLGS

AGGWSPK AGHVGLG AGLVVHP AGSTVHP AGTVHVG AGVTHVP AHSLVGG AHSVL P AHVLGVS AHVVLGT

AGGYIEF AGHVGLP AGLVVHS AGSTVHS AGTVHVP AGVTHVS AHSLVGP AHSVLVS AHVLGVT AHVVLVG

AGHGWPV AGH GLS AGLVVHT AGSVGHP AGTVHVS AGVTLHG AHSLVGS AHSVLVT AHVLVGG AHVVLVP

AGHLGGG AGHVGLT AGSHGGP AGSVGHT AGTVLHG AGVTLHP AHSLVGT AHSVVGP AHVLVGP AHVVLVS

AGHLGGP AGHVGVP AGSHGGT AGSVHGP AGTVLHP AGVTLHS AHSLVVG AHSVVGT AHVLVGS AHVVLVT

AGHLGGS AGHVGVT AGSHGLG AGSVHGT AGTVLHS AGVTVHG AHSLVVP AHSVVLG AHVLVGT AHVVVGP

AGHLGGT AGHVLGG AGSHGLP AGSVHLG AGTVVHG AGVTVHP AHSLVVS AHSVVLP AHVLVVG AHVVVGT

AGHLGVG AGHVLGP AGSHGLS AGSVHLP AGTVVHP AGVTVHS AHSLVVT AHSVVLS AHVLVVP AHVVVLG

AGHLGVP AGHVLGS AGSHGLT AGSVHLS AGTVVHS AGVVGHP AHSPGGG AHSVVLT AHVLVVS AHVVVLP

AGHLGVS AGHVLGT AGSHGVP AGSVHLT AGVHGGP AGVVGHT AHSPGGS AHSVVVP AHVLVVT AHVVVLS

AGHLGVT AGHVLVG AGSHGVT AGSVHVP AGVHGGT AGVVHGP AHSPGGT AHSVVVT AHVPGGG AHVVVLT

AGHLVGG AGHVL P AGSHLGG AGSVHVT AGVHGLG AGVVHGT AHSPGLG AHTLGGG AHVPGGS AHVVVVP

AGHLVGP AGHVLVS AGSHLGP AGSVLHG AGVHGLP AGVVHLG AHSPGLS AHTLGGP AHVPGGT AHVVVVT

AGHLVGS AGHVLVT AGSHLGS AGSVLHP AGVHGLS AGVVHLP AHSPGLT AHTLGGS AHVPGLG AHWGSSG

AGHLVGT AGH VGP AGSHLGT AGSVLHS AGVHGLT AGVVHLS AHSPGVG AHTLGVG AHVPGLS AIGGSSN

AGHLVVG AGHVVGT AGSHLVG AGSVLHT AGVHGVP AGVVHLT AHSPGVS AHTLGVP AHVPGLT AIHQKFP

AGHLVVP AGHVVLG AGSHLVP AGSVVHP AGVHGVT AGVVHVP AHSPGVT AHTLGVS AHVPGVG AIPGSSL

AGHLVVS AGHVVLP AGSHLVS AGSVVHT AGVHLGG AGVVHVT AHSPLGG AHTLVGG AHVPGVS AISHSSR

AGHLVVT AGHVVLS AGSHLVT AGTHGGG AGVHLGP AGVVLHG AHSPLGS AHTLVGP AHVPGVT AKGGHGS

AGHPGGG AGHVVLT AGSHVGP AGTHGGP AGVHLGS AGVVLHP AHSPLGT AHTLVGS AHVPLGG AKGGSSN

AGHPGGS AGHVVVP AGSHVGT AGTHGGS AGVHLGT AGVVLHS AHSPLVG AHTLVVG AHVPLGS AKGGSSV

AGHPGGT AGHVVVT AGSHVLG AGTHGLG AGVHLVG AGVVLHT AHSPLVS AHTLVVP AHVPLGT AKGGTLV

AGHPGLG AGIQFKV AGSHVLP AGTHGLP AGVHLVP AGVVVHP AHSPLVT AHTLVVS AHVPLVG AKGQSSS

AGHPGLS AGLGSQV AGSHVLS AGTHGLS AGVHLVS AGVVVHT AHSPVGG AHTPGGG AHVPLVS AKGVSSD

AGHPGLT AGLHGGG AGSHVLT AGTHGVG AGVHLVT AHGASVV AHSPVGS AHTPGGS AHVPLVT AKTGRSF

AGHPG G AGLHGGP AGSHVVP AGTHGVP AGVHVGP AHGHESV AHSPVGT AHTPGLG AHVPVGG ALFEWIV

AGHPG S AGLHGGS AGSHVVT AGTHGVS AGVHVGT AHGQKID AHSPVLG AHTPGLS AHVPVGS ALTGSSV

AGHPGVT AGLHGGT AGSLGHG AGTHLGG AGVHVLG AHLPGGG AHSPVLS AHTPGVG AHVPVGT AMFGSSV

AGHPLGG AGLHGVG AGSLGHP AGTHLGP AGVHVLP AHLPGGS AHSPVLT AHTPGVS AHVPVLG AMGFGIP

AGHPLGS AGLHGVP AGSLGHS AGTHLGS AGVHVLS AHLPGGT AHSPVVG AHTPLGG AHVPVLS AMGGSSV

AGHPLGT AGLHGVS AGSLGHT AGTHLVG AGVHVLT AHLPGVG AHSPVVS AHTPLGS AHVPVLT AMGYSQV

AGHPLVG AGLHGVT AGSLHGG AGTHL P AGVHVVP AHLPGVS AHSPVVT AHTPLVG AHVPVVG AMIGFTV

AGHPLVS AGLHVGG AGSLHGP AGTHLVS AGVHVVT AHLPGVT AHSSGGP AHTPLVS AHVPVVS ANAGVPV

AGHPLVT AGLHVGP AGSLHGS AGTHVGG AGVLGHG AHLPVGG AHSSGGT AHTPVGG AHVPVVT ANALFSV

AGHPVGG AGLHVGS AGSLHGT AGTHVGP AGVLGHP AHLPVGS AHSSGLG AHTPVGS AHVSGGP ANGGDSV

AGHPVGS AGLHVGT AGSLHVG AGTHVGS AGVLGHS AHLPVGT AHSSGLP AHTPVLG AHVSGGT ANGGGPV

AGHPVGT AGLH VG AGSLHVP AGTHVLG AGVLGHT AHLPVVG AHSSGLS AHTPVLS AH SGLG ANGGSSM

AGHPVLG AGLHVVP AGSLHVS AGTHVLP AGVLHGG AHLPVVS AHSSGLT AHTPVVG AH SGLP ANHNPPV

AGHPVLS AGLH VS AGSLHVT AGTHVLS AGVLHGP AHLPVVT AHSSGVP AHTPVVS AH SGLS ANMGSSM

AGHP LT AGLHVVT AGSLVHG AGTHVVG AGVLHGS AHLSGGG AHSSGVT AHTSGGG AH SGLT APAGSHD

AGHP VG AGLPGHG AGSLVHP AGTHVVP AGVLHGT AHLSGGP AHSSLGG AHTSGGP AHVSG P APEGSSV

AGHP VS AGLPGHS AGSLVHS AGTHVVS AGVLHVG AHLSGGS AHSSLGP AHTSGGS AHVSGVT APGESGW

AGHP VT AGLPGHT AGSLVHT AGTLGHG AGVLHVP AHLSGGT AHSSLGS AHTSGLG AHVSLGG APGGGSV

AGHSGGP AGLPHGG AGSPGHG AGTLGHP AGVLHVS AHLSGVG AHSSLGT AHTSGLP AH SLGP APGGVSV

AGHSGGT AGLPHGS AGSPGHS AGTLGHS AGVLHVT AHLSGVP AHSSLVG AHTSGLS AHVSLGS APMGFSV

AGHSGLG AGLPHGT AGSPGHT AGTLHGG AGVLVHG AHLSGVS AHSSLVP AHTSGVG AHVSLGT AQGGFQV

AGHSGLP AGLPHVG AGSPHGG AGTLHGP AGVL HP AHLSGVT AHSSLVS AHTSG P AHVSLVG AQGGHSV

AGHSGLS AGLPHVS AGSPHGS AGTLHGS AGVLVHS AHLSVGG AHSSLVT AHTSGVS AHVSL P AQGGSKV

AGHSGLT AGLPHVT AGSPHGT AGTLHVG AGVLVHT AHLSVGP AHSSVGP AHTSLGG AHVSLVS AQGGSSV

AGHSGVP AGLPVHG AGSPHLG AGTLHVP AG PGHG AHLSVGS AHSSVGT AHTSLGP AHVSLVT AQPGISV

AGHSGVT AGLPVHS AGSPHLS AGTLHVS AG PGHS AHLSVGT AHSSVLG AHTSLGS AHVSVGP ARFGSSD

AGHSLGG AGLPVHT AGSPHLT AGTLVHG AG PGHT AHLSVVG AHSSVLP AHTSLVG AHVSVGT ARGGWSK

AGHSLGP AGLSGHG AGSPHVG AGTL HP AGVPHGG AHLSVVP AHSSVLS AHTSL P AHVSVLG ARQYSSM

AGHSLGS AGLSGHP AGSPHVS AGTLVHS AGVPHGS AHLSVVS AHSSVLT AHTSLVS AHVSVLP ASGGESV

AGHSLGT AGLSGHS AGSPHVT AGTPGHG AGVPHGT AHLSVVT AHSSVVP AHTSVGG AHVSVLS ASGGSSY

AGHSLVG AGLSGHT AGSPLHG AGTPGHS AGVPHLG AHLTGGG AHSSVVT AHTSVGP AHVSVLT ASGPTSM

AGHSLVP AGLSHGG AGSPLHS AGTPHGG AGVPHLS AHLTGGP AHSTGGG AHTSVGS AHVSVVP ASHLGGG

AGHSLVS AGLSHGP AGSPLHT AGTPHGS AGVPHLT AHLTGGS AHSTGGP AHTSVLG AHVSVVT ASHLGGP

AGHSLVT AGLSHGS AGSPVHG AGTPHLG AGVPHVG AHLTGVG AHSTGGS AHTSVLP AHVTGGG ASHLGGS

AGHSVGP AGLSHGT AGSPVHS AGTPHLS AGVPHVS AHLTGVP AHSTGLG AHTSVLS AHVTGGP ASHLGGT

AGHSVGT AGLSHVG AGSPVHT AGTPHVG AGVPHVT AHLTGVS AHSTGLP AHTSVVG AHVTGGS ASHLGVG

AGHSVLG AGLSHVP AGSSGHP AGTPHVS AGVPLHG AHLTVGG AHSTGLS AHTSVVP AHVTGLG ASHLGVP

AGHSVLP AGLSHVS AGSSGHT AGTPLHG AGVPLHS AHLTVGP AHSTG G AHTSVVS AHVTGLP ASHLGVS

AGHSVLS AGLSHVT AGSSHGP AGTPLHS AGVPLHT AHLTVGS AHSTGVP AHTVGGG AHVTGLS ASHLGVT

AGHSVLT AGLSVHG AGSSHGT AGTPVHG AGVPVHG AHLTVVG AHSTG S AHTVGGP AHVTGVG ASHLVGG

AGHSVVP AGLS HP AGSSHLG AGTPVHS AGVPVHS AHLTVVP AHSTLGG AHTVGGS AHVTGVP ASHLVGP

AGHSVVT AGLSVHS AGSSHLP AGTSGHG AGVPVHT AHLTVVS AHSTLGP AHTVGLG AHVTGVS ASHLVGS ASHLVGT ASHVVLS ASSHVLS ASTHLGG ASVHVVP ATHLVGP ATLSHVS ATSVVHG AVFWVSW AWGPSMV

ASHLVVG ASHVVLT ASSHVLT ASTHLGP ASVHVVT ATHLVGS ATLSVHG ATSVVHP AVGDGSV AWGQSSV

ASHLVVP ASHVVVP ASSHVVP ASTHLGS ASVLGHG ATHLVVG ATLSVHP ATSVVHS AVGDKSV AWIRSTV

ASHLVVS ASHVVVT ASSHVVT ASTHLVG ASVLGHP ATHLVVP ATLSVHS ATVHGGG AVGDVSV AWPGSSV

ASHLVVT ASKFESN ASSLGHG ASTHL P ASVLGHS ATHLVVS ATLVGHG ATVHGGP AVGESSG AYAWSEV

ASHPGGG ASLHGGG ASSLGHP ASTHLVS ASVLGHT ATHPGGG ATLVGHP ATVHGGS AVGESSV AYDISYF

ASHPGGS ASLHGGP ASSLGHS ASTHVGG ASVLHGG ATHPGGS ATLVGHS ATVHGLG AVGFGEV AYGGRYP

ASHPGGT ASLHGGS ASSLGHT ASTHVGP ASVLHGP ATHPGLG ATLVHGG ATVHGLP AVGFNSV AYGHPSH

ASHPGLG ASLHGGT ASSLHGG ASTHVGS ASVLHGS ATHPGLS ATLVHGP ATVHGLS AVGFSPV AYGRSSV

ASHPGLS ASLHGVG ASSLHGP ASTHVLG ASVLHGT ATHPGVG ATLVHGS ATVHGVG AVGGDSR AYGVHFY

ASHPGLT ASLHG P ASSLHGS ASTHVLP ASVLHVG ATHPGVS ATLVHVG ATVHGVP AVGGGSV AYSFHLV

ASHPGVG ASLHGVS ASSLHGT ASTHVLS ASVLHVP ATHPLGG ATLVHVP ATVHGVS AVGGISY DADGSSQ

ASHPGVS ASLHGVT ASSLHVG ASTHVVG ASVLHVS ATHPLGS ATLVHVS ATVHLGG AVGGKDV DAGGSKA

ASHPGVT ASLHVGG ASSLHVP ASTHVVP ASVLHVT ATHPLVG ATLVVHG ATVHLGP AVGGLHQ DAGGSSY

ASHPLGG ASLHVGP ASSLHVS ASTHVVS ASVLVHG ATHPLVS ATLVVHP ATVHLGS AVGGSAV DAGMSSK

ASHPLGS ASLHVGS ASSLHVT ASTLGHG ASVLVHP ATHPVGG ATL VHS ATVHLVG AVGGSEV DAGTSYV

ASHPLGT ASLHVGT ASSLVHG ASTLGHP ASVLVHS ATHPVGS ATSHGGG ATVHL P AVGGSGV DAKIVQF

ASHPLVG ASLH VG ASSL HP ASTLGHS ASVLVHT ATHPVLG ATSHGGP ATVHLVS AVGGSKQ DATGTAQ

ASHPLVS ASLHVVP ASSLVHS ASTLHGG ASVPGHG ATHPVLS ATSHGGS ATVHVGG AVGGSKS DAYGFYV

ASHPLVT ASLHVVS ASSLVHT ASTLHGP ASVPGHS ATHPVVG ATSHGLG ATVHVGP AVGGSLG DDGGPSR

ASHPVGG ASLHVVT ASSPGHG ASTLHGS ASVPGHT ATHPVVS ATSHGLP ATVHVGS AVGGSLV DDGNSSV

ASHPVGS ASLPGHG ASSPGHS ASTLHVG ASVPHGG ATHSGGG ATSHGLS ATVHVLG AVGGSMV DEGGLSV

ASHPVGT ASLPGHS ASSPGHT ASTLHVP ASVPHGS ATHSGGP ATSHGVG ATVHVLP AVGGSND DEGGQTG

ASHPVLG ASLPGHT ASSPHGG ASTLHVS ASVPHGT ATHSGGS ATSHGVP ATVHVLS AVGGSQV DEGGSSV

ASHPVLS ASLPHGG ASSPHGS ASTLVHG ASVPHLG ATHSGLG ATSHGVS ATVHVVG AVGGSSA DEGRSSW

ASHPVLT ASLPHGS ASSPHGT ASTLVHP ASVPHLS ATHSGLP ATSHLGG ATVHVVP AVGGSSD DEGWSPN

ASHPVVG ASLPHGT ASSPHLG ASTLVHS ASVPHLT ATHSGLS ATSHLGP ATVHVVS AVGGSSG DFGGASL

ASHPVVS ASLPHVG ASSPHLS ASTPGHG ASVPHVG ATHSGVG ATSHLGS ATVLGHG AVGGSSH DFGGVDV

ASHPVVT ASLPHVS ASSPHLT ASTPGHS ASVPHVS ATHSG P ATSHLVG ATVLGHP AVGGSSI DFGGVQN

ASHSGGP ASLPHVT ASSPHVG ASTPHGG ASVPHVT ATHSGVS ATSHLVP ATVLGHS AVGGSSK DFWVSLP

ASHSGGT ASLPVHG ASSPHVS ASTPHGS ASVPLHG ATHSLGG ATSHLVS ATVLHGG AVGGSSP DFYGSMV

ASHSGLG ASLPVHS ASSPHVT ASTPHLG ASVPLHS ATHSLGP ATSHVGG ATVLHGP AVGGSSR DGGQSKV

ASHSGLP ASLPVHT ASSPLHG ASTPHLS ASVPLHT ATHSLGS ATSHVGP ATVLHGS AVGGSSS DHGDSSV

ASHSGLS ASLSGHG ASSPLHS ASTPHVG ASVPVHG ATHSLVG ATSHVGS ATVLHVG AVGGSSV DHGGSME

ASHSGLT ASLSGHP ASSPLHT ASTPHVS ASVPVHS ATHSL P ATSHVLG ATVLHVP AVGGSYG DHGGSST

ASHSGVP ASLSGHS ASSPVHG ASTPLHG ASVPVHT ATHSLVS ATSHVLP ATVLHVS AVGGSYS DHGGSSV

ASHSGVT ASLSGHT ASSPVHS ASTPLHS ASVSGHP ATHSVGG ATSHVLS ATVLVHG AVGGWSQ DHYGSSD

ASHSLGG ASLSHGG ASSPVHT ASTPVHG ASVSGHT ATHSVGP ATSHVVG ATVL HP A GHTSV DIGGGSG

ASHSLGP ASLSHGP ASSSGHP ASTPVHS ASVSHGP ATHSVGS ATSHVVP ATVLVHS AVGISLV DIGGSQV

ASHSLGS ASLSHGS ASSSGHT ASTSGHG ASVSHGT ATHSVLG ATSHVVS ATVPGHG AVGISMK DIGISQV

ASHSLGT ASLSHGT ASSSHGP ASTSGHP ASVSHLG ATHSVLP ATSLGHG ATVPGHS AVGKEKV DIHGYSV

ASHSLVG ASLSHVG ASSSHGT ASTSGHS ASVSHLP ATHSVLS ATSLGHP ATVPHGG AVGKSEV DINGSGV

ASHSL P ASLSHVP ASSSHLG ASTSHGG ASVSHLS ATHSVVG ATSLGHS ATVPHGS AVGKSFI DIPGFSS

ASHSLVS ASLSHVS ASSSHLP ASTSHGP ASVSHLT ATHSVVP ATSLHGG ATVPHLG AVGKSPV DIPGPGF

ASHSLVT ASLSHVT ASSSHLS ASTSHGS ASVSHVP ATHSVVS ATSLHGP ATVPHLS A GKTSV DITGSGV

ASHSVGP ASLSVHG ASSSHLT ASTSHLG ASVSHVT ATHVGGG ATSLHGS ATVPHVG AVGLPEV DKGGGSV

ASH SVG T ASLSVHP ASSSHVP ASTSHLP ASVSLHG ATHVGGP ATSLHVG ATVPHVS AVGMTAV DKGMSHW

ASHSVLG ASLSVHS ASSSHVT ASTSHLS ASVSLHP ATHVGGS ATSLHVP ATVPLHG AVGNSNV DKHNDNI

ASHSVLP ASLSVHT ASSSLHG ASTSHVG ASVSLHS ATHVGLG ATSLHVS ATVPLHS AVGNSQM DKILSSV

ASHSVLS ASLTGHG ASSSLHP ASTSHVP ASVSLHT ATHVGLP ATSLVHG ATVPVHG AVGNSSK DKNGSSA

ASHSVLT ASLTGHP ASSSLHS ASTSHVS ASVSVHP ATHVGLS ATSLVHP ATVPVHS AVGQSSA DLAGHVI

ASHSVVP ASLTGHS ASSSLHT ASTSLHG ASVSVHT ATHVGVG ATSLVHS ATVSGHG A GRQVH DLAGTSV

ASHSVVT ASLTHGG ASSS HP ASTSLHP ASVTGHG ATHVGVP ATSPGHG AT SGHP AVGRSSL DLDYSSV

ASHTGGG ASLTHGP ASSSVHT ASTSLHS ASVTGHP ATHVGVS ATSPGHS ATVSGHS AVGSSLV DLGGHKW

ASHTGGP ASLTHGS ASSTGHG ASTSVHG ASVTGHS ATHVLGG ATSPHGG ATVSHGG AVGSSSS DLGGSMM

ASHTGGS ASLTHVG ASSTGHP ASTS HP ASVTHGG ATHVLGP ATSPHGS ATVSHGP AVGSSVP DLGGSMV

ASHTGLG ASLTHVP ASSTGHS ASTSVHS ASVTHGP ATHVLGS ATSPHLG ATVSHGS AVGTKFV DLGGSSA

ASHTGLP ASLTHVS ASSTHGG ASTVGHG ASVTHGS ATHVLVG ATSPHLS ATVSHLG AVGTRSS DLGSSGV

ASHTGLS ASLTVHG ASSTHGP ASTVGHP ASVTHLG ATHVL P ATSPHVG ATVSHLP AVGWSEW DLIGPSM

ASHTGVG ASLTVHP ASSTHGS ASTVGHS ASVTHLP ATHVLVS ATSPHVS ATVSHLS AVGYQSV DLMGHSV

ASHTGVP ASLTVHS ASSTHLG ASTVHGG ASVTHLS ATHVVGG ATSPLHG ATVSHVG AVGYSSV DLNGKTM

ASHTGVS ASLVGHG ASSTHLP ASTVHGP ASVTHVG ATHVVGP ATSPLHS ATVSHVP AVHGSSN DLQGSAV

ASHTLGG ASLVGHP ASSTHLS ASTVHGS ASVTHVP ATHVVGS ATSPVHG ATVSHVS AVHGWSQ DLQSSSV

ASHTLGP ASLVGHS ASSTHVG ASTVHLG ASVTHVS ATHVVLG ATSPVHS ATVSLHG AVHRSGV DLSMYKG

ASHTLGS ASLVGHT ASSTHVP ASTVHLP ASVTLHG ATHVVLP ATSSGHG ATVSLHP AVIGSSW DLTMSPV

ASHTLVG ASLVHGG ASSTHVS ASTVHLS ASVTLHP ATHVVLS ATSSGHP ATVSLHS AVIGTSV DMGGSSV

ASHTL P ASLVHGP ASSTLHG ASTVHVG ASVTLHS ATHVVVG ATSSGHS ATVSVHG AVLESLK DMGNIPP

ASHTLVS ASLVHGS ASSTLHP ASTVHVP ASVTVHG ATHVVVP ATSSHGG ATVSVHP AVLGSSH DMGSTSY

ASHTVGG ASLVHGT ASSTLHS ASTVHVS ASVTVHP ATHVVVS ATSSHGP ATVSVHS AVLGSSV DMKGASV

ASHTVGP ASLVHVG ASSTVHG ASTVLHG ASVTVHS ATLHGGG ATSSHGS ATVVGHG AVMGSGH DMLGISV

ASHTVGS ASLVHVP ASSTVHP ASTVLHP AS VGHP ATLHGGP ATSSHLG AT VGHP AVMGSIH DMNYSVV

ASHTVLG ASLVHVS ASSTVHS ASTVLHS AS VGHT ATLHGGS ATSSHLP ATVVGHS AVNGNLI DNGGSSH

ASHTVLP ASLVHVT ASSVGHP ASTVVHG ASVVHGP ATLHGVG ATSSHLS ATVVHGG AVNGSKE DNGSSSW

ASHTVLS ASLVVHG ASSVGHT ASTVVHP ASVVHGT ATLHGVP ATSSHVG ATVVHGP AVNGSKS DNMSNSG

ASHTVVG ASLVVHP ASSVHGP ASTVVHS AS VHLG ATLHGVS ATSSHVP ATVVHGS AVNMSLD DNTGSSV

ASHTVVP ASLVVHS ASSVHGT ASVHGGP ASVVHLP ATLHVGG ATSSHVS AT VHLG AVNRHYV DNWGKDV

ASHTVVS ASLVVHT ASSVHLG ASVHGGT AS VHLS ATLHVGP ATSSLHG ATVVHLP AVPDFSV DPGGSNV

ASHVGGP ASSHGGP ASSVHLP ASVHGLG AS VHLT ATLHVGS ATSSLHP AT VHLS AVPGQSR DPGGVFN

ASHVGGT ASSHGGT ASSVHLS ASVHGLP ASVVHVP ATLHVVG ATSSLHS ATVVHVG AVPGRSV DPGHSGV

ASHVGLG ASSHGLG ASSVHLT ASVHGLS ASVVHVT ATLHVVP ATSSVHG ATVVHVP AVPGSSW DPTPHSV

ASHVGLP ASSHGLP ASSVHVP ASVHGLT ASVVLHG ATLHVVS ATSS HP ATVVHVS AVPGSTF DQGGDTV

ASHVGLS ASSHGLS ASSVHVT ASVHGVP ASVVLHP ATLPGHG ATSSVHS ATVVLHG AVPKSPV DQGNSSF

ASH GLT ASSHGLT ASSVLHG ASVHGVT ASVVLHS ATLPGHS ATSVGHG ATVVLHP AVQAIHV DQPGKYN

ASHVGVP ASSHGVP ASSVLHP ASVHLGG ASVVLHT ATLPHGG ATSVGHP ATVVLHS AVQGNSQ DQSGSDK

ASHVGVT ASSHGVT ASSVLHS ASVHLGP ASVVVHP ATLPHGS ATSVGHS ATVVVHG AVSGGSN DQTGSSV

ASHVLGG ASSHLGG ASSVLHT ASVHLGS ASVVVHT ATLPHVG ATSVHGG ATVVVHP AVSGSSI DRDGGSV

ASHVLGP ASSHLGP ASSVVHP ASVHLGT ATGESSV ATLPHVS ATSVHGP ATVVVHS AVSGSSV DRGASSV

ASHVLGS ASSHLGS ASSVVHT ASVHLVG ATGGFSV ATLPVHG ATSVHGS AVAGSQV AVSLSFV DRGGGMV

ASHVLGT ASSHLGT ASTHGGG ASVHL P ATGKYSA ATLPVHS ATSVHLG AVAWDSV AVTGDSV DRGGSSV

ASHVLVG ASSHLVG ASTHGGP ASVHLVS ATGRWSV ATLSGHG ATSVHLP A DGSSV AVTGSVS DRGHSLV

ASHVL P ASSHL P ASTHGGS ASVHLVT ATHLGGG ATLSGHP ATS HLS AVDNSLT AVVDSVV DRGYNQK

ASHVLVS ASSHLVS ASTHGLG ASVHVGP ATHLGGP ATLSGHS ATSVHVG AVEGSPV AVVGSSV DRGYPLY

ASHVLVT ASSHLVT ASTHGLP ASVHVGT ATHLGGS ATLSHGG ATSVHVP AVEGSSS AVVKVSV DRNGIMI

ASHVVGP ASSHVGP ASTHGLS ASVHVLG ATHLGVG ATLSHGP ATSVHVS AVELSTD AVVTSSQ DRVASAS

ASHVVGT ASSHVGT ASTHGVG ASVHVLP ATHLGVP ATLSHGS ATSVLHG AVEYHQP AVWGKDY DSGDLAW

ASHVVLG ASSHVLG ASTHGVP ASVHVLS ATHLGVS ATLSHVG ATSVLHP AVFGHSV AVWYSLS DSGGHAI

ASHVVLP ASSHVLP ASTHGVS ASVHVLT ATHLVGG ATLSHVP ATSVLHS AVFMSSV AVYGSSQ DSGGPFW DSGGSDY DVLASSV ELWGSSW EVGKSVV FEAGSTF FEAPSSF FEASQI FEATTQV FEGNSQL FEGQSNV

DSGGSNV DVLETSV EMGGFSK EVGKTSS FEAGSTI FEAPSSI FEASQL FEATTSF FEGNSQV FEGQSQF

DSGPSSY DVLRWNK EMGISKK EVGLSMG FEAGSTL FEAPSSL FEASQV FEATTSI FEGNSSF FEGQSQI

DSMTSTI DVLYSSH EMNGSTH EVGLSSL FEAGSTV FEAPSSV FEASSF FEATTSL FEGNSSI FEGQSQL

DTGGIKF DVMFSTV EMPGSSV EVGLSSV FEAGSVT FEAPSTF FEASSI FEATTSV FEGNSSL FEGQSQV

DTGGLSV DVMGQEV E AVSAV EVGMSLV FEAGSYF FEAPSTI FEASSL FEATTTF FEGNSSV FEGQSSF

DTGGSSE DVMGSMV E FGRSV EVGNSIT FEAGSYI FEAPSTL FEASS F FEATTTI FEGNSTF FEGQSSI

DTGSSFL DVMGSNV ENFGSSV EVGNSSV FEAGSYL FEAPSTV FEASSNI FEATTTL FEGNSTI FEGQSSL

DTGWSML DVMTDSV ENGGSNF EVGNSTT FEAGSYV FEAPSYF FEASSNL FEATTTV FEGNSTL FEGQSSV

DTIGSSF DVNGSSQ ENGGSPV EVGPSSH FEAGTNF FEAPSYI FEASSNV FEATTV FEGNSTV FEGQSTF

DTIYTSG DVNGVSM ENGGSQV EVGQWSA FEAGT I FEAPSYL FEASSQF FEATTYF FEGNSV FEGQSTI

DVAGSSV DVNHSSV ENGGSVV EVGRESV FEAGT L FEAPSYV FEASSQI FEATTYI FEGNSYF FEGQSTL

DVARVSM DVNITSL ENGLSAV EVGRFQV FEAGTNV FEAPTNF FEASSQL FEATTYL FEGNSYI FEGQSTV

DVATSSV DV RSIY ENISDSV EVGRLFV FEAGTQF FEAPT I FEASSQV FEATTYV FEGNSYL FEGQSV

DVDFETV DVPGTIV ENTGGSV EVGRNSV FEAGTQI FEAPT L FEASSSF FEATYF FEGNSYV FEGQSYF

DVDGGSV DVQGKFS ENWRWSV EVGRSSM FEAGTQL FEAPTNV FEASSSI FEATYI FEGNTF FEGQSYI

DVDPPSV DVQGKSV EPGMSDV EVGRSSV FEAGTQV FEAPTQF FEASSSL FEATYL FEGNTI FEGQSYL

DVEFSHV DVSGSLE EPKGRSY EVGRWAV FEAGTSF FEAPTQI FEASSSV FEATYV FEGNTL FEGQSYV

DVEGSSN DVSGSSV EPLGRYV EVGRYSV FEAGTSI FEAPTQL FEASSTF FEAY F FEGNTNF FEGQTF

DVEGSSV DVSRHSH EPWKSSV EVGSESV FEAGTSL FEAPTQV FEASSTI FEAYNI FEGNTNI FEGQTI

DVFGSG DVTARSP EQGDTSI EVGSSSS FEAGTSV FEAPTSF FEASSTL FEAYNL FEGNTNL FEGQTL

DVFGSNG DVTDSSV EQGEVSA EVGTHSV FEAGTTF FEAPTSI FEASSTV FEAYNV FEGNTNV FEGQTNF

DVFGSSV DVTGTSV EQPLSNV EVGTIHS FEAGTTI FEAPTSL FEASSV FEAYQF FEGNTQF FEGQTNI

DVFGSSY DVTHQSV EQWGDSR EVGTKKV FEAGTTL FEAPTSV FEASSYF FEAYQI FEGNTQI FEGQTNL

DVFGYVI DVTIHAV ERGGSSE EVGTSVT FEAGTTV FEAPTTF FEASSYI FEAYQL FEGNTQL FEGQTNV

DVFTPSV DVTKTAE ERGGSSV EVGYASI FEAGTYF FEAPTTI FEASSYL FEAYQV FEGNTQV FEGQTQF

DVGASSF DVVESEV ERLGSSV EVGYSSQ FEAGTYI FEAPTTL FEASSYV FEAYSF FEGNTSF FEGQTQI

DVGDDPV DVVRSSV ERNQSAA EVGYSST FEAGTYL FEAPTTV FEASTF FEAYSI FEGNTSI FEGQTQL

DVGDSSW DVWGISA ERTGSDV EVHGDQV FEAGTYV FEAPTYF FEASTI FEAYSL FEGNTSL FEGQTQV

DVGEQSV DVWGSLV ERYGSSP EVHGGSM FEANNF FEAPTYI FEASTL FEAYSV FEGNTSV FEGQTSF

DVGFSSV DVWGSSD ERYGVYT EVHGNGV FEANNI FEAPTYL FEASTNF FEAYTF FEGNTTF FEGQTSI

DVGGAEV DVWGSSV ESFLRLV EVHGSHV FEANNL FEAPTYV FEASTNI FEAYTI FEGNTTI FEGQTSL

DVGGDSD DVYGSIV ESGASLP EVHGSSS FEANNV FEAQNF FEASTNL FEAYTL FEGNTTL FEGQTSV

DVGGGSV DVYGTTV ESGGSSM EVHGSSV FEANQF FEAQNI FEASTNV FEAYTV FEGNTTV FEGQTTF

DVGGKSF DVYKSAW ESGGSSW EVHLSMV FEANQI FEAQNL FEASTQF FEAYYF FEGNTV FEGQTTI

DVGGNSL DVYYSQV ESGNRSE EVHRHSH FEANQL FEAQNV FEASTQI FEAYYI FEGNTYF FEGQTTL

DVGGNSV DWAGLSS ESPGDYV EVIGFTD FEANQV FEAQQF FEASTQL FEAYYL FEGNTYI FEGQTTV

DVGGNVV DWFGSAA ESSGSLV EVIGSND FEANSF FEAQQI FEASTQV FEAYYV FEGNTYL FEGQTV

DVGGPDV DWGPSYV ESSWSSH EVIGSSV FEANSI FEAQQL FEASTSF FEEGYPV FEGNTYV FEGQTYF

DVGGPNV DWGRNIV ETENSSV EVIKSSA FEANSL FEAQQV FEASTSI FEGGSDV FEGNYF FEGQTYI

DVGGPVV DWNMFTY ETGGSKV EVISSSV FEANSNF FEAQSF FEASTSL FEGGSNF FEGNYI FEGQTYL

DVGGQQS DYFGSYV ETGGSSI EVKGSKV FEANSNI FEAQSI F EASTS V FEGGSNI FEGNYL FEGQTYV

DVGGQSH DYGGSSV ETHNSSV EVKKSSY FEANSNL FEAQSL FEASTTF FEGGSNL FEGNYV FEGQYF

DVGGRLT DYNLSSV ETKWPNE EVLGSSD FEANSNV FEAQSNF FEASTTI FEGGSNV FEGPSNF FEGQYI

DVGGRSF DYQKSSQ ETMGFAQ EVMGSSV FEANSQF FEAQSNI FEASTTL FEGGSQF FEGPSNI FEGQYL

DVGGSDT DYVWKSG EVADVSV EVMGSSY FEANSQI FEAQSNL FEASTTV FEGGSQI FEGPSNL FEGQYV

DVGGSGV DYWPSSV EVAGLIV EVMKSSH FEANSQL FEAQSNV FEASTV FEGGSQL FEGPSNV FEGRHGV

DVGGSKV DYYGLSW EVAKSSV EVNPSSV FEANSQV FEAQSQF FEASTYF FEGGSQV FEGPSQF FEGRNKV

DVGGSPV EAAGSSA EVAPSSV EVPGSSV FEANSSF FEAQSQI FEASTYI FEGGSSF FEGPSQI FEGRTSV

DVGGSQV EAGGFSV EVDWSKV EVPGSYV FEANSSI FEAQSQL FEASTYL FEGGSSI FEGPSQL FEGSNF

DVGGSSD EAGGVKK EVEGFQV EVSDSSS FEANSSL FEAQSQV FEASTYV FEGGSSL FEGPSQV FEGSNI

DVGGSSE EAGNGST EVEGSSI EVSELGV FEANSSV FEAQSSF FEASYF FEGGSSV FEGPSSF FEGSNL

DVGGSSH EAGQSSR EVEHGHV EVSGDSV FEANSTF FEAQSSI FEASYI FEGGSTF FEGPSSI FEGSNV

DVGGSSI EAGTKSV EVEKSST EVSGQSE FEANSTI FEAQSSL FEASYL FEGGSTI FEGPSSL FEGSQF

DVGGSSK EAMFSSY EVEPSSQ EVSGSPI FEANSTL FEAQSSV FEASYV FEGGSTL FEGPSSV FEGSQI

DVGGSSL EAQDHSV EVFGKGV EVSIKLL FEANSTV FEAQSTF FEATNF FEGGSTV FEGPSTF FEGSQL

DVGGSSS EATGASM EVFGSST EVSWSSV FEANSV FEAQSTI FEATNI FEGGSYF FEGPSTI FEGSQV

DVGGSST EDGDRHK EVFLHMK EVTGSSP FEANSYF FEAQSTL FEATNL FEGGSYI FEGPSTL FEGSSF

DVGGSSV EDHGQVQ EVGAFSV EVTLSMV FEANSYI FEAQSTV FEATNV FEGGSYL FEGPSTV FEGSSI

DVGGSTA EDLGSSM EVGASSA EVTLSSV FEANSYL FEAQSV FEATQF FEGGSYV FEGPSYF FEGSSL

DVGGSTM EDVDDGV EVGASSV EVVGFFV FEANSYV FEAQSYF FEATQI FEGGTNF FEGPSYI FEGSSNF

DVGGSTV EEGGSSH EVGDSSV EVVGGSV FEANTF FEAQSYI FEATQL FEGGTNI FEGPSYL FEGSSNI

DVGGSVV EEGGSSP EVGFSAT EVVGPFH FEANTI FEAQSYL FEATQV FEGGTNL FEGPSYV FEGSSNL

DVGGSYV EEGQSQF EVGFSYV EVVGSSV FEANTL FEAQSYV FEATSF FEGGTNV FEGPTNF FEGSSNV

DVGGVVS EFAGHSY EVGGASV EVVMSNV FEANTNF FEAQTF FEATSI FEGGTQF FEGPTNI FEGSSQF

DVGGYSH EFGGSSA EVGGATV EVWAYLV FEANT I FEAQTI FEATSL FEGGTQI FEGPTNL FEGSSQI

DVGGYSV EFGGSSR EVGGDDN EVWGSSV FEANT L FEAQTL FEATSNF FEGGTQL FEGPTNV FEGSSQL

DVGHSSK EFVWGA EVGGDKV EVWGWSN FEANTNV FEAQT F FEATSNI FEGGTQV FEGPTQF FEGSSQV

DVGKSSM EGFGSSV EVGGEMY EVWIVSV FEANTQF FEAQT I FEATSNL FEGGTSF FEGPTQI FEGSSSF

DVGKTSV EGGEASV EVGGESV EVWKSSP FEANTQI FEAQT L FEATSNV FEGGTSI FEGPTQL FEGSSSI

DVGKYSG EGGGKSV EVGGFSE EVWWGSR FEANTQL FEAQTNV FEATSQF FEGGTSL FEGPTQV FEGSSSL

DVGLSLV EGGGSSV EVGGGSV EVYAASV FEANTQV FEAQTQF FEATSQI FEGGTSV FEGPTSF FEGSSSV

DVGMPYA EGGGYSV EVGGHYQ EVYGSSA FEANTSF FEAQTQI FEATSQL FEGGTTF FEGPTSI FEGSSTF

DVGMSDE EGGWSSR EVGGISD EWGGSSY FEANTSI FEAQTQL FEATSQV FEGGTTI FEGPTSL FEGSSTI

DVGMSSV EGHLSVV EVGGISV EWGWLSV FEANTSL FEAQTQV FEATSSF FEGGTTL FEGPTSV FEGSSTL

DVG KSV EGQGLLS EVGGNSV EWIGSVV FEANTSV FEAQTSF FEATSSI FEGGTTV FEGPTTF FEGSSTV

DVG SKV EGWTSKF EVGGRIE EWWNSYV FEANTTF FEAQTSI FEATSSL FEGGTYF FEGPTTI FEGSSV

DVGQSSG EGYYSSV EVGGSFV EYMQTDV FEANTTI FEAQTSL FEATSSV FEGGTYI FEGPTTL FEGSSYF

DVGQSSS EHGGSKP EVGGSIV EYSGQSV FEANTTL FEAQTSV FEATSTF FEGGTYL FEGPTTV FEGSSYI

DVGQSSV EHGNSYV EVGGSKV FAGISSV FEANTTV FEAQTTF FEATSTI FEGGTYV FEGPTYF FEGSSYL

DVGRIMV EHGSEES EVGGSMV FATGSYL FEANTV FEAQTTI FEATSTL FEGNNF FEGPTYI FEGSSYV

DVGRSNG EHPSSSV EVGGSNA FDGHSAV FEANTYF FEAQTTL FEATSTV FEGNNI FEGPTYL FEGSTF

DVGRSSV EIGGSHV EVGGSSD FDGSSSV FEANTYI FEAQTTV FEATSV FEGNNL FEGPTYV FEGSTI

DVGTDQV EIGGSLY EVGGSSL FDLMSSG FEANTYL FEAQTV FEATSYF FEGNNV FEGQNF FEGSTL

DVG SGD EIGGSQR EVGGSSM FDWKPST FEANTYV FEAQTYF FEATSYI FEGNQF FEGQNI FEGSTNF

DVGVVST EIGGSSV EVGGSSR FEAGSNF FEANYF FEAQTYI FEATSYL FEGNQI FEGQNL FEGSTNI

DVGWSSV EIGLSSV EVGGSSV FEAGSNI FEANYI FEAQTYL FEATSYV FEGNQL FEGQNV FEGSTNL

DVGYSSN EIGMWMI EVGGSSW FEAGSNL FEANYL FEAQTYV FEATTF FEGNQV FEGQQF FEGSTNV

DVGYSST EIIWHKV EVGGSVV FEAGSNV FEANYV FEAQYF FEATTI FEGNSF FEGQQI FEGSTQF

DVHFSSI EISGHHP EVGGSYV FEAGSQF FEAPSNF FEAQYI FEATTL FEGNSI FEGQQL FEGSTQI

DVHGDID EKEGNSV EVGGTSV FEAGSQI FEAPSNI FEAQYL FEATT F FEGNSL FEGQQV FEGSTQL

DVHGESV EKGGSQV EVGGVNV FEAGSQL FEAPSNL FEAQYV FEATTNI FEGNSNF FEGQSF FEGSTQV

DVHG SQ ELGGSDV EVGGVSV FEAGSQV FEAPSNV FEASNF FEATT L FEGNSNI FEGQSI FEGSTSF

DVHPLHV ELGGSSM EVGGWMV FEAGSSF FEAPSQF FEASNI FEATTNV FEGNSNL FEGQSL FEGSTSI

DVIGSSQ ELGKHSV EVGGYHV FEAGSSI FEAPSQI FEASNL FEATTQF FEGNSNV FEGQSNF FEGSTSL

D IPSSA ELIISAE EVGHDSA FEAGSSL FEAPSQL FEASNV FEATTQI FEGNSQF FEGQSNI FEGSTSV

D IPSSY ELLGSVG EVGIVIV FEAGSSV FEAPSQV FEASQF FEATTQL FEGNSQI FEGQSNL FEGSTTF FEGSTTI FESGSNV FESPSNF FESQYI FESTTL FNAGSQV FNAPSQF FNASNI FNATTNV FNGNSL

FEGSTTL FESGSQF FESPSNI FESQYL FESTTNF FNAGSSF FNAPSQI FNASNL FNATTQF FNGNSNF

FEGSTTV FESGSQI FESPSNL FESQYV FESTTNI FNAGSSI FNAPSQL FNASNV FNATTQI FNGNSNI

FEGSTV FESGSQL FESPSNV FESSNF FESTTNL FNAGSSL FNAPSQV FNASQF FNATTQL FNGNSNL

FEGSTYF FESGSQV FESPSQF FESSNI FESTTNV FNAGSSV FNAPSSF FNASQI FNATTQV FNGNSNV

FEGSTYI FESGSSF FESPSQI FESSNL FESTTQF FNAGSTF FNAPSSI FNASQL FNATTSF FNGNSQF

FEGSTYL FESGSSI FESPSQL FESSNV FESTTQI FNAGSTI FNAPSSL FNASQV FNATTSI FNGNSQI

FEGSTYV FESGSSL FESPSQV FESSQF FESTTQL FNAGSTL FNAPSSV FNASSF FNATTSL FNGNSQL

FEGSYF FESGSSV FESPSSF FESSQI FESTTQV FNAGSTV FNAPSTF FNASSI FNATTSV FNGNSQV

FEGSYI FESGSTF FESPSSI FESSQL FESTTSF FNAGSYF FNAPSTI FNASSL FNATTTF FNGNSSF

FEGSYL FESGSTI FESPSSL FESSQV FESTTSI F AGSYI FNAPSTL FNASSNF FNATTTI FNGNSSI

FEGSYV FESGSTL FESPSSV FESSSF FESTTSL FNAGSYL FNAPSTV FNASSNI FNATTTL FNGNSSL

FEGTNF FESGST FESPSTF FESSSI FESTTSV FNAGSYV FNAPSYF FNASSNL FNATTTV FNGNSSV

FEGTNI FESGSYF FESPSTI FESSSL FESTTTF FNAGT F FNAPSYI FNASSNV FNATTV FNGNSTF

FEGTNL FESGSYI FESPSTL FESSSNF FESTTTI FNAGTNI FNAPSYL FNASSQF FNATTYF FNGNSTI

FEGTNV FESGSYL FESPSTV FESSSNI FESTTTL FNAGTNL FNAPSYV FNASSQI FNATTYI FNGNSTL

FEGTQF FESGSYV FESPSYF FESSSNL FESTTTV FNAGTNV FNAPTNF FNASSQL FNATTYL FNGNSTV

FEGTQI FESGTNF FESPSYI FESSSNV FESTTV FNAGTQF FNAPTNI FNASSQV F NATTY V FNGNSV

FEGTQL FESGTNI FESPSYL FESSSQF FESTTYF F AGTQI FNAPTNL FNASSSF FNATYF FNGNSYF

FEGTQV FESGTNL FESPSYV FESSSQI FESTTYI FNAGTQL FNAPTNV FNASSSI FNATYI FNGNSYI

FEGTSF FESGTNV FESPTNF FESSSQL FESTTYL FNAGTQV FNAPTQF FNASSSL FNATYL FNGNSYL

FEGTSI FESGTQF FESPTNI FESSSQV FESTTYV FNAGTSF FNAPTQI FNASSSV FNATYV FNGNSYV

FEGTSL FESGTQI FESPTNL FESSSSF FESTYF F AGTSI FNAPTQL FNASSTF FNAYNF FNGNTF

FEGTSNF FESGTQL FESPTNV FESSSSI FESTYI F AGTSL FNAPTQV FNASSTI FNAYNI FNGNTI

FEGTSNI FESGTQV FESPTQF FESSSSL FESTYL FNAGTSV FNAPTSF FNASSTL FNAYNL FNGNTL

FEGTSNL FESGTSF FESPTQI FESSSSV FESTYV F AGTTF FNAPTSI FNASSTV FNAYNV FNGNTNF

FEGTSNV FESGTSI FESPTQL FESSSTF FESYNF F AGTTI FNAPTSL FNASSV FNAYQF FNGNTNI

FEGTSQF FESGTSL FESPTQV FESSSTI FESYNI FNAGTTL FNAPTSV FNASSYF FNAYQI FNGNTNL

FEGTSQI FESGTSV FESPTSF FESSSTL FESYNL FNAGTTV FNAPTTF FNASSYI FNAYQL FNGNTNV

FEGTSQL FESGTTF FESPTSI FESSSTV FESYNV FNAGTYF FNAPTTI FNASSYL FNAYQV FNGNTQF

FEGTSQV FESGTTI FESPTSL FESSSV FESYQF FNAGTYI FNAPTTL FNASSYV FNAYSF FNGNTQI

FEGTSSF FESGTTL FESPTSV FESSSYF FESYQI FNAGTYL FNAPTTV FNASTF FNAYSI FNGNTQL

FEGTSSI FESGTTV FESPTTF FESSSYI FESYQL FNAGTYV FNAPTYF FNASTI FNAYSL FNGNTQV

FEGTSSL FESGTYF FESPTTI FESSSYL FESYQV FNANNF FNAPTYI FNASTL FNAYSV FNGNTSF

FEGTSSV FESGTYI FESPTTL FESSSYV FESYSF FNANNI FNAPTYL FNASTNF FNAYTF FNGNTSI

FEGTSTF FESGTYL FESPTTV FESSTF FESYSI FNANNL FNAPTYV FNASTNI FNAYTI FNGNTSL

FEGTSTI FESGTYV FESPTYF FESSTI FESYSL FNANNV FNAQNF FNASTNL FNAYTL FNGNTSV

FEGTSTL FESNNF FESPTYI FESSTL FESYSV FNANQF FNAQNI FNASTNV FNAYTV FNGNTTF

FEGTSTV FESNNI FESPTYL FESSTNF FESYTF FNANQI FNAQNL FNASTQF FNAYYF FNGNTTI

FEGTSV FESNNL FESPTYV FESSTNI FESYTI FNANQL FNAQNV FNASTQI FNAYYI FNGNTTL

FEGTSYF FESNNV FESQNF FESSTNL FESYTL FNANQV FNAQQF FNASTQL FNAYYL FNGNTTV

FEGTSYI FESNQF FESQNI FESSTNV FESYTV FNANSF FNAQQI FNASTQV FNAYYV FNGNTV

FEGTSYL FESNQI FESQNL FESSTQF FESYYF FNANSI FNAQQL FNASTSF FNFGRGL FNGNTYF

FEGTSYV FESNQL FESQNV FESSTQI FESYYI FNANSL FNAQQV FNASTSI FNGGLSV FNGNTYI

FEGTTF FESNQV FESQQF FESSTQL FESYYL FNANSNF FNAQSF FNASTSL FNGGSNF FNGNTYL

FEGTTI FESNSF FESQQI FESSTQV FESYYV FNANSNI FNAQSI FNASTSV FNGGSNI FNGNTYV

FEGTTL FESNSI FESQQL FESSTSF FEVWSSV FNANSNL FNAQSL FNASTTF FNGGSNL FNGNYF

FEGTTNF FESNSL FESQQV FESSTSI FFGGPSV FNANSNV FNAQSNF FNASTTI FNGGSNV FNGNYI

FEGTTNI FESNSNF FESQSF FESSTSL FFHNSVV FNANSQF FNAQSNI FNASTTL FNGGSQF FNGNYL

FEGTTNL FESNSNI FESQSI FESSTSV FFIGSSV FNANSQI FNAQSNL FNASTTV FNGGSQI FNGNYV

FEGTTNV FESNSNL FESQSL FESSTTF FGDGYSH FNANSQL FNAQSNV FNASTV FNGGSQL FNGPSNF

FEGTTQF FESNSNV FESQSNF FESSTTI FGGGSEV FNANSQV FNAQSQF FNASTYF FNGGSQV FNGPSNI

FEGTTQI FESNSQF FESQSNI FESSTTL FGGQISV FNANSSF FNAQSQI FNASTYI FNGGSSF FNGPSNL

FEGTTQL FESNSQI FESQSNL FESSTTV FGMGGSG FNANSSI FNAQSQL FNASTYL FNGGSSI FNGPSNV

FEGTTQV FESNSQL FESQSNV FESSTV FGPHSNA FNANSSL FNAQSQV FNASTYV FNGGSSK FNGPSQF

FEGTTSF FESNSQV FESQSQF FESSTYF FGSG KV FNANSSV FNAQSSF FNASYF FNGGSSL FNGPSQI

FEGTTSI FESNSSF FESQSQI FESSTYI FHGFDYW FNANSTF FNAQSSI FNASYI FNGGSSR FNGPSQL

FEGTTSL FESNSSI FESQSQL FESSTYL FHGGDSV FNANSTI FNAQSSL FNASYL FNGGSSV FNGPSQV

FEGTTSV FESNSSL FESQSQV FESSTYV FHGGSSL FNANSTL FNAQSSV FNASYV FNGGSTF FNGPSSF

FEGTTTF FESNSSV FESQSSF FESSYF FHGTPSV FNANSTV FNAQSTF FNATNF FNGGSTI FNGPSSI

FEGTTTI FESNSTF FESQSSI FESSYI FHQGKHA FNANSV FNAQSTI FNATNI FNGGSTL FNGPSSL

FEGTTTL FESNSTI FESQSSL FESSYL FIGGSDM FNANSYF FNAQSTL FNATNL FNGGSTV FNGPSSV

FEGTTTV FESNSTL FESQSSV FESSYV FIGGSSV FNANSYI FNAQSTV FNATNV FNGGSYF FNGPSTF

FEGTTV FESNSTV FESQSTF FESTNF FIGSLKV FNANSYL FNAQSV FNATQF FNGGSYI FNGPSTI

FEGTTYF FESNSV FESQSTI FESTNI FINGSSV FNANSYV FNAQSYF FNATQI FNGGSYL FNGPSTL

FEGTTYI FESNSYF FESQSTL FESTNL FIQGVHV F ANTF FNAQSYI FNATQL FNGGSYV FNGPSTV

FEGTTYL FESNSYI FESQST FESTNV FIWGSSP F ANTI FNAQSYL FNATQV FNGGTNF FNGPSYF

FEGTTYV FESNSYL FESQSV FESTQF FKFGSLM FNANTL FNAQSYV FNATSF FNGGTNI FNGPSYI

FEGTYF FESNSYV FESQSYF FESTQI FKGGTPV FNANT F FNAQTF FNATSI FNGGTNL FNGPSYL

FEGTYI FESNTF FESQSYI FESTQL FKGPSSV FNANTNI FNAQTI FNATSL FNGGTNV FNGPSYV

FEGTYL FESNTI FESQSYL FESTQV FKLGSSV FNANTNL FNAQTL FNATSNF FNGGTQF FNGPTNF

FEGTYV FESNTL FESQSYV FESTSF FKNFSSV FNANTNV FNAQTNF FNATSNI FNGGTQI FNGPTNI

FEGYNF FESNTNF FESQTF FESTSI FKNGSSW FNANTQF FNAQTNI FNATSNL FNGGTQL FNGPTNL

FEGYNI FESNTNI FESQTI FESTSL FKQEQSR F ANTQI FNAQTNL FNATSNV FNGGTQV FNGPTNV

FEGYNL FESNTNL FESQTL FESTSNF FKVVSSN FNANTQL FNAQTNV FNATSQF FNGGTSF FNGPTQF

FEGYNV FESNTNV FESQTNF FESTSNI FKVYSVV FNANTQV FNAQTQF FNATSQI FNGGTSI FNGPTQI

FEGYQF FESNTQF FESQTNI FESTSNL FLGGSMH FNANTSF FNAQTQI FNATSQL FNGGTSL FNGPTQL

FEGYQI FESNTQI FESQTNL FESTSNV FLGGYYS F ANTSI FNAQTQL FNATSQV FNGGTSV FNGPTQV

FEGYQL FESNTQL FESQTNV FESTSQF FLGRPSE FNANTSL FNAQTQV FNATSSF FNGGTTF FNGPTSF

FEGYQV FESNTQV FESQTQF FESTSQI FLSGSSY F ANTS V FNAQTSF FNATSSI FNGGTTI FNGPTSI

FEGYSF FESNTSF FESQTQI FESTSQL FLVQTHN FNANTTF FNAQTSI FNATSSL FNGGTTL FNGPTSL

FEGYSI FESNTSI FESQTQL FESTSQV FMAGSMN FNANTTI FNAQTSL FNATSSV FNGGTTV FNGPTSV

FEGYSL FESNTSL FESQTQV FESTSSF FMGEWSV FNANTTL FNAQTSV FNATSTF FNGGTYF FNGPTTF

FEGYSV FESNTSV FESQTSF FESTSSI FMGGRSL FNANTTV FNAQTTF FNATSTI FNGGTYI FNGPTTI

FEGYTF FESNTTF FESQTSI FESTSSL FMGGSKV FNANTV FNAQTTI FNATSTL FNGGTYL FNGPTTL

FEGYTI FESNTTI FESQTSL FESTSSV FMGGYSV FNANTYF FNAQTTL FNATSTV FNGGTYV FNGPTTV

FEGYTL FESNTTL FESQTSV FESTSTF FMLGTWV FNANTYI FNAQTTV FNATSV FNGNHYV FNGPTYF

FEGYTV FESNTTV FESQTTF FESTSTI FMMGPSV FNANTYL FNAQTV FNATSYF FNGNNF FNGPTYI

FEGYYF FESNTV FESQTTI FESTSTL FMMGSEL FNANTYV FNAQTYF FNATSYI FNGNNI FNGPTYL

FEGYYI FESNTYF FESQTTL FESTSTV FMVWSSR FNANYF FNAQTYI FNATSYL FNGNNL FNGPTYV

FEGYYL FESNTYI FESQTTV FESTSV FNAGSNF FNANYI FNAQTYL FNATSYV FNGNNV FNGQNF

FEGYYV FESNTYL FESQTV FESTSYF F AGS I FNANYL FNAQTYV FNATTF FNGNQF FNGQNI

FEHINAA FESNTYV FESQTYF FESTSYI F AGS L FNANYV FNAQYF FNATTI FNGNQI FNGQNL

FEPGSVV FESNYF FESQTYI FESTSYL FNAGSNV FNAPSNF FNAQYI FNATTL FNGNQL FNGQNV

FESGSNF FESNYI FESQTYL FESTSYV FNAGSQF FNAPSNI FNAQYL FNATTNF FNGNQV FNGQQF

FESGSNI FESNYL FESQTYV FESTTF FNAGSQI FNAPSNL FNAQYV FN ATTN I FNGNSF FNGQQI

FESGSNL FESNYV FESQYF FESTTI FNAGSQL FNAPSNV FNASNF FNATTNL FNGNSI FNGQQL FNGQQV FNGSTSI FNSGSNI FNSNYL FNSQTYV FNSTTF FQANQI FQAQNL FQASTQF FQAYYF

FNGQSF FNGSTSL FNSGSNL FNSNYV FNSQYF FNSTTI FQANQL FQAQNV FQASTQI FQAYYI

FNGQSI FNGSTSV FNSGSNV FNSPSNF FNSQYI FNSTTL FQANQV FQAQQF FQASTQL FQAYYL

FNGQSL FNGSTTF FNSGSQF FNSPSNI FNSQYL FNSTTNF FQANSF FQAQQI FQASTQV FQAYYV

FNGQSNF FNGSTTI FNSGSQI FNSPSNL FNSQYV FNSTTNI FQANSI FQAQQL FQASTSF FQGGIEV

FNGQSNI FNGSTTL FNSGSQL FNSPSNV FNSSNF FNSTTNL FQANSL FQAQQV FQASTSI FQGGPSY

FNGQSNL FNGSTTV FNSGSQV FNSPSQF FNSSNI FNSTTNV FQANSNF FQAQSF FQASTSL FQGGSHV

FNGQSNV FNGSTV FNSGSSF FNSPSQI FNSSNL FNSTTQF FQANSNI FQAQSI FQASTSV FQGGSNF

FNGQSQF FNGSTYF FNSGSSI FNSPSQL FNSSNV FNSTTQI FQANSNL FQAQSL FQASTTF FQGGSNI

FNGQSQI FNGSTYI FNSGSSL FNSPSQV FNSSQF F STTQL FQANSNV FQAQSNF FQASTTI FQGGSNL

FNGQSQL FNGSTYL FNSGSSV FNSPSSF FNSSQI FNSTTQV FQANSQF FQAQSNI FQASTTL FQGGSNV

FNGQSQV FNGSTYV FNSGSTF FNSPSSI FNSSQL FNSTTSF FQANSQI FQAQSNL FQASTTV FQGGSQF

FNGQSSF FNGSYF FNSGSTI FNSPSSL FNSSQV FNSTTSI FQANSQL FQAQSNV FQASTV FQGGSQI

FNGQSSI FNGSYI FNSGSTL FNSPSSV FNSSSF FNSTTSL FQANSQV FQAQSQF FQASTYF FQGGSQL

FNGQSSL FNGSYL FNSGSTV FNSPSTF FNSSSI FNSTTSV FQANSSF FQAQSQI FQASTYI FQGGSQV

FNGQSSV FNGSYV FNSGSYF FNSPSTI FNSSSL FNSTTTF FQANSSI FQAQSQL FQASTYL FQGGSSF

FNGQSTF FNGTNF FNSGSYI FNSPSTL FNSSSNF FNSTTTI FQANSSL FQAQSQV FQASTYV FQGGSSI

FNGQSTI FNGTNI FNSGSYL FNSPSTV FNSSSNI FNSTTTL FQANSSV FQAQSSF FQASYF FQGGSSL

FNGQSTL FNGTNL FNSGSYV FNSPSYF FNSSSNL FNSTTTV FQANSTF FQAQSSI FQASYI FQGGSSV

FNGQSTV FNGTNV FNSGTNF FNSPSYI FNSSSNV FNSTTV FQANSTI FQAQSSL FQASYL FQGGSTF

FNGQSV FNGTQF FNSGTNI FNSPSYL FNSSSQF FNSTTYF FQANSTL FQAQSSV FQASYV FQGGSTI

FNGQSYF FNGTQI FNSGTNL FNSPSYV FNSSSQI FNSTTYI FQANSTV FQAQSTF FQATNF FQGGSTL

FNGQSYI FNGTQL FNSGTNV FNSPTNF FNSSSQL FNSTTYL FQANSV FQAQSTI FQATNI FQGGSTV

FNGQSYL FNGTQV FNSGTQF FNSPTNI FNSSSQV FNSTTYV FQANSYF FQAQSTL FQAT L FQGGSYF

FNGQSYV FNGTSF FNSGTQI FNSPTNL FNSSSSF FNSTYF FQANSYI FQAQSTV FQATNV FQGGSYI

FNGQTF FNGTSI FNSGTQL FNSPTNV FNSSSSI FNSTYI FQANSYL FQAQSV FQATQF FQGGSYL

FNGQTI FNGTSL FNSGTQV FNSPTQF FNSSSSL FNSTYL FQANSYV FQAQSYF FQATQI FQGGSYV

FNGQTL FNGTSNF FNSGTSF FNSPTQI FNSSSSV FNSTYV FQANTF FQAQSYI FQATQL FQGGTNF

FNGQTNF FNGTSNI FNSGTSI FNSPTQL FNSSSTF FNSYNF FQANTI FQAQSYL FQATQV FQGGTNI

FNGQTNI FNGTSNL FNSGTSL FNSPTQV FNSSSTI FNSYNI FQANTL FQAQSYV FQATSF FQGGTNL

FNGQTNL FNGTSNV FNSGTSV FNSPTSF FNSSSTL FNSYNL FQANTNF FQAQTF FQATSI FQGGTNV

FNGQTNV FNGTSQF FNSGTTF FNSPTSI FNSSSTV FNSYNV FQANTNI FQAQTI FQATSL FQGGTQF

FNGQTQF FNGTSQI FNSGTTI FNSPTSL FNSSSV FNSYQF FQANTNL FQAQTL FQATS F FQGGTQI

FNGQTQI FNGTSQL FNSGTTL FNSPTSV FNSSSYF FNSYQI FQANTNV FQAQT F FQATS I FQGGTQL

FNGQTQL FNGTSQV FNSGTTV FNSPTTF FNSSSYI FNSYQL FQANTQF FQAQTNI FQATS L FQGGTQV

FNGQTQV FNGTSSF FNSGTYF FNSPTTI FNSSSYL FNSYQV FQANTQI FQAQTNL FQATSNV FQGGTSF

FNGQTSF FNGTSSI FNSGTYI FNSPTTL FNSSSYV FNSYSF FQANTQL FQAQTNV FQATSQF FQGGTSI

FNGQTSI FNGTSSL FNSGTYL FNSPTTV FNSSTF FNSYSI FQANTQV FQAQTQF FQATSQI FQGGTSL

FNGQTSL FNGTSSV FNSGTYV FNSPTYF FNSSTI FNSYSL FQANTSF FQAQTQI FQATSQL FQGGTS

FNGQTSV FNGTSTF FNSNNF FNSPTYI FNSSTL FNSYSV FQANTSI FQAQTQL FQATSQV FQGGTTF

FNGQTTF FNGTSTI FNSNNI FNSPTYL FNSSTNF FNSYTF FQANTSL FQAQTQV FQATSSF FQGGTTI

FNGQTTI FNGTSTL FNSNNL FNSPTYV FNSSTNI FNSYTI FQANTSV FQAQTSF FQATSSI FQGGTTL

FNGQTTL FNGTSTV FNSNNV FNSQNF FNSSTNL FNSYTL FQAIMTTF FQAQTSI FQATSSL FQGGTTV

FNGQTTV FNGTSV FNSNQF FNSQNI FNSSTNV FNSYTV FQANTTI FQAQTSL FQATSSV FQGGTYF

FNGQTV FNGTSYF FNSNQI FNSQNL F SSTQF FNSYYF FQANTTL FQAQTSV FQATSTF FQGGTYI

FNGQTYF FNGTSYI FNSNQL FNSQNV FNSSTQI FNSYYI FQANTTV FQAQTTF FQATSTI FQGGTYL

FNGQTYI FNGTSYL FNSNQV FNSQQF F SSTQL FNSYYL FQANTV FQAQTTI FQATSTL FQGGTYV

FNGQTYL FNGTSYV FNSNSF FNSQQI FNSSTQV FNSYYV FQANTYF FQAQTTL FQATSTV FQGNNF

FNGQTYV FNGTTF FNSNSI FNSQQL F SSTSF FNWDSSV FQANTYI FQAQTTV FQATSV FQGNNI

FNGQYF FNGTTI FNSNSL FNSQQV FNSSTSI FPDLHIV FQANTYL FQAQTV FQATSYF FQGNNL

FNGQYI FNGTTL FNSNSNF FNSQSF F SSTSL FPGDAST FQANTYV FQAQTYF FQATSYI FQGNNV

FNGQYL FNGTTNF FNSNSNI FNSQSI FNSSTSV FPTGSSV FQANYF FQAQTYI FQATSYL FQGNQF

FNGQYV FNGTTNI FNSNSNL FNSQSL FNSSTTF FQAGSNF FQANYI FQAQTYL FQATSYV FQGNQI

FNGSNF FNGTTNL FNSNSNV FNSQSNF FNSSTTI FQAGSNI FQANYL FQAQTYV FQATTF FQGNQL

FNGSNI FNGTTNV FNSNSQF FNSQSNI FNSSTTL FQAGSNL FQANYV FQAQYF FQATTI FQGNQV

FNGSNL FNGTTQF FNSNSQI FNSQSNL FNSSTTV FQAGSNV FQAPSNF FQAQYI FQATTL FQGNSF

FNGSNV FNGTTQI FNSNSQL FNSQSNV FNSSTV FQAGSQF FQAPSNI FQAQYL FQATTNF FQGNSI

FNGSQF FNGTTQL FNSNSQV FNSQSQF F SSTYF FQAGSQI FQAPS L FQAQYV FQATTNI FQGNSL

FNGSQI FNGTTQV FNSNSSF FNSQSQI FNSSTYI FQAGSQL FQAPSNV FQASNF FQATT L FQGNSNF

FNGSQL FNGTTSF FNSNSSI FNSQSQL FNSSTYL FQAGSQV FQAPSQF FQASNI FQATTNV FQGNSNI

FNGSQV FNGTTSI FNSNSSL FNSQSQV FNSSTYV FQAGSSF FQAPSQI FQASNL FQATTQF FQGNSNL

FNGSSF FNGTTSL FNSNSSV FNSQSSF FNSSYF FQAGSSI FQAPSQL FQASNV FQATTQI FQGNSNV

FNGSSI FNGTTSV FNSNSTF FNSQSSI FNSSYI FQAGSSL FQAPSQV FQASQF FQATTQL FQGNSQF

FNGSSL FNGTTTF FNSNSTI FNSQSSL FNSSYL FQAGSSV FQAPSSF FQASQI FQATTQV FQGNSQI

FNGSSNF FNGTTTI FNSNSTL FNSQSSV FNSSYV FQAGSTF FQAPSSI FQASQL FQATTSF FQGNSQL

FNGSSNI FNGTTTL FNSNSTV FNSQSTF FNSTNF FQAGSTI FQAPSSL FQASQV FQATTSI FQGNSQV

FNGSSNL FNGTTTV FNSNSV FNSQSTI FNSTNI FQAGSTL FQAPSSV FQASSF FQATTSL FQGNSSF

FNGSSNV FNGTTV FNSNSYF FNSQSTL FNSTNL FQAGSTV FQAPSTF FQASSI FQATTSV FQGNSSI

FNGSSQF FNGTTYF FNSNSYI F SQST FNSTNV FQAGSYF FQAPSTI FQASSL FQATTTF FQGNSSL

FNGSSQI FNGTTYI FNSNSYL FNSQSV FNSTQF FQAGSYI FQAPSTL FQASSNF FQATTTI FQGNSSV

FNGSSQL FNGTTYL FNSNSYV FNSQSYF FNSTQI FQAGSYL FQAPSTV FQASSNI FQATTTL FQGNSTF

FNGSSQV FNGTTYV FNSNTF FNSQSYI FNSTQL FQAGSYV FQAPSYF FQASSNL FQATTTV FQGNSTI

FNGSSSF FNGTYF FNSNTI FNSQSYL FNSTQV FQAGTNF FQAPSYI FQASSNV FQATTV FQGNSTL

FNGSSSI FNGTYI FNSNTL FNSQSYV FNSTSF FQAGTNI FQAPSYL FQASSQF FQATTYF FQGNSTV

FNGSSSL FNGTYL FNSNTNF FNSQTF FNSTSI FQAGTNL FQAPSYV FQASSQI FQATTYI FQGNSV

FNGSSSV FNGTYV FNSNTNI FNSQTI FNSTSL FQAGTNV FQAPTNF FQASSQL FQATTYL FQGNSYF

FNGSSTF FNGYNF FNSNTNL FNSQTL FNSTSNF FQAGTQF FQAPTNI FQASSQV FQATTYV FQGNSYI

FNGSSTI FNGYNI FNSNTNV FNSQTNF FNSTSNI FQAGTQI FQAPTNL FQASSSF FQATYF FQGNSYL

FNGSSTL FNGYNL FNSNTQF FNSQTNI FNSTSNL FQAGTQL FQAPTNV FQASSSI FQATYI FQGNSYV

FNGSSTV FNGYNV FNSNTQI FNSQTNL FNSTSNV FQAGTQV FQAPTQF FQASSSL FQATYL FQGNTF

FNGSSV FNGYQF FNSNTQL FNSQTNV FNSTSQF FQAGTSF FQAPTQI FQASSSV FQATYV FQGNTI

FNGSSYF FNGYQI FNSNTQV FNSQTQF F STSQI FQAGTSI FQAPTQL FQASSTF FQAYNF FQGNTL

FNGSSYI FNGYQL FNSNTSF FNSQTQI FNSTSQL FQAGTSL FQAPTQV FQASSTI FQAYNI FQGNTNF

FNGSSYL FNGYQV FNSNTSI FNSQTQL FNSTSQV FQAGTSV FQAPTSF FQASSTL FQAYNL FQGNTNI

FNGSSYV FNGYSF FNSNTSL FNSQTQV FNSTSSF FQAGTTF FQAPTSI FQASSTV FQAYNV FQGNTNL

FNGSTF FNGYSI FNSNTSV FNSQTSF FNSTSSI FQAGTTI FQAPTSL FQASSV FQAYQF FQGNTNV

FNGSTI FNGYSL FNSNTTF FNSQTSI FNSTSSL FQAGTTL FQAPTSV FQASSYF FQAYQI FQGNTQF

FNGSTL FNGYSV FNSNTTI FNSQTSL FNSTSSV FQAGTTV FQAPTTF FQASSYI FQAYQL FQGNTQI

FNGSTNF FNGYTF FNSNTTL FNSQTSV FNSTSTF FQAGTYF FQAPTTI FQASSYL FQAYQV FQGNTQL

FNGSTNI FNGYTI FNSNTTV FNSQTTF FNSTSTI FQAGTYI FQAPTTL FQASSYV FQAYSF FQGNTQV

FNGSTNL FNGYTL FNSNTV FNSQTTI FNSTSTL FQAGTYL FQAPTTV FQASTF FQAYSI FQGNTSF

FNGSTNV FNGYTV FNSNTYF FNSQTTL F STSTV FQAGTYV FQAPTYF FQASTI FQAYSL FQGNTSI

FNGSTQF FNGYYF FNSNTYI FNSQTTV FNSTSV FQANNF FQAPTYI FQASTL FQAYSV FQGNTSL

FNGSTQI FNGYYI FNSNTYL FNSQTV FNSTSYF FQA I FQAPTYL FQASTNF FQAYTF FQGNTSV

FNGSTQL FNGYYL FNSNTYV FNSQTYF FNSTSYI FQANNL FQAPTYV FQASTNI FQAYTI FQGNTTF

FNGSTQV FNGYYV FNSNYF FNSQTYI F STSYL FQA V FQAQNF FQASTNL FQAYTL FQGNTTI

FNGSTSF FNSGSNF FNSNYI FNSQTYL FNSTSYV FQANQF FQAQNI FQASTNV FQAYTV FQGNTTL FQGNTTV FQGQTTF FQGTSTF FQSGTYV FQSPTYF FQSSTI FQSYSL FVANSYV FVAQSYF FVATQI

FQGNTV FQGQTTI FQGTSTI FQSNNF FQSPTYI FQSSTL FQSYSV FVANTF FVAQSYI FVATQL

FQG TYF FQGQTTL FQGTSTL FQSNNI FQSPTYL FQSSTNF FQSYTF FVANTI FVAQSYL FVATQV

FQGNTYI FQGQTTV FQGTSTV FQSNNL FQSPTYV FQSSTNI FQSYTI FVANTL FVAQSYV FVATSF

FQGNTYL FQGQTV FQGTSV FQSNNV FQSQNF FQSST L FQSYTL FVANTNF FVAQTF FVATSI

FQGNTYV FQGQTYF FQGTSYF FQSNQF FQSQNI FQSSTNV FQSYTV FVANTNI FVAQTI FVATSL

FQGNYF FQGQTYI FQGTSYI FQSNQI FQSQNL FQSSTQF FQSYYF FVANTNL FVAQTL FVATSNF

FQGNYI FQGQTYL FQGTSYL FQSNQL FQSQNV FQSSTQI FQSYYI FVANTNV FVAQTNF FVATSNI

FQGNYL FQGQTYV FQGTSYV FQSNQV FQSQQF FQSSTQL FQSYYL FVANTQF FVAQTNI FVATSNL

FQGNYV FQGQYF FQGTTF FQSNSF FQSQQI FQSSTQV FQSYYV FVANTQI FVAQTNL FVATSNV

FQGPSNF FQGQYI FQGTTI FQSNSI FQSQQL FQSSTSF FRGDSSL FVANTQL FVAQTNV FVATSQF

FQGPSNI FQGQYL FQGTTL FQSNSL FQSQQV FQSSTSI FRGGSFK FVANTQV FVAQTQF FVATSQI

FQGPSNL FQGQYV FQGTT F FQSNSNF FQSQSF FQSSTSL FRQQSSV FVANTSF FVAQTQI FVATSQL

FQGPSNV FQGRYPV FQGTT I FQSNSNI FQSQSI FQSSTSV FRTGSHG FVANTSI FVAQTQL FVATSQV

FQGPSQF FQGSNF FQGTT L FQSNSNL FQSQSL FQSSTTF FRTVSSS FVANTSL FVAQTQV FVATSSF

FQGPSQI FQGSNI FQGTTNV FQSNSNV FQSQSNF FQSSTTI FSGGYSF FVANTSV FVAQTSF FVATSSI

FQGPSQL FQGSNL FQGTTQF FQSNSQF FQSQSNI FQSSTTL FSGPSLS FVANTTF FVAQTSI FVATSSL

FQGPSQV FQGSNV FQGTTQI FQSNSQI FQSQSNL FQSSTTV FSVFPSV FVANTTI FVAQTSL FVATSSV

FQGPSSF FQGSQF FQGTTQL FQSNSQL FQSQSNV FQSSTV FSWSFSV FVANTTL FVAQTSV FVATSTF

FQGPSSI FQGSQI FQGTTQV FQSNSQV FQSQSQF FQSSTYF FSYTSSV FVANTTV FVAQTTF FVATSTI

FQGPSSL FQGSQL FQGTTSF FQSNSSF FQSQSQI FQSSTYI FTDGLVT FVANTV FVAQTTI FVATSTL

FQGPSSV FQGSQV FQGTTSI FQSNSSI FQSQSQL FQSSTYL FTGYSSD FVANTYF FVAQTTL FVATSTV

FQGPSTF FQGSSF FQGTTSL FQSNSSL FQSQSQV FQSSTYV FTSGSGV FVANTYI FVAQTTV FVATSV

FQGPSTI FQGSSI FQGTTSV FQSNSSV FQSQSSF FQSSYF FTVSLIV FVANTYL FVAQTV FVATSYF

FQGPSTL FQGSSL FQGTTTF FQSNSTF FQSQSSI FQSSYI FVAGINF FVANTYV FVAQTYF FVATSYI

FQGPSTV FQGSSNF FQGTTTI FQSNSTI FQSQSSL FQSSYL FVAGSGG FVANYF FVAQTYI FVATSYL

FQGPSYF FQGSSNI FQGTTTL FQSNSTL FQSQSSV FQSSYV FVAGSNF FVANYI FVAQTYL FVATSYV

FQGPSYI FQGSSNL FQGTTTV FQSNSTV FQSQSTF FQSTNF FVAGSNI FVANYL FVAQTYV FVATTF

FQGPSYL FQGSSNV FQGTTV FQSNSV FQSQSTI FQSTNI FVAGSNL FVANYV FVAQYF FVATTI

FQGPSYV FQGSSQF FQGTTYF FQSNSYF FQSQSTL FQSTNL FVAGSNV FVAPSNF FVAQYI FVATTL

FQGPTNF FQGSSQI FQGTTYI FQSNSYI FQSQSTV FQSTNV FVAGSQF FVAPSNI FVAQYL FVATTNF

FQGPTNI FQGSSQL FQGTTYL FQSNSYL FQSQSV FQSTQF FVAGSQI FVAPSNL FVAQYV FVATTNI

FQGPTNL FQGSSQV FQGTTYV FQSNSYV FQSQSYF FQSTQI FVAGSQL FVAPSNV FVASNF FVATTNL

FQGPTNV FQGSSSF FQGTYF FQSNTF FQSQSYI FQSTQL FVAGSQV FVAPSQF FVASNI FVATTNV

FQGPTQF FQGSSSI FQGTYI FQSNTI FQSQSYL FQSTQV FVAGSSF FVAPSQI FVASNL FVATTQF

FQGPTQI FQGSSSL FQGTYL FQSNTL FQSQSYV FQSTSF FVAGSSI FVAPSQL FVASNV FVATTQI

FQGPTQL FQGSSSV FQGTYV FQSNTNF FQSQTF FQSTSI FVAGSSL FVAPSQV FVASQF FVATTQL

FQGPTQV FQGSSTF FQGYNF FQSNTNI FQSQTI FQSTSL FVAGSSV FVAPSSF FVASQI FVATTQV

FQGPTSF FQGSSTI FQGYNI FQSNTNL FQSQTL FQSTSNF FVAGSTF FVAPSSI FVASQL FVATTSF

FQGPTSI FQGSSTL FQGYNL FQSNTNV FQSQTNF FQSTSNI FVAGSTI FVAPSSL FVASQV FVATTSI

FQGPTSL FQGSSTV FQGYNV FQSNTQF FQSQTNI FQSTS L FVAGSTL FVAPSSV FVASSF FVATTSL

FQGPTSV FQGSSV FQGYQF FQSNTQI FQSQTNL FQSTSNV FVAGSTV FVAPSTF FVASSI FVATTSV

FQGPTTF FQGSSYF FQGYQI FQSNTQL FQSQTNV FQSTSQF FVAGSYF FVAPSTI FVASSL FVATTTF

FQGPTTI FQGSSYI FQGYQL FQSNTQV FQSQTQF FQSTSQI FVAGSYI FVAPSTL FVASSNF FVATTTI

FQGPTTL FQGSSYL FQGYQV FQSNTSF FQSQTQI FQSTSQL FVAGSYL FVAPSTV FVASSNI FVATTTL

FQGPTTV FQGSSYV FQGYSF FQSNTSI FQSQTQL FQSTSQV FVAGSYV FVAPSYF FVASSNL FVATTTV

FQGPTYF FQGSTF FQGYSI FQSNTSL FQSQTQV FQSTSSF FVAGTNF FVAPSYI FVASSNV FVATTV

FQGPTYI FQGSTI FQGYSL FQSNTSV FQSQTSF FQSTSSI FVAGTNI FVAPSYL FVASSQF FVATTYF

FQGPTYL FQGSTL FQGYSV FQSNTTF FQSQTSI FQSTSSL FVAGTNL FVAPSYV FVASSQI FVATTYI

FQGPTYV FQGSTNF FQGYTF FQSNTTI FQSQTSL FQSTSSV FVAGTNV FVAPTNF FVASSQL FVATTYL

FQGQNF FQGSTNI FQGYTI FQSNTTL FQSQTSV FQSTSTF FVAGTQF FVAPTNI FVASSQV FVATTYV

FQGQNI FQGSTNL FQGYTL FQSNTTV FQSQTTF FQSTSTI FVAGTQI FVAPTNL FVASSSF FVATYF

FQGQNL FQGSTNV FQGYTV FQSNTV FQSQTTI FQSTSTL FVAGTQL FVAPTNV FVASSSI FVATYI

FQGQNV FQGSTQF FQGYYF FQSNTYF FQSQTTL FQSTSTV FVAGTQV FVAPTQF FVASSSL FVATYL

FQGQQF FQGSTQI FQGYYI FQSNTYI FQSQTTV FQSTSV FVAGTSF FVAPTQI FVASSSV FVATYV

FQGQQI FQGSTQL FQGYYL FQSNTYL FQSQTV FQSTSYF FVAGTSI FVAPTQL FVASSTF FVAYNF

FQGQQL FQGSTQV FQGYYV FQSNTYV FQSQTYF FQSTSYI FVAGTSL FVAPTQV FVASSTI FVAY I

FQGQQV FQGSTSF FQPGSSV FQSNYF FQSQTYI FQSTSYL FVAGTSV FVAPTSF FVASSTL FVAY L

FQGQSF FQGSTSI FQSGSNF FQSNYI FQSQTYL FQSTSYV FVAGTTF FVAPTSI FVASSTV FVAYNV

FQGQSI FQGSTSL FQSGSNI FQSNYL FQSQTYV FQSTTF FVAGTTI FVAPTSL FVASSV FVAYQF

FQGQSL FQGSTSV FQSGSNL FQSNYV FQSQYF FQSTTI FVAGTTL FVAPTSV FVASSYF FVAYQI

FQGQSNF FQGSTTF FQSGSNV FQSPSNF FQSQYI FQSTTL FVAGTTV FVAPTTF FVASSYI FVAYQL

FQGQSNI FQGSTTI FQSGSQF FQSPSNI FQSQYL FQSTTNF FVAGTYF FVAPTTI FVASSYL FVAYQV

FQGQSNL FQGSTTL FQSGSQI FQSPSNL FQSQYV FQSTTNI FVAGTYI FVAPTTL FVASSYV FVAYSF

FQGQSNV FQGSTTV FQSGSQL FQSPSNV FQSSNF FQSTTNL FVAGTYL FVAPTTV FVASTF FVAYSI

FQGQSQF FQGSTV FQSGSQV FQSPSQF FQSSNI FQSTTNV FVAGTYV FVAPTYF FVASTI FVAYSL

FQGQSQI FQGSTYF FQSGSSF FQSPSQI FQSS L FQSTTQF FVANNF FVAPTYI FVASTL FVAYSV

FQGQSQL FQGSTYI FQSGSSI FQSPSQL FQSSNV FQSTTQI FVANNI FVAPTYL FVASTNF FVAYTF

FQGQSQV FQGSTYL FQSGSSL FQSPSQV FQSSQF FQSTTQL FVANNL FVAPTYV FVASTNI FVAYTI

FQGQSSF FQGSTYV FQSGSSV FQSPSSF FQSSQI FQSTTQV FVANNV FVAQNF FVASTNL FVAYTL

FQGQSSI FQGSYF FQSGSTF FQSPSSI FQSSQL FQSTTSF FVANQF FVAQNI FVASTNV FVAYTV

FQGQSSL FQGSYI FQSGSTI FQSPSSL FQSSQV FQSTTSI FVANQI FVAQNL FVASTQF FVAYYF

FQGQSSV FQGSYL FQSGSTL FQSPSSV FQSSSF FQSTTSL FVANQL FVAQNV FVASTQI FVAYYI

FQGQSTF FQGSYV FQSGSTV FQSPSTF FQSSSI FQSTTSV FVANQV FVAQQF FVASTQL FVAYYL

FQGQSTI FQGTNF FQSGSYF FQSPSTI FQSSSL FQSTTTF FVANSF FVAQQI FVASTQV FVAYYV

FQGQSTL FQGT I FQSGSYI FQSPSTL FQSSSNF FQSTTTI FVANSI FVAQQL FVASTSF FVDGSHV

FQGQSTV FQGT L FQSGSYL FQSPSTV FQSSSNI FQSTTTL FVANSL FVAQQV FVASTSI FVDGSSY

FQGQSV FQGTNV FQSGSYV FQSPSYF FQSSSNL FQSTTTV FVANSNF FVAQSF F VASTS L FVDNSAV

FQGQSYF FQGTQF FQSGTNF FQSPSYI FQSSSNV FQSTTV FVANSNI FVAQSI FVASTSV FVDSSKV

FQGQSYI FQGTQI FQSGTNI FQSPSYL FQSSSQF FQSTTYF FVANSNL FVAQSL FVASTTF FVDYKDT

FQGQSYL FQGTQL FQSGTNL FQSPSYV FQSSSQI FQSTTYI FVANSNV FVAQSNF FVASTTI FVEGSSM

FQGQSYV FQGTQV FQSGTNV FQSPTNF FQSSSQL FQSTTYL FVANSQF FVAQSNI FVASTTL FVEGSSV

FQGQTF FQGTSF FQSGTQF FQSPTNI FQSSSQV FQSTTYV FVANSQI FVAQSNL FVASTTV FVESSLI

FQGQTI FQGTSI FQSGTQI FQSPTNL FQSSSSF FQSTYF FVANSQL FVAQSNV FVASTV FVFSSSH

FQGQTL FQGTSL FQSGTQL FQSPTNV FQSSSSI FQSTYI FVANSQV FVAQSQF FVASTYF FVGANLV

FQGQTNF FQGTSNF FQSGTQV FQSPTQF FQSSSSL FQSTYL FVANSSF FVAQSQI FVASTYI FVGASDI

FQGQTNI FQGTSNI FQSGTSF FQSPTQI FQSSSSV FQSTYV FVANSSI FVAQSQL FVASTYL FVGASSP

FQGQTNL FQGTSNL FQSGTSI FQSPTQL FQSSSTF FQSYNF FVANSSL FVAQSQV FVASTYV FVGASSV

FQGQTNV FQGTSNV FQSGTSL FQSPTQV FQSSSTI FQSYNI FVANSSV FVAQSSF FVASYF FVGEPSV

FQGQTQF FQGTSQF FQSGTSV FQSPTSF FQSSSTL FQSYNL FVANSTF FVAQSSI FVASYI FVGESQL

FQGQTQI FQGTSQI FQSGTTF FQSPTSI FQSSSTV FQSYNV FVANSTI FVAQSSL FVASYL FVGESSV

FQGQTQL FQGTSQL FQSGTTI FQSPTSL FQSSSV FQSYQF FVANSTL FVAQSSV FVASYV FVGFESM

FQGQTQV FQGTSQV FQSGTTL FQSPTSV FQSSSYF FQSYQI FVANSTV FVAQSTF FVATNF FVGFTPV

FQGQTSF FQGTSSF FQSGTTV FQSPTTF FQSSSYI FQSYQL FVANSV FVAQSTI FVATNI FVGGESV

FQGQTSI FQGTSSI FQSGTYF FQSPTTI FQSSSYL FQSYQV FVANSYF FVAQSTL FVATNL FVGGGNV

FQGQTSL FQGTSSL FQSGTYI FQSPTTL FQSSSYV FQSYSF FVANSYI FVAQSTV FVATNV FVGGHIV

FQGQTSV FQGTSSV FQSGTYL FQSPTTV FQSSTF FQSYSI FVANSYL FVAQSV FVATQF FVGGIFG FVGGISV FVGNSTF FVGQSSF FVGSTYV FVHRSSV FVSNTQF FVSQTNI F STS L GAHLGVS GAHVLVT

FVGGKSV FVGNSTI FVGQSSI FVGSYF FVIGSSV FVSNTQI FVSQTNL FVSTSNV GAHLGVT GAHVVGP

FVGGLSN FVGNSTL FVGQSSL FVGSYI FVLGDSV FVSNTQL FVSQTNV FVSTSQF GAHLVGG GAHVVGT

FVGGLSV FVGNSTV FVGQSSV FVGSYL FVLGLSL FVSNTQV FVSQTQF FVSTSQI GAHLVGP GAHVVLG

FVGGPSV FVGNSV FVGQSTF FVGSYV FVMGESV FVSNTSF FVSQTQI FVSTSQL GAHLVGS GAHVVLP

FVGGQSE FVGNSYF FVGQSTI FVGTNF FVNGESV FVSNTSI FVSQTQL FVSTSQV GAHLVGT GAHVVLS

FVGGQVA FVGNSYI FVGQSTL FVGTNI FVNHSSD FVSNTSL FVSQTQV FVSTSSF GAHLVVG GAHVVLT

FVGGRSV FVGNSYL FVGQSTV FVGTNL FVNPESV FVSNTSV FVSQTSF FVSTSSI GAHLVVP GAHVVVP

FVGGRSY FVGNSYV FVGQSV FVGTNV FVPSSSR FVSNTTF FVSQTSI FVSTSSL GAHLVVS GAHVVVT

FVGGSAL FVGNTF FVGQSYF FVGTQF FVPYSSV FVSNTTI FVSQTSL FVSTSSV GAHLVVT GALHGGG

FVGGSAV FVGNTI FVGQSYI FVGTQI FVQGIYV FVSNTTL FVSQTSV FVSTSTF GAHPGGG GALHGGP

FVGGSEV FVGNTL FVGQSYL FVGTQL FVQGQSK FVSNTTV FVSQTTF FVSTSTI GAHPGGS GALHGGS

FVGGSFG FVGNT F FVGQSYV FVGTQV FVQGSSV FVSNTV FVSQTTI FVSTSTL GAHPGGT GALHGGT

FVGGSNF FVGNT I FVGQTF FVGTSF FVQQRSV FVSNTYF FVSQTTL FVSTSTV GAHPGLG GALHGVG

FVGGSNG FVGNT L FVGQTI FVGTSI FVQRYVV FVSNTYI FVSQTTV FVSTSV GAHPGLS GALHGVP

FVGGSNI FVGNTNV FVGQTL FVGTSL FVSFSSV FVSNTYL FVSQTV FVSTSYF GAHPGLT GALHGVS

FVGGSNL FVGNTQF FVGQT F FVGTSNF FVSGIS FVSNTYV FVSQTYF FVSTSYI GAHPGVG GALHGVT

FVGGSNV FVGNTQI FVGQTNI FVGTSNI F SGKSM FVSNYF FVSQTYI FVSTSYL GAHPGVS GALHVGG

FVGGSQF FVGNTQL FVGQT L FVGTSNL FVSGSNF FVSNYI FVSQTYL FVSTSYV GAHPGVT GALHVGP

FVGGSQI FVGNTQV FVGQTNV FVGTSNV FVSGSNI FVSNYL FVSQTYV FVSTTF GAHPLGG GALHVGS

FVGGSQL FVGNTSF FVGQTQF FVGTSQF FVSGSNL FVSNYV FVSQYF FVSTTI GAHPLGS GALHVGT

FVGGSQT FVGNTSI FVGQTQI FVGTSQI FVSGSNV FVSPSNF FVSQYI FVSTTL GAHPLGT GALHVVG

FVGGSQV FVGNTSL FVGQTQL FVGTSQL FVSGSQF FVSPSNI FVSQYL FVSTT F GAHPLVG GALHVVP

FVGGSSA FVG TS FVGQTQV FVGTSQV FVSGSQI FVSPSNL FVSQYV FVSTTNI GAHPLVS GALHVVS

FVGGSSF FVGNTTF FVGQTSF FVGTSSF FVSGSQL FVSPSNV FVSSNF FVSTT L GAHPLVT GALHVVT

FVGGSSH FVGNTTI FVGQTSI FVGTSSI FVSGSQV FVSPSQF FVSSNI FVSTTNV GAHPVGG GALPGHG

FVGGSSI FVGNTTL FVGQTSL FVGTSSL FVSGSSF FVSPSQI FVSSNL FVSTTQF GAHPVGS GALPGHS

FVGGSSK FVGNTTV FVGQTSV FVGTSST FVSGSSI FVSPSQL FVSSNV FVSTTQI GAHPVGT GALPGHT

FVGGSSL FVGNTV FVGQTTF FVGTSSV FVSGSSL FVSPSQV FVSSQF FVSTTQL GAHPVLG GALPHGG

FVGGSSN FVGNTYF FVGQTTI FVGTSTF FVSGSSV FVSPSSF FVSSQI FVSTTQV GAHPVLS GALPHGS

FVGGSSR FVGNTYI FVGQTTL FVGTSTI FVSGSTF FVSPSSI FVSSQL FVSTTSF GAHPVLT GALPHGT

FVGGSSS FVGNTYL FVGQTTV FVGTSTL FVSGSTI FVSPSSL FVSSQV FVSTTSI GAHPVVG GALPHVG

FVGGSSV FVGNTYV FVGQTV FVGTSTV FVSGSTL FVSPSSV FVSSSF F STTSL GAHPVVS GALPHVS

FVGGSTF FVGNYF FVGQTYF FVGTSV FVSGSTV FVSPSTF FVSSSI FVSTTSV GAHPVVT GALPHVT

FVGGSTI FVGNYI FVGQTYI FVGTSYF FVSGSYF FVSPSTI FVSSSL FVSTTTF GAHSGGP GALPVHG

FVGGSTL FVGNYL FVGQTYL FVGTSYI FVSGSYI FVSPSTL FVSSSNF FVSTTTI GAHSGGT GALPVHS

FVGGSTR FVGNYV FVGQTYV FVGTSYL F SGSYL FVSPSTV FVSSSNI FVSTTTL GAHSGLG GALPVHT

FVGGSTV FVGPSAV FVGQYF FVGTSYV FVSGSYV FVSPSYF FVSSSNL FVSTTTV GAHSGLP GALSGHG

FVGGSYF FVGPSNF FVGQYI FVGTTF FVSGTNF FVSPSYI FVSSSNV FVSTTV GAHSGLS GALSGHP

FVGGSYI FVGPSNI FVGQYL FVGTTI FVSGTNI FVSPSYL FVSSSQF FVSTTYF GAHSGLT GALSGHS

FVGGSYL FVGPSNL FVGQYV FVGTTL FVSGTNL FVSPSYV FVSSSQI FVSTTYI GAHSGVP GALSGHT

FVGGSYV FVGPSNV FVGRSSV FVGTTNF FVSGTNV FVSPTNF FVSSSQL F STTYL GAHSGVT GALSHGG

FVGGTNF FVGPSQF FVGSNF FVGTTNI FVSGTQF FVSPTNI FVSSSQV FVSTTYV GAHSLGG GALSHGP

FVGGTNI FVGPSQI FVGSNI FVGTTNL FVSGTQI FVSPTNL FVSSSSF FVSTYF GAHSLGP GALSHGS

FVGGTNL FVGPSQL FVGSNL FVGTTNV FVSGTQL FVSPTNV FVSSSSI FVSTYI GAHSLGS GALSHGT

FVGGTNV FVGPSQV FVGSNV FVGTTQF FVSGTQV FVSPTQF FVSSSSL F STYL GAHSLGT GALSHVG

FVGGTQF FVGPSSF FVGSQF FVGTTQI FVSGTSF FVSPTQI FVSSSSV FVSTYV GAHSLVG GALSHVP

FVGGTQI FVGPSSI FVGSQI FVGTTQL FVSGTSI FVSPTQL FVSSSTF FVSYNF GAHSLVP GALSHVS

FVGGTQL FVGPSSL FVGSQL FVGTTQV FVSGTSL FVSPTQV FVSSSTI FVSYNI GAHSLVS GALSHVT

FVGGTQV FVGPSSV FVGSQV FVGTTSF FVSGTSV FVSPTSF FVSSSTL FVSYNL GAHSLVT GALSVHG

FVGGTSF FVGPSTF FVGSSF FVGTTSI FVSGTTF FVSPTSI FVSSSTV FVSYNV GAHSVGP GALSVHP

FVGGTSI FVGPSTI FVGSSI FVGTTSL FVSGTTI FVSPTSL FVSSSV FVSYQF GAHSVGT GALSVHS

FVGGTSL FVGPSTL FVGSSL FVGTTSV FVSGTTL FVSPTSV FVSSSYF FVSYQI GAHSVLG GALSVHT

FVGGTSV FVGPSTV FVGSSNF FVGTTTF FVSGTTV FVSPTTF FVSSSYI FVSYQL GAHSVLP GALTGHG

FVGGTTF FVGPSYF FVGSSNI FVGTTTI FVSGTYF FVSPTTI FVSSSYL FVSYQV GAHSVLS GALTGHP

FVGGTTI FVGPSYI FVGSSNL FVGTTTL F SGTYI FVSPTTL FVSSSYV FVSYSF GAHSVLT GALTGHS

FVGGTTL FVGPSYL FVGSSNV FVGTTTV FVSGTYL FVSPTTV FVSSTF FVSYSI GAHSVVP GALTHGG

FVGGTTV FVGPSYV FVGSSQF FVGTTV FVSGTYV FVSPTYF FVSSTI FVSYSL GAHSVVT GALTHGP

FVGGTYF FVGPT F FVGSSQI FVGTTYF FVSNNF FVSPTYI FVSSTL FVSYSV GAHTGGG GALTHGS

FVGGTYI FVGPTNI FVGSSQL FVGTTYI FVSNNI FVSPTYL FVSST F FVSYTF GAHTGGP GALTHVG

FVGGTYL FVGPT L FVGSSQV FVGTTYL FVSNNL FVSPTYV FVSSTNI FVSYTI GAHTGGS GALTHVP

FVGGTYV FVGPTNV FVGSSSF FVGTTYV FVSNNV FVSQNF FVSSTNL FVSYTL GAHTGLG GALTHVS

FVGGYSF FVGPTQF FVGSSSI FVGTYF FVSNQF FVSQNI FVSSTNV FVSYTV GAHTGLP GALTVHG

FVGGYSV FVGPTQI FVGSSSL FVGTYI FVSNQI FVSQNL FVSSTQF FVSYYF GAHTGLS GALTVHP

FVGHSEH FVGPTQL FVGSSSV FVGTYL FVSNQL FVSQNV FVSSTQI FVSYYI GAHTGVG GALTVHS

FVGISEK FVGPTQV FVGSSTF FVGTYV FVSNQV FVSQQF FVSSTQL FVSYYL GAHTGVP GALVGHG

FVGISSV FVGPTSF FVGSSTI FVGVGSV FVSNSF FVSQQI FVSSTQV FVSYYV GAHTGVS GALVGHP

FVGIYSK FVGPTSI FVGSSTL FVGWGSK FVSNSI FVSQQL FVSSTSF FVTGSSQ GAHTLGG GALVGHS

FVGKSKL FVGPTSL FVGSSTV FVGWLHV FVSNSL FVSQQV FVSSTSI FVTQSSA GAHTLGP GALVGHT

FVGKSMV FVGPTSV FVGSSV FVGWSKV FVSNSNF FVSQSF FVSSTSL FVTYSLQ GAHTLGS GALVHGG

FVGKSSV FVGPTTF FVGSSYF FVGWSSE FVSNSNI FVSQSI FVSSTSV FVVGESR GAHTLVG GALVHGP

FVGMSDV FVGPTTI FVGSSYI FVGYKMM FVSNSNL FVSQSL FVSSTTF FVVISEV GAHTLVP GALVHGS

FVGNNF FVGPTTL FVGSSYL FVGYNF FVSNSNV FVSQSNF FVSSTTI FVVISSA GAHTLVS GALVHGT

FVGNNI FVGPTTV FVGSSYV FVGYNI FVSNSQF FVSQSNI FVSSTTL FVVPSSV GAHTVGG GALVHVG

FVGNNL FVGPTYF FVGSTF FVGYNL FVSNSQI FVSQS L FVSSTTV FVVQSNV GAHTVGP GALVHVP

FVGNNV FVGPTYI FVGSTI FVGYNV FVS SQL FVSQSNV FVSSTV FVVWSSV GAHTVGS GALVHVS

FVGNQF FVGPTYL FVGSTL FVGYQF FVSNSQV FVSQSQF FVSSTYF FVWGFSV GAHTVLG GALVHVT

FVGNQI FVGPTYV FVGSTNF FVGYQI FVSNSSF FVSQSQI FVSSTYI FVWGVSV GAHTVLP GALVVHG

FVGNQL FVGQ F FVGSTNI FVGYQL FVSNSSI FVSQSQL F SSTYL FVYGSSA GAHTVLS GALVVHP

FVGNQQP FVGQNI FVGSTNL FVGYQV FVSNSSL FVSQSQV FVSSTYV FVYGSSH GAHTVVG GALVVHS

FVGNQV FVGQ L FVGSTNV FVGYSF FVSNSSV FVSQSSF FVSSYF FVYGTIS GAHTVVP GALVVHT

FVG RSV FVGQNV FVGSTQF FVGYSI FVSNSTF FVSQSSI FVSSYI FVYGWSV GAHTVVS GASGSDN

FVGNSF FVGQQF FVGSTQI FVGYSL FVSNSTI FVSQSSL FVSSYL FYDVSSS GAHVGGP GASHGGP

FVGNSI FVGQQI FVGSTQL FVGYSV FVS STL FVSQSSV FVSSYV FYGAGEE GAHVGGT GASHGGT

FVGNSL FVGQQL FVGSTQV FVGYTF FVSNSTV FVSQSTF FVST F FYGWPTI GAHVGLG GASHGLG

FVGNSNF FVGQQV FVGSTSF FVGYTI FVSNSV FVSQSTI FVSTNI FYTQRSV GAHVGLP GASHGLP

FVGNSNI FVGQSF FVGSTSI FVGYTL FVSNSYF FVSQSTL FVST L FYWGSEV GAHVGLS GASHGLS

FVGNSNL FVGQSI FVGSTSL FVGYTV FVSNSYI FVSQSTV FVSTNV GAFGHHV GAHVGLT GASHGLT

FVGNSNV FVGQSL FVGSTSV FVGYWSF FVSNSYL FVSQSV FVSTQF GAGGKNP GAHVGVP GASHGVP

FVGNSQF FVGQSNF FVGSTTF FVGYYF FVSNSYV FVSQSYF FVSTQI GAGGSSV GAHVGVT GASHGVT

FVGNSQI FVGQSNI FVGSTTI FVGYYI FVSNTF FVSQSYI FVSTQL GAHHSGV GAHVLGG GASHLGG

FVGNSQL FVGQSNL FVGSTTL FVGYYL FVSNTI FVSQSYL FVSTQV GAHLGGG GAHVLGP GASHLGP

FVGNSQV FVGQSNV FVGSTTV FVGYYV FVSNTL FVSQSYV FVSTSF GAHLGGP GAHVLGS GASHLGS

FVGNSSF FVGQSQF FVGSTV FVHGHSV FVSNTNF FVSQTF FVSTSI GAHLGGS GAHVLGT GASHLGT

FVGNSSI FVGQSQI FVGSTYF FVHGSSQ FVSNTNI FVSQTI FVSTSL GAHLGGT GAHVLVG GASHLVG

FVGNSSL FVGQSQL FVGSTYI FVHMPNK FVSNTNL FVSQTL FVSTSNF GAHLGVG GAHVLVP GASH L VP

FVGNSSV FVGQSQV FVGSTYL FVHPKKD FVSNTNV FVSQTNF FVSTSNI GAHLGVP GAHVLVS GASHLVS GASHLVT GATHGLP GAVHVGT GEGLPSH GGATLHP GGHPGVT GGHVALS GGLSGHT GGSHVLA GGTAHVP

GASHVGP GATHGLS GAVHVLG GEGMPDV GGATLHS GGHPLAG GGHVALT GGLSHAG GGSHVLP GGTAHVS

GASHVGT GATHGVG GAVHVLP GEGMSEV GGATVHG GGHPLAS GGHVAVP GGLSHAP GGSHVLT GGTALHG

GASHVLG GATHGVP GAVHVLS GFFNSSV GGATVHP GGHPLAT GGHVAVT GGLSHAS GGSLAHG GGTALHP

GASHVLP GATHGVS GAVHVLT GFGGIGV GGATVHS GGHPLGA GGHVGAP GGLSHAT GGSLAHP GGTALHS

GASHVLS GATHLGG GAVHVVP GFGGMSQ GGAVGHP GGHPLGG GGHVGAT GGLSHGA GGSLAHS GGTAVHG

GASHVLT GATHLGP GAVHVVT GFGGYST GGAVGHT GGHPLGS GGHVGLA GGLSHGP GGSLAHT GGTAVHP

GASHVVP GATHLGS GAVLGHG GFGSDGV GGAVHGP GGHPLGT GGHVGLP GGLSHGT GGSLGHA GGTAVHS

GASHVVT GATHLVG GAVLGHP GFNGSVI GGAVHGT GGHPLVA GGHVGLT GGLSHVA GGSLGHP GGTHAGG

GASLGHG GATHL P GAVLGHS G GAG SSI GGAVHLG GGHPLVG GGHVLAG GGLSHVP GGSLGHT GGTHAGP

GASLGHP GATHLVS GAVLGHT GGAHGGP GGAVHLP GGHPLVS GGHVLAP GGLSHVT GGSLHAG GGTHAGS

GASLGHS GATHVGG GAVLHGG GGAHGGT GGAVHLS GGHPLVT GGHVLAS GGLSVHA GGSLHAP GGTHALG

GASLGHT GATHVGP GAVLHGP GGAHGLG GGAVHLT GGHPVAG GGHVLAT GGLSVHP GGSLHAS GGTHALP

GASLHGG GATHVGS GAVLHGS GGAHGLP GGAVHVP GGHPVAS GGHVLGA GGLSVHT GGSLHAT GGTHALS

GASLHGP GATHVLG GAVLHGT GGAHGLS GGAVHVT GGHPVAT GGHVLGP GGLTAHG GGSLHGA GGTHAVG

GASLHGS GATHVLP GAVLHVG GGAHGLT GGAVLHG GGHPVGA GGHVLGT GGLTAHP GGSLHGP GGTHAVP

GASLHGT GATHVLS GAVLHVP GGAHGVP GGAVLHP GGHPVGT GGHVLVA GGLTAHS GGSLHGT GGTHAVS

GASLHVG GATHVVG GAVLHVS GGAHGVT GGAVLHS GGHPVLA GGHVLVP GGLTGHA GGSLHVA GGTHGAG

GASLHVP GATHVVP GAVLHVT GGAHLGG GGAVLHT GGHPVLG GGHVLVT GGLTGHG GGSLHVP GGTHGAP

GASLHVS GATHVVS GAVLVHG GGAHLGP GGAVVHP GGHPVLS GGHVVAP GGLTGHP GGSLHVT GGTHGAS

GASLHVT GATLGHG GAVLVHP GGAHLGS GGAVVHT GGHPVLT GGHVVAT GGLTGHS GGSLVHA GGTHGGA

GASLVHG GATLGHP GAVLVHS GGAHLGT GGGGKSY GGHPVVA GGHVVLA GGLTHAG GGSLVHP GGTHGGP

GASLVHP GATLGHS GAVLVHT GGAHLVG GGGGSDV GGHPVVT GGHVVLP GGLTHAP GGSLVHT GGTHGLA

GASLVHS GATLHGG GAVPGHG GGAHLVP GGGGSLV GGHSAGP GGHVVLT GGLTHAS GGSPAHG GGTHGLG

GASLVHT GATLHGP GAVPGHS GGAHLVS GGGGSSV GGHSAGT GGINANS GGLTHGA GGSPAHS GGTHGLP

GASPGHG GATLHGS GAVPGHT GGAHLVT GGGPWLA GGHSALG GGLAGHG GGLTHGG GGSPAHT GGTHGLS

GASPGHS GATLHVG GAVPHGG GGAHVGP GGHAGGP GGHSALP GGLAGHP GGLTHGP GGSPGHA GGTHGVA

GASPGHT GATLHVP GAVPHGS GGAHVGT GGHAGGT GGHSALS GGLAGHS GGLTHGS GGSPGHT GGTHGVP

GASPHGG GATLHVS GAVPHGT GGAHVLG GGHAGLG GGHSALT GGLAGHT GGLTHVA GGSPHAG GGTHLAG

GASPHGS GATLVHG GAVPHLG GGAHVLP GGHAGLP GGHSAVP GGLAHGG GGLTHVG GGSPHAS GGTHLAP

GASPHGT GATL HP GAVPHLS GGAHVLS GGHAGLS GGHSAVT GGLAHGP GGLTHVP GGSPHAT GGTHLAS

GASPHLG GATLVHS GAVPHLT GGAHVLT GGHAGLT GGHSGAP GGLAHGS GGLTHVS GGSPHGA GGTHLGA

GASPHLS GATPGHG GAVPHVG GGAHVVP GGHAGVP GGHSGAT GGLAHGT GGLTVHA GGSPHGT GGTHLGG

GASPHLT GATPGHS GAVPHVS GGAHVVT GGHAGVT GGHSGLA GGLAHVG GGLTVHG GGSPHLA GGTHLGP

GASPHVG GATPHGG GAVPHVT GGALGHG GGHALGG GGHSGLP GGLAHVP GGLTVHP GGSPHLG GGTHLGS

GASPHVS GATPHGS GAVPLHG GGALGHP GGHALGP GGHSGLT GGLAHVS GGLTVHS GGSPHLS GGTHLVA

GASPHVT GATPHLG GAVPLHS GGALGHS GGHALGS GGHSLAG GGLAHVT GGLVAHG GGSPHLT GGTHLVG

GASPLHG GATPHLS GAVPLHT GGALGHT GGHALGT GGHSLAP GGLAVHG GGLVAHP GGSPHVA GGTHLVP

GASPLHS GATPHVG GAVPVHG GGALHGG GGHALVG GGHSLAS GGLAVHP GGLVAHS GGSPHVT GGTHLVS

GASPLHT GATPHVS GAVPVHS GGALHGP GGHALVP GGHSLAT GGLAVHS GGLVAHT GGSPLHA GGTHVAG

GASPVHG GATPLHG GAVPVHT GGALHGS GGHALVS GGHSLGA GGLAVHT GGLVGHA GGSPLHG GGTHVAP

GASPVHS GATPLHS GAVSGHP GGALHGT GGHALVT GGHSLGP GGLHAGG GGLVGHP GGSPLHS GGTHVAS

GASPVHT GATPVHG GAVSGHT GGALHVG GGHAVGP GGHSLGT GGLHAGP GGLVGHT GGSPLHT GGTHVGA

GASSGHP GATPVHS GAVSHGP GGALHVP GGHAVGT GGHSLVA GGLHAGS GGLVHAG GGSPVHA GGTHVGP

GASSGHT GATSGHG GAVSHGT GGALHVS GGHAVLG GGHSLVP GGLHAGT GGLVHAP GGSPVHT GGTHVLA

GASSHGP GATSGHP GAVSHLG GGALHVT GGHAVLP GGHSLVT GGLHAVG GGLVHAS GGSSAHP GGTHVLG

GASSHGT GATSGHS GAVSHLP GGALVHG GGHAVLS GGHSVAP GGLHAVP GGLVHAT GGSSAHT GGTHVLP

GASSHLG GATSHGG GAVSHLS G GAL VHP GGHAVLT GGHSVAT GGLHAVS GGLVHGA GGSSHAP GGTHVLS

GASSHLP GATSHGP GAVSHLT GGALVHS GGHAVVP GGHSVLA GGLHAVT GGLVHGP GGSSHAT GGTHVVA

GASSHLS GATSHGS GAVSHVP GGALVHT GGHAVVT GGHSVLP GGLHGAG GGLVHGT GGSSHLA GGTHVVP

GASSHLT GATSHLG GAVSHVT GGAPGHG GGHLAGG GGHSVLT GGLHGAP GGLVHVA GGSSHLP GGTLAHG

GASSHVP GATSHLP GAVSLHG GGAPGHS GGHLAGP GGHTAGG GGLHGAS GGLVHVP GGSSHLT GGTLAHP

GASSHVT GATSHLS GAVSLHP GGAPGHT GGHLAGS GGHTAGP GGLHGAT GGLVHVT GGSSLHA GGTLAHS

GASSLHG GATSHVG GAVSLHS GGAPHGG GGHLAGT GGHTAGS GGLHGGA GGLVVHA GGSSLHP GGTLGHA

GASSLHP GATSHVP GAVSLHT GGAPHGS GGHLAVG GGHTALG GGLHGGP GGLVVHP GGSSLHT GGTLGHG

GASSLHS GATSHVS GAVSVHP GGAPHGT GGHLAVP GGHTALP GGLHGGT GGLVVHT GGSTAHG GGTLGHP

GASSLHT GATSLHG GAVSVHT GGAPHLG GGHLAVS GGHTALS GGLHGVA GGSAGHP GGSTAHP GGTLGHS

G ASS HP GATSLHP GAVTGHG GGAPHLS GGHLAVT GGHTAVG GGLHGVP GGSAGHT GGSTAHS GGTLHAG

GASSVHT GATSLHS GAVTGHP GGAPHLT GGHLGAG GGHTAVP GGLHGVT GGSAHGP GGSTGHA GGTLHAP

GASTGHG GATSVHG GAVTGHS GGAPHVG GGHLGAP GGHTAVS GGLHVAG GGSAHGT GGSTGHP GGTLHAS

GASTGHP GATS HP GAVTHGG GGAPHVS GGHLGAS GGHTGAG GGLHVAP GGSAHLG GGSTHAG GGTLHGA

GASTGHS GATSVHS GAVTHGP GGAPHVT GGHLGAT GGHTGAP GGLHVAS GGSAHLP GGSTHAP GGTLHGG

GASTHGG GATVGHG GAVTHGS GGAPLHG GGHLGGA GGHTGAS GGLHVAT GGSAHLS GGSTHAS GGTLHGP

GASTHGP GATVGHP GAVTHLG GGAPLHS GGHLGGP GGHTGGA GGLHVGA GGSAHLT GGSTHGA GGTLHGS

GASTHGS GATVGHS GAVTHLP GGAPLHT GGHLGGT GGHTGGP GGLHVGP GGSAHVP GGSTHGP GGTLHVA

GASTHLG GATVHGG GAVTHLS GGAPVHG GGHLGVA GGHTGLA GGLHVGT GGSAHVT GGSTHLA GGTLHVG

GASTHLP GATVHGP GAVTHVG GGAPVHS GGHLGVP GGHTGLG GGLHVVA GGSALHG GGSTHLG GGTLHVP

GASTHLS GATVHGS GAVTHVP GGAPVHT GGHLGVT GGHTGLP GGLHVVP GGSALHP GGSTHLP GGTLHVS

GASTHVG GATVHLG GAVTHVS GGASGHP GGHLVAG GGHTGLS GGLHVVT GGSALHS GGSTHLS GGTLVHA

GASTHVP GATVHLP GAVTLHG GGASGHT GGHLVAP GGHTGVA GGLPAHG GGSALHT GGSTHVA GGTLVHG

GASTHVS GATVHLS GAVTLHP GGASHGP GGHLVAS GGHTGVP GGLPAHS GGSAVHP GGSTHVP GGTLVHP

GASTLHG GATVHVG GAVTLHS GGASHGT GGHLVAT GGHTLAG GGLPAHT GGSAVHT GGSTLHA GGTLVHS

GASTLHP GATVHVP GAVTVHG GGASHLG GGHLVGA GGHTLAP GGLPGHA GGSHAGP GGSTLHG GGTPAHG

GASTLHS GATVHVS GAVTVHP GGASHLP GGHLVGP GGHTLAS GGLPGHG GGSHAGT GGSTLHP GGTPAHS

GASTVHG GATVLHG GAVTVHS GGASHLS GGHLVGT GGHTLGA GGLPGHS GGSHALG GGSTLHS GGTPGHA

GASTVHP GATVLHP GAVVGHP GGASHLT GGHLVVA GGHTLGG GGLPGHT GGSHALP GGSTVHA GGTPGHG

GASTVHS GATVLHS GAVVGHT GGASHVP GGHLVVP GGHTLGP GGLPHAG GGSHALS GGSTVHP GGTPGHS

GAS GHP GATVVHG GAVVHGP GGASHVT GGHLVVT GGHTLGS GGLPHAS GGSHALT GGSVAHP GGTPHAG

GAS GHT GATVVHP GAVVHGT GGASLHG GGHPAGG GGHTLVA GGLPHAT GGSHAVP GGSVAHT GGTPHAS

GASVHGP GATVVHS GAVVHLG GGASLHP GGHPAGS GGHTLVG GGLPHGA GGSHAVT GGSVHAP GGTPHGA

GASVHGT GAVHGGP GAVVHLP GGASLHS GGHPAGT GGHTLVP GGLPHGG GGSHGAP GGSVHAT GGTPHGG

GAS HLG GAVHGGT GAVVHLS GGASLHT GGHPALG GGHTLVS GGLPHGS GGSHGAT GGSVHLA GGTPHGS

GASVHLP GAVHGLG GAVVHLT G GAS VHP GGHPALS GGHTVAG GGLPHGT GGSHGLA GGSVHLP GGTPHLA

GAS HLS GAVHGLP GAVVHVP GGASVHT GGHPALT GGHTVAP GGLPHVA GGSHGLP GGSVHLT GGTPHLG

GAS HLT GAVHGLS GAVVHVT GGATGHG GGHPAVG GGHTVAS GGLPHVG GGSHGLT GGSVLHA GGTPHLS

GASVHVP GAVHGLT GAVVLHG GGATGHP GGHPAVS GGHTVGA GGLPHVS GGSHLAG GGSVLHP GGTPHVA

GASVHVT GAVHGVP GAVVLHP GGATGHS GGHPAVT GGHTVGP GGLPHVT GGSHLAP GGSVLHT GGTPHVG

GASVLHG GAVHGVT GAVVLHS GGATHGG GGHPGAG GGHTVLA GGLPVHA GGSHLAS GGTAGHG GGTPHVS

GASVLHP GAVHLGG GAVVLHT GGATHGP GGHPGAS GGHTVLG GGLPVHG GGSHLAT GGTAGHP GGTPLHA

GASVLHS GAVHLGP GAVVVHP GGATHGS GGHPGAT GGHTVLP GGLPVHS GGSHLGA GGTAGHS GGTPLHG

GASVLHT GAVHLGS GAVVVHT GGATHLG GGHPGGA GGHTVLS GGLPVHT GGSHLGP GGTAHGG GGTPLHS

GAS VHP GAVHLGT GDFLSSA GGATHLP GGHPGGT GGHTVVA GGLSAHG GGSHLGT GGTAHGP GGTPVHA

GASVVHT GAVHLVG GDGGSSV GGATHLS GGHPGLA GGHTVVP GGLSAHP GGSHLVA GGTAHGS GGTPVHG

GATHGGG GAVHLVP GDGLSYD GGATHVG GGHPGLG GGHVAGP GGLSAHS GGSHLVP GGTAHLG GGTPVHS

GATHGGP GAVHLVS GEFGWSV GGATHVP GGHPGLS GGHVAGT GGLSAHT GGSHLVT GGTAHLP GGTSAHG

GATHGGS GAVHLVT GEGEYSV GGATHVS GGHPGLT GGHVALG GGLSGHA GGSHVAP GGTAHLS GGTSAHP

GATHGLG GAVHVGP GEGGSSV GGATLHG GGHPGVA GGHVALP GGLSGHP GGSHVAT GGTAHVG GGTSAHS GGTSGHA GGVLHGP GHAPGVT GHLAGVG GHLVAGP GHSPGLT GHSVALG GHTPLGA GHTVVLP GHVPVVT

GGTSGHP GGVLHGT GHAPLGG GHLAG P GHLVAGS GHSPGVA GHSVALP GHTPLGG GHTVVLS GHVSAGP

GGTSHAG GGVLHVA GHAPLGS GHLAGVS GHLVAGT GHSPGVT GHSVALS GHTPLGS GHTVVVA GHVSAGT

GGTSHAP GGVLHVP GHAPLGT GHLAGVT GHLVAVG GHSPLAG GHSVALT GHTPLVA GHTVVVP GHVSALG

GGTSHAS GGVLHVT GHAPLVG GHLAVGG GHLVA P GHSPLAS GHSVAVP GHTPLVG GHVAGGP GHVSALP

GGTSHGA GGVLVHA GHAPLVS GHLAVGP GHLVAVS GHSPLAT GHSVAVT GHTPLVS GHVAGGT GHVSALS

GGTSHGP GGVL HP GHAPLVT GHLAVGS GHLVAVT GHSPLGA GHSVGAP GHTPVAG GHVAGLG GHVSALT

GGTSHLA GGVLVHT GHAPVGG GHLAVGT GHLVGAG GHSPLGG GHSVGAT GHTPVAS GHVAGLP GHVSAVP

GGTSHLG GGVPAHG GHAPVGS GHLAVVG GHLVGAP GHSPLGS GHSVGLA GHTPVGA GHVAGLS GHVSAVT

GGTSHLP GGVPAHS GHAPVGT GHLAVVP GHLVGAS GHSPLGT GHSVGLP GHTPVGG GHVAGLT GHVSGAP

GGTSHLS GGVPAHT GHAPVLG GHLAVVS GHLVGAT GHSPLVA GHSVGLT GHTPVGS GHVAGVP GHVSGAT

GGTSHVA GGVPGHA GHAPVLS GHLAVVT GHLVGGA GHSPLVG GHSVLAG GHTPVLA GHVAGVT GHVSGLA

GGTSHVP GGVPGHT GHAP LT GHLPAGG GHLVGGP GHSPLVS GHSVLAP GHTPVLG GHVALGG GHVSGLP

GGTSLHA GGVPHAG GHAP VG GHLPAGS GHLVGGT GHSPLVT GHSVLAS GHTPVLS GHVALGP GHVSGLT

GGTSLHG GGVPHAS GHAP VS GHLPAGT GHLVGVA GHSPVAG GHSVLAT GHTPVVA GHVALGS GHVSLAG

GGTSLHP GGVPHAT GHAP VT GHLPAVG GHLVGVP GHSPVAS GHSVLGA GHTPVVG GHVALGT GHVSLAP

GGTSLHS GGVPHGA GHASGGP GHLPAVS GHLVGVT GHSPVAT GHSVLGP GHTPVVS GHVALVG GHVSLAS

GGTSVHA GGVPHGT GHASGGT GHLPAVT GHL VAG GHSPVGA GHSVLGT GHTSAGG GHVALVP GHVSLAT

GGTSVHP GGVPHLA GHASGLG GHLPGAG GHLVVAP GHSPVGT GHSVLVA GHTSAGP GHVALVS GHVSLGA

GGTVAHG GGVPHLG GHASGLP GHLPGAS GHL VAS GHSPVLA GHSVLVP GHTSAGS GHVALVT GHVSLGP

GGTVAHP GGVPHLS GHASGLS GHLPGAT GHL VAT GHSPVLG GHSVLVT GHTSALG GHVAVGP GHVSLGT

GGTVAHS GGVPHLT GHASGLT GHLPGGA GHLVVGA GHSPVLS GHSVVAP GHTSALP GHVAVGT GHVSLVA

GGTVGHA GGVPHVA GHASGVP GHLPGGG GHLVVGP GHSPVLT GHSVVAT GHTSALS GHVAVLG GHVSLVP

GGTVGHP GGVPHVT GHASGVT GHLPGGS GHLVVGT GHSPVVA GHSVVLA GHTSAVG GHVAVLP GHVSLVT

GGTVHAG GGVPLHA GHASLGG GHLPGGT GHLVVVA GHSPVVT GHSVVLP GHTSAVP GHVAVLS GHVSVAP

GGTVHAP GGVPLHG GHASLGP GHLPGVA GHLVVVP GHSSAGP GHSVVLT GHTSAVS GHVAVLT GHVSVAT

GGTVHAS GGVPLHS GHASLGS GHLPGVG GHLVVVT GHSSAGT GHTAGGG GHTSGAG GHVAVVP GHVSVLA

GGTVHGA GGVPLHT GHASLGT GHLPGVS GHRQPHV GHSSALG GHTAGGP GHTSGAP GHVAVVT GHVSVLP

GGTVHGP GGVPVHA GHASLVG GHLPGVT GHSAGGP GHSSALP GHTAGGS GHTSGAS GHVLAGG GHVSVLT

GGTVHLA GGVPVHT GHASLVP GHLPVAG GHSAGGT GHSSALS GHTAGLG GHTSGGA GHVLAGP GHVTAGG

GGTVHLG GGVSAHP GHASLVS GHLPVAS GHSAGLG GHSSALT GHTAGLP GHTSGGP GHVLAGS GHVTAGP

GGTVHLP GGVSAHT GHASLVT GHLP AT GHSAGLP GHSSAVP GHTAGLS GHTSGLA GHVLAGT GHVTAGS

GGTVHLS GGVSHAP GHAS GP GHLP GA GHSAGLS GHSSAVT GHTAGVG GHTSGLG GHVLAVG GHVTALG

GGTVHVA GGVSHAT GHAS GT GHLPVGG GHSAGLT GHSSGAP GHTAGVP GHTSGLP GHVLAVP GHVTALP

GGTVHVP GGVSHLA GHAS LG GHLPVGS GHSAGVP GHSSGAT GHTAGVS GHTSGLS GHVLAVS GHVTALS

GGTVLHA GGVSHLP GHASVLP GHLPVGT GHSAGVT GHSSGLA GHTALGG GHTSGVA GHVLAVT GHVTAVG

GGTVLHG GGVSHLT GHAS LS GHLPVVA GHSALGG GHSSGLP GHTALGP GHTSGVP GHVLGAG GHVTAVP

GGTVLHP GGVSLHA GHAS LT GHLPVVG GHSALGP GHSSGLT GHTALGS GHTSLAG GHVLGAP GHVTAVS

GGTVLHS GGVSLHP GHAS VP GHLPVVS GHSALGS GHSSLAG GHTALVG GHTSLAP GHVLGAS GHVTGAG

GGTVVHA GGVSLHT GHASVVT GHLPVVT GHSALGT GHSSLAP GHTALVP GHTSLAS GHVLGAT GHVTGAP

GGTVVHP GGVTAHG GHATGGG GHLSAGG GHSALVG GHSSLAS GHTALVS GHTSLGA GHVLGGA GHVTGAS

GGVAGHP GGVTAHP GHATGGP GHLSAGP GHSALVP GHSSLAT GHTAVGG GHTSLGG GHVLGGP GHVTGGA

GGVAGHT GGVTAHS GHATGGS GHLSAGS GHSALVS GHSSLGA GHTAVGP GHTSLGP GHVLGGT GHVTGGP

GGVAHGP GGVTGHA GHATGLG GHLSAGT GHSALVT GHSSLGP GHTAVGS GHTSLGS GHVLGVA GHVTGLA

GGVAHGT GGVTGHP GHATGLP GHLSAVG GHSAVGP GHSSLGT GHTAVLG GHTSLVA GHVLGVP GHVTGLG

GGVAHLG GGVTHAG GHATGLS GHLSAVP GHSAVGT GHSSLVA GHTAVLP GHTSLVG GHVLGVT GHVTGLP

GGVAHLP GGVTHAP GHATGVG GHLSAVS GHSAVLG GHSSLVP GHTAVLS GHTSLVP GHVLVAG GHVTGLS

GGVAHLS GGVTHAS GHATGVP GHLSAVT GHSAVLP GHSSLVT GHTAVVG GHTSLVS GHVLVAP GHVTGVA

GGVAHLT GGVTHGA GHATGVS GHLSGAG GHSAVLS GHSSVAP GHTAVVP GHTSVAG GHVLVAS GHVTGVP

GGVAHVP GGVTHGP GHATLGG GHLSGAP GHSAVLT GHSSVAT GHTAVVS GHTSVAP GHVLVAT GHVTLAG

GGVAHVT GGVTHLA GHATLGP GHLSGAS GHSAVVP GHSSVLA GHTLAGG GHTSVAS GHVLVGA GHVTLAP

GGVALHG GGVTHLG GHATLGS GHLSGAT GHSAVVT GHSSVLP GHTLAGP GHTSVGA GHVLVGP GHVTLAS

GGVALHP GGVTHLP GHATLVG GHLSGGA GHSLAGG GHSSVLT GHTLAGS GHTSVGP GHVLVGT GHVTLGA

GGVALHS GGVTHLS GHATL P GHLSGGP GHSLAGP GHSTAGG GHTLAVG GHTSVLA GHVLVVA GHVTLGG

GGVALHT GGVTHVA GHATLVS GHLSGGT GHSLAGS GHSTAGP GHTLAVP GHTSVLG GHVLVVP GHVTLGP

GGVAVHP GGVTHVP GHATVGG GHLSGVA GHSLAGT GHSTAGS GHTLAVS GHTSVLP GHVLVVT GHVTLGS

GGVAVHT GGVTLHA GHATVGP GHLSG P GHSLAVG GHSTALG GHTLGAG GHTSVLS GHVPAGG GHVTLVA

GGVHAGP GGVTLHG GHATVGS GHLSGVT GHSLAVP GHSTALP GHTLGAP GHTSVVA GHVPAGS GHVTLVG

GGVHAGT GGVTLHP GHATVLG GHLSVAG GHSLAVS GHSTALS GHTLGAS GHTSVVP GHVPAGT GHVTLVP

GGVHALG GGVTLHS GHATVLP GHLSVAP GHSLAVT GHSTAVG GHTLGGA GHTVAGG GHVPALG GHVTLVS

GGVHALP GGVTVHA GHATVLS GHLSVAS GHSLGAG GHSTAVP GHTLGGG GHTVAGP GHVPALS GHVTVAG

GGVHALS GGVTVHP GHAT VG GHLSVAT GHSLGAP GHSTAVS GHTLGGP GHTVAGS GHVPALT GHVTVAP

GGVHALT GGVVAHP GHAT VP GHLSVGA GHSLGAS GHSTGAG GHTLGGS GHTVALG GHVPAVG GHVTVAS

GGVHAVP GGVVAHT GHAT VS GHLSVGP GHSLGAT GHSTGAP GHTLGVA GHTVALP GHVPAVS GHVTVGA

GGVHAVT GGVVHAP GHAVGGP GHLSVGT GHSLGGA GHSTGAS GHTLGVG GHTVALS GHVPAVT GHVTVGP

GGVHGAP GGVVHAT GHAVGGT GHLSVVA GHSLGGP GHSTGGA GHTLGVP GHTVAVG GHVPGAG GHVTVLA

GGVHGAT GGVVHLA GHAVGLG GHLSVVP GHSLGGT GHSTGGP GHTLGVS GHTVAVP GHVPGAS GHVTVLG

GGVHGLA GGVVHLP GHAVGLP GHLSVVT GHSLGVA GHSTGLA GHTLVAG GHTVAVS GHVPGAT GHVTVLP

GGVHGLP GGVVHLT GHAVGLS GHLTAGG GHSLGVP GHSTGLG GHTLVAP GHTVGAG GHVPGGA GHVTVLS

GGVHGLT GGVVLHA GHAVGLT GHLTAGP GHSLGVT GHSTGLP GHTLVAS GHTVGAP GHVPGGT GHVTVVA

GGVHLAG GGVVLHP GHAVGVP GHLTAGS GHSLVAG GHSTGLS GHTLVGA GHTVGAS GHVPGLA GHVTVVP

GGVHLAP GGVVLHT GHAVGVT GHLTAVG GHSLVAP GHSTGVA GHTLVGG GHTVGGA GHVPGLG GHVVAGP

GGVHLAS GHAGSLV GHAVLGG GHLTA P GHSLVAS GHSTGVP GHTLVGP GHTVGGP GHVPGLS GHVVAGT

GGVHLAT GHALGGG GHAVLGP GHLTAVS GHSLVAT GHSTLAG GHTLVGS GHTVGLA GHVPGLT GHVVALG

GGVHLGA GHALGGP GHAVLGS GHLTGAG GHSLVGA GHSTLAP GHTLVVA GHTVGLG GHVPGVA GHVVALP

GGVHLGP GHALGGS GHAVLGT GHLTGAP GHSLVGP GHSTLAS GHTLVVG GHTVGLP GHVPGVT GHVVALS

GGVHLGT GHALGGT GHAVLVG GHLTGAS GHSLVGT GHSTLGA GHTLVVP GHTVGLS GHVPLAG GHVVALT

GGVHLVA GHALGVG GHAVL P GHLTGGA GHSLVVA GHSTLGG GHTLVVS GHTVGVA GHVPLAS GHVVAVP

GGVHLVP GHALGVP GHAVLVS GHLTGGG GHSLVVP GHSTLGP GHTPAGG GHTVGVP GHVPLAT GHVVAVT

GGVHLVT GHALGVS GHAVLVT GHLTGGP GHSLVVT GHSTLGS GHTPAGS GHTVLAG GHVPLGA GHVVGAP

GGVHVAP GHALGVT GHAVVGP GHLTGGS GHSPAGG GHSTLVA GHTPALG GHTVLAP GHVPLGG GHVVGAT

GGVHVAT GHALVGG GHAVVGT GHLTGVA GHSPAGS GHSTLVG GHTPALS GHTVLAS GHVPLGS GHVVGLA

GGVHVLA GHALVGP GHAVVLG GHLTG G GHSPAGT GHSTLVP GHTPAVG GHTVLGA GHVPLGT GHVVGLP

GGVHVLP GHALVGS GHAVVLP GHLTGVP GHSPALG GHSTLVS GHTPAVS GHTVLGG GHVPLVA GHVVGLT

GGVHVLT GHAL GT GHAVVLS GHLTG S GHSPALS GHSTVAG GHTPGAG GHTVLGP GHVPLVG GHVVLAG

GGVLAHG GHAL VG GHAVVLT GHLT AG GHSPALT GHSTVAP GHTPGAS GHTVLGS GHVPLVS GHVVLAP

GGVLAHP GHAL VP GHAVVVP GHLTVAP GHSPAVG GHSTVAS GHTPGGA GHTVLVA GHVPLVT GHVVLAS

GGVLAHS GHAL VS GHAVVVT GHLT AS GHSPAVS GHSTVGA GHTPGGG GHTVLVG GHVPVAG GHVVLAT

GGVLAHT GHALVVT GHGFSFV GHLTVGA GHSPAVT GHSTVGP GHTPGGS GHTVLVP GHVPVAS GHVVLGA

GGVLGHA GHAPGGG GHGFSVF GHLTVGG GHSPGAG GHSTVLA GHTPGLA GHTVLVS GHVPVAT GHVVLGP

GGVLGHP GHAPGGS GHGGPSV GHLTVGP GHSPGAS GHSTVLG GHTPGLG GHTVVAG GHVPVGA GHVVLGT

GGVLGHT GHAPGGT GHGGSEV GHLTVGS GHSPGAT GHSTVLP GHTPGLS GHTVVAP GHVPVGT GHVVLVA

GGVLHAG GHAPGLG GHGGSKV GHLTVVA GHSPGGA GHSTVLS GHTPGVA GHTVVAS GHVPVLA GHVVLVP

GGVLHAP GHAPGLS GHLAGGG GHLTVVG GHSPGGT GHSTVVA GHTPGVG GHTVVGA GHVPVLG GHVVLVT

GGVLHAS GHAPGLT GHLAGGP GHLTVVP GHSPGLA GHSTVVP GHTPGVS GHTVVGP GHVPVLS GHVVVAP

GGVLHAT GHAPG G GHLAGGS GHLTVVS GHSPGLG GHSVAGP GHTPLAG GHTVVLA GHVPVLT GHVVVAT

GGVLHGA GHAPG S GHLAGGT GHLVAGG GHSPGLS GHSVAGT GHTPLAS GHTVVLG GHVPVVA GHVVVLA GHVVVLP GSAPHGG GSHLAGS GSHTAGP GSLHGGA GSLVVHA GSSSLHP GSTLGHA GSVALHS GSVTHLS

GHVVVLT GSAPHGS GSHLAGT GSHTAGS GSLHGGP GSLVVHP GSSSLHT GSTLGHG GSVALHT GSVTHVA

GIGGAFV GSAPHGT GSHLAVG GSHTALG GSLHGGT GSLVVHT GSSTAHG GSTLGHP GSVAVHP GSVTHVP

GIGGGVR GSAPHLG GSHLAVP GSHTALP GSLHGVA GSSAGHP GSSTAHP GSTLGHS GSVAVHT GSVTLHA

GIGMSYV GSAPHLS GSHLAVS GSHTALS GSLHGVP GSSAGHT GSSTAHS GSTLHAG GSVHAGP GSVTLHG

GIG SSG GSAPHLT GSHLAVT GSHTAVG GSLHGVT GSSAHGP GSSTGHA GSTLHAP GSVHAGT GSVTLHP

GIGQSSV GSAPHVG GSHLGAG GSHTAVP GSLHVAG GSSAHGT GSSTGHP GSTLHAS GSVHALG GSVTLHS

GIGYTSI GSAPHVS GSHLGAP GSHTAVS GSLHVAP GSSAHLG GSSTHAG GSTLHGA GSVHALP GSVTVHA

GIMGSSV GSAPHVT GSHLGAS GSHTGAG GSLHVAS GSSAHLP GSSTHAP GSTLHGG GSVHALS GSVTVHP

GIVGSSW GSAPLHG GSHLGAT GSHTGAP GSLHVAT GSSAHLS GSSTHAS GSTLHGP GSVHALT GSVVAHP

GKFGSSQ GSAPLHS GSHLGGA GSHTGAS GSLHVGA GSSAHLT GSSTHGA GSTLHGS GSVHAVP GSVVAHT

GKGASSP GSAPLHT GSHLGGP GSHTGGA GSLHVGP GSSAHVP GSSTHGP GSTLHVA GSVHAVT GSVVHAP

GKGGYVW GSAPVHG GSHLGGT GSHTGGP GSLHVGT GSSAHVT GSSTHLA GSTLHVG GSVHGAP GSVVHAT

GKGPRGQ GSAPVHS GSHLGVA GSHTGLA GSLHVVA GSSALHG GSSTHLG GSTLHVP GSVHGAT GSVVHLA

GKNGKSV GSAPVHT GSHLGVP GSHTGLG GSLHVVP GSSALHP GSSTHLP GSTLHVS GSVHGLA GSVVHLP

GKNGMSM GSASGHP GSHLGVT GSHTGLP GSLHVVT GSSALHS GSSTHLS GSTLVHA GSVHGLP GSVVHLT

GKWHSSQ GSASGHT GSHLVAG GSHTGLS GSLPAHG GSSALHT GSSTHVA GSTLVHG GSVHGLT GSVVLHA

GLAGSSV GSASHGP GSHLVAP GSHTGVA GSLPAHS GSSAVHP GSSTHVP G STL VHP GSVHLAG GSVVLHP

GLDGNSV GSASHGT GSHLVAS GSHTGVP GSLPAHT GSSAVHT GSSTLHA GSTLVHS GSVHLAP GSVVLHT

GLGASSK GSASHLG GSHLVAT GSHTLAG GSLPGHA GSSHAGP GSSTLHG GSTPAHG GSVHLAS GTAHGGG

GLGAS N GSASHLP GSHLVGA GSHTLAP GSLPGHG GSSHAGT GSSTLHP GSTPAHS GSVHLAT GTAHGGP

GLGGSSP GSASHLS GSHLVGP GSHTLAS GSLPGHS GSSHALG GSSTLHS GSTPGHA GSVHLGA GTAHGGS

GLIGSDV GSASHLT GSHLVGT GSHTLGA GSLPGHT GSSHALP GSSTVHA GSTPGHG GSVHLGP GTAHGLG

GLISSSV GSASHVP GSHLVVA GSHTLGG GSLPHAG GSSHALS GSSTVHP GSTPGHS GSVHLGT GTAHGLP

GLQGNSQ GSASHVT GSHLVVP GSHTLGP GSLPHAS GSSHALT GSSVAHP GSTPHAG GSVHLVA GTAHGLS

GLWHSSL GSASLHG GSHLVVT GSHTLGS GSLPHAT GSSHAVP GSSVAHT GSTPHAS GSVHLVP GTAHGVG

GMGFSST GSASLHP GSHPAGG GSHTLVA GSLPHGA GSSHAVT GSSVHAP GSTPHGA GSVHLVT GTAHGVP

GMGNGDV GSASLHS GSHPAGS GSHTLVG GSLPHGG GSSHGAP GSSVHAT GSTPHGG GSVHVAP GTAHGVS

GMWGVSV GSASLHT GSHPAGT GSHTLVP GSLPHGS GSSHGAT GSSVHLA GSTPHGS GSVHVAT GTAHLGG

GNGGYSN GSASVHP GSHPALG GSHTLVS GSLPHGT GSSHGLA GSSVHLP GSTPHLA GSVHVLA GTAHLGP

GNGPLSV GSASVHT GSHPALS GSHTVAG GSLPHVA GSSHGLP GSSVHLT GSTPHLG GSVHVLP GTAHLGS

GNGRSSV GSATGHG GSHPALT GSHTVAP GSLPHVG GSSHGLT GSSVLHA GSTPHLS GSVHVLT GTAHLVG

GNGVSST GSATGHP GSHPAVG GSHTVAS GSLPHVS GSSHLAG GSSVLHP GSTPHVA GSVLAHG GTAHLVP

GNMIFSV GSATGHS GSHPAVS GSHTVGA GSLPHVT GSSHLAP GSSVLHT GSTPHVG GSVLAHP GTAHLVS

GNTGSAV GSATHGG GSHPAVT GSHTVGP GSLPVHA GSSHLAS GSTAGHG GSTPHVS GSVLAHS GTAHVGG

GPGGDNV GSATHGP GSHPGAG GSHTVLA GSLPVHG GSSHLAT G STAG HP GSTPLHA GSVLAHT GTAHVGP

GPGGEAV GSATHGS GSHPGAS GSHTVLG GSLPVHS GSSHLGA GSTAGHS GSTPLHG GSVLGHA GTAHVGS

GPGGSSV GSATHLG GSHPGAT GSHTVLP GSLPVHT GSSHLGP GSTAHGG GSTPLHS GSVLGHP GTAHVLG

GPGGVSD GSATHLP GSHPGGA GSHTVLS GSLSAHG GSSHLGT GSTAHGP GSTPVHA GSVLGHT GTAHVLP

GPGISSE GSATHLS GSHPGGT GSHTVVA GSLSAHP GSSHLVA GSTAHGS GSTPVHG GSVLHAG GTAHVLS

GPGPVSD GSATHVG GSHPGLA GSHTVVP GSLSAHS GSSHLVP GSTAHLG GSTPVHS GSVLHAP GTAHVVG

GPNGSSV GSATHVP GSHPGLG GSHVAGP GSLSAHT GSSHLVT GSTAHLP GSTSAHG GSVLHAS GTAHVVP

GPQDSSI GSATHVS GSHPGLS GSHVAGT GSLSGHA GSSHVAP GSTAHLS GSTSAHP GSVLHAT GTAHVVS

GQGDSMI GSATLHG GSHPGLT GSHVALG GSLSGHP GSSHVAT GSTAHVG GSTSAHS GSVLHGA GTALGHG

GQGGYSF GSATLHP GSHPGVA GSHVALP GSLSGHT GSSHVLA GSTAHVP GSTSGHA GSVLHGP GTALGHP

GQGWYSP GSATLHS GSHPGVT GSHVALS GSLSHAG GSSHVLP GSTAHVS GSTSGHP GSVLHGT GTALGHS

GRANRSV GSATVHG GSHPLAG GSHVALT GSLSHAP GSSHVLT GSTALHG GSTSHAG GSVLHVA GTALHGG

GREGPSV GSATVHP GSHPLAS GSHVAVP GSLSHAS GSSLAHG GSTALHP GSTSHAP GSVLHVP GTALHGP

GRGGKSI GSATVHS GSHPLAT GSHVAVT GSLSHAT GSSLAHP GSTALHS GSTSHAS GSVLHVT GTALHGS

GRGGQSV GSAVGHP GSHPLGA GSHVGAP GSLSHGA GSSLAHS GSTAVHG GSTSHGA GSVLVHA GTALHVG

GRGGSSN GSAVGHT GSHPLGG GSHVGAT GSLSHGP GSSLAHT GSTAVHP GSTSHGP GSVLVHP GTALHVP

GRGGSSV GSAVHGP GSHPLGS GSHVGLA GSLSHGT GSSLGHA GSTAVHS GSTSHLA GSVLVHT GTALHVS

GRGTSLV GSAVHGT GSHPLGT GSHVGLP GSLSHVA GSSLGHP GSTHAGG GSTSHLG GSVPAHG GTALVHG

GRVHASY GSAVHLG GSHPLVA GSHVGLT GSLSHVP GSSLGHT GSTHAGP GSTSHLP GSVPAHS GTALVHP

GSAHGGP GSAVHLP GSHPLVG GSHVLAG GSLSHVT GSSLHAG GSTHAGS GSTSHLS GSVPAHT GTALVHS

GSAHGGT GSAVHLS GSHPLVS GSHVLAP GSLSVHA GSSLHAP GSTHALG GSTSHVA GSVPGHA GTAPGHG

GSAHGLG GSAVHLT GSHPLVT GSHVLAS GSLSVHP GSSLHAS GSTHALP GSTSHVP GSVPGHT GTAPGHS

GSAHGLP GSAVHVP GSHPVAG GSHVLAT GSLSVHT GSSLHAT GSTHALS GSTSLHA GSVPHAG GTAPHGG

GSAHGLS GSAVHVT GSHPVAS GSHVLGA GSLTAHG GSSLHGA GSTHAVG GSTSLHG GSVPHAS GTAPHGS

GSAHGLT GSAVLHG GSHPVAT GSHVLGP GSLTAHP GSSLHGP GSTHAVP GSTSLHP GSVPHAT GTAPHLG

GSAHGVP GSAVLHP GSHPVGA GSHVLGT GSLTAHS GSSLHGT GSTHAVS GSTSLHS GSVPHGA GTAPHLS

GSAHGVT GSAVLHS GSHPVGT GSHVLVA GSLTGHA GSSLHVA GSTHGAG GSTSVHA GSVPHGT GTAPHVG

GSAHLGG GSAVLHT GSHPVLA GSHVLVP GSLTGHG GSSLHVP GSTHGAP GSTSVHP GSVPHLA GTAPHVS

GSAHLGP GSAVVHP GSHPVLG GSHVLVT GSLTGHP GSSLHVT GSTHGAS GSTVAHG GSVPHLG GTAPLHG

GSAHLGS GSAVVHT GSHPVLS GSHVVAP GSLTGHS GSSLVHA GSTHGGA GSTVAHP GSVPHLS GTAPLHS

GSAHLGT GSFGKNV GSHPVLT GSHVVAT GSLTHAG GSSLVHP GSTHGGP GSTVAHS GSVPHLT GTAPVHG

GSAHLVG GSFGSNV GSHPVVA GSHVVLA GSLTHAP GSSLVHT GSTHGLA GSTVGHA GSVPHVA GTAPVHS

GSAHLVP GSGGLML GSHPVVT GSHVVLP GSLTHAS GSSPAHG GSTHGLG GSTVGHP GSVPHVT GTASGHG

GSAHLVS GSGGSSV GSHSAGP GSHVVLT GSLTHGA GSSPAHS GSTHGLP GSTVHAG GSVPLHA GTASGHP

GSAHLVT GSGMSST GSHSAGT GSLAGHG GSLTHGG GSSPAHT GSTHGLS GSTVHAP GSVPLHG GTASGHS

GSAHVGP GSGTSSV GSHSALG G SLAG HP GSLTHGP GSSPGHA GSTHGVA GSTVHAS GSVPLHS GTASHGG

GSAHVGT GSHAGGP GSHSALP GSLAGHS GSLTHGS GSSPGHT GSTHGVP GSTVHGA GSVPLHT GTASHGP

GSAHVLG GSHAGGT GSHSALS GSLAGHT GSLTHVA GSSPHAG GSTHLAG GSTVHGP GSVPVHA GTASHGS

GSAHVLP GSHAGLG GSHSALT GSLAHGG GSLTHVG GSSPHAS GSTHLAP GSTVHLA GSVPVHT GTASHLG

GSAHVLS GSHAGLP GSHSAVP GSLAHGP GSLTHVP GSSPHAT GSTHLAS GSTVHLG GSVSAHP GTASHLP

GSAHVLT GSHAGLS GSHSAVT GSLAHGS GSLTHVS GSSPHGA GSTHLGA GSTVHLP GSVSAHT GTASHLS

GSAHVVP GSHAGLT GSHSGAP GSLAHGT GSLTVHA GSSPHGT GSTHLGG GSTVHLS GSVSHAP GTASHVG

GSAHVVT GSHAGVP GSHSGAT GSLAHVG GSLTVHG GSSPHLA GSTHLGP GSTVHVA GSVSHAT GTASHVP

GSALGHG GSHAGVT GSHSGLA GSLAHVP GSLTVHP GSSPHLG GSTHLGS GSTVHVP GSVSHLA GTASHVS

GSALGHP GSHALGG GSHSGLP GSLAHVS GSLTVHS GSSPHLS GSTHLVA GSTVLHA GSVSHLP GTASLHG

GSALGHS GSHALGP GSHSGLT GSLAHVT GSLVAHG GSSPHLT GSTHLVG GSTVLHG GSVSHLT GTASLHP

GSALGHT GSHALGS GSHSLAG GSLAVHG GSLVAHP GSSPHVA GSTHLVP GSTVLHP GSVSLHA GTASLHS

GSALHGG GSHALGT GSHSLAP G SLA VHP GSLVAHS GSSPHVT GSTHLVS GSTVLHS GSVSLHP GTASVHG

GSALHGP GSHALVG GSHSLAS GSLAVHS GSLVAHT GSSPLHA GSTHVAG GSTVVHA GSVSLHT GTASVHP

GSALHGS GSHALVP GSHSLAT GSLAVHT GSLVGHA GSSPLHG GSTHVAP GSTVVHP GSVTAHG GTASVHS

GSALHGT GSHALVS GSHSLGA GSLHAGG GSLVGHP GSSPLHS GSTHVAS GSVAGHP GSVTAHP GTAVGHG

GSALHVG GSHALVT GSHSLGP GSLHAGP GSLVGHT GSSPLHT GSTHVGA GSVAGHT GSVTAHS GTAVGHP

GSALHVP GSHAVGP GSHSLGT GSLHAGS GSLVHAG GSSPVHA GSTHVGP GSVAHGP GSVTGHA GTAVGHS

GSALHVS GSHAVGT GSHSLVA GSLHAGT GSLVHAP GSSPVHT GSTHVLA GSVAHGT GSVTGHP GTAVHGG

GSALHVT GSHAVLG GSHSLVP GSLHAVG GSLVHAS GSSSAHP GSTHVLG GSVAHLG GSVTHAG GTAVHGP

GSALVHG GSHAVLP GSHSLVT GSLHAVP GSLVHAT GSSSAHT GSTHVLP GSVAHLP GSVTHAP GTAVHGS

GSALVHP GSHAVLS GSHSVAP GSLHAVS GSLVHGA GSSSHAP GSTHVLS GSVAHLS GSVTHAS GTAVHLG

GSALVHS GSHAVLT GSHSVAT GSLHAVT GSLVHGP GSSSHAT GSTHVVA GSVAHLT GSVTHGA GTAVHLP

GSALVHT GSHAVVP GSHSVLA GSLHGAG GSLVHGT GSSSHLA GSTHVVP GSVAHVP GSVTHGP GTAVHLS

GSAPGHG GSHAVVT GSHSVLP GSLHGAP GSLVHVA GSSSHLP GSTLAHG GSVAHVT GSVTHLA GTAVHVG

GSAPGHS GSHLAGG GSHSVLT GSLHGAS GSLVHVP GSSSHLT GSTLAHP GSVALHG GSVTHLG GTAVHVP

GSAPGHT GSHLAGP GSHTAGG GSLHGAT GSLVHVT GSSSLHA GSTLAHS GSVALHP GSVTHLP GTAVHVS GTAVLHG GTHSAGG GTLHAGP GTSAHVP GTSSGHA GTVHVLG GVDSFSM GVSGSSW HAGVNYI HDGHSQM

GTAVLHP GTHSAGP GTLHAGS GTSAH S GTSSGHP GTVHVLP GVETSSV GVSISSV HAGVSST HDGHSSE

GTAVLHS GTHSAGS GTLHAVG GTSALHG GTSSHAG GTVHVLS GVFGDVI GVSMHSA HAGVSSV HDGISSV

GTAVVHG GTHSALG GTLHAVP GTSALHP GTSSHAP GTVHVVA GVFGSSK GVSTSSV HAGWDSK HDGKHMV

GTAVVHP GTHSALP GTLHAVS GTSALHS GTSSHAS GTVHVVP GVFHSSI GVTGFLE HAGYRSN HDGKKSV

GTAVVHS GTHSALS GTLHGAG GTSAVHG GTSSHGA GTVLAHG G GASSG GVTGISV HAGYSQV HDGKSHI

GTGESST GTHSAVG GTLHGAP GTSA HP GTSSHGP GTVLAHP GVGASSL GVTGKSV HAHGGFP HDGKSSS

GTGGNYW GTHSA P GTLHGAS GTSAVHS GTSSHLA GTVLAHS GVGASSV GVTGRKV HAHGSMP HDGLSIV

GTGGSNV GTHSAVS GTLHGGA GTSHAGG GTSSHLG GTVLGHA G GDYSA GVVLDAV HAHGYSV HDGLSSV

GTHAGGG GTHSGAG GTLHGGG GTSHAGP GTSSHLP GTVLGHG GVGEFSV GVVLSSR HAHRPSP HDGNWNV

GTHAGGP GTHSGAP GTLHGGP GTSHAGS GTSSHLS GTVLGHP GVGESSV GVVVKEW HAIGYLV HDGPKVI

GTHAGGS GTHSGAS GTLHGGS GTSHALG GTSSH A GTVLGHS GVGFKSV GVVYYSV HALGHHN HDGQIIV

GTHAGLG GTHSGGA GTLHGVA GTSHALP GTSSHVP GTVLHAG GVGFSPV GVWNSAV HALGSAV HDGQSLV

GTHAGLP GTHSGGP GTLHGVG GTSHALS GTSSLHA GTVLHAP GVGFSSV GVWSSDK HALGSSS HDGQSVV

GTHAGLS GTHSGLA GTLHGVP GTSHAVG GTSSLHG GTVLHAS GVGFTSV G YGASV HALGSTV HDGQVSY

GTHAGVG GTHSGLG GTLHGVS GTSHA P GTSSLHP GTVLHGA GVGGAHG GVYGSSL HALYTLV HDGRSLE

GTHAGVP GTHSGLP GTLHVAG GTSHAVS GTSSLHS GTVLHGG GVGGASV GVYLSSV HAMFIPV HDGRSTI

GTHAGVS GTHSGLS GTLHVAP GTSHGAG GTSSVHA GTVLHGP GVGGDSP GVYNSSQ HAMGSSA HDGSSSV

GTHALGG GTHSGVA GTLHVAS GTSHGAP GTSS HP GTVLHGS GVGGGAW GWGGSLV HAMIYAT HDGTSSV

GTHALGP GTHSG P GTLHVGA GTSHGAS GTSVAHG GTVLHVA GVGGGEI GWGGSSV HAMTQSV HDGVGVV

GTHALGS GTHSLAG GTLHVGG GTSHGGA GTSVAHP GTVLHVG GVGGHSS GWGLSSV HANFAST HDGVSGM

GTHALVG GTHSLAP GTLHVGP GTSHGGP GTSVAHS GTVLHVP GVGGKQM GWMISSQ HANGPSV HDGWSSL

GTHAL P GTHSLAS GTLHVGS GTSHGLA GTSVGHA GTVLHVS GVGGLVP GWQGESK HANMSFV HDGWSST

GTHALVS GTHSLGA GTLHVVA GTSHGLG GTSVGHP GTVLVHA GVGGNSI GYGEWSG HANRSSV HDGWSSV

GTHAVGG GTHSLGG GTLHVVG GTSHGLP GTSVHAG GTVLVHG GVGGNSV GYGGSMV HAPFSSF HDGYSDV

GTHAVGP GTHSLGP GTLHVVP GTSHGLS GTSVHAP GTVLVHP GVGGQSS GYGIASR HAPFSSQ HDHGQKV

GTHAVGS GTHSLGS GTLHVVS GTSHGVA GTSVHAS GTVLVHS G GGRAT GYGRVSV HAPKWSH HDHGYYV

GTHAVLG GTHSLVA GTLPAHG GTSHGVP GTSVHGA GTVPAHG GVGGSEM GYGSDDV HAQGSST HDHNSQV

GTHAVLP GTHSLVG GTLPAHS GTSHLAG GTSVHGP GTVPAHS GVGGSER GYMGYAQ HAQNNSV HDHPISV

GTHAVLS GTHSL P GTLPGHA GTSHLAP GTSVHLA GTVPGHA GVGGSLH GYWVSPV HAQNQAN HDIASQV

GTHAVVG GTHSLVS GTLPGHG GTSHLAS GTSVHLG GTVPGHG GVGGSLV HAAGSSW HAQYSHV HDIGSQV

GTHAVVP GTHS AG GTLPGHS GTSHLGA GTSVHLP GTVPGHS GVGGSMH HAAQSMV HASGDAL HDIHYSV

GTHAVVS GTHSVAP GTLPHAG GTSHLGG GTSVHLS GTVPHAG GVGGSMN HADGSQG HASGSSV HDITSSD

GTHLAGG GTHS AS GTLPHAS GTSHLGP GTSVHVA GTVPHAS GVGGSNV HADMTSQ HATFSSA HDLGDSY

GTHLAGP GTHSVGA GTLPHGA GTSHLGS GTSVHVP GTVPHGA GVGGSPV HADNSTV HATGKSV HDLGIGV

GTHLAGS GTHSVGP GTLPHGG GTSHLVA GTSVLHA GTVPHGG GVGGSSE HADWSHV HATISEV HDLGLSY

GTHLA G GTHSVLA GTLPHGS GTSHLVG GTSVLHG GTVPHGS GVGGSSF HAEFQHV HATKKDV HDLGVHI

GTHLAVP GTHSVLG GTLPHVA GTSHLVP GTSVLHP GTVPHLA GVGGSSK HAEGSSV HATNHSP HDLQNGD

GTHLAVS GTHSVLP GTLPHVG GTSHLVS GTSVLHS GTVPHLG GVGGSSL HAEISSV HATQTYY HDMGESV

GTHLGAG GTHSVLS GTLPHVS GTSHVAG GTSVVHA GTVPHLS GVGGSSS HAEWSSV HATRVSH HDMGKSE

GTHLGAP GTHSVVA GTLPVHA GTSHVAP GTS VHP GTVPHVA GVGGSSV HAFGSDP HA AHSV HDMGVSP

GTHLGAS GTHSVVP GTLPVHG GTSHVAS GTTGSSV GTVPHVG GVGGTSV HAFGSSV HA GSLV HDMHSSV

GTHLGGA GTHVAGG GTLPVHS GTSHVGA GTVAGHG GTVPHVS GVGGVDV HAFGTGP HAWGSKD HDMKPSG

GTHLGGG GTHVAGP GTLSAHG GTSHVGP GTVAGHP GTVPLHA GVGGVNV HAFMSSV HAWGSLV HDMMESR

GTHLGGP GTHVAGS GTLSAHP GTSHVLA GTVAGHS GTVPLHG GVGGWFV HAFQQSL HAWIQSM HDMNSEG

GTHLGGS GTHVALG GTLSAHS GTSHVLG GTVAHGG GTVPLHS GVGGYSV HAGASNF HAWTPSQ HDNGSSP

GTHLGVA GTHVALP GTLSGHA GTSHVLP GTVAHGP GTVPVHA GVGHSSN HAGDSGG HAYPSAF HDNMMSV

GTHLGVG GTHVALS GTLSGHG GTSHVLS GTVAHGS GTVPVHG G GIDTW HAGDSPV HDAGGSG HDNWSHE

GTHLGVP GTHVAVG GTLSGHP GTSHVVA GTVAHLG GTVPVHS GVGLPVM HAGDSSV HDDGKSV HDQESSV

GTHLGVS GTHVAVP GTLSGHS GTSHVVP GTVAHLP GTVSAHG GVGMASV HAGDTSY HDDPEQR HDQGISV

GTHLVAG GTHVAVS GTLSHAG GTSLAHG GTVAHLS GTVSAHP GVGMEHR HAGEEFN HDEFIYV HDQGSSL

GTHLVAP GTHVGAG GTLSHAP GTSLAHP GTVAHVG GTVSAHS GVGMHSR HAGFDIQ HDEGSAV HDQKPAV

GTHLVAS GTHVGAP GTLSHAS GTSLAHS GTVAHVP GTVSGHA GVGNIAL HAGFSSV HDETSSV HDSGSSV

GTHL GA GTHVGAS GTLSHGA GTSLGHA GTVAHVS GTVSGHP GVGNSSV HAGGASV HDEWGSV HDSKGSY

GTHLVGG GTHVGGA GTLSHGG GTSLGHG GTVALHG GTVSHAG GVGNSSY HAGGAVL HDFGRSV HDTGRSL

GTHLVGP GTHVGGP GTLSHGP GTSLGHP GTVALHP GTVSHAP GVGNYVM HAGGDSA HDFGSSQ HDTHKSV

GTHLVGS GTHVGLA GTLSHGS GTSLGHS GTVALHS GTVSHAS GVGQKQA HAGGESV HDFGWSS HDTISSV

GTHLVVA GTHVGLG GTLSHVA GTSLHAG GTVAVHG GTVSHGA GVGQLSV HAGGFSS HDFRSSW HDTMFSV

GTHLVVG GTHVGLP GTLSHVG GTSLHAP GTVAVHP GTVSHGP GVGRISV HAGGHQV HDGAHPV HDVGQMV

GTHLVVP GTHVGLS GTLSHVP GTSLHAS GTVAVHS GTVSHLA GVGSDHV HAGGHSV HDGEHSD HDVGSSV

GTHLVVS GTHVGVA GTLSHVS GTSLHGA GTVHAGG GTVSHLG GVGSSNV HAGGKSV HDGESSV HDVWAEP

GTHPAGG GTHVGVP GTLSVHA GTSLHGG GTVHAGP GTVSHLP GVGSSSI HAGGLSG HDGFSST HDVWNYV

GTHPAGS GTHVLAG GTLSVHG GTSLHGP GTVHAGS GTVSHLS GVGSSSV HAGGLSV HDGGASA HDWNFTE

GTHPALG GTHVLAP GTLSVHP GTSLHGS GTVHALG GTVSHVA GVGTSPV HAGGPLV HDGGDSV HDWTSSH

GTHPALS GTHVLAS GTLSVHS GTSLHVA GTVHALP GTVSHVP GVGVSMV HAGGQSV HDGGESE HDYGQSF

GTHPA G GTHVLGA GTLVAHG GTSLHVG GTVHALS GTVSLHA GVGVSSV HAGGQSY HDGGFSQ HDYGSAQ

GTHPA S GTHVLGG GTLVAHP GTSLHVP GTVHAVG GTVSLHG GVGVVKL HAGGRSI HDGGFSV HEAGKSK

GTHPGAG GTHVLGP GTLVAHS GTSLHVS GTVHA P GTVSLHP GVHKSSV HAGGSHV HDGGGGV HEAGSNF

GTHPGAS GTHVLGS GTLVGHA GTSLVHA GTVHAVS GTVSLHS GVHLVPF HAGGSKV HDGGGSM HEAGSNI

GTHPGGA GTHVLVA GTLVGHG GTSLVHG GTVHGAG GTVSVHA GVIDSKN HAGGSLV HDGGGSV HEAGSNL

GTHPGGG GTHVLVG GTLVGHP GTSL HP GTVHGAP GTVSVHP GVIGGYV HAGGSQA HDGGHSR HEAGSNV

GTHPGGS GTHVL P GTLVGHS GTSLVHS GTVHGAS GTVVAHG GVIGSQV HAGGSQM HDGGIGV HEAGSQF

GTHPGLA GTHVLVS GTLVHAG GTSPAHG GTVHGGA GTVVAHP GVIKSSL HAGGSSA HDGGLSM HEAGSQI

GTHPGLG GTHVVAG GTLVHAP GTSPAHS GTVHGGP GTVVAHS GVIPNSL HAGGSSE HDGGPGV HEAGSQL

GTHPGLS GTHVVAP GTLVHAS GTSPGHA GTVHGLA GTVVGHA GVLGSEM HAGGSSH HDGGPSL HEAGSQV

GTHPGVA GTHVVAS GTLVHGA GTSPGHG GTVHGLG GTVVGHP GVLGSEN HAGGSSM HDGGPSV HEAGSSF

GTHPGVG GTHVVGA GTLVHGG GTSPGHS GTVHGLP GTVVHAG GVLPSSV HAGGSST HDGGRDV HE AG SSI

GTHPGVS GTHVVGP GTLVHGP GTSPHAG GTVHGLS GTVVHAP GVLRSSY HAGGSSV HDGGRSV HE AG SSL

GTHPLAG GTHVVLA GTLVHGS GTSPHAS GTVHGVA GTVVHAS GVLVSKD HAGGSVL HDGGSFM HEAGSSV

GTHPLAS GTHVVLG GTLVHVA GTSPHGA GTVHG P GTVVHGA GVMGSSS HAGGVDF HDGGSFV HEAGSTF

GTHPLGA GTHVVLP GTLVHVG GTSPHGG GTVHLAG GTVVHGP GVMGSTQ HAGGVEV HDGGSKI HEAGSTI

GTHPLGG GTHVVLS GTLVHVP GTSPHGS GTVHLAP GTVVHLA G NAEAS HAGGYSL HDGGSNV HE AG STL

GTHPLGS GTHVVVA GTLVHVS GTSPHLA GTVHLAS GTVVHLG GVNAGSV HAGGYYV HDGGSSF HEAGSTV

GTHPLVA GTHVVVP GTLVVHA GTSPHLG GTVHLGA GTVVHLP GVNGSEV HAGIDYV HDGGSSH HEAGSYF

GTHPLVG GTLAGHG GTLVVHG GTSPHLS GTVHLGG GTVVHLS GVNRSLV HAGKGSH HDGGSSL HEAGSYI

GTHPLVS GTLAGHP GTLVVHP GTSPHVA GTVHLGP GTVVHVA GVPESYL HAGKIMH HDGGSSP HEAGSYL

GTHPVAG GTLAGHS GTL VHS GTSPHVG GTVHLGS GTVVHVP GVPFSST HAGKSSV HDGGSSQ HEAGSYV

GTHPVAS GTLAHGG GTSAGHG GTSPHVS GTVHLVA GTVVLHA G PGRGA HAG LAS HDGGSSV HEAGTNF

GTHP GA GTLAHGP GTSAGHP GTSPLHA GTVHLVG GTVVLHG GVPGSSA HAGLSSV HDGGSSY HEAGTNI

GTHPVGG GTLAHGS GTSAGHS GTSPLHG GTVHLVP GTVVLHP GVPGSSV HAGMSSR HDGGSTV HEAGTNL

GTHPVGS GTLAHVG GTSAHGG GTSPLHS GTVHLVS GTVVLHS GVPGTSV HAGPLSV HDGGSYV HEAGTNV

GTHPVLA GTLAHVP GTSAHGP GTSPVHA GTVHVAG GTVVVHA GVPRSME HAGPSKE HDGGTSV HEAGTQF

GTHPVLG GTLAHVS GTSAHGS GTSPVHG GTVHVAP GTVVVHP GVQGFSV HAGPSSV HDGGVSV HEAGTQI

GTHPVLS GTLAVHG GTSAHLG GTSPVHS GTVHVAS GVAEGSV GVQGSHV HAGRPYV HDGGYSV HEAGTQL

GTHPVVA GTLAVHP GTSAHLP GTSSAHG GTVHVGA G AGRKV GVQHSGV HAGRRSV HDGHASV HEAGTQV

GTHPVVG GTLAVHS GTSAHLS GTSSAHP GTVHVGP GVDDQSV GVSGDSV HAGSYHF HDGHQSV HEAGTSF

GTHPVVS GTLHAGG GTSAHVG GTSSAHS GTVHVLA GVDMSSV GVSGSPV HAGVILV HDGHSPV HEAGTSI HEAGTSL HEAPTQL HEASSTF HEAYKSV HEGGTYI HEGPTNI HEGSSNL HEGTTTI HESGTTI HESPTSI

HEAGTSV HEAPTQV HEASSTI HEAYNF HEGGTYL HEGPTNL HEGSSNV HEGTTTL HESGTTL HESPTSL

HEAGTTF HEAPTSF HEASSTL HEAYNI HEGGTYV HEGPTNV HEGSSQF HEGTTTV HESGTTV HESPTSV

HEAGTTI HEAPTSI HEASSTV HEAYNL HEGGVIV HEGPTQF HEGSSQI HEGTTV HESGTVV HESPTTF

HEAGTTL HEAPTSL HEASSV HEAYNV HEGGWSV HEGPTQI HEGSSQL HEGTTYF HESGTYF HESPTTI

HEAGTTV HEAPTSV HEASSYF HEAYQF HEGGYAV HEGPTQL HEGSSQV HEGTTYI HESGTYI HESPTTL

HEAGTYF HEAPTTF HEASSYI HEAYQI HEGHNPH HEGPTQV HEGSSSF HEGTTYL HESGTYL HESPTTV

HEAGTYI HEAPTTI HEASSYL HEAYQL HEGHSVV HEGPTSF HEGSSSI HEGTTYV HESGTYV HESPTYF

HEAGTYL HEAPTTL HEASSYV HEAYQV HEGKEEW HEGPTSI HEGSSSL HEGTYF HESNNF HESPTYI

HEAGTYV HEAPTTV HEASTF HEAYSF HEGMSGV HEGPTSL HEGSSSV HEGTYI HESNNI HESPTYL

HEAITSV HEAPTYF HEASTI HEAYSI HEGMSSV HEGPTSV HEGSSTF HEGTYL HESNNL HESPTYV

HEANNF HEAPTYI HEASTL HEAYSL HEGMSYV HEGPTTF HEGSSTI HEGTYV HESNNV HESQNF

HEANNI HEAPTYL HEASTNF HEAYSV HEGNNF HEGPTTI HEGSSTL HEGVSYV HESNQF HESQNI

HEANNL HEAPTYV HEASTNI HEAYTF HEGNNI HEGPTTL HEGSSTV HEGWFSG HESNQI HESQNL

HEANNV HEAQNF HEASTNL HEAYTI HEGNNL HEGPTTV HEGSSV HEGWSPV HESNQL HESQNV

HEANQF HEAQNI HEASTNV HEAYTL HEGNNV HEGPTYF HEGSSYF HEGWSSV HESNQV HESQQF

HEANQI HEAQNL HEASTQF HEAYTV HEGNQF HEGPTYI HEGSSYI HEGYKTV HESNSF HESQQI

HEANQL HEAQNV HEASTQI HEAYWMV HEGNQI HEGPTYL HEGSSYL HEGYNF HESNSI HESQQL

HEANQV HEAQQF HEASTQL HEAYYF HEGNQL HEGPTYV HEGSSYV HEGYNI HESNSL HESQQV

HEANSF HEAQQI HEASTQV HEAYYI HEGNQV HEGQNF HEGSTF HEGYNL HESNSNF HESQSF

HEANSI HEAQQL HEASTSF HEAYYL HEGNSF HEGQNI HEGSTI HEGYNV HESNSNI HESQSI

HEANSL HEAQQV HEASTSI HEAYYV HEGNSI HEGQNL HEGSTL HEGYQF HESNSNL HESQSL

HEANSNF HEAQSF HEASTSL HEDGSSK HEGNSKV HEGQNV HEGSTNF HEGYQI HESNSNV HESQSNF

HEANSNI HEAQSI HEASTSV HEDGSSV HEGNSL HEGQQF HEGSTNI HEGYQL HESNSQF HESQSNI

HEANSNL HEAQSL HEASTTF HEDISTV HEGNSNF HEGQQI HEGSTNL HEGYQV HESNSQI HESQSNL

HEANSNV HEAQSNF HEASTTI HEDRWSL HEGNSNI HEGQQL HEGSTNV HEGYSF HESNSQL HESQSNV

HEANSQF HEAQSNI HEASTTL HEEGSSN HEGNSNL HEGQQV HEGSTQF HEGYSGV HESNSQV HESQSQF

HEANSQI HEAQSNL HEASTTV HEENPSV HEGNSNV HEGQSF HEGSTQI HEGYSI HESNSSF HESQSQI

HEANSQL HEAQSNV HEASTV HEFADSI HEGNSQF HEGQSI HEGSTQL HEGYSL HESNSSI HESQSQL

HEANSQV HEAQSQF HEASTYF HEFGSSS HEGNSQI HEGQSL HEGSTQV HEGYSV HESNSSL HESQSQV

HEANSSF HEAQSQI HEASTYI HEGASSR HEGNSQL HEGQSNF HEGSTSF HEGYTF HESNSSV HESQSSF

HEANSSI HEAQSQL HEASTYL HEGDKGV HEGNSQV HEGQSNI HEGSTSI HEGYTI HESNSTF HESQSSI

HEANSSL HEAQSQV HEASTYV HEGDSFV HEGNSSF HEGQSNL HEGSTSL HEGYTL HESNSTI HESQSSL

HEANSSV HEAQSSF HEASYF HEGDSSV HEGNSSI HEGQSNV HEGSTSV HEGYTV HESNSTL HESQSSV

HEANSTF HEAQSSI HEASYI HEGELSH HEGNSSL HEGQSQF HEGSTTF HEGYYF HESNSTV HESQSTF

HEANSTI HEAQSSL HEASYL HEGFRSV HEGNSSV HEGQSQI HEGSTTI HEGYYI HESNSV HESQSTI

HEANSTL HEAQSSV HEASYV HEGFSSV HEGNSTF HEGQSQL HEGSTTL HEGYYL HESNSYF HESQSTL

HEANSTV HEAQSTF HEATNF HEGFSTV HEGNSTI HEGQSQV HEGSTTV HEGYYV HESNSYI HESQSTV

HEANSV HEAQSTI HEATNI HEGGASE HEGNSTL HEGQSSF HEGSTV HEHAFQN HESNSYL HESQSV

HEANSYF HEAQSTL HEATNL HEGGASP HEGNSTV HEGQSSI HEGSTYF HEHGISL HESNSYV HESQSYF

HEANSYI HEAQSTV HEATNV HEGGDSS HEGNSV HEGQSSL HEGSTYI HEHQISF HESNTF HESQSYI

HEANSYL HEAQSV HEATQF HEGGDSV HEGNSYF HEGQSSV HEGSTYL HEHRSHN HESNTI HESQSYL

HEANSYV HEAQSYF HEATQI HEGGESV HEGNSYI HEGQSTF HEGSTYV HEIGSSW HESNTL HESQSYV

HEANTF HEAQSYI HEATQL HEGGGSA HEGNSYL HEGQSTI HEGSVST HEIHWLP HESNTNF HESQTF

HEANTI HEAQSYL HEATQV HEGGGSV HEGNSYV HEGQSTL HEGSYF HEILTSV HESNTNI HESQTI

HEANTL HEAQSYV HEATSF HEGGIFV HEGNTF HEGQSTV HEGSYI HEIMASV HESNTNL HESQTL

HEANTNF HEAQTF HEATSI HEGGKSV HEGNTI HEGQSV HEGSYL HEKGSAV HESNTNV HESQTNF

HEANTNI HEAQTI HEATSL HEGGKSY HEGNTL HEGQSVV HEGSYV HEKGSST HESNTQF HESQTNI

HEANTNL HEAQTL HEATSNF HEGGNSV HEGNTNF HEGQSYF HEGTNF HELAWSD HESNTQI HESQTNL

HEANTNV HEAQTNF HEATSNI HEGGRFM HEGNTNI HEGQSYI HEGTNI HELNSSV HESNTQL HESQTNV

HEANTQF HEAQTNI HEATSNL HEGGRGN HEGNTNL HEGQSYL HEGTNL HEMASSV HESNTQV HESQTQF

HEANTQI HEAQT L HEATSNV HEGGRSS HEGNTNV HEGQSYV HEGTNQV HEMGSSN HESNTSF HESQTQI

HEANTQL HEAQTNV HEATSQF HEGGSFV HEGNTQF HEGQTF HEGTNV HEMVPKV HESNTSI HESQTQL

HEANTQV HEAQTQF HEATSQI HEGGSGV HEGNTQI HEGQTI HEGTQF HENFNVV HESNTSL HESQTQV

HEANTSF HEAQTQI HEATSQL HEGGSNF HEGNTQL HEGQTL HEGTQI HENGFSV HESNTSV HESQTSF

HEANTSI HEAQTQL HEATSQV HEGGSNI HEGNTQV HEGQTNF HEGTQL HENGLSV HESNTTF HESQTSI

HEANTSL HEAQTQV HEATSSF HEGGSNL HEGNTSF HEGQTNI HEGTQV HENGSSV HESNTTI HESQTSL

HEANTSV HEAQTSF HEATSSI HEGGSNV HEGNTSI HEGQTNL HEGTSF HENMSQV HESNTTL HESQTSV

HEANTTF HEAQTSI HEATSSL HEGGSPV HEGNTSL HEGQTNV HEGTSI HENNSNI HESNTTV HESQTTF

HEANTTI HEAQTSL HEATSSV HEGGSQF HEGNTSV HEGQTQF HEGTSL HENWENH HESNTV HESQTTI

HEANTTL HEAQTSV HEATSTF HEGGSQI HEGNTTF HEGQTQI HEGTSNF HEPGSDV HESNTYF HESQTTL

HEANTTV HEAQTTF HEATSTI HEGGSQL HEGNTTI HEGQTQL HEGTSNI HEPGSSM HESNTYI HESQTTV

HEANTV HEAQTTI HEATSTL HEGGSQV HEGNTTL HEGQTQV HEGTSNL HEPLAIV HESNTYL HESQTV

HEANTYF HEAQTTL HEATSTV HEGGSSF HEGNTTV HEGQTSF HEGTSNV HEQGNSV HESNTYV HESQTYF

HEANTYI HEAQTTV HEATSV HEGGSSI HEGNTV HEGQTSI HEGTSQF HESGSNF HESNYF HESQTYI

HEANTYL HEAQTV HEATSYF HEGGSSL HEGNTYF HEGQTSL HEGTSQI HESGSNI HESNYI HESQTYL

HEANTYV HEAQTYF HEATSYI HEGGSSM HEGNTYI HEGQTSV HEGTSQL HESGSNL HESNYL HESQTYV

HEANYF HEAQTYI HEATSYL HEGGSSP HEGNTYL HEGQTTF HEGTSQV HESGSNV HESNYV HESQYF

HEANYI HEAQTYL HEATSYV HEGGSSV HEGNTYV HEGQTTI HEGTSSF HESGSQF HESPSNF HESQYI

HEANYL HEAQTYV HEATTF HEGGSTF HEGNYF HEGQTTL HEGTSSI HESGSQI HESPSNI HESQYL

HEANYV HEAQYF HEATTI HEGGSTI HEGNYI HEGQTTV HEGTSSL HESGSQL HESPSNL HESQYV

HEAPSNF HEAQYI HEATTL HEGGSTL HEGNYL HEGQTV HEGTSSV HESGSQV HESPSNV HESSNF

HEAPSNI HEAQYL HEATTNF HEGGSTV HEGNYV HEGQTYF HEGTSTF HESGSSF HESPSQF HESSNI

HEAPSNL HEAQYV HEATTNI HEGGSVW HEGPRSV HEGQTYI HEGTSTI HESGSSI HESPSQI HESSNL

HEAPSNV HEASNF HEATTNL HEGGSYF HEGPSKM HEGQTYL HEGTSTL HESGSSL HESPSQL HESSNV

HEAPSQF HEASNI HEATTNV HEGGSYI HEGPSKT HEGQTYV HEGTSTV HESGSSV HESPSQV HESSQF

HEAPSQI HEASNL HEATTQF HEGGSYL HEGPSNF HEGQYF HEGTSV HESGSTF HESPSSF HESSQI

HEAPSQL HEASNV HEATTQI HEGGSYV HEGPSNI HEGQYI HEGTSYF HESGSTI HESPSSI HESSQL

HEAPSQV HEASQF HEATTQL HEGGTMV HEGPSNL HEGQYL HEGTSYI HESGSTL HESPSSL HESSQV

HEAPSSF HEASQI HEATTQV HEGGTNF HEGPSNV HEGQYV HEGTSYL HESGSTV HESPSSV HESSSF

HEAPSSI HEASQL HEATTSF HEGGTNI HEGPSQF HEGRIAS HEGTSYV HESGSYF HESPSTF HESSSI

HEAPSSL HEASQV HEATTSI HEGGTNL HEGPSQI HEGRSSF HEGTTF HESGSYI HESPSTI HESSSL

HEAPSSV HEASSF HEATTSL HEGGTNV HEGPSQL HEGRSSV HEGTTI HESGSYL HESPSTL HESSSNF

HEAPSTF HEASSI HEATTSV HEGGTQF HEGPSQV HEGSKSV HEGTTL HESGSYV HESPSTV HESSSNI

HEAPSTI HEASSL HEATTTF HEGGTQI HEGPSSF HEGSNF HEGTTNF HESGTNF HESPSYF HESSSNL

HEAPSTL HEASS F HEATTTI HEGGTQL HEGPSSI HEGSNI HEGTTNI HESGTNI HESPSYI HESSSNV

HEAPSTV HEASSNI HEATTTL HEGGTQV HEGPSSL HEGSNL HEGTTNL HESGTNL HESPSYL HESSSQF

HEAPSYF HEASSNL HEATTTV HEGGTSF HEGPSSV HEGSNV HEGTTNV HESGTNV HESPSYV HESSSQI

HEAPSYI HEASSNV HEATTV HEGGTSG HEGPSTF HEGSQF HEGTTQF HESGTQF HESPTNF HESSSQL

HEAPSYL HEASSQF HEATTYF HEGGTSI HEGPSTI HEGSQI HEGTTQI HESGTQI HESPTNI HESSSQV

HEAPSYV HEASSQI HEATTYI HEGGTSL HEGPSTL HEGSQL HEGTTQL HESGTQL HESPTNL HESSSSF

HEAPTNF HEASSQL HEATTYL HEGGTSV HEGPSTV HEGSQV HEGTTQV HESGTQV HESPTNV HESSSSI

HEAPTNI HEASSQV HEATTYV HEGGTTF HEGPSYF HEGSSF HEGTTSF HESGTSF HESPTQF HESSSSL

HEAPTNL HEASSSF HEATYF HEGGTTI HEGPSYI HEGSSI HEGTTSI HESGTSI HESPTQI HESSSSV

HEAPTNV HEASSSI HEATYI HEGGTTL HEGPSYL HEGSSL HEGTTSL HESGTSL HESPTQL HESSSTF

HEAPTQF HEASSSL HEATYL HEGGTTV HEGPSYV HEGSSNF HEGTTSV HESGTSV HESPTQV HESSSTI

HEAPTQI HEASSSV HEATYV HEGGTYF HEGPTNF HEGSSNI HEGTTTF HESGTTF HESPTSF HESSSTL HESSSTV HESYNV HFGTSNV HGGTSSD HHGGSNF HIFMSSF HIYGQSI HKWGSSM HLMESSP HMGREGD

HESSSV HESYQF HFGVNTR HGGVSKS HHGGSQR HIFYNIV HIYGSAS HKWGTDV HLMGDQE HMGRGHM

HESSSYF HESYQI HFGWSSP HGGVSSV HHGGSQV HIGAADV HKAGSSV HKWYSSV HLMLFGV HMGSSSY

HESSSYI HESYQL HFHEGMV HGGVYLV HHGGSSI HIGADSV HKANSDI HKYGKAT HLNGESV HMGSYLE

HESSSYL HESYQV HFHGSQI HGGWSMT HHGGSSK HIGATSS HKDESSV HKYGSSN HLNYSSS HMGTSEF

HESSSYV HESYSF HFIGEDG HGGYDHV HHGGSSN HIGDEHV HKDGSSV HKYGSSV HLPGGQV HMGTSGV

HESSTF HESYSI HFIGPSV HGGYSSA HHGGSSV HIGDWSG HKDKNSL HKYSSSN HLPGVSV HMGTSST

HESSTI HESYSL HFIGSSK HGGYVMV HHGGSTI HIGDYDV HKDNSSE HLADIIV HLPHRST HMGVDSR

HESSTL HESYSV HFISSSV HGGYYDV HHGGSYF HIGEIGS HKDVSSV HLANSSH HLPMNKV HMGVQSV

HESSTNF HESYTF HFKMRSV HGHDISV HHGGTSV HIGESSV HKEGSSV HLANVSV HLPPSLP HMGYHFV

HESSTNI HESYTI HFLGSHV HGHFPSK HHGGVSF HIGFISS HKFGGSV HLARSSV HLQKSHA HMGYLSV

HESSTNL HESYTL HFLGSSV HGHGGSV HHGGVSV HIGFSSA HKFGSIV HLDASIV HLQLVSV HMGYSSV

HESSTNV HESYTV HFMGSFV HGIGPSL HHGGWDL HIGGALV HKFGSSV HLDGQSL HLRNSSV HMHLSSV

HESSTQF HESYYF HFMGSSE HGIHSKG HHGGWSR HIGGAST HKFNEDV HLDGSPH HLSGFDM HMHNWSV

HESSTQI HESYYI HFMGSSV HGKGTSV HHGGYAW HIGGDDA HKGANLR HLEFWSI HLSGFNN HMIFFSV

HESSTQL HESYYL HFMGSYY HGLDKPV HHGGYMD HIGGDFV HKGAYSV HLEGSND HLSGSDW HMIGDSN

HESSTQV HESYYV HFMKSSG HGLGPSN HHGGYSV HIGGDSV HKGFSSH HLEGSSE HLSGSSV HMIGSSH

HESSTSF HETGSIW HFNQSIV HGLGSFP HHGHHMV HIGGESM HKGFSSK HLEGSSV HLSSSGV HMIYLSV

HESSTSI HETGSSW HFPGFEV HGLLVST HHGHSSV HIGGFDI HKGGDSQ HLEGYSP HLTGQSV HMLGNSV

HESSTSL HE GTSV HFPSYSV HGMMSLR HHGIPST HIGGGDQ HKGGESV HLFASSV HLTLIPP HMLGSTF

HESSTSV HEVLASH HFQASYV HGNGPMR HHGISIS HIGGGNM HKGGFEV HLGAQSV HLVFSSV HMMDSSM

HESSTTF HE MKAV HFQGSHV HGNKSSV HHGISLV HIGGHSV HKGGFSV HLGASPV HLVGSPV HMMGSLV

HESSTTI HEVMSEV HFQSQHV HGNPESV HHGISQV HIGGLKV HKGGGSH HLGDSKI HLVGSTK HMMGWHY

HESSTTL HEVRSSV HFRGWSV HGNTSSV HHGKSSA HIGGPSW HKGGHGA HLGEDFV HLWGS R HMMVDFS

HESSTTV HEVSSSQ HFSGRSV HGPGFHV HHGKSSV HIGGQSS HKGGNPQ HLGFEHV HLWGSSV HMNGFAG

HESSTV HEVYSSV HFSGSSV HGPGFSM HHGLQSV HIGGSDV HKGGPTL HLGFNSM HLWTSLG HMNTSGG

HESSTYF HEWSSRV HFVEQSY HGPGSQV HHGMHSH HIGGSEV HKGGQAV HLGFSSV HLWVSSV HM TSSV

HESSTYI HEYDSSQ HFVPDSS HGPTFSV HHGMSMV HIGGSHD HKGGQGV HLGGASV HLYASSV HMPGAKV

HESSTYL HEYHETD HFWGDSL HGPVSAV HHGNLIV HIGGSNR HKGGRSF HLGGDNG HLYEQSV HMPGDSV

HESSTYV HEYISSI HGAASSV HGPWESV HHGNSSV HIGGSNV HKGGSAF HLGGEMV HLYGSSV HMPGSMV

HESSYF HFAGWSV HGAFPSV HGPWGNV HHGPDSV HIGGSSG HKGGSAV HLGGESV HLYLLSW HMQGLSV

HESSYI HFAPSSW HGDGLIF HGQDNSV HHGPSSV HIGGSSK HKGGSEV HLGGFPF HLYRFSV HMQWASL

HESSYL HFASWAV HGDGSSR HGQLPVV HHGQTSP HIGGSSM HKGGSHV HLGGHGV HMADSSV HMRGISV

HESSYV HFAYSQV HGDIYQT HGSFSNV HHGRDNV HIGGSSP HKGGSKV HLGGHSP HMAGHDV HMSGHSV

HESTNF HFDDSSP HGDYSSV HGSGSNM HHGRSSV HIGGSSQ HKGGSMN HLGGHVV HMAGTSV HMSRSSV

HESTNI HFDGQSF HGEGSSV HGSGSSD HHGSESV HIGGSSS HKGGSPV HLGGISS HMAIGSV HMTGSHV

HESTNL HFDLSSV HGEWTMD HGSGSST HHGSLSV HIGGSST HKGGSQV HLGGKSV HMDIAIQ HMTGSPV

HESTNV HFEGISV HGFA QW HGSGSSV HHGSQEF HIGGSSV HKGGSSS HLGGLSS HMEGSMV HMTGSSP

HESTQF HFEGSSD HGGAS V HGSPFIV HHGVSFM HIGGSSY HKGGSSV HLGGLSV HMEGSSS HMTGSSV

HESTQI HFESKSV HGGAYS HGSPSST HHGVSSV HIGGSTV HKGGSSY HLGGPSQ HMEGSSV HMTGTSE

HESTQL HFFGISV HGGDGST HGTGASV HHGWSHT HIGGSYH HKGGTST HLGGQSV HMFGQSE HMTLEDK

HESTQV HFFGKKV HGGDLNV HGTGSSK HHGWSYV HIGGVSF HKGGVSV HLGGSED HMFGSSV HMTWSSK

HESTSF HFFGSEI HGGDQSE HGTGSSN HHIGASM HIGGYSV HKGGWTV HLGGSEV HMFRSSV HMVAKYE

HESTSI HFFLSSH HGGDSSV HGTKSQV HHIGSKV HIGHTYL HKGGYNV HLGGSFV HMGAAMK HMVDSSV

HESTSL HFFNSSG HGGESTV HGVDSSE HHILVKV HIGHVAM HKGGYSP HLGGSHV HMGDQQV HMVFWSW

HESTSNF HFFQTSV HGGFSVL HG GSST HHLISQV HIGKLSV HKGGYSV HLGGSKV HMGESPV HMVGIQV

HESTSNI HFFVHSV HGGGAGV HGVGTSW HHLRVKS HIGKSPW HKGHQSV HLGGSMV HMGESSK HMVGLSR

HESTSNL HFGAAFV HGGGASY HGVTSVD HHMHHSV HIGLGIV HKGHSNW HLGGSQK HMGFGSN HM GLSV

HESTSNV HFGASSV HGGGDST HGVYSDV HHM KSS HIGLSLS HKGHSSW HLGGSQV HMGFNSY HMVGNMV

HESTSQF HFGASYK HGGGEIR HGWGSSV HHNGSQV HIGLSSM HKGKSSS HLGGSSF HMGGAHL HMVGWSV

HESTSQI HFGDKSV HGGGENE HGWGTDT HHNGSSV HIGLSSN HKGNSGV HLGGSSG HMGGAMV HMVMSFK

HESTSQL HFGESSV HGGGESA HGYGSQR HHNMSPI HIGMSSI HKGNSSV HLGGSSH HMGGASV HMWGHDT

HESTSQV HFGFHVV HGGGESH HGYGSSL HH PASSE HIGNNGV HKGPKSV HLGGSSV HMGGEAH HMWGPSI

HESTSSF HFGFSSW HGGGGHW HGYGSSV HHPGSFL HIGNSSV HKGPNSR HLGGSVH HMGGESH HMWGVSV

HESTSSI HFGGAMP HGGGGSR HGYNWQS HHPPSTG HIGRDLY HKGQSSV HLGGSYQ HMGGGKD HMYGAGV

HESTSSL HFGGASM HGGGHDE HGYPGNK HHPQSGV HIGRSTV HKGRSIE HLGGTSV HMGGGSV HMYGSNV

HESTSSV HFGGDPV HGGGIAQ HGYQSGL HHPWISE HIGTIVV HKG AKA HLGGVLV HMGGHSV HMYLPMV

HESTSTF HFGGDSW HGGGISW HHAGIQL HHQGSSK HIGVNVV HKGWSSV HLGGVSV HMGGKSV HMYQKHF

HESTSTI HFGGENV HGGGNSV HHAGSST HHQHSVV HIGVSPV HKGYDSV HLGGWQD HMGGMSW HNAGSNF

HESTSTL HFGGHLP HGGGNSW HHAMISV HHQRDSE HIGWSSH HKHGSSV HLGGWSV HMGGNSA HNAGSNI

HESTSTV HFGGHSV HGGGPSV HHAWSSS HHQRNHH HIGWSSK HKHVSVE HLGGYAV HMGGRSV HNAGSNL

HESTSV HFGGIKL HGGGQAK HHDPKSV HHQTFSG HIGYNSV HKIMITV HLGGYQP HMGGSAV HNAGSNV

HESTSYF HFGGISR HGGGRSV HHEAPSL HHSGASV HIGYSSF HKIVSGV HLGGYSV HMGGSDE HNAGSQF

HESTSYI HFGGISV HGGGSAA HHEFSFV HHSGRHQ HIGYSSV HKLASSV HLGHQFS HMGGSDN HNAGSQI

HESTSYL HFGGPMW HGGGSDV HHEGSFV HHSGSDV HIHGEFE HKLAYSV HLGHRSV HMGGSDV HNAGSQL

HESTSYV HFGGRLD HGGGSFV HHEGSSV HHSGSIV HIHGRPV HKLGFHE HLGHSSV HMGGSEV HNAGSQV

HESTTF HFGGSEA HGGGSKV HHEWSLV HHSGSLW HIHGSMD HKLGQSF HLGISQV HMGGSGP HNAGSSF

HESTTI HFGGSEH HGGGSSF HHFGLSV HHSGYSI HIHGSSA HKLISLD HLGKISP HMGGSIR HNAGSSI

HESTTL HFGGSEV HGGGSSG HHFKISI HHSQSPV HIHGSSV HKLNSSV HLGKSHR HMGGSIT HNAGSSL

HESTTNF HFGGSHL HGGGSSK HHFLLSV HHSQSSL HIHNISQ HKLPGQY HLGLSSP HMGGSKV HNAGSSV

HESTTNI HFGGSIV HGGGSSN HHFLSNY HHSSSPV HIIGSMV HKMGSDV HLGLSSV HMGGSLG HNAGSTF

HESTTIML HFGGSLV HGGGSSV HHFRGSQ HHTGVSV HIIGSSV HKNGAS HLGMSSV HMGGSMY HNAGSTI

HESTTNV HFGGSMV HGGGSSY HHGANSG HHTQSST HIIGWEV HKNGFSV HLGM AV HMGGSNV HNAGSTL

HESTTQF HFGGSSE HGGGSTN HHGASDV HHVASID HIIGWLV HKNGQSV HLGQRIM HMGGSPI HNAGSTV

HESTTQI HFGGSSQ HGGGSYR HHGASEV HHVGFPD HIIHWDF HKNGSSV HLGQSSG HMGGSQQ HNAGSVV

HESTTQL HFGGSST HGGGSYV HHGDEQV HHVGSGS HIIPSSS HKNKDSR HLGQSSV HMGGSSM HNAGSYF

HESTTQV HFGGSSV HGGGTHV HHGDQQV HHVGYSV HIIPSSV HKNVWSH HLGRSTV HMGGSSV HNAGSYI

HESTTSF HFGGSSY HGGGVAP HHGDSFV HHWGSSE HIIWSSK HKNYSKV HLGSESD HMGGSTV HNAGSYL

HESTTSI HFGGTIS HGGGVER HHGDSSK HHWGSSV HILAQSN HKQGPKY HLGSSSP HMGGTEE HNAGSYV

HESTTSL HFGGVDV HGGHNSV HHGESGV HHWMYEF HILDSYM HKQGWSV HLGSSSV HMGGTMW HNAGTGV

HESTTSV HFGGWSV HGGHSSV HHGFFSV HHWNRIV HILTSKY HKQISSH HLGSSTV HMGGTPF HNAGTNF

HESTTTF HFGGYDV HGGIKSV HHGGDHL HHYGSSV HIMGQSM HKSDESV HLGSTFK HMGGVSH HNAGTNI

HESTTTI HFGGYLV HGGILLV HHGGDKL HHYGTHV HINGSSV HKSGFSR HLGVSAV HMGGWVK HNAGTNL

HESTTTL HFGHESA HGGISSV HHGGDSV HHYLPSV HIQGSSV HKSGSSD HLGVSSV HMGGYHV HNAGTNV

HESTTTV HFGHSSN HGGKNPD HHGGEAV HHYMSSN HIQKDDV HKSGSTV HLGWSSQ HMGGYMI HNAGTQF

HESTTV HFGHSSV HGGKYSV HHGGEQV HHYYSSM HISGFGV HKTGSSV HLGYLQV HMGGYSI HNAGTQI

HESTTYF HFGHSYP HGGLQSE HHGGFSH HIAGSEM HISGNLY HKTGSYH HLGYSSD HMGHASV HNAGTQL

HESTTYI HFGIDSV HGGMGSY HHGGHPV HIAHSDN HISLVSQ HKTRSWV HLGYSSV HMGLGMV HNAGTQV

HESTTYL HFGLSSV HGGMLSV HHGGHSM HIDGSEV HISMSSV HKTVYSI HLHGSNV HMGLSSV HNAGTSF

HESTTYV HFGNRTV HGGMSMV HHGGIFV HIDGSSV HITEHAN HKVASSI HLHNHVV HMGNSNQ HNAGTSI

HESTYF HFGPQSM HGGNFPV HHGGISV HIDNSAV HITGNMV HKVGDNV HLHTSSM HMGPDSS HNAGTSL

HESTYI HFGQQSV HGGNSNV HHGGIVV HIEGSGL HIVMYSV HKVGSSG HLIGSSR HMGPESD HNAGTSV

HESTYL HFGQSVS HGGQSAV HHGGNSV HIEGSSP HIVVSSV HKVLSSV HLIGVSV HMGPSVV HNAGTTF

HESTYV HFGRSQE HGGRSAE HHGGREV HIEGVHV HIVYSSH HKVPFSV HLIHITG HMGQSLN HNAGTTI

HESYNF HFGSSEF HGGRSIV HHGGSDI HIELDSA HIWGSMV HKWAHSV HLIHSSH HMGQSSV HNAGTTL

HESYNI HFGSSSV HGGSNSL HHGGSDP HIFASSV HIWGSQV HKWGFYV HLLASSV HMGQVPV HNAGTTV

HESYNL HFGTHSV HGGTHGP HHGGSHV HIFDGSV HIWGSVI HKWGSSL HLLSSVV HMGQYEV HNAGTYF HNAGTYI HNAPTTL HNASSYV HNAYQV HNGGYVR HNGPTNL HNGSSQF HNGTTTF HNSNNL HNSPTYV

HNAGTYL HNAPTTV HNASTF HNAYSF HNGHSMP HNGPTNV HNGSSQI HNGTTTI HNSNNV HNSQNF

HNAGTYV HNAPTYF HNASTI HNAYSI HNGITYM HNGPTQF HNGSSQL HNGTTTL HNSNQF HNSQNI

HNANNF HNAPTYI HNASTL HNAYSL HNGKLSK HNGPTQI HNGSSQV HNGTTTV HNSNQI HNSQNL

HNANNI HNAPTYL HNASTNF HNAYSV HNGKSAM HNGPTQL HNGSSSF HNGTTV HNSNQL HNSQNV

HNANNL HNAPTYV HNASTNI HNAYTF HNGKSVD HNGPTQV HNGSSSI HNGTTYF HNSNQV HNSQQF

HNANNV HNAQNF HNASTNL ΗΝΑΥΤΊ HNGLISV HNGPTSF HNGSSSL HNGTTYI HNSNSF HNSQQI

HNANQF HNAQNI HNASTNV HNAYTL HNGLSSM HNGPTSI HNGSSSV HNGTTYL HNSNSI HNSQQL

H A QI HNAQNL HNASTQF HNAYTV HNGLSSV HNGPTSL HNGSSTF HNGTTYV HNSNSL HNSQQV

HNANQL HNAQNV HNASTQI HNAYYF HNGMPKE HNGPTSV HNGSSTI HNGTYF HNSNSNF HNSQSF

HNANQV HNAQQF HNASTQL HNAYYI HNGMSGV HNGPTTF HNGSSTL HNGTYI HNSNSNI HNSQSI

HNANSF HNAQQI HNASTQV HNAYYL HNGMSSV HNGPTTI HNGSSTV HNGTYL HNSNSNL HNSQSL

H NAN SI HNAQQL HNASTSF HNAYYV HNGNNF HNGPTTL HNGSSV HNGTYV HNSNSNV HNSQSNF

HNANSL HNAQQV HNASTSI HNDGKSV HNGNNI HNGPTTV HNGSSYF HNGTYYS HNSNSQF HNSQSNI

HNANSNF HNAQSF HNASTSL HNDGSSH HNGNNL HNGPTYF HNGSSYI HNGVSSH HNSNSQI HNSQSNL

HNANSNI HNAQSI HNASTSV HNDMFSI HNGNNV HNGPTYI HNGSSYL HNGWPEV HNSNSQL HNSQSNV

HNANSNL HNAQSL HNASTTF HNEGSHV HNGNQF HNGPTYL HNGSSYV HNGWSTV HNSNSQV HNSQSQF

HNANSNV HNAQSNF HNASTTI HNEGSSI HNGNQI HNGPTYV HNGSTF HNGYNF HNSNSSF HNSQSQI

HNANSQF HNAQSNI HNASTTL HNEMSSV HNGNQL HNGQGSV HNGSTI HNGYNI HNSNSSI HNSQSQL

HNANSQI HNAQSNL HNASTTV HNETSST HNGNQV HNGQNF HNGSTL HNGYNL HNSNSSL HNSQSQV

HNANSQL HNAQSNV HNAST HNFASSV HNGNSF HNGQNI HNGSTNF HNGYNV HNSNSSV HNSQSSF

HNANSQV HNAQSQF HNASTYF HNFDSFV HNGNSI HNGQNL HNGSTNI HNGYQF HNSNSTF HNSQSSI

HNANSSF HNAQSQI HNASTYI HNFGLSM HNGNSL HNGQNV HNGSTNL HNGYQI HNSNSTI HNSQSSL

HNANSSI HNAQSQL HNASTYL HNFGQFL HNGNSNF HNGQQF HNGSTNV HNGYQL HNSNSTL HNSQSSV

HNANSSL HNAQSQV HNASTYV HNFIKSV HNGNSNI HNGQQI HNGSTQF HNGYQV HNSNSTV HNSQSTF

HNANSSV HNAQSSF HNASYF HNFMNSV HNGNSNL HNGQQL HNGSTQI HNGYSF HNSNSV HNSQSTI

HNANSTF HNAQSSI HNASYI HNFPQAV HNGNSNV HNGQQV HNGSTQL HNGYSI HNSNSYF HNSQSTL

HNANSTI HNAQSSL HNASYL HNGAAQV HNGNSQF HNGQSF HNGSTQV HNGYSL HNSNSYI HNSQSTV

HNANSTL HNAQSSV HNASYV HNGASEV HNGNSQI HNGQSI HNGSTSF HNGYSPV HNSNSYL HNSQSV

HNANSTV HNAQSTF HNATNF HNGASMV HNGNSQL HNGQSL HNGSTSI HNGYSV HNSNSYV HNSQSYF

HNANSV HNAQSTI HNATNI HNGASPG HNGNSQV HNGQSNF HNGSTSL HNGYTF HNSNTF HNSQSYI

HNANSYF HNAQSTL HNATNL HNGDSIV HNGNSSF HNGQSNI HNGSTSV HNGYTI HNSNTI HNSQSYL

HNANSYI HNAQSTV HNATNV HNGEFSP HNGNSSI HNGQSNL HNGSTTF HNGYTL HNSNTL HNSQSYV

HNANSYL HNAQSV HNATQF HNGESSP HNGNSSL HNGQSNV HNGSTTI HNGYTV HNSNTNF HNSQTF

HNANSYV HNAQSYF HNATQI HNGFSHV HNGNSSV HNGQSQF HNGSTTL HNGYYF HNSNTNI HNSQTI

HNANTF HNAQSYI HNATQL HNGGDNV HNGNSTF HNGQSQI HNGSTTV HNGYYI HNSNTNL HNSQTL

ΗΝΑΝΤΊ HNAQSYL HNATQV HNGGEST HNGNSTI HNGQSQL HNGSTV HNGYYL HNSNTNV HNSQTNF

HNANTL HNAQSYV HNATSF HNGGESV HNGNSTL HNGQSQV HNGSTYF HNGYYV HNSNTQF HNSQTNI

HNANTNF HNAQTF HNATSI HNGGGKV HNGNSTV HNGQSSF HNGSTYI HNHDSSV HNSNTQI HNSQTNL

HNANTNI HNAQTI HNATSL HNGGHQY HNGNSV HNGQSSI HNGSTYL HNHGSSV HNSNTQL HNSQTNV

HNANTNL HNAQTL HNATSNF HNGGHSV HNGNSYF HNGQSSL HNGSTYV HNHGWKM HNSNTQV HNSQTQF

HNANTNV HNAQTNF HNATSNI HNGGQVV HNGNSYI HNGQSSV HNGSYF HNHGYST HNSNTSF HNSQTQI

HNANTQF HNAQTNI HNATSNL HNGGRPW HNGNSYL HNGQSTF HNGSYI HNLGSFV HNSNTSI HNSQTQL

HNANTQI HNAQTNL HNATSNV HNGGRSI HNGNSYV HNGQSTI HNGSYL HNMGIEM HNSNTSL HNSQTQV

HNANTQL HNAQTNV HNATSQF HNGGRSK HNGNTF HNGQSTL HNGSYV HNMGSSG HNSNTSV HNSQTSF

HNANTQV HNAQTQF HNATSQI HNGGSHD HNGNTI HNGQSTV HNGTGSY HNMGSSV HNSNTTF HNSQTSI

HNANTSF HNAQTQI HNATSQL HNGGSHH HNGNTL HNGQSV HNGTHSK HNNGSSV HNSNTTI HNSQTSL

HNANTSI HNAQTQL HNATSQV HNGGSIN HNGNTNF HNGQSYF HNGTNF HNNHSSV HNSNTTL HNSQTSV

HNANTSL HNAQTQV HNATSSF HNGGSMV HNGNTNI HNGQSYI HNGTNI HNPGASV HNSNTTV HNSQTTF

HNANTSV HNAQTSF HNATSSI HNGGSNF HNGNTNL HNGQSYL HNGTNL HNPQHSV HNSNTV HNSQTTI

HNANTTF HNAQTSI HNATSSL HNGGSNI HNGNTNV HNGQSYV HNGTNV HNPRAPS HNSNTYF HNSQTTL

HNANTTI HNAQTSL HNATSSV HNGGSNL HNGNTQF HNGQTF HNGTQF HNQGSSQ HNSNTYI HNSQTTV

HNANTTL HNAQTSV HNATSTF HNGGSNV HNGNTQI HNGQTI HNGTQI HNQHFNV HNSNTYL HNSQTV

HNANTTV HNAQTTF HNATSTI HNGGSPL HNGNTQL HNGQTL HNGTQL HNQRSDV HNSNTYV HNSQTYF

HNANTV HNAQTTI HNATSTL HNGGSQF HNGNTQV HNGQTNF HNGTQV HNSFDFV HNSNYF HNSQTYI

HNANTYF HNAQTTL HNATSTV HNGGSQI HNGNTSF HNGQTNI HNGTSF HNSGSNF HNSNYI HNSQTYL

HNANTYI HNAQTTV HNATSV HNGGSQL HNGNTSI HNGQTNL HNGTSI HNSGSNI HNSNYL HNSQTYV

HNANTYL HNAQTV HNATSYF HNGGSQV HNGNTSL HNGQTNV HNGTSKV HNSGSNL HNSNYV HNSQYF

HNANTYV HNAQTYF HNATSYI HNGGSSE HNGNTSV HNGQTQF HNGTSL HNSGSNV HNSPSNF HNSQYI

HNANYF HNAQTYI HNATSYL HNGGSSF HNGNTTF HNGQTQI HNGTSMN HNSGSQF HNSPSNI HNSQYL

HNANYI HNAQTYL HNATSYV HNGGSSG HNGNTTI HNGQTQL HNGTSNF HNSGSQI HNSPSNL HNSQYV

HNANYL HNAQTYV HNATTF HNGGSSI HNGNTTL HNGQTQV HNGTSNI HNSGSQL HNSPSNV HNSSNF

HNANYV HNAQYF HNATTI HNGGSSL HNGNTTV HNGQTSF HNGTSNL HNSGSQV HNSPSQF HNSSNI

HNAPSNF HNAQYI HNATTL HNGGSSN HNGNTV HNGQTSI HNGTSNV HNSGSSF HNSPSQI HNSSNL

HNAPSNI HNAQYL HNATTNF HNGGSSR HNGNTYF HNGQTSL HNGTSQF HNSGSSI HNSPSQL HNSSNV

HNAPSNL HNAQYV HNATTNI HNGGSSS HNGNTYI HNGQTSV HNGTSQI HNSGSSL HNSPSQV HNSSQF

HNAPSNV HNASNF HNATTNL HNGGSSV HNGNTYL HNGQTTF HNGTSQL HNSGSSV HNSPSSF HNSSQI

HNAPSQF HNASNI HNATTNV HNGGSTF HNGNTYV HNGQTTI HNGTSQV HNSGSTF HNSPSSI HNSSQL

HNAPSQI HNASNL HNATTQF HNGGSTI HNGNYF HNGQTTL HNGTSSF HNSGSTI HNSPSSL HNSSQV

HNAPSQL HNASNV HNATTQI HNGGSTL HNGNYI HNGQTTV HNGTSSI HNSGSTL HNSPSSV HNSSSF

HNAPSQV HNASQF HNATTQL HNGGSTV HNGNYL HNGQTV HNGTSSL HNSGSTV HNSPSTF HNSSSI

HNAPSSF HNASQI HNATTQV HNGGSYD HNGNYV HNGQTYF HNGTSSS HNSGSYF HNSPSTI HNSSSL

HNAPSSI HNASQL HNATTSF HNGGSYF HNGPDNL HNGQTYI HNGTSSV HNSGSYI HNSPSTL HNSSSNF

HNAPSSL HNASQV HNATTSI HNGGSYI HNGPGFV HNGQTYL HNGTSTF HNSGSYL HNSPSTV HNSSSNI

HNAPSSV HNASSF HNATTSL HNGGSYL HNGPSHV HNGQTYV HNGTSTI HNSGSYV HNSPSYF HNSSSNL

HNAPSTF HNASSI HNATTSV HNGGSYV HNGPSNF HNGQYF HNGTSTL HNSGTNF HNSPSYI HNSSSNV

HNAPSTI HNASSL HNATTTF HNGGTNF HNGPSNI HNGQYI HNGTSTV HNSGTNI HNSPSYL HNSSSQF

HNAPSTL HNASSNF HNATTTI HNGGTNI HNGPSNL HNGQYL HNGTSV HNSGTNL HNSPSYV HNSSSQI

HNAPSTV HNASSNI HNATTTL HNGGTNL HNGPSNV HNGQYV HNGTSYF HNSGTNV HNSPTNF HNSSSQL

HNAPSYF HNASSNL HNATTTV HNGGTNV HNGPSQF HNGRSSV HNGTSYI HNSGTQF HNSPTNI HNSSSQV

HNAPSYI HNASSNV HNATTV HNGGTQF HNGPSQI HNGSHFE HNGTSYL HNSGTQI HNSPTNL HNSSSSF

HNAPSYL HNASSQF HNATTYF HNGGTQI HNGPSQL HNGSNF HNGTSYV HNSGTQL HNSPTNV HNSSSSI

HNAPSYV HNASSQI HNATTYI HNGGTQL HNGPSQV HNGSNI HNGTTF HNSGTQV HNSPTQF HNSSSSL

HNAPTNF HNASSQL HNATTYL HNGGTQV HNGPSSF HNGSNL HNGTTI HNSGTSF HNSPTQI HNSSSSV

HNAPTNI HNASSQV HNATTYV HNGGTSF HNGPSSI HNGSNV HNGTTL HNSGTSI HNSPTQL HNSSSTF

HNAPTNL HNASSSF HNATYF HNGGTSI HNGPSSL HNGSQF HNGTTNF HNSGTSL HNSPTQV HNSSSTI

HNAPTNV HNASSSI HNATYI HNGGTSL HNGPSSV HNGSQI HNGTTNI HNSGTSV HNSPTSF HNSSSTL

HNAPTQF HNASSSL HNATYL HNGGTSV HNGPSTF HNGSQL HNGTTNL HNSGTTF HNSPTSI HNSSSTV

HNAPTQI HNASSSV HNATYV HNGGTTF HNGPSTI HNGSQV HNGTTNV HNSGTTI HNSPTSL HNSSSV

HNAPTQL HNASSTF HNAYKSV HNGGTTI HNGPSTL HNGSSF HNGTTQF HNSGTTL HNSPTSV HNSSSYF

HNAPTQV HNASSTI HNAYNF HNGGTTL HNGPSTV HNGSSFK HNGTTQI HNSGTTV HNSPTTF HNSSSYI

HNAPTSF HNASSTL HNAYNI HNGGTTV HNGPSYF HNGSSI HNGTTQL HNSGTYF HNSPTTI HNSSSYL

HNAPTSI HNASSTV HNAYNL HNGGTYF HNGPSYI HNGSSL HNGTTQV HNSGTYI HNSPTTL HNSSSYV

HNAPTSL HNASSV HNAYNV HNGGTYI HNGPSYL HNGSSNF HNGTTSF HNSGTYL HNSPTTV HNSSTF

HNAPTSV HNASSYF HNAYQF HNGGTYL HNGPSYV HNGSSNI HNGTTSI HNSGTYV HNSPTYF HNSSTI

HNAPTTF HNASSYI HNAYQI HNGGTYV HNGPTNF HNGSSNL HNGTTSL HNSNNF HNSPTYI HNSSTL

HNAPTTI HNASSYL HNAYQL HNGGYSV HNGPTNI HNGSSNV HNGTTSV HNSNNI HNSPTYL HNSSTNF HNSSTNI HNSYTI HPLWSSV HQANSTL HQAQSSL HQASYL HQGGEEA HQGNSST HQGQSQI HQGSTTI

HNSSTNL HNSYTL HPMAASV HQANSTV HQAQSSV HQASYV HQGGEMV HQG SSV HQGQSQL HQGSTTL

HNSSTNV HNSYTV HPMGSVQ HQANSV HQAQSTF HQATNF HQGGHKV HQG STF HQGQSQV HQGSTTV

H SSTQF HNSYYF HPMSSSV HQANSYF HQAQSTI HQATNI HQGGHSH HQGNSTI HQGQSSF HQGSTV

H SSTQI HNSYYI HPNGYSV HQANSYI HQAQSTL HQATNL HQGGHSI HQGNSTL HQGQSSI HQGSTYF

H SSTQL HNSYYL HPNHSEV HQANSYL HQAQSTV HQATNV HQGGKGQ HQG STV HQGQSSL HQGSTYI

HNSSTQV HNSYYV HPNMSSV HQANSYV HQAQSV HQATQF HQGGLTV HQG SV HQGQSSV HQGSTYL

H SSTSF HNTGHSV HPQGDHV HQANTF HQAQSYF HQATQI HQGGNSV HQG SYF HQGQSTF HQGSTYV

HNSSTSI HNTGSLV HPQGPSV HQANTI HQAQSYI HQATQL HQGGQET HQGNSYI HQGQSTI HQGSYF

H SSTSL HNTGSTV HPQGSEW HQANTL HQAQSYL HQATQV HQGGQSF HQGNSYL HQGQSTL HQGSYI

HNSSTSV HNVGETV HPQGSSV HQANTNF HQAQSYV HQATSF HQGGSDV HQG SYV HQGQSTV HQGSYL

HNSSTTF H GSAW HPRKEEV HQANTNI HQAQTF HQATSI HQGGSNF HQGNTF HQGQSV HQGSYV

HNSSTTI HNWYNSF HPSGKKV HQANTNL HQAQTI HQATSL HQGGSNI HQGNTI HQGQSYF HQGTNF

HNSSTTL HNYGKSV HPSGSYV HQANTNV HQAQTL HQATSNF HQGGSNL HQG TL HQGQSYI HQGTNI

HNSSTTV HNYGRSV HPSGWSV HQANTQF HQAQTNF HQATSNI HQGGSNV HQGNTNF HQGQSYL HQGTNL

HNSSTV HNYGSSS HPSPSSV HQANTQI HQAQTNI HQATSNL HQGGSPV HQGNTNI HQGQSYV HQGTNV

H SSTYF HPAGHEV HPSVSEV HQANTQL HQAQTNL HQATSNV HQGGSQF HQGNTNL HQGQTF HQGTQF

HNSSTYI HPAGSDI HPTSLSI HQANTQV HQAQTNV HQATSQF HQGGSQI HQG TNV HQGQTI HQGTQI

H SSTYL HPAGSSV HPTVSVV HQANTSF HQAQTQF HQATSQI HQGGSQL HQG TQF HQGQTL HQGTQL

HNSSTYV HPAWSST HPVGRSV HQANTSI HQAQTQI HQATSQL HQGGSQV HQGNTQI HQGQTNF HQGTQV

HNSSYF HPDGSSV HPVGSQV HQANTSL HQAQTQL HQATSQV HQGGSSD HQG TQL HQGQTNI HQGTSF

HNSSYI HPESFFG HPVISFV HQANTSV HQAQTQV HQATSSF HQGGSSE HQGNTQV HQGQTNL HQGTSI

HNSSYL HPFEKSV HPVISSF HQANTTF HQAQTSF HQATSSI HQGGSSF HQG TSF HQGQTNV HQGTSL

HNSSYV HPFGAGV HPWGRSV HQANTTI HQAQTSI HQATSSL HQGGSSI HQGNTSI HQGQTQF HQGTSNF

HNSTNF HPFGTFA HPWGSSI HQANTTL HQAQTSL HQATSSV HQGGSSL HQGNTSL HQGQTQI HQGTSNI

HNSTNI HPFGVSN HPWSSSV HQANTTV HQAQTSV HQATSTF HQGGSSM HQG TSV HQGQTQL HQGTSNL

HNSTNL HPFMSSG HPYAHMV HQANTV HQAQTTF HQATSTI HQGGSSP HQGNTTF HQGQTQV HQGTSNV

HNSTNV HPGDSEV HPYGSDY HQANTYF HQAQTTI HQATSTL HQGGSSV HQGNTTI HQGQTSF HQGTSQF

HNSTQF HPGDSIW HPYGSSV HQANTYI HQAQTTL HQATSTV HQGGSSW HQGNTTL HQGQTSI HQGTSQI

HNSTQI HPGEAIV HPYRRSV HQANTYL HQAQTTV HQATSV HQGGSSY HQGNTTV HQGQTSL HQGTSQL

HNSTQL HPGEISV HQAGSNF HQANTYV HQAQTV HQATSYF HQGGSTF HQGNTV HQGQTSV HQGTSQV

HNSTQV HPGESLT HQAGS I HQANYF HQAQTYF HQATSYI HQGGSTI HQGNTYF HQGQTTF HQGTSSF

HNSTSF HPGFKGV HQAGS L HQANYI HQAQTYI HQATSYL HQGGSTL HQGNTYI HQGQTTI HQGTSSI

HNSTSI HPGFSFV HQAGSNV HQANYL HQAQTYL HQATSYV HQGGSTV HQGNTYL HQGQTTL HQGTSSL

HNSTSL HPGFSSV HQAGSQF HQANYSL HQAQTYV HQATTF HQGGSVW HQGNTYV HQGQTTV HQGTSSV

HNSTSNF HPGGADH HQAGSQI HQANYV HQAQYF HQATTI HQGGSYF HQG YF HQGQTV HQGTSTF

HNSTSNI HPGGALY HQAGSQL HQAPSNF HQAQYI HQATTL HQGGSYI HQGNYI HQGQTYF HQGTSTI

HNSTSNL HPGGASM HQAGSQV HQAPSNI HQAQYL HQATTNF HQGGSYL HQGNYL HQGQTYI HQGTSTL

HNSTSNV HPGGDSV HQAGSSF HQAPSNL HQAQYV HQATTNI HQGGSYV HQGNYV HQGQTYL HQGTSTV

HNSTSQF HPGGFPV HQ AG SSI HQAPSNV HQASNF HQATTNL HQGGTHV HQGPDSW HQGQTYV HQGTSV

HNSTSQI HPGGFSA HQAGSSL HQAPSQF HQASNI HQATTNV HQGGTNF HQGPSDL HQGQYF HQGTSYF

HNSTSQL HPGGHSV HQAGSSV HQAPSQI HQASNL HQATTQF HQGGTNI HQGPSNF HQGQYI HQGTSYI

HNSTSQV HPGGIMV HQAGSTF HQAPSQL HQASNV HQATTQI HQGGTNL HQGPSNI HQGQYL HQGTSYL

HNSTSSF HPGGKSM HQAGSTI HQAPSQV HQASQF HQATTQL HQGGTNV HQGPSNL HQGQYV HQGTSYV

HNSTSSI HPGGLSI HQAGSTL HQAPSSF HQASQI HQATTQV HQGGTQF HQGPSNV HQGRSSV HQGTTF

HNSTSSL HPGGPAS HQAGSTV HQAPSSI HQASQL HQATTSF HQGGTQI HQGPSQF HQGRVIV HQGTTI

HNSTSSV HPGGQSQ HQAGSYF HQAPSSL HQASQV HQATTSI HQGGTQL HQGPSQI HQGRYFV HQGTTL

HNSTSTF HPGGRLF HQAGSYI HQAPSSV HQASSF HQATTSL HQGGTQV HQGPSQL HQGSAVI HQGTTNF

HNSTSTI HPGGSAL HQAGSYL HQAPSTF HQASSI HQATTSV HQGGTSF HQGPSQV HQGSNF HQGTTNI

HNSTSTL HPGGSDV HQAGSYV HQAPSTI HQASSL HQATTTF HQGGTSI HQGPSSF HQGSNI HQGTTNL

H STSTV HPGGSMM HQAGT F HQAPSTL HQASSNF HQATTTI HQGGTSL HQGPSSI HQGSNL HQGTTNV

HNSTSV HPGGSMV HQAGTNI HQAPSTV HQASSNI HQATTTL HQGGTSV HQGPSSL HQGSNV HQGTTQF

HNSTSYF HPGGSPV HQAGTNL HQAPSYF HQASSNL HQATTTV HQGGTTF HQGPSSV HQGSQF HQGTTQI

HNSTSYI HPGGSQV HQAGTNV HQAPSYI HQASSNV HQATTV HQGGTTI HQGPSTF HQGSQI HQGTTQL

HNSTSYL HPGGSSD HQAGTQF HQAPSYL HQASSQF HQATTYF HQGGTTL HQGPSTI HQGSQL HQGTTQV

HNSTSYV HPGGSSF HQAGTQI HQAPSYV HQASSQI HQATTYI HQGGTTV HQGPSTL HQGSQV HQGTTSF

HNSTTF HPGGSSG HQAGTQL HQAPTNF HQASSQL HQATTYL HQGGTYF HQGPSTV HQGSRSV HQGTTSI

HNSTTI HPGGSSP HQAGTQV HQAPTNI HQASSQV HQATTYV HQGGTYI HQGPSYF HQGSSF HQGTTSL

HNSTTL HPGGSSS HQAGTSF HQAPTNL HQASSSF HQATYF HQGGTYL HQGPSYI HQGSSI HQGTTSV

HNSTTNF HPGGSSV HQAGTSI HQAPTNV HQASSSI HQATYI HQGGTYV HQGPSYL HQGSSL HQGTTTF

HNSTTNI HPGGSTK HQAGTSL HQAPTQF HQASSSL HQATYL HQGGVSM HQGPSYV HQGSSNF HQGTTTI

HNSTTNL HPGGSVT HQAGTSV HQAPTQI HQASSSV HQATYV HQGGVSN HQGPTNF HQGSSNI HQGTTTL

HNSTTNV HPGGSYY HQAGTTF HQAPTQL HQASSTF HQAY F HQGGWID HQGPTNI HQGSSNL HQGTTTV

HNSTTQF HPGGTLV HQAGTTI HQAPTQV HQASSTI HQAYNI HQGGWSV HQGPTNL HQGSSNV HQGTTV

HNSTTQI HPGGVSV HQAGTTL HQAPTSF HQASSTL HQAYNL HQGGYSV HQGPTNV HQGSSQF HQGTTYF

HNSTTQL HPGGVYA HQAGTTV HQAPTSI HQASSTV HQAYNV HQGHNSV HQGPTQF HQGSSQI HQGTTYI

HNSTTQV HPGKHSV HQAGTYF HQAPTSL HQASSV HQAYQF HQGHSSV HQGPTQI HQGSSQL HQGTTYL

HNSTTSF HPGLISH HQAGTYI HQAPTSV HQASSYF HQAYQI HQGHYSV HQGPTQL HQGSSQV HQGTTYV

HNSTTSI HPGLSNV HQAGTYL HQAPTTF HQASSYI HQAYQL HQGISEV HQGPTQV HQGSSSF HQGTYF

HNSTTSL HPGLSNW HQAGTYV HQAPTTI HQASSYL HQAYQV HQGISSV HQGPTSF HQGSSSI HQGTYI

HNSTTSV HPGLSSD HQAGVSV HQAPTTL HQASSYV HQAYSF HQGLLSV HQGPTSI HQGSSSL HQGTYL

HNSTTTF HPGNISV HQAMTSM HQAPTTV HQASTF HQAYSI HQGLSSN HQGPTSL HQGSSSV HQGTYV

HNSTTTI HPGPSSS HQAN F HQAPTYF HQASTI HQAYSL HQGLSSV HQGPTSV HQGSSTF HQGVDSM

HNSTTTL HPGQRMV HQA I HQAPTYI HQASTL HQAYSV HQGMSSG HQGPTTF HQGSSTI HQGVSTV

HNSTTTV HPGQSSP HQ ANN L HQAPTYL HQASTNF HQAYTF HQGMSTD HQGPTTI HQGSSTL HQGYHAV

HNSTTV HPGRFTV HQANNV HQAPTYV HQASTNI HQAYTI HQGNNF HQGPTTL HQGSSTV HQGYNF

HNSTTYF HPGRSDK HQANQF HQAQNF HQASTNL HQAYTL HQGNNI HQGPTTV HQGSSV HQGYNI

HNSTTYI HPGRSEV HQANQI HQAQNI HQASTNV HQAYTV HQGNNL HQGPTYF HQGSSYF HQGYNL

HNSTTYL HPGSGSD HQANQL HQAQNL HQASTQF HQAYYF HQGNNV HQGPTYI HQGSSYI HQGYNV

HNSTTYV HPGSSNV HQANQV HQAQNV HQASTQI HQAYYI HQGNQF HQGPTYL HQGSSYL HQGYQF

HNSTYF HPGSVSV HQANSF HQAQQF HQASTQL HQAYYL HQGNQI HQGPTYV HQGSSYV HQGYQI

HNSTYI HPGTAKD HQ ANSI HQAQQI HQASTQV HQAYYV HQGNQL HQGQNF HQGSTF HQGYQL

HNSTYL HPG AST HQANSL HQAQQL HQASTSF HQDKPSV HQGNQV HQGQNI HQGSTI HQGYQV

HNSTYV HPGVNSS HQANSNF HQAQQV HQASTSI HQFDEDV HQGNSF HQGQNL HQGSTL HQGYSF

HNSYNF HPGVSSV HQANSNI HQAQSF HQASTSL HQFGHKV HQG SI HQGQNV HQGSTNF HQGYSI

HNSYNI HPGWSSK HQANSNL HQAQSI HQASTSV HQFGSSV HQGNSL HQGQQF HQGSTNI HQGYSL

HNSYNL HPGYGTE HQANSNV HQAQSL HQASTTF HQFNSST HQGNSNF HQGQQI HQGSTNL HQGYSV

HNSYNV HPGYSSV HQANSQF HQAQSNF HQASTTI HQGALST HQGNSNI HQGQQL HQGSTNV HQGYTF

HNSYQF HPHASQY HQANSQI HQAQSNI HQASTTL HQGDFTV HQGNSNL HQGQQV HQGSTQF HQGYTI

HNSYQI HPHGSSV HQANSQL HQAQSNL HQASTTV HQGDHSR HQGNSNV HQGQSF HQGSTQI HQGYTL

HNSYQL HPIGSSV HQANSQV HQAQSNV HQASTV HQGDSSA HQGNSQF HQGQSI HQGSTQL HQGYTV

HNSYQV HPIGVSV HQANSSF HQAQSQF HQASTYF HQGESHV HQGNSQI HQGQSL HQGSTQV HQGYWSV

HNSYSF HPIGYSV HQANSSI HQAQSQI HQASTYI HQGFIPD HQGNSQL HQGQSNF HQGSTSF HQGYYF

HNSYSI HPIQSQV HQANSSL HQAQSQL HQASTYL HQGFSSI HQGNSQV HQGQSNI HQGSTSI HQGYYI

HNSYSL HPLGISY HQANSSV HQAQSQV HQASTYV HQGFSSV HQG SSF HQGQSNL HQGSTSL HQGYYL

HNSYSV HPLGSAV HQANSTF HQAQSSF HQASYF HQGGASV HQG SSI HQGQSNV HQGSTSV HQGYYV

HNSYTF HPLGSSV HQANSTI HQAQSSI HQASYI HQGGDSV HQG SSL HQGQSQF HQGSTTF HQHFSSV HQHGPSV HQSNTQF HQSQTNI HQSTSNI HRGGEQR HSEGPSY HSLQSSM HTGMSSF HVAGSSF HVANTSV

HQHGQSG HQSNTQI HQSQTNL HQSTSNL HRGGESE HSEGRAL HSMGSSS HTGMSSR HVAGSSI HVANTTF

HQHGSSM HQSNTQL HQSQTNV HQSTSNV HRGGFSV HSEGSSF HSMNSIF HTGNHST HVAGSSL HVANTTI

HQHVSQV HQSNTQV HQSQTQF HQSTSQF HRGGGSV HSEGSSG HSMSLSP HTGNSSL HVAGSSP HVANTTL

HQIFILV HQSNTSF HQSQTQI HQSTSQI HRGGKSV HSEGSSV HSNDSYW HTGNVHV HVAGSSQ HVANTTV

HQIGSDV HQSNTSI HQSQTQL HQSTSQL HRGGQQE HSFGRLS HSNGSPE HTGQSEV HVAGSSV HVANTV

HQLGIVR HQSNTSL HQSQTQV HQSTSQV HRGGQST HSFGSAV HSNHSSW HTGQSSF HVAGSTF HVANTYF

HQLGSGV HQSNTSV HQSQTSF HQSTSSF HRGGQSY HSFGSLN HSNMMEK HTGQSSV HVAGSTI HVANTYI

HQLGSSV HQSNTTF HQSQTSI HQSTSSI HRGGSHV HSFGSSV HSPAQSM HTGRSAV HVAGSTL HVANTYL

HQLRSSI HQSNTTI HQSQTSL HQSTSSL HRGGSLV HSGARSE HSPGESV HTGRSSI HVAGSTV HVANTYV

HQMGSDV HQSNTTL HQSQTSV HQSTSSV HRGGSMN HSGASGG HSPGFEV HTGSSLV HVAGSVV HVANYF

HQMWSSG HQSNTTV HQSQTTF HQSTSTF HRGGSMV HSGASKI HSPGSHV HTGSSSV HVAGSYF HVANYI

HQ FSSV HQSNTV HQSQTTI HQSTSTI HRGGSSI HSGASKV HSPWTSN HTGTHSY HVAGSYI HVANYL

HQNGSSV HQSNTYF HQSQTTL HQSTSTL HRGGSSL HSGASMV HSQIRSV HTGTSSG HVAGSYL HVANYV

HQPASFV HQSNTYI HQSQTTV HQSTSTV HRGGSSN HSGASSV HSQSSSV HTGTSSN HVAGSYV HVAPSNF

HQPSSSI HQSNTYL HQSQTV HQSTSV HRGGSSV HSGASYV HSQYWPV HTGWASV HVAGTNF HVAPSNI

HQSGSDV HQSNTYV HQSQTYF HQSTSYF HRGGSTV HSGAVYV HSRPQSV HTGWSSV HVAGTNI HVAPSNL

HQSGSNF HQSNYF HQSQTYI HQSTSYI HRGGSVV HSGDQSY HSRWTYF HTGYFSV HVAGTNL HVAPSNV

HQSGSNI HQSNYI HQSQTYL HQSTSYL HRGGSYV HSGDSSR HSSGEIH HTGYLSE HVAGTNV HVAPSQF

HQSGSNL HQSNYL HQSQTYV HQSTSYV HRGGTGF HSGDSVF HSSHDGV HTGYSEN HVAGTQF HVAPSQI

HQSGSNV HQSNYV HQSQYF HQSTTF HRGGVSM HSGESVV HSSLIVT HTGYSSV HVAGTQI HVAPSQL

HQSGSQF HQSPS F HQSQYI HQSTTI HRGGVSV HSGFSSV HSTGSFV HTHFSSV HVAGTQL HVAPSQV

HQSGSQI HQSPSNI HQSQYL HQSTTL HRGGWKA HSGGASV HSTGSLF HTIDESV HVAGTQV HVAPSSF

HQSGSQL HQSPSNL HQSQYV HQSTTNF HRGGWNV HSGGETV HSTGSSV HTIEQSV HVAGTSF HVAPSSI

HQSGSQV HQSPSNV HQSRSSE HQSTTNI HRGGYAV HSGGFAV HSTRSSI HTIGSSV HVAGTSI HVAPSSL

HQSGSSF HQSPSQF HQSSNF HQSTT L HRGGYPV HSGGGSV HSVGFYV HTKGVSV HVAGTSL HVAPSSV

HQSGSSI HQSPSQI HQSSNI HQSTTNV HRGGYSV HSGGGTI HSVGSLV HTKVSIM HVAGTSV HVAPSTF

HQSGSSL HQSPSQL HQSS L HQSTTQF HRGHSSD HSGGHII HSVGSSV HTLGESV HVAGTTF HVAPSTI

HQSGSSV HQSPSQV HQSSNV HQSTTQI HRGISKQ HSGGILY HSVHSSV HTLGLTK HVAGTTI HVAPSTL

HQSGSTF HQSPSSF HQSSQF HQSTTQL HRGKHSV HSGGINV HSWGKSV HTLGSSH HVAGTTL HVAPSTV

HQSGSTI HQSPSSI HQSSQI HQSTTQV HRGLKSV HSGGL D HSWGSQV HTLYSST HVAGTTV HVAPSYF

HQSGSTL HQSPSSL HQSSQL HQSTTSF HRGNAPM HSGGLSI HSWGSSV HTMGSSM HVAGTYF HVAPSYI

HQSGSTV HQSPSSV HQSSQV HQSTTSI HRGNESD HSGGNML HSWGWSV HTMGSSV HVAGTYI HVAPSYL

HQSGSYF HQSPSTF HQSSSF HQSTTSL HRGPNSV HSGGNMV HSYGGSD HTMISSS HVAGTYL HVAPSYV

HQSGSYI HQSPSTI HQSSSI HQSTTSV HRGQDLR HSGGQAS HSYGRSV HTMSSTV HVAGTYV HVAPTLA

HQSGSYL HQSPSTL HQSSSL HQSTTTF HRGR SV HSGGQSN HSYGSSV HTNES D HVAGVSR HVAPTNF

HQSGSYV HQSPSTV HQSSSNF HQSTTTI HRGRSTV HSGGQSV HSYVSSV HTNQSSV HVAGYSR HVAPTNI

HQSGTNF HQSPSYF HQSSSNI HQSTTTL HRGSSIS HSGGRMV HTAEVLE HTPASSN HVAHSSM HVAPTNL

HQSGTNI HQSPSYI HQSSSNL HQSTTTV HRGSSTV HSGGRVV HTAEYSV HTPGSPI HVAISLE HVAPTNV

HQSGTNL HQSPSYL HQSSSNV HQSTTV HRGTSSV HSGGSDV HTAGSLI HTPGSVF HVAITSN HVAPTQF

HQSGTNV HQSPSYV HQSSSQF HQSTTYF HRGVSMP HSGGSEN HTDESSV HTQGHNF HVAKSSS HVAPTQI

HQSGTQF HQSPTNF HQSSSQI HQSTTYI HRGVSSV HSGGSEV HTDGSEN HTQGSHV HVALGSV HVAPTQL

HQSGTQI HQSPTNI HQSSSQL HQSTTYL HRGWFKV HSGGSFV HTDMSEA HTQQSSV HVALLSV HVAPTQV

HQSGTQL HQSPTNL HQSSSQV HQSTTYV HRGWSLV HSGGSGE HTDVSFI HTSGKSV HVALSFV HVAPTSF

HQSGTQV HQSPTNV HQSSSSF HQSTYF HRGWSSN HSGGSHM HTEGSHV HTSGSGS HVALVSW HVAPTSI

HQSGTSF HQSPTQF HQSSSSI HQSTYI HRGYESA HSGGSKQ HTEGSNV HTSGSKA HVAMKLV HVAPTSL

HQSGTSI HQSPTQI HQSSSSL HQSTYL HRGYSPM HSGGSMV HTEGSSL HTTGSEV HVAMQSD HVAPTSV

HQSGTSL HQSPTQL HQSSSSV HQSTYV HRGYSQV HSGGSMW HTEGSSV HTTYSSV HVAMRSV HVAPTTF

HQSGTSV HQSPTQV HQSSSTF HQSYNF HRGYSSV HSGGSNV HTETDSV HTVFQSV HVAMSST HVAPTTI

HQSGTTF HQSPTSF HQSSSTI HQSYNI HRHGHSS HSGGSSA HTFGHFV HTVFVSV HVAMWSA HVAPTTL

HQSGTTI HQSPTSI HQSSSTL HQSYNL HRHLSSV HSGGSSS HTFLSVV HTVGSKR HVANGSM HVAPTTV

HQSGTTL HQSPTSL HQSSSTV HQSYNV HRKMKSW HSGGSST HTFPLHI HTVGSSV HVANNF HVAPTYF

HQSGTTV HQSPTSV HQSSSV HQSYQF HRLGRSE HSGGSSV HTFVSSE HTYGSSQ HVANNI HVAPTYI

HQSGTYF HQSPTTF HQSSSYF HQSYQI HRLGSKG HSGGSTF HTGASNV HTYWSSV HVANNL HVAPTYL

HQSGTYI HQSPTTI HQSSSYI HQSYQL HRLGSNV HSGGSTV HTGASVV HVAAKFW HVANNV HVAPTYV

HQSGTYL HQSPTTL HQSSSYL HQSYQV HRLPSSY HSGGSVG HTGEEPY H ADTGF HVANQF HVAQESS

HQSGTYV HQSPTTV HQSSSYV HQSYSF HRMESSV HSGGSVV HTGEESV HVADVGY HVANQI HVAQNF

HQSGWAV HQSPTYF HQSSTF HQSYSI HRMESWV HSGGSYM HTGESFV HVAELHV HVANQL HVAQNI

HQSNNF HQSPTYI HQSSTI HQSYSL HRMGSSV HSGGSYV HTGEYHV HVAESQP HVANQV HVAQNL

HQSNNI HQSPTYL HQSSTL HQSYSV HRNGGSP HSGGSYW HTGFSSI HVAESSA HVANSF HVAQNV

HQSNNL HQSPTYV HQSSTNF HQSYTF HRNGSSV HSGGTSF HTGFSSV HVAESST HVANSI HVAQQF

HQSNNV HQSQNF HQSSTNI HQSYTI HRNLSSG HSGGVSV HTGFWSV HVAESSV HVANSL HVAQQI

HQSNQF HQSQNI HQSST L HQSYTL HRNVSGN HSGIISP HTGGAAM HVAFSSW HVANSNF HVAQQL

HQSNQI HQSQNL HQSSTNV HQSYTV HRNWNSV HSGKHNV HTGGFSP HVAGEKF HVANSNI HVAQQV

HQSNQL HQSQNV HQSSTQF HQSYYF HRPASSV HSGKHTV HTGGFSS HVAGHNN HVANSNL HVAQSF

HQSNQV HQSQQF HQSSTQI HQSYYI HRPGGAV HSGKSSK HTGGGPK HVAGIEV HVANSNV HVAQSI

HQSNSF HQSQQI HQSSTQL HQSYYL HRPKVSR HSGLLPV HTGGIIN HVAGISV HVANSQF HVAQSL

HQSNSI HQSQQL HQSSTQV HQSYYV HRPWRSV HSGMDSV HTGGISE HVAGKML HVANSQI HVAQSNF

HQSNSL HQSQQV HQSSTSF HQTDSYP HRQILAD HSGMTLV HTGGISV HVAGKSI HVANSQL HVAQSNI

HQSNSNF HQSQSF HQSSTSI HQTFDNV HRSDGSM HSGNSLS HTGGKHE HVAGKSV HVANSQV HVAQSNL

HQSNSNI HQSQSI HQSSTSL HQTTLSV HRSGASI HSGNSQR HTGGKSE HVAGLNV HVANSSF HVAQSNV

HQSNSNL HQSQSL HQSSTSV HQVFVQV HRSGLSS HSGNSSV HTGGPSV HVAGNGA HVANSSI HVAQSQF

HQSNSNV HQSQSNF HQSSTTF HQVGEAQ HRSGNNV HSGPGSV HTGGSFV HVAGNSN HVANSSL HVAQSQI

HQSNSQF HQSQSNI HQSSTTI HQVGQSV HRSGSSV HSGPSGH HTGGSMK HVAGPKN HVANSSV HVAQSQL

HQSNSQI HQSQSNL HQSSTTL HQVGSYV HRSIISK HSGQSSV HTGGSMY HVAGPSD HVANSTF HVAQSQV

HQSNSQL HQSQSNV HQSSTTV HQVNVDD HRSKKET HSGRSGM HTGGSPP HVAGPSW HVANSTI HVAQSSF

HQSNSQV HQSQSQF HQSSTV HQVVGSF HRSPSSY HSGRSQV HTGGSQV HVAGQKY HVANSTL HVAQSSI

HQSNSSF HQSQSQI HQSSTYF HQVWSFR HRTGFPN HSGRSSV HTGGSSD HVAGQSV HVANSTV HVAQSSL

HQSNSSI HQSQSQL HQSSTYI HQWWSSF HRVESVV HSGRWMA HTGGSSF HVAGRFV HVANSV HVAQSSV

HQSNSSL HQSQSQV HQSSTYL HQYGSSP HRVGSSV HSGSWTV HTGGSSI HVAGRSS HVANSYF HVAQSTF

HQSNSSV HQSQSSF HQSSTYV HRADSSV HRVNSLV HSGTYSV HTGGSSK HVAGRSY HVANSYI HVAQSTI

HQSNSTF HQSQSSI HQSSYF HRAGENV HRVPSSL HSGYHSH HTGGSSS HVAGSAS HVANSYL HVAQSTL

HQSNSTI HQSQSSL HQSSYI HRAGSFD HRVYSSV HSHGSMV HTGGSSV HVAGSIV HVANSYV HVAQST

HQSNSTL HQSQSSV HQSSYL HRAIGNE HRWGASH HSHSVKG HTGGVEV HVAGSKL HVANTF HVAQSV

HQSNSTV HQSQSTF HQSSYV HRDGWSV HRWGSSV HSIGESV HTGGVLM HVAGSNF HVANTI HVAQSYF

HQSNSV HQSQSTI HQSTNF HREDSSV HRYEWSV HSIGNST HTGGWDV HVAGSNI HVANTL HVAQSYI

HQSNSYF HQSQSTL HQSTNI HRFGDSV HRYGHSP HSIGSPA HTGGWFV HVAGSNL HVANTNF HVAQSYL

HQSNSYI HQSQSTV HQSTNL HRFGQSY HRYGSSV HSIGSSD HTGGWSP HVAGSNV HVANTNI HVAQSYV

HQSNSYL HQSQSV HQSTNV HRFGVQS HSAGQSV HSIMTSV HTGGWSV HVAGSPI HVANTNL HVAQTF

HQSNSYV HQSQSYF HQSTQF HRFHFGF HSAGSSV HSIYSKV HTGGYSV HVAGSPV HVANTNV HVAQTI

HQSNTF HQSQSYI HQSTQI HRFRSSY HSAGYTF HSKGQKV HTGISSK HVAGSQA HVANTQF HVAQTL

HQSNTI HQSQSYL HQSTQL HRGDVSV HSAQSEE HSKGSSV HTGKSDV HVAGSQF HVANTQI HVAQTNF

HQSNTL HQSQSYV HQSTQV HRGENSV HSDGRYV HSKGVSA HTGKSSV HVAGSQI HVANTQL HVAQTNI

HQSNTNF HQSQTF HQSTSF HRGESSK HSDGSSG HSKWSPF HTGLKVM HVAGSQL HVANTQV HVAQTNL

HQSNTNI HQSQTI HQSTSI HRGFDFV HSDISSV HSLGFSL HTGLNSV HVAGSQV HVANTSF HVAQTNV

HQSNTNL HQSQTL HQSTSL HRGFSSV HSDTRSD HSLGSSK HTGLQSV HVAGSSA HVANTSI HVAQTQF

HQSNTNV HQSQTNF HQSTSNF HRGGEHV HSDTSKL HSLGSSL HTGMRIA HVAGSSD HVANTSL HVAQTQI HVAQTQL HVATSNL HVDGSSN HVFGSFV HVGDSQE HVGGDTY HVGGNGV HVGGSLV HVGGVDW HVGKKIV

HVAQTQV HVATSNV HVDGSSP HVFGSGH HVGDSQV HVGGDYL HVGGNNF HVGGSMF HVGGVHF HVGKRSK

HVAQTSF HVATSQF HVDGSSS HVFGSIA HVGDSSF HVGGEDV HVGGNNV HVGGSMS HVGGVLG HVGKRSV

HVAQTSI HVATSQI HVDGSSV HVFGSIV HVGDSSG HVGGEEV HVGGNPV HVGGSMV H GG SA HVGKSFV

HVAQTSL HVATSQL HVDGSSW HVFGSLV HVGDSSN HVGGEHV HVGGNSA HVGGSNF HVGGVSH HVGKSIE

HVAQTSV HVATSQV HVDGSVK HVFGSMV HVGDSSS HVGGEIF HVGGNSE HVGGSNI HVGGVSI HVGKSIV

HVAQTTF HVATSSF HVDGSVL HVFGSNV HVGDSST HVGGEIV HVGGNSF HVGGSNL HVGGVSS HVGKSKH

HVAQTTI HVATSSI HVDGSYV HVFGSQE HVGDSSV HVGGEKM HVGGNSP HVGGSNM HVGGVSV HVGKSKV

HVAQTTL HVATSSL HVDGTIV HVFGSQL HVGDSSY HVGGEKV HVGGNSQ HVGGSNV H GG YS HVGKSLK

HVAQTTV HVATSSV HVDGWVE HVFGSSN HVGDWAV HVGGELV HVGGNST HVGGSPA H GGWAV HVGKSNL

HVAQTV HVATSTF HVDGYYV HVFGSSQ HVGEDAV HVGGESF HVGGNSV HVGGSPE HVGGWFV HVGKSSA

HVAQTYF HVATSTI HVDLDSQ HVFGSSV HVGEDQI HVGGESH HVGGPKV HVGGSPF HVGGWMH HVGKSSH

HVAQTYI HVATSTL HVDLSSL HVFGSSY HVGEDSV HVGGESL HVGGPMV HVGGSPH HVGGWMV HVGKSSM

HVAQTYL HVATSTV HVDLSSV HVFGTSV HVGEDVQ HVGGESM HVGGPNV HVGGSPL HVGGWPS HVGKSSP

HVAQTYV HVATSV HVDMSSV HVFGVQV HVGEFVR HVGGESS HVGGPPG HVGGSPV HVGGWSA HVGKSST

HVAQYF HVATSYF HVDM FV HVFGVSS HVGEGSV HVGGESV HVGGPQY HVGGSPY HVGGWSE HVGKSSV

HVAQYI HVATSYI HVDNLST HVFGWSH HVGEIGV HVGGESW HVGGPSF HVGGSQF HVGGWSF HVGKSSY

HVAQYL HVATSYL HVDNSFV HVFGWSP HVGEISM HVGGEVV HVGGPSG HVGGSQI HVGGWSH HVGKSTF

HVAQYV HVATSYV HVDPAQD HVFGWSV HVGEKTV HVGGEYV HVGGPSH HVGGSQK HVGGWSK HVGKSVE

HVARLKG HVATTF HVDPSGA HVFGWSY HVGEKYV HVGGFEY HVGGPSM HVGGSQL HVGGWSM HVGKSYE

HVARSHV HVATTI HVDQSSV HVFGWTV HVGELQV HVGGFFE HVGGPSP HVGGSQN HVGGWSN HVGKTIT

HVARSSV HVATTL HVDQYAM HVFHHQI HVGELSE HVGGFFK HVGGPSQ HVGGSQQ HVGGWSS HVGKTSQ

HVASIDP HVATTNF HVDRGSV HVFHSKE HVGENSV HVGGFFV HVGGPSV HVGGSQT HVGGWST HVGKVKV

HVASNF HVATTNI HVDRSSL HVFISFS HVGEQSV HVGGFLV HVGGPVH HVGGSQV HVGGWSV HVGKVLV

HVASNI HVATTNL HVDSSSV HVFISSS HVGERSV HVGGFLY HVGGQAV HVGGSSA HVGGWTV HVGKWGH

HVASNL HVATTNV HVDTRSV HVFLIAK HVGESAV HVGGFSF HVGGQIV HVGGSSD HVGGWVV HVGKWSV

HVASNV HVATTQF HVDTSQW HVFLSSV HVGESDE HVGGFSK HVGGQIY HVGGSSE HVGGYEV HVGKYHV

HVASQF HVATTQI HVDVSFK HVFMGGV HVGESEV HVGGFSN HVGGQLE HVGGSSF HVGGYFV HVGKYSD

HVASQI HVATTQL HVDVSSQ HVFMLKV HVGESFV HVGGFSV HVGGQSK HVGGSSG HVGGYHV HVGLDGV

HVASQL HVATTQV HVDWSLF HVFNWSV HVGESHV HVGGFSY HVGGQSP HVGGSSH HVGGYIV HVGLESF

HVASQV HVATTSF HVDWSSV HVFPFSA HVGESNK HVGGGAV HVGGQSR HVGGSSI HVGGYPK HVGLFSV

HVASSF HVATTSI HVDYSYV HVFQSSV HVGESNV HVGGGFV HVGGQSV HVGGSSK HVGGYQE HVGLHSV

HVASSI HVATTSL HVEANST HVFQSTV HVGESPL HVGGGKV HVGGQTN HVGGSSL HVGGYSM HVGLISN

HVASSL HVATTSV HVEDSKD HVFQYSV HVGESPT HVGGGNG HVGGRDV HVGGSSM HVGGYSP HVGLLSV

HVASS F HVATTTF HVEDVSV HVFWSFE HVGESPV HVGGGNV HVGGREV HVGGSSN HVGGYSR HVGLNKV

HVASSNI HVATTTI HVEEHG HVFWWSV HVGESQV HVGGGQD HVGGRFV HVGGSSP HVGGYSV HVGLNSA

HVASSNL HVATTTL HVEESSA HVFYASP HVGESSE HVGGGSD HVGGRHV HVGGSSQ HVGGYSW HVGLNSV

HVASSNV HVATTTV HVEESS HVFYYSV HVGESSS HVGGGSE HVGGRNK HVGGSSR HVGGYTK HVGLPSW

HVASSQF HVATTV HVEGAMI HVGAAHV H GESST HVGGGSI HVGGRNV HVGGSSS HVGHDSV HVGLRVV

HVASSQI HVATTYF HVEGDSV HVGAASV HVGESSV HVGGGSM HVGGRSL H GGSST HVGHHDG HVGLSAA

HVASSQL HVATTYI HVEGHKV HVGAAVV HVGETLV HVGGGSQ HVGGRSQ HVGGSSV HVGHISF HVGLSAV

HVASSQV HVATTYL HVEGNSP HVGADSP HVGEWNV HVGGGSS HVGGRSS HVGGSSW HVGHISN HVGLSEP

HVASSSF HVATTYV HVEGNSV HVGAESV HVGEWSL HVGGGSV HVGGRSV HVGGSSY HVGHKSH HVGLSGS

HVASSSI HVATYF HVEGPAY HVGAFNV HVGEYSE HVGGGTV H GGRTS HVGGSTD HVGHLSV HVGLSGT

HVASSSL HVATYI HVEGPDV HVGAFSV H GFASL HVGGGVN HVGGRTV HVGGSTF HVGHNHE HVGLSHT

HVASSSV HVATYL HVEGPMV HVGAFYW H GFASP HVGGHAV HVGGRYL H GGSTI HVGHNSV HVGLSHV

HVASSTF HVATYV HVEGPSV HVGAGYD HVGFHGF HVGGHDS HVGGSAA HVGGSTL HVGHNVL HVGLSKS

HVASSTI HVAVESV HVEGRSH HVGAHSK HVGFHQM HVGGHEL HVGGSAD HVGGSTM HVGHPDV HVGLSLD

HVASSTL HVAVSSV HVEGSGD HVGAKGV HVGFIFK HVGGHGV HVGGSAE HVGGSTN HVGHSAV HVGLSMS

HVASSTV HVAWSSK HVEGSGV HVGAM G HVGFISV HVGGHLR HVGGSAF HVGGSTT HVGHSDV HVGLSSD

HVASSV HVAYGSV HVEGSMV HVGANSV HVGFLDV HVGGHLV HVGGSAL H GGST HVGHSHV HVGLSSF

HVASSYF HVAY F HVEGSNF HVGAPSV HVGFPFS HVGGHMV HVGGSAN H GGSTW HVGHSLL HVGLSSI

HVASSYI HVAYNI HVEGSSH HVGAQSM H GFRVV HVGGHPV HVGGSAQ HVGGSVA HVGHSLW HVGLSSP

HVASSYL HVAY L HVEGSSV HVGARIV HVGFSFA HVGGHSG H GGSAV HVGGSVE HVGHSPV HVGLSSR

HVASSYV HVAYNV HVEGSSY HVGARKV HVGFSLV HVGGHSM H GGSAY HVGGSVF HVGHSQV HVGLSST

HVASTF HVAYQF HVEGSTK HVGASDQ HVGFSNP HVGGHSP HVGGSDF HVGGSVS HVGHSSF HVGLSSV

HVASTI HVAYQI HVEGSYV HVGASFM HVGFSPV HVGGHSR HVGGSDN HVGGSVV HVGHSSV HVGLSSW

HVASTL HVAYQL HVEGTSI HVGASGV HVGFSSE HVGGHSV HVGGSDV HVGGSYD HVGHSSW HVGLSVV

HVASTNF HVAYQV HVEGTSV HVGASHV HVGFSSG HVGGHSY HVGGSDY HVGGSYE HVGHSTV HVGLWSV

HVASTNI HVAYRSV HVEGVSI H GASKV HVGFSSN HVGGHTQ HVGGSEE HVGGSYF HVGHSVN HVGLYSQ

HVASTNL HVAYSDK HVEGWIV H GASKW HVGFSSV HVGGHVT HVGGSEF HVGGSYH HVGHSYN HVGLYSV

HVASTNV HVAYSF HVEHSSV HVGASNV HVGFSSW HVGGIFF HVGGSEN HVGGSYI HVGHTPV HVGMDHA

HVASTQF HVAYSI HVEINIF HVGASPG H GFSTG HVGGIIV HVGGSES HVGGSYL HVGHTSV HVGMDSF

HVASTQI HVAYSL HVEISSP HVGASSA H GFST HVGGIKV HVGGSET HVGGSYM HVGHYSI HVGMFEM

HVASTQL HVAYSV HVEKSIV HVGASSL HVGFSVV HVGGILV HVGGSEV HVGGSYS HVGIASN HVGMFEV

HVASTQV HVAYTF HVELSNV HVGASSS HVGFSYS HVGGINK HVGGSEY HVGGSYV HVGIASQ HVGMHSV

HVASTSF HVAYTI HVEMREV HVGASSV HVGFTIV HVGGISE HVGGSFA HVGGTHV HVGIASV HVGMKSV

HVASTSI HVAYTL HVEQSDV HVGASSY HVGGAAV HVGGISP HVGGSFK HVGGTIV HVGIASW HVGMLSV

HVASTSL HVAYTV HVEQSVP HVGASVV HVGGADM HVGGISQ HVGGSFP HVGGTKP HVGIESI HVGMNVV

HVASTSV HVAYYF HVERDDV H GATSR HVGGAIY HVGGIST HVGGSFQ HVGGTKV HVGIFSV HVGMPDV

HVASTTF HVAYYI HVERGLV H GATST HVGGAKV HVGGISV HVGGSFR HVGGTMQ HVGIFTE HVGMPIM

HVASTTI HVAYYL HVERSSV HVGAWSI HVGGALV HVGGITV HVGGSFV HVGGTNF HVGIHGA HVGMPSV

HVASTTL HVAYYV HVESKSV HVGAYNM HVGGAMT HVGGIVV HVGGSFW HVGGTNI HVGIHHK HVGMQSV

HVASTTV HVDDSMV HVESSSD HVGAYSV HVGGAMV HVGGKDV HVGGSFY HVGGTNL HVGIKHV HVGMSAS

HVASTV HVDGASV HVETKKV HVGDAG HVGGAPV HVGGKNY HVGGSGG HVGGTNV HVGILSE HVGMSDP

HVASTYF HVDGFSV HVETSDG HVGDATF HVGGASE HVGGKQV HVGGSGH HVGGTQE HVGIQSV HVGMSEY

HVASTYI HVDGGSS HVETSTV HVGDDAF HVGGASG HVGGKSD HVGGSGK HVGGTQF HVGIRSP HVGMSHV

HVASTYL HVDGIIV HVFASDV HVGDDSQ HVGGASK H GGKST HVGGSGQ HVGGTQI HVGIRSS HVGMSLY

HVASTYV HVDGISV HVFASHK HVGDEEV HVGGASS HVGGKSV HVGGSGV HVGGTQL HVGISEV HVGMSMS

HVASYF HVDGKSG HVFASSN HVGDEIA HVGGASV H GGKYV HVGGSHE HVGGTQV HVGISGV HVGMSMV

HVASYI HVDGLSV HVFASSR HVGDEWS HVGGAYV HVGGLDV HVGGSHG HVGGTSF HVGISKV HVGMSPH

HVASYL HVDGNEV HVFAVHV HVGDGKV HVGGDDG HVGGLIT HVGGSHV HVGGTSH HVGISPF HVGMSPL

HVASYV HVDG SK HVFDSAM HVGDGSR HVGGDEV HVGGLQV HVGGSHW HVGGTSI HVGISSD HVGMSPV

HVATKSV HVDGPSY HVFDSYV HVGDGSV HVGGDFV HVGGLSE HVGGSID HVGGTSL HVGISSL HVGMSSH

HVATNF HVDGQDK HVFEIYT HVGDISV HVGGDKE HVGGLSG HVGGSIF HVGGTSM HVGISSQ HVGMSSP

HVATNI HVDGREV HVFEPME HVGDLSR HVGGDKF HVGGLSI HVGGSIQ H GGTSV HVGISSV HVGMSSS

HVATNL HVDGRSV HVFFSNW HVGDLSV HVGGDLE HVGGLSM HVGGSIV HVGGTSW HVGISYH HVGMSST

HVATNV HVDGSHV HVFFSSV HVGDNSV HVGGDLK HVGGLSN HVGGSKS HVGGTTF HVGITSS HVGMSSV

HVATQF HVDGSIV HVFGGIY HVGDNWS HVGGDMV HVGGLSV HVGGSKT HVGGTTI HVGITSV HVGMSTV

HVATQI HVDGSKR HVFGISS HVGDRSV HVGGDNV HVGGLSY HVGGSKV HVGGTTL HVGIYSV HVGMSYV

HVATQL HVDGSLV HVFGISV HVGDSDR HVGGDQV HVGGLVE HVGGSLA HVGGTTV HVGKAVV HVGMTSV

HVATQV HVDGSMV HVFGKSA HVGDSFM HVGGDSD HVGGLVV HVGGSLD HVGGTVV HVGKDSR HVGMTSY

HVATSF HVDGSNT HVFGKSV HVGDSGP HVGGDSG HVGGLYI HVGGSLF HVGGTYF HVGKEKF HVGMWSV

HVATSI HVDGSQK HVFGLFV HVGDSIV HVGGDSI HVGGNAV HVGGSLI HVGGTYI HVGKFSS HVGMYST

HVATSL HVDGSQV HVFGQSQ HVGDSMV HVGGDSN HVGGNEV HVGGSLM HVGGTYL HVGKGSV HVGMYSV

HVATSNF HVDGSSG HVFGQSW HVGDSNQ HVGGDSV HVGGNFV HVGGSLR HVGGTYV HVGKHSP HVGNASY

HVATSNI HVDGSSL HVFGSDV HVGDS HVGGDSW HVGGNGL HVGGSLS HVGGVDG HVGKIKV HVGNDQV HVGNDSV HVGPSEV HVGQSSE HVGSNIV HVGTNSQ HVGVSSQ HVHASSR HVIMVAI HVMFSSP HVNMNSV

HVGNEEV HVGPSFL HVGQSSF HVGSNL HVGTNSV HVGVSST HVHASSV HVIMVSV HVMGASF HVNMPSI

HVG ETV HVGPSKQ HVGQSSG HVGSNV HVGTNV HVGVSSV HVHDFSV HVINGAV HVMGEPV HVNMPTS

HVGNHVV HVGPSKV HVGQSSI HVGSPIV HVGTQF HVGVSSY HVHDSSV HVINSSF HVMGFFV HVNMSST

HVG LTV HVGPSNF HVGQSSL HVGSPPV HVGTQI HVGVSTG HVHEEDV HVINSSV HVMGFSA HVNNSSI

HVGNNF HVGPSNI HVGQSST HVGSPSV HVGTQL HVGVSVV HVHESPR HVINSTV HVMGFVM HVNPGSV

HVGNNI HVGPSNL HVGQSSV HVGSQF HVGTQSV HVGVTIV HVHESST HVIPSLV HVMGISV HVNPSSS

HVGNNL HVGPSNV HVGQSSW HVGSQI HVGTQV H GWASR HVHESSV HVIPSSV HVMGKSV HVNPSSV

HVGNNV HVGPSPV HVGQSTF HVGSQL HVGTRHA HVGWDAL HVHFAPF HVIQSSL HVMGNLF HVNQSPI

HVG S HVGPSQF HVGQSTI HVGSQSV HVGTSDG HVGWDQV HVHGAQL HVISASE HVMGNQV HVNRSSE

HVGNQF HVGPSQI HVGQSTL HVGSQV HVGTSEP HVGWESV HVHGAQR HVISSHV HVMGPNQ HVNSSSP

HVG QI HVGPSQL HVGQSTR HVGSRPV HVGTSF HVGWFYQ HVHGEST HVISSSG HVMGSFH HVNSWKV

HVGNQL HVGPSQV HVGQSTV HVGSSAV HVGTSGV HVGWGEV HVHGESV HVITHYY HVMGSFV HVNTISV

HVGNQSV HVGPSSF HVGQSV HVGSSDI HVGTSI HVGWGSF HVHGFSL HVITSSH HVMGSIV HVNVSMV

HVG QV HVGPSSI HVGQSVA HVGSSF HVGTSKV HVGWHSN HVHGISE HVITTNV HVMGSKA HVNVSSM

HVG RSD HVGPSSK HVGQSVV HVGSSFV HVGTSL HVGWKMV HVHGISV HVIVSGK HVMGSKH HVNWKLV

HVG RSV HVGPSSL HVGQSYF HVGSSGL HVGTSMQ HVGWKSS HVHGKEV HVIVSIE HVMGSLD HVNWWIV

HVG SAV HVGPSSV HVGQSYI HVGSSHV HVGTS F HVGWNSW HVHGLSH HVIWSSM HVMGSNS HVNYSSV

HVGNSDS HVGPSTF HVGQSYL HVGSSI HVGTSNI HVGWPEV HVHGLSS HVIYNSV HVMGSQV HVPASIM

HVGNSEH HVGPSTI HVGQSYV HVGSSKK HVGTSNL HVGWQSY HVHGNSN HVIYSSV HVMGSSD HVPDLVV

HVGNSF HVGPSTL HVGQTF HVGSSL HVGTSNV HVGWRSV HVHGQSH HVIYSVV HVMGSSE HVPDSVE

HVGNSHQ HVGPSTV HVGQTI HVGSSLV HVGTSPV HVGWSAV HVHGSAI HVKGKSK HVMGSSG HVPDWKV

HVGNSI HVGPSYF HVGQTKI HVGSSMV HVGTSQF HVGWSDM HVHGSDV HVKGSAS HVMGSSI HVPGDYV

HVGNSL HVGPSYI HVGQTL HVGSSMY HVGTSQI HVGWSEV HVHGSGV HVKGSDV HVMGSSM HVPGFSD

HVG SLY HVGPSYL HVGQTNF HVGSSNF HVGTSQL HVGWSFV HVHGSSD HVKGSGV HVMGSSR HVPGFSF

HVGNSNF HVGPSYV HVGQTNI HVGSSNI HVGTSQV HVGWSGV HVHGSSE HVKGSIG HVMGSST HVPGGIG

HVGNSNI HVGPTMV HVGQTNL HVGSSNL H GTSSF HVGWSHV HVHGSSG HVKGSKV HVMGSSV HVPGHTV

HVGNSNL HVGPTNF HVGQTNV HVGSSNV HVGTSSI HVGWSKN HVHGSSH HVKGSPA HVMGSSW HVPGISV

HVGNSNV HVGPTNI HVGQTQF HVGSSQF H GTSSL HVGWSPA HVHGSSL HVKGSSS HVMGWDV HVPGKMV

HVGNSPV HVGPTNL HVGQTQI HVGSSQI HVGTSSV HVGWSPS HVHGSST HVKGYSV HVMGWNV HVPGKSV

HVGNSQF HVGPTNV HVGQTQL HVGSSQL HVGTSTF HVGWSPV HVHGSSV HVKHSFG HVMGWSH HVPGPSV

HVG SQI HVGPTQF HVGQTQV HVGSSQV H GTSTI HVGWSSA HVHGVDV HVKMSSM HVMGYFV HVPGQSI

HVGNSQL HVGPTQI HVGQTSF HVGSSSA HVGTSTL HVGWSSK HVHGYSV HVLAAWV HVMIIMT HVPGRFV

HVGNSQV HVGPTQL HVGQTSI HVGSSSF HVGTSTN HVGWSSL HVHHGSV HVLASSW HVMKGHV HVPGSDV

HVGNSSF HVGPTQV HVGQTSL HVGSSSI HVGTSTV HVGWSSM HVHHQSN HVLDYSV HVMKSSV HVPGSEH

HVGNSSH HVGPTSF HVGQTSV HVGSSSL HVGTSV HVGWSSN HVHHSEV HVLEISV HVMMSAV HVPGSHW

HVGNSSI HVGPTSI HVGQTTF HVGSSSV H GTSYF HVGWSSQ HVHHSSM HVLESSV HVMMSSE HVPGSKV

HVGNSSK HVGPTSL HVGQTTI HVGSSTF H GTSYH HVGWVSV HVHHYQI HVLFSSA HVMNKEV HVPGSLV

HVGNSSL HVGPTSV HVGQTTL HVGSSTI HVGTSYI HVGWWSV HVHIQSE HVLFTSV HVMNSDV HVPGSMV

HVGNSSM HVGPTTF HVGQTTV HVGSSTL H GTSYL HVGWWYV HVHISMQ HVLGAAA HVMNSSV HVPGSNE

HVGNSSN HVGPTTI HVGQTV HVGSSTV HVGTSYV HVGYAQL HVHMSPG HVLGASP HVMPESH HVPGSQL

HVGNSSP HVGPTTL HVGQTYF HVGSSV HVGTTF HVGYDSV HVHNSST HVLGDLV HVMPVSH HVPGSQV

HVGNSSQ HVGPTTV HVGQTYI HVGSSYF HVGTTI HVGYDVV HVHNVSE HVLGDSV HVMPYEV HVPGSSH

HVGNSSV HVGPTYF HVGQTYL HVGSSYI HVGTTL HVGYGQV HVHPEDV HVLGEAV HVMQSDV HVPGSSK

HVGNSTF HVGPTYI HVGQTYV HVGSSYL HVGTTNF HVGYHSV HVHQGSV HVLGFKV HVMSFDK HVPGSSM

HVGNSTI HVGPTYL HVGQVSV HVGSSYV HVGTTNI HVGYIVR HVHQSDW HVLGGFF HVMSSSY HVPGSSV

HVGNSTL HVGPTYV HVGQYF HVGSTF HVGTTNL HVGYKAV HVHQWSV HVLGKSV HVMSTSE HVPGSSW

HVGNSTV HVGP MS HVGQYI HVGSTI HVGTTNV HVGYLDF HVHRRNV HVLGNED HVMTSSE HVPGSTV

HVGNSV HVGPVSW HVGQYL HVGSTL HVGTTQF HVGYNF HVHRSSN HVLGQSH HVMTSSV HVPGSVM

HVGNSYF HVGPWSV HVGQYV HVGSTNF HVGTTQI HVGYNI HVHRWEA HVLGQST HVMTSTL HVPGSVV

HVG SYI HVGPYSG HVGRANF HVGSTNI HVGTTQL HVGYNL HVHSSSV HVLGSEV HVMVSKG HVPGTSG

HVG SYL HVGQAAV HVGRDAT HVGSTNL HVGTTQV HVGYNV HVHTSST HVLGSGD HVMVSSV HVPGVHV

HVGNSYV HVGQAFG HVGRDKV HVGSTNV HVGTTSF HVGYPSD HVHWFSV HVLGSHV HVMYSTF HVPGWKP

HVGNTF HVGQASV HVGRDSV HVGSTQF H GTTSI HVGYQF HVHYKPR HVLGSHW HVMYTSV HVPGWSL

HVGNTI HVGQDSE HVGRFSV HVGSTQI HVGTTSL HVGYQI HVHYSFV HVLGSKV HVNDSGF HVPGWSN

HVG TL HVGQEQN HVGRGET HVGSTQL HVGTTSV HVGYQL HVHYSSD HVLGSQL HVNDSSM HVPGWSV

HVGNTNF HVGQGFV HVGRGFE HVGSTQV HVGTTTF HVGYQSV HVIASGV HVLGSSG HVNERSV HVPGYAP

HVGNTNI HVGQGYV HVGRGSK H GSTSA HVGTTTI HVGYQV HVIASSN HVLGSSL HVNESYT HVPGYIK

HVG TNL HVGQHSS HVGRGSL H GSTSF HVGTTTL HVGYQYY HVIASSS HVLGSSM HVNFSPI HVPIDSV

HVGNTNV HVGQIIP HVGRGSV HVGSTSI HVGTTTV HVGYRPV HVIDGSV HVLGSSV HVNFSSE HVPINVF

HVGNTQF HVGQISR HVGRKSL H GSTSL HVGTTV HVGYSAD HVIDSSV HVLGSYN HVNFSSG HVPKFTH

HVG TQI HVGQKSV HVGRKSS H GSTS HVGTTYF HVGYSAF HVIEGLV HVLGTKV HVNFSSV HVPLAST

HVGNTQL HVGQNF HVGRKSV HVGSTSV HVGTTYI HVGYSAY HVIESES HVLGTSV HVNGAKV HVPLQSA

HVGNTQS HVGQNI HVGR SM HVGSTTF HVGTTYL HVGYSDT HVIFSSA HVLGVND HVNGASQ HVPLSEV

HVGNTQV HVGQNL HVGRPFV HVGSTTI HVGTTYV HVGYSER HVIFSSV HVLGVTV HVNGASV HVPNAHV

HVGNTSF HVGQNSQ HVGRSEV HVGSTTL HVGTVSN HVGYSF HVIGAIR HVLGWDE HVNGDSW HVPNPSQ

HVG TSI HVGQNV HVGRSNQ HVGSTTV HVGTWQV HVGYSFH HVIGASE HVLGYSD HVNGEHV HVPNSDV

HVGNTSL HVGQQF HVGRSNW HVGSTV HVGTYAV HVGYSI HVIGESV HVLHHSV HVNGEIG HVPNSSF

H VG NTS V HVGQQI HVGRSPV H GSTYF HVGTYF HVGYSKV HVIGISV HVLHSMV HVNGFSQ HVPNSSV

HVGNTTF HVGQQL HVGRSSF HVGSTYI HVGTYI HVGYSL HVIGKSK HVLHSSV HVNGGSF HVPPSGV

HVGNTTI HVGQQV HVGRSSI H GSTYL HVGTYL HVGYSMS HVIGNKQ HVLIETV HVNGGSV HVPQSLR

HVGNTTL HVGQRSF HVGRSSM HVGSTYV HVGTYV HVGYSNA HVIGPSV HVLLSSV HVNGKYV HVPRSSF

HVGNTTV HVGQRST HVGRSSN HVGSVSD HVGTYVG HVGYSNV HVIGPVV HVLMASV HVNGRAV HVPRSSV

HVG TV HVGQSAD HVGRSSQ HVGSVSL HVGVAPF HVGYSSD HVIGQSV HVLMTSV HVNGRGV HVPRSYR

HVGNTYF HVGQSAV HVGRSSV HVGSVTT HVGVAVA HVGYSSF HVIGQTV HVLNISE HVNGRSV HVPRYSV

HVG TYI HVGQSF HVGRSSW HVGSWGF HVGVDIV HVGYSSH HVIGSAP HVLPGSG HVNGSGD HVPSKSV

HVGNTYL HVGQSFV HVGRSVV HVGSWSD HVGVDSD HVGYSSI HVIGSEV HVLPSSV HVNGSIK HVPSPSV

HVGNTYV HVGQSGP HVGRSYQ HVGSYF HVGVEFS HVGYSSK HVIGSFV HVLQSIV HVNGSIV HVPTIDV

HVG VQN HVGQSHM HVGRTAV HVGSYI HVGVESV HVGYSSR HVIGSIE HVLRSHP HVNGSLV HVPVGMH

HVGNYF HVGQSI HVGRTSG HVGSYL HVGVEVW HVGYSSV HVIGSLV HVLRSPQ HVNGSNV HVPVSSG

HVGNYI HVGQSIH HVGRTSI HVGSYSE HVGVGDV HVGYSSW HVIGSSF HVLSDHG HVNGSSD HVPYESV

HVG YL HVGQSKV HVGRTSQ HVGSYV HVGVHFV HVGYSSY HVIGSSN HVLSSVV HVNGSSL HVPYSSK

HVGNYV HVGQSL HVGRVSL H GTAS HVGVHLV HVGYSV HVIGSSV HVLTSHI HVNGSST HVPYSSY

HVG ATV HVGQSLV HVGRWSL H GTASR HVGVISV HVGYTF HVIGSSY HVLTSSV HVNGSSV HVQAESM

HVGPDSV HVGQSMP HVGRWSV HVGTDDV HVGVLSV HVGYTI HVIGSTP HVLVSLV HVNGSSW HVQDSSV

HVGPESQ HVGQSNF HVGSAHV HVGTESV HVGVSDA HVGYTL HVIGTSV HVLVSSY HVNGSYM HVQDSVN

HVGPESV HVGQSNI HVGSASD HVGTGDI HVGVSDV HVGYTV HVIGWSV HVLWSIV HVNGVSH HVQEGSV

HVGPFAR HVGQSNL HVGSASV HVGTHHV HVGVSFM HVGYVSK HVIGYSV HVLWSSV HVNGVSV HVQFRAV

HVGPGSV HVGQSNR HVGSDNV HVGTHSV HVGVSFV HVGYWKV HVIHSSV HVLYESV HVNGVYV HVQFSSV

HVGPIKH HVGQSNV HVGSDSN HVGTHSY HVGVSHQ HVGYWSV HVIISHS HVMANSV HVNGWEV HVQGDSL

HVGPISE HVGQSQF HVGSEKQ HVGTIMP HVGVSHV HVGYYF HVIISSW HVMASFV HVNGWSS HVQGDSS

HVGPISQ HVGQSQI HVGSGKV HVGTKSP HVGVSIV HVGYYI HVIIWSV HVMASTV HVNGYSL HVQGFSV

HVGPLSV HVGQSQL HVGSGSD HVGTMFN HVGVSKI HVGYYL HVIKQVI HVMASVR HVNHSSG HVQGGDQ

HVGPNSV HVGQSQV HVGSGSV HVGTNF HVGVSMH HVGYYV HVIKSSE HVMDSDV HVNIAGV HVQGHGY

HVGPQSL HVGQSQW HVGSKST HVGTNI HVGVSNS HVHAQSW HVILSSV HVMESSV HVNISSS HVQGHSV

HVGPRSV HVGQSQY HVGSNF HVGTNL HVGVSNV HVHASGV HVIMSLV HVMFAMI HVNKLYG HVQGISV

HVGPSDV HVGQSSA HVGSNI HVGTNSA HVGVSSN HVHASIK HVIMSSV HVMFEQY HVNLSAV HVQGKSY HVQGLND HVSGSTH HVSNTYV HVSQTTI HVSTSSV HVTGSSW H VYTST HVYGSQV HWGPFSV HYGGYSV

HVQGLSD HVSGSTI HVSNYF HVSQTTL HVSTSTF HVTGVFQ HVWAVSV HVYGSSD HWGPSFV HYGISKY

HVQGLSV HVSGSTL HVSNYI HVSQTTV HVSTSTI HVTGYGV HVWDSSV HVYGSSG HWGPSSH HYGISSV

HVQGNSV HVSGSTV HVSNYL HVSQTV HVSTSTL HVTGYSK HVWEKGN HVYGSSP HWGRKSY HYGKNSF

HVQGPSM HVSGSVV HVSNYV HVSQTYF HVSTSTV HVTGYST HVWENSY HVYGSSQ HWGRRSV HYGKPNG

HVQGQSV HVSGSYF HVSPASG HVSQTYI HVSTSV HVTHPSV HVWEPSK HVYGSSV HWGSSIY HYGKSGY

HVQGQVK HVSGSYI HVSPFSM HVSQTYL HVSTSYF HVTHSSL HVWESSV HVYGSSW HWGSSPV HYGKSHY

HVQGRSQ HVSGSYL HVSPSNF HVSQTYV HVSTSYI HVTHSSM HVWGAKV HVYGSYV HWGTASV HYGLSHR

HVQGSDV HVSGSYV HVSPSNI HVSQYF HVSTSYL HVTHSSV HVWGASD HVYGVQV HWGTRAV HYGLSSL

HVQGSGV HVSGTNF HVSPSNL HVSQYI HVSTSYV HVTIESS HVWGFIR HVYGVSH HWGTSSV HYGLSSN

HVQGSGW HVSGTNI HVSPSNV HVSQYL HVSTTF HVTISGV HVWGFSV HVYGVSN HWGTTFS HYGMFHH

HVQGSLV HVSGTNL HVSPSQF HVSQYV HVSTTI HVTKLSV HVWGHEV HVYGVSQ HWGVDSV HYGMIPN

HVQGSNV HVSGTNV HVSPSQI HVSRGGD HVSTTL HVTKSSG HVWGKDV HVYGVSV HWGVSSV HYGMSFP

HVQGSSA HVSGTQF HVSPSQL HVSRTSV HVSTTNF HVTMSSV HVWGKSQ HVYGVYV HWHGHDI HYGMSVI

HVQGSSE HVSGTQI HVSPSQV HVSSNF HVSTTNI HVTNSSV HVWGLHV HVYHGHP HWHGSGV HYGMYLP

HVQGSSK HVSGTQL HVSPSSF HVSSNI HVSTTNL HVTPSSV HVWGLIV HVYHPSV HWHPPSV HYGNSSR

HVQGSSR HVSGTQV HVSPSSI HVSSNL HVSTTNV HVTQSHV HVWGLSK HVYHSSV HWHPSSV HYGPRSF

HVQGSSV HVSGTSF HVSPSSL HVSSNV HVSTTQF HVTRSSY HVWG QE HVYISST HWHWSSV HYGPSSV

HVQGSVR HVSGTSI HVSPSSV HVSSQF HVSTTQI HVTRSTH HVWGQEL HVYKSSM HWIASSV HYGPSTG

HVQGWSP HVSGTSL HVSPSTF HVSSQI HVSTTQL HVTSKMV HVWGQSP HVYLSSN HWIESSV HYGQHSV

HVQGYEV HVSGTSV HVSPSTI HVSSQL HVSTTQV HVTSRPL HVWGQSY HVYLSSQ HWIGFFV HYGQSAT

HVQGYSV HVSGTTF HVSPSTL HVSSQV H STTSF HVTSSKV HVWGQYY HVYLSSV HWIPDSV HYGQSHY

HVQGYYV HVSGTTI HVSPSTV HVSSSF HVSTTSI HVTSSSV HVWGSAV HVYMSSY HWIWADV HYGQSSN

HVQIPQV HVSGTTL HVSPSYF HVSSSI H STTSL HVTSYHA HVWGSEH HVYNGPV HWLGSSV HYGRSSD

HVQKGHL HVSGTTV HVSPSYI HVSSSL HVSTTSV HVTTFSH HVWGSHH HVYNSSV HWMGSSS HYGRSSV

HVQKSVR HVSGTYF HVSPSYL HVSSSNF HVSTTTF HVTTSSH HVWGSMV HVYNYSV HWMGSSV HYGSLME

HVQLDYV HVSGTYI HVSPSYV HVSSSNI HVSTTTI HVTTSSV HVWGSSD HVYPDSQ HWMKSSV HYGSSFD

HVQLHHV HVSGTYL HVSPTNF HVSSSNL HVSTTTL HVTVESV HVWGSSG HVYPGSV HWMNFSW HYGSSII

HVQLILM HVSGTYV HVSPTNI HVSSSNV HVSTTTV HVTVSKN HVWGSSK HVYQSHV HWMNYSV HYGVESY

HVQMQAL HVSGVGV HVSPTNL HVSSSQF HVSTTV HVTVSSY HVWGSST HVYRLST HWNESLE HYGVTSY

HVQMSMD HVSGWQI HVSPTNV HVSSSQI H STTYF HVTVSYV HVWGSSV HVYRQSE HWNRSET HYGWQGG

HVQMWSD HVSGWSV HVSPTQF HVSSSQL HVSTTYI HVTVYSV HVWGSSW HVYSKMV HWPASSW HYGWSYV

HVQNSSV HVSGWYV HVSPTQI HVSSSQV H STTYL HVTWGSV HVWGSVV HVYTSMV HWPGDSV HYGYSSV

HVQPSFV HVSHQFV HVSPTQL HVSSSSF H STTYV HVTWNSV HVWGSYV H YTSSK HWPGIVV HYHGFSV

HVQQSSV HVSHSSV HVSPTQV HVSSSSI H STYF HVTYRSV HVWGTYV HVYTSSL HWPWVSV HYHTISV

HVQQVEV HVSHYSV HVSPTSF HVSSSSL HVSTYI HVVAHSH HVWGVEV HVYVQSS HWQDESV HYHYWSV

HVQRDSV HVSIRLV HVSPTSI HVSSSSV H STYL HVVDSEV HVWGVSV HVYVSSV HWQSSMV HYIGRSI

HVQRRSV HVSIRSV HVSPTSL HVSSSTF HVSTYV HVVDSSI HVWGYSN HVYWSSV HWRQASY HYIGSNR

HVQRSPV HVSISSV HVSPTSV HVSSSTI HVSVSSQ HVVDSSV HVWHSPV HVYYHKV HWRVSKV HYIISPQ

HVQRSSN HVSKKSR HVSPTTF HVSSSTL HVSVYSV HVVESYV HVWHSSV HVYYSSR HWSGSYV HYLISSV

HVQRSSV HVSKQSV HVSPTTI HVSSSTV HVSWHLF HVVFKSV HVWISKD HWAGPYV HWSWSSV HYLLSSE

HVQSISV HVSMSSD HVSPTTL HVSSSV HVSY F HVVGEQT HVWIYSV HWAGQPR HWTGSVT HYMRYSV

HVQSSLV HVSNNF HVSPTTV HVSSSYF HVSYNI HVVGESV HVWKSMV HWAGSQV HWVGFSV HYNGSDG

HVQTRSL HVSNNI HVSPTYF HVSSSYI HVSYNL HVVGFSA HVWKSSI HWDGDSV HWVGSSV HYNGSSA

HVQVSTV HVSNNL HVSPTYI HVSSSYL HVSYNV HVVGFSN HVWLSSV HWDGSSR HWWGSPV HYNGSTV

HVQWSNV HVSNNV HVSPTYL HVSSSYV HVSYQF HVVGGNV HVWLVSR HWDLSPV HWYGNSV HYNISSS

HVQWSSK HVSNQF HVSPTYV HVSSTF HVSYQI HVVGHEV HVWMSAV HWDLSSV HWYGSHG HYNMSSV

HVQWSSV HVSNQI HVSPWSV HVSSTI HVSYQL HVVGHSY HVWMYSV HWEGISV HWYGSKV HYPGLSV

HVQWSTV HVSNQL HVSQHNM HVSSTL HVSYQV HVVGIYN HVWNQFV HWEQNSV HWYGSSG HYPIHDP

HVQYSEV HVSNQV HVSQNF HVSSTNF HVSYSF HVVG SH HVWNSSI HWGAGKV HWYSSHV HYPWSLA

HVRGHSV HVSNSF HVSQNI HVSSTNI HVSYSI HVVGPSV HVWNSSV HWGASSL HYAFRSV HYQQNGV

HVRQIVV HVS SI HVSQNL HVSSTNL HVSYSL HVVGQPV HVWPWSQ HWGASSV HYAGSSV HYSDSSQ

HVRYENV HVSNSL HVSQNV HVSSTNV HVSYSTH HVVGSIV HVWQSSV HWGDRFS HYAQSYV HYSGRSV

HVRYSSQ HVSNSNF HVSQQF HVSSTQF HVSYSV HVVGSKD HVWRSMW HWGESGV HYAYSSV HYSLQSI

HVSAEMF HVSNS I HVSQQI HVSSTQI HVSYTF HVVGSPL HVWRYPN HWGESNS HYDGSVE HYTDYSV

HVSASSD HVSNS L HVSQQL HVSSTQL HVSYTI HVVGSQK HVWSGPQ HWGFDSM HYDLSSF HYTGIYY

HVSDPNV HVSNSNV HVSQQV HVSSTQV HVSYTL HVVGSQV HVWSKSF HWGGDSY HYDMSMV HYTGTVV

HVSDVSM HVSNSQF HVSQSF HVSSTSF HVSYTSK HVVGSSR HVWSSIV HWGGEFV HYDNGSV HYTLDHV

HVSESGV HVSNSQI HVSQSI HVSSTSI HVSYTV HVVGSSV HVWTPSV HWGGFSE HYDQSPW HYVGQSG

HVSFTST HVS SQL HVSQSL HVSSTSL HVSYYF HVVGSSW HVWTSAI HWGGGIV HYEGNSF HYVGSG

HVSFYSV HVSNSQV HVSQSNF HVSSTSV HVSYYI HVVGSSY HVWTSPN HWGGHSV HYEHQVV HYVGSSF

HVSGASN HVSNSSF HVSQSNI HVSSTTF HVSYYL HVVGSTH HVWTYLV HWGGIEV HYEPNAV HYVHSDH

HVSGASQ HVS SSI HVSQS L HVSSTTI HVSYYV HVVGSTV HVWVGDH HWGGIFP HYESHSD HYVMSHV

HVSGASV HVSNSSL HVSQSNV HVSSTTL HVTAISV HVVGSVV HVWVSPQ HWGGISK HYEVWAL HYVPQSW

HVSGELA HVSNSSV HVSQSQF HVSSTTV HVTALSV HVVGTTV HVWWSHA HWGGLPT HYGAESV HYWGHAV

HVSGGDV HVSNSTF HVSQSQI HVSSTV HVTAQFV HVVGVSV HVWWSYV HWGGNPV HYGAGSV HYWTKSI

HVSGGHR HVSNSTI HVSQSQL HVSSTYF HVTDQTH HVVHQSV HVWYSSV HWGGPSV HYGASLV HYYPKDA

HVSGGKV HVS STL HVSQSQV HVSSTYI HVTDSSQ HVVHSKV HVWYVPQ HWGGRSV HYGASSV IAFTSSQ

HVSGGSF HVSNSTV HVSQSSF HVSSTYL HVTDSSS HVVHSSV HVYASSV HWGGSEV HYGDFSV IAGGNHV

HVSGGSV HVSNSV HVSQSSI HVSSTYV HVTEFID HVVHTFG HVYDVSG HWGGSGV HYGDSGV IAGGSAV

HVSGLSA HVSNSYF HVSQSSL HVSSWHV HVTFSSA HVVHTSY HVYEIAG HWGGSIV HYGEVST IAGMYSV

HVSGLSS HVSNSYI HVSQSSV HVSSYF HVTFSST HVVIWLV HVYESSD HWGGSLV HYGFSGS IAMGLSR

HVSGLSV HVSNSYL HVSQSTF HVSSYI HVTGASW HVVKSSV H YESST HWGGSNV HYGFSIV IAPGESV

HVSGPSL HVSNSYV HVSQSTI HVSSYL HVTGFSV HVVLSSH HVYFYIV HWGGSPW HYGGDSV IAPWSEV

HVSGQDV HVSNTF HVSQSTL HVSSYV HVTGFVM HVVLSSV HVYGALV HWGGSSD HYGGGAY IASPMFF

HVSGSAV HVSNTI HVSQSTV HVSTNF HVTGGSV HVVMIFD HVYGDSV HWGGSSF HYGGGEV IAVTSSW

HVSGSHV HVSNTL HVSQSV HVSTNI HVTGHFV HVVMRSI HVYGESY HWGGSSP HYGGHSL IDAGLIV

HVSGSIV HVSNTNF HVSQSYF HVSTNL HVTGHSA HVVNSER HVYGGST HWGGSSQ HYGGKSP IDGKFSV

HVSGSLI HVSNTNI HVSQSYI HVSTNV HVTGHSR HVVPSIE HVYGGSV HWGGSSS HYGGLSV IDWGFFV

HVSGSLQ HVSNTNL HVSQSYL HVSTQF HVTGKIV HVVPSMI HVYGHSS HWGGSSV HYGGNQV IEEGSSV

HVSGSMV HVSNTNV HVSQSYV HVSTQI HVTGLAV HVVQSDE HVYGKIE HWGGSVR HYGGNSV IEGGSSV

HVSGS F HVSNTQF HVSQTF HVSTQL HVTGLST HVVQSKV HVYGLSF HWGGSYI HYGGPSV IEGMGSR

HVSGS H HVSNTQI HVSQTI HVSTQV HVTG SQ HVVQSLV HVYGLSV HWGGTSV HYGGQMD IEGWSMV

HVSGS I HVSNTQL HVSQTL HVSTSF HVTGPSV HVVQSQV HVYGLSW HWGGVMV HYGGSAV IEGYVSV

HVSGS L HVSNTQV HVSQTNF HVSTSI HVTGSDV HVVRSGI HVYGNSV HWGGYLV HYGGSEV IEHSSLK

HVSGSNV HVSNTSF HVSQTNI HVSTSL HVTGSFE HVVRSSV HVYGPSV HWGIDSI HYGGSFV IESGSYV

HVSGSQF HVSNTSI HVSQTNL H STS F HVTGSHN HVVSQSV HVYGQSV HWGKKGV HYGGSGV IEVGSSV

HVSGSQI HVSNTSL HVSQTNV HVSTSNI HVTGSIM HVVSSNV HVYGRHG HWGKSSV HYGGSHP IFGESSV

HVSGSQL HVSNTSV HVSQTQF H STS L HVTGSMD HVVTPSN HVYGRLA HWGLSEV HYGGSHV IFGGFTV

HVSGSQV HVSNTTF HVSQTQI HVSTSNV HVTGSMV HVVTRSL HVYGRNR HWGLSSY HYGGSIV IFGGLTW

HVSGSSE HVSNTTI HVSQTQL HVSTSQF HVTGSPV HVVTSSV HVYGSER HWGLVSH HYGGSLP IFGGSNE

HVSGSSF HVSNTTL HVSQTQV HVSTSQI HVTGSSG HVVVKMW HVYGSFM HWGMDSW HYGGSSE IFHKSSV

HVSGSSI HVSNTTV HVSQTSF HVSTSQL HVTGSSK HVVVNYV HVYGSHV HWGMQSG HYGGSSM IFIGSDE

HVSGSSL HVSNTV HVSQTSI HVSTSQV HVTGSSM HVVVRSW HVYGSIR HWGMSEA HYGGSSV IFQGSSG

HVSGSSS HVSNTYF HVSQTSL HVSTSSF HVTGSSN HVVVSQV HVYGSMV HWGMSSK HYGGTSM IFVGTSV

HVSGSSV HVSNTYI HVSQTSV HVSTSSI HVTGSSP HVVYSHG HVYGSNV HWGNESR HYGGWSA IFWGSSS

HVSGSTF HVSNTYL HVSQTTF HVSTSSL HVTGSSV HVVYSSV HVYGSPV HWGNKEV HYGGYLR IGGESGV IGGFSSD IVGGSIW KFQKKSN KVGGSSV LAHSGGP LASTHVS LAVSHGP LGASVHT LGHSGVP LGSHGGP

IGHGLSV IVGGSPQ KFQNQQV KVGGSTP LAHSGGS LASTVHG LAVSHGS LGATGHG LGHSGVT LGSHGGT

IGQGISD IVGGSQV KGGLWSV KVGGSVV LAHSGGT LASTVHP LAVSHGT LGATGHP LGHSVAG LGSHGVA

IHFGQII IVGGSSA KGGWSSV KVGGSYV LAHSG G LASTVHS LAVSHVG LGATGHS LGHSVAP LGSHGVP

IHGDTSR IVGGSSD KGTASPV KVGGVTV LAHSGVP LASVGHG LAVSHVP LGATHGG LGHSVAS LGSHGVT

IHGGGSV IVGGSSG KHAWNSV KVGHSSV LAHSG S LASVGHP LAVSHVS LGATHGP LGHSVAT LGSHVAG

IHGGNYW IVGGSSH KHFQSVV KVGISSA LAHSGVT LASVGHS LAVSHVT LGATHGS LGHSVGA LGSHVAP

IHGGSAY IVGGSSV KHGGSAV KVGISSV LAHSVGG LASVGHT LAVSVHG LGATHVG LGHSVGP LGSHVAS

IHGGSPS IVGGSTP KHGMFSF KVGKLSV LAHSVGP LASVHGG LAVSVHP LGATHVP LGHSVGT LGSHVAT

IHGLSEF IVGGSVR KHVGISV KVGKSDV LAHSVGS LASVHGP LAVSVHS LGATHVS LGHSVVA LGSHVGA

IHGQSSV IVGGSVV KIFGSPA KVGKSSE LAHSVGT LASVHGS LAVSVHT LGATVHG LGHSVVP LGSHVGP

IHQGSSP IVGGYSV KIGESIV KVGLSIQ LAHSVVG LASVHGT LAVTGHG LGATVHP LGHSVVT LGSHVGT

IIGFSSV IVGHLSV KIGFSSV KVGLSSV LAHSVVP LASVHVG LAVTGHP LGATVHS LGHTAGG LGSHVVA

IIGGINV IVGHSSV KIGGSSV KVGMPTV LAHSVVS LASVHVP LAVTGHS LGAVGHG LGHTAGP LGSHVVP

IIGGSLV IVGIYSH KIGGTFY KVGMSMS LAHSVVT LASVHVS LAVTHGG LGAVGHP LGHTAGS LGSHVVT

IIGISKG I GKSSV KKATRSV KVGNRSV LAHTGGG LASVHVT LAVTHGP LGAVGHS LGHTAVG LGSPAHG

IIGYSSN IVGLAEK KKGDSSQ KVGNSSG LAHTGGP LASVVHG LAVTHGS LGAVGHT LGHTAVP LGSPAHS

IIPGSPV IVGLESA KKGGFFK KVGNSTV LAHTGGS LASVVHP LAVTHVG LGAVHGG LGHTAVS LGSPAHT

IITDVKV IVGLGST KKGMWMV KVGNVSI LAHTGVG LASVVHS LAVTHVP LGAVHGP LGHTGAG LGSPGHA

IIWGSSV I GLTSV KKGQSSV KVGPSSD LAHTGVP LASVVHT LAVTHVS LGAVHGS LGHTGAP LGSPGHG

IKDGGYK IVG GSG KKGVVTQ KVGPSSV LAHTGVS LATHGGG LAVTVHG LGAVHGT LGHTGAS LGSPGHS

IKGASSV IVGNLSD KKLGGST KVGQSPT LAHTVGG LATHGGP LAVTVHP LGAVHVG LGHTGGA LGSPGHT

IKGGSSV IVGPSSF KLGGSHV KVGQSSW LAHTVGP LATHGGS LAVTVHS LGAVHVP LGHTGGG LGSPHAG

IKGTQGV IVGQSSV KLGGSQV KVGQSYH LAHTVGS LATHGVG LAVVGHG LGAVHVS LGHTGGP LGSPHAS

IKHGSKV IVGQWSE KLGKSID KVGRSSI LAHTVVG LATHGVP LAVVGHP LGAVHVT LGHTGGS LGSPHAT

IKIPSHY IVGTSSV KLITSHV KVGSFSV LAHTVVP LATHGVS LAVVGHS LGAVVHG LGHTGVA LGSPHGA

IKSHTSH IVGTTEV KLNGSSV KVGSNSV LAHTVVS LATHVGG LAVVGHT LGAVVHP LGHTGVG LGSPHGG

ILGEGSG IVGVSTV KLQGKSQ KVGSSSI LAHVGGG LATHVGP LAVVHGG LGAVVHS LGHTGVP LGSPHGS

ILGGISV IVGWSSV KMGGHAV KVGTSTR LAHVGGP LATHVGS LAVVHGP LGAVVHT LGHTGVS LGSPHGT

ILGGLSS IVGYQKV KMGGSSI KVGWGTM LAHVGGS LATHVVG LAVVHGS LGDGHFV LGHTVAG LGSPHVA

ILGGSSM I GYSSV KMGGSSR KVGWNIV LAHVGGT LATHVVP LAVVHGT LGGGGSV LGHTVAP LGSPHVG

ILGPQSV IVGYYSH KMGISSV KVGYSIW LAHVGVG LATHVVS LAVVHVG LGGGSHV LGHTVAS LGSPHVS

ILGWSNV IVHDSHD KMPHSSV KVHGYSV LAHVGVP LATPGHG LAVVHVP LGGGSSP LGHTVGA LGSPHVT

ILGYIGQ IVHGSMV KMQKLQF KVHHSIV LAHVGVS LATPGHS LAVVHVS LGGKLSV LGHTVGG LGSPVHA

ILGYSHV IVHGSSV KMQNSDA KVHHSSH LAHVGVT LATPHGG LAVVHVT LGGNKHV LGHTVGP LGSPVHG

ILPGSIV IVHGVSV KNDGSGF KVHVHSY LAHVVGG LATPHGS LAVVVHG LGGYSSV LGHTVGS LGSPVHS

IMGGSSP IVIIPAV KNGGESV KVIASTK LAH VGP LATPHVG LAVVVHP LGHAESV LGHTVVA LGSPVHT

IMGIGSM IVKNISK KNGQSSD KVIGEPS LAHVVGS LATPHVS LAVVVHS LGHAGGG LGHTVVG LGSSAHG

IMGWHSV IVLESSY KNGYQSN KVIGSSV LAHVVGT LATPVHG LAVVVHT LGHAGGP LGHTVVP LGSSAHP

INGARIR IVLMSEV KNGYYAQ KVIISLH LAH VVG LATPVHS LDGGSLV LGHAGGS LGHTVVS LGSSAHS

INPYSKV IVLVSGV KNQALSQ KVLGSDI LAHVVVP LATSGHG LDGGSSV LGHAGGT LGHVAGG LGSSAHT

INVSSSG IVMGIEV KNQGSSV KVMFAM LAHVVVS LATSGHP LDPGNSL LGHAGVG LGHVAGP LGSSGHA

IPAGSHV IVMGSSD KNVGSNV KVMFSSL LAHVVVT LATSGHS LDPNKST LGHAGVP LGHVAGS LGSSGHP

IPDNPHV IVMGSSK KNWISSL KVMGFSL LAIYDSV LATSHGG LEAGSSV LGHAGVS LGHVAGT LGSSGHT

IPGGKMQ IVMGSSP KNYGESV KVMGHSV LAPGSSR LATSHGP LEEESLM LGHAGVT LGHVAVG LGSSHAG

IPGGSSA IVMHSSV KQGGSFD KVMKSSV LASHGGG LATSHGS LEGGSSQ LGHAVGG LGHVAVP LGSSHAP

IPGRVEM IVMLSKQ KQGLSSV KVMPSAW LASHGGP LATSHVG LEGISHY LGHAVGP LGHVAVS LGSSHAS

IPIGSIV I MVSSV KQPTSSN KVNGGSV LASHGGS LATSHVP LEGTSSG LGHAVGS LGHVAVT LGSSHAT

IQEYVSD IVNGSSV KRGGDST KVNGSSV LASHGGT LATSHVS LELDHHV LGHAVGT LGHVGAG LGSSHGA

IQYESSV I NRSSV KRGKSQV KVPDQSY LASHGVG LATSVHG LEYGSPV LGHAVVG LGHVGAP LGSSHGP

IRGGQEV I NVRSV KRQGSQV KVPYFKV LASHGVP LATSVHP LFMKKNV LGHAVVP LGHVGAS LGSSHGT

IRGGRSV IVPGEEV KRWTSSV KVQGGQH LASHGVS LATSVHS LFQGSSV LGHAVVS LGHVGAT LGSSHVA

IRGTNSV I PTSMV KSGGDAV KVQGSST LASHGVT LATVGHG LFSRSHV LGHAVVT LGHVGGA LGSSHVP

IRIGSIV IVPVSSM KSGGGSV KVQGSSV LASHVGG LATVGHP LFWDPSA LGHPAGG LGHVGGP LGSSHVT

ISEIEKD IVQGDMV KSGGTII KVSFRHV LASH GP LATVGHS LGAHGGG LGHPAGS LGHVGGT LGSSVHA

ISFHSSV IVQGSSD KSTFSEV KVSGKKI LASHVGS LATVHGG LGAHGGP LGHPAGT LGHVGVA LGSSVHP

ISGGFIF IVQGSSV KTGGSSK KVSGQLQ LASHVGT LATVHGP LGAHGGS LGHPAVG LGHVGVP LGSSVHT

ISGGSLV IVSDFMF KTPGSPI KVSYTSV LASHVVG LATVHGS LGAHGGT LGHPAVS LGHVGVT LGSTAHG

ISGGSST IVSGHSN KVAGSAF KVTTSAV LASHVVP LATVHVG LGAHGVG LGHPAVT LGHVVAG LGSTAHP

ISGLGMP IVSGSGV KVDGSSV KVVDPSP LASHVVS LATVHVP LGAHGVP LGHPGAG LGHVVAP LGSTAHS

ISMGDVV IVSGSSV KVEASSV KVVGRYI LASHVVT LATVHVS LGAHGVS LGHPGAS LGHVVAS LGSTGHA

ISWGSSF IVSVSNT KVEGSGV KVVGSDQ LASPGHG LATVVHG LGAHGVT LGHPGAT LG H WAT LGSTGHG

ITFSSSS IVTGSFV KVEGSSV KVVMSSV LASPGHS LATVVHP LGAHVGG LGHPGGA LGHVVGA LGSTGHP

ITGGDSV I VGIS KVFGESV KVWGVSG LASPGHT LATVVHS LGAHVGP LGHPGGG LGHVVGP LGSTGHS

ITGGSSD I VG HF KVFGLSV KVYGTSV LASPHGG LAVHGGG LGAHVGS LGHPGGS LGHVVGT LGSTHAG

ITGGSSV I VGSAV KVFHSHV KVYVKST LASPHGS LAVHGGP LGAHVGT LGHPGGT LGHVVVA LGSTHAP

ITGGYMF I VGVSI KVFNNSV KVYYSIV LASPHGT LAVHGGS LGAHVVG LGHPGVA LGHVVVP LGSTHAS

ITGGYSV IVVIFEV KVFWSTT KWGGLAS LASPHVG LAVHGGT LGAHVVP LGHPGVG LGHVVVT LGSTHGA

ITGHFSN IVWGDSL KVGDDSE KWTGSSY LASPHVS LAVHGVG LGAHVVS LGHPGVS LGSAGHG LGSTHGG

ITIYSSD IVWGSHP KVGGASV KWVQTSN LASPHVT LAVHGVP LGAHVVT LGHPGVT LGSAGHP LGSTHGP

ITMGSSQ IVWNKAD KVGGASW KYDRRER LASPVHG LAVHGVS LGAPGHG LGHPVAG LGSAGHS LGSTHGS

ITYGTKH I YGRSV KVGGDKV KYEGSSV LASPVHS LAVHGVT LGAPGHS LGHPVAS LGSAGHT LGSTHVA

IVDGASI IVYGSSK KVGGDSG KYFGSSV LASPVHT LAVHVGG LGAPGHT LGHPVAT LGSAHGG LGSTHVG

IVDGEQT IWEGAGM KVGGE S KYGASSV LASSGHG LAVHVGP LGAPHGG LGHPVGA LGSAHGP LGSTHVP

IVDGSSD IWFGSMY KVGGFSV KYGESSW LASSGHP LAVHVGS LGAPHGS LGHPVGG LGSAHGS LGSTHVS

IVEGSSV IWGGGSG KVGGGSV KYGGDMV LASSGHS LAVHVGT LGAPHGT LGHPVGS LGSAHGT LGSTVHA

IVFGAMV IWGGLPV KVGGHSV KYGGDSV LASSGHT LAVHVVG LGAPHVG LGHPVGT LGSAHVG LGSTVHG

I FGLAV IWGGSTG KVGGIHV KYPGSSV LASSHGG LAVHVVP LGAPHVS LGHPVVA LGSAHVP LGSTVHP

I FGSSV IWGIHFI KVGGKDN LAGGGMV LASSHGP LAVHVVS LGAPHVT LGHPVVG LGSAHVS LGSTVHS

IVGAKYY IWIGVSV KVGGKSV LAGGGPV LASSHGS LAVHVVT LGAPVHG LGHPVVS LGSAHVT LGSVAHG

IVGDSGV IWWQSSH KVGGLPL LAGGKTR LASSHGT LAVPGHG LGAPVHS LGHPVVT LGSAVHG LGSVAHP

IVGDSSV IYGGVVV KVGGLTN LAGGRSV LASSHVG LAVPGHS LGAPVHT LGHSAGG LGSAVHP LGSVAHS

IVGERAV IYGTWSV KVGGPPV LAGGSSN LASSHVP LAVPGHT LGASGHG LGHSAGP LGSAVHS LGSVAHT

IVGFSSQ IYLRDSV KVGGQLV LAGHSSV LASSHVS LAVPHGG LGASGHP LGHSAGS LGSAVHT LGSVGHA

IVGGAGS IYLRYSV KVGGQSP LAHPGGG LASSHVT LAVPHGS LGASGHS LGHSAGT LGSHAGG LGSVGHP

IVGGESQ KAGGPHV KVGGSDV LAHPGGS LASSVHG LAVPHGT LGASGHT LGHSAVG LGSHAGP LGSVGHT

IVGGESV KAGGSHV KVGGSFS LAHPGGT LASS HP LAVPHVG LGASHGG LGHSAVP LGSHAGS LGSVHAG

IVGGEVV KAGGSSM KVGGSFV LAHPGVG LASSVHS LAVPHVS LGASHGP LGHSAVS LGSHAGT LGSVHAP

IVGGKSV KAGTSKH KVGGSGV LAHPGVS LASSVHT LAVPHVT LGASHGS LGHSAVT LGSHAVG LGSVHAS

IVGGKSW KDGFASH KVGGSKV LAHPGVT LASTGHG LAVPVHG LGASHGT LGHSGAG LGSHAVP LGSVHAT

IVGGLEV KDGGLSF KVGGSMG LAHPVGG LASTGHP LAVPVHS LGASHVG LGHSGAP LGSHAVS LGSVHGA

IVGGLSV KDGQNSD KVGGSMH LAHPVGS LASTGHS LAVPVHT LGASHVP LGHSGAS LGSHAVT LGSVHGP

IVGGLVS KEEPSMV KVGGSMV LAHPVGT LASTHGG LAVSGHG LGASHVS LGHSGAT LGSHGAG LGSVHGT

IVGGNPV KEQVFEV KVGGSPI LAHPVVG LASTHGP LAVSGHP LGASHVT LGHSGGA LGSHGAP LGSVHVA

IVGGQSV KFGKNSK KVGGSSD LAHPVVS LASTHGS LAVSGHS LGASVHG LGHSGGP LGSHGAS LGSVHVP

IVGGRIV KFGMSSN KVGGSSK LAHPVVT LASTHVG LAVSGHT LGASVHP LGHSGGT LGSHGAT LGSVHVT

IVGGRSV KFIRYAV KVGGSSL LAHSGGG LASTHVP LAVSHGG LGASVHS LGHSGVA LGSHGGA LGSVVHA LGSVVHP LGTVHVP LGVTGHP LHGGTSY LHST GS LHTVAVP LHVTAGP LRGLVAV LSHPAGG LSHVGGP

LGSV HT LGTVHVS LGVTGHS LHGLSQV LHST VA LHTVAVS LHVTAGS LRGQEVQ LSHPAGS LSHVGGT

LGTAGHG LGTVVHA LGVTHAG LHSAGGG LHST VG LHTVGAG LHVTAVG LRGRSSV LSHPAGT LSHVGVA

LGTAGHP LGTVVHG LGVTHAP LHSAGGP LHSTVVP LHTVGAP LHVTAVP LRIGESE LSHPAVG LSHVGVP

LGTAGHS LGTVVHP LGVTHAS LHSAGGS LHSTVVS LHTVGAS LHVTAVS LRIWSIV LSHPAVS LSHVGVT

LGTAHGG LGTVVHS LGVTHGA LHSAGGT LHSVAGG LHTVGGA LHVTGAG LRSYSPD LSHPAVT LSHVVAG

LGTAHGP LG AGHG LGVTHGG LHSAG G LHSVAGP LHTVGGG LHVTGAP LSAHGGG LSHPGAG LSHVVAP

LGTAHGS LG AGHP LGVTHGP LHSAGVP LHSVAGS LHTVGGP LHVTGAS LSAHGGP LSHPGAS LSHVVAS

LGTAHVG LG AGHS LGVTHGS LHSAG S LHSVAGT LHTVGGS LHVTGGA LSAHGGS LSHPGAT LSHVVAT

LGTAHVP LGVAGHT LGVTHVA LHSAGVT LHSVAVG LHTVGVA LHVTGGG LSAHGGT LSHPGGA LSHVVGA

LGTAHVS LGVAHGG LGVTHVG LHSAVGG LHSVAVP LHTVGVG LHVTGGP LSAHGVG LSHPGGG LSHVVGP

LGTAVHG LGVAHGP LGVTHVP LHSAVGP LHSVAVS LHTVGVP LHVTGGS LSAHGVP LSHPGGS LSHVVGT

LGTAVHP LGVAHGS LGVTHVS LHSAVGS LHSVAVT LHTVGVS LHVTGVA LSAHGVS LSHPGGT LSHVVVA

LGTAVHS LGVAHGT LGVTVHA LHSAVGT LHSVGAG LHTVVAG LHVTGVG LSAHGVT LSHPGVA LSHVVVP

LGTGSAV LGVAHVG LGVTVHG LHSAVVG LHSVGAP LHTVVAP LHVTGVP LSAHVGG LSHPGVG LSHVVVT

LGTHAGG LGVAHVP LGVTVHP LHSAVVP LHSVGAS LHTVVAS LHVTGVS LSAHVGP LSHPGVS LSMGSSI

LGTHAGP LGVAHVS LGVTVHS LHSAVVS LHSVGAT LHTVVGA LHVTVAG LSAHVGS LSHPGVT LSSAGHG

LGTHAGS LGVAHVT LGVVAHG LHSAVVT LHSVGGA LHTVVGG LHVTVAP LSAHVGT LSHPVAG LSSAGHP

LGTHAVG LGVAVHG LGVVAHP LHSPAGG LHSVGGP LHTVVGP LHVTVAS LSAHVVG LSHPVAS LSSAGHS

LGTHAVP LG AVHP LGVVAHS LHSPAGS LHSVGGT LHTVVGS LHVTVGA LSAHVVP LSHPVAT LSSAGHT

LGTHAVS LGVAVHS LGVVAHT LHSPAGT LHSVGVA LHTVVVA LHVTVGG LSAHVVS LSHPVGA LSSAHGG

LGTHGAG LGVAVHT LGVVGHA LHSPAVG LHSVGVP LHTVVVG LHVTVGP LSAHVVT LSHPVGG LSSAHGP

LGTHGAP LGVHAGG LGVVGHP LHSPAVS LHSVGVT LHTVVVP LHVTVGS LSAPGHG LSHPVGS LSSAHGS

LGTHGAS LG HAGP LGVVGHT LHSPAVT LHSVVAG LHTVVVS LHVTVVA LSAPGHS LSHPVGT LSSAHGT

LGTHGGA LGVHAGS LGVVHAG LHSPGAG LHSVVAP LHVAGGG LHVTVVG LSAPGHT LSHPVVA LSSAHVG

LGTHGGG LGVHAGT LGVVHAP LHSPGAS LHSVVAS LHVAGGP LHVTVVP LSAPHGG LSHPVVG LSSAHVP

LGTHGGP LG HAVG LGVVHAS LHSPGAT LHSVVAT LHVAGGS LHVTVVS LSAPHGS LSHPVVS LSSAHVS

LGTHGGS LG HAVP LG WHAT LHSPGGA LHSVVGA LHVAGGT LHVVAGG LSAPHGT LSHPVVT LSSAHVT

LGTHGVA LG HAVS LGVVHGA LHSPGGG LHSVVGP LHVAGVG LHVVAGP LSAPHVG LSHSAGG LSSAVHG

LGTHGVG LGVHAVT LGVVHGP LHSPGGS LHSVVGT LHVAGVP LHVVAGS LSAPHVS LSHSAGP LSSA HP

LGTHGVP LGVHGAG LGVVHGT LHSPGGT LHSVVVA LHVAGVS LHVVAGT LSAPHVT LSHSAGS LSSAVHS

LGTHGVS LGVHGAP LGVVHVA LHSPGVA LHSVVVP LHVAGVT LHVVAVG LSAPVHG LSHSAGT LSSAVHT

LGTHVAG LGVHGAS LGVVHVP LHSPGVG LHSVVVT LHVAVGG LHVVAVP LSAPVHS LSHSAVG LSSHAGG

LGTHVAP LGVHGAT LGVVHVT LHSPGVS LHTAGGG LHVAVGP LHVVAVS LSAPVHT LSHSAVP LSSHAGP

LGTHVAS LGVHGGA LG VVHA LHSPGVT LHTAGGP LHVAVGS LHVVAVT LSASGHG LSHSAVS LSSHAGS

LGTHVGA LGVHGGP LGVVVHP LHSPVAG LHTAGGS LHVAVGT LH VGAG LSASGHP LSHSAVT LSSHAGT

LGTHVGG LGVHGGT LGVVVHT LHSPVAS LHTAGVG LHVAVVG LHVVGAP LSASGHS LSHSGAG LSSHAVG

LGTHVGP LGVHGVA LHAPGGG LHSPVAT LHTAGVP LHVAVVP LH VGAS LSASGHT LSHSGAP LSSHA P

LGTHVGS LGVHGVP LHAPGGS LHSPVGA LHTAGVS LHVAVVS LH VGAT LSASHGG LSHSGAS LSSHAVS

LGTHVVA LGVHGVT LHAPGGT LHSPVGG LHTAVGG LHVAVVT LHVVGGA LSASHGP LSHSGAT LSSHAVT

LGTHVVG LGVHVAG LHAPGVG LHSPVGS LHTAVGP LHVPAGG LHVVGGP LSASHGS LSHSGGA LSSHGAG

LGTHVVP LGVHVAP LHAPGVS LHSPVGT LHTAVGS LHVPAGS LHVVGGT LSASHGT LSHSGGP LSSHGAP

LGTHVVS LGVHVAS LHAPGVT LHSPVVA LHTAVVG LHVPAGT LH VG A LSASHVG LSHSGGT LSSHGAS

LGTPAHG LGVHVAT LHAPVGG LHSPVVG LHTAVVP LHVPAVG LHVVGVP LSASHVP LSHSGVA LSSHGAT

LGTPAHS LGVHVGA LHAPVGS LHSPVVS LHTAVVS LHVPAVS LHVVGVT LSASHVS LSHSGVP LSSHGGA

LGTPGHA LGVHVGP LHAPVGT LHSPVVT LHTPAGG LHVPAVT LHVVVAG LSASHVT LSHSGVT LSSHGGP

LGTPGHG LGVHVGT LHAPVVG LHSSAGG LHTPAGS LHVPGAG LHVVVAP LSASVHG LSHSVAG LSSHGGT

LGTPGHS LGVHVVA LHAPVVS LHSSAGP LHTPAVG LHVPGAS LHVVVAS LSAS HP LSHSVAP LSSHGVA

LGTPHAG LGVHVVP LHAPVVT LHSSAGS LHTPAVS LHVPGAT LHVVVAT LSASVHS LSHSVAS LSSHGVP

LGTPHAS LGVHVVT LHASGGG LHSSAGT LHTPGAG LHVPGGA LH VVGA LSASVHT LSHSVAT LSSHGVT

LGTPHGA LGVPAHG LHASGGP LHSSAVG LHTPGAS LHVPGGG LHVVVGP LSATGHG LSHSVGA LSSHVAG

LGTPHGG LGVPAHS LHASGGS LHSSAVP LHTPGGA LHVPGGS LHVVVGT LSATGHP LSHSVGP LSSHVAP

LGTPHGS LG PAHT LHASGGT LHSSAVS LHTPGGG LHVPGGT LHVVVVA LSATGHS LSHSVGT LSSHVAS

LGTPHVA LG PGHA LHASGVG LHSSAVT LHTPGGS LHVPGVA LHVVVVP LSATHGG LSHSVVA LSSHVAT

LGTPHVG LGVPGHG LHASG P LHSSGAG LHTPGVA LHVPGVG LHVVVVT LSATHGP LSHSVVP LSSHVGA

LGTPHVS LGVPGHS LHASGVS LHSSGAP LHTPGVG LHVPGVS LIAFTYV LSATHGS LSHSVVT LSSHVGP

LGTPVHA LG PGHT LHASGVT LHSSGAS LHTPGVS LHVPGVT LIGGSSE LSATHVG LSHTAGG LSSHVGT

LGTPVHG LGVPHAG LHASVGG LHSSGAT LHTPVAG LHVPVAG LIGGSSV LSATHVP LSHTAGP LSSHVVA

LGTPVHS LGVPHAS LHAS GP LHSSGGA LHTPVAS LHVPVAS LIPHSFR LSATHVS LSHTAGS LSSHVVP

LGTSAHG LGVPHAT LHASVGS LHSSGGP LHTPVGA LHVPVAT LKGGLKL LSATVHG LSHTAVG LSSHVVT

LGTSAHP LGVPHGA LHASVGT LHSSGGT LHTPVGG LHVPVGA LKGGPSV LSATVHP LSHTAVP LSSPAHG

LGTSAHS LGVPHGG LHASVVG LHSSGVA LHTPVGS LHVPVGG LKGGSFP LSATVHS LSHTAVS LSSPAHS

LGTSGHA LGVPHGS LHASVVP LHSSGVP LHTPVVA LHVPVGS LKWGSIV LSAVGHG LSHTGAG LSSPAHT

LGTSGHG LGVPHGT LHASVVS LHSSGVT LHTPVVG LHVPVGT LKYGPSV LSAVGHP LSHTGAP LSSPGHA

LGTSGHP LGVPHVA LHASVVT LHSSVAG LHTPVVS LHVPVVA LKYGVSV LSAVGHS LSHTGAS LSSPGHG

LGTSGHS LGVPHVG LHATGGG LHSSVAP LHTSAGG LHVPVVG LLGGSSR LSAVGHT LSHTGGA LSSPGHS

LGTSHAG LGVPHVS LHATGGP LHSSVAS LHTSAGP LHVPVVS LLGPNSV LSAVHGG LSHTGGG LSSPGHT

LGTSHAP LGVPHVT LHATGGS LHSSVAT LHTSAGS LHVPVVT LLHDSSH LSAVHGP LSHTGGP LSSPHAG

LGTSHAS LG P HA LHATGVG LHSSVGA LHTSAVG LH SAGG LLPQSVV LSAVHGS LSHTGGS LSSPHAS

LGTSHGA LGVPVHG LHATGVP LHSSVGP LHTSAVP LH SAGP LLWFFLE LSAVHGT LSHTGVA LSSPHAT

LGTSHGG LGVPVHS LHATGVS LHSSVGT LHTSAVS LH SAGS LLYGWKH LSAVHVG LSHTGVG LSSPHGA

LGTSHGP LGVPVHT LHATVGG LHSSVVA LHTSGAG LH SAGT LMAYWEE LSAVHVP LSHTGVP LSSPHGG

LGTSHGS LGVSAHG LHATVGP LHSSVVP LHTSGAP LH SA G LMGGKQK LSAVHVS LSHTGVS LSSPHGS

LGTSH A LG SAHP LHATVGS LHSSVVT LHTSGAS LHVSAVP LMGGSAH LSAVHVT LSHTVAG LSSPHGT

LGTSHVG LGVSAHS LHAT VG LHSTAGG LHTSGGA LHVSAVS LMGMASG LSAVVHG LSHTVAP LSSPHVA

LGTSHVP LG SAHT LHATVVP LHSTAGP LHTSGGG LHVSAVT LMGMSPA LSAVVHP LSHTVAS LSSPHVG

LGTSHVS LG SGHA LHATVVS LH STAGS LHTSGGP LHVSGAG LMGSFQT LSAVVHS LSHTVGA LSSPHVS

LGTSVHA LG SGHP LHAVGGG LHSTA G LHTSGGS LHVSGAP LMYAWSV LSAVVHT LSHTVGG LSSPHVT

LGTSVHG LG SGHT LHAVGGP LHSTAVP LHTSGVA LHVSGAS LNGGSSA LSFGSSV LSHTVGP LSSPVHA

LGTSVHP LGVSHAG LHAVGGS LHSTA S LHTSGVG LHVSGAT LNHWSSM LSGGSSV LSHTVGS LSSPVHG

LGTSVHS LG SHAP LHAVGGT LHSTGAG LHTSGVP LHVSGGA LNHWSSV LSGVSSV LSHTVVA LSSPVHS

LGTVAHG LGVSHAS LHAVGVG LHSTGAP LHTSGVS LHVSGGP LNKGSVT LSHAGGG LSHTVVG LSSPVHT

LGTVAHP LG SHAT LHAVGVP LHSTGAS LHTSVAG LHVSGGT LNKGSYV LSHAGGP LSHTVVP LSSSAHG

LGTVAHS LGVSHGA LHAVGVS LHSTGGA LHTSVAP LHVSGVA LNLMSMV LSHAGGS LSHTVVS LSSSAHP

LGTVGHA LGVSHGP LHAVGVT LHSTGGG LHTSVAS LHVSGVP LNMNSSY LSHAGGT LSHVAGG LSSSAHS

LGTVGHG LGVSHGT LHAVVGG LHSTGGP LHTSVGA LHVSGVT LNMYWGV LSHAGVG LSHVAGP LSSSAHT

LGTVGHP LG SH A LHAVVGP LHSTGGS LHTSVGG LHVSVAG LPEGKSF LSHAGVP LSHVAGS LSSSGHA

LGTVGHS LGVSHVP LHAVVGS LHSTG A LHTSVGP LHVSVAP LPGDSHV LSHAGVS LSHVAGT LSSSGHP

LGTVHAG LGVSHVT LHAVVGT LHSTG G LHTSVGS LHVSVAS LPGGRSV LSHAGVT LSHVAVG LSSSGHT

LGTVHAP LGVSVHA LHAVVVG LHSTGVP LHTSVVA LHVSVAT LPIGSSD LSHAVGG LSHVAVP LSSSHAG

LGTVHAS LGVSVHP LHAVVVP LHSTG S LHTSVVG LHVSVGA LPKWSSV LSHAVGP LSHVAVS LSSSHAP

LGTVHGA LG S HT LHAVVVS LHST AG LHTSVVP LHVSVGP LQAGSPF LSHAVGS LSHVAVT LSSSHAS

LGTVHGG LGVTAHG LHAVVVT LHSTVAP LHTSVVS LHVSVGT LQGKSYV LSHAVGT LSHVGAG LSSSHAT

LGTVHGP LGVTAHP LHGASSV LHST AS LHTVAGG LHVSVVA LQNTSIF LSHAVVG LSHVGAP LSSSHGA

LGTVHGS LGVTAHS LHGGGSV LHSTVGA LHTVAGP LHVSVVP LQYGGSV LSHAVVP LSHVGAS LSSSHGP

LGTVHVA LGVTGHA LHGGPSL LHST GG LHTVAGS LHVSVVT LRAYNSV LSHAVVS LSHVGAT LSSSHGT

LGTVHVG LGVTGHG LHGGSSV LHST GP LHTVAVG LHVTAGG LRGGYMY LSHAVVT LSHVGGA LSSSHVA LSSSHVP LSTPHGS LSVPAHT LTAPHGS LTHVAVS LTSSHVP LTVSHGG LVGRTQF MKGGVHV MVGLSLP

LSSSHVT LSTPHVA LSVPGHA LTAPH G LTHVGAG LTSSHVS LTVSHGP LVGSSSF MKGRFSD MVGMDQS

LSSSVHA LSTPHVG LSVPGHG LTAPH S LTHVGAP LTSSVHA LTVSHGS LVGSSSV MKHGISI MVGMHSV

LSSS HP LSTPHVS LSVPGHS LTAPVHG LTHVGAS LTSSVHG LTVSH A LVGYSSV MLAGTIV MVGMSSL

LSSSVHT LSTPVHA LSVPGHT LTAPVHS LTHVGGA LTSS HP LTVSH G LVHGSHA MLGGSSV MVGMSSV

LSSTAHG LSTPVHG LS PHAG LTASGHG LTHVGGG LTSSVHS LTVSHVP LVHGSSI MLGGYSF MVGMSTR

LSSTAHP LSTPVHS LS PHAS LTASGHP LTHVGGP LTSVAHG LTVSHVS LVIGHLA MLLGSHN MVGPHEI

LSSTAHS LSTSAHG LS PHAT LTASGHS LTHVGGS LTSVAHP LTVSVHA LVIGQYW MLMGSSG MVGPSEV

LSSTGHA LSTSAHP LSVPHGA LTASHGG LTHVGVA LTSVAHS LTVSVHG LVIGWVV MLNGSSV MVGRSSS

LSSTGHG LSTSAHS LSVPHGG LTASHGP LTHVGVG LTSVGHA LTVS HP LVKGSSV MLWMPSN MVGRSSV

LSSTGHP LSTSGHA LSVPHGS LTASHGS LTHVGVP LTSVGHG LTVSVHS LVLRSSV MMGESPV MVGSRLS

LSSTGHS LSTSGHG LSVPHGT LTASHVG LTHVGVS LTSVGHP LTVVAHG LVLVSLV MMGHRHV MVGSSSV

LSSTHAG LSTSGHP LSVPHVA LTASHVP LTHVVAG LTSVGHS LTVVAHP LVLVSSW MMGISFN MVGSSYR

LSSTHAP LSTSGHS LSVPHVG LTASHVS LTHVVAP LTSVHAG LTVVAHS LVMGKLV MMNPSLV MVGTSIV

LSSTHAS LSTSHAG LS PHVS LTASVHG LTHVVAS LTSVHAP LTVVGHA LVMG T MMQGTSV MVGVRSV

LSSTHGA LSTSHAP LSVPHVT LTASVHP LTHVVGA LTSVHAS LTVVGHG LVMGSMY MMYGVQG MVGVSLM

LSSTHGG LSTSHAS LSVPVHA LTASVHS LTHVVGG LTSVHGA LTVVGHP LVNGPSH MMYIRKS MVIIISV

LSSTHGP LSTSHGA LSVPVHG LTAVGHG LTHVVGP LTSVHGG LTVVGHS LVNGTSH M GGFQA MVIWSSV

LSSTHGS LSTSHGG LSVPVHS LTAVGHP LTHVVGS LTSVHGP LTVVHAG LVNGWST MNGGSDV MVKGSSV

LSSTHVA LSTSHGP LSVPVHT LTAVGHS LTHVVVA LTSVHGS LTVVHAP LVNKGYV MNGGSSV MVLGSVV

LSSTHVG LSTSHGS LSVSAHG LTAVHGG LTHVVVG LTSVHVA LTVVHAS LVNLSSV MNGGTVV MVLHSDV

LSSTHVP LSTSH A LSVSAHP LTAVHGP LTHVVVP LTSVHVG LTVVHGA L PEAS MNQLSAV MVMGRSV

LSSTHVS LSTSH G LSVSAHS LTAVHGS LTHVVVS LTSVHVP LTVVHGG LVPGSSE MNSVVSV MVMGSYV

LSSTVHA LSTSHVP LSVSAHT LTAVHVG LTMGAST LTSVHVS LTVVHGP LVPLKMV MPGGSKK MVMMSKD

LSSTVHG LSTSHVS LSVSGHA LTAVHVP LTQFWPV LTSVVHA LTVVHGS LVQGYEV MPGGSST MVMNSSY

LSSTVHP LSTSVHA LSVSGHP LTAVHVS LTSAGHG LTSVVHG LTVVHVA LVQVPST MPGTSPV MVNGSAV

LSSTVHS LSTSVHG LSVSGHT LTAVVHG LTSAGHP LTSVVHP LTVVHVG LVSASTF MPG KSY MVNGSSV

LSSVAHG LSTS HP LSVSHAG LTAVVHP LTSAGHS LTSVVHS LTVVHVP LVSGETV MPSNSSN MVPGKSV

LSSVAHP LSTSVHS LSVSHAP LTA VHS LTSAHGG LTVAGHG LTVVHVS LVSGRSL MQMSSDV MVPGSGV

LSSVAHS LSTVAHG LSVSHAS LTGAEHM LTSAHGP LTVAGHP LTVVVHA LVSGSSV MQTGQMM MVPHSSV

LSSVAHT LSTVAHP LSVSHAT LTGGLSV LTSAHGS LTVAGHS LTVVVHG LVTGSLW MQTVSNV MVQESSV

LSSVGHA LSTVAHS LSVSHGA LTGGWSV LTSAHVG LTVAHGG LT VHP LVTKSSM MQWQHSV MVQGVST

LSSVGHP LSTVGHA LSVSHGP LTHAGGG LTSAHVP LTVAHGP LTVVVHS LVTYSHV MRGGFSV MVQSSEV

LSSVGHT LSTVGHG LSVSHGT LTHAGGP LTSAHVS LTVAHGS LTYTSYV LVVGESQ MRGGSKQ MVQVIAD

LSSVHAG LSTVGHP LSVSHVA LTHAGGS LTSAVHG LTVAH G LVADSSR LVVGSSV MRGYSSV MVRLSSV

LSSVHAP LSTVGHS LSVSHVP LTHAGVG LTSAVHP LTVAHVP LVAGSSY LVWESSV MRSGSLM MVSGKVT

LSSVHAS LSTVHAG LSVSHVT LTHAG P LTSAVHS LTVAH S LVAMLSV LVWGGSV MRTGSSE MVTGHSP

LSSVHAT LSTVHAP LSVSVHA LTHAGVS LTSHAGG LTVAVHG LVAQSPQ LVWGKYV MSAFSSV MVTGSSH

LSSVHGA LSTVHAS LSVS HP LTHAVGG LTSHAGP LTVA HP LVDGHSM LVWPTSR MSGGDMT MVTGSSY

LSSVHGP LSTVHGA LSVSVHT LTHA GP LTSHAGS LTVAVHS LVDGSSV LVYFSSV MSGGSST MVTGSYV

LSSVHGT LSTVHGG LSVTAHG LTHAVGS LTSHAVG LTVDSSV LVDHFST LVYNSTD MSGRWSV MVVGRNS

LSSVHVA LSTVHGP LSVTAHP LTHAVVG LTSHAVP LTVHAGG LVDRNHE LVYRSSV MSGVYGV MVVGSSK

LSSVHVP LSTVHGS LSVTAHS LTHAVVP LTSHAVS LTVHAGP LVEGASV LVYWSHI MSNGDST MVVGSSN

LSSVHVT LSTVHVA LSVTGHA LTHAVVS LTSHGAG LTVHAGS LVEGSGV LWGNFSD MSTPWQY MVWGISV

LSSVVHA LSTVHVG LSVTGHG LTHPAGG LTSHGAP LTVHAVG LVEGWVV LWGRSSW MTFGSSV MVWGSSR

LSSVVHP LSTVHVP LSVTGHP LTHPAGS LTSHGAS LTVHA P LVFASSG LWHGRYT MTGGLSD MVYGLFV

LSSVVHT LSTVHVS LSVTGHS LTHPA G LTSHGGA LTVHAVS LVFGSSA LYGGSHV MTGGSLV MVYGSSV

LSTAGHG LSTVVHA LSVTHAG LTHPA S LTSHGGG LTVHGAG LVFRSSH LYGLDEW MTGLYVE MWGGSSF

LSTAGHP LSTVVHG LSVTHAP LTHPGAG LTSHGGP LTVHGAP LVGATMV LYGNPYV MTGSSQN MWGYSKV

LSTAGHS LSTVVHP LSVTHAS LTHPGAS LTSHGGS LTVHGAS LVGDSAQ MAGGGSR MTPGASR MYGGSSA

LSTAHGG LSTVVHS LSVTHGA LTHPGGA LTSHG A LTVHGGA LVGESSL MAGGSYV MTPNWTV MYGQSKV

LSTAHGP LSVAGHG LSVTHGG LTHPGGG LTSHG G LTVHGGG LVGESSQ MAGGVSG MVAGEVE MYGSASA

LSTAHGS LSVAGHP LSVTHGP LTHPGGS LTSHGVP LTVHGGP LVGFESH MAGHTSQ MVAGQAV MYGVSVV

LSTAH G LSVAGHS LSVTHGS LTHPG A LTSHG S LTVHGGS LVGFVLV MAGKSSW MVDGHSV MYNGSQV

LSTAHVP LSVAGHT LSVTHVA LTHPG G LTSH AG LTVHGVA LVGGAAV MAGMGSV MVDGSPF MYQTSFV

LSTAH S LSVAHGG LSVTHVG LTHPG S LTSHVAP LTVHGVG LVGGADV MAG ST MVDWSSV MYTAQSI

LSTAVHG LSVAHGP LSVTHVP LTHPVAG LTSH AS LTVHGVP LVGGASD MAGRSGV MVEGVKH MYWGSSV

LSTA HP LSVAHGS LSVTHVS LTHPVAS LTSHVGA LTVHGVS LVGGASF MAHWWMV MVEKANK NAGRSHA

LSTAVHS LSVAHGT LSVTVHA LTHPVGA LTSH GG LTVHVAG LVGGAYS MANGNKL MVFGSSV name

LSTGHSV LSVAHVG LSVTVHG LTHPVGG LTSH GP LTVHVAP LVGGEAV MAYDSIV MVFWRSE NATGASA

LSTHAGG LSVAHVP LSVTVHP LTHPVGS LTSH GS LTVHVAS LVGGGSW MDFGSSV MVFYSGR NDGGSSG

LSTHAGP LSVAHVS LSVTVHS LTHPVVA LTSH VA LTVHVGA LVGGHIV MDGDNSV MVGAWSF NDHHSSV

LSTHAGS LSVAHVT LSVVAHG LTHPVVG LTSH VG LTVHVGG LVGGISW MDGGSSK MVGDAVN DLGKSW

LSTHAVG LSVAVHG LSVVAHP LTHPVVS LTSHVVP LTVHVGP LVGGKEV MDGLNIV MVGDYSV NDMASFV

LSTHA P LSVA HP LSVVAHS LTHSAGG LTSHVVS LTVHVGS LVGGPSS MEDGSSV MVGESSN NDYGVNV

LSTHAVS LSVAVHS LSVVAHT LTHSAGP LTSPAHG LTVHVVA LVGGPVK MEGFQDV MVGESSV NDYIHSP

LSTHGAG LSVAVHT LSVVGHA LTHSAGS LTSPAHS LTVHVVG LVGGRSV MEGRSSV MVGETSV NEAGSNF

LSTHGAP LSVHAGG LSVVGHP LTHSAVG LTSPGHA LTVHVVP LVGGSEV MELESSV MVGFSSV NEAGSNI

LSTHGAS LSVHAGP LSVVGHT LTHSAVP LTSPGHG LTVHVVS LVGGSIT MEWQTSV MVGGDSP NEAGSNL

LSTHGGA LSVHAGS LSVVHAG LTHSAVS LTSPGHS LTVPAHG LVGGSSD MFDGSHS MVGGEEV NEAGSNV

LSTHGGG LSVHAGT LSVVHAP LTHSGAG LTSPHAG LTVPAHS LVGGSSV MFGMQFV MVGGESV NEAGSQF

LSTHGGP LSVHAVG LSVVHAS LTHSGAP LTSPHAS LTVPGHA LVGGSTV MFGSFSV MVGGFSH NEAGSQI

LSTHGGS LSVHA P LSVVHAT LTHSGAS LTSPHGA LTVPGHG LVGGTSV MFSRPVF MVGGFSV NEAGSQL

LSTHGVA LSVHAVS LSVVHGA LTHSGGA LTSPHGG LTVPGHS LVGGVSA MGFSLSV MVGGIND NEAGSQV

LSTHGVG LSVHAVT LSVVHGP LTHSGGG LTSPHGS LTVPHAG LVGGVSF MGFVSIQ MVGGISV NEAGSSF

LSTHGVP LSVHGAG LSVVHGT LTHSGGP LTSPH A LTVPHAS LVGGWLV MGGGDSV MVGGKNV NEAGSSI

LSTHGVS LSVHGAP LSVVHVA LTHSGGS LTSPH G LTVPHGA LVGGYSP MGGGSSE MVGGLSF NEAGSSL

LSTHVAG LSVHGAS LSVVHVP LTHSGVA LTSPHVS LTVPHGG LVGHKFA MGGGSSG MVGGSEI NEAGSSV

LSTHVAP LSVHGAT LSVVHVT LTHSGVG LTSPVHA LTVPHGS LVGHSNM MGGWSSS MVGGSEV NEAGSTF

LSTHVAS LSVHGGA LSVVVHA LTHSGVP LTSPVHG LTVPHVA LVGHSSI MGLGRSV MVGGSFR NEAGSTI

LSTHVGA LSVHGGP LSVVVHP LTHSGVS LTSPVHS LTVPHVG LVGHSSV MGPGSSV MVGGSGV NEAGSTL

LSTHVGG LSVHGGT LSVVVHT LTHSVAG LTSSAHG LTVPHVS LVGIQSV MGVSWNV MVGGSPQ NEAGSTV

LSTHVGP LSVHGVA LTAHGGG LTHSVAP LTSSAHP LTVPVHA LVGKSSV MHDGSAV MVGGSSE NEAGSYF

LSTHVGS LSVHGVP LTAHGGP LTHSVAS LTSSAHS LTVPVHG LVGLDAQ MHGASSV MVGGSSM NEAGSYI

LSTHVVA LSVHGVT LTAHGGS LTHSVGA LTSSGHA LTVPVHS LVGLSAL MHGGATV MVGGSSP NEAGSYL

LSTHVVG LSVHVAG LTAHGVG LTHSVGG LTSSGHG LTVRSDV LVGLSDH MHGGSGV MVGGSSQ NEAGSYV

LSTHVVP LSVHVAP LTAHGVP LTHSVGP LTSSGHP LTVSAHG LVGLSEF MHGGSSV MVGGSSV NEAGTNF

LSTHVVS LSVHVAS LTAHG S LTHSVGS LTSSGHS LTVSAHP LVGMSGQ MHGPSYH MVGGSSY NEAGTNI

LSTPAHG LSVHVAT LTAHVGG LTHSVVA LTSSHAG LTVSAHS LVGMSSV MHGYGIV MVGGSTD NEAGTNL

LSTPAHS LSVHVGA LTAHVGP LTHSVVG LTSSHAP LTVSGHA LVGNEVV MHSTSSF MVGGSYV NEAGTNV

LSTPGHA LSVHVGP LTAH GS LTHSVVP LTSSHAS LTVSGHG LVG VFL MHVGVFI MVGGVKV NEAGTQF

LSTPGHG LSVHVGT LTAHVVG LTHSVVS LTSSHGA LTVSGHP LVG LV MHYGGME MVGGYSS NEAGTQI

LSTPGHS LSVHVVA LTAHVVP LTHVAGG LTSSHGG LTVSGHS LVGPNSH M IDG LSI MVGGYSV NEAGTQL

LSTPHAG LSVHVVP LTAH VS LTHVAGP LTSSHGP LTVSHAG LVGQSAV MIGPRSV MVGHKML NEAGTQV

LSTPHAS LSVHVVT LTAPGHG LTHVAGS LTSSHGS LTVSHAP LVGREGV MIMGSSP MVGHSSV NEAGTSF

LSTPHGA LSVPAHG LTAPGHS LTHVAVG LTSSHVA LTVSHAS LVGRRFV MKDEPGY MVGHSYV NEAGTSI

LSTPHGG LSVPAHS LTAPHGG LTHVAVP LTSSHVG LTVSHGA LVGRSSV MKGGSSD MVGIEST NEAGTSL EAGTSV NEAPTSF EASSTL EAY L NEGNTNV NEGQTNF NEGTSNI NESGTQV NESPTQF NESSSSL EAGTTF NEAPTSI NEASSTV EAYNV NEGNTQF NEGQTNI NEGTSNL NESGTSF NESPTQI NESSSSV

NEAGTTI NEAPTSL NEASS NEAYQF NEGNTQI NEGQTNL NEGTSNV NESGTSI NESPTQL NESSSTF

NEAGTTL NEAPTSV NEASSYF NEAYQI NEGNTQL NEGQTNV NEGTSQF NESGTSL NESPTQV NESSSTI

NEAGTTV NEAPTTF NEASSYI NEAYQL NEGNTQV NEGQTQF NEGTSQI NESGTSV NESPTSF NESSSTL

NEAGTYF NEAPTTI EASSYL NEAYQV NEGNTSF NEGQTQI NEGTSQL NESGTTF NESPTSI NESSSTV

NEAGTYI NEAPTTL NEASSYV NEAYSF NEGNTSI NEGQTQL NEGTSQV NESGTTI NESPTSL NESSSV

NEAGTYL NEAPTTV NEASTF NEAYSI NEGNTSL NEGQTQV NEGTSSF NESGTTL NESPTSV NESSSYF

NEAGTYV NEAPTYF NEASTI NEAYSL NEGNTSV NEGQTSF NEGTSSI NESGTTV NESPTTF NESSSYI

NEANNF NEAPTYI NEASTL NEAYSV NEGNTTF NEGQTSI NEGTSSL NESGTYF NESPTTI NESSSYL

NEANNI NEAPTYL NEASTNF NEAYTF NEGNTTI NEGQTSL NEGTSSV NESGTYI NESPTTL NESSSYV

NEANNL NEAPTYV NEASTNI NEAYTI NEGNTTL NEGQTSV NEGTSTF NESGTYL NESPTTV NESSTF

NEANNV NEAQNF NEASTNL NEAYTL NEGNTTV NEGQTTF NEGTSTI NESGTYV NESPTYF NESSTI

NEANQF NEAQNI NEASTNV NEAYTV NEGNTV NEGQTTI NEGTSTL NESNNF NESPTYI NESSTL

NEANQI NEAQNL NEASTQF NEAYYF NEGNTYF NEGQTTL NEGTSTV NESNNI NESPTYL NESSTNF

NEANQL NEAQNV NEASTQI EAYYI NEGNTYI NEGQTTV NEGTSV NESNNL NESPTYV NESSTNI

NEANQV NEAQQF NEASTQL NEAYYL NEGNTYL NEGQTV NEGTSYF NESNNV NESQNF NESSTNL

NEANSF NEAQQI NEASTQV EAYYV NEGNTYV NEGQTYF NEGTSYI NESNQF NESQNI NESSTNV

NEANSI NEAQQL NEASTSF NEGGNSV NEGNYF NEGQTYI NEGTSYL NESNQI NESQNL NESSTQF

NEANSL NEAQQV NEASTSI NEGGSNF NEGNYI NEGQTYL NEGTSYV NESNQL NESQNV NESSTQI

NEANSNF NEAQSF NEASTSL NEGGSNI NEGNYL NEGQTYV NEGTTF NESNQV NESQQF NESSTQL

NEANSNI NEAQSI EASTS NEGGSNL NEGNYV NEGQYF NEGTTI NESNSF NESQQI NESSTQV

NEANSNL NEAQSL NEASTTF NEGGSNV NEGPSNF NEGQYI NEGTTL NESNSI NESQQL NESSTSF

NEANSNV NEAQSNF NEASTTI NEGGSQF NEGPSNI NEGQYL NEGTTNF NESNSL NESQQV NESSTSI

NEANSQF NEAQSNI NEASTTL NEGGSQI NEGPSNL NEGQYV NEGTTNI NESNSNF NESQSF NESSTSL

NEANSQI NEAQSNL NEASTTV NEGGSQL NEGPSNV NEGSNF NEGTTNL NESNSNI NESQSI NESSTSV

NEANSQL NEAQSNV NEASTV NEGGSQV NEGPSQF NEGSNI NEGTTNV NESNSNL NESQSL NESSTTF

NEANSQV NEAQSQF NEASTYF NEGGSSF NEGPSQI NEGSNL NEGTTQF NESNSNV NESQSNF NESSTTI

NEANSSF NEAQSQI NEASTYI NEGGSSI NEGPSQL NEGSNV NEGTTQI NESNSQF NESQSNI NESSTTL

NEANSSI NEAQSQL NEASTYL NEGGSSL NEGPSQV NEGSQF NEGTTQL NESNSQI NESQSNL NESSTTV

NEANSSL NEAQSQV NEASTYV NEGGSSV NEGPSSF NEGSQI NEGTTQV NESNSQL NESQSNV NESSTV

NEANSSV NEAQSSF NEASYF NEGGSTF NEGPSSI NEGSQL NEGTTSF NESNSQV NESQSQF NESSTYF

NEANSTF NEAQSSI NEASYI NEGGSTI NEGPSSL NEGSQV NEGTTSI NESNSSF NESQSQI NESSTYI

NEANSTI NEAQSSL NEASYL NEGGSTL NEGPSSV NEGSSF NEGTTSL N ESN SSI NESQSQL NESSTYL

NEANSTL NEAQSSV NEASYV NEGGSTV NEGPSTF NEGSSI NEGTTSV NESNSSL NESQSQV NESSTYV

NEANSTV NEAQSTF NEAT F NEGGSYF NEGPSTI NEGSSL NEGTTTF NESNSSV NESQSSF NESSYF

NEANSV NEAQSTI NEAT I NEGGSYI NEGPSTL NEGSSNF NEGTTTI NESNSTF NESQSSI NESSYI

NEANSYF NEAQSTL NEAT L NEGGSYL NEGPSTV NEGSSNI NEGTTTL NESNSTI NESQSSL NESSYL

NEANSYI NEAQSTV NEATNV NEGGSYV NEGPSYF NEGSSNL NEGTTTV N ESN STL NESQSSV NESSYV

NEANSYL NEAQSV NEATQF NEGGTNF NEGPSYI NEGSSNV NEGTTV NESNSTV NESQSTF NESTNF

NEANSYV NEAQSYF NEATQI NEGGTNI NEGPSYL NEGSSQF NEGTTYF NESNSV NESQSTI NESTNI

NEANTF NEAQSYI NEATQL NEGGTNL NEGPSYV NEGSSQI NEGTTYI NESNSYF NESQSTL NESTNL

NEANTI NEAQSYL NEATQV NEGGTNV NEGPTNF NEGSSQL NEGTTYL NESNSYI NESQSTV NESTNV

NEANTL NEAQSYV NEATSF NEGGTQF NEGPTNI NEGSSQV NEGTTYV NESNSYL NESQSV NESTQF

NEANTNF NEAQTF NEATSI NEGGTQI NEGPTNL NEGSSSF NEGTYF NESNSYV NESQSYF NESTQI

NEANTNI NEAQTI NEATSL NEGGTQL NEGPTNV NEGSSSI NEGTYI NESNTF NESQSYI NESTQL

NEANTNL NEAQTL NEATSNF NEGGTQV NEGPTQF NEGSSSL NEGTYL NESNTI NESQSYL NESTQV

NEANTNV NEAQTNF NEATSNI NEGGTSF NEGPTQI NEGSSSV NEGTYV NESNTL NESQSYV NESTSF

NEANTQF NEAQTNI NEATSNL NEGGTSI NEGPTQL NEGSSTF NEGWVSV NESNTNF NESQTF NESTSI

NEANTQI NEAQTNL NEATSNV NEGGTSL NEGPTQV NEGSSTI NEGYNF NESNTNI NESQTI NESTSL

NEANTQL NEAQTNV NEATSQF NEGGTSV NEGPTSF NEGSSTL NEGYNI NESNTNL NESQTL NESTSNF

NEANTQV NEAQTQF NEATSQI NEGGTTF NEGPTSI NEGSSTV NEGYNL NESNTNV NESQTNF NESTSNI

NEANTSF NEAQTQI NEATSQL NEGGTTI NEGPTSL NEGSSV NEGYNV NESNTQF NESQTNI NESTSNL

NEANTSI NEAQTQL NEATSQV NEGGTTL NEGPTSV NEGSSYF NEGYQF NESNTQI NESQTNL NESTSNV

NEANTSL NEAQTQV NEATSSF NEGGTTV NEGPTTF NEGSSYI NEGYQI NESNTQL NESQTNV NESTSQF

NEANTSV NEAQTSF NEATSSI NEGGTYF NEGPTTI NEGSSYL NEGYQL NESNTQV NESQTQF NESTSQI

NEANTTF NEAQTSI NEATSSL NEGGTYI NEGPTTL NEGSSYV NEGYQV NESNTSF NESQTQI NESTSQL

NEANTTI NEAQTSL NEATSSV NEGGTYL NEGPTTV NEGSTF NEGYSF NESNTSI NESQTQL NESTSQV

NEANTTL NEAQTSV NEATSTF NEGGTYV NEGPTYF NEGSTI NEGYSI NESNTSL NESQTQV NESTSSF

NEANTTV NEAQTTF NEATSTI NEGNNF NEGPTYI NEGSTL NEGYSL NESNTSV NESQTSF NESTSSI

NEANTV NEAQTTI NEATSTL NEGNNI NEGPTYL NEGSTNF NEGYSV NESNTTF NESQTSI NESTSSL

NEANTYF EAQTTL NEATSTV NEGNNL NEGPTYV NEGSTNI NEGYTF NESNTTI NESQTSL NESTSSV

NEANTYI NEAQTTV NEATS NEGNNV NEGQNF NEGSTNL NEGYTI NESNTTL NESQTSV NESTSTF

NEANTYL NEAQTV NEATSYF NEGNQF NEGQNI NEGSTNV NEGYTL NESNTTV NESQTTF NESTSTI

NEANTYV EAQTYF NEATSYI NEGNQI NEGQNL NEGSTQF NEGYTV NESNTV NESQTTI NESTSTL

NEANYF NEAQTYI NEATSYL NEGNQL NEGQNV NEGSTQI NEGYYF NESNTYF NESQTTL NESTSTV

NEANYI EAQTYL NEATSYV NEGNQV NEGQQF NEGSTQL NEGYYI NESNTYI NESQTTV NESTSV

NEANYL NEAQTYV NEATTF NEGNSF NEGQQI NEGSTQV NEGYYL NESNTYL NESQTV NESTSYF

NEANYV NEAQYF NEATTI NEGNSI NEGQQL NEGSTSF NEGYYV NESNTYV NESQTYF NESTSYI

NEAPSNF NEAQYI NEATTL NEGNSL NEGQQV NEGSTSI NEMGGAE NESNYF NESQTYI NESTSYL

NEAPSNI NEAQYL NEATT F NEGNSNF NEGQSF NEGSTSL NESGSNF NESNYI NESQTYL NESTSYV

NEAPSNL NEAQYV NEATT I NEGNSNI NEGQSI NEGSTSV NESGSNI NESNYL NESQTYV NESTTF

NEAPSNV NEASNF NEATT L NEGNSNL NEGQSL NEGSTTF NESGSNL NESNYV NESQYF NESTTI

NEAPSQF NEASNI NEATTNV NEGNSNV NEGQSNF NEGSTTI NESGSNV NESPSNF NESQYI NESTTL

NEAPSQI NEASNL NEATTQF NEGNSQF NEGQSNI NEGSTTL NESGSQF NESPSNI NESQYL NESTTNF

NEAPSQL NEASNV NEATTQI NEGNSQI NEGQSNL NEGSTTV NESGSQI NESPSNL NESQYV NESTTNI

NEAPSQV NEASQF EATTQL NEGNSQL NEGQSNV NEGSTV NESGSQL NESPSNV NESSNF NESTTNL

NEAPSSF NEASQI NEATTQV NEGNSQV NEGQSQF NEGSTYF NESGSQV NESPSQF NESSNI NESTTNV

NEAPSSI NEASQL NEATTSF NEGNSSF NEGQSQI NEGSTYI NESGSSF NESPSQI NESSNL NESTTQF

NEAPSSL NEASQV NEATTSI NEGNSSI NEGQSQL NEGSTYL NESGSSI NESPSQL NESSNV NESTTQI

NEAPSSV NEASSF NEATTSL NEGNSSL NEGQSQV NEGSTYV NESGSSL NESPSQV NESSQF NESTTQL

NEAPSTF NEASSI NEATTSV NEGNSSV NEGQSSF NEGSYF NESGSSV NESPSSF NESSQI NESTTQV

NEAPSTI NEASSL NEATTTF NEGNSTF NEGQSSI NEGSYI NESGSTF NESPSSI NESSQL NESTTSF

NEAPSTL NEASSNF NEATTTI NEGNSTI NEGQSSL NEGSYL NESGSTI NESPSSL NESSQV NESTTSI

NEAPSTV NEASSNI NEATTTL NEGNSTL NEGQSSV NEGSYV NESGSTL NESPSSV NESSSF NESTTSL

NEAPSYF NEASSNL NEATTTV NEGNSTV NEGQSTF NEGTNF NESGSTV NESPSTF NESSSI NESTTSV

NEAPSYI NEASSNV NEATTV NEGNSV NEGQSTI NEGTNI NESGSYF NESPSTI NESSSL NESTTTF

NEAPSYL NEASSQF NEATTYF NEGNSYF NEGQSTL NEGTNL NESGSYI NESPSTL NESSSNF NESTTTI

NEAPSYV NEASSQI NEATTYI NEGNSYI NEGQSTV NEGTNV NESGSYL NESPSTV NESSSNI NESTTTL

NEAPTNF NEASSQL NEATTYL NEGNSYL NEGQSV NEGTQF NESGSYV NESPSYF NESSSNL NESTTTV

NEAPTNI NEASSQV NEATTYV NEGNSYV NEGQSYF NEGTQI NESGTNF NESPSYI NESSSNV NESTTV

NEAPTNL EASSSF NEATYF NEGNTF NEGQSYI NEGTQL NESGTNI NESPSYL NESSSQF NESTTYF

NEAPTNV NEASSSI NEATYI NEGNTI NEGQSYL NEGTQV NESGTNL NESPSYV NESSSQI NESTTYI

NEAPTQF NEASSSL NEATYL NEGNTL NEGQSYV NEGTSF NESGTNV NESPTNF NESSSQL NESTTYL

NEAPTQI NEASSSV NEATYV NEGNTNF NEGQTF NEGTSI NESGTQF NESPTNI NESSSQV NESTTYV

NEAPTQL NEASSTF NEAYNF NEGNTNI NEGQTI NEGTSL NESGTQI NESPTNL NESSSSF NESTYF

NEAPTQV NEASSTI NEAYNI NEGNTNL NEGQTL NEGTSNF NESGTQL NESPTNV NESSSSI NESTYI NESTYL NNAGTYI NNAPTTL NNASSYV NNAYSF NNGNTSI NNGQTQL NNGTSQV NNSGTTI NNSPTSL ESTYV NNAGTYL NNAPTTV NNASTF N NAY SI NNGNTSL NNGQTQV NNGTSSF NNSGTTL NNSPTSV

NESYNF NNAGTYV NNAPTYF NNASTI NNAYSL NNGNTSV NNGQTSF NNGTSSI NNSGTTV NNSPTTF

NESYNI NNANNF NNAPTYI NNASTL NNAYSV NNGNTTF NNGQTSI NNGTSSL NNSGTYF NNSPTTI

NESYNL NNANNI NNAPTYL NNASTNF NNAYTF NNGNTTI NNGQTSL NNGTSSV NNSGTYI NNSPTTL

NESYNV NNANNL NNAPTYV NNASTNI NNAYTI NNGNTTL NNGQTSV NNGTSTF NNSGTYL NNSPTTV

NESYQF NNANNV NNAQNF NNASTNL NNAYTL NNGNTTV NNGQTTF NNGTSTI NNSGTYV NNSPTYF

NESYQI NNANQF NNAQNI NNASTNV NNAYTV NNGNTV NNGQTTI NNGTSTL NNSNNF NNSPTYI

NESYQL NNANQI NNAQNL NNASTQF NNAYYF NNGNTYF NNGQTTL NNGTSTV NNSNNI NNSPTYL

NESYQV NNANQL NNAQNV NNASTQI NNAYYI NNGNTYI NNGQTTV NNGTS NNSNNL NNSPTYV

NESYSF NNANQV NNAQQF NNASTQL NNAYYL NNGNTYL NNGQTV NNGTSYF NNSNNV NNSQNF

NESYSI NNANSF NNAQQI NNASTQV NNAYYV NNGNTYV NNGQTYF NNGTSYI NNSNQF NNSQNI

NESYSL NNANSI NNAQQL NNASTSF NNGGNDV NNGNYF NNGQTYI NNGTSYL NNSNQI NNSQNL

NESYSV NNANSL NNAQQV NNASTSI NNGGSNF NNGNYI NNGQTYL NNGTSYV NNSNQL NNSQNV

NESYTF NNANSNF NNAQSF NNASTSL NNGGSNI NNGNYL NNGQTYV NNGTTF NNSNQV NNSQQF

NESYTI NNANSNI NNAQSI NNASTSV NNGGSNL NNGNYV NNGQYF NNGTTI NNSNSF NNSQQI

NESYTL NNANSNL NNAQSL NNASTTF NNGGSNV NNGPSNF NNGQYI NNGTTL NNSNSI NNSQQL

NESYTV NNANSNV NNAQSNF NNASTTI NNGGSQF NNGPSNI NNGQYL NNGTTNF NNSNSL NNSQQV

NESYYF NNANSQF NNAQSNI NNASTTL NNGGSQI NNGPSNL NNGQYV NNGTTNI NNSNSNF NNSQSF

NESYYI NNANSQI NNAQSNL NNASTTV NNGGSQL NNGPSNV NNGSNF NNGTTNL NNSNSNI NNSQSI

NESYYL NNANSQL NNAQSNV NNASTV NNGGSQV NNGPSQF NNGSNI NNGTTNV NNSNSNL NNSQSL

NESYYV NNANSQV NNAQSQF NNASTYF NNGGSSF NNGPSQI NNGSNL NNGTTQF NNSNSNV NNSQSNF

NFPGSSM NNANSSF NNAQSQI NNASTYI NNGGSSI NNGPSQL NNGSNV NNGTTQI NNSNSQF NNSQSNI

NFWGSSV N NAN SSI NNAQSQL NNASTYL NNGGSSL NNGPSQV NNGSQF NNGTTQL NNSNSQI NNSQSNL

NGDMKSN NNANSSL NNAQSQV NNASTYV NNGGSSV NNGPSSF NNGSQI NNGTTQV NNSNSQL NNSQSNV

NGDQSGV NNANSSV NNAQSSF NNASYF NNGGSTF NNGPSSI NNGSQL NNGTTSF NNSNSQV NNSQSQF

NGGGSSV NNANSTF NNAQSSI NNASYI NNGGSTI NNGPSSL NNGSQV NNGTTSI NNSNSSF NNSQSQI

NGGHSSV NNANSTI NNAQSSL NNASYL NNGGSTL NNGPSSV NNGSSF NNGTTSL NNSNSSI NNSQSQL

NGGQIMV N NAN STL NNAQSSV NNASYV NNGGSTV NNGPSTF NNGSSI NNGTTSV NNSNSSL NNSQSQV

NGMPSSV NNANSTV NNAQSTF NNATNF NNGGSYF NNGPSTI NNGSSL NNGTTTF NNSNSSV NNSQSSF

NGQGHLV NNANSV NNAQSTI NNATNI NNGGSYI NNGPSTL NNGSSNF NNGTTTI NNSNSTF NNSQSSI

NHDIWYR NNANSYF NNAQSTL NNATNL NNGGSYL NNGPSTV NNGSSNI NNGTTTL NNSNSTI NNSQSSL

NHGGKHV NNANSYI NNAQSTV NNATNV NNGGSYV NNGPSYF NNGSSNL NNGTTTV NNSNSTL NNSQSSV

NHGLLSG NNANSYL NNAQSV NNATQF NNGGTNF NNGPSYI NNGSSNV NNGTTV NNSNSTV NNSQSTF

NHGSSSR NNANSYV NNAQSYF NNATQI NNGGTNI NNGPSYL NNGSSQF NNGTTYF NNSNSV NNSQSTI

NHGYSSV NNANTF NNAQSYI NNATQL NNGGTNL NNGPSYV NNGSSQI NNGTTYI NNSNSYF NNSQSTL

NHMGSSV NNANTI NNAQSYL NNATQV NNGGTNV NNGPTNF NNGSSQL NNGTTYL NNSNSYI NNSQSTV

NHRGLTV NNANTL NNAQSYV NNATSF NNGGTQF NNGPTNI NNGSSQV NNGTTYV NNSNSYL NNSQSV

NHSPYLV NNANTNF NNAQTF NNATSI NNGGTQI NNGPTNL NNGSSSF NNGTYF NNSNSYV NNSQSYF

NHVMSSV NNANTNI NNAQTI NNATSL NNGGTQL NNGPTNV NNGSSSI NNGTYI NNSNTF NNSQSYI

NIFIPSV NNANTNL NNAQTL NNATSNF NNGGTQV NNGPTQF NNGSSSL NNGTYL NNSNTI NNSQSYL

NIGGDSV NNANTNV NNAQTNF NNATSNI NNGGTSF NNGPTQI NNGSSSV NNGTYV NNSNTL NNSQSYV

NIGGSDH NNANTQF NNAQTNI NNATSNL NNGGTSI NNGPTQL NNGSSTF NNGWRKV NNSNTNF NNSQTF

NIGGSHV NNANTQI NNAQTNL NNATSNV NNGGTSL NNGPTQV NNGSSTI NNGYNI NNSNTNI NNSQTI

NIGGSYK NNANTQL NNAQTNV NNATSQF NNGGTSV NNGPTSF NNGSSTL NNGYNL NNSNTNL NNSQTL

NIGHSAV NNANTQV NNAQTQF NNATSQI NNGGTTF NNGPTSI NNGSSTV NNGYNV NNSNTNV NNSQTNF

NIPYWSV NNANTSF NNAQTQI NNATSQL NNGGTTI NNGPTSL NNGSSV NNGYQF NNSNTQF NNSQTNI

IMKAGSIP NNANTSI NNAQTQL NNATSQV NNGGTTL NNGPTSV NNGSSYF NNGYQI NNSNTQI NNSQTNL

NKDGSSE NNANTSL NNAQTQV NNATSSF NNGGTTV NNGPTTF NNGSSYI NNGYQL NNSNTQL NNSQTNV

NKSGSSV NNANTSV NNAQTSF NNATSSI NNGGTYF NNGPTTI NNGSSYL NNGYQV NNSNTQV NNSQTQF

NKWGNSV NNANTTF NNAQTSI NNATSSL NNGGTYI NNGPTTL NNGSSYV NNGYSF NNSNTSF NNSQTQI

NLGQTSP NNANTTI NNAQTSL NNATSSV NNGGTYL NNGPTTV NNGSTF NNGYSI NNSNTSI NNSQTQL

NLGVSSV NNANTTL NNAQTSV NNATSTF NNGGTYV NNGPTYF NNGSTI NNGYSL NNSNTSL NNSQTQV

NLSGSEV NNANTTV NNAQTTF NNATSTI NNGNNF NNGPTYI NNGSTL NNGYSV NNSNTSV NNSQTSF

NLSGSFG NNANTV NNAQTTI NNATSTL NNGNNI NNGPTYL NNGSTNF NNGYTF NNSNTTF NNSQTSI

NMAGLSV NNANTYF NNAQTTL NNATSTV NNGNNL NNGPTYV NNGSTNI NNGYTI NNSNTTI NNSQTSL

NMGGEHV NNANTYI NNAQTTV NNATSV NNGNNV NNGQNF NNGSTNL NNGYTL NNSNTTL NNSQTSV

NMGGSDD NNANTYL NNAQTV NNATSYF NNGNQF NNGQNI NNGSTNV NNGYTV NNSNTTV NNSQTTF

NMGTTSV NNANTYV NNAQTYF NNATSYI NNGNQI NNGQNL NNGSTQF NNGYYF NNSNTV NNSQTTI

NNAGPS NNANYF NNAQTYI NNATSYL NNGNQL NNGQNV NNGSTQI NNGYYI NNSNTYF NNSQTTL

NNAGSNF NNANYI NNAQTYL NNATSYV NNGNQV NNGQQF NNGSTQL NNGYYL NNSNTYI NNSQTTV

NNAGSNI NNANYL NNAQTYV NNATTF NNGNSF NNGQQI NNGSTQV NNGYYV NNSNTYL NNSQTV

NNAGSNL NNANYV NNAQYF NNATTI NNGNSI NNGQQL NNGSTSF NNHGQPF NNSNTYV NNSQTYF

NNAGSNV NNAPSNF NNAQYI NNATTL NNGNSL NNGQQV NNGSTSI NNSGSNF NNSNYF NNSQTYI

NNAGSQF NNAPSNI NNAQYL NNATTNF NNGNSNF NNGQSF NNGSTSL NNSGSNI NNSNYI NNSQTYL

NNAGSQI NNAPSNL NNAQYV NNATTNI NNGNSNI NNGQSI NNGSTSV NNSGSNL NNSNYL NNSQTYV

N NAG SQL NNAPSNV NNASNF NNATTNL NNGNSNL NNGQSL NNGSTTF NNSGSNV NNSNYV NNSQYF

NNAGSQV NNAPSQF NNASNI NNATTNV NNGNSNV NNGQSNF NNGSTTI NNSGSQF NNSPSNF NNSQYI

NNAGSSF NNAPSQI NNASNL NNATTQF NNGNSQF NNGQSNI NNGSTTL NNSGSQI NNSPSNI NNSQYL

N NAG SSI NNAPSQL NNASNV NNATTQI NNGNSQI NNGQSNL NNGSTTV NNSGSQL NNSPSNL NNSQYV

NNAGSSL NNAPSQV NNASQF NNATTQL NNGNSQL NNGQSNV NNGSTV NNSGSQV NNSPSNV NNSSNF

NNAGSSV NNAPSSF NNASQI NNATTQV NNGNSQV NNGQSQF NNGSTYF NNSGSSF NNSPSQF NNSSNI

NNAGSTF NNAPSSI NNASQL NNATTSF NNGNSSF NNGQSQI NNGSTYI NNSGSSI NNSPSQI NNSSNL

NNAGSTI NNAPSSL NNASQV NNATTSI NNGNSSI NNGQSQL NNGSTYL NNSGSSL NNSPSQL NNSSNV

NNAGSTL NNAPSSV NNASSF NNATTSL NNGNSSL NNGQSQV NNGSTYV NNSGSSV NNSPSQV NNSSQF

NNAGSTV NNAPSTF NNASSI NNATTSV NNGNSSV NNGQSSF NNGSYF NNSGSTF NNSPSSF NNSSQI

NNAGSYF NNAPSTI NNASSL NNATTTF NNGNSTF NNGQSSI NNGSYI NNSGSTI NNSPSSI NNSSQL

NNAGSYI NNAPSTL NNASSNF NNATTTI NNGNSTI NNGQSSL NNGSYL NNSGSTK NNSPSSL NNSSQV

NNAGSYL NNAPSTV NNASSNI NNATTTL NNGNSTL NNGQSSV NNGSYV NNSGSTL NNSPSSV NNSSSF

NNAGSYV NNAPSYF NNASSNL NNATTTV NNGNSTV NNGQSTF NNGTNF NNSGSTV NNSPSTF NNSSSI

NNAGTNF NNAPSYI NNASSNV NNATTV NNGNSV NNGQSTI NNGTNI NNSGSYF NNSPSTI NNSSSL

NNAGTNI NNAPSYL NNASSQF NNATTYF NNGNSYF NNGQSTL NNGTNL NNSGSYI NNSPSTL NNSSSNF

NNAGTNL NNAPSYV NNASSQI NNATTYI NNGNSYI NNGQSTV NNGTNV NNSGSYL NNSPSTV NNSSSNI

NNAGTNV NNAPTNF NNASSQL NNATTYL NNGNSYL NNGQSV NNGTQF NNSGSYV NNSPSYF NNSSSNL

NNAGTQF NNAPTNI NNASSQV NNATTYV NNGNSYV NNGQSYF NNGTQI NNSGTNF NNSPSYI NNSSSNV

NNAGTQI NNAPTNL NNASSSF NNATYF NNGNTF NNGQSYI NNGTQL NNSGTNI NNSPSYL NNSSSQF

NNAGTQL NNAPTNV NNASSSI NNATYI NNGNTI NNGQSYL NNGTQV NNSGTNL NNSPSYV NNSSSQI

NNAGTQV NNAPTQF NNASSSL NNATYL NNGNTL NNGQSYV NNGTSF NNSGTNV NNSPTNF NNSSSQL

NNAGTSF NNAPTQI NNASSSV NNATYV NNGNTNF NNGQTF NNGTSI NNSGTQF NNSPTNI NNSSSQV

NNAGTSI NNAPTQL NNASSTF NNAYNF NNGNTNI NNGQTI NNGTSL NNSGTQI NNSPTNL NNSSSSF

NNAGTSL NNAPTQV NNASSTI NNAYNI NNGNTNL NNGQTL NNGTSNF NNSGTQL NNSPTNV NNSSSSI

NNAGTSV NNAPTSF NNASSTL NNAYNL NNGNTNV NNGQTNF NNGTSNI NNSGTQV NNSPTQF NNSSSSL

NNAGTTF NNAPTSI NNASSTV NNAYNV NNGNTQF NNGQTNI NNGTSNL NNSGTSF NNSPTQI NNSSSSV

NNAGTTI NNAPTSL NNASS NNAYQF NNGNTQI NNGQTNL NNGTSNV NNSGTSI NNSPTQL NNSSSTF

NNAGTTL NNAPTSV NNASSYF NNAYQI NNGNTQL NNGQTNV NNGTSQF NNSGTSL NNSPTQV NNSSSTI

NNAGTTV NNAPTTF NNASSYI NNAYQL NNGNTQV NNGQTQF NNGTSQI NNSGTSV NNSPTSF NNSSSTL

NNAGTYF NNAPTTI NNASSYL NNAYQV NNGNTSF NNGQTQI NNGTSQL NNSGTTF NNSPTSI NNSSSTV NNSSSV NNSYQF NQANTNF NQAQTF NQATSI NQGGTQI NQGPTNI NQGSSQV NQGTTYV NQSNSYL

NNSSSYF NNSYQI NQANTNI NQAQTI NQATSL NQGGTQL NQGPTNL NQGSSSF NQGTYF NQSNSYV

NNSSSYI NNSYQL NQANTNL NQAQTL NQATSNF NQGGTQV NQGPTNV NQGSSSI NQGTYI NQSNTF

NNSSSYL NNSYQV NQANTNV NQAQTNF NQATSNI NQGGTSF NQGPTQF NQGSSSL NQGTYL NQSNTI

NNSSSYV NNSYSF NQANTQF NQAQTNI NQATSNL NQGGTSI NQGPTQI NQGSSSV NQGTYV NQSNTL

NNSSTF NNSYSI NQANTQI NQAQTNL NQATSNV NQGGTSL NQGPTQL NQGSSTF NQGYEDL NQSNTNF

NNSSTI NNSYSL NQANTQL NQAQTNV NQATSQF NQGGTSV NQGPTQV NQGSSTI NQGYNF NQSNTNI

NNSSTL NNSYSV NQANTQV NQAQTQF NQATSQI NQGGTTF NQGPTSF NQGSSTL NQGYNI NQSNTNL

NNSSTNF NNSYTF NQANTSF NQAQTQI NQATSQL NQGGTTI NQGPTSI NQGSSTV NQGYNL NQSNTNV

NNSSTNI NNSYTI NQANTSI NQAQTQL NQATSQV NQGGTTL NQGPTSL NQGSSV NQGYNV NQSNTQF

NNSSTNL NNSYTL NQANTSL NQAQTQV NQATSSF NQGGTTV NQGPTSV NQGSSYF NQGYQF NQSNTQI

NNSSTNV NNSYTV NQANTSV NQAQTSF NQATSSI NQGGTYF NQGPTTF NQGSSYI NQGYQI NQSNTQL

NNSSTQF NNSYYF NQANTTF NQAQTSI NQATSSL NQGGTYI NQGPTTI NQGSSYL NQGYQL NQSNTQV

NNSSTQI NNSYYI NQANTTI NQAQTSL NQATSSV NQGGTYL NQGPTTL NQGSSYV NQGYQV NQSNTSF

NNSSTQL NNSYYL NQANTTL NQAQTSV NQATSTF NQGGTYV NQGPTTV NQGSTF NQGYSF NQSNTSI

NNSSTQV NNSYYV NQANTTV NQAQTTF NQATSTI NQGGVSK NQGPTYF NQGSTI NQGYSI NQSNTSL

NNSSTSF NNWIAQV NQANTV NQAQTTI NQATSTL NQGNNF NQGPTYI NQGSTL NQGYSL NQSNTSV

NNSSTSI NPGEWSF NQANTYF NQAQTTL NQATSTV NQGNNI NQGPTYL NQGSTNF NQGYSV NQSNTTF

NNSSTSL NPGFSSV NQANTYI NQAQTTV NQATSV NQGNNL NQGPTYV NQGSTNI NQGYTF NQSNTTI

NNSSTSV NPGGSSV NQANTYL NQAQTV NQATSYF NQGNNV NQGQNF NQGSTNL NQGYTI NQSNTTL

NNSSTTF NPNGHMV NQANTYV NQAQTYF NQATSYI NQGNQF NQGQNI NQGSTNV NQGYTL NQSNTTV

NNSSTTI NPPGRSV NQANYF NQAQTYI NQATSYL NQGNQI NQGQNL NQGSTQF NQGYTV NQSNTV

NNSSTTL NQAGSNF NQANYI NQAQTYL NQATSYV NQGNQL NQGQNV NQGSTQI NQGYYF NQSNTYF

NNSSTTV NQAGSNI NQANYL NQAQTYV NQATTF NQGNQV NQGQQF NQGSTQL NQGYYI NQSNTYI

NNSSTV NQAGSNL NQANYV NQAQYF NQATTI NQGNSF NQGQQI NQGSTQV NQGYYL NQSNTYL

NNSSTYF NQAGSNV NQAPSNF NQAQYI NQATTL NQGNSI NQGQQL NQGSTSF NQGYYV NQSNTYV

NNSSTYI NQAGSQF NQAPSNI NQAQYL NQATTNF NQGNSL NQGQQV NQGSTSI NQPGSMA NQSNYF

NNSSTYL NQAGSQI NQAPSNL NQAQYV NQATTNI NQGNSNF NQGQSF NQGSTSL NQSGSNF NQSNYI

NNSSTYV NQAGSQL NQAPSNV NQASNF NQATTNL NQGNSNI NQGQSI NQGSTSV NQSGSNI NQSNYL

NNSSYF NQAGSQV NQAPSQF NQASNI NQATTNV NQGNSNL NQGQSL NQGSTTF NQSGSNL NQSNYV

NNSSYI NQAGSSF NQAPSQI NQASNL NQATTQF NQGNSNV NQGQSNF NQGSTTI NQSGSNV NQSPSNF

NNSSYL NQAGSSI NQAPSQL NQASNV NQATTQI NQGNSQF NQGQSNI NQGSTTL NQSGSQF NQSPSNI

NNSSYV NQAGSSL NQAPSQV NQASQF NQATTQL NQGNSQI NQGQSNL NQGSTTV NQSGSQI NQSPSNL

NNSTNF NQAGSSV NQAPSSF NQASQI NQATTQV NQGNSQL NQGQSNV NQGSTV NQSGSQL NQSPSNV

NNSTNI NQAGSTF NQAPSSI NQASQL NQATTSF NQGNSQV NQGQSQF NQGSTYF NQSGSQV NQSPSQF

NNSTNL NQAGSTI NQAPSSL NQASQV NQATTSI NQGNSSF NQGQSQI NQGSTYI NQSGSSF NQSPSQI

NNSTNV NQAGSTL NQAPSSV NQASSF NQATTSL NQGNSSI NQGQSQL NQGSTYL NQSGSSI NQSPSQL

NNSTQF NQAGSTV NQAPSTF NQASSI NQATTSV NQGNSSL NQGQSQV NQGSTYV NQSGSSL NQSPSQV

NNSTQI NQAGSYF NQAPSTI NQASSL NQATTTF NQGNSSV NQGQSSF NQGSYF NQSGSSV NQSPSSF

NNSTQL NQAGSYI NQAPSTL NQASSNF NQATTTI NQGNSTF NQGQSSI NQGSYI NQSGSTF NQSPSSI

NNSTQV NQAGSYL NQAPSTV NQASSNI NQATTTL NQGNSTI NQGQSSL NQGSYL NQSGSTI NQSPSSL

NNSTSF NQAGSYV NQAPSYF NQASSNL NQATTTV NQGNSTL NQGQSSV NQGSYV NQSGSTL NQSPSSV

NNSTSI NQAGTNF NQAPSYI NQASSNV NQATTV NQGNSTV NQGQSTF NQGTNF NQSGSTV NQSPSTF

NNSTSL NQAGTNI NQAPSYL NQASSQF NQATTYF NQGNSV NQGQSTI NQGTNI NQSGSYF NQSPSTI

NNSTSNF NQAGTNL NQAPSYV NQASSQI NQATTYI NQGNSYF NQGQSTL NQGTNL NQSGSYI NQSPSTL

NNSTSNI NQAGTNV NQAPTNF NQASSQL NQATTYL NQGNSYI NQGQSTV NQGTNV NQSGSYL NQSPSTV

NNSTSNL NQAGTQF NQAPTNI NQASSQV NQATTYV NQGNSYL NQGQSV NQGTQF NQSGSYV NQSPSYF

NNSTSNV NQAGTQI NQAPTNL NQASSSF NQATYF NQGNSYV NQGQSYF NQGTQI NQSGTNF NQSPSYI STSQF NQAGTQL NQAPTNV NQASSSI NQATYI NQGNTF NQGQSYI NQGTQL NQSGTNI NQSPSYL

NNSTSQI NQAGTQV NQAPTQF NQASSSL NQATYL NQGNTI NQGQSYL NQGTQV NQSGTNL NQSPSYV

NNSTSQL NQAGTSF NQAPTQI NQASSSV NQATYV NQGNTL NQGQSYV NQGTSF NQSGTNV NQSPTNF STSQV NQAGTSI NQAPTQL NQASSTF NQAYNF NQGNTNF NQGQTF NQGTSI NQSGTQF NQSPTNI

NNSTSSF NQAGTSL NQAPTQV NQASSTI NQAYNI NQGNTNI NQGQTI NQGTSL NQSGTQI NQSPTNL

NNSTSSI NQAGTSV NQAPTSF NQASSTL NQAYNL NQGNTNL NQGQTL NQGTSNF NQSGTQL NQSPTNV STSSL NQAGTTF NQAPTSI NQASSTV NQAYNV NQGNTNV NQGQTNF NQGTSNI NQSGTQV NQSPTQF

NNSTSSV NQAGTTI NQAPTSL NQASSV NQAYQF NQGNTQF NQGQTNI NQGTSNL NQSGTSF NQSPTQI

NNSTSTF NQAGTTL NQAPTSV NQASSYF NQAYQI NQGNTQI NQGQTNL NQGTSNV NQSGTSI NQSPTQL

NNSTSTI NQAGTTV NQAPTTF NQASSYI NQAYQL NQGNTQL NQGQTNV NQGTSQF NQSGTSL NQSPTQV

NNSTSTL NQAGTYF NQAPTTI NQASSYL NQAYQV NQGNTQV NQGQTQF NQGTSQI NQSGTSV NQSPTSF

NNSTSTV NQAGTYI NQAPTTL NQASSYV NQAYSF NQGNTSF NQGQTQI NQGTSQL NQSGTTF NQSPTSI

NNSTSV NQAGTYL NQAPTTV NQASTF NQAYSI NQGNTSI NQGQTQL NQGTSQV NQSGTTI NQSPTSL

NNSTSYF NQAGTYV NQAPTYF NQASTI NQAYSL NQGNTSL NQGQTQV NQGTSSF NQSGTTL NQSPTSV

NNSTSYI NQANNF NQAPTYI NQASTL NQAYSV NQGNTSV NQGQTSF NQGTSSI NQSGTTV NQSPTTF

NNSTSYL NQANNI NQAPTYL NQASTNF NQAYTF NQGNTTF NQGQTSI NQGTSSL NQSGTYF NQSPTTI

NNSTSYV NQANNL NQAPTYV NQASTNI NQAYTI NQGNTTI NQGQTSL NQGTSSV NQSGTYI NQSPTTL

NNSTTF NQANNV NQAQNF NQASTNL NQAYTL NQGNTTL NQGQTSV NQGTSTF NQSGTYL NQSPTTV

NNSTTI NQANQF NQAQNI NQASTNV NQAYTV NQGNTTV NQGQTTF NQGTSTI NQSGTYV NQSPTYF

NNSTTL NQANQI NQAQNL NQASTQF NQAYYF NQGNTV NQGQTTI NQGTSTL NQSNNF NQSPTYI

NNSTTNF NQANQL NQAQNV NQASTQI NQAYYI NQGNTYF NQGQTTL NQGTSTV NQSNNI NQSPTYL

NNSTTNI NQANQV NQAQQF NQASTQL NQAYYL NQGNTYI NQGQTTV NQGTSV NQSNNL NQSPTYV

NNSTTNL NQANSF NQAQQI NQASTQV NQAYYV NQGNTYL NQGQTV NQGTSYF NQSNNV NQSQNF

NNSTTNV NQANSI NQAQQL NQASTSF NQGGSNF NQGNTYV NQGQTYF NQGTSYI NQSNQF NQSQNI

NNSTTQF NQANSL NQAQQV NQASTSI NQGGSNI NQGNYF NQGQTYI NQGTSYL NQSNQI NQSQNL

NNSTTQI NQANSNF NQAQSF NQASTSL NQGGSNL NQGNYI NQGQTYL NQGTSYV NQSNQL NQSQNV

NNSTTQL NQANSNI NQAQSI NQASTSV NQGGSNV NQGNYL NQGQTYV NQGTTF NQSNQV NQSQQF

NNSTTQV NQANSNL NQAQSL NQASTTF NQGGSQF NQGNYV NQGQYF NQGTTI NQSNSF NQSQQI

NNSTTSF NQANSNV NQAQSNF NQASTTI NQGGSQI NQGPSNF NQGQYI NQGTTL NQSNSI NQSQQL

NNSTTSI NQANSQF NQAQSNI NQASTTL NQGGSQL NQGPSNI NQGQYL NQGTTNF NQSNSL NQSQQV

NNSTTSL NQANSQI NQAQSNL NQASTTV NQGGSQV NQGPSNL NQGQYV NQGTTNI NQSNSNF NQSQSF

NNSTTSV NQANSQL NQAQSNV NQASTV NQGGSSF NQGPSNV NQGSNF NQGTTNL NQSNSNI NQSQSI

NNSTTTF NQANSQV NQAQSQF NQASTYF NQGGSSI NQGPSQF NQGSNI NQGTTNV NQSNSNL NQSQSL

NNSTTTI NQANSSF NQAQSQI NQASTYI NQGGSSL NQGPSQI NQGSNL NQGTTQF NQSNSNV NQSQSNF

NNSTTTL NQANSSI NQAQSQL NQASTYL NQGGSSP NQGPSQL NQGSNV NQGTTQI NQSNSQF NQSQSNI

NNSTTTV NQANSSL NQAQSQV NQASTYV NQGGSSV NQGPSQV NQGSQF NQGTTQL NQSNSQI NQSQSNL

NNSTTV NQANSSV NQAQSSF NQASYF NQGGSTF NQGPSSF NQGSQI NQGTTQV NQSNSQL NQSQSNV

NNSTTYF NQANSTF NQAQSSI NQASYI NQGGSTI NQGPSSI NQGSQL NQGTTSF NQSNSQV NQSQSQF

NNSTTYI NQANSTI NQAQSSL NQASYL NQGGSTL NQGPSSL NQGSQV NQGTTSI NQSNSSF NQSQSQI

NNSTTYL NQANSTL NQAQSSV NQASYV NQGGSTV NQGPSSV NQGSSF NQGTTSL NQSNSSI NQSQSQL

NNSTTYV NQANSTV NQAQSTF NQATNF NQGGSYF NQGPSTF NQGSSI NQGTTSV NQSNSSL NQSQSQV

NNSTYF NQANSV NQAQSTI NQATNI NQGGSYI NQGPSTI NQGSSL NQGTTTF NQSNSSV NQSQSSF

NNSTYI NQANSYF NQAQSTL NQATNL NQGGSYL NQGPSTL NQGSSNF NQGTTTI NQSNSTF NQSQSSI

NNSTYL NQANSYI NQAQSTV NQATNV NQGGSYV NQGPSTV NQGSSNI NQGTTTL NQSNSTI NQSQSSL

NNSTYV NQANSYL NQAQSV NQATQF NQGGTNF NQGPSYF NQGSSNL NQGTTTV NQSNSTL NQSQSSV

NNSYNF NQANSYV NQAQSYF NQATQI NQGGTNI NQGPSYI NQGSSNV NQGTTV NQSNSTV NQSQSTF

NNSYNI NQANTF NQAQSYI NQATQL NQGGTNL NQGPSYL NQGSSQF NQGTTYF NQSNSV NQSQSTI

NNSYNL NQANTI NQAQSYL NQATQV NQGGTNV NQGPSYV NQGSSQI NQGTTYI NQSNSYF NQSQSTL

NNSYNV NQANTL NQAQSYV NQATSF NQGGTQF NQGPTNF NQGSSQL NQGTTYL NQSNSYI NQSQSTV NQSQSV NQSTQF NVAGSQI NVANYL NVAQTYL NVATSYV NVGGSSI NVGNTYL NVGQTTF NVGTSQV

NQSQSYF NQSTQI NVAGSQL NVANYV NVAQTYV IMVATTF NVGGSSL NVGNTYV NVGQTTI NVGTSSF

NQSQSYI NQSTQL NVAGSQV NVAPRSV NVAQYF NVATTI NVGGSSV NVGNYF NVGQTTL NVGTSSI

NQSQSYL NQSTQV NVAGSSD NVAPSNF NVAQYI NVATTL NVGGSSY NVGNYI NVGQTTV NVGTSSL

NQSQSYV NQSTSF NVAGSSF NVAPSNI NVAQYL NVATTNF NVGGSTF NVGNYL NVGQTV NVGTSSV

NQSQTF NQSTSI NVAGSSI NVAPSNL NVAQYV NVATTNI NVGGSTI NVGNYV NVGQTYF NVGTSTF

NQSQTI NQSTSL NVAGSSL NVAPSNV NVASNF NVATTNL NVGGSTL NVGPPDT NVGQTYI NVGTSTI

NQSQTL NQSTSNF NVAGSSV NVAPSQF NVASNI NVATTNV NVGGSTV NVGPSNF NVGQTYL NVGTSTL

NQSQTNF NQSTSNI NVAGSTF NVAPSQI NVASNL NVATTPP NVGGSYF NVGPSNI NVGQTYV NVGTSTV

NQSQTNI NQSTSNL AGSTI NVAPSQL NVASNV NVATTQF NVGGSYI NVGPSNL NVGQYF NVGTSV

NQSQTNL NQSTSNV NVAGSTL NVAPSQV NVASQF NVATTQI NVGGSYL NVGPSNV NVGQYI NVGTSYF

NQSQTNV NQSTSQF AGST NVAPSSF NVASQI NVATTQL NVGGSYV NVGPSQF NVGQYL NVGTSYI

NQSQTQF NQSTSQI AGSYF NVAPSSI NVASQL NVATTQV NVGGTNF NVGPSQI NVGQYV NVGTSYL

NQSQTQI NQSTSQL NVAGSYI NVAPSSL NVASQV NVATTSF NVGGTNI NVGPSQL NVGRESL NVGTSYV

NQSQTQL NQSTSQV AGSYL NVAPSSV NVASSF NVATTSI NVGGTNL NVGPSQV NVGRKNT NVGTTF

NQSQTQV NQSTSSF NVAGSYV NVAPSTF NVASSI NVATTSL NVGGTNV NVGPSSF NVGRSSV NVGTTI

NQSQTSF NQSTSSI NVAGTNF NVAPSTI NVASSL NVATTSV NVGGTQF NVGPSSI NVGRYSV NVGTTL

NQSQTSI NQSTSSL NVAGTNI NVAPSTL NVASSNF NVATTTF NVGGTQI NVGPSSL NVGSNF NVGTTNF

NQSQTSL NQSTSSV NVAGTNL NVAPSTV NVASSNI NVATTTI NVGGTQL NVGPSSV NVGSNI NVGTTNI

NQSQTSV NQSTSTF NVAGTNV NVAPSYF NVASSNL NVATTTL NVGGTQV NVGPSTF NVGSNL NVGTTNL

NQSQTTF NQSTSTI NVAGTQF NVAPSYI NVASSNV NVATTTV NVGGTSF NVGPSTI NVGSNLV NVGTTNV

NQSQTTI NQSTSTL NVAGTQI NVAPSYL NVASSQF NVATTV NVGGTSI NVGPSTL NVGSNV NVGTTQF

NQSQTTL NQSTSTV NVAGTQL NVAPSYV NVASSQI NVATTYF NVGGTSL NVGPSTV NVGSQF NVGTTQI

NQSQTTV NQSTSV NVAGTQV NVAPTNF NVASSQL NVATTYI NVGGTSV NVGPSYF NVGSQI NVGTTQL

NQSQTV NQSTSYF NVAGTSF NVAPTNI NVASSQV NVATTYL NVGGTTF NVGPSYI NVGSQL NVGTTQV

NQSQTYF NQSTSYI NVAGTSI NVAPTNL NVASSSF NVATTYV NVGGTTI NVGPSYL NVGSQV NVGTTSF

NQSQTYI NQSTSYL NVAGTSL NVAPTNV NVASSSI NVATYF NVGGTTL NVGPSYV NVGSSF NVGTTSI

NQSQTYL NQSTSYV NVAGTSV NVAPTQF NVASSSL NVATYI NVGGTTV NVGPTNF NVGSSI NVGTTSL

NQSQTYV NQSTTF NVAGTTF NVAPTQI NVASSSV NVATYL NVGGTYF NVGPTNI NVGSSL NVGTTSV

NQSQYF NQSTTI NVAGTTI NVAPTQL NVASSTF NVATYV NVGGTYI NVGPTNL NVGSSNF NVGTTTF

NQSQYI NQSTTL NVAGTTL NVAPTQV NVASSTI NVAYNF NVGGTYL NVGPTNV NVGSSNI NVGTTTI

NQSQYL NQSTTNF NVAGTTV NVAPTSF NVASSTL NVAYNI NVGGTYV NVGPTQF NVGSSNL NVGTTTL

NQSQYV NQSTTNI NVAGTYF NVAPTSI NVASSTV NVAY L NVGGWSV NVGPTQI NVGSSNV NVGTTTV

NQSSNF NQSTTNL NVAGTYI APTSL NVASSV NVAYNV NVGGYHQ NVGPTQL NVGSSQF NVGTTV

NQSSNI NQSTTNV NVAGTYL NVAPTSV NVASSYF NVAYQF NVGGYSA NVGPTQV NVGSSQI NVGTTYF

NQSSNL NQSTTQF NVAGTYV NVAPTTF NVASSYI NVAYQI NVGGYVV NVGPTSF NVGSSQL NVGTTYI

NQSSNV NQSTTQI NVAHPHV NVAPTTI NVASSYL NVAYQL NVGGYYF NVGPTSI NVGSSQV NVGTTYL

NQSSQF NQSTTQL NVAISSE NVAPTTL NVASSYV NVAYQV NVGHSSM NVGPTSL NVGSSSF NVGTTYV

NQSSQI NQSTTQV NVANNF NVAPTTV NVASTF NVAYSF NVGKSSD NVGPTSV NVGSSSI NVGTYF

NQSSQL NQSTTSF A I NVAPTYF NVASTI NVAYSI NVGLIHV NVGPTTF NVGSSSL NVGTYI

NQSSQV NQSTTSI NVANNL NVAPTYI NVASTL NVAYSL NVGMAQH NVGPTTI NVGSSSV NVGTYL

NQSSSF NQSTTSL NVANNV NVAPTYL NVASTNF NVAYSV NVGMKSV NVGPTTL NVGSSTF NVGTYV

NQSSSI NQSTTSV NVANQF NVAPTYV NVASTNI IMVAYTF NVGNNF NVGPTTV NVGSSTI NVGWDSQ

NQSSSL NQSTTTF NVANQI NVAQNF NVASTNL NVAYTI NVGNNI NVGPTYF NVGSSTL NVGYNF

NQSSSNF NQSTTTI NVANQL NVAQNI NVASTNV NVAYTL NVGNNL NVGPTYI NVGSSTV NVGYNI

NQSSSNI NQSTTTL NVANQV NVAQ L NVASTQF NVAYTV NVGNNV NVGPTYL NVGSSV NVGYNL

NQSSS L NQSTTTV NVANSF NVAQNV NVASTQI NVAYYF NVGNQF NVGPTYV NVGSSYF NVGYNV

NQSSSNV NQSTTV NVANSI NVAQQF NVASTQL NVAYYI NVG QI NVGPVSA NVGSSYI NVGYQF

NQSSSQF NQSTTYF NVANSL NVAQQI NVASTQV NVAYYL NVG QL NVGQGQA NVGSSYL NVGYQI

NQSSSQI NQSTTYI NVANSNF NVAQQL NVASTSF NVAYYV NVGNQV NVGQISV NVGSSYV NVGYQL

NQSSSQL NQSTTYL NVANSNI NVAQQV NVASTSI NVDDKSL NVGNSF NVGQNF NVGSTF NVGYQV

NQSSSQV NQSTTYV NVANSNL NVAQSF N VASTS L NVDGFSV NVGNSI NVGQNI NVGSTI NVGYSF

NQSSSSF NQSTYF NVANSNV NVAQSI NVASTSV NVDGSDK NVGNSIV NVGQNL NVGSTL NVGYSI

NQSSSSI NQSTYI NVANSQF NVAQSL NVASTTF NVDGSQY NVGNSL NVGQNV NVGSTNF NVGYSL

NQSSSSL NQSTYL NVANSQI NVAQSNF NVASTTI NVDGSSV NVGNSNF NVGQQF NVGSTNI NVGYSSL

NQSSSSV NQSTYV NVANSQL NVAQSNI NVASTTL NVDGSSY NVGNSNI NVGQQI NVGSTNL NVGYSV

NQSSSTF NQSYNF NVANSQV NVAQSNL NVASTTV NVDISAV NVGNSNL NVGQQL NVGSTNV IMVGYTF

NQSSSTI NQSYNI NVANSSF NVAQSNV NVASTV NVEGSSV NVGNSNV NVGQQV NVGSTQF NVGYTI

NQSSSTL NQSY L NVANSSI NVAQSQF NVASTYF NVEQSSV NVGNSQF NVGQSF NVGSTQI IMVGYTL

NQSSSTV NQSYNV NVANSSL NVAQSQI NVASTYI NVFFSSV NVG SQI NVGQSI NVGSTQL NVGYTV

NQSSSV NQSYQF NVANSSV NVAQSQL NVASTYL NVFGYSP NVGNSQL NVGQSL NVGSTQV NVGYYF

NQSSSYF NQSYQI NVANSSY NVAQSQV NVASTYV NVFRSKV NVGNSQV NVGQSNF NVGSTSF NVGYYI

NQSSSYI NQSYQL NVANSTF NVAQSSF NVASYF NVFWDDV NVGNSSF NVGQSNI NVGSTSI NVGYYL

NQSSSYL NQSYQV NVANSTI NVAQSSI NVASYI NVGASSV NVGNSSI NVGQSNL NVGSTSL NVGYYV

NQSSSYV NQSYSF NVANSTL NVAQSSL NVASYL NVGAS I NVGNSSL NVGQSNV NVGSTSV NVHGGSV

NQSSTF NQSYSI NVANSTV NVAQSSV NVASYV NVGDSKE NVGNSSV NVGQSQF NVGSTTF NVHGSKH

NQSSTI NQSYSL NVANSV NVAQSTF NVATNF NVGDSKV NVGNSTF NVGQSQI NVGSTTI NVHGSSA

NQSSTL NQSYSV NVANSYF NVAQSTI NVATNI NVGDSTV NVGNSTI NVGQSQL NVGSTTL NVHISMG

NQSSTNF NQSYTF NVANSYI NVAQSTL NVATNL NVGFHAV NVGNSTL NVGQSQV NVGSTTV NVHYRSQ

NQSSTNI NQSYTI NVANSYL NVAQSTV NVATNV NVGFHFD NVGNSTV NVGQSSF NVGSTV NVIGLSR

NQSSTNL NQSYTL NVANSYV NVAQSV NVATQF IMVGFSKA NVGNSV NVGQSSI NVGSTYF NVIGSSV

NQSSTNV NQSYTV NVANTF NVAQSYF NVATQI NVGFSSV NVGNSYF NVGQSSL NVGSTYI NVKGPSP

NQSSTQF NQSYYF NVANTI NVAQSYI NVATQL NVGFTFD NVGNSYI NVGQSSV NVGSTYL NVMISSV

NQSSTQI NQSYYI NVANTL NVAQSYL NVATQV NVGGASE NVGNSYL NVGQSTF NVGSTYV NVMNSSV

NQSSTQL NQSYYL NVANTNF NVAQSYV NVATSF NVGGASG NVGNSYV NVGQSTI NVGSYF NVMPSTV

NQSSTQV NQSYYV NVANTNI NVAQTF NVATSI NVGGASV NVGNTF NVGQSTL NVGSYGQ NVMVSGR

NQSSTSF NRGGRSQ NVANTNL NVAQTI NVATSL NVGGELV NVGNTI NVGQSTV NVGSYI NVNGSSV

NQSSTSI NRGGSSY NVANTNV NVAQTL NVATSNF NVGGFSA NVGNTL NVGQSV NVGSYL NVNHRSS

NQSSTSL NRGHGSV NVANTQF NVAQT F NVATSNI NVGGGSV NVGNTNF NVGQSYF NVGSYV NVPGPEV

NQSSTSV RGKSDP NVANTQI NVAQTNI NVATSNL NVGGGVV NVGNTNI NVGQSYI NVGTNF NVPGSSQ

NQSSTTF RGTSSY NVANTQL NVAQT L NVATSNV NVGGHSV NVGNTNL NVGQSYL NVGTNI NVPMVLV

NQSSTTI NRIGSSV NVANTQV NVAQTNV NVATSQF NVGGITR NVGNTNV NVGQSYV NVGTNL NVQFSQE

NQSSTTL NRWTSSV NVANTSF NVAQTQF NVATSQI NVGGLDV NVGNTQF NVGQTF NVGTNV NVQQSRV

NQSSTTV NSGGSSP NVANTSI NVAQTQI NVATSQL NVGGRLT NVG TQI NVGQTI NVGTQF NVQSWHV

NQSSTV NSGVRSV NVANTSL NVAQTQL NVATSQV NVGGSDV NVGNTQL NVGQTL NVGTQI NVSGIIV

NQSSTYF NTGGSFV NVANTSV NVAQTQV NVATSSF NVGGSEL NVGNTQV NVGQTNF NVGTQL NVSGLSP

NQSSTYI NTGSSSV NVANTTF NVAQTSF NVATSSI NVGGSEV NVGNTSF NVGQTNI NVGTQV NVSGSAV

NQSSTYL NTGTSDV NVANTTI NVAQTSI NVATSSL NVGGSGV NVGNTSI NVGQTNL NVGTSF NVSGSKV

NQSSTYV NTHTSGV NVANTTL NVAQTSL NVATSSV NVGGSNF NVGNTSL NVGQTNV NVGTSI NVSGSNF

NQSSYF NVAEDSV NVANTTV NVAQTSV NVATSTF NVGGSNI NVGNTSV NVGQTQF NVGTSL NVSGSNI

NQSSYI NVAGGSL NVANTV NVAQTTF NVATSTI NVGGSNL NVGNTTF NVGQTQI NVGTSNF NVSGSNL

NQSSYL NVAGHSH NVANTYF NVAQTTI NVATSTL NVGGSNV NVGNTTI NVGQTQL NVGTSNI NVSGSNV

NQSSYV NVAGSNF NVANTYI NVAQTTL NVATSTV NVGGSQF NVGNTTL NVGQTQV NVGTSNL NVSGSQF

NQSTNF NVAGSNI NVANTYL NVAQTTV NVATSV NVGGSQI NVGNTTV NVGQTSF NVGTSNV NVSGSQI

NQSTNI NVAGSNL NVANTYV NVAQTV NVATSYF NVGGSQL NVGNTV NVGQTSI NVGTSQF NVSGSQL

NQSTNL NVAGSNV NVANYF NVAQTYF NVATSYI NVGGSQV NVGNTYF NVGQTSL NVGTSQI NVSGSQV

NQSTNV NVAGSQF NVANYI NVAQTYI NVATSYL NVGGSSF NVGNTYI NVGQTSV NVGTSQL NVSGSSF NVSGSSI NVSPSQI NVSSNL NVSTTQF PHTGWSV PVGGQSV PVYGSSV QEANSTV QEAQSTF QEATNF

NVSGSSL NVSPSQL NVSSNV NVSTTQI PIGGRSV PVGGQVV PWAMSSV QEANSV QEAQSTI QEATNI

NVSGSSV NVSPSQV NVSSQF NVSTTQL PIGGSSV PVGGRKV PWEGFSK QEANSYF QEAQSTL QEATNL SGSTF NVSPSSF NVSSQI NVSTTQV PIGNNSY PVGGSAV PWGGSSE QEANSYI QEAQSTV QEATNV

NVSGSTI NVSPSSI NVSSQL STTSF PIPTSQI PVGGSDV PWGGSSV QEANSYL QEAQSV QEATQF

NVSGSTL NVSPSSL NVSSQV NVSTTSI PKGGHSV PVGGSGV PWGRSSP QEANSYV QEAQSYF QEATQI

NVSGSTV NVSPSSV NVSSSF NVSTTSL PKGGSSV PVGGSHV PWGTKFV QEANTF QEAQSYI QEATQL

NVSGSYF NVSPSTF NVSSSI NVSTTSV PKGGSVW PVGGSKV PYENSPF QEANTI QEAQSYL QEATQV

NVSGSYI NVSPSTI NVSSSL NVSTTTF PKGQSNV PVGGSQV PYGNSSV QEANTL QEAQSYV QEATSF

NVSGSYL NVSPSTL NVSSSNF NVSTTTI PKHYQSV PVGGSSI PYHGWSV QEANTNF QEAQTF QEATSI

NVSGSYV NVSPSTV NVSSSNI NVSTTTL PKMADSW PVGGSSM PYSGSSW QEANT I QEAQTI QEATSL

NVSGTNF NVSPSYF NVSSSNL NVSTTTV PKMGSSH PVGGSSN QAAMTKM QEANT L QEAQTL QEATSNF

NVSGTNI NVSPSYI NVSSSNV NVSTTV PKSDSSV PVGGSSR QAFTLFV QEANTNV QEAQTNF QEATSNI

NVSGTNL NVSPSYL NVSSSQF NVSTTYF PLEPTSV PVGGSSS QAGEKSS QEANTQF QEAQT I QEATSNL

NVSGTNV NVSPSYV NVSSSQI NVSTTYI PLGGSNV PVGGSSV QAGGDSH QEANTQI QEAQT L QEATSNV

NVSGTQF NVSPTNF NVSSSQL NVSTTYL PLGLSSE PVGGSSW QAGGSSV QEANTQL QEAQTNV QEATSQF

NVSGTQI NVSPTNI NVSSSQV NVSTTYV PLPGQMQ PVGGSSY QAGGVSK QEANTQV QEAQTQF QEATSQI

NVSGTQL NVSPTNL NVSSSSF NVSTYF PLSMWSV PVGGSYV QAGHWIV QEANTSF QEAQTQI QEATSQL

NVSGTQV NVSPTNV NVSSSSI NVSTYI PMGGSSA PVGGTSV QAGKSSH QEANTSI QEAQTQL QEATSQV SGTSF NVSPTQF NVSSSSL NVSTYL PMGGSSV PVGIAYV QAGSTYV QEANTSL QEAQTQV QEATSSF

NVSGTSI NVSPTQI NVSSSSV NVSTYV PMGIRSL PVGKWSV QAGYSHV QEANTSV QEAQTSF QEATSSI

NVSGTSL NVSPTQL NVSSSTF NVSYNF PMGMHSY PVGLIDQ QALGSMQ QEAIMTTF QEAQTSI QEATSSL

NVSGTSV NVSPTQV NVSSSTI NVSYNI PMGMNSW PVGLSSM QAMIVSV QEANTTI QEAQTSL QEATSSV

NVSGTTF NVSPTSF NVSSSTL NVSYNL PMGSTMV PVGLYSV QAPGSSD QEANTTL QEAQTSV QEATSTF

NVSGTTI NVSPTSI NVSSSTV NVSYNV PNDGSHV PVGMQSA QAPGSSV QEANTTV QEAQTTF QEATSTI

NVSGTTL NVSPTSL NVSSSV NVSYQF PNGFSSH PVGMSSV QDGGDSV QEANTV QEAQTTI QEATSTL

NVSGTTV NVSPTSV NVSSSYF NVSYQI PNGGSSV PVGNSGT QDGGSSW QEANTYF QEAQTTL QEATSTV

NVSGTYF NVSPTTF NVSSSYI NVSYQL PNGISIV PVGNSVD QDGMSSV QEANTYI QEAQTTV QEATSV

NVSGTYI NVSPTTI NVSSSYL NVSYQV PNGYHPV PVGPASE QDGMWAD QEANTYL QEAQTV QEATSYF

NVSGTYL NVSPTTL NVSSSYV NVSYSF PNYGSDV PVGPSEL QDGWGAV QEANTYV QEAQTYF QEATSYI

NVSGTYV NVSPTTV NVSSTF NVSYSI PPAWIKL PVGPSNH QDIGSFV QEANYF QEAQTYI QEATSYL

NVSKWSD NVSPTYF NVSSTI NVSYSL PPFGASV PVGPSSG QEAGSNF QEANYI QEAQTYL QEATSYV

NVSNNF NVSPTYI NVSSTL NVSYSV PPGGNSP PVGPSSP QEAGSNI QEANYL QEAQTYV QEATTF

NVSNNI NVSPTYL NVSSTNF NVSYTF PPGGSIV PVGPSSV QEAGSNL QEANYV QEAQYF QEATTI

NVSNNL NVSPTYV NVSSTNI NVSYTI PPGKSSV PVGQDSV QEAGSNV QEAPSNF QEAQYI QEATTL

NVSNNV NVSQNF NVSSTNL NVSYTL PPGQSIV PVGQSDG QEAGSQF QEAPSNI QEAQYL QEATTNF

NVSNQF NVSQNI NVSSTNV NVSYTV PPGSSSM PVGRSVV QEAGSQI QEAPSNL QEAQYV QEATTNI

NVSNQI NVSQNL NVSSTQF NVSYYF PPPGSST PVGSSSA QEAGSQL QEAPSNV QEASNF QEATTNL

NVSNQL NVSQNV NVSSTQI NVSYYI PPRRSVL PVGSSSV QEAGSQV QEAPSQF QEASNI QEATTNV

NVSNQV NVSQQF NVSSTQL NVSYYL PPSGAS PVGTMFD QEAGSSF QEAPSQI QEASNL QEATTQF

NVSNSF NVSQQI NVSSTQV NVSYYV PQGGSSV PVGTSSI QEAGSSI QEAPSQL QEASNV QEATTQI

NVSNSI NVSQQL NVSSTSF NVTGSYY PQGGSSY PVGVHLV QEAGSSL QEAPSQV QEASQF QEATTQL

NVSNSL NVSQQV NVSSTSI NVTGVMA PQGQAGE PVGVSAV QEAGSSV QEAPSSF QEASQI QEATTQV

NVSNSNF NVSQSF NVSSTSL NVTSDSV PQGRDSW PVGVSFV QEAGSTF QEAPSSI QEASQL QEATTSF

NVSNSNI NVSQSI NVSSTSV NVTWENA PQIGSSA PVGWPSV QEAGSTI QEAPSSL QEASQV QEATTSI

NVSNSNL NVSQSL IMVSSTTF NVTYSSV PQYGGHF PVGWSNV QEAGSTL QEAPSSV QEASSF QEATTSL

NVSNSNV NVSQSNF NVSSTTI NVVGPIS PRGGSIM PVGWTSV QEAGST QEAPSTF QEASSI QEATTSV

NVSNSQF NVSQSNI IMVSSTTL NVVSSDV PRGGSSY PVGYIIV QEAGSYF QEAPSTI QEASSL QEATTTF

NVSNSQI NVSQSNL NVSSTTV NVWDWSV PRGYSSI PVGYSYV QEAGSYI QEAPSTL QEASSNF QEATTTI

NVSNSQL NVSQSNV NVSSTV NVWFTSV PSFGNSN PVGYWSH QEAGSYL QEAPSTV QEASSNI QEATTTL

NVSNSQV NVSQSQF NVSSTYF NVWLSSV PSGDAHV PVIASSV QEAGSYV QEAPSYF QEASSNL QEATTTV

NVSNSSF NVSQSQI NVSSTYI NWFGNAV PSVVSNG PVIASYR QEAGTNF QEAPSYI QEASSNV QEATTV

NVSNSSI NVSQSQL NVSSTYL NWGGGKA PSWWSTK PVIGEDR QEAGT I QEAPSYL QEASSQF QEATTYF

NVSNSSL NVSQSQV NVSSTYV NWGGSLQ PTADESY PVIGPIF QEAGT L QEAPSYV QEASSQI QEATTYI

NVSNSSV NVSQSSF NVSSYF NWGGSSV PTDGYDH PVIGRVK QEAGTNV QEAPTNF QEASSQL QEATTYL

NVSNSTF NVSQSSI NVSSYI NWGHDSV PTGDSSL PVIGSSF QEAGTQF QEAPT I QEASSQV QEATTYV

NVSNSTI NVSQSSL NVSSYL NWGLSSV PTGGSSV PVIGSSS QEAGTQI QEAPT L QEASSSF QEATYF

NVSNSTL NVSQSSV NVSSYV NWGRYVV PTGGWLF PVIKISR QEAGTQL QEAPTNV QEASSSI QEATYI

NVSNSTV NVSQSTF NVSTNF NWGVFSI PVAGSSN PVLASSS QEAGTQV QEAPTQF QEASSSL QEATYL

NVSNSV NVSQSTI NVSTNI NWIGSSV PVATSVY PVLGLSV QEAGTSF QEAPTQI QEASSSV QEATYV

NVSNSYF NVSQSTL NVSTNL NWLGSWP PVAWSGW PVLGNNE QEAGTSI QEAPTQL QEASSTF QEAYNF

NVSNSYI NVSQSTV NVSTNV NWRYPSV PVDAQSV PVLGSSK QEAGTSL QEAPTQV QEASSTI QEAYNI

NVSNSYL NVSQSV NVSTQF NWSGSSV PVDGSGE PVLNFAV QEAGTSV QEAPTSF QEASSTL QEAY L

NVSNSYV NVSQSYF NVSTQI NYGGSFV PVDGTSV PVMDSEV QEAGTTF QEAPTSI QEASSTV QEAYNV

NVSNTF NVSQSYI NVSTQL NYGGSVI PVDISSV PVMGSSV QEAGTTI QEAPTSL QEASSV QEAYQF

NVSNTI NVSQSYL NVSTQV NYGSGSR PVDLSSS PVMHSSA QEAGTTL QEAPTSV QEASSYF QEAYQI

NVSNTL NVSQSYV NVSTSF NYQESAV PVDLSSV PVNGMSV QEAGTTV QEAPTTF QEASSYI QEAYQL

NVSNTNF NVSQTF NVSTSI NYWGSSV PVDRSMV PVNGSSW QEAGTYF QEAPTTI QEASSYL QEAYQV

NVSNTNI NVSQTI NVSTSL PADLSAF PVEDSVG PVPGEFG QEAGTYI QEAPTTL QEASSYV QEAYSF

NVSNTNL NVSQTL NVSTSNF PAGGSSV PVEESSV PVPKSSN QEAGTYL QEAPTTV QEASTF QEAYSI

NVSNTNV NVSQTNF NVSTSNI PAGLSSV PVEFSVF PVQGFSF QEAGTYV QEAPTYF QEASTI QEAYSL

NVSNTQF NVSQTNI NVSTSNL PAGQSSS PVEGNGV PVQMDSV QEANNF QEAPTYI QEASTL QEAYSV

NVSNTQI NVSQTNL NVSTSNV PAGVFSS PVEGPEW PVQVSMK QEANNI QEAPTYL QEASTNF QEAYTF

NVSNTQL NVSQTNV NVSTSQF PANRFGS PVEGSSV PVSGPSV QEANNL QEAPTYV QEASTNI QEAYTI

NVSNTQV NVSQTQF NVSTSQI PDGERDV PVEVFSV PVSSSYV QEANNV QEAQNF QEASTNL QEAYTL

NVSNTSF NVSQTQI NVSTSQL PDGIVEV PVFGSKV PVTASIV QEANQF QEAQNI QEASTNV QEAYTV

NVSNTSI NVSQTQL NVSTSQV PDGLSSV PVFLELM PVTGIAV QEANQI QEAQNL QEASTQF QEAYYF

NVSNTSL NVSQTQV NVSTSSF PDVVSSV PVGANSG PVTGRSV QEANQL QEAQNV QEASTQI QEAYYI

NVSNTSV NVSQTSF NVSTSSI PEGGGWD PVGAYAH PVTGSGV QEANQV QEAQQF QEASTQL QEAYYL

NVSNTTF NVSQTSI NVSTSSL PEGGHDV PVGDASV PVTGVAV QEANSF QEAQQI QEASTQV QEAYYV

NVSNTTI NVSQTSL NVSTSSV PEGGSFE PVGDQNV PVTSSHK QEANSI QEAQQL QEASTSF QEGGSNF

NVSNTTL NVSQTSV NVSTSTF PEGGSYP PVGDSFD PVVAQAW QEANSL QEAQQV QEASTSI QEGGSNI

NVSNTTV NVSQTTF NVSTSTI PEGQSGW PVGDSSS PVVERSV QEANSNF QEAQSF QEASTSL QEGGSNL

NVSNTV NVSQTTI NVSTSTL PEGRREV PVGEPHV PVVESSV QEANSNI QEAQSI Q EASTS V QEGGSNV

NVSNTYF NVSQTTL NVSTSTV PEGSSSV PVGESSV PVVGAGH QEANSNL QEAQSL QEASTTF QEGGSQF

NVSNTYI NVSQTTV NVSTSV PFGGSLK PVGFRSV PVVGSEG QEANSNV QEAQSNF QEASTTI QEGGSQI

NVSNTYL NVSQTV STSYF PFGGSSY PVGFSSV PVVGSSN QEANSQF QEAQSNI QEASTTL QEGGSQL

NVSNTYV NVSQTYF NVSTSYI PFHWYSV PVGGASV PVVGWMV QEANSQI QEAQSNL QEASTTV QEGGSQV

NVSNYF NVSQTYI STSYL PFSGSSD PVGGAVV PVVLSAH QEANSQL QEAQSNV QEAST QEGGSSF

NVSNYI NVSQTYL NVSTSYV PFWGTPV PVGGDSV PVWGSHV QEANSQV QEAQSQF QEASTYF QEGGSSI

NVSNYL NVSQTYV IMVSTTF PGKGPVV PVGGETV PVWGSSV QEANSSF QEAQSQI QEASTYI QEGGSSL

NVSNYV NVSQYF NVSTTI PGPGSLV PVGGFSN PVWGSSY QEANSSI QEAQSQL QEASTYL QEGGSSV

NVSPSNF NVSQYI IMVSTTL PHGGISV PVGGFSW PVWMWYK QEANSSL QEAQSQV QEASTYV QEGGSTF

NVSPSNI NVSQYL NVSTTNF PHGGKSV PVGGHSV PVWPSSV QEANSSV QEAQSSF QEASYF QEGGSTI

NVSPSNL NVSQYV NVSTTNI PHGGSHV PVGGISM PVWSSSV QEANSTF QEAQSSI QEASYI QEGGSTL

NVSPSNV NVSSNF NVSTTNL PHGISDW PVGGPSV PVWVSMV QEANSTI QEAQSSL QEASYL QEGGSTV

NVSPSQF NVSSNI NVSTTNV PHGQTSR PVGGQQV PVYESIM QEANSTL QEAQSSV QEASYV QEGGSYF QEGGSYI QEGPSTI QEGSSL QEGTTTF QESNSTI QESQSSL QESSYL QHGKSSD QNANTF QNAQSYI

QEGGSYL QEGPSTL QEGSSNF QEGTTTI QES STL QESQSSV QESSYV QHGLTSV QNANTI QNAQSYL

QEGGSYV QEGPSTV QEGSSNI QEGTTTL QESNSTV QESQSTF QESTNF QHGQSSV QNANTL QNAQSYV

QEGGTNF QEGPSYF QEGSSNL QEGTTTV QESNSV QESQSTI QESTNI QHIESGV QNANT F QNAQTF

QEGGTNI QEGPSYI QEGSSNV QEGTTV QESNSYF QESQSTL QESTNL QHNGRQV QNANTNI QNAQTI

QEGGTNL QEGPSYL QEGSSQF QEGTTYF QESNSYI QESQSTV QESTNV QHSGSSV QNANTNL QNAQTL

QEGGTNV QEGPSYV QEGSSQI QEGTTYI QESNSYL QESQSV QESTQF QIILSIS QNANTNV QNAQTNF

QEGGTQF QEGPTNF QEGSSQL QEGTTYL QESNSYV QESQSYF QESTQI QIVHSIS QNANTQF QNAQTNI

QEGGTQI QEGPTNI QEGSSQV QEGTTYV QESNTF QESQSYI QESTQL QIVTETI QNANTQI QNAQTNL

QEGGTQL QEGPTNL QEGSSSF QEGTYF QESNTI QESQSYL QESTQV QIWGSSE QNANTQL QNAQTNV

QEGGTQV QEGPTNV QEGSSSI QEGTYI QESNTL QESQSYV QESTSF QIWGSSV QNANTQV QNAQTQF

QEGGTSF QEGPTQF QEGSSSL QEGTYL QESNTNF QESQTF QESTSI QKGRWKG QNANTSF QNAQTQI

QEGGTSI QEGPTQI QEGSSSV QEGTYV QESNTNI QESQTI QESTSL QKGTSSV QNANTSI QNAQTQL

QEGGTSL QEGPTQL QEGSSTF QEGYNF QESNTNL QESQTL QESTSNF QKIGSSV QNANTSL QNAQTQV

QEGGTSV QEGPTQV QEGSSTI QEGYNI QESNTNV QESQTNF QESTSNI QLAGSSE Q ANTS QNAQTSF

QEGGTTF QEGPTSF QEGSSTL QEGYNL QESNTQF QESQTNI QESTSNL QLGGSKV QNANTTF QNAQTSI

QEGGTTI QEGPTSI QEGSSTV QEGYNV QESNTQI QESQTNL QESTSNV QLGGSSI QNANTTI QNAQTSL

QEGGTTL QEGPTSL QEGSSV QEGYQF QESNTQL QESQTNV QESTSQF QLTVSAV QNANTTL QNAQTSV

QEGGTTV QEGPTSV QEGSSYF QEGYQI QESNTQV QESQTQF QESTSQI QMDGESP QNANTTV QNAQTTF

QEGGTYF QEGPTTF QEGSSYI QEGYQL QESNTSF QESQTQI QESTSQL QMGASMV QNANTV QNAQTTI

QEGGTYI QEGPTTI QEGSSYL QEGYQV QESNTSI QESQTQL QESTSQV QMGGSST QNANTYF QNAQTTL

QEGGTYL QEGPTTL QEGSSYV QEGYSF QESNTSL QESQTQV QESTSSF QMGGTEY Q ANTYI QNAQTTV

QEGGTYV QEGPTTV QEGSTF QEGYSI QESNTSV QESQTSF QESTSSI QMGISST Q ANTYL QNAQTV

QEGNFKI QEGPTYF QEGSTI QEGYSL QESNTTF QESQTSI QESTSSL QMIGTST QNANTYV QNAQTYF

QEGNNF QEGPTYI QEGSTL QEGYSV QESNTTI QESQTSL QESTSSV QMVMSTV QNANYF QNAQTYI

QEGNNI QEGPTYL QEGSTNF QEGYTF QESNTTL QESQTSV QESTSTF QNAGSNF Q A YI QNAQTYL

QEGNNL QEGPTYV QEGSTNI QEGYTI QESNTTV QESQTTF QESTSTI Q AGS I QNANYL QNAQTYV

QEGNNV QEGQNF QEGSTNL QEGYTL QESNTV QESQTTI QESTSTL Q AGS L QNANYV QNAQYF

QEGNQF QEGQNI QEGSTNV QEGYTV QESNTYF QESQTTL QESTSTV QNAGSNV QNAPSNF QNAQYI

QEGNQI QEGQNL QEGSTQF QEGYYF QESNTYI QESQTTV QESTSV QNAGSQF QNAPSNI QNAQYL

QEGNQL QEGQNV QEGSTQI QEGYYI QESNTYL QESQTV QESTSYF QNAGSQI QNAPSNL QNAQYV

QEGNQV QEGQQF QEGSTQL QEGYYL QESNTYV QESQTYF QESTSYI QNAGSQL QNAPSNV QNASNF

QEGNSF QEGQQI QEGSTQV QEGYYV QESNYF QESQTYI QESTSYL QNAGSQV QNAPSQF QNASNI

QEGNSI QEGQQL QEGSTSF QESGSNF QESNYI QESQTYL QESTSYV QNAGSSF QNAPSQI QNASNL

QEGNSL QEGQQV QEGSTSI QESGSNI QESNYL QESQTYV QESTTF Q NAG SSI QNAPSQL QNASNV

QEGNSNF QEGQSF QEGSTSL QESGSNL QESNYV QESQYF QESTTI QNAGSSL QNAPSQV QNASQF

QEGNSNI QEGQSI QEGSTSV QESGSNV QESPSNF QESQYI QESTTL QNAGSSV QNAPSSF QNASQI

QEGNSNL QEGQSL QEGSTTF QESGSQF QESPSNI QESQYL QESTTNF QNAGSTF QNAPSSI QNASQL

QEGNSNV QEGQSNF QEGSTTI QESGSQI QESPSNL QESQYV QESTTNI QNAGSTI QNAPSSL QNASQV

QEGNSQF QEGQSNI QEGSTTL QESGSQL QESPSNV QESSNF QESTTNL QNAGSTL QNAPSSV QNASSF

QEGNSQI QEGQSNL QEGSTTV QESGSQV QESPSQF QESSNI QESTTNV Q AGST QNAPSTF QNASSI

QEGNSQL QEGQSNV QEGSTV QESGSSF QESPSQI QESSNL QESTTQF QNAGSYF QNAPSTI QNASSL

QEGNSQV QEGQSQF QEGSTYF QESGSSI QESPSQL QESSNV QESTTQI Q AGSYI QNAPSTL QNASSNF

QEGNSSF QEGQSQI QEGSTYI QESGSSL QESPSQV QESSQF QESTTQL QNAGSYL QNAPSTV QNASSNI

QEGNSSI QEGQSQL QEGSTYL QESGSSV QESPSSF QESSQI QESTTQV QNAGSYV QNAPSYF QNASSNL

QEGNSSL QEGQSQV QEGSTYV QESGSTF QESPSSI QESSQL QESTTSF QNAGT F QNAPSYI QNASSNV

QEGNSSV QEGQSSF QEGSYF QESGSTI QESPSSL QESSQV QESTTSI QNAGTNI QNAPSYL QNASSQF

QEGNSTF QEGQSSI QEGSYI QESGSTL QESPSSV QESSSF QESTTSL QNAGTNL Q APSYV QNASSQI

QEGNSTI QEGQSSL QEGSYL QESGSTV QESPSTF QESSSI QESTTSV QNAGTNV QNAPTNF QNASSQL

QEGNSTL QEGQSSV QEGSYV QESGSYF QESPSTI QESSSL QESTTTF QNAGTQF QNAPTNI QNASSQV

QEGNSTV QEGQSTF QEGTNF QESGSYI QESPSTL QESSSNF QESTTTI QNAGTQI QNAPTNL QNASSSF

QEGNSV QEGQSTI QEGTNI QESGSYL QESPSTV QESSSNI QESTTTL QNAGTQL QNAPTNV QNASSSI

QEGNSYF QEGQSTL QEGTNL QESGSYV QESPSYF QESSSNL QESTTTV QNAGTQV QNAPTQF QNASSSL

QEGNSYI QEGQSTV QEGTNV QESGTNF QESPSYI QESSSNV QESTTV QNAGTSF QNAPTQI QNASSSV

QEGNSYL QEGQSV QEGTQF QESGTNI QESPSYL QESSSQF QESTTYF QNAGTSI QNAPTQL QNASSTF

QEGNSYV QEGQSYF QEGTQI QESGTNL QESPSYV QESSSQI QESTTYI QNAGTSL QNAPTQV QNASSTI

QEGNTF QEGQSYI QEGTQL QESGTNV QESPTNF QESSSQL QESTTYL QNAGTSV QNAPTSF QNASSTL

QEGNTI QEGQSYL QEGTQV QESGTQF QESPTNI QESSSQV QESTTYV QNAGTTF QNAPTSI QNASSTV

QEGNTL QEGQSYV QEGTSF QESGTQI QESPTNL QESSSSF QESTYF QNAGTTI QNAPTSL QNASSV

QEGNTNF QEGQTF QEGTSI QESGTQL QESPTNV QESSSSI QESTYI QNAGTTL QNAPTSV QNASSYF

QEGNTNI QEGQTI QEGTSL QESGTQV QESPTQF QESSSSL QESTYL QNAGTTV QNAPTTF QNASSYI

QEGNTNL QEGQTL QEGTSNF QESGTSF QESPTQI QESSSSV QESTYV QNAGTYF QNAPTTI QNASSYL

QEGNTNV QEGQT F QEGTSNI QESGTSI QESPTQL QESSSTF QESYNF QNAGTYI QNAPTTL QNASSYV

QEGNTQF QEGQTNI QEGTSNL QESGTSL QESPTQV QESSSTI QESYNI QNAGTYL QNAPTTV QNASTF

QEGNTQI QEGQT L QEGTSNV QESGTSV QESPTSF QESSSTL QESYNL QNAGTYV Q APTYF QNASTI

QEGNTQL QEGQTNV QEGTSQF QESGTTF QESPTSI QESSSTV QESYNV QNANNF QNAPTYI QNASTL

QEGNTQV QEGQTQF QEGTSQI QESGTTI QESPTSL QESSSV QESYQF QNANNI QNAPTYL QNASTNF

QEGNTSF QEGQTQI QEGTSQL QESGTTL QESPTSV QESSSYF QESYQI QNANNL QNAPTYV QNASTNI

QEGNTSI QEGQTQL QEGTSQV QESGTTV QESPTTF QESSSYI QESYQL QNANNV QNAQNF QNASTNL

QEGNTSL QEGQTQV QEGTSSF QESGTYF QESPTTI QESSSYL QESYQV QNANQF QNAQNI QNASTNV

QEGNTSV QEGQTSF QEGTSSI QESGTYI QESPTTL QESSSYV QESYSF QNANQI QNAQNL QNASTQF

QEGNTTF QEGQTSI QEGTSSL QESGTYL QESPTTV QESSTF QESYSI QNANQL QNAQNV QNASTQI

QEGNTTI QEGQTSL QEGTSSV QESGTYV QESPTYF QESSTI QESYSL QNANQV QNAQQF QNASTQL

QEGNTTL QEGQTSV QEGTSTF QESNNF QESPTYI QESSTL QESYSV QNANSF QNAQQI QNASTQV

QEGNTTV QEGQTTF QEGTSTI QESNNI QESPTYL QESSTNF QESYTF QNANSI QNAQQL QNASTSF

QEGNTV QEGQTTI QEGTSTL QESNNL QESPTYV QESSTNI QESYTI QNANSL QNAQQV QNASTSI

QEGNTYF QEGQTTL QEGTSTV QESNNV QESQNF QESSTNL QESYTL QNANSNF QNAQSF QNASTSL

QEGNTYI QEGQTTV QEGTSV QESNQF QESQNI QESSTNV QESYTV QNANSNI QNAQSI QNASTSV

QEGNTYL QEGQTV QEGTSYF QESNQI QESQNL QESSTQF QESYYF QNANSNL QNAQSL QNASTTF

QEGNTYV QEGQTYF QEGTSYI QESNQL QESQNV QESSTQI QESYYI QNANSNV QNAQSNF QNASTTI

QEGNYF QEGQTYI QEGTSYL QESNQV QESQQF QESSTQL QESYYL QNANSQF QNAQSNI QNASTTL

QEGNYI QEGQTYL QEGTSYV QESNSF QESQQI QESSTQV QESYYV QNANSQI QNAQSNL QNASTTV

QEGNYL QEGQTYV QEGTTF QESNSI QESQQL QESSTSF QFELSEQ QNANSQL QNAQSNV QNASTV

QEGNYV QEGQYF QEGTTI QESNSL QESQQV QESSTSI QFGERSQ QNANSQV QNAQSQF QNASTYF

QEGPSNF QEGQYI QEGTTL QESNSNF QESQSF QESSTSL QFGGSSG QNANSSF QNAQSQI QNASTYI

QEGPSNI QEGQYL QEGTTNF QESNSNI QESQSI QESSTSV QFGNTSH QNANSSI QNAQSQL QNASTYL

QEGPSNL QEGQYV QEGTTNI QESNSNL QESQSL QESSTTF QFVGSSV QNANSSL QNAQSQV QNASTYV

QEGPSNV QEGSNF QEGTTNL QESNSNV QESQSNF QESSTTI QGGGIST QNANSSV QNAQSSF QNASYF

QEGPSQF QEGSNI QEGTTNV QESNSQF QESQSNI QESSTTL QGGGSVF QNANSTF QNAQSSI QNASYI

QEGPSQI QEGSNL QEGTTQF QESNSQI QESQSNL QESSTTV QGGPQSV QNANSTI QNAQSSL QNASYL

QEGPSQL QEGSNV QEGTTQI QESNSQL QESQSNV QESSTV QGGQSMV QNANSTL QNAQSSV QNASYV

QEGPSQV QEGSQF QEGTTQL QESNSQV QESQSQF QESSTYF QGGTSSV QNANSTV QNAQSTF QNATNF

QEGPSSF QEGSQI QEGTTQV QESNSSF QESQSQI QESSTYI QGNGSSK QNANSV QNAQSTI QNATNI

QEGPSSI QEGSQL QEGTTSF QESNSSI QESQSQL QESSTYL QGQGSSV QNANSYF QNAQSTL QNATNL

QEGPSSL QEGSQV QEGTTSI QES SSL QESQSQV QESSTYV QHEFTSR QNANSYI QNAQSTV QNATNV

QEGPSSV QEGSSF QEGTTSL QESNSSV QESQSSF QESSYF QHGESSV QNANSYL QNAQSV QNATQF

QEGPSTF QEGSSI QEGTTSV QESNSTF QESQSSI QESSYI QHGGPSV QNANSYV QNAQSYF QNATQI QNATQL QNGGTNV QNGPTNF QNGSSQL QNGTTYL QNSNSYI QNSQSTV QNSTNV QQAGSSV QQAPSSF

QNATQV QNGGTQF QNGPTNI QNGSSQV QNGTTYV QNSNSYL QNSQSV QNSTQF QQAGSTF QQAPSSI

QNATSF QNGGTQI QNGPTNL QNGSSSF QNGTYF QNSNSYV QNSQSYF QNSTQI QQAGSTI QQAPSSL

QNATSI QNGGTQL QNGPTNV QNGSSSI QNGTYI QNSNTF QNSQSYI QNSTQL QQAGSTL QQAPSSV

QNATSL QNGGTQV QNGPTQF QNGSSSL QNGTYL QNSNTI QNSQSYL QNSTQV QQAGSTV QQAPSTF

QNATSNF QNGGTSF QNGPTQI QNGSSSV QNGTYV QNSNTL QNSQSYV QNSTSF QQAGSYF QQAPSTI

QNATSNI QNGGTSI QNGPTQL QNGSSTF QNGYNF QNSNTNF QNSQTF QNSTSI QQAGSYI QQAPSTL

QNATS L QNGGTSL QNGPTQV QNGSSTI QNGYNI QNSNTNI QNSQTI QNSTSL QQAGSYL QQAPSTV

QNATSNV QNGGTSV QNGPTSF QNGSSTL QNGYNL QNSNTNL QNSQTL QNSTSNF QQAGSYV QQAPSYF

QNATSQF QNGGTTF QNGPTSI QNGSSTV QNGYNV QNSNTNV QNSQTNF QNSTSNI QQAGTNF QQAPSYI

QNATSQI QNGGTTI QNGPTSL QNGSSV QNGYQF QNSNTQF QNSQTNI QNSTSNL QQAGTNI QQAPSYL

QNATSQL QNGGTTL QNGPTSV QNGSSYF QNGYQI QNSNTQI QNSQTNL QNSTSNV QQAGTNL QQAPSYV

QNATSQV QNGGTTV QNGPTTF QNGSSYI QNGYQL QNSNTQL QNSQTNV QNSTSQF QQAGTNV QQAPTNF

QNATSSF QNGGTYF QNGPTTI QNGSSYL QNGYQV QNSNTQV QNSQTQF QNSTSQI QQAGTQF QQAPTNI

QNATSSI QNGGTYI QNGPTTL QNGSSYV QNGYSF QNSNTSF QNSQTQI QNSTSQL QQAGTQI QQAPTNL

QNATSSL QNGGTYL QNGPTTV QNGSTF QNGYSI QNSNTSI QNSQTQL QNSTSQV QQAGTQL QQAPTNV

QNATSSV QNGGTYV QNGPTYF QNGSTI QNGYSL QNSNTSL QNSQTQV QNSTSSF QQAGTQV QQAPTQF

QNATSTF QNGNNF QNGPTYI QNGSTL QNGYSV QNSNTSV QNSQTSF QNSTSSI QQAGTSF QQAPTQI

QNATSTI QNGNNI QNGPTYL QNGSTNF QNGYTF QNSNTTF QNSQTSI QNSTSSL QQAGTSI QQAPTQL

QNATSTL QNGNNL QNGPTYV QNGSTNI QNGYTI QNSNTTI QNSQTSL QNSTSSV QQAGTSL QQAPTQV

QNATSTV QNGNNV QNGQNF QNGSTNL QNGYTL QNSNTTL QNSQTSV QNSTSTF QQAGTSV QQAPTSF

QNATSV QNGNQF QNGQNI QNGSTNV QNGYTV QNSNTTV QNSQTTF QNSTSTI QQAGTTF QQAPTSI

QNATSYF QNGNQI QNGQNL QNGSTQF QNGYYF QNSNTV QNSQTTI QNSTSTL QQAGTTI QQAPTSL

QNATSYI QNGNQL QNGQNV QNGSTQI QNGYYI QNSNTYF QNSQTTL QNSTSTV QQAGTTL QQAPTSV

QNATSYL QNGNQV QNGQQF QNGSTQL QNGYYL QNSNTYI QNSQTTV QNSTSV QQAGTTV QQAPTTF

QNATSYV QNGNSF QNGQQI QNGSTQV QNGYYV QNSNTYL QNSQTV QNSTSYF QQAGTYF QQAPTTI

QNATTF QNGNSI QNGQQL QNGSTSF QNIGSSD QNSNTYV QNSQTYF QNSTSYI QQAGTYI QQAPTTL

QNATTI QNGNSL QNGQQV QNGSTSI QNMLSYV QNSNYF QNSQTYI QNSTSYL QQAGTYL QQAPTTV

QNATTL QNGNSNF QNGQSF QNGSTSL QNSGSNF QNSNYI QNSQTYL QNSTSYV QQAGTYV QQAPTYF

QNATTNF QNGNSNI QNGQSI QNGSTSV QNSGSNI QNSNYL QNSQTYV QNSTTF QQANNF QQAPTYI

QNATTNI QNGNSNL QNGQSL QNGSTTF QNSGSNL QNSNYV QNSQYF QNSTTI QQANNI QQAPTYL

QNATTNL QNGNSNV QNGQSNF QNGSTTI QNSGSNV QNSPSNF QNSQYI QNSTTL QQANNL QQAPTYV

QNATTNV QNGNSQF QNGQSNI QNGSTTL QNSGSQF QNSPSNI QNSQYL QNSTTNF QQANNV QQAQNF

QNATTQF QNGNSQI QNGQSNL QNGSTTV QNSGSQI QNSPSNL QNSQYV QNSTTNI QQANQF QQAQNI

QNATTQI QNGNSQL QNGQSNV QNGSTV QNSGSQL QNSPSNV QNSSNF QNSTTNL QQANQI QQAQNL

QNATTQL QNGNSQV QNGQSQF QNGSTYF QNSGSQV QNSPSQF QNSSNI QNSTTNV QQANQL QQAQNV

QNATTQV QNGNSSF QNGQSQI QNGSTYI QNSGSSF QNSPSQI QNSSNL QNSTTQF QQANQV QQAQQF

QNATTSF QNGNSSI QNGQSQL QNGSTYL QNSGSSI QNSPSQL QNSSNV QNSTTQI QQANSF QQAQQI

QNATTSI QNGNSSL QNGQSQV QNGSTYV QNSGSSL QNSPSQV QNSSQF QNSTTQL QQANSI QQAQQL

QNATTSL QNGNSSV QNGQSSF QNGSYF QNSGSSV QNSPSSF QNSSQI QNSTTQV QQANSL QQAQQV

QNATTSV QNGNSTF QNGQSSI QNGSYI QNSGSTF QNSPSSI QNSSQL QNSTTSF QQANSNF QQAQSF

QNATTTF QNGNSTI QNGQSSL QNGSYL QNSGSTI QNSPSSL QNSSQV QNSTTSI QQANSNI QQAQSI

QNATTTI QNGNSTL QNGQSSV QNGSYV QNSGSTL QNSPSSV QNSSSF QNSTTSL QQANSNL QQAQSL

QNATTTL QNGNSTV QNGQSTF QNGTNF QNSGST QNSPSTF QNSSSI QNSTTSV QQANSNV QQAQSNF

QNATTTV QNGNSV QNGQSTI QNGTNI QNSGSYF QNSPSTI QNSSSL QNSTTTF QQANSQF QQAQSNI

QNATTV QNGNSYF QNGQSTL QNGTNL QNSGSYI QNSPSTL QNSSSNF QNSTTTI QQANSQI QQAQSNL

QNATTYF QNGNSYI QNGQSTV QNGTNV QNSGSYL QNSPSTV QNSSSNI QNSTTTL QQANSQL QQAQSNV

QNATTYI QNGNSYL QNGQSV QNGTQF QNSGSYV QNSPSYF QNSSSNL QNSTTTV QQANSQV QQAQSQF

QNATTYL QNGNSYV QNGQSYF QNGTQI QNSGTNF QNSPSYI QNSSSNV QNSTTV QQANSSF QQAQSQI

QNATTYV QNGNTF QNGQSYI QNGTQL QNSGTNI QNSPSYL QNSSSQF QNSTTYF QQANSSI QQAQSQL

QNATYF QNGNTI QNGQSYL QNGTQV QNSGTNL QNSPSYV QNSSSQI QNSTTYI QQANSSL QQAQSQV

QNATYI QNGNTL QNGQSYV QNGTSF QNSGTNV QNSPTNF QNSSSQL QNSTTYL QQANSSV QQAQSSF

QNATYL QNGNTNF QNGQTF QNGTSI QNSGTQF QNSPTNI QNSSSQV QNSTTYV QQANSTF QQAQSSI

QNATYV QNGNTNI QNGQTI QNGTSL QNSGTQI QNSPTNL QNSSSSF QNSTYF QQANSTI QQAQSSL

QNAYNF QNGNTNL QNGQTL QNGTSNF QNSGTQL QNSPTNV QNSSSSI QNSTYI QQANSTL QQAQSSV

QNAYNI QNGNTNV QNGQTNF QNGTSNI QNSGTQV QNSPTQF QNSSSSL QNSTYL QQANSTV QQAQSTF

QNAYNL QNGNTQF QNGQTNI QNGTSNL QNSGTSF QNSPTQI QNSSSSV QNSTYV QQANSV QQAQSTI

QNAYNV QNGNTQI QNGQTNL QNGTSNV QNSGTSI QNSPTQL QNSSSTF QNSYNF QQANSYF QQAQSTL

QNAYQF QNGNTQL QNGQTNV QNGTSQF QNSGTSL QNSPTQV QNSSSTI QNSYNI QQANSYI QQAQSTV

QNAYQI QNGNTQV QNGQTQF QNGTSQI QNSGTSV QNSPTSF QNSSSTL QNSYNL QQANSYL QQAQSV

QNAYQL QNGNTSF QNGQTQI QNGTSQL QNSGTTF QNSPTSI QNSSSTV QNSYNV QQANSYV QQAQSYF

QNAYQV QNGNTSI QNGQTQL QNGTSQV QNSGTTI QNSPTSL QNSSSV QNSYQF QQANTF QQAQSYI

QNAYSF QNGNTSL QNGQTQV QNGTSSF QNSGTTL QNSPTSV QNSSSYF QNSYQI QQANTI QQAQSYL

QNAYSI QNGNTSV QNGQTSF QNGTSSI QNSGTTV QNSPTTF QNSSSYI QNSYQL QQANTL QQAQSYV

QNAYSL QNGNTTF QNGQTSI QNGTSSL QNSGTYF QNSPTTI QNSSSYL QNSYQV QQANTNF QQAQTF

QNAYSV QNGNTTI QNGQTSL QNGTSSV QNSGTYI QNSPTTL QNSSSYV QNSYSF QQANTNI QQAQTI

QNAYTF QNGNTTL QNGQTSV QNGTSTF QNSGTYL QNSPTTV QNSSTF QNSYSI QQANTNL QQAQTL

QNAYTI QNGNTTV QNGQTTF QNGTSTI QNSGTYV QNSPTYF QNSSTI QNSYSL QQANTNV QQAQTNF

QNAYTL QNGNTV QNGQTTI QNGTSTL QNSNNF QNSPTYI QNSSTL QNSYSSW QQANTQF QQAQTNI

QNAYTV QNGNTYF QNGQTTL QNGTSTV QNSNNI QNSPTYL QNSSTNF QNSYSV QQANTQI QQAQTNL

QNAYYF QNGNTYI QNGQTTV QNGTSV QNSNNL QNSPTYV QNSSTNI QNSYTF QQANTQL QQAQTNV

QNAYYI QNGNTYL QNGQTV QNGTSYF QNSNNV QNSQNF QNSSTNL QNSYTI QQANTQV QQAQTQF

QNAYYL QNGNTYV QNGQTYF QNGTSYI QNSNQF QNSQNI QNSSTNV QNSYTL QQANTSF QQAQTQI

QNAYYV QNGNYF QNGQTYI QNGTSYL QNSNQI QNSQNL QNSSTQF QNSYTV QQANTSI QQAQTQL

QNGGSNF QNGNYI QNGQTYL QNGTSYV QNSNQL QNSQNV QNSSTQI QNSYYF QQANTSL QQAQTQV

QNGGSNI QNGNYL QNGQTYV QNGTTF QNSNQV QNSQQF QNSSTQL QNSYYI QQANTSV QQAQTSF

QNGGSNL QNGNYV QNGQYF QNGTTI QNSNSF QNSQQI QNSSTQV QNSYYL QQANTTF QQAQTSI

QNGGSNV QNGPSNF QNGQYI QNGTTL QNSNSI QNSQQL QNSSTSF QNSYYV QQANTTI QQAQTSL

QNGGSQF QNGPSNI QNGQYL QNGTTNF QNSNSL QNSQQV QNSSTSI QPEGSSP QQANTTL QQAQTSV

QNGGSQI QNGPSNL QNGQYV QNGTTNI QNSNSNF QNSQSF QNSSTSL QPGGQSP QQANTTV QQAQTTF

QNGGSQL QNGPSNV QNGSNF QNGTTNL QNSNSNI QNSQSI QNSSTSV QPGGSSV QQANTV QQAQTTI

QNGGSQV QNGPSQF QNGSNI QNGTTNV QNSNSNL QNSQSL QNSSTTF QPGKLSG QQANTYF QQAQTTL

QNGGSSF QNGPSQI QNGSNL QNGTTQF QNSNSNV QNSQSNF QNSSTTI QPGRSPV QQANTYI QQAQTTV

QNGGSSI QNGPSQL QNGSNV QNGTTQI QNSNSQF QNSQSNI QNSSTTL QPGVSSV QQANTYL QQAQTV

QNGGSSL QNGPSQV QNGSQF QNGTTQL QNSNSQI QNSQSNL QNSSTTV QPIGWSV QQANTYV QQAQTYF

QNGGSSV QNGPSSF QNGSQI QNGTTQV QNSNSQL QNSQSNV QNSSTV QPVGEDV QQANYF QQAQTYI

QNGGSTF QNGPSSI QNGSQL QNGTTSF QNSNSQV QNSQSQF QNSSTYF QQAGSNF QQANYI QQAQTYL

QNGGSTI QNGPSSL QNGSQV QNGTTSI QNSNSSF QNSQSQI QNSSTYI QQAGSNI QQANYL QQAQTYV

QNGGSTL QNGPSSV QNGSSF QNGTTSL QNSNSSI QNSQSQL QNSSTYL QQAGSNL QQANYV QQAQYF

QNGGSTV QNGPSTF QNGSSI QNGTTSV QNSNSSL QNSQSQV QNSSTYV QQAGSNV QQAPSNF QQAQYI

QNGGSYF QNGPSTI QNGSSL QNGTTTF QNSNSSV QNSQSSF QNSSYF QQAGSQF QQAPSNI QQAQYL

QNGGSYI QNGPSTL QNGSSNF QNGTTTI QNSNSTF QNSQSSI QNSSYI QQAGSQI QQAPSNL QQAQYV

QNGGSYL QNGPSTV QNGSSNI QNGTTTL QNSNSTI QNSQSSL QNSSYL QQAGSQL QQAPSNV QQASNF

QNGGSYV QNGPSYF QNGSSNL QNGTTTV QNSNSTL QNSQSSV QNSSYV QQAGSQV QQAPSQF QQASNI

QNGGTNF QNGPSYI QNGSSNV QNGTTV QNSNSTV QNSQSTF QNSTNF QQAGSSF QQAPSQI QQASNL

QNGGTNI QNGPSYL QNGSSQF QNGTTYF QNSNSV QNSQSTI QNSTNI QQAGSSI QQAPSQL QQASNV

QNGGTNL QNGPSYV QNGSSQI QNGTTYI QNSNSYF QNSQSTL QNSTNL QQAGSSL QQAPSQV QQASQF QQASQI QQATTQV QQGNSNV QQGQSNF QQGSTTF QQSGSNV QQSPSNF QQSQYI QQSTTL QVANNL

QQASQL QQATTSF QQGNSQF QQGQSNI QQGSTTI QQSGSQF QQSPSNI QQSQYL QQSTTNF QVANNV

QQASQV QQATTSI QQGNSQI QQGQSNL QQGSTTL QQSGSQI QQSPSNL QQSQYV QQSTTNI QVANQF

QQASSF QQATTSL QQGNSQL QQGQSNV QQGSTTV QQSGSQL QQSPSNV QQSSNF QQSTTNL QVANQI

QQASSI QQATTSV QQGNSQV QQGQSQF QQGSTV QQSGSQV QQSPSQF QQSSNI QQSTTNV QVANQL

QQASSL QQATTTF QQGNSSF QQGQSQI QQGSTYF QQSGSSF QQSPSQI QQSSNL QQSTTQF QVANQV

QQASSNF QQATTTI QQG SSI QQGQSQL QQGSTYI QQSGSSI QQSPSQL QQSSNV QQSTTQI QVANSF

QQASSNI QQATTTL QQGNSSL QQGQSQV QQGSTYL QQSGSSL QQSPSQV QQSSQF QQSTTQL QVANSI

QQASSNL QQATTTV QQGNSSV QQGQSSF QQGSTYV QQSGSSV QQSPSSF QQSSQI QQSTTQV QVANSL

QQASSNV QQATTV QQGNSTF QQGQSSI QQGSYF QQSGSTF QQSPSSI QQSSQL QQSTTSF QVANSNF

QQASSQF QQATTYF QQGNSTI QQGQSSL QQGSYI QQSGSTI QQSPSSL QQSSQV QQSTTSI QVANSNI

QQASSQI QQATTYI QQGNSTL QQGQSSV QQGSYL QQSGSTL QQSPSSV QQSSSF QQSTTSL QVANSNL

QQASSQL QQATTYL QQGNSTV QQGQSTF QQGSYV QQSGSTV QQSPSTF QQSSSI QQSTTSV QVANSNV

QQASSQV QQATTYV QQGNSV QQGQSTI QQGTNF QQSGSYF QQSPSTI QQSSSL QQSTTTF QVANSQF

QQASSSF QQATYF QQGNSYF QQGQSTL QQGTNI QQSGSYI QQSPSTL QQSSSNF QQSTTTI QVANSQI

QQASSSI QQATYI QQGNSYI QQGQSTV QQGTNL QQSGSYL QQSPSTV QQSSSNI QQSTTTL QVANSQL

QQASSSL QQATYL QQGNSYL QQGQSV QQGTNV QQSGSYV QQSPSYF QQSSSNL QQSTTTV QVANSQV

QQASSSV QQATYV QQGNSYV QQGQSYF QQGTQF QQSGTNF QQSPSYI QQSSSNV QQSTTV QVANSSF

QQASSTF QQAYNF QQGNTF QQGQSYI QQGTQI QQSGTNI QQSPSYL QQSSSQF QQSTTYF QVANSSI

QQASSTI QQAYNI QQGNTI QQGQSYL QQGTQL QQSGTNL QQSPSYV QQSSSQI QQSTTYI QVANSSL

QQASSTL QQAYNL QQGNTL QQGQSYV QQGTQV QQSGTNV QQSPTNF QQSSSQL QQSTTYL QVANSSV

QQASSTV QQAYQF QQGNTNF QQGQTF QQGTSF QQSGTQF QQSPTNI QQSSSQV QQSTTYV QVANSTF

QQASSV QQAYQI QQGNTNI QQGQTI QQGTSI QQSGTQI QQSPTNL QQSSSSF QQSTYF QVANSTI

QQASSYF QQAYQL QQGNTNL QQGQTL QQGTSL QQSGTQL QQSPTNV QQSSSSI QQSTYI QVANSTL

QQASSYI QQAYQV QQGNTNV QQGQTNF QQGTSNF QQSGTQV QQSPTQF QQSSSSL QQSTYL QVANSTV

QQASSYL QQAYSF QQGNTQF QQGQTNI QQGTSNI QQSGTSF QQSPTQI QQSSSSV QQSTYV QVANSV

QQASSYV QQAYSI QQGNTQI QQGQTNL QQGTSNL QQSGTSI QQSPTQL QQSSSTF QQSYNF QVANSYF

QQASTF QQAYSL QQGNTQL QQGQTNV QQGTSNV QQSGTSL QQSPTQV QQSSSTI QQSYNI QVANSYI

QQASTI QQAYSV QQGNTQV QQGQTQF QQGTSQF QQSGTSV QQSPTSF QQSSSTL QQSYNL QVANSYL

QQASTL QQAYTF QQGNTSF QQGQTQI QQGTSQI QQSGTTF QQSPTSI QQSSSTV QQSYQF QVANSYV

QQASTNF QQAYTI QQGNTSI QQGQTQL QQGTSQL QQSGTTI QQSPTSL QQSSSV QQSYQI QVANTF

QQAST I QQAYTL QQGNTSL QQGQTQV QQGTSQV QQSGTTL QQSPTSV QQSSSYF QQSYQL QVANTI

QQAST L QQAYTV QQG TS QQGQTSF QQGTSSF QQSGTTV QQSPTTF QQSSSYI QQSYQV QVANTL

QQASTNV QQAYYF QQGNTTF QQGQTSI QQGTSSI QQSGTYF QQSPTTI QQSSSYL QQSYSF QVANTNF

QQASTQF QQAYYI QQGNTTI QQGQTSL QQGTSSL QQSGTYI QQSPTTL QQSSSYV QQSYSI QVANTNI

QQASTQI QQAYYL QQGNTTL QQGQTSV QQGTSSV QQSGTYL QQSPTTV QQSSTF QQSYSL QVANTNL

QQASTQL QQAYYV QQGNTTV QQGQTTF QQGTSTF QQSGTYV QQSPTYF QQSSTI QQSYSV QVANTNV

QQASTQV QQGGGSH QQGNTV QQGQTTI QQGTSTI QQSNNF QQSPTYI QQSSTL QQSYTF QVANTQF

QQASTSF QQGGGSV QQG TYF QQGQTTL QQGTSTL QQSNNI QQSPTYL QQSSTNF QQSYTI QVANTQI

QQASTSI QQGGSNF QQGNTYI QQGQTTV QQGTSTV QQSNNL QQSPTYV QQSSTNI QQSYTL QVANTQL

QQASTSL QQGGSNI QQGNTYL QQGQTV QQGTSV QQSNNV QQSQNF QQSSTNL QQSYTV QVANTQV

QQASTSV QQGGSNL QQGNTYV QQGQTYF QQGTSYF QQSNQF QQSQNI QQSSTNV QQSYYF QVANTSF

QQASTTF QQGGSNV QQGNYF QQGQTYI QQGTSYI QQSNQI QQSQNL QQSSTQF QQSYYI QVANTSI

QQASTTI QQGGSQF QQGNYI QQGQTYL QQGTSYL QQSNQL QQSQNV QQSSTQI QQSYYL QVANTSL

QQASTTL QQGGSQI QQGNYL QQGQTYV QQGTSYV QQSNQV QQSQQF QQSSTQL QQSYYV QVANTSV

QQASTTV QQGGSQL QQGNYV QQGQYF QQGTTF QQSNSF QQSQQI QQSSTQV QRGRSSI QVANTTF

QQASTV QQGGSQV QQGPSNF QQGQYI QQGTTI QQSNSI QQSQQL QQSSTSF QSAGSSV QVANTTI

QQASTYF QQGGSSF QQGPSNI QQGQYL QQGTTL QQSNSL QQSQQV QQSSTSI QSGGSSV QVANTTL

QQASTYI QQGGSSI QQGPSNL QQGQYV QQGTTNF QQSNSNF QQSQSF QQSSTSL QSGWWSV QVANTTV

QQASTYL QQGGSSL QQGPSNV QQGRSSL QQGTTNI QQSNSNI QQSQSI QQSSTSV QSHGAVV QVANTV

QQASTYV QQGGSSV QQGPSQF QQGSNF QQGTTNL QQSNSNL QQSQSL QQSSTTF QTFPHSV QVANTYF

QQASYF QQGGSTF QQGPSQI QQGSNI QQGTTNV QQSNSNV QQSQSNF QQSSTTI QTGFYS QVANTYI

QQASYI QQGGSTI QQGPSQL QQGSNL QQGTTQF QQSNSQF QQSQSNI QQSSTTL QTGGPSK QVANTYL

QQASYL QQGGSTL QQGPSQV QQGSNV QQGTTQI QQSNSQI QQSQSNL QQSSTTV QTGGSSV QVANTYV

QQASYV QQGGSTV QQGPSSF QQGSQF QQGTTQL QQSNSQL QQSQSNV QQSSTV QVAGSNF QVANYF

QQAT F QQGGSTY QQGPSSI QQGSQI QQGTTQV QQSNSQV QQSQSQF QQSSTYF QVAGSNI QVANYI

QQATNI QQGGSYF QQGPSSL QQGSQL QQGTTSF QQSNSSF QQSQSQI QQSSTYI QVAGSNL QVANYL

QQATNL QQGGSYI QQGPSSV QQGSQV QQGTTSI QQSNSSI QQSQSQL QQSSTYL QVAGSNV QVANYV

QQATNV QQGGSYL QQGPSTF QQGSSF QQGTTSL QQSNSSL QQSQSQV QQSSTYV QVAGSQF QVAPSNF

QQATQF QQGGSYV QQGPSTI QQGSSI QQGTTSV QQSNSSV QQSQSSF QQSSYF QVAGSQI QVAPSNI

QQATQI QQGGTNF QQGPSTL QQGSSL QQGTTTF QQSNSTF QQSQSSI QQSSYI QVAGSQL QVAPSNL

QQATQL QQGGTNI QQGPSTV QQGSSNF QQGTTTI QQSNSTI QQSQSSL QQSSYL QVAGSQV QVAPSNV

QQATQV QQGGTNL QQGPSYF QQGSSNI QQGTTTL QQSNSTL QQSQSSV QQSSYV QVAGSSF QVAPSQF

QQATSF QQGGTNV QQGPSYI QQGSSNL QQGTTTV QQSNSTV QQSQSTF QQSTNF QVAGSSI QVAPSQI

QQATSI QQGGTQF QQGPSYL QQGSSNV QQGTTV QQSNSV QQSQSTI QQSTNI QVAGSSL QVAPSQL

QQATSL QQGGTQI QQGPSYV QQGSSQF QQGTTYF QQSNSYF QQSQSTL QQSTNL QVAGSSV QVAPSQV

QQATSNF QQGGTQL QQGPTNF QQGSSQI QQGTTYI QQSNSYI QQSQSTV QQSTNV QVAGSTF QVAPSSF

QQATS I QQGGTQV QQGPTNI QQGSSQL QQGTTYL QQSNSYL QQSQSV QQSTQF QVAGSTI QVAPSSI

QQATS L QQGGTSF QQGPTNL QQGSSQV QQGTTYV QQSNSYV QQSQSYF QQSTQI QVAGSTL QVAPSSL

QQATSNV QQGGTSI QQGPTNV QQGSSSF QQGTYF QQSNTF QQSQSYI QQSTQL QVAGSTV QVAPSSV

QQATSQF QQGGTSL QQGPTQF QQGSSSI QQGTYI QQSNTI QQSQSYL QQSTQV QVAGSYF QVAPSTF

QQATSQI QQGGTSV QQGPTQI QQGSSSL QQGTYL QQSNTL QQSQSYV QQSTSF QVAGSYI QVAPSTI

QQATSQL QQGGTTF QQGPTQL QQGSSSV QQGTYV QQSNTNF QQSQTF QQSTSI QVAGSYL QVAPSTL

QQATSQV QQGGTTI QQGPTQV QQGSSTF QQGYNF QQSNTNI QQSQTI QQSTSL QVAGSYV QVAPSTV

QQATSSF QQGGTTL QQGPTSF QQGSSTI QQGYNI QQSNTNL QQSQTL QQSTSNF QVAGTLY QVAPSYF

QQATSSI QQGGTTV QQGPTSI QQGSSTL QQGYNL QQSNTNV QQSQTNF QQSTSNI QVAGTNF QVAPSYI

QQATSSL QQGGTYF QQGPTSL QQGSSTV QQGYNV QQSNTQF QQSQTNI QQSTSNL QVAGTNI QVAPSYL

QQATSSV QQGGTYI QQGPTSV QQGSSV QQGYQF QQSNTQI QQSQTNL QQSTSNV QVAGTNL QVAPSYV

QQATSTF QQGGTYL QQGPTTF QQGSSYF QQGYQI QQSNTQL QQSQTNV QQSTSQF QVAGTNV QVAPTNF

QQATSTI QQGGTYV QQGPTTI QQGSSYI QQGYQL QQSNTQV QQSQTQF QQSTSQI QVAGTQF QVAPTNI

QQATSTL QQGGWDA QQGPTTL QQGSSYL QQGYQV QQSNTSF QQSQTQI QQSTSQL QVAGTQI QVAPTNL

QQATSTV QQGHSSV QQGPTTV QQGSSYV QQGYSF QQSNTSI QQSQTQL QQSTSQV QVAGTQL QVAPTNV

QQATSV QQGISSV QQGPTYF QQGSTF QQGYSI QQSNTSL QQSQTQV QQSTSSF QVAGTQV QVAPTQF

QQATSYF QQGNNF QQGPTYI QQGSTI QQGYSL QQSNTSV QQSQTSF QQSTSSI QVAGTSF QVAPTQI

QQATSYI QQGNNI QQGPTYL QQGSTL QQGYSV QQSNTTF QQSQTSI QQSTSSL QVAGTSI QVAPTQL

QQATSYL QQGNNL QQGPTYV QQGSTNF QQGYTF QQSNTTI QQSQTSL QQSTSSV QVAGTSL QVAPTQV

QQATSYV QQGNNV QQGQNF QQGSTNI QQGYTI QQSNTTL QQSQTSV QQSTSTF QVAGTSV QVAPTSF

QQATTF QQGNQF QQGQNI QQGSTNL QQGYTL QQSNTTV QQSQTTF QQSTSTI QVAGTTF QVAPTSI

QQATTI QQGNQI QQGQNL QQGSTNV QQGYTV QQSNTV QQSQTTI QQSTSTL QVAGTTI QVAPTSL

QQATTL QQGNQL QQGQNV QQGSTQF QQGYYF QQSNTYF QQSQTTL QQSTSTV QVAGTTL QVAPTSV

QQATTNF QQGNQV QQGQQF QQGSTQI QQGYYI QQSNTYI QQSQTTV QQSTSV QVAGTTV QVAPTTF

QQATTNI QQGNSF QQGQQI QQGSTQL QQGYYL QQSNTYL QQSQTV QQSTSYF QVAGTYF QVAPTTI

QQATTNL QQG SI QQGQQL QQGSTQV QQGYYV QQSNTYV QQSQTYF QQSTSYI QVAGTYI QVAPTTL

QQATTNV QQGNSL QQGQQV QQGSTSF QQQLSEV QQSNYF QQSQTYI QQSTSYL QVAGTYL QVAPTTV

QQATTQF QQGNSNF QQGQSF QQGSTSI QQSGSNF QQSNYI QQSQTYL QQSTSYV QVAGTYV QVAPTYF

QQATTQI QQGNS I QQGQSI QQGSTSL QQSGSNI QQSNYL QQSQTYV QQSTTF QVANNF QVAPTYI

QQATTQL QQGNS L QQGQSL QQGSTSV QQSGSNL QQSNYV QQSQYF QQSTTI QVANNI QVAPTYL QVAPTYV QVASTNI QVAYTI QVGNQF QVGQNF QVGSTF QVGYQV QVSNSQV QVSQSQF QVSSTYF

QVAQNF QVASTNL QVAYTL QVGNQI QVGQNI QVGSTI QVGYSF QVSNSSF QVSQSQI QVSSTYI

QVAQNI QVASTNV QVAYTV QVGNQL QVGQNL QVGSTL QVGYSI QVSNSSI QVSQSQL QVSSTYL

QVAQNL QVASTQF QVAYYF QVGNQV QVGQNV QVGSTNF QVGYSL QVSNSSL QVSQSQV QVSSTYV

QVAQNV QVASTQI QVAYYI QVGNSF QVGQQF QVGSTNI QVGYSSV QVSNSSV QVSQSSF QVSSYF

QVAQQF QVASTQL QVAYYL QVGNSI QVGQQI QVGSTNL QVGYSV QVSNSTF QVSQSSI QVSSYI

QVAQQI QVASTQV QVAYYV QVGNSL QVGQQL QVGSTNV QVGYTF QVSNSTI QVSQSSL QVSSYL

QVAQQL QVASTSF QVDGKDV QVGNSNF QVGQQV QVGSTQF QVGYTI QVSNSTL QVSQSSV QVSSYV

QVAQQV QVASTSI QVDGSLV QVGNSNI QVGQSF QVGSTQI QVGYTL QVSNSTV QVSQSTF QVSTNF

QVAQSF QVASTSL QVDGSSI QVGNSNL QVGQSI QVGSTQL QVGYTV QVSNSV QVSQSTI QVSTNI

QVAQSI QVASTSV QVDGSSV QVGNSNV QVGQSL QVGSTQV QVGYYF QVSNSYF QVSQSTL QVSTNL

QVAQSL QVASTTF QVDGWSK QVGNSQF QVGQSNF QVGSTSF QVGYYI QVSNSYI QVSQSTV QVSTNV

QVAQSNF QVASTTI QVDSSSV QVGNSQI QVGQSNI QVGSTSI QVGYYL QVSNSYL QVSQSV QVSTQF

QVAQSNI QVASTTL QVEGSDV QVGNSQL QVGQSNL QVGSTSL QVGYYV QVSNSYV QVSQSYF QVSTQI

QVAQSNL QVASTTV QVEKSNV QVGNSQV QVGQSNV QVGSTSV QVHGYSV QVSNTF QVSQSYI QVSTQL

QVAQSNV QVASTV QVENSSS QVGNSSF QVGQSQF QVGSTTF QVHPWLV QVSNTI QVSQSYL QVSTQV

QVAQSQF QVASTYF QVFGGSV QVGNSSI QVGQSQI QVGSTTI QVIGLSV QVSNTL QVSQSYV QVSTSF

QVAQSQI QVASTYI QVFGSSQ QVGNSSL QVGQSQL QVGSTTL QVIYSSK QVSNTNF QVSQTF QVSTSI

QVAQSQL QVASTYL QVFGSSV QVGNSSV QVGQSQV QVGSTTV QVLGDSV QVSNTNI QVSQTI QVSTSL

QVAQSQV QVASTYV QVFKSSG QVGNSTF QVGQSSF QVGSTV QVLGGIY QVSNTNL QVSQTL QVSTSNF

QVAQSSF QVASYF QVGASGV QVG STI QVGQSSI QVGSTYF QVMGSGV QVSNTNV QVSQTNF QVSTSNI

QVAQSSI QVASYI QVGDKM QVGNSTL QVGQSSL QVGSTYI QVMGWSE QVSNTQF QVSQTNI QVSTSNL

QVAQSSL QVASYL QVGDSSY QVGNSTV QVGQSSV QVGSTYL QVMLSSV QVSNTQI QVSQTNL QVSTSNV

QVAQSSV QVASYV QVGDTSV QVGNSV QVGQSSY QVGSTYV QVMNASV QVSNTQL QVSQTNV QVSTSQF

QVAQSTF QVATNF QVGEKSH QVGNSYF QVGQSTF QVGSWIF QVMQSYA QVSNTQV QVSQTQF QVSTSQI

QVAQSTI QVAT I QVGEPNV QVGNSYI QVGQSTI QVGSYF QVNGSSV QVSNTSF QVSQTQI QVSTSQL

QVAQSTL QVAT L QVGESSK QVGNSYL QVGQSTL QVGSYI QVNGWSV QVSNTSI QVSQTQL QVSTSQV

QVAQSTV QVATNV QVGETSV QVGNSYV QVGQSTV QVGSYL QVNLSYA QVSNTSL QVSQTQV QVSTSSF

QVAQSV QVATQF QVGFSFV QVGNTF QVGQSV QVGSYV QVNMSSV QVSNTSV QVSQTSF QVSTSSI

QVAQSYF QVATQI QVGFTIV QVGNTI QVGQSYF QVGTNF QVPDYSA QVSNTTF QVSQTSI QVSTSSL

QVAQSYI QVATQL QVGGASV QVGNTL QVGQSYI QVGTNI QVPGVGV QVSNTTI QVSQTSL QVSTSSV

QVAQSYL QVATQV QVGGDSV QVGNTNF QVGQSYL QVGTNL QVQEAAV QVSNTTL QVSQTSV QVSTSTF

QVAQSYV QVATSF QVGGFMP QVGNTNI QVGQSYV QVGTNV QVQGSPV QVSNTTV QVSQTTF QVSTSTI

QVAQTF QVATSI QVGGHSV QVGNTNL QVGQTF QVGTQF QVQGWSQ QVSNTV QVSQTTI QVSTSTL

QVAQTI QVATSL QVGGIEV QVGNTNV QVGQTI QVGTQI QVQSSSV QVSNTYF QVSQTTL QVSTSTV

QVAQTL QVATSNF QVGGKYY QVGNTQF QVGQTL QVGTQL QVSESSV QVSNTYI QVSQTTV QVSTSV

QVAQTNF QVATSNI QVGGLSV QVGNTQI QVGQTNF QVGTQV QVSFSSV QVSNTYL QVSQTV QVSTSYF

QVAQTNI QVATSNL QVGGNSV QVGNTQL QVGQTNI QVGTSF QVSGS F QVSNTYV QVSQTYF QVSTSYI

QVAQTNL QVATSNV QVGGSGK QVGNTQV QVGQTNL QVGTSI QVSGSNI QVSNYF QVSQTYI QVSTSYL

QVAQTNV QVATSQF QVGGSHE QVGNTSF QVGQTNV QVGTSL QVSGSNL QVSNYI QVSQTYL QVSTSYV

QVAQTQF QVATSQI QVGGSLY QVGNTSI QVGQTQF QVGTSNF QVSGSNV QVSNYL QVSQTYV QVSTTF

QVAQTQI QVATSQL QVGGSMV QVGNTSL QVGQTQI QVGTSNI QVSGSPV QVSNYV QVSQYF QVSTTI

QVAQTQL QVATSQV QVGGSNF QVG TS QVGQTQL QVGTSNL QVSGSQF QVSPSNF QVSQYI QVSTTL

QVAQTQV QVATSSF QVGGSNI QVGNTTF QVGQTQV QVGTSNV QVSGSQI QVSPSNI QVSQYL QVSTTNF

QVAQTSF QVATSSI QVGGSNL QVGNTTI QVGQTSF QVGTSQF QVSGSQL QVSPSNL QVSQYV QVSTTNI

QVAQTSI QVATSSL QVGGSNV QVGNTTL QVGQTSI QVGTSQI QVSGSQV QVSPSNV QVSSNF QVSTTNL

QVAQTSL QVATSSV QVGGSQF QVGNTTV QVGQTSL QVGTSQL QVSGSSF QVSPSQF QVSSNI QVSTTNV

QVAQTSV QVATSTF QVGGSQI QVGNTV QVGQTSV QVGTSQV QVSGSSI QVSPSQI QVSSNL QVSTTQF

QVAQTTF QVATSTI QVGGSQL QVGNTYF QVGQTTF QVGTSSF QVSGSSL QVSPSQL QVSSNV QVSTTQI

QVAQTTI QVATSTL QVGGSQV QVGNTYI QVGQTTI QVGTSSI QVSGSSV QVSPSQV QVSSQF QVSTTQL

QVAQTTL QVATSTV QVGGSSF QVGNTYL QVGQTTL QVGTSSL QVSGSTF QVSPSSF QVSSQI QVSTTQV

QVAQTTV QVATSV QVGGSSI QVGNTYV QVGQTTV QVGTSSV QVSGSTI QVSPSSI QVSSQL QVSTTSF

QVAQTV QVATSYF QVGGSSL QVGNYF QVGQTV QVGTSTF QVSGSTL QVSPSSL QVSSQV QVSTTSI

QVAQTYF QVATSYI QVGGSSQ QVGNYI QVGQTYF QVGTSTI QVSGSTV QVSPSSV QVSSSF QVSTTSL

QVAQTYI QVATSYL QVGGSSV QVGNYL QVGQTYI QVGTSTL QVSGSYF QVSPSTF QVSSSI QVSTTSV

QVAQTYL QVATSYV QVGGSSW QVGNYV QVGQTYL QVGTSTV QVSGSYI QVSPSTI QVSSSL QVSTTTF

QVAQTYV QVATTF QVGGSTF QVGPSNF QVGQTYV QVGTSV QVSGSYL QVSPSTL QVSSSNF QVSTTTI

QVAQYF QVATTI QVGGSTI QVGPSNI QVGQYF QVGTSYF QVSGSYV QVSPSTV QVSSSNI QVSTTTL

QVAQYI QVATTL QVGGSTL QVGPSNL QVGQYI QVGTSYI QVSGTNF QVSPSYF QVSSSNL QVSTTTV

QVAQYL QVATT F QVGGSTM QVGPSNV QVGQYL QVGTSYL QVSGTNI QVSPSYI QVSSSNV QVSTTV

QVAQYV QVATT I QVGGSTV QVGPSQF QVGQYV QVGTSYV QVSGTNL QVSPSYL QVSSSQF QVSTTYF

QVASNF QVATT L QVGGSYF QVGPSQI QVGRFAV QVGTTF QVSGTNV QVSPSYV QVSSSQI QVSTTYI

QVASNI QVATTNV QVGGSYI QVGPSQL QVGRGSV QVGTTI QVSGTQF QVSPTNF QVSSSQL QVSTTYL

QVASNL QVATTQF QVGGSYL QVGPSQV QVGRQSV QVGTTL QVSGTQI QVSPTNI QVSSSQV QVSTTYV

QVASNV QVATTQI QVGGSYV QVGPSSF QVGRSSI QVGTTNF QVSGTQL QVSPTNL QVSSSSF QVSTYF

QVASQF QVATTQL QVGGT F QVGPSSI QVGSNF QVGTTNI QVSGTQV QVSPTNV QVSSSSI QVSTYI

QVASQI QVATTQV QVGGTNI QVGPSSL QVGSNI QVGTTNL QVSGTSF QVSPTQF QVSSSSL QVSTYL

QVASQL QVATTSF QVGGT L QVGPSSV QVGSNL QVGTTNV QVSGTSI QVSPTQI QVSSSSV QVSTYV

QVASQV QVATTSI QVGGTNV QVGPSTF QVGSNV QVGTTQF QVSGTSL QVSPTQL QVSSSTF QVSYNF

QVASSF QVATTSL QVGGTQF QVGPSTI QVGSQF QVGTTQI QVSGTSV QVSPTQV QVSSSTI QVSYNI

QVASSI QVATTSV QVGGTQI QVGPSTL QVGSQI QVGTTQL QVSGTTF QVSPTSF QVSSSTL QVSYNL

QVASSL QVATTTF QVGGTQL QVGPSTV QVGSQL QVGTTQV QVSGTTI QVSPTSI QVSSSTV QVSYNV

QVASSNF QVATTTI QVGGTQV QVGPSYF QVGSQV QVGTTSF QVSGTTL QVSPTSL QVSSSV QVSYQF

QVASSNI QVATTTL QVGGTSF QVGPSYI QVGSSF QVGTTSI QVSGTTV QVSPTSV QVSSSYF QVSYQI

QVASSNL QVATTTV QVGGTSI QVGPSYL QVGSSI QVGTTSL QVSGTYF QVSPTTF QVSSSYI QVSYQL

QVASSNV QVATTV QVGGTSL QVGPSYV QVGSSL QVGTTSV QVSGTYI QVSPTTI QVSSSYL QVSYQV

QVASSQF QVATTYF QVGGTSV QVGPTNF QVGSS F QVGTTTF QVSGTYL QVSPTTL QVSSSYV QVSYSF

QVASSQI QVATTYI QVGGTTF QVGPTNI QVGSSNI QVGTTTI QVSGTYV QVSPTTV QVSSTF QVSYSI

QVASSQL QVATTYL QVGGTTI QVGPTNL QVGSS L QVGTTTL QVSGWSV QVSPTYF QVSSTI QVSYSL

QVASSQV QVATTYV QVGGTTL QVGPTNV QVGSSNV QVGTTTV QVSNNF QVSPTYI QVSSTL QVSYSV

QVASSSF QVATYF QVGGTTV QVGPTQF QVGSSQF QVGTTV QVSNNI QVSPTYL QVSSTNF QVSYTF

QVASSSI QVATYI QVGGTYF QVGPTQI QVGSSQI QVGTTYF QVSNNL QVSPTYV QVSSTNI QVSYTI

QVASSSL QVATYL QVGGTYI QVGPTQL QVGSSQL QVGTTYI QVSNNV QVSQNF QVSSTNL QVSYTL

QVASSSV QVATYV QVGGTYL QVGPTQV QVGSSQV QVGTTYL QVSNQF QVSQNI QVSSTNV QVSYTV

QVASSTF QVAYNF QVGGTYV QVGPTSF QVGSSSF QVGTTYV QVSNQI QVSQNL QVSSTQF QVSYYF

QVASSTI QVAYNI QVGGYDK QVGPTSI QVGSSSI QVGTYF QVSNQL QVSQNV QVSSTQI QVSYYI

QVASSTL QVAYNL QVGHDMV QVGPTSL QVGSSSL QVGTYI QVSNQV QVSQQF QVSSTQL QVSYYL

QVASSTV QVAYNV QVGHKSV QVGPTSV QVGSSSV QVGTYL QVSNSF QVSQQI QVSSTQV QVSYYV

QVASSV QVAYQF QVGISLG QVGPTTF QVGSSTF QVGTYV QVSNSI QVSQQL QVSSTSF QVTGPFV

QVASSYF QVAYQI QVGKSSP QVGPTTI QVGSSTI QVGWSNF QVSNSL QVSQQV QVSSTSI QVTGPSH

QVASSYI QVAYQL QVGLSIV QVGPTTL QVGSSTL QVGYNF QVSNSNF QVSQSF QVSSTSL QVTGSSD

QVASSYL QVAYQV QVGLSSI QVGPTTV QVGSSTV QVGYNI QVSNSNI QVSQSI QVSSTSV QVTGSSP

QVASSYV QVAYSF QVGMSEV QVGPTYF QVGSSV QVGY L QVSNSNL QVSQSL QVSSTTF QVVGSQT

QVASTF QVAYSI QVGNNF QVGPTYI QVGSSYF QVGYNV QVSNSNV QVSQSNF QVSSTTI QVVGSSH

QVASTI QVAYSL QVGNNI QVGPTYL QVGSSYI QVGYQF QVSNSQF QVSQSNI QVSSTTL QVVGSSV

QVASTL QVAYSV QVGNNL QVGPTYV QVGSSYL QVGYQI QVSNSQI QVSQSNL QVSSTTV QVVGYSV

QVASTNF QVAYTF QVGNNV QVGQGVV QVGSSYV QVGYQL QVSNSQL QVSQSNV QVSSTV QVVSPSR QVWGRPV RRSGSAT RVNNMNL SAHSVGP SALS VHP SASSHLT SATSHLG SAVSHVT SGALVHP SGHAVVT

QVWGSMV RSDIPSV RVNQSSY SAHSVGT SALSVHS SASSHVP SATSHLP SAVSLHG SGALVHS SGHLAGG

QVWIKSV RSGLVSF RVNRPSV SAHSVLG SALSVHT SASSHVT SATSHLS SAVSLHP SGALVHT SGHLAGP

QVYGSVS RSGPSSY RVPQSHV SAHSVLP SALTGHG SASSLHG SATSHVG SAVSLHS SGAPGHG SGHLAGS

QWDGHED RSHGWSI RVQGSMK SAHSVLS SALTGHP SASSLHP SATSHVP SAVSLHT SGAPGHS SGHLAGT

QWGGDSV RSKLSSV RVQGSSI SAHSVLT SALTGHS SASSLHS SATSHVS SAVSVHP SGAPGHT SGHLAVG

QWGGSNE RSQGVSM RVQGTVV SAHSVVP SALTHGG SASSLHT SATSLHG SAVSVHT SGAPHGG SGHLAVP

QWPGPSE RTDGWYV RVQYSSY SAHSVVT SALTHGP SASSVHP SATSLHP SAVTGHG SGAPHGS SGHLAVS

QYFGSSV RTFGSSE RVRQSSQ SAHTGGG SALTHGS SASSVHT SATSLHS SAVTGHP SGAPHGT SGHLAVT

QYFPSSV RTGGQNM RVSGSGV SAHTGGP SALTHVG SASTGHG SATSVHG SAVTGHS SGAPHLG SGHLGAG

QYGAFFV RTGNSSM RVSGSMV SAHTGGS SALTHVP SASTGHP SATS VHP SAVTHGG SGAPHLS SGHLGAP

QYGGSPW RTGRQMV RVSGYSV SAHTGLG SALTHVS SASTGHS SATSVHS SAVTHGP SGAPHLT SGHLGAS

QYGGSSV RVAGSSP RVSQSSI SAHTGLP SALTVHG SASTHGG SATVGHG SAVTHGS SGAPHVG SGHLGAT

QYGMGAV RVAGSSQ RVSWSSV SAHTGLS SALTVHP SASTHGP SATVGHP SAVTHLG SGAPHVS SGHLGGA

QYWGSLV RVAGSSV RVVGLQM SAHTG G SALTVHS SASTHGS SATVGHS SAVTHLP SGAPHVT SGHLGGP

RAGGQSV RVAGYSE RVVGLSA SAHTG P SALVGHG SASTHLG SATVHGG SAVTHLS SGAPLHG SGHLGGT

RAGGSSV RVASYIV RVVKSKM SAHTGVS SALVGHP SASTHLP SATVHGP SAVTHVG SGAPLHS SGHLGVA

RAGMSYL RVDGSSD RVVLEAV SAHTLGG SALVGHS SASTHLS SATVHGS SAVTHVP SGAPLHT SGHLGVP

RAG SWF V RVDGSSV RVWGQSV SAHTLGP SALVGHT SASTHVG SATVHLG SAVTHVS SGAPVHG SGHLGVT

RAYTSIV RVEGSDA RVWGVKV SAHTLGS SALVHGG SASTHVP SATVHLP SAVTLHG SGAPVHS SGHLVAG

RDGHLNV RVEGSSV RVWQSEI SAHTLVG SALVHGP SASTHVS SATVHLS SAVTLHP SGAPVHT SGHLVAP

RDHWSQQ RVEQSSK RVYFDYV SAHTL P SALVHGS SASTLHG SATVHVG SAVTLHS SGASGHP SGHLVAS

RDNGAYR RVEYSSV RWDGEST SAHTLVS SALVHGT SASTLHP SATVHVP SAVTVHG SGASGHT SGHLVAT

RDNGSSV RVFATSV RWGDSGD SAHTVGG SALVHVG SASTLHS SATVHVS SAVTVHP SGASHGP SGHLVGA

RDYGSSR RVFFRHV RWGGSMV SAHTVGP SALVHVP SASTVHG SATVLHG SAVTVHS SGASHGT SGHLVGP

REENSSL RVFGQGV RWNTVSH SAHTVGS SALVHVS SASTVHP SATVLHP SAVVGHP SGASHLG SGHLVGT

REGESEV RVFGRSD RWPLTSV SAHTVLG SALVHVT SASTVHS SATVLHS SAVVGHT SGASHLP SGHLVVA

REGGSSQ RVGAPGR RYAPWSV SAHTVLP SALVVHG SASVGHP SATVVHG SAVVHGP SGASHLS SGHLVVP

REGWKPL RVGDDMV RYGGRSP SAHTVLS SALVVHP SASVGHT SATVVHP SAVVHGT SGASHLT SGHLVVT

REQHNLV RVGDLGV RYGGSSM SAHTVVG SALVVHS SASVHGP SATVVHS SAVVHLG SGASHVP SGHPAGG

RESISSV RVGDSSQ RYGGSSR SAHTVVP SALVVHT SASVHGT SAVHGGP SAVVHLP SGASHVT SGHPAGS

RFATHSP RVGERKA RYGGTSM SAHTVVS SANEINV SASVHLG SAVHGGT SAVVHLS SGASLHG SGHPAGT

RFGGSNE RVGESSD RYGLYSP SAHVGGP SASHGGP SASVHLP SAVHGLG SAVVHLT SGASLHP SGHPALG

RFGGSSR RVGESVW RYIESSD SAHVGGT SASHGGT SASVHLS SAVHGLP SAVVHVP SGASLHS SGHPALS

RFGSSSL RVGGFSM RYIGSSK SAHVGLG SASHGLG SASVHLT SAVHGLS SAVVHVT SGASLHT SGHPALT

RFLGTSL RVGGGFA RYVDSSV SAHVGLP SASHGLP SASVHVP SAVHGLT SAVVLHG SGASVHP SGHPAVG

RFWVSAV RVGGGST SAGGHMV SAHVGLS SASHGLS SASVHVT SAVHGVP SAVVLHP SGASVHT SGHPAVS

RGGEDSV RVGGGSV SAGGSSS SAHVGLT SASHGLT SASVLHG SAVHGVT SAVVLHS SGATGHG SGHPAVT

RGGGSSV RVGGISV SAGLQSV SAHVGVP SASHGVP SASVLHP SAVHLGG SAVVLHT SGATGHP SGHPGAG

RGGWSSV RVGGKSE SAGNSKV SAHVGVT SASHGVT SASVLHS SAVHLGP SAVVVHP SGATGHS SGHPGAS

RGLELSF RVGGKSS SAGPSSV SAHVLGG SASHLGG SASVLHT SAVHLGS SAVVVHT SGATHGG SGHPGAT

RGSGVNQ RVGGLHV SAHLGGG SAHVLGP SASHLGP SASVVHP SAVHLGT SDGDSDN SGATHGP SGHPGGA

RHDGSTV RVGGLTA SAHLGGP SAHVLGS SASHLGS SASVVHT SAVHLVG SDGGSKV SGATHGS SGHPGGT

RHFGVVG RVGGPTV SAHLGGS SAHVLGT SASHLGT SATHGGG SAVHLVP SDGGSSR SGATHLG SGHPGLA

RHGGFSV RVGGQKV SAHLGGT SAHVLVG SASHLVG SATHGGP SAVHLVS SDGGTPV SGATHLP SGHPGLG

RHGGSSA RVGGQSV SAHLGVG SAHVL P SASHLVP SATHGGS SAVHLVT SDGNSSA SGATHLS SGHPGLS

RHGMSSG RVGGRGK SAHLG P SAHVLVS SASHLVS SATHGLG SAVHVGP SDLGVSV SGATHVG SGHPGLT

RHGTIQV RVGGSAV SAHLGVS SAHVLVT SASHLVT SATHGLP SAVHVGT SDMQSSV SGATHVP SGHPGVA

RHGTSPA RVGGSDG SAHLGVT SAHVVGP SASHVGP SATHGLS SAVHVLG SEGGRSV SGATHVS SGHPGVT

RHPGSNV RVGGSGH SAHLVGG SAHVVGT SASHVGT SATHGVG SAVHVLP SEGGSFV SGATLHG SGHPLAG

RHQGVSQ RVGGSG SAHLVGP SAHVVLG SASHVLG SATHGVP SAVHVLS SEGGSSA SGATLHP SGHPLAS

RIFGFSR RVGGSII SAHLVGS SAHVVLP SASHVLP SATHGVS SAVHVLT SEGGSSD SGATLHS SGHPLAT

RIGGEFE RVGGSNI SAHLVGT SAHVVLS SASHVLS SATHLGG SAVHVVP SEGGSSM SGATVHG SGHPLGA

RIGGSSV RVGGSS SAHLVVG SAHVVLT SASHVLT SATHLGP SAVHVVT SEIESSP SGATVHP SGHPLGG

RIGISNV RVGGSSP SAHLVVP SAHVVVP SASHVVP SATHLGS SAVLGHG SEMGVEL SGATVHS SGHPLGS

RIGPTIV RVGGSST SAHLVVS SAHVVVT SASHVVT SATHLVG SAVLGHP SFDGDIQ SGAVGHP SGHPLGT

RIGTSTV RVGGSSV SAHLVVT SALHGGG SASLGHG SATHLVP SAVLGHS SFGGPQL SGAVGHT SGHPLVA

RILWSSI RVGGSSW SAHPGGG SALHGGP SASLGHP SATHLVS SAVLGHT SFGGSSV SGAVHGP SGHPLVG

RKANVIV RVGGST SAHPGGS SALHGGS SASLGHS SATHVGG SAVLHGG SFIQFSV SGAVHGT SGHPLVS

RKGGSIV RVGGSVV SAHPGGT SALHGGT SASLGHT SATHVGP SAVLHGP SFYGFYV SGAVHLG SGHPLVT

RKGGSSV RVGGSYM SAHPGLG SALHGVG SASLHGG SATHVGS SAVLHGS SGAHGGP SGAVHLP SGHPVAG

RKGTSSR RVGGYSV SAHPGLS SALHGVP SASLHGP SATHVLG SAVLHGT SGAHGGT SGAVHLS SGHPVAS

RKQGSSE RVGISSS SAHPGLT SALHGVS SASLHGS SATHVLP SAVLHVG SGAHGLG SGAVHLT SGHPVAT

RKQNDSD RVGKLTD SAHPGVG SALHGVT SASLHGT SATHVLS SAVLHVP SGAHGLP SGAVHVP SGHPVGA

RKWMSST RVGKQSV SAHPGVS SALHVGG SASLHVG SATHVVG SAVLHVS SGAHGLS SGAVHVT SGHPVGT

RKYSSHV RVGKSFH SAHPGVT SALHVGP SASLHVP SATHVVP SAVLHVT SGAHGLT SGAVLHG SGHPVLA

RLGGSMV RVGKSVV SAHPLGG SALHVGS SASLHVS SATHVVS SAVLVHG SGAHGVP SGAVLHP SGHPVLG

RLGGSSV RVGLGSD SAHPLGS SALHVGT SASLHVT SATLGHG SAVLVHP SGAHGVT SGAVLHS SGHPVLS

RLGGWNM RVGLSQI SAHPLGT SALHVVG SASLVHG SATLGHP SAVLVHS SGAHLGG SGAVLHT SGHPVLT

RLQQSSA RVGMESI SAHPLVG SALHVVP SASLVHP SATLGHS SAVLVHT SGAHLGP SGAVVHP SGHPVVA

RMFNHSV RVG TSA SAHPLVS SALHVVS SASLVHS SATLHGG SAVPGHG SGAHLGS SGAVVHT SGHPVVT

RMGASYM RVGPKSP SAHPLVT SALHVVT SASLVHT SATLHGP SAVPGHS SGAHLGT SGGESYV SGHSAGP

RMGGASP RVGQQDV SAHPVGG SALPGHG SASPGHG SATLHGS SAVPGHT SGAHLVG SGGGSDR SGHSAGT

RMGQYSQ RVGQRSE SAHPVGS SALPGHS SASPGHS SATLHVG SAVPHGG SGAHLVP SGGLSSG SGHSALG

RMGYSSN RVGRSEP SAHPVGT SALPGHT SASPGHT SATLHVP SAVPHGS SGAHLVS SGHAGGP SGHSALP

RMMI SD RVGSTIV SAHPVLG SALPHGG SASPHGG SATLHVS SAVPHGT SGAHLVT SGHAGGT SGHSALS

RMPGSSV RVGVSSV SAHPVLS SALPHGS SASPHGS SATLVHG SAVPHLG SGAHVGP SGHAGLG SGHSALT

RMVGSSV RVGWPSE SAHPVLT SALPHGT SASPHGT SATLVHP SAVPHLS SGAHVGT SGHAGLP SGHSAVP

RNEGSVV RVGWSSV SAHPVVG SALPHVG SASPHLG SATLVHS SAVPHLT SGAHVLG SGHAGLS SGHSAVT

RNGGSQV RVGWWSH SAHPVVS SALPHVS SASPHLS SATPGHG SAVPHVG SGAHVLP SGHAGLT SGHSGAP

RNGRSSV RVHGPSN SAHPVVT SALPHVT SASPHLT SATPGHS SAVPHVS SGAHVLS SGHAGVP SGHSGAT

RNGTSSV RVHKHSV SAHSGGP SALPVHG SASPHVG SATPHGG SAVPHVT SGAHVLT SGHAGVT SGHSGLA

RPGGHSV RVIGQQN SAHSGGT SALPVHS SASPHVS SATPHGS SAVPLHG SGAHVVP SGHALGG SGHSGLP

RPGGSNV RVIGSSQ SAHSGLG SALPVHT SASPHVT SATPHLG SAVPLHS SGAHVVT SGHALGP SGHSGLT

RPGMSSF RVIGSYV SAHSGLP SALSGHG SASPLHG SATPHLS SAVPLHT SGALGHG SGHALGS SGHSLAG

RPGNWMM RVISSKP SAHSGLS SALSGHP SASPLHS SATPHVG SAVPVHG SGALGHP SGHALGT SGHSLAP

RPSGEVL RVIVSYI SAHSGLT SALSGHS SASPLHT SATPHVS SAVPVHS SGALGHS SGHALVG SGHSLAS

RPTTNSS RVKIASV SAHSG P SALSGHT SASPVHG SATPLHG SAVPVHT SGALGHT SGHALVP SGHSLAT

RQAHDSI RVLASSA SAHSGVT SALSHGG SASPVHS SATPLHS SAVSGHP SGALHGG SGHALVS SGHSLGA

RQPGSKI RVLGSGV SAHSLGG SALSHGP SASPVHT SATPVHG SAVSGHT SGALHGP SGHALVT SGHSLGP

RRGEESV RVLGSSD SAHSLGP SALSHGS SASSGHP SATPVHS SAVSHGP SGALHGS SGHAVGP SGHSLGT

RRGISSR RVLTSSV SAHSLGS SALSHGT SASSGHT SATSGHG SAVSHGT SGALHGT SGHAVGT SGHSLVA

RRGPLSV RVMAGQV SAHSLGT SALSHVG SASSHGP SATSGHP SAVSHLG SGALHVG SGHAVLG SGHSLVP

RRGTSEA RVMASSV SAHSLVG SALSHVP SASSHGT SATSGHS SAVSHLP SGALHVP SGHAVLP SGHSLVT

RRMGHSV RVMGETV SAHSL P SALSHVS SASSHLG SATSHGG SAVSHLS SGALHVS SGHAVLS SGHSVAP

RRPPSSS RVMGSSV SAHSLVS SALSHVT SASSHLP SATSHGP SAVSHLT SGALHVT SGHAVLT SGHSVAT

RRQGLSV RVNGWSV SAHSLVT SALSVHG SASSHLS SATSHGS SAVSHVP SGALVHG SGHAVVP SGHSVLA SGHSVLP SGLHGAP SGLVH A SGSSHLP SGTLAHG SGVAHVT SGVTHLA SHATLGP SHLSGAS SHSAVLT

SGHSVLT SGLHGAS SGLVHVP SGSSHLT SGTLAHP SGVALHG SGVTHLG SHATLGS SHLSGAT SHSAVVP

SGHTAGG SGLHGAT SGLVHVT SGSSLHA SGTLAHS SGVALHP SGVTHLP SHATLVG SHLSGGA SHSAVVT

SGHTAGP SGLHGGA SGLVVHA SGSSLHP SGTLGHA SGVALHS SGVTHLS SHATL P SHLSGGP SHSLAGG

SGHTAGS SGLHGGP SGLVVHP SGSSLHT SGTLGHG SGVALHT SGVTHVA SHATLVS SHLSGGT SHSLAGP

SGHTALG SGLHGGT SGLVVHT SGSTAHG SGTLGHP SGVAVHP SGVTHVP SHATVGG SHLSGVA SHSLAGS

SGHTALP SGLHGVA SGSAGHP SGSTAHP SGTLGHS SGVAVHT SGVTLHA SHATVGP SHLSGVP SHSLAGT

SGHTALS SGLHGVP SGSAGHT SGSTAHS SGTLHAG SGVHAGP SGVTLHG SHATVGS SHLSGVT SHSLAVG

SGHTAVG SGLHGVT SGSAHGP SGSTGHA SGTLHAP SGVHAGT SGVTLHP SHATVLG SHLSSHL SHSLA P

SGHTA P SGLHVAG SGSAHGT SGSTGHP SGTLHAS SGVHALG SGVTLHS SHATVLP SHLSVAG SHSLAVS

SGHTAVS SGLHVAP SGSAHLG SGSTHAG SGTLHGA SGVHALP SGVTVHA SHATVLS SHLSVAP SHSLAVT

SGHTGAG SGLHVAS SGSAHLP SGSTHAP SGTLHGG SGVHALS SGVTVHP SHATVVG SHLSVAS SHSLGAG

SGHTGAP SGLH AT SGSAHLS SGSTHAS SGTLHGP SGVHALT SGVVAHP SHATVVP SHLSVAT SHSLGAP

SGHTGAS SGLHVGA SGSAHLT SGSTHGA SGTLHGS SGVHA P SGVVAHT SHATVVS SHLSVGA SHSLGAS

SGHTGGA SGLHVGP SGSAHVP SGSTHGP SGTLHVA SGVHAVT SGVVHAP SHAVGGP SHLSVGP SHSLGAT

SGHTGGP SGLHVGT SGSAHVT SGSTHLA SGTLHVG SGVHGAP SGVVHAT SHAVGGT SHLSVGT SHSLGGA

SGHTGLA SGLH VA SGSALHG SGSTHLG SGTLHVP SGVHGAT SGVVHLA SHAVGLG SHLSVVA SHSLGGP

SGHTGLG SGLHVVP SGSALHP SGSTHLP SGTLHVS SGVHGLA SGVVHLP SHAVGLP SHLSVVP SHSLGGT

SGHTGLP SGLHVVT SGSALHS SGSTHLS SGTLVHA SGVHGLP SGVVHLT SHAVGLS SHLSVVT SHSLGVA

SGHTGLS SGLPAHG SGSALHT SGSTHVA SGTLVHG SGVHGLT SGVVLHA SHAVGLT SHLTAGG SHSLGVP

SGHTGVA SGLPAHS SGSAVHP SGSTHVP SGTL HP SGVHLAG SGVVLHP SHAVGVP SHLTAGP SHSLGVT

SGHTG P SGLPAHT SGSAVHT SGSTLHA SGTLVHS SGVHLAP SGVVLHT SHAVGVT SHLTAGS SHSLVAG

SGHTLAG SGLPGHA SGSHAGP SGSTLHG SGTPAHG SGVHLAS SGYLESV SHAVLGG SHLTAVG SHSLVAP

SGHTLAP SGLPGHG SGSHAGT SGSTLHP SGTPAHS SGVHLAT SHALGGG SHAVLGP SHLTAVP SHSLVAS

SGHTLAS SGLPGHS SGSHALG SGSTLHS SGTPGHA SGVHLGA SHALGGP SHAVLGS SHLTAVS SHSLVAT

SGHTLGA SGLPGHT SGSHALP SGSTVHA SGTPGHG SGVHLGP SHALGGS SHAVLGT SHLTGAG SHSLVGA

SGHTLGG SGLPHAG SGSHALS SGSTVHP SGTPGHS SGVHLGT SHALGGT SHAVLVG SHLTGAP SHSLVGP

SGHTLGP SGLPHAS SG SHALT SGSVAHP SGTPHAG SGVHLVA SHALGVG SHAVL P SHLTGAS SHSLVGT

SGHTLGS SGLPHAT SGSHA P SGSVAHT SGTPHAS SGVHLVP SHALGVP SHAVLVS SHLTGGA SHSLVVA

SGHTLVA SGLPHGA SGSHAVT SGSVHAP SGTPHGA SGVHLVT SHALGVS SHAVLVT SHLTGGG SHSLVVP

SGHTLVG SGLPHGG SGSHGAP SGSVHAT SGTPHGG SGVHVAP SHALGVT SHAVVGP SHLTGGP SHSLVVT

SGHTL P SGLPHGS SGSHGAT SGSVHLA SGTPHGS SGVHVAT SHALVGG SHAVVGT SHLTGGS SHSPAGG

SGHTLVS SGLPHGT SGSHGLA SGSVHLP SGTPHLA SGVHVLA SHALVGP SHAVVLG SHLTGVA SHSPAGS

SGHT AG SGLPHVA SGSHGLP SGSVHLT SGTPHLG SGVHVLP SHALVGS SHAVVLP SHLTG G SHSPAGT

SGHTVAP SGLPHVG SGSHGLT SGSVLHA SGTPHLS SGVHVLT SHALVGT SHAWLS SHLTGVP SHSPALG

SGHT AS SGLPHVS SGSHLAG SGSVLHP SGTPHVA SGVLAHG SHALVVG SHAVVLT SHLTGVS SHSPALS

SGHT GA SGLPHVT SGSHLAP SGSVLHT SGTPHVG SGVLAHP SHALVVP SHAVVVP SHLTVAG SHSPALT

SGHTVGP SGLP HA SGSHLAS SGTAGHG SGTPHVS SGVLAHS SHALVVS SHAVVVT SHLTVAP SHSPAVG

SGHTVLA SGLP HG SGSHLAT SGTAGHP SGTPLHA SGVLAHT SHALVVT SHGDFFV SHLTVAS SHSPAVS

SGHT LG SGLP HS SGSHLGA SGTAGHS SGTPLHG SGVLGHA SHAPGGG SHGGNIV SHLTVGA SHSPAVT

SGHTVLP SGLPVHT SGSHLGP SGTAHGG SGTPLHS SGVLGHP SHAPGGS SHGGSSV SHLTVGG SHSPGAG

SGHT LS SGLSAHG SGSHLGT SGTAHGP SGTPVHA SGVLGHT SHAPGGT SHGGTTI SHLTVGP SHSPGAS

SGHTVVA SGLSAHP SGSHLVA SGTAHGS SGTPVHG SGVLHAG SHAPGLG SHGRSSV SHLTVGS SHSPGAT

SGHTVVP SGLSAHS SGSHLVP SGTAHLG SGTPVHS SGVLHAP SHAPGLS SHLAGGG SHLTVVA SHSPGGA

SGHVAGP SGLSAHT SGSHLVT SGTAHLP SGTSAHG SGVLHAS SHAPGLT SHLAGGP SHLTVVG SHSPGGT

SGHVAGT SGLSGHA SGSHVAP SGTAHLS SGTSAHP SGVLHAT SHAPGVG SHLAGGS SHLTVVP SHSPGLA

SGHVALG SGLSGHP SGSHVAT SGTAHVG SGTSAHS SGVLHGA SHAPGVS SHLAGGT SHLTVVS SHSPGLG

SGHVALP SGLSGHT SGSHVLA SGTAHVP SGTSGHA SGVLHGP SHAPGVT SHLAG G SHLVAGG SHSPGLS

SGHVALS SGLSHAG SGSHVLP SGTAHVS SGTSGHP SGVLHGT SHAPLGG SHLAGVP SHLVAGP SHSPGLT

SGHVALT SGLSHAP SGSHVLT SGTALHG SGTSHAG SGVLHVA SHAPLGS SHLAG S SHLVAGS SHSPGVA

SGHVAVP SGLSHAS SGSLAHG SGTALHP SGTSHAP SGVLHVP SHAPLGT SHLAGVT SHLVAGT SHSPGVT

SGHVAVT SGLSHAT SGSLAHP SGTALHS SGTSHAS SGVLHVT SHAPLVG SHLAVGG SHLVAVG SHSPLAG

SGHVGAP SGLSHGA SGSLAHS SGTAVHG SGTSHGA SGVLVHA SHAPLVS SHLAVGP SHLVAVP SHSPLAS

SGHVGAT SGLSHGP SGSLAHT SGTA HP SGTSHGP SGVL HP SHAPLVT SHLAVGS SHLVAVS SHSPLAT

SGH GLA SGLSHGT SGSLGHA SGTAVHS SGTSHLA SGVLVHT SHAPVGG SHLAVGT SHLVAVT SHSPLGA

SGHVGLP SGLSHVA SGSLGHP SGTHAGG SGTSHLG SGVPAHG SHAPVGS SHLA VG SHLVGAG SHSPLGG

SGHVGLT SGLSHVP SGSLGHT SGTHAGP SGTSHLP SGVPAHS SHAPVGT SHLAVVP SHLVGAP SHSPLGS

SGHVLAG SGLSHVT SGSLHAG SGTHAGS SGTSHLS SGVPAHT SHAPVLG SHLAVVS SHLVGAS SHSPLGT

SGHVLAP SGLSVHA SGSLHAP SGTHALG SGTSHVA SGVPGHA SHAPVLS SHLAVVT SHLVGAT SHSPLVA

SGHVLAS SGLS HP SGSLHAS SGTHALP SGTSHVP SGVPGHT SHAPVLT SHLPAGG SHLVGGA SHSPLVG

SGHVLAT SGLSVHT SGSLHAT SGTHALS SGTSLHA SGVPHAG SHAPVVG SHLPAGS SHLVGGP SHSPLVS

SGHVLGA SGLTAHG SGSLHGA SGTHAVG SGTSLHG SGVPHAS SHAPVVS SHLPAGT SHLVGGT SHSPLVT

SGHVLGP SGLTAHP SGSLHGP SGTHA P SGTSLHP SGVPHAT SHAPVVT SHLPAVG SHLVGVA SHSPVAG

SGHVLGT SGLTAHS SGSLHGT SGTHAVS SGTSLHS SGVPHGA SHASGGP SHLPAVS SHLVGVP SHSPVAS

SGHVLVA SGLTGHA SGSLHVA SGTHGAG SGTSVHA SGVPHGT SHASGGT SHLPAVT SHLVGVT SHSPVAT

SGHVL P SGLTGHG SGSLHVP SGTHGAP SGTS HP SGVPHLA SHASGLG SHLPGAG SHLVVAG SHSPVGA

SGHVLVT SGLTGHP SGSLHVT SGTHGAS SGTVAHG SGVPHLG SHASGLP SHLPGAS SHLVVAP SHSPVGT

SGHVVAP SGLTGHS SGSLVHA SGTHGGA SGTVAHP SGVPHLS SHASGLS SHLPGAT SHLVVAS SHSPVLA

SGH VAT SGLTHAG SGSLVHP SGTHGGP SGTVAHS SGVPHLT SHASGLT SHLPGGA SHLVVAT SHSPVLG

SGHVVLA SGLTHAP SGSLVHT SGTHGLA SGTVGHA SGVPHVA SHASGVP SHLPGGG SHLVVGA SHSPVLS

SGHVVLP SGLTHAS SGSPAHG SGTHGLG SGTVGHP SGVPHVT SHASGVT SHLPGGS SHLVVGP SHSPVLT

SGH LT SGLTHGA SGSPAHS SGTHGLP SGTVHAG SGVPLHA SHASLGG SHLPGGT SHLVVGT SHSPVVA

SGLAGHG SGLTHGG SGSPAHT SGTHGLS SGTVHAP SGVPLHG SHASLGP SHLPGVA SHLVVVA SHSPVVT

SGLAGHP SGLTHGP SGSPGHA SGTHGVA SGTVHAS SGVPLHS SHASLGS SHLPGVG SHLVVVP SHSSAGP

SGLAGHS SGLTHGS SGSPGHT SGTHGVP SGTVHGA SGVPLHT SHASLGT SHLPGVS SHLVVVT SHSSAGT

SGLAGHT SGLTHVA SGSPHAG SGTHLAG SGTVHGP SGVPVHA SHASLVG SHLPGVT SHNHNLT SHSSALG

SGLAHGG SGLTHVG SGSPHAS SGTHLAP SGTVHLA SGVPVHT SHASLVP SHLPVAG SHSAGGP SHSSALP

SGLAHGP SGLTHVP SGSPHAT SGTHLAS SGTVHLG SGVSAHP SHASLVS SHLPVAS SHSAGGT SHSSALS

SGLAHGS SGLTHVS SGSPHGA SGTHLGA SGTVHLP SGVSAHT SHASLVT SHLPVAT SHSAGLG SHSSALT

SGLAHGT SGLTVHA SGSPHGT SGTHLGG SGTVHLS SGVSHAP SHASVGP SHLPVGA SHSAGLP SHSSAVP

SGLAHVG SGLTVHG SGSPHLA SGTHLGP SGTVHVA SGVSHAT SHASVGT SHLPVGG SHSAGLS SHSSAVT

SGLAH P SGLTVHP SGSPHLG SGTHLGS SGTVHVP SGVSHLA SHASVLG SHLPVGS SHSAGLT SHSSGAP

SGLAHVS SGLTVHS SGSPHLS SGTHLVA SGTVLHA SGVSHLP SHASVLP SHLPVGT SHSAGVP SHSSGAT

SGLAHVT SGLVAHG SGSPHLT SGTHLVG SGTVLHG SGVSHLT SHASVLS SHLPVVA SHSAGVT SHSSGLA

SGLA HG SGLVAHP SGSPHVA SGTHL P SGTVLHP SGVSLHA SHASVLT SHLPVVG SHSALGG SHSSGLP

SGLA HP SGLVAHS SGSPHVT SGTHLVS SGTVLHS SGVSLHP SHASVVP SHLPVVS SHSALGP SHSSGLT

SGLA HS SGLVAHT SGSPLHA SGTHVAG SGTVVHA SGVSLHT SHASVVT SHLPVVT SHSALGS SHSSLAG

SGLA HT SGLVGHA SGSPLHG SGTHVAP SGTVVHP SGVTAHG SHATGGG SHLSAGG SHSALGT SHSSLAP

SGLHAGG SGLVGHP SGSPLHS SGTHVAS SGVAGHP SGVTAHP SHATGGP SHLSAGP SHSALVG SHSSLAS

SGLHAGP SGLVGHT SGSPLHT SGTHVGA SGVAGHT SGVTAHS SHATGGS SHLSAGS SHSAL P SHSSLAT

SGLHAGS SGLVHAG SGSPVHA SGTHVGP SGVAHGP SGVTGHA SHATGLG SHLSAGT SHSALVS SHSSLGA

SGLHAGT SGLVHAP SGSPVHT SGTHVLA SGVAHGT SGVTGHP SHATGLP SHLSAVG SHSALVT SHSSLGP

SGLHA G SGLVHAS SGSSAHP SGTHVLG SGVAHLG SGVTHAG SHATGLS SHLSAVP SHSAVGP SHSSLGT

SGLHA P SGLVHAT SGSSAHT SGTHVLP SGVAHLP SGVTHAP SHATGVG SHLSAVS SHSAVGT SHSSLVA

SGLHA S SGLVHGA SGSSHAP SGTHVLS SGVAHLS SGVTHAS SHATGVP SHLSAVT SHSAVLG SHSSLVP

SGLHAVT SGLVHGP SGSSHAT SGTHVVA SGVAHLT SGVTHGA SHATGVS SHLSGAG SHSAVLP SHSSLVT

SGLHGAG SGLVHGT SGSSHLA SGTHVVP SGVAHVP SGVTHGP SHATLGG SHLSGAP SHSAVLS SHSSVAP SHSSVAT SHTAVVP SHTSVAG SHVLVAP SHVTGVA SQNGLSV SSATVHP SSHPLGA SSHVGAP SSLSHGA

SHSSVLA SHTAVVS SHTSVAP SHVLVAS SHVTGVP SQVGSSA SSATVHS SSHPLGG SSHVGAT SSLSHGP

SHSSVLP SHTLAGG SHTSVAS SHVLVAT SHVTLAG SQVLPLE SSAVGHP SSHPLGS SSHVGLA SSLSHGT

SHSSVLT SHTLAGP SHTSVGA SHVL GA SHVTLAP SRGGSSV SSAVGHT SSHPLGT SSHVGLP SSLSHVA

SHSTAGG SHTLAGS SHTSVGP SHVLVGP SHVTLAS SRGMSSV SSAVHGP SSHPLVA SSHVGLT SSLSHVP

SHSTAGP SHTLAVG SHTSVLA SHVLVGT SHVTLGA SRHNSSV SSAVHGT SSHPLVG SSHVLAG SSLSHVT

SHSTAGS SHTLA P SHTSVLG SHVLVVA SHVTLGG SRNGSMV SSAVHLG SSHPLVS SSHVLAP SSLSVHA

SHSTALG SHTLAVS SHTSVLP SHVLVVP SHVTLGP SSAHGGP SSAVHLP SSHPLVT SSHVLAS SSLSVHP

SHSTALP SHTLGAG SHTSVLS SHVLVVT SHVTLGS SSAHGGT SSAVHLS SSHPVAG SSHVLAT SSLSVHT

SHSTALS SHTLGAP SHTSVVA SHVPAGG SHVTLVA SSAHGLG SSAVHLT SSHPVAS SSHVLGA SSLTAHG

SHSTAVG SHTLGAS SHTSVVP SHVPAGS SHVTLVG SSAHGLP SSAVHVP SSHPVAT SSHVLGP SSLTAHP

SHSTAVP SHTLGGA SHTVAGG SHVPAGT SHVTL P SSAHGLS SSAVHVT SSHPVGA SSHVLGT SSLTAHS

SHSTAVS SHTLGGG SHTVAGP SHVPALG SHVTLVS SSAHGLT SSAVLHG SSHPVGT SSHVLVA SSLTGHA

SHSTGAG SHTLGGP SHTVAGS SHVPALS SHVT AG SSAHGVP SSAVLHP SSHPVLA SSHVLVP SSLTGHG

SHSTGAP SHTLGGS SHTVALG SHVPALT SHVTVAP SSAHGVT SSAVLHS SSHPVLG SSHVLVT SSLTGHP

SHSTGAS SHTLGVA SHTVALP SHVPAVG SHVTVAS SSAHLGG SSAVLHT SSHPVLS SSHVVAP SSLTGHS

SHSTGGA SHTLGVG SHTVALS SHVPAVS SHVTVGA SSAHLGP SSAVVHP SSHPVLT SSHVVAT SSLTHAG

SHSTGGP SHTLGVP SHTVAVG SHVPAVT SHVTVGP SSAHLGS SSAVVHT SSHPVVA SSHVVLA SSLTHAP

SHSTGLA SHTLGVS SHTVAVP SHVPGAG SHVTVLA SSAHLGT SSGGSHE SSHPVVT SSHVVLP SSLTHAS

SHSTGLG SHTLVAG SHTVAVS SHVPGAS SHVTVLG SSAHLVG SSGGSTV SSHSAGP SSHVVLT SSLTHGA

SHSTGLP SHTLVAP SHTVGAG SHVPGAT SHVTVLP SSAHLVP SSGISSV SSHSAGT SSLAGHG SSLTHGG

SHSTGLS SHTLVAS SHTVGAP SHVPGGA SHVTVLS SSAHLVS SSHAGGP SSHSALG SSLAGHP SSLTHGP

SHSTGVA SHTL GA SHTVGAS SHVPGGT SHVTVVA SSAHLVT SSHAGGT SSHSALP SSLAGHS SSLTHGS

SHSTGVP SHTLVGG SHTVGGA SHVPGLA SHVTVVP SSAHVGP SSHAGLG SSHSALS SSLAGHT SSLTHVA

SHSTLAG SHTLVGP SHTVGGP SHVPGLG SH VAGP SSAHVGT SSHAGLP SSHSALT SSLAHGG SSLTHVG

SHSTLAP SHTLVGS SHTVGLA SHVPGLS SH VAGT SSAHVLG SSHAGLS SSHSAVP SSLAHGP SSLTHVP

SHSTLAS SHTLVVA SHTVGLG SHVPGLT SH VALG SSAHVLP SSHAGLT SSHSAVT SSLAHGS SSLTHVS

SHSTLGA SHTLVVG SHTVGLP SHVPGVA SHVVALP SSAHVLS SSHAGVP SSHSGAP SSLAHGT SSLTVHA

SHSTLGG SHTLVVP SHTVGLS SHVPGVT SHVVALS SSAHVLT SSHAGVT SSHSGAT SSLAHVG SSLTVHG

SHSTLGP SHTLVVS SHTVG A SHVPLAG SH VALT SSAHVVP SSHALGG SSHSGLA SSLAHVP SSLTVHP

SHSTLGS SHTPAGG SHTVGVP SHVPLAS SHVVAVP SSAHVVT SSHALGP SSHSGLP SSLAHVS SSLTVHS

SHSTLVA SHTPAGS SHTVLAG SHVPLAT SHVVAVT SSALGHG SSHALGS SSHSGLT SSLAHVT SSLVAHG

SHSTLVG SHTPALG SHTVLAP SHVPLGA SHVVGAP SSALGHP SSHALGT SSHSLAG SSLAVHG SSLVAHP

SHSTL P SHTPALS SHTVLAS SHVPLGG SHVVGAT SSALGHS SSHALVG SSHSLAP SSLAVHP SSLVAHS

SHSTLVS SHTPAVG SHTVLGA SHVPLGS SH VGLA SSALGHT SSHALVP SSHSLAS SSLAVHS SSLVAHT

SHSTRTH SHTPAVS SHTVLGG SHVPLGT SHVVGLP SSALHGG SSHALVS SSHSLAT SSLAVHT SSLVGHA

SHSTVAG SHTPGAG SHTVLGP SHVPLVA SH VGLT SSALHGP SSHALVT SSHSLGA SSLHAGG SSLVGHP

SHSTVAP SHTPGAS SHTVLGS SHVPLVG SHVVLAG SSALHGS SSHAVGP SSHSLGP SSLHAGP SSLVGHT

SHSTVAS SHTPGGA SHTVLVA SHVPLVS SHVVLAP SSALHGT SSHAVGT SSHSLGT SSLHAGS SSLVHAG

SHSTVGA SHTPGGG SHTVLVG SHVPLVT SHVVLAS SSALHVG SSHAVLG SSHSLVA SSLHAGT SSLVHAP

SHSTVGP SHTPGGS SHTVL P SHVPVAG SHVVLAT SSALHVP SSHAVLP SSHSLVP SSLHAVG SSLVHAS

SHSTVLA SHTPGLA SHTVLVS SHVPVAS SHVVLGA SSALHVS SSHAVLS SSHSLVT SSLHAVP SSLVHAT

SHSTVLG SHTPGLG SHTVVAG SHVPVAT SHVVLGP SSALHVT SSHAVLT SSHSVAP SSLHAVS SSLVHGA

SHSTVLP SHTPGLS SHTVVAP SHVPVGA SHVVLGT SSALVHG SSHAVVP SSHSVAT SSLHAVT SSLVHGP

SHSTVLS SHTPGVA SHTVVAS SHVPVGT SHVVLVA SSALVHP SSHAVVT SSHSVLA SSLHGAG SSLVHGT

SHSTVVA SHTPG G SHTVVGA SHVPVLA SHVVL P SSALVHS SSHGSSK SSHSVLP SSLHGAP SSLVHVA

SHSTVVP SHTPGVS SHTVVGP SHVPVLG SHVVLVT SSALVHT SSHLAGG SSHSVLT SSLHGAS SSLVHVP

SHSVAGP SHTPLAG SHTVVLA SHVPVLS SHVVVAP SSAPGHG SSHLAGP SSHTAGG SSLHGAT SSLVHVT

SHSVAGT SHTPLAS SHTVVLG SHVPVLT SHVVVAT SSAPGHS SSHLAGS SSHTAGP SSLHGGA SSLVVHA

SHSVALG SHTPLGA SHTVVLP SHVPVVA SHVVVLA SSAPGHT SSHLAGT SSHTAGS SSLHGGP SSLVVHP

SHSVALP SHTPLGG SHTVVLS SHVPVVT SHVVVLP SSAPHGG SSHLAVG SSHTALG SSLHGGT SSLVVHT

SHSVALS SHTPLGS SHTVVVA SHVSAGP SHVVVLT SSAPHGS SSHLAVP SSHTALP SSLHGVA SSPDKSR

SHSVALT SHTPLVA SHTVVVP SHVSAGT SHWFSIV SSAPHGT SSHLAVS SSHTALS SSLHGVP SSSAGHP

SHSVAVP SHTPLVG SHVAGGP SHVSALG SIFESSV SSAPHLG SSHLAVT SSHTAVG SSLHGVT SSSAGHT

SHSVAVT SHTPLVS SHVAGGT SHVSALP SIFGGSV SSAPHLS SSHLGAG SSHTAVP SSLHVAG SSSAHGP

SHSVGAP SHTPVAG SHVAGLG SHVSALS SIGGGSK SSAPHLT SSHLGAP SSHTAVS SSLHVAP SSSAHGT

SHSVGAT SHTPVAS SHVAGLP SHVSALT SIGGSMV SSAPHVG SSHLGAS SSHTGAG SSLHVAS SSSAHLG

SHSVGLA SHTPVGA SHVAGLS SHVSAVP SIGSSNV SSAPHVS SSHLGAT SSHTGAP SSLHVAT SSSAHLP

SHSVGLP SHTPVGG SHVAGLT SHVSAVT SIHFHTV SSAPHVT SSHLGGA SSHTGAS SSLHVGA SSSAHLS

SHSVGLT SHTPVGS SHVAGVP SHVSGAP SIHVSPV SSAPLHG SSHLGGP SSHTGGA SSLHVGP SSSAHLT

SHSVLAG SHTPVLA SHVAGVT SHVSGAT SITNSSE SSAPLHS SSHLGGT SSHTGGP SSLHVGT SSSAHVP

SHSVLAP SHTPVLG SHVALGG SHVSGLA SKGISTN SSAPLHT SSHLGVA SSHTGLA SSLHVVA SSSAHVT

SHSVLAS SHTPVLS SHVALGP SHVSGLP SKGRNSV SSAPVHG SSHLGVP SSHTGLG SSLHVVP SSSALHG

SHSVLAT SHTPVVA SHVALGS SHVSGLT SLGGFWV SSAPVHS SSHLGVT SSHTGLP SSLHVVT SSSALHP

SHSVLGA SHTPVVG SHVALGT SH SLAG SLGGSSV SSAPVHT SSHLVAG SSHTGLS SSLPAHG SSSALHS

SHSVLGP SHTPVVS SHVALVG SHVSLAP SLGLSGV SSASGHP SSHLVAP SSHTGVA SSLPAHS SSSALHT

SHSVLGT SHTSAGG SHVALVP SHVSLAS SLGMSKI SSASGHT SSHLVAS SSHTGVP SSLPAHT SSSAVHP

SHSVLVA SHTSAGP SHVALVS SH SLAT SLGRPSW SSASHGP SSHLVAT SSHTLAG SSLPGHA SSSAVHT

SHSVL P SHTSAGS SHVALVT SHVSLGA SLSGSSY SSASHGT SSHLVGA SSHTLAP SSLPGHG SSSGTHG

SHSVLVT SHTSALG SHVAVGP SHVSLGP SLVGSSV SSASHLG SSHLVGP SSHTLAS SSLPGHS SSSHAGP

SHSVVAP SHTSALP SHVAVGT SHVSLGT SLYLSIG SSASHLP SSHLVGT SSHTLGA SSLPGHT SSSHAGT

SHSVVAT SHTSALS SHVAVLG SHVSLVA SMGGMLV SSASHLS SSHLVVA SSHTLGG SSLPHAG SSSHALG

SHSVVLA SHTSAVG SHVAVLP SHVSLVP SMGGSSH SSASHLT SSHLVVP SSHTLGP SSLPHAS SSSHALP

SHSVVLP SHTSAVP SHVAVLS SHVSLVT SMGPSVV SSASHVP SSHLVVT SSHTLGS SSLPHAT SSSHALS

SHSVVLT SHTSAVS SHVAVLT SHVSVAP SMLGSSI SSASHVT SSHPAGG SSHTLVA SSLPHGA SSSHALT

SHTAGGG SHTSGAG SHVAVVP SHVSVAT SMWGFMV SSASLHG SSHPAGS SSHTLVG SSLPHGG SSSHAVP

SHTAGGP SHTSGAP SHVAVVT SHVSVLA SNALSSV SSASLHP SSHPAGT SSHTLVP SSLPHGS SSSHAVT

SHTAGGS SHTSGAS SHVGASS SHVSVLP SNGASSE SSASLHS SSHPALG SSHTLVS SSLPHGT SSSHGAP

SHTAGLG SHTSGGA SHVLAGG SHVSVLT SNGDSMQ SSASLHT SSHPALS SSHTVAG SSLPHVA SSSHGAT

SHTAGLP SHTSGGP SHVLAGP SHVTAGG SNGWSSY SSASVHP SSHPALT SSHTVAP SSLPHVG SSSHGLA

SHTAGLS SHTSGLA SHVLAGS SHVTAGP SNIPYSV SSASVHT SSHPAVG SSHTVAS SSLPHVS SSSHGLP

SHTAGVG SHTSGLG SHVLAGT SHVTAGS SNNDMSV SSATGHG SSHPAVS SSHTVGA SSLPHVT SSSHGLT

SHTAGVP SHTSGLP SHVLAVG SHVTALG SPDGSSL SSATGHP SSHPAVT SSHTVGP SSLPVHA SSSHLAG

SHTAGVS SHTSGLS SHVLA P SHVTALP SPGGSSL SSATGHS SSHPGAG SSHTVLA SSLPVHG SSSHLAP

SHTALGG SHTSGVA SHVLAVS SHVTALS SPGLQHV SSATHGG SSHPGAS SSHTVLG SSLPVHS SSSHLAS

SHTALGP SHTSGVP SHVLAVT SHVTA G SPGWSAV SSATHGP SSHPGAT SSHTVLP SSLPVHT SSSHLAT

SHTALGS SHTSLAG SHVLGAG SHVTAVP SPKISSW SSATHGS SSHPGGA SSHTVLS SSLSAHG SSSHLGA

SHTALVG SHTSLAP SHVLGAP SHVTAVS SPMSPLV SSATHLG SSHPGGT SSHTVVA SSLSAHP SSSHLGP

SHTALVP SHTSLAS SHVLGAS SHVTGAG SPSQYFV SSATHLP SSHPGLA SSHTVVP SSLSAHS SSSHLGT

SHTALVS SHTSLGA SHVLGAT SHVTGAP SPVNSTV SSATHLS SSHPGLG SSHVAGP SSLSAHT SSSHLVA

SHTAVGG SHTSLGG SHVLGGA SHVTGAS SPWNSST SSATHVG SSHPGLS SSHVAGT SSLSGHA SSSHLVP

SHTAVGP SHTSLGP SHVLGGP SHVTGGA SQDGWSV SSATHVP SSHPGLT SSHVALG SSLSGHP SSSHLVT

SHTAVGS SHTSLGS SHVLGGT SHVTGGP SQGGELY SSATHVS SSHPGVA SSHVALP SSLSGHT SSSHVAP

SHTAVLG SHTSLVA SHVLGVA SHVTGLA SQGGEPP SSATLHG SSHPGVT SSHVALS SSLSHAG SSSHVAT

SHTAVLP SHTSLVG SHVLGVP SHVTGLG SQGGSGV SSATLHP SSHPLAG SSHVALT SSLSHAP SSSHVLA

SHTAVLS SHTSLVP SHVLGVT SHVTGLP SQGPSHM SSATLHS SSHPLAS SSHVAVP SSLSHAS SSSHVLP

SHTAVVG SHTSLVS SHVLVAG SHVTGLS SQGTSSK SSATVHG SSHPLAT SSHVAVT SSLSHAT SSSHVLT SSSLAHG SSTALHP SSTSGHP SSVLHGP STALGHP STHLGGA STHVAGG STLPVHG STSHVAS STVAGHG

SSSLAHP SSTALHS SSTSHAG SSVLHGT STALGHS STHLGGG STHVAGP STLPVHS STSHVGA ST AG HP

SSSLAHS SSTAVHG SSTSHAP SSVLHVA STALHGG STHLGGP STHVAGS STLSAHG STSHVGP STVAGHS

SSSLAHT SSTAVHP SSTSHAS SSVLHVP STALHGP STHLGGS STHVALG STLSAHP STSHVLA STVAHGG

SSSLGHA SSTAVHS SSTSHGA SSVLHVT STALHGS STHLGVA STHVALP STLSAHS STSHVLG STVAHGP

SSSLGHP SSTGSEV SSTSHGP SSVLVHA STALHVG STHLGVG STHVALS STLSGHA STSHVLP STVAHGS

SSSLGHT SSTHAGG SSTSHLA SSVL HP STALHVP STHLGVP STHVAVG STLSGHG STSHVLS STVAHLG

SSSLHAG SSTHAGP SSTSHLG SSVLVHT STALHVS STHLGVS STHVAVP STLSGHP STSHVVA STVAHLP

SSSLHAP SSTHAGS SSTSHLP SSVPAHG STALVHG STHLVAG STHVAVS STLSGHS STSHVVP STVAHLS

SSSLHAS SSTHALG SSTSHLS SSVPAHS STAL HP STHLVAP STHVGAG STLSHAG STSLAHG STVAHVG

SSSLHAT SSTHALP SSTSHVA SSVPAHT STALVHS STHLVAS STHVGAP STLSHAP STSLAHP STVAHVP

SSSLHGA SSTHALS SSTSHVP SSVPGHA STAPGHG STHL GA STHVGAS STLSHAS STSLAHS STVAHVS

SSSLHGP SSTHAVG SSTSLHA SSVPGHT STAPGHS STHLVGG STHVGGA STLSHGA STSLGHA STVALHG

SSSLHGT SSTHAVP SSTSLHG SSVPHAG STAPHGG STHLVGP STHVGGP STLSHGG STSLGHG STVALHP

SSSLHVA SSTHAVS SSTSLHP SSVPHAS STAPHGS STHLVGS STHVGLA STLSHGP STSLGHP STVALHS

SSSLHVP SSTHGAG SSTSLHS SSVPHAT STAPH LG STHLVVA STHVGLG STLSHGS STSLGHS STVAVHG

SSSLHVT SSTHGAP SSTSVHA SSVPHGA STAPH LS STHLVVG STHVGLP STLSHVA STSLHAG STVAVHP

SSSLVHA SSTHGAS SSTS HP SSVPHGT STAPHVG STHLVVP STHVGLS STLSHVG STSLHAP STVAVHS

SSSLVHP SSTHGGA SSTVAHG SSVPHLA STAPHVS STHLVVS STHVGVA STLSHVP STSLHAS STVHAGG

SSSLVHT SSTHGGP SSTVAHP SSVPHLG STAPLHG STHPAGG STHVGVP STLSHVS STSLHGA STVHAGP

SSSPAHG SSTHGLA SSTVAHS SSVPHLS STAPLHS STHPAGS STHVLAG STLSVHA STSLHGG STVHAGS

SSSPAHS SSTHGLG SSTVGHA SSVPHLT STAPVHG STHPALG STHVLAP STLSVHG STSLHGP STVHALG

SSSPAHT SSTHGLP SSTVGHP SSVPHVA STAPVHS STHPALS STHVLAS STLS HP STSLHGS STVHALP

SSSPGHA SSTHGLS SSTVHAG SSVPHVT STASGHG STHPA G STHVLGA STLSVHS STSLHVA STVHALS

SSSPGHT SSTHGVA SSTVHAP SSVPLHA STASGHP STHPA S STHVLGG STLVAHG STSLHVG STVHAVG

SSSPHAG SSTHGVP SSTVHAS SSVPLHG STASGHS STHPGAG STHVLGP STL AHP STSLHVP STVHAVP

SSSPHAS SSTHLAG SSTVHGA SSVPLHS STASHGG STHPGAS STHVLGS STLVAHS STSLHVS STVHAVS

SSSPHAT SSTHLAP SSTVHGP SSVPLHT STASHGP STHPGGA STHVLVA STL GHA STSLVHA STVHGAG

SSSPHGA SSTHLAS SSTVHLA SSVPVHA STASHGS STHPGGG STHVLVG STL GHG STSLVHG STVHGAP

SSSPHGT SSTHLGA SSTVHLG SSVPVHT STASHLG STHPGGS STHVL P STL GHP STSLVHP STVHGAS

SSSPHLA SSTHLGG SSTVHLP SSVSAHP STASH LP STHPGLA STHVLVS STL GHS STSLVHS STVHGGA

SSSPHLG SSTHLGP SSTVHLS SSVSAHT STASHLS STHPGLG STHVVAG STL HAG STSPAHG STVHGGP

SSSPHLS SSTHLGS SSTVHVA SSVSHAP STASH VG STHPGLS STHVVAP STL HAP STSPAHS STVHGLA

SSSPHLT SSTHLVA SSTVHVP SSVSHAT STASHVP STHPG A STHVVAS STL HAS STSPGHA STVHGLG

SSSPHVA SSTHLVG SSTVLHA SSVSHLA STASHVS STHPGVG STHVVGA STL HGA STSPGHG STVHGLP

SSSPHVT SSTHL P SSTVLHG SSVSHLP STASLHG STHPGVS STHVVGP STL HGG STSPGHS STVHGLS

SSSPLHA SSTHLVS SSTVLHP SSVSHLT STASLHP STHPLAG STHVVLA STL HGP STSPHAG STVHGVA

SSSPLHG SSTHVAG SSTVLHS SSVSLHA STASLHS STHPLAS STHVVLG STL HGS STSPHAS STVHGVP

SSSPLHS SSTHVAP SSTVVHA SSVSLHP STASVHG STHPLGA STHVVLP STL HVA STSPHGA STVHLAG

SSSPLHT SSTHVAS SSTVVHP SSVSLHT STAS HP STHPLGG STHVVLS STL HVG STSPHGG STVHLAP

SSSPVHA SSTHVGA SSVAGHP SSVTAHG STASVHS STHPLGS STHVVVA STL HVP STSPHGS STVHLAS

SSSPVHT SSTHVGP SSVAGHT SSVTAHP STAVGHG STHPLVA STHVVVP STL HVS STSPHLA STVHLGA

SSSSAHP SSTHVLA SSVAHGP SSVTAHS STA GHP STHPLVG STIGSNP STL VHA STSPHLG STVHLGG

SSSSAHT SSTHVLG SSVAHGT SSVTGHA STAVGHS STHPLVS STLAGHG STL VHG STSPHLS STVHLGP

SSSSHAP SSTHVLP SSVAHLG SSVTGHP STAVHGG STHPVAG STLAGHP STL VHP STSPHVA STVHLGS

SSSSHAT SSTHVLS SSVAHLP SSVTHAG STAVHGP STHPVAS STLAGHS STL WHS STSPHVG STVHLVA

SSSSHLA SSTHVVA SSVAHLS SSVTHAP STAVHGS STHPVGA STLAHGG STSAGHG STSPHVS STVHLVG

SSSSHLP SSTHVVP SSVAHLT SSVTHAS STAVHLG STHPVGG STLAHGP STSAGHP STSPLHA STVHL P

SSSSHLT SSTLAHG SSVAHVP SSVTHGA STAVHLP STHPVGS STLAHGS STSAGHS STSPLHG STVHLVS

SSSSLHA SSTLAHP SSVAHVT SSVTHGP STAVHLS STHPVLA STLAHVG STSAHGG STSPLHS STVHVAG

SSSSLHP SSTLAHS SSVALHG SSVTHLA STAVHVG STHPVLG STLAHVP STSAHGP STSPVHA STVHVAP

SSSSLHT SSTLGHA SSVALHP SSVTHLG STAVHVP STHPVLS STLAHVS STSAHGS STSPVHG STVHVAS

SSSTAHG SSTLGHG SSVALHS SSVTHLP STAVHVS STHPVVA STLAVHG STSAHLG STSPVHS STVHVGA

SSSTAHP SSTLGHP SSVALHT SSVTHLS STAVLHG STHPVVG STLAVHP STSAHLP STSSAHG STVHVGP

SSSTAHS SSTLGHS SSVAVHP SSVTHVA STAVLHP STHPVVS STLAVHS STSAHLS STSSAHP STVHVLA

SSSTGHA SSTLHAG SSVAVHT SSVTHVP STAVLHS STHSAGG STLHAGG STSAHVG STSSAHS STVHVLG

SSSTGHP SSTLHAP SSVGISV SSVTLHA STAVVHG STHSAGP STLHAGP STSAHVP STSSGHA STVHVLP

SSSTHAG SSTLHAS SSVHAGP SSVTLHG STAVVHP STHSAGS STLHAGS STSAHVS STSSGHP STVHVLS

SSSTHAP SSTLHGA SSVHAGT SSVTLHP STAVVHS STHSALG STLHAVG STSALHG STSSHAG STVHVVA

SSSTHAS SSTLHGG SSVHALG SSVTLHS STGDNSV STHSALP STLHAVP STSALHP STSSHAP STVHVVP

SSSTHGA SSTLHGP SSVHALP SSVTVHA STGDSSV STHSALS STLHAVS STSALHS STSSHAS STVLAHG

SSSTHGP SSTLHGS SSVHALS SSVTVHP STGGLSV STHSAVG STLHGAG STSAVHG STSSHGA STVLAHP

SSSTHLA SSTLHVA SSVHALT SSVVAHP STGGSSV STHSAVP STLHGAP STSAVHP STSSHGP STVLAHS

SSSTHLG SSTLHVG SSVHAVP SSVVAHT STGWHSQ STHSAVS STLHGAS STSAVHS STSSHLA STVLGHA

SSSTHLP SSTLHVP SSVHAVT SSVVHAP STHAGGG STHSGAG STLHGGA STSHAGG STSSHLG STVLGHG

SSSTHLS SSTLHVS SSVHGAP SSVVHAT STHAGGP STHSGAP STLHGGG STSHAGP STSSHLP STVLGHP

SSSTHVA SSTLVHA SSVHGAT SSVVHLA STHAGGS STHSGAS STLHGGP STSHAGS STSSHLS STVLGHS

SSSTHVP SSTLVHG SSVHGLA SSVVHLP STHAGLG STHSGGA STLHGGS STSHALG STSSHVA STVLHAG

SSSTLHA SSTL HP SSVHGLP SSVVHLT STHAGLP STHSGGP STLHGVA STSHALP STSSHVP STVLHAP

SSSTLHG SSTLVHS SSVHGLT SSVVLHA STHAGLS STHSGLA STLHGVG STSHALS STSSLHA STVLHAS

SSSTLHP SSTPAHG SSVHLAG SSVVLHP STHAG G STHSGLG STLHGVP STSHAVG STSSLHG STVLHGA

SSSTLHS SSTPAHS SSVHLAP SSVVLHT STHAG P STHSGLP STLHGVS STSHAVP STSSLHP STVLHGG

SSSTVHA SSTPGHA SSVHLAS STAHGGG STHAG S STHSGLS STLHVAG STSHAVS STSSLHS STVLHGP

SSSTVHP SSTPGHG SSVHLAT STAHGGP STHALGG STHSGVA STLHVAP STSHGAG STSSVHA STVLHGS

SSSVAHP SSTPGHS SSVHLGA STAHGGS STHALGP STHSGVP STLHVAS STSHGAP STSSVHP STVLHVA

SSSVAHT SSTPHAG SSVHLGP STAHGLG STHALGS STHSLAG STLHVGA STSHGAS STSVAHG STVLHVG

SSSVHAP SSTPHAS SSVHLGT STAHGLP STHALVG STHSLAP STLHVGG STSHGGA STSVAHP STVLHVP

SSSVHAT SSTPHGA SSVHLVA STAHGLS STHAL P STHSLAS STLHVGP STSHGGP STSVAHS STVLHVS

SSSVHLA SSTPHGG SSVHL P STAHGVG STHALVS STHSLGA STLHVGS STSHGLA STSVGHA STVLVHA

SSSVHLP SSTPHGS SSVHLVT STAHGVP STHAVGG STHSLGG STLHVVA STSHGLG STSVGHP STVLVHG

SSSVHLT SSTPHLA SSVHVAP STAHGVS STHAVGP STHSLGP STLHVVG STSHGLP STSVHAG STVL HP

SSSVLHA SSTPHLG SSVHVAT STAHLGG STHAVGS STHSLGS STLHVVP STSHGLS STSVHAP STVLVHS

SSSVLHP SSTPHLS SSVHVLA STAHLGP STHAVLG STHSLVA STLHVVS STSHGVA STSVHAS STVPAHG

SSSVLHT SSTPHVA SSVHVLP STAHLGS STHAVLP STHSLVG STLPAHG STSHGVP STSVHGA STVPAHS

SSTAGHG SSTPHVG SSVHVLT STAHLVG STHAVLS STHSLVP STLPAHS STSHLAG STSVHGP STVPGHA

SSTAGHP SSTPHVS SSVLAHG STAHL P STHAVVG STHSLVS STLPGHA STSHLAP STSVHLA STVPGHG

SSTAGHS SSTPLHA SSVLAHP STAHLVS STHAVVP STHSVAG STLPGHG STSHLAS STSVHLG STVPGHS

SSTAHGG SSTPLHG SSVLAHS STAHVGG STHAVVS STHSVAP STLPGHS STSHLGA STSVHLP STVPHAG

SSTAHGP SSTPLHS SSVLAHT STAHVGP STHLAGG STHSVAS STLPHAG STSHLGG STSVHLS STVPHAS

SSTAHGS SSTPVHA SSVLGHA STAHVGS STHLAGP STHSVGA STLPHAS STSHLGP STSVHVA STVPHGA

SSTAHLG SSTPVHG SSVLGHP STAHVLG STHLAGS STHSVGP STLPHGA STSHLGS STSVHVP STVPHGG

SSTAHLP SSTPVHS SSVLGHT STAHVLP STHLA G STHSVLA STLPHGG STSHLVA STSVLHA STVPHGS

SSTAHLS SSTQWSH SSVLHAG STAHVLS STHLAVP STHSVLG STLPHGS STSHLVG STSVLHG STVPHLA

SSTAHVG SSTSAHG SSVLHAP STAHVVG STHLAVS STHSVLP STLPHVA STSHLVP STSVLHP STVPHLG

SSTAHVP SSTSAHP SSVLHAS STAHVVP STHLGAG STHSVLS STLPHVG STSHLVS STSVLHS STVPHLS

SSTAHVS SSTSAHS SSVLHAT STAHVVS STHLGAP STHSVVA STLPHVS STSHVAG STSVVHA STVPHVA

SSTALHG SSTSGHA SSVLHGA STALGHG STHLGAS STHSVVP STLPVHA STSHVAP STSVVHP STVPHVG STVPHVS SVGGSSP TEGGSSL TVAGPSV TVTGSSF VAHTGLG VALTHVS VASTGHS VATSVHS VAVTHGP

STVPLHA SVGGSSQ TEGPESL TVAGSSV TVTGSSV VAHTGLP VALTVHG VASTHGG VATVGHG VAVTHGS

STVPLHG SVGGSSV TEGSSTF TVAGTSV TVTQWSV VAHTGLS VALTVHP VASTHGP VATVGHP VAVTHLG

STVPLHS SVGGSSW TEIGSSV TVANSSV TVTWSQV VAHTGVG VALTVHS VASTHGS VATVGHS VAVTHLP

STVPVHA SVGGSSY TELGGSV TVDGDSQ TVVESSD VAHTGVP VALVGHG VASTHLG VATVHGG VAVTHLS

STVPVHG SVGGSTV TENGSSV TVDGFNE TVVGSSK VAHTGVS VALVGHP VASTHLP VATVHGP VAVTHVG

STVPVHS SVGGSYH TFDTSSP TVDMSSA TVVGWYV VAHTLGG VALVGHS VASTHLS VATVHGS VAVTHVP

STVSAHG SVGGSYV TFEGSAV TVDVSSG TVVGYSA VAHTLGP VALVGHT VASTHVG VATVHLG VAVTHVS

STVSAHP SVGGTSV TFGALSY TVEGHHR TVVIPDV VAHTLGS VALVHGG VASTHVP VATVHLP VAVTLHG

STVSAHS SVGGVSS TFGGLIV TVEISAV TVVRSSL VAHTLVG VALVHGP VASTHVS VATVHLS VAVTLHP

STVSGHA SVGGYSV TFGMSFP TVEKTQY TVWESSV VAHTLVP VALVHGS VASTLHG VATVHVG VAVTLHS

STVSGHP SVGHSSY TFGRSEV TVERSYV TVWFSDP VAHTLVS VALVHGT VASTLHP VATVHVP VAVTVHG

STVSHAG SVGHVSV TFGYSSI TVFFSSF TVWFSSV VAHTVGG VALVHVG VASTLHS VATVHVS VAVTVHP

STVSHAP SVGIESV TFIGISV TVGAKSM TVWGHYV VAHTVGP VALVHVP VASTVHG VATVLHG VAVTVHS

STVSHAS SVGIFNV TGEGDSY TVGDHAV TVWGLMV VAHTVGS VALVHVS VASTVHP VATVLHP VAVVGHP

STVSHGA SVGISSV TGGGSSG TVGES V TVWGSHV VAHTVLG VALVHVT VASTVHS VATVLHS VAVVGHT

STVSHGP SVGKEQV TGGGSSV TVGEYSK TVWMRSV VAHTVLP VALVVHG VASVGHP VATVVHG VAVVHGP

STVSHLA SVGKSAD TGGGVSF TVGFRSV TVYMSKV VAHTVLS VALVVHP VASVGHT VATVVHP VAVVHGT

STVSHLG SVGKSSV TGGNTSL TVGFSSV TVYNWSI VAHTVVG VALVVHS VASVHGP VATVVHS VAVVHLG

STVSHLP SVGKSTL TGGVSHT TVGGAGQ TVYYSYV VAHTVVP VALVVHT VASVHGT VAVHGGP VAVVHLP

STVSHLS SVGKSYV TGIGSSV TVGGASV TWGGQVV VAHTVVS VASGISN VASVHLG VAVHGGT VAVVHLS

STVSHVA SVGLHSE TGYGSGN TVGGESR TWSGQSE VAHVGGP VASHGGP VASVHLP VAVHGLG VAVVHLT

STVSHVP SVGLWSQ THFYTGV TVGGESV TWSGSSM VAHVGGT VASHGGT VASVHLS VAVHGLP VAVVHVP

STVSLHA SVGMSSA THGGHST TVGGFSV TYANSSV VAHVGLG VASHGLG VASVHLT VAVHGLS VAVVHVT

STVSLHG SVGNPHV THGGWSW TVGGGSV TYEGSSV VAHVGLP VASHGLP VASVHVP VAVHGLT VAVVLHG

STVSLHP SVG SSF THGIHSV TVGGGVV TYGGPNV VAHVGLS VASHGLS VASVHVT VAVHGVP VAVVLHP

STVSLHS SVGQGPR THGLSSW TVGGNSN TYMGWLV VAHVGLT VASHGLT VASVLHG VAVHGVT VAVVLHS

STVSVHA SVGRHSV THGMVSV TVGGPSV VAGGGIV VAHVGVP VASHGVP VASVLHP VAVHLGG VAVVLHT

STVS HP SVGRVSN THGWSSG TVGGQFM VAGGSQV VAHVGVT VASHGVT VASVLHS VAVHLGP VAVVVHP

STVVAHG SVGSVSV THQITYV TVGGQSV VAGGTSS VAHVLGG VASHLGG VASVLHT VAVHLGS VAVVVHT

STVVAHP SVGVSHV THSGSSE TVGGQYD VAHLGGG VAHVLGP VASHLGP VASVVHP VAVHLGT VAYGGSV

STVVAHS SVGWSMV TIGASSV TVGGRQI VAHLGGP VAHVLGS VASHLGS VASVVHT VAVHLVG VDEGASV

ST VGHA SVGYISV TIGGSLV TVGGRSV VAHLGGS VAHVLGT VASHLGT VATHGGG VAVHLVP VDGGRSQ

STVVGHP SVHGSTI TIG RSI V TVGGSDG VAHLGGT VAHVLVG VASHLVG VATHGGP VAVHLVS VDGGSSV

STVVHAG SVHGSYT TILGSST TVGGSDP VAHLGVG VAHVLVP VASHLVP VATHGGS VAVHLVT VDGLSSV

STVVHAP SVHHQSG TILGSSV TVGGSDV VAHLGVP VAHVLVS VASHLVS VATHGLG VAVHVGP VDGRRSV

STVVHAS SVHKSSH TKGGSFV TVGGSGL VAHLGVS VAHVLVT VASHLVT VATHGLP VAVHVGT VDLGKSM

STVVHGA SVHMSSV TKGGSHV TVGGSHV VAHLGVT VAHVVGP VASHVGP VATHGLS VAVHVLG VEATEHV

STVVHGP SVHRSSV TKGGSSF TVGGSLM VAHLVGG VAHVVGT VASHVGT VATHGVG VAVHVLP VEGGQLV

ST VHLA SVIGRHN TKGGSSV TVGGSSN VAHLVGP VAHVVLG VASHVLG VATHGVP VAVHVLS VEGGSQV

ST VHLG SVIGWSV TKGYSSV TVGGSSV VAHLVGS VAHVVLP VASHVLP VATHGVS VAVHVLT VEGGSVV

STVVHLP SVIGYSE TLGGSLN TVGGSSW VAHLVGT VAHVVLS VASHVLS VATHLGG VAVHVVP VEGIDSM

ST VHLS SVINFSH TLGGSSV TVGGSTV VAHLVVG VAHVVLT VASHVLT VATHLGP VAVHVVT VEITGSV

STVVHVA SVIYNNH TLGMYSD TVGGSYP VAHLVVP VAHVVVP VASHVVP VATHLGS VAVLGHG VELHSSV

STVVHVP SVLAHSI TLPISIV TVGGVPY VAHLVVS VAHVVVT VASHVVT VATHLVG VAVLGHP VENWSQV

STVVLHA SVLGSSV TLSGFSV TVGGYMV VAHLVVT VALHGGG VASLGHG VATHLVP VAVLGHS VFGGISE

STVVLHG SVLGWSV TLSLSSV TVGGYTV VAHPGGG VALHGGP VASLGHP VATHLVS VAVLGHT VFGGSLV

STVVLHP SVLGYSG TMAGSSA TVGHKLV VAHPGGS VALHGGS VASLGHS VATHVGG VAVLHGG VFGGSSD

STVVLHS SVLLSFV TMDGYYV TVGHYNV VAHPGGT VALHGGT VASLGHT VATHVGP VAVLHGP VFGGSSN

STVVVHA SVLTQSP TMGASST TVGISSK VAHPGLG VALHGVG VASLHGG VATHVGS VAVLHGS VFGGTAV

STVVVHP SVMGSHD TMGESSV TVGISSN VAHPGLS VALHGVP VASLHGP VATHVLG VAVLHGT VFGWIKT

STYQG L SVMGWSV TMGGAFD TVGIWST VAHPGLT VALHGVS VASLHGS VATHVLP VAVLHVG VGAHGGP

SVAGSSV SVMRSSV TMGGNSI TVGKEKV VAHPGVG VALHGVT VASLHGT VATHVLS VAVLHVP VGAHGGT

SVAISLV SVNGEFR TMGGSSV TVGKPSA VAHPGVS VALHVGG VASLHVG VATHVVG VAVLHVS VGAHGLG

SVARQVV SVNGGKV TMTEHSG TVGLSAI VAHPGVT VALHVGP VASLHVP VATHVVP VAVLHVT VGAHGLP

SVASSSL SVNGSSV TMYGSSV TVGLSIV VAHPLGG VALHVGS VASLHVS VATHVVS VAVLVHG VGAHGLS

SVDKYMV SVNKISR TNAGSTV TVGMSIE VAHPLGS VALHVGT VASLHVT VATLGHG VAVLVHP VGAHGLT

SVDMSSP SV LILV TNGEESY TVGMSIN VAHPLGT VALHVVG VASLVHG VATLGHP VAVLVHS VGAHGVP

SVDVDPV SVNLSSL TNGGKSF TVGNIHS VAHPLVG VALHVVP VASLVHP VATLGHS VAVLVHT VGAHGVT

SVEGFSV SVNRSEQ TNGGSSF TVG SQV VAHPLVS VALHVVS VASLVHS VATLHGG VAVPGHG VGAHLGG

SVEGRHV SVPASSD TNGQANV TVGPSSY VAHPLVT VALHVVT VASLVHT VATLHGP VAVPGHS VGAHLGP

SVEVIIF SVPWHSV TNGQSDM TVGQSPP VAHPVGG VALPGHG VASPGHG VATLHGS VAVPGHT VGAHLGS

SVFAWSV SVQGPIV TPAGWSV TVGQSSE VAHPVGS VALPGHS VASPGHS VATLHVG VAVPHGG VGAHLGT

SVFGSED SVQHSSV TPGGHSY TVGRSHV VAHPVGT VALPGHT VASPGHT VATLHVP VAVPHGS VGAHLVG

SVFGSSD SVQWSYT TPGGNDI TVGSESV VAHPVLG VALPHGG VASPHGG VATLHVS VAVPHGT VGAHLVP

SVGAKSY SVSGQPD TPGGSSI TVGSSIV VAHPVLS VALPHGS VASPHGS VATLVHG VAVPHLG VGAHLVS

SVGASSF SVSPSSV TPGGSSV TVGSSVT VAHPVLT VALPHGT VASPHGT VATLVHP VAVPHLS VGAHLVT

SVGAS Y SVTDSSV TPSGSSV TVGTDKV VAHPVVG VALPHVG VASPHLG VATLVHS VAVPHLT VGAHVGP

SVGAWFV SVTGSYA TPVESMG TVGTSDN VAHPVVS VALPHVS VASPHLS VATPGHG VAVPHVG VGAHVGT

SVGDSQL SVTWKKT TQEASSR TVGWKYV VAHPVVT VALPHVT VASPHLT VATPGHS VAVPHVS VGAHVLG

SVGENSQ SVVGPSI TQGGESV TVGYFMV VAHSGGP VALPVHG VASPHVG VATPHGG VAVPHVT VGAHVLP

SVGESSE SVVGSSD TQGMSLV TVGYSHI VAHSGGT VALPVHS VASPHVS VATPHGS VAVPLHG VGAHVLS

SVG ESS V SVVLSSV TQHGNSR TVHG SW VAHSGLG VALPVHT VASPHVT VATPHLG VAVPLHS VGAHVLT

SVGFSSV SVVVSSS TQHGSQV TVHGSGV VAHSGLP VALSGHG VASPLHG VATPHLS VAVPLHT VGAHVVP

SVGFSTV SVWGSLV TQLFTSF TVHGSVV VAHSGLS VALSGHP VASPLHS VATPHVG VAVPVHG VGAHVVT

SVGGASI SVWHSTV TQMTNSP TVHGWSV VAHSGLT VALSGHS VASPLHT VATPHVS VAVPVHS VGALGHG

SVGGDSI SVWYYGT TQPGYAI TVHISPI VAHSGVP VALSGHT VASPVHG VATPLHG VAVPVHT VGALGHP

SVGGDSV SVYDSSW TRAGDTW TVIYYSY VAHSGVT VALSHGG VASPVHS VATPLHS VAVSGHP VGALGHS

SVGGETN SVYGSSR TRGASTF TVKGESK VAHSLGG VALSHGP VASPVHT VATPVHG VAVSGHT VGALGHT

SVGGFSP SVYHSSF TRGGGSV TVMGKYV VAHSLGP VALSHGS VASSGHP VATPVHS VAVSHGP VGALHGG

SVGGFSV SWDDPSQ TRGKSSW TVMGSSV VAHSLGS VALSHGT VASSGHT VATSGHG VAVSHGT VGALHGP

SVGGLSV SWGGGFV TRGRSSV TVMGVSV VAHSLGT VALSHVG VASSHGP VATSGHP VAVSHLG VGALHGS

SVGGNSY SWGSSSF TRLGSTF TVMHLSV VAHSLVG VALSHVP VASSHGT VATSGHS VAVSHLP VGALHGT

SVGGPAI SYGGEPA TRTEQSG TVMHSSV VAHSLVP VALSHVS VASSHLG VATSHGG VAVSHLS VGALHVG

SVGGPSR SYGGLSV TRWGSKV TVMISSI VAHSLVS VALSHVT VASSHLP VATSHGP VAVSHLT VGALHVP

SVGGPSV SYGNSMV TSDGNSG TVNGQSH VAHSLVT VALSVHG VASSHLS VATSHGS VAVSHVP VGALHVS

SVGGQPM SYPGSPV TSGGEVV TVNGSHV VAHSVGP VALSVHP VASSHLT VATSHLG VAVSHVT VGALHVT

SVGGQSS TAGGSKD TSGMGVA TVPGDSD VAHSVGT VALSVHS VASSHVP VATSHLP VAVSLHG VGALVHG

SVGGSAV TAGGSSV TSGWSDA TVPGESM VAHSVLG VALSVHT VASSHVT VATSHLS VAVSLHP VGALVHP

SVGGSGV TAGRSST TSTADVN TVQGETY VAHSVLP VALTGHG VASSLHG VATSHVG VAVSLHS VGALVHS

SVGGSKE TAHGASW TSVQSFW TVQGKDK VAHSVLS VALTGHP VASSLHP VATSHVP VAVSLHT VGALVHT

SVGGSMK TAIGYSV TTGGSHR TVQPRSG VAHSVLT VALTGHS VASSLHS VATSHVS VAVSVHP VGAPGHG

SVGGSND TDGGVSV TTGGSQV TVQVGVS VAHSVVP VALTHGG VASSLHT VATSLHG VAVSVHT VGAPGHS

SVGGSSF TDGKAYV TTGISSL TVQWSMV VAHSVVT VALTHGP VASSVHP VATSLHP VAVTGHG VGAPGHT

SVGGSSG TDGWNSH TTGKSDV TVSGWIV VAHTGGG VALTHGS VASSVHT VATSLHS VAVTGHP VGAPHGG

SVGGSSH TEAGSTH TTGTHSW TVSGWLV VAHTGGP VALTHVG VASTGHG VATSVHG VAVTGHS VGAPHGS

SVGGSSI TEGGKSV TTIKSSF TVSVLSV VAHTGGS VALTHVP VASTGHP VATSVHP VAVTHGG VGAPHGT VGAPHLG VGHLGAG VGHTAVP VGLHGVT VGSAGHT VGSTAHS VGTLGHS VGVAVHT VGVTLHA VHATVGS

VGAPHLS VGHLGAP VGHTAVS VGLHVAG VGSAHGP VGSTGHA VGTLHAG VGVHAGP VGVTLHG VHATVLG

VGAPHLT VGHLGAS VGHTGAG VGLHVAP VGSAHGT VGSTGHP VGTLHAP VGVHAGT VGVTLHP VHATVLP

VGAPHVG VGHLGAT VGHTGAP VGLHVAS VGSAHLG VGSTHAG VGTLHAS VGVHALG VGVTLHS VHATVLS

VGAPHVS VGHLGGA VGHTGAS VGLHVAT VGSAHLP VGSTHAP VGTLHGA VGVHALP VGVTVHA VHATVVG

VGAPHVT VGHLGGP VGHTGGA VGLHVGA VGSAHLS VGSTHAS VGTLHGG VGVHALS VGVTVHP VHATVVP

VGAPLHG VGHLGGT VGHTGGP VGLHVGP VGSAHLT VGSTHGA VGTLHGP VGVHALT VGVVAHP VHATVVS

VGAPLHS VGHLGVA VGHTGLA VGLHVGT VGSAHVP VGSTHGP VGTLHGS VGVHAVP VGVVAHT VHAVGGP

VGAPLHT VGHLGVP VGHTGLG VGLHVVA VGSAHVT VGSTHLA VGTLHVA VGVHAVT VGVVHAP VHAVGGT

VGAPVHG VGHLGVT VGHTGLP VGLHVVP VGSALHG VGSTHLG VGTLHVG VGVHGAP VGVVHAT VHAVGLG

VGAPVHS VGHLVAG VGHTGLS VGLHVVT VGSALHP VGSTHLP VGTLHVP VGVHGAT VGVVHLA VHAVGLP

VGAPVHT VGHLVAP VGHTGVA VGLPAHG VGSALHS VGSTHLS VGTLHVS VGVHGLA VGVVHLP VHAVGLS

VGASGHP VGHLVAS VGHTGVP VGLPAHS VGSALHT VGSTHVA VGTLVHA VGVHGLP VGVVHLT VHAVGLT

VGASGHT VGHLVAT VGHTLAG VGLPAHT VGSAVHP VGSTHVP VGTLVHG VGVHGLT VGVVLHA VHAVGVP

VGASHGP VGHLVGA VGHTLAP VGLPGHA VGSAVHT VGSTLHA VGTLVHP VGVHLAG VGVVLHP VHAVGVT

VGASHGT VGHLVGP VGHTLAS VGLPGHG VGSHAGP VGSTLHG VGTLVHS VGVHLAP VGVVLHT VHAVLGG

VGASHLG VGHLVGT VGHTLGA VGLPGHS VGSHAGT VGSTLHP VGTPAHG VGVHLAS VHALGGG VHAVLGP

VGASHLP VGHLVVA VGHTLGG VGLPGHT VGSHALG VGSTLHS VGTPAHS VGVHLAT VHALGGP VHAVLGS

VGASHLS VGHLVVP VGHTLGP VGLPHAG VGSHALP VGSTVHA VGTPGHA VGVHLGA VHALGGS VHAVLGT

VGASHLT VGHLVVT VGHTLGS VGLPHAS VGSHALS VGSTVHP VGTPGHG VGVHLGP VHALGGT VHAVLVG

VGASHVP VGHPAGG VGHTLVA VGLPHAT VGSHALT VGSVAHP VGTPGHS VGVHLGT VHALGVG VHAVLVP

VGASHVT VGHPAGS VGHTLVG VGLPHGA VGSHAVP VGSVAHT VGTPHAG VGVHLVA VHALGVP VHAVLVS

VGASLHG VGHPAGT VGHTLVP VGLPHGG VGSHAVT VGSVHAP VGTPHAS VGVHLVP VHALGVS VHAVLVT

VGASLHP VGHPALG VGHTLVS VGLPHGS VGSHGAP VGSVHAT VGTPHGA VGVHLVT VHALGVT VHAVVGP

VGASLHS VGHPALS VGHTVAG VGLPHGT VGSHGAT VGSVHLA VGTPHGG VGVHVAP VHALVGG VHAVVGT

VGASLHT VGHPALT VGHTVAP VGLPHVA VGSHGLA VGSVHLP VGTPHGS VGVHVAT VHALVGP VHAVVLG

VGAS HP VGHPAVG VGHTVAS VGLPHVG VGSHGLP VGSVHLT VGTPHLA VGVHVLA VHALVGS VHAVVLP

VGASVHT VGHPAVS VGHTVGA VGLPHVS VGSHGLT VGSVLHA VGTPHLG VGVHVLP VHALVGT VHAVVLS

VGATGHG VGHPAVT VGHTVGP VGLPHVT VGSHLAG VGSVLHP VGTPHLS VGVHVLT VHALVVG VHAVVLT

VGATGHP VGHPGAG VGHTVLA VGLPVHA VGSHLAP VGSVLHT VGTPHVA VGVLAHG VHALVVP VHAVVVP

VGATGHS VGHPGAS VGHTVLG VGLPVHG VGSHLAS VGTAGHG VGTPHVG VGVLAHP VHALVVS VHAVVVT

VGATHGG VGHPGAT VGHTVLP VGLPVHS VGSHLAT VGTAGHP VGTPHVS VGVLAHS VHALVVT VHLAGGG

VGATHGP VGHPGGA VGHTVLS VGLPVHT VGSHLGA VGTAGHS VGTPLHA VGVLAHT VHAPGGG VHLAGGP

VGATHGS VGHPGGT VGHTVVA VGLSAHG VGSHLGP VGTAHGG VGTPLHG VGVLGHA VHAPGGS VHLAGGS

VGATHLG VGHPGLA VGHTVVP VGLSAHP VGSHLGT VGTAHGP VGTPLHS VGVLGHP VHAPGGT VHLAGGT

VGATHLP VGHPGLG VGHVAGP VGLSAHS VGSHLVA VGTAHGS VGTPVHA VGVLGHT VHAPGLG VHLAGVG

VGATHLS VGHPGLS VGHVAGT VGLSAHT VGSHLVP VGTAHLG VGTPVHG VGVLHAG VHAPGLS VHLAGVP

VGATHVG VGHPGLT VGHVALG VGLSGHA VGSHLVT VGTAHLP VGTPVHS VGVLHAP VHAPGLT VHLAGVS

VGATHVP VGHPGVA VGHVALP VGLSGHP VGSHVAP VGTAHLS VGTSAHG VGVLHAS VHAPGVG VHLAGVT

VGATHVS VGHPGVT VGHVALS VGLSGHT VGSHVAT VGTAHVG VGTSAHP VGVLHAT VHAPGVS VHLAVGG

VGATLHG VGHPLAG VGHVALT VGLSHAG VGSHVLA VGTAHVP VGTSAHS VGVLHGA VHAPGVT VHLAVGP

VGATLHP VGHPLAS VGHVAVP VGLSHAP VGSHVLP VGTAHVS VGTSGHA VGVLHGP VHAPLGG VHLAVGS

VGATLHS VGHPLAT VGHVAVT VGLSHAS VGSHVLT VGTALHG VGTSGHP VGVLHGT VHAPLGS VHLAVGT

VGATVHG VGHPLGA VGHVGAP VGLSHAT VGSLAHG VGTALHP VGTSHAG VGVLHVA VHAPLGT VHLAVVG

VGATVHP VGHPLGG VGHVGAT VGLSHGA VGSLAHP VGTALHS VGTSHAP VGVLHVP VHAPLVG VHLAVVP

VGATVHS VGHPLGS VGHVGLA VGLSHGP VGSLAHS VGTAVHG VGTSHAS VGVLHVT VHAPLVS VHLAVVS

VGAVGHP VGHPLGT VGHVGLP VGLSHGT VGSLAHT VGTAVHP VGTSHGA VGVLVHA VHAPLVT VHLAVVT

VGAVGHT VGHPLVA VGHVGLT VGLSHVA VGSLGHA VGTAVHS VGTSHGP VGVLVHP VHAPVGG VHLPAGG

VGAVHGP VGHPLVG VGHVLAG VGLSHVP VGSLGHP VGTGSSS VGTSHLA VGVLVHT VHAPVGS VHLPAGS

VGAVHGT VGHPLVS VGHVLAP VGLSHVT VGSLGHT VGTHAGG VGTSHLG VGVPAHG VHAPVGT VHLPAGT

VGAVHLG VGHPLVT VGHVLAS VGLSVHA VGSLHAG VGTHAGP VGTSHLP VGVPAHS VHAPVLG VHLPAVG

VGAVHLP VGHPVAG VGHVLAT VGLSVHP VGSLHAP VGTHAGS VGTSHLS VGVPAHT VHAPVLS VHLPAVS

VGAVHLS VGHPVAS VGHVLGA VGLSVHT VGSLHAS VGTHALG VGTSHVA VGVPGHA VHAPVLT VHLPAVT

VGAVHLT VGHPVAT VGHVLGP VGLTAHG VGSLHAT VGTHALP VGTSHVP VGVPGHT VHAPVVG VHLPGAG

VGAVHVP VGHPVGA VGHVLGT VGLTAHP VGSLHGA VGTHALS VGTSLHA VGVPHAG VHAPVVS VHLPGAS

VGAVHVT VGHPVGT VGHVLVA VGLTAHS VGSLHGP VGTHAVG VGTSLHG VGVPHAS VHAPVVT VHLPGAT

VGAVLHG VGHPVLA VGHVLVP VGLTGHA VGSLHGT VGTHAVP VGTSLHP VGVPHAT VHASGGP VHLPGGA

VGAVLHP VGHPVLG VGHVLVT VGLTGHG VGSLHVA VGTHAVS VGTSLHS VGVPHGA VHASGGT VHLPGGG

VGAVLHS VGHPVLS VGHVVAP VGLTGHP VGSLHVP VGTHGAG VGTSVHA VGVPHGT VHASGLG VHLPGGS

VGAVLHT VGHPVLT VGHVVAT VGLTGHS VGSLHVT VGTHGAP VGTSVHP VGVPHLA VHASGLP VHLPGGT

VGA VHP VGHPVVA VGHVVLA VGLTHAG VGSLVHA VGTHGAS VGTVAHG VGVPHLG VHASGLS VHLPGVA

VGA VHT VGHPVVT VGHVVLP VGLTHAP VGSLVHP VGTHGGA VGTVAHP VGVPHLS VHASGLT VHLPGVG

VGGGSMV VGHSAGP VGHVVLT VGLTHAS VGSLVHT VGTHGGP VGTVAHS VGVPHLT VHASGVP VHLPGVS

VGGGSSV VGHSAGT VGIMYQV VGLTHGA VGSPAHG VGTHGLA VGTVGHA VGVPHVA VHASGVT VHLPGVT

VGGRWAL VGHSALG VGLAGHG VGLTHGG VGSPAHS VGTHGLG VGTVGHP VGVPHVT VHASLGG VHLPVAG

VGHAGGP VGHSALP VGLAGHP VGLTHGP VGSPAHT VGTHGLP VGTVHAG VGVPLHA VHASLGP VHLPVAS

VGHAGGT VGHSALS VGLAGHS VGLTHGS VGSPGHA VGTHGLS VGTVHAP VGVPLHG VHASLGS VHLPVAT

VGHAGLG VGHSALT VGLAGHT VGLTHVA VGSPGHT VGTHGVA VGTVHAS VGVPLHS VHASLGT VHLPVGA

VGHAGLP VGHSAVP VGLAHGG VGLTHVG VGSPHAG VGTHGVP VGTVHGA VGVPLHT VHASLVG VHLPVGG

VGHAGLS VGHSAVT VGLAHGP VGLTHVP VGSPHAS VGTHLAG VGTVHGP VGVPVHA VHASLVP VHLPVGS

VGHAGLT VGHSGAP VGLAHGS VGLTHVS VGSPHAT VGTHLAP VGTVHLA VGVPVHT VHASLVS VHLPVGT

VGHAGVP VGHSGAT VGLAHGT VGLTVHA VGSPHGA VGTHLAS VGTVHLG VGVSAHP VHASLVT VHLPVVA

VGHAGVT VGHSGLA VGLAHVG VGLTVHG VGSPHGT VGTHLGA VGTVHLP VGVSAHT VHASVGP VHLPVVG

VGHALGG VGHSGLP VGLAHVP VGLTVHP VGSPHLA VGTHLGG VGTVHLS VGVSHAP VHASVGT VHLPVVS

VGHALGP VGHSGLT VGLAHVS VGLTVHS VGSPHLG VGTHLGP VGTVHVA VGVSHAT VHASVLG VHLPVVT

VGHALGS VGHSLAG VGLAHVT VGLVAHG VGSPHLS VGTHLGS VGTVHVP VGVSHLA VHASVLP VHLSAGG

VGHALGT VGHSLAP VGLAVHG VGLVAHP VGSPHLT VGTHLVA VGTVLHA VGVSHLP VHASVLS VHLSAGP

VGHALVG VGHSLAS VGLAVHP VGLVAHS VGSPHVA VGTHLVG VGTVLHG VGVSHLT VHASVLT VHLSAGS

VGHALVP VGHSLAT VGLAVHS VGLVAHT VGSPHVT VGTHLVP VGTVLHP VGVSLHA VHASVVP VHLSAGT

VGHALVS VGHSLGA VGLAVHT VGLVGHA VGSPLHA VGTHLVS VGTVLHS VGVSLHP VHASVVT VHLSAVG

VGHALVT VGHSLGP VGLHAGG VGLVGHP VGSPLHG VGTHVAG VGTVVHA VGVSLHT VHATGGG VHLSAVP

VGHAVGP VGHSLGT VGLHAGP VGLVGHT VGSPLHS VGTHVAP VGTVVHP VGVTAHG VHATGGP VHLSAVS

VGHAVGT VGHSLVA VGLHAGS VGLVHAG VGSPLHT VGTHVAS VGVAGHP VGVTAHP VHATGGS VHLSAVT

VGHAVLG VGHSLVP VGLHAGT VGLVHAP VGSPVHA VGTHVGA VGVAGHT VGVTAHS VHATGLG VHLSGAG

VGHAVLP VGHSLVT VGLHAVG VGLVHAS VGSPVHT VGTHVGP VGVAHGP VGVTGHA VHATGLP VHLSGAP

VGHAVLS VGHSVAP VGLHAVP VGLVHAT VGSSAHP VGTHVLA VGVAHGT VGVTGHP VHATGLS VHLSGAS

VGHAVLT VGHSVAT VGLHAVS VGLVHGA VGSSAHT VGTHVLG VGVAHLG VGVTHAG VHATGVG VHLSGAT

VGHAVVP VGHSVLA VGLHAVT VGLVHGP VGSSHAP VGTHVLP VGVAHLP VGVTHAP VHATGVP VHLSGGA

VGHAVVT VGHSVLP VGLHGAG VGLVHGT VGSSHAT VGTHVLS VGVAHLS VGVTHAS VHATGVS VHLSGGP

VGHLAGG VGHSVLT VGLHGAP VGLVHVA VGSSHLA VGTHVVA VGVAHLT VGVTHGA VHATLGG VHLSGGT

VGHLAGP VGHTAGG VGLHGAS VGLVHVP VGSSHLP VGTHVVP VGVAHVP VGVTHGP VHATLGP VHLSGVA

VGHLAGS VGHTAGP VGLHGAT VGLVHVT VGSSHLT VGTLAHG VGVAHVT VGVTHLA VHATLGS VHLSGVP

VGHLAGT VGHTAGS VGLHGGA VGLVVHA VGSSLHA VGTLAHP VGVALHG VGVTHLG VHATLVG VHLSGVT

VGHLAVG VGHTALG VGLHGGP VGLVVHP VGSSLHP VGTLAHS VGVALHP VGVTHLP VHATLVP VHLSVAG

VGHLAVP VGHTALP VGLHGGT VGLVVHT VGSSLHT VGTLGHA VGVALHS VGVTHLS VHATLVS VHLSVAP

VGHLAVS VGHTALS VGLHGVA VG KSSV VGSTAHG VGTLGHG VGVALHT VGVTHVA VHATVGG VHLSVAS

VGHLAVT VGHTAVG VGLHGVP VGSAGHP VGSTAHP VGTLGHP VGVAVHP VGVTHVP VHATVGP VHLSVAT VHLSVGA VHSLGAT VHSTGAP VHTLGVA VHTVALP VHVPAVS VHVTVGA VSAHVGT VSHAGLG VSHSALT

VHLSVGP VHSLGGA VHSTGAS VHTLGVG VHTVALS VHVPAVT VHVTVGP VSAHVLG VSHAGLP VSHSAVP

VHLSVGT VHSLGGP VHSTGGA VHTLGVP VHTVAVG VHVPGAG VHVTVLA VSAHVLP VSHAGLS VSHSAVT

VHLSVVA VHSLGGT VHSTGGP VHTLGVS VHTVAVP VHVPGAS VHVTVLG VSAHVLS VSHAGLT VSHSGAP

VHLSVVP VHSLGVA VHSTGLA VHTLVAG VHTVAVS VHVPGAT VHVTVLP VSAHVLT VSHAGVP VSHSGAT

VHLSVVT VHSLGVP VHSTGLG VHTLVAP VHTVGAG VHVPGGA VHVTVLS VSAHVVP VSHAGVT VSHSGLA

VHLTAGG VHSLGVT VHSTGLP VHTLVAS VHTVGAP VHVPGGT VHVTVVA VSAHVVT VSHALGG VSHSGLP

VHLTAGP VHSLVAG VHSTGLS VHTL GA VHTVGAS VHVPGLA VHVTVVP VSALGHG VSHALGP VSHSGLT

VHLTAGS VHSLVAP VHSTGVA VHTLVGG VHTVGGA VHVPGLG VHVVAGP VSALGHP VSHALGS VSHSLAG

VHLTA G VHSLVAS VHSTGVP VHTLVGP VHTVGGP VHVPGLS VHVVAGT VSALGHS VSHALGT VSHSLAP

VHLTAVP VHSLVAT VHSTLAG VHTLVGS VHTVGLA VHVPGLT VHVVALG VSALGHT VSHALVG VSHSLAS

VHLTA S VHSLVGA VHSTLAP VHTLVVA VHTVGLG VHVPGVA VHVVALP VSALHGG VSHALVP VSHSLAT

VHLTGAG VHSLVGP VHSTLAS VHTLVVG VHTVGLP VHVPGVT VHVVALS VSALHGP VSHALVS VSHSLGA

VHLTGAP VHSLVGT VHSTLGA VHTLVVP VHTVGLS VHVPLAG VHVVALT VSALHGS VSHALVT VSHSLGP

VHLTGAS VHSLVVA VHSTLGG VHTLVVS VHTVGVA VHVPLAS VHVVAVP VSALHGT VSHAVGP VSHSLGT

VHLTGGA VHSLVVP VHSTLGP VHTPAGG VHTVGVP VHVPLAT VHVVAVT VSALHVG VSHAVGT VSHSLVA

VHLTGGG VHSLVVT VHSTLGS VHTPAGS VHTVLAG VHVPLGA VHVVGAP VSALHVP VSHAVLG VSHSLVP

VHLTGGP VHSPAGG VHSTLVA VHTPALG VHTVLAP VHVPLGG VHVVGAT VSALHVS VSHAVLP VSHSLVT

VHLTGGS VHSPAGS VHSTLVG VHTPALS VHTVLAS VHVPLGS VHVVGLA VSALHVT VSHAVLS VSHSVAP

VHLTGVA VHSPAGT VHSTL P VHTPAVG VHTVLGA VHVPLGT VHVVGLP VSALVHG VSHAVLT VSHSVAT

VHLTGVG VHSPALG VHSTLVS VHTPAVS VHTVLGG VHVPLVA VHVVGLT VSALVHP VSHAVVP VSHSVLA

VHLTGVP VHSPALS VHSTVAG VHTPGAG VHTVLGP VHVPLVG VHVVLAG VSALVHS VSHAVVT VSHSVLP

VHLTGVS VHSPALT VHSTVAP VHTPGAS VHTVLGS VHVPLVS VHVVLAP VSALVHT VSHLAGG VSHSVLT

VHLTVAG VHSPAVG VHSTVAS VHTPGGA VHTVLVA VHVPLVT VHVVLAS VSAPGHG VSHLAGP VSHTAGG

VHLTVAP VHSPAVS VHSTVGA VHTPGGG VHTVLVG VHVPVAG VHVVLAT VSAPGHS VSHLAGS VSHTAGP

VHLTVAS VHSPAVT VHSTVGP VHTPGGS VHTVL P VHVPVAS VHVVLGA VSAPGHT VSHLAGT VSHTAGS

VHLTVGA VHSPGAG VHSTVLA VHTPGLA VHTVLVS VHVPVAT VHVVLGP VSAPHGG VSHLAVG VSHTALG

VHLTVGG VHSPGAS VHSTVLG VHTPGLG VHTVVAG VHVPVGA VHVVLGT VSAPHGS VSHLAVP VSHTALP

VHLTVGP VHSPGAT VHSTVLP VHTPGLS VHTVVAP VHVPVGT VHVVLVA VSAPHGT VSHLAVS VSHTALS

VHLTVGS VHSPGGA VHSTVLS VHTPGVA VHTVVAS VHVPVLA VHVVL P VSAPHLG VSHLAVT VSHTAVG

VHLTVVA VHSPGGT VHSTVVA VHTPGVG VHTVVGA VHVPVLG VHVVLVT VSAPHLS VSHLGAG VSHTAVP

VHLTVVG VHSPGLA VHSTVVP VHTPGVS VHTVVGP VHVPVLS VHVVVAP VSAPHLT VSHLGAP VSHTAVS

VHLTVVP VHSPGLG VHSVAGP VHTPLAG VHTVVLA VHVPVLT VHVVVAT VSAPHVG VSHLGAS VSHTGAG

VHLTVVS VHSPGLS VHSVAGT VHTPLAS VHTVVLG VHVPVVA VHVVVLA VSAPHVS VSHLGAT VSHTGAP

VHLVAGG VHSPGLT VHSVALG VHTPLGA VHTVVLP VHVPVVT VHVVVLP VSAPHVT VSHLGGA VSHTGAS

VHLVAGP VHSPGVA VHSVALP VHTPLGG VHTVVLS VHVSAGP VHVVVLT VSAPLHG VSHLGGP VSHTGGA

VHLVAGS VHSPGVT VHSVALS VHTPLGS VHTVVVA VHVSAGT VIEGYSV VSAPLHS VSHLGGT VSHTGGP

VHLVAGT VHSPLAG VHSVALT VHTPLVA VHTVVVP VHVSALG VIFGGSL VSAPLHT VSHLGVA VSHTGLA

VHLVAVG VHSPLAS VHSVAVP VHTPLVG VHVAGGP VHVSALP VIGGSSF VSAPVHG VSHLGVP VSHTGLG

VHLVAVP VHSPLAT VHSVAVT VHTPLVS VHVAGGT VHVSALS VIGGSSM VSAPVHS VSHLGVT VSHTGLP

VHLVAVS VHSPLGA VHSVGAP VHTPVAG VHVAGLG VHVSALT VIGGSSN VSAPVHT VSHLVAG VSHTGLS

VHLVAVT VHSPLGG VHSVGAT VHTPVAS VHVAGLP VHVSAVP VIGPSSV VSASGHP VSHLVAP VSHTGVA

VHLVGAG VHSPLGS VHSVGLA VHTPVGA VHVAGLS VHVSAVT VIGRSSV VSASGHT VSHLVAS VSHTGVP

VHLVGAP VHSPLGT VHSVGLP VHTPVGG VHVAGLT VHVSGAP VKGPPTV VSASHGP VSHLVAT VSHTLAG

VHLVGAS VHSPLVA VHSVGLT VHTPVGS VHVAGVP VHVSGAT VKGYSSH VSASHGT VSHLVGA VSHTLAP

VHLVGAT VHSPLVG VHSVLAG VHTPVLA VHVAGVT VHVSGLA VKLGSSD VSASHLG VSHLVGP VSHTLAS

VHLVGGA VHSPLVS VHSVLAP VHTPVLG VHVALGG VHVSGLP VKQQSQV VSASHLP VSHLVGT VSHTLGA

VHLVGGP VHSPLVT VHSVLAS VHTPVLS VHVALGP VHVSGLT VKVGSSI VSASHLS VSHLVVA VSHTLGG

VHLVGGT VHSPVAG VHSVLAT VHTPVVA VHVALGS VHVSLAG VKWGSSG VSASHLT VSHLVVP VSHTLGP

VHLVGVA VHSPVAS VHSVLGA VHTPVVG VHVALGT VHVSLAP VLGFQKQ VSASHVP VSHLVVT VSHTLGS

VHLVGVP VHSPVAT VHSVLGP VHTPVVS VHVALVG VHVSLAS VLGGSKV VSASHVT VSHPAGG VSHTLVA

VHLVGVT VHSPVGA VHSVLGT VHTSAGG VHVALVP VHVSLAT VLGGSSV VSASLHG VSHPAGS VSHTLVG

VHLVVAG VHSPVGT VHSVLVA VHTSAGP VHVALVS VHVSLGA VLGISST VSASLHP VSHPAGT VSHTLVP

VHL VAP VHSPVLA VHSVL P VHTSAGS VHVALVT VHVSLGP VLGMSNV VSASLHS VSHPALG VSHTLVS

VHLVVAS VHSPVLG VHSVLVT VHTSALG VHVAVGP VHVSLGT VMGASFV VSASLHT VSHPALS VSHTVAG

VHL VAT VHSPVLS VHSVVAP VHTSALP VHVAVGT VHVSLVA VMGGISV VSASVHP VSHPALT VSHTVAP

VHLVVGA VHSPVLT VHSVVAT VHTSALS VHVAVLG VHVSLVP VMGGKGV VSASVHT VSHPAVG VSHTVAS

VHLVVGP VHSPVVA VHSVVLA VHTSAVG VHVAVLP VHVSLVT VMGGSSF VSATGHG VSHPAVS VSHTVGA

VHLVVGT VHSPVVT VHSVVLP VHTSAVP VHVAVLS VHVSVAP VMGLSSV VSATGHP VSHPAVT VSHTVGP

VHLVVVA VHSSAGP VHSVVLT VHTSAVS VHVAVLT VHVSVAT VMRV PI VSATGHS VSHPGAG VSHTVLA

VHLVVVP VHSSAGT VHTAGGG VHTSGAG VHVAVVP VHVSVLA V GFTSV VSATHGG VSHPGAS VSHTVLG

VHLVVVT VHSSALG VHTAGGP VHTSGAP VHVAVVT VHVSVLP VNGGSSV VSATHGP VSHPGAT VSHTVLP

VHSAGGP VHSSALP VHTAGGS VHTSGAS VHVLAGG VHVSVLT VNGKVSV VSATHGS VSHPGGA VSHTVLS

VHSAGGT VHSSALS VHTAGLG VHTSGGA VHVLAGP VHVTAGG VPGLSSV VSATHLG VSHPGGT VSHTVVA

VHSAGLG VHSSALT VHTAGLP VHTSGGP VHVLAGS VHVTAGP VPNNSSF VSATHLP VSHPGLA VSHTVVP

VHSAGLP VHSSAVP VHTAGLS VHTSGLA VHVLAGT VHVTAGS VPPNSQW VSATHLS VSHPGLG VSHVAGP

VHSAGLS VHSSAVT VHTAGVG VHTSGLG VHVLAVG VHVTALG VPVPVSV VSATHVG VSHPGLS VSHVAGT

VHSAGLT VHSSGAP VHTAGVP VHTSGLP VHVLA P VHVTALP VQGGFSV VSATHVP VSHPGLT VSHVALG

VHSAGVP VHSSGAT VHTAGVS VHTSGLS VHVLAVS VHVTALS VQGGYSV VSATHVS VSHPGVA VSHVALP

VHSAGVT VHSSGLA VHTALGG VHTSGVA VHVLAVT VHVTAVG VQG ST VSATLHG VSHPGVT VSHVALS

VHSALGG VHSSGLP VHTALGP VHTSGVP VHVLGAG VHVTAVP VQNGSSV VSATLHP VSHPLAG VSHVALT

VHSALGP VHSSGLT VHTALGS VHTSLAG VHVLGAP VHVTAVS VQSRSSM VSATLHS VSHPLAS VSHVAVP

VHSALGS VHSSLAG VHTALVG VHTSLAP VHVLGAS VHVTGAG VQSTSSR VSATVHG VSHPLAT VSHVAVT

VHSALGT VHSSLAP VHTALVP VHTSLAS VHVLGAT VHVTGAP VQVGVSP VSATVHP VSHPLGA VSHVGAP

VHSALVG VHSSLAS VHTALVS VHTSLGA VHVLGGA VHVTGAS VQWGSSV VSATVHS VSHPLGG VSHVGAT

VHSALVP VHSSLAT VHTAVGG VHTSLGG VHVLGGP VHVTGGA VRGGSDW VSAVGHP VSHPLGS VSHVGLA

VHSALVS VHSSLGA VHTAVGP VHTSLGP VHVLGGT VHVTGGP VRGPHSV VSAVGHT VSHPLGT VSHVGLP

VHSALVT VHSSLGP VHTAVGS VHTSLGS VHVLGVA VHVTGLA VRGPSSA VSAVHGP VSHPLVA VSHVGLT

VHSAVGP VHSSLGT VHTAVLG VHTSLVA VHVLGVP VHVTGLG VRMGILV VSAVHGT VSHPLVG VSHVLAG

VHSAVGT VHSSLVA VHTAVLP VHTSLVG VHVLGVT VHVTGLP VRNMSSV VSAVHLG VSHPLVS VSHVLAP

VHSAVLG VHSSLVP VHTAVLS VHTSLVP VHVLVAG VHVTGLS VSAHGGP VSAVHLP VSHPLVT VSHVLAS

VHSAVLP VHSSLVT VHTAVVG VHTSLVS VHVLVAP VHVTGVA VSAHGGT VSAVHLS VSHPVAG VSHVLAT

VHSAVLS VHSSVAP VHTAVVP VHTSVAG VHVLVAS VHVTGVP VSAHGLG VSAVHLT VSHPVAS VSHVLGA

VHSAVLT VHSSVAT VHTAVVS VHTSVAP VHVLVAT VHVTLAG VSAHGLP VSAVHVP VSHPVAT VSHVLGP

VHSAVVP VHSSVLA VHTLAGG VHTSVAS VHVL GA VHVTLAP VSAHGLS VSAVHVT VSHPVGA VSHVLGT

VHSAVVT VHSSVLP VHTLAGP VHTSVGA VHVLVGP VHVTLAS VSAHGLT VSAVLHG VSHPVGT VSHVLVA

VHSLAGG VHSSVLT VHTLAGS VHTSVGP VHVLVGT VHVTLGA VSAHGVP VSAVLHP VSHPVLA VSHVLVP

VHSLAGP VHSTAGG VHTLAVG VHTSVLA VHVLVVA VHVTLGG VSAHGVT VSAVLHS VSHPVLG VSHVLVT

VHSLAGS VHSTAGP VHTLA P VHTSVLG VHVLVVP VHVTLGP VSAHLGG VSAVLHT VSHPVLS VSHVVAP

VHSLAGT VHSTAGS VHTLAVS VHTSVLP VHVLVVT VHVTLGS VSAHLGP VSAVVHP VSHPVLT VSHVVAT

VHSLAVG VHSTALG VHTLGAG VHTSVLS VHVPAGG VHVTLVA VSAHLGS VSAVVHT VSHPVVA VSHVVLA

VHSLA P VHSTALP VHTLGAP VHTSVVA VHVPAGS VHVTLVG VSAHLGT VSDGSSV VSHPVVT VSHVVLP

VHSLAVS VHSTALS VHTLGAS VHTSVVP VHVPAGT VHVTL P VSAHLVG VSEGSSV VSHSAGP VSHVVLT

VHSLAVT VHSTAVG VHTLGGA VHTVAGG VHVPALG VHVTLVS VSAHLVP VSGGRSV VSHSAGT VSIFDMA

VHSLGAG VHSTAVP VHTLGGG VHTVAGP VHVPALS VHVTVAG VSAHLVS VSGGSMK VSHSALG VSLAGHG

VHSLGAP VHSTAVS VHTLGGP VHTVAGS VHVPALT VHVTVAP VSAHLVT VSHAGGP VSHSALP VSLAGHP

VHSLGAS VHSTGAG VHTLGGS VHTVALG VHVPAVG VHVTVAS VSAHVGP VSHAGGT VSHSALS VSLAGHS VSLAGHT VSLTHVA VSSPGHT VSTHGVP VSTVHGA VSVPLHT VTASHGP VTHPGAG VTHVLGP VTLVAHS

VSLAHGG VSLTHVG VSSPHAG VSTHLAG VSTVHGP VSVPVHA VTASHGS VTHPGAS VTHVLGS VTLVGHA

VSLAHGP VSLTHVP VSSPHAS VSTHLAP VSTVHLA VSVPVHT VTASHLG VTHPGGA VTHVLVA VTLVGHG

VSLAHGS VSLTHVS VSSPHAT VSTHLAS VSTVHLG VSVSAHP VTASHLP VTHPGGG VTHVLVG VTLVGHP

VSLAHGT VSLTVHA VSSPHGA VSTHLGA VSTVHLP VSVSAHT VTASHLS VTHPGGS VTHVLVP VTLVGHS

VSLAHVG VSLTVHG VSSPHGT VSTHLGG VSTVHLS VSVSHAP VTASHVG VTHPGLA VTHVLVS VTLVHAG

VSLAHVP VSLTVHP VSSPHLA VSTHLGP VSTVHVA VSVSHAT VTASHVP VTHPGLG VTHVVAG VTLVHAP

VSLAHVS VSLTVHS VSSPHLG VSTHLGS VSTVHVP VSVSHLA VTASHVS VTHPGLS VTHVVAP VTLVHAS

VSLAHVT VSLVAHG VSSPHLS VSTHLVA VSTVLHA VSVSHLP VTASLHG VTHPGVA VTHVVAS VTLVHGA

VSLAVHG VSLVAHP VSSPHLT VSTHLVG VSTVLHG VSVSHLT VTASLHP VTHPGVG VTHVVGA VTLVHGG

VSLA HP VSLVAHS VSSPHVA VSTHLVP VSTVLHP VSVSLHA VTASLHS VTHPGVS VTHVVGP VTLVHGP

VSLAVHS VSLVAHT VSSPHVT VSTHLVS VSTVLHS VSVSLHP VTASVHG VTHPLAG VTHVVLA VTLVHGS

VSLAVHT VSLVGHA VSSPLHA VSTHVAG VSTVVHA VSVSLHT VTASVHP VTHPLAS VTHVVLG VTLVHVA

VSLHAGG VSLVGHP VSSPLHG VSTHVAP VSTVVHP VSVTAHG VTASVHS VTHPLGA VTHVVLP VTLVHVG

VSLHAGP VSLVGHT VSSPLHS VSTHVAS VSVAGHP VSVTAHP VTAVGHG VTHPLGG VTHVVLS VTLVHVP

VSLHAGS VSLVHAG VSSPLHT VSTHVGA VSVAGHT VSVTAHS VTAVGHP VTHPLGS VTHVVVA VTLVHVS

VSLHAGT VSLVHAP VSSPVHA VSTHVGP VSVAHGP VSVTGHA VTAVGHS VTHPLVA VTHVVVP VTLVVHA

VSLHAVG VSLVHAS VSSPVHT VSTHVLA VSVAHGT VSVTGHP VTAVHGG VTHPLVG VTLAGHG VTLVVHG

VSLHA P VSLVHAT VSSSAHP VSTHVLG VSVAHLG VSVTHAG VTAVHGP VTHPLVS VTLAGHP VTLVVHP

VSLHAVS VSLVHGA VSSSAHT VSTHVLP VSVAHLP VSVTHAP VTAVHGS VTHPVAG VTLAGHS VTLVVHS

VSLHAVT VSLVHGP VSSSHAP VSTHVLS VSVAHLS VSVTHAS VTAVHLG VTHPVAS VTLAHGG VTSAGHG

VSLHGAG VSLVHGT VSSSHAT VSTHVVA VSVAHLT VSVTHGA VTAVHLP VTHPVGA VTLAHGP VTSAGHP

VSLHGAP VSLVHVA VSSSHLA VSTHVVP VSVAHVP VSVTHGP VTAVHLS VTHPVGG VTLAHGS VTSAGHS

VSLHGAS VSLVHVP VSSSHLP VSTLAHG VSVAHVT VSVTHLA VTAVHVG VTHPVGS VTLAHVG VTSAHGG

VSLHGAT VSLVHVT VSSSHLT VSTLAHP VSVALHG VSVTHLG VTAVHVP VTHPVLA VTLAHVP VTSAHGP

VSLHGGA VSLVVHA VSSSLHA VSTLAHS VSVALHP VSVTHLP VTAVHVS VTHPVLG VTLAHVS VTSAHGS

VSLHGGP VSLVVHP VSSSLHP VSTLGHA VSVALHS VSVTHLS VTAVLHG VTHPVLS VTLAVHG VTSAHLG

VSLHGGT VSLVVHT VSSSLHT VSTLGHG VSVALHT VSVTHVA VTAVLHP VTHPVVA VTLAVHP VTSAHLP

VSLHGVA VSQGSQV VSSTAHG VSTLGHP VSVAVHP VSVTHVP VTAVLHS VTHPVVG VTLAVHS VTSAHLS

VSLHGVP VSSAGHP VSSTAHP VSTLGHS VSVAVHT VSVTLHA VTAVVHG VTHPVVS VTLHAGG VTSAHVG

VSLHGVT VSSAGHT VSSTAHS VSTLHAG VSVHAGP VSVTLHG VTAVVHP VTHSAGG VTLHAGP VTSAHVP

VSLHVAG VSSAHGP VSSTGHA VSTLHAP VSVHAGT VSVTLHP VTAVVHS VTHSAGP VTLHAGS VTSAHVS

VSLHVAP VSSAHGT VSSTGHP VSTLHAS VSVHALG VSVTLHS VTENSMF VTHSAGS VTLHAVG VTSALHG

VSLHVAS VSSAHLG VSSTHAG VSTLHGA VSVHALP VSVTVHA VTGASFV VTHSALG VTLHAVP VTSALHP

VSLHVAT VSSAHLP VSSTHAP VSTLHGG VSVHALS VSVTVHP VTGGGPF VTHSALP VTLHAVS VTSALHS

VSLHVGA VSSAHLS VSSTHAS VSTLHGP VSVHALT VSVVAHP VTGGMNV VTHSALS VTLHGAG VTSAVHG

VSLHVGP VSSAHLT VSSTHGA VSTLHGS VSVHAVP VSVVAHT VTGGSEQ VTHSAVG VTLHGAP VTSAVHP

VSLHVGT VSSAHVP VSSTHGP VSTLHVA VSVHAVT VSVVHAP VTGGVDV VTHSAVP VTLHGAS VTSAVHS

VSLHVVA VSSAHVT VSSTHLA VSTLHVG VSVHGAP VSVVHAT VTGRSSV VTHSAVS VTLHGGA VTSHAGG

VSLHVVP VSSALHG VSSTHLG VSTLHVP VSVHGAT VSVVHLA VTHAGGG VTHSGAG VTLHGGG VTSHAGP

VSLHVVT VSSALHP VSSTHLP VSTLHVS VSVHGLA VSVVHLP VTHAGGP VTHSGAP VTLHGGP VTSHAGS

VSLPAHG VSSALHS VSSTHLS VSTLVHA VSVHGLP VSVVHLT VTHAGGS VTHSGAS VTLHGGS VTSHALG

VSLPAHS VSSALHT VSSTHVA VSTLVHG VSVHGLT VSVVLHA VTHAGLG VTHSGGA VTLHGVA VTSHALP

VSLPAHT VSSAVHP VSSTHVP VSTLVHP VSVHLAG VSVVLHP VTHAGLP VTHSGGP VTLHGVG VTSHALS

VSLPGHA VSSAVHT VSSTLHA VSTLVHS VSVHLAP VSVVLHT VTHAGLS VTHSGLA VTLHGVP VTSHAVG

VSLPGHG VSSHAGP VSSTLHG VSTPAHG VSVHLAS VTAHGGG VTHAGVG VTHSGLG VTLHGVS VTSHAVP

VSLPGHS VSSHAGT VSSTLHP VSTPAHS VSVHLAT VTAHGGP VTHAGVP VTHSGLP VTLHVAG VTSHAVS

VSLPGHT VSSHALG VSSTLHS VSTPGHA VSVHLGA VTAHGGS VTHAGVS VTHSGLS VTLHVAP VTSHGAG

VSLPHAG VSSHALP VSSTVHA VSTPGHG VSVHLGP VTAHGLG VTHALGG VTHSGVA VTLHVAS VTSHGAP

VSLPHAS VSSHALS VSSTVHP VSTPGHS VSVHLGT VTAHGLP VTHALGP VTHSGVP VTLHVGA VTSHGAS

VSLPHAT VSSHALT VSSVAHP VSTPHAG VSVHLVA VTAHGLS VTHALGS VTHSLAG VTLHVGG VTSHGGA

VSLPHGA VSSHAVP VSSVAHT VSTPHAS VSVHLVP VTAHGVG VTHALVG VTHSLAP VTLHVGP VTSHGGP

VSLPHGG VSSHAVT VSSVHAP VSTPHGA VSVHLVT VTAHGVP VTHALVP VTHSLAS VTLHVGS VTSHGLA

VSLPHGS VSSHGAP VSSVHAT VSTPHGG VSVHVAP VTAHGVS VTHALVS VTHSLGA VTLHVVA VTSHGLG

VSLPHGT VSSHGAT VSSVHLA VSTPHGS VSVHVAT VTAHLGG VTHAVGG VTHSLGG VTLHVVG VTSHGLP

VSLPHVA VSSHGLA VSSVHLP VSTPHLA VSVHVLA VTAHLGP VTHAVGP VTHSLGP VTLHVVP VTSHGLS

VSLPHVG VSSHGLP VSSVHLT VSTPHLG VSVHVLP VTAHLGS VTHAVGS VTHSLGS VTLHVVS VTSHGVA

VSLPHVS VSSHGLT VSSVLHA VSTPHLS VSVHVLT VTAHLVG VTHAVLG VTHSLVA VTLPAHG VTSHGVP

VSLPHVT VSSHLAG VSSVLHP VSTPHVA VSVLAHG VTAHLVP VTHAVLP VTHSLVG VTLPAHS VTSHLAG

VSLPVHA VSSHLAP VSSVLHT VSTPHVG VSVLAHP VTAHLVS VTHAVLS VTHSLVP VTLPGHA VTSHLAP

VSLPVHG VSSHLAS VSTAGHG VSTPHVS VSVLAHS VTAHVGG VTHAVVG VTHSLVS VTLPGHG VTSHLAS

VSLPVHS VSSHLAT VSTAGHP VSTPLHA VSVLAHT VTAHVGP VTHAVVP VTHSVAG VTLPGHS VTSHLGA

VSLPVHT VSSHLGA VSTAGHS VSTPLHG VSVLGHA VTAHVGS VTHAVVS VTHSVAP VTLPHAG VTSHLGG

VSLSAHG VSSHLGP VSTAHGG VSTPLHS VSVLGHP VTAHVLG VTHLAGG VTHSVAS VTLPHAS VTSHLGP

VSLSAHP VSSHLGT VSTAHGP VSTPVHA VSVLGHT VTAHVLP VTHLAGP VTHSVGA VTLPHGA VTSHLGS

VSLSAHS VSSHLVA VSTAHGS VSTPVHG VSVLHAG VTAHVLS VTHLAGS VTHSVGP VTLPHGG VTSHLVA

VSLSAHT VSSHLVP VSTAHLG VSTPVHS VSVLHAP VTAHVVG VTHLAVG VTHSVLA VTLPHGS VTSHLVG

VSLSGHA VSSHLVT VSTAHLP VSTSAHG VSVLHAS VTAHVVP VTHLAVP VTHSVLG VTLPHVA VTSHLVP

VSLSGHP VSSHVAP VSTAHLS VSTSAHP VSVLHAT VTAHVVS VTHLAVS VTHSVLP VTLPHVG VTSHLVS

VSLSGHT VSSHVAT VSTAHVG VSTSAHS VSVLHGA VTALGHG VTHLGAG VTHSVLS VTLPHVS VTSHVAG

VSLSHAG VSSHVLA VSTAHVP VSTSGHA VSVLHGP VTALGHP VTHLGAP VTHSVVA VTLPVHA VTSHVAP

VSLSHAP VSSHVLP VSTAHVS VSTSGHP VSVLHGT VTALGHS VTHLGAS VTHSVVP VTLPVHG VTSHVAS

VSLSHAS VSSHVLT VSTALHG VSTSHAG VSVLHVA VTALHGG VTHLGGA VTHVAGG VTLPVHS VTSHVGA

VSLSHAT VSSLAHG VSTALHP VSTSHAP VSVLHVP VTALHGP VTHLGGG VTHVAGP VTLSAHG VTSHVGP

VSLSHGA VSSLAHP VSTALHS VSTSHAS VSVLHVT VTALHGS VTHLGGP VTHVAGS VTLSAHP VTSHVLA

VSLSHGP VSSLAHS VSTAVHG VSTSHGA VSVLVHA VTALHVG VTHLGGS VTHVALG VTLSAHS VTSHVLG

VSLSHGT VSSLAHT VSTAVHP VSTSHGP VSVLVHP VTALHVP VTHLGVA VTHVALP VTLSGHA VTSHVLP

VSLSHVA VSSLGHA VSTAVHS VSTSHLA VSVLVHT VTALHVS VTHLGVG VTHVALS VTLSGHG VTSHVLS

VSLSHVP VSSLGHP VSTHAGG VSTSHLG VSVPAHG VTALVHG VTHLGVP VTHVAVG VTLSGHP VTSHVVA

VSLSHVT VSSLGHT VSTHAGP VSTSHLP VSVPAHS VTALVHP VTHLGVS VTHVAVP VTLSGHS VTSHVVP

VSLSVHA VSSLHAG VSTHAGS VSTSHLS VSVPAHT VTALVHS VTHLVAG VTHVAVS VTLSHAG VTSLAHG

VSLS HP VSSLHAP VSTHALG VSTSHVA VSVPGHA VTAPGHG VTHLVAP VTHVGAG VTLSHAP VTSLAHP

VSLSVHT VSSLHAS VSTHALP VSTSHVP VSVPGHT VTAPGHS VTHLVAS VTHVGAP VTLSHAS VTSLAHS

VSLTAHG VSSLHAT VSTHALS VSTSLHA VSVPHAG VTAPHGG VTHLVGA VTHVGAS VTLSHGA VTSLGHA

VSLTAHP VSSLHGA VSTHAVG VSTSLHG VSVPHAS VTAPHGS VTHLVGG VTHVGGA VTLSHGG VTSLGHG

VSLTAHS VSSLHGP VSTHAVP VSTSLHP VSVPHAT VTAPHLG VTHLVGP VTHVGGP VTLSHGP VTSLGHP

VSLTGHA VSSLHGT VSTHAVS VSTSLHS VSVPHGA VTAPHLS VTHLVGS VTHVGLA VTLSHGS VTSLGHS

VSLTGHG VSSLHVA VSTHGAG VSTSVHA VSVPHGT VTAPHVG VTHLVVA VTHVGLG VTLSHVA VTSLHAG

VSLTGHP VSSLHVP VSTHGAP VSTSVHP VSVPHLA VTAPHVS VTHLVVG VTHVGLP VTLSHVG VTSLHAP

VSLTGHS VSSLHVT VSTHGAS VSTVAHG VSVPHLG VTAPLHG VTHLVVP VTHVGLS VTLSHVP VTSLHAS

VSLTHAG VSSLVHA VSTHGGA VSTVAHP VSVPHLS VTAPLHS VTHLVVS VTHVGVA VTLSHVS VTSLHGA

VSLTHAP VSSLVHP VSTHGGP VSTVAHS VSVPHLT VTAPVHG VTHPAGG VTHVGVP VTLSVHA VTSLHGG

VSLTHAS VSSLVHT VSTHGLA VSTVGHA VSVPHVA VTAPVHS VTHPAGS VTHVLAG VTLSVHG VTSLHGP

VSLTHGA VSSPAHG VSTHGLG VSTVGHP VSVPHVT VTASGHG VTHPALG VTHVLAP VTLSVHP VTSLHGS

VSLTHGG VSSPAHS VSTHGLP VSTVHAG VSVPLHA VTASGHP VTHPALS VTHVLAS VTLSVHS VTSLHVA

VSLTHGP VSSPAHT VSTHGLS VSTVHAP VSVPLHG VTASGHS VTHPAVG VTHVLGA VTLVAHG VTSLHVG

VSLTHGS VSSPGHA VSTHGVA VSTVHAS VSVPLHS VTASHGG VTHPAVS VTHVLGG VTLVAHP VTSLHVP VTSLHVS VTVHAVS VTVSLHS VVGSSQV WEAGTSF WEAPTQF WEASSSL WEATYL WEGNTNF WEGQTF

VTSLVHA VTVHGAG VTVSVHA VVGSSYP WEAGTSI WEAPTQI WEASSSV WEATYV WEGNTNI WEGQTI

VTSLVHG VTVHGAP VTVSVHP VVGSVMF WEAGTSL WEAPTQL WEASSTF WEAYNF WEGNTNL WEGQTL

VTSL HP VTVHGAS VTVVAHG VVGTSKS WEAGTSV WEAPTQV WEASSTI WEAYNI WEGNTNV WEGQTNF

VTSLVHS VTVHGGA VTVVAHP VVGTSSV WEAGTTF WEAPTSF WEASSTL WEAYNL WEGNTQF WEGQTNI

VTSPAHG VTVHGGP VTVVAHS VVG SG WEAGTTI WEAPTSI WEASSTV WEAYNV WEGNTQI WEGQTNL

VTSPAHS VTVHGLA VTVVGHA VVGWYSV WEAGTTL WEAPTSL WEASSV WEAYQF WEGNTQL WEGQTNV

VTSPGHA VTVHGLG VTVVGHP VVGYDFV WEAGTTV WEAPTSV WEASSYF WEAYQI WEG TQV WEGQTQF

VTSPGHG VTVHGLP VTVVHAG VVGYSSE WEAGTYF WEAPTTF WEASSYI WEAYQL WEGNTSF WEGQTQI

VTSPGHS VTVHGLS VTVVHAP VVGYSSV WEAGTYI WEAPTTI WEASSYL WEAYQV WEGNTSI WEGQTQL

VTSPHAG VTVHGVA VTVVHAS VVHFTPV WEAGTYL WEAPTTL WEASSYV WEAYSF WEGNTSL WEGQTQV

VTSPHAS VTVHG P VTVVHGA VVHGSSD WEAGTYV WEAPTTV WEASTF WEAYSI WEGNTSV WEGQTSF

VTSPHGA VTVHLAG VTVVHGP VVHGSSV WEANNF WEAPTYF WEASTI WEAYSL WEGNTTF WEGQTSI

VTSPHGG VTVHLAP VTVVHLA VVHWHSV WEANNI WEAPTYI WEASTL WEAYSV WEGNTTI WEGQTSL

VTSPHGS VTVHLAS VTV HLG VVIFPVV WEANNL WEAPTYL WEASTNF WEAYTF WEGNTTL WEGQTSV

VTSPHLA VTVHLGA VTVVHLP VVIGSYV WEANNV WEAPTYV WEASTNI WEAYTI WEGNTTV WEGQTTF

VTSPHLG VTVHLGG VTVVHLS VVKAAYV WEANQF WEAQNF WEASTNL WEAYTL WEGNTV WEGQTTI

VTSPHLS VTVHLGP VTVVHVA VVKASSH WEANQI WEAQNI WEASTNV WEAYTV WEGNTYF WEGQTTL

VTSPHVA VTVHLGS VTVVHVP VVLFSSV WEANQL WEAQ L WEASTQF WEAYYF WEGNTYI WEGQTTV

VTSPHVG VTVHLVA VTVVLHA VVLGRSR WEANQV WEAQNV WEASTQI WEAYYI WEGNTYL WEGQTV

VTSPHVS VTVHLVG VTVVLHG VVLGSFV WEANSF WEAQQF WEASTQL WEAYYL WEGNTYV WEGQTYF

VTSPLHA VTVHLVP VTVVLHP VVLGSSV WEANSI WEAQQI WEASTQV WEAYYV WEGNYF WEGQTYI

VTSPLHG VTVHLVS VTVVLHS VVMGSLV WEANSL WEAQQL WEASTSF WEGGSNF WEGNYI WEGQTYL

VTSPLHS VTVHVAG VTVVVHA VVMGSSV WEANSNF WEAQQV WEASTSI WEGGSNI WEGNYL WEGQTYV

VTSPVHA VTVHVAP VTVVVHP VVMVSSW WEANSNI WEAQSF WEASTSL WEGGSNL WEGNYV WEGQYF

VTSPVHG VTVHVAS VVAFFVV VVNRADV WEANSNL WEAQSI WEASTSV WEGGSNV WEGPSNF WEGQYI

VTSPVHS VTVHVGA VVAGEFV VVNYPSV WEANSNV WEAQSL WEASTTF WEGGSQF WEGPSNI WEGQYL

VTSSAHG VTVHVGP VVAGRSV VVPRSPV WEANSQF WEAQSNF WEASTTI WEGGSQI WEGPSNL WEGQYV

VTSSAHP VTVHVLA VVAKSNV VVPVLHA WEANSQI WEAQSNI WEASTTL WEGGSQL WEGPSNV WEGRSNV

VTSSAHS VTVHVLG VVASSSG VVQAQLV WEANSQL WEAQSNL WEASTTV WEGGSQV WEGPSQF WEGRSSD

VTSSGHA VTVHVLP VVDGSSV VVQGIQV WEANSQV WEAQSNV WEASTV WEGGSSF WEGPSQI WEGSNF

VTSSGHP VTVHVLS VVDSSNK VVQWSPV WEANSSF WEAQSQF WEASTYF WEGGSSI WEGPSQL WEGSNI

VTSSHAG VTVHVVA VVEDSSV VVRGQSK WEANSSI WEAQSQI WEASTYI WEGGSSL WEGPSQV WEGSNL

VTSSHAP VTVHVVP VVEGSSS VVSYSNT WEANSSL WEAQSQL WEASTYL WEGGSSV WEGPSSF WEGSNV

VTSSHAS VTVLAHG VVEGYSL VVTISFV WEANSSV WEAQSQV WEASTYV WEGGSTF WEGPSSI WEGSQF

VTSSHGA VTVLAHP VVFGLNV VVVASLR WEANSTF WEAQSSF WEASYF WEGGSTI WEGPSSL WEGSQI

VTSSHGP VTVLAHS VVFGVIV VVVGLSV WEANSTI WEAQSSI WEASYI WEGGSTL WEGPSSV WEGSQL

VTSSHLA VTVLGHA VVGAGSP VVVGSSH WEANSTL WEAQSSL WEASYL WEGGSTV WEGPSTF WEGSQV

VTSSHLG VTVLGHG VVGASSV VVVGSVV WEANSTV WEAQSSV WEASYV WEGGSYF WEGPSTI WEGSSF

VTSSHLP VTVLGHP VVGDSEM VVVLSHV WEANSV WEAQSTF WEATNF WEGGSYI WEGPSTL WEGSSI

VTSSHLS VTVLGHS VVGDSSW VVVRSHV WEANSYF WEAQSTI WEATNI WEGGSYL WEGPSTV WEGSSL

VTSSHVA VTVLHAG VVGEMKW VVWGPAY WEANSYI WEAQSTL WEATNL WEGGSYV WEGPSYF WEGSSNF

VTSSHVP VTVLHAP VVGEQSA VVWGSST WEANSYL WEAQSTV WEATNV WEGGTNF WEGPSYI WEGSSNI

VTSSLHA VTVLHAS VVGESSN VVYEQSS WEANSYV WEAQSV WEATQF WEGGTNI WEGPSYL WEGSSNL

VTSSLHG VTVLHGA VVGEVIV VVYGTSY WEANTF WEAQSYF WEATQI WEGGTNL WEGPSYV WEGSSNV

VTSSLHP VTVLHGG VVGFWEV VWDESEV WEANTI WEAQSYI WEATQL WEGGTNV WEGPTNF WEGSSQF

VTSSLHS VTVLHGP VVGGANV VWDGISV WEANTL WEAQSYL WEATQV WEGGTQF WEGPTNI WEGSSQI

VTSSVHA VTVLHGS VVGGASV VWGGSNY WEANTNF WEAQSYV WEATSF WEGGTQI WEGPTNL WEGSSQL

VTSS HP VTVLHVA VVGGDAV VWGLAFV WEANT I WEAQTF WEATSI WEGGTQL WEGPTNV WEGSSQV

VTSVAHG VTVLHVG VVGGDFM VWGTSHV WEANTNL WEAQTI WEATSL WEGGTQV WEGPTQF WEGSSSF

VTSVAHP VTVLHVP VVGGESV VWPGSSV WEANTNV WEAQTL WEATSNF WEGGTSF WEGPTQI WEGSSSI

VTSVAHS VTVLHVS VVGGGDV VWQAVEV WEANTQF WEAQTNF WEATSNI WEGGTSI WEGPTQL WEGSSSL

VTSVGHA VTVLVHA VVGGISV VYFPSQV WEANTQI WEAQTNI WEATSNL WEGGTSL WEGPTQV WEGSSSV

VTSVGHP VTVLVHG VVGGKEI VYGASAV WEANTQL WEAQT L WEATSNV WEGGTSV WEGPTSF WEGSSTF

VTSVHAG VTVLVHP VVGGMSD VYGGAFV WEANTQV WEAQTNV WEATSQF WEGGTTF WEGPTSI WEGSSTI

VTSVHAP VTVLVHS VVGGPSK VYGGESV WEANTSF WEAQTQF WEATSQI WEGGTTI WEGPTSL WEGSSTL

VTSVHAS VTVPAHG VVGGQSV VYGGKSD WEANTSI WEAQTQI WEATSQL WEGGTTL WEGPTSV WEGSSTV

VTSVHGA VTVPAHS VVGGRSV VYGWSSV WEANTSL WEAQTQL WEATSQV WEGGTTV WEGPTTF WEGSSV

VTSVHGP VTVPGHA VVGGSEV VYQYSSM WEANTSV WEAQTQV WEATSSF WEGGTYF WEGPTTI WEGSSYF

VTSVHLA VTVPGHG VVGGSFH VYVLSSK WEANTTF WEAQTSF WEATSSI WEGGTYI WEGPTTL WEGSSYI

VTSVHLG VTVPGHS VVGGSIV WADRDLV WEANTTI WEAQTSI WEATSSL WEGGTYL WEGPTTV WEGSSYL

VTSVHLP VTVPHAG VVGGSME WAGGSIV WEANTTL WEAQTSL WEATSSV WEGGTYV WEGPTYF WEGSSYV

VTSVHLS VTVPHAS VVGGSNV WAKGQGV WEANTTV WEAQTSV WEATSTF WEGNNF WEGPTYI WEGSTF

VTSVHVA VTVPHGA VVGGSNW WATMSMV WEANTV WEAQTTF WEATSTI WEGNNI WEGPTYL WEGSTI

VTSVHVP VTVPHGG VVGGSSE WDGGEHQ WEANTYF WEAQTTI WEATSTL WEGNNL WEGPTYV WEGSTL

VTSVLHA VTVPHGS VVGGSSL WDGGRSL WEANTYI WEAQTTL WEATSTV WEGNNV WEGQNF WEGSTNF

VTSVLHG VTVPHLA VVGGSSQ WDGHSKV WEANTYL WEAQTTV WEATSV WEGNQF WEGQNI WEGSTNI

VTSVLHP VTVPHLG VVGGSSS WDGNHSV WEANTYV WEAQTV WEATSYF WEGNQI WEGQNL WEGSTNL

VTSVLHS VTVPHLS VVGGSSV WDGVSSG WEANYF WEAQTYF WEATSYI WEGNQL WEGQNV WEGSTNV

VTSVVHA VTVPHVA VVGGSSW WEAGSNF WEANYI WEAQTYI WEATSYL WEGNQV WEGQQF WEGSTQF

VTSVVHP VTVPHVG VVGGSYV WEAGSNI WEANYL WEAQTYL WEATSYV WEGNSF WEGQQI WEGSTQI

VTVAGHG VTVPHVS VVGGVSV WEAGSNL WEANYV WEAQTYV WEATTF WEGNSI WEGQQL WEGSTQL

VTVAGHP VTVPLHA VVGGVVK WEAGSNV WEAPSML WEAQYF WEATTI WEGNSL WEGQQV WEGSTQV

VTVAGHS VTVPLHG VVGGWSF WEAGSQF WEAPSNF WEAQYI WEATTL WEGNSNF WEGQSF WEGSTSF

VTVAHGG VTVPLHS VVGGWTA WEAGSQI WEAPSNI WEAQYL WEATTNF WEGNSNI WEGQSI WEGSTSI

VTVAHGP VTVPVHA VVGGYQV WEAGSQL WEAPSNL WEAQYV WEATTNI WEGNSNL WEGQSL WEGSTSL

VTVAHGS VTVPVHG VVGGYSN WEAGSQV WEAPSNV WEASNF WEATTNL WEGNSNV WEGQSNF WEGSTSV

VTVAHLG VTVPVHS VVGHKSP WEAGSSF WEAPSQF WEASNI WEATTNV WEGNSQF WEGQSNI WEGSTTF

VTVAHLP VTVSAHG VVGHSKV WEAGSSI WEAPSQI WEASNL WEATTQF WEGNSQI WEGQSNL WEGSTTI

VTVAHLS VTVSAHP VVGHSSV WEAGSSL WEAPSQL WEASNV WEATTQI WEGNSQL WEGQSNV WEGSTTL

VTVAHVG VTVSAHS VVGIDSF WEAGSSV WEAPSQV WEASQF WEATTQL WEGNSQV WEGQSQF WEGSTTV

VTVAHVP VTVSGHA VVGIPKV WEAGSTF WEAPSSF WEASQI WEATTQV WEGNSSF WEGQSQI WEGSTV

VTVAHVS VTVSGHP VVGISYV WEAGSTI WEAPSSI WEASQL WEATTSF WEGNSSI WEGQSQL WEGSTYF

VTVALHG VTVSHAG VVGKSQT WEAGSTL WEAPSSL WEASQV WEATTSI WEGNSSL WEGQSQV WEGSTYI

VTVALHP VTVSHAP VVGKSSQ WEAGSTV WEAPSSV WEASSF WEATTSL WEGNSSV WEGQSSF WEGSTYL

VTVALHS VTVSHAS VVGLPDV WEAGSYF WEAPSTF WEASSI WEATTSV WEGNSTF WEGQSSI WEGSTYV

VTVAVHG VTVSHGA VVGLSSI WEAGSYI WEAPSTI WEASSL WEATTTF WEGNSTI WEGQSSL WEGSYF

VTVAVHP VTVSHGP VVGM SV WEAGSYL WEAPSTL WEASSNF WEATTTI WEGNSTL WEGQSSV WEGSYI

VTVAVHS VTVSHLA VVGMSSL WEAGSYV WEAPSTV WEASSNI WEATTTL WEGNSTV WEGQSTF WEGSYL

VTVHAGG VTVSHLG VVGQDSV WEAGTNF WEAPSYF WEASSNL WEATTTV WEGNSV WEGQSTI WEGSYV

VTVHAGP VTVSHLP VVGQSFF WEAGTNI WEAPSYI WEASSNV WEATTV WEGNSYF WEGQSTL WEGTNF

VTVHAGS VTVSHLS VVGQSSV WEAGTNL WEAPSYL WEASSQF WEATTYF WEGNSYI WEGQSTV WEGTNI

VTVHALG VTVSHVA VVGQVSP WEAGTNV WEAPSYV WEASSQI WEATTYI WEGNSYL WEGQSV WEGTNL

VTVHALP VTVSHVP VVGRSSY WEAGTQF WEAPTNF WEASSQL WEATTYL WEGNSYV WEGQSYF WEGTNV

VTVHALS VTVSLHA VVGRYDV WEAGTQI WEAPTNI WEASSQV WEATTYV WEGNTF WEGQSYI WEGTQF

VTVHAVG VTVSLHG VVGSRSV WEAGTQL WEAPTNL WEASSSF WEATYF WEGNTI WEGQSYL WEGTQI

VTVHAVP VTVSLHP VVGSSDV WEAGTQV WEAPTNV WEASSSI WEATYI WEGNTL WEGQSYV WEGTQL WEGTQV WESGTNI WESPSYL WESSSQF WESTTYF WNAGTNI WNAPSYL WNASSQF WNATTYF WNGNSV

WEGTSF WESGTNL WESPSYV WESSSQI WESTTYI WNAGTNL WNAPSYV WNASSQI WNATTYI WNGNSYF

WEGTSI WESGTNV WESPTNF WESSSQL WESTTYL WNAGTNV WNAPTNF WNASSQL WNATTYL WNGNSYI

WEGTSL WESGTQF WESPTNI WESSSQV WESTTYV WNAGTQF WNAPTNI WNASSQV WNATTYV WNGNSYL

WEGTSMV WESGTQI WESPTNL WESSSSF WESTYF WNAGTQI WNAPTNL WNASSSF WNATYF WNGNSYV

WEGTSNF WESGTQL WESPTNV WESSSSI WESTYI WNAGTQL WNAPTNV WNASSSI WNATYI WNGNTF

WEGTSNI WESGTQV WESPTQF WESSSSL WESTYL WNAGTQV WNAPTQF WNASSSL WNATYL WNGNTI

WEGTSNL WESGTSF WESPTQI WESSSSV WESTYV WNAGTSF WNAPTQI WNASSSV WNATYV WNGNTL

WEGTSNV WESGTSI WESPTQL WESSSTF WESYNF WNAGTSI WNAPTQL WNASSTF WNAYNF WNGNTNF

WEGTSQF WESGTSL WESPTQV WESSSTI WESYNI WNAGTSL WNAPTQV WNASSTI WNAYNI WNGNTNI

WEGTSQI WESGTSV WESPTSF WESSSTL WESYNL WNAGTSV WNAPTSF WNASSTL WNAYNL WNGNTNL

WEGTSQL WESGTTF WESPTSI WESSSTV WESYNV WNAGTTF WNAPTSI WNASSTV WNAYNV WNGNTNV

WEGTSQV WESGTTI WESPTSL WESSSV WESYQF WNAGTTI WNAPTSL WNASSV WNAYQF WNGNTQF

WEGTSSF WESGTTL WESPTSV WESSSYF WESYQI WNAGTTL WNAPTSV WNASSYF WNAYQI WNGNTQI

WEGTSSI WESGTTV WESPTTF WESSSYI WESYQL WNAGTTV WNAPTTF WNASSYI WNAYQL WNGNTQL

WEGTSSL WESGTYF WESPTTI WESSSYL WESYQV WNAGTYF WNAPTTI WNASSYL WNAYQV WNGNTQV

WEGTSSV WESGTYI WESPTTL WESSSYV WESYSF WNAGTYI WNAPTTL WNASSYV WNAYSF WNGNTSF

WEGTSTF WESGTYL WESPTTV WESSTF WESYSI WNAGTYL WNAPTTV WNASTF WNAYSI WNGNTSI

WEGTSTI WESGTYV WESPTYF WESSTI WESYSL WNAGTYV WNAPTYF WNASTI WNAYSL WNGNTSL

WEGTSTL WESNNF WESPTYI WESSTL WESYSV WNANNF WNAPTYI WNASTL WNAYSV WNGNTSV

WEGTSTV WESNNI WESPTYL WESSTNF WESYTF WNANNI WNAPTYL WNASTNF WNAYTF WNGNTTF

WEGTSV WESNNL WESPTYV WESSTNI WESYTI WNANNL WNAPTYV WNASTNI WNAYTI WNGNTTI

WEGTSYF WESNNV WESQNF WESSTNL WESYTL WNANNV WNAQNF WNASTNL WNAYTL WNGNTTL

WEGTSYI WESNQF WESQNI WESSTNV WESYTV WNANQF WNAQNI WNASTNV WNAYTV WNGNTTV

WEGTSYL WESNQI WESQNL WESSTQF WESYYF W A QI WNAQNL WNASTQF WNAYYF WNGNTV

WEGTSYV WESNQL WESQNV WESSTQI WESYYI WNANQL WNAQNV WNASTQI WNAYYI WNGNTYF

WEGTTF WESNQV WESQQF WESSTQL WESYYL WNANQV WNAQQF WNASTQL WNAYYL WNGNTYI

WEGTTI WESNSF WESQQI WESSTQV WESYYV WNANSF WNAQQI WNASTQV WNAYYV WNGNTYL

WEGTTL WESNSI WESQQL WESSTSF WETGSDN W NAN SI WNAQQL WNASTSF WNDGSSV WNGNTYV

WEGTTNF WESNSL WESQQV WESSTSI WFEGATE WNANSL WNAQQV WNASTSI WNGGSNF WNGNYF

WEGTTNI WESNSNF WESQSF WESSTSL WFGDSSV WNANSNF WNAQSF WNASTSL WNGGSNI WNGNYI

WEGTTNL WESNSNI WESQSI WESSTSV WFGGSSV WNANSNI WNAQSI WNASTSV WNGGSNL WNGNYL

WEGTTNV WESNSNL WESQSL WESSTTF WFGGYSI WNANSNL WNAQSL WNASTTF WNGGSNV WNGNYV

WEGTTQF WESNSNV WESQSNF WESSTTI WFGSSFN WNANSNV WNAQSNF WNASTTI WNGGSQF WNGPSNF

WEGTTQI WESNSQF WESQSNI WESSTTL WGELDAV WNANSQF WNAQSNI WNASTTL WNGGSQI WNGPSNI

WEGTTQL WESNSQI WESQSNL WESSTTV WGGDSYV WNANSQI WNAQSNL WNASTTV WNGGSQL WNGPSNL

WEGTTQV WESNSQL WESQSNV WESSTV WGGGASV WNANSQL WNAQSNV WNASTV WNGGSQV WNGPSNV

WEGTTSF WESNSQV WESQSQF WESSTYF WGGGSSY WNANSQV WNAQSQF WNASTYF WNGGSSF WNGPSQF

WEGTTSI WESNSSF WESQSQI WESSTYI WGGKESE WNANSSF WNAQSQI WNASTYI WNGGSSI WNGPSQI

WEGTTSL WESNSSI WESQSQL WESSTYL WGGRWSG WNANSSI WNAQSQL WNASTYL WNGGSSL WNGPSQL

WEGTTSV WESNSSL WESQSQV WESSTYV WGSRSKV WNANSSL WNAQSQV WNASTYV WNGGSSV WNGPSQV

WEGTTTF WESNSSV WESQSSF WESSYF WGTGSSG WNANSSV WNAQSSF WNASYF WNGGSTF WNGPSSF

WEGTTTI WESNSTF WESQSSI WESSYI WHAGYVV WNANSTF WNAQSSI WNASYI WNGGSTI WNGPSSI

WEGTTTL WESNSTI WESQSSL WESSYL WHFGSTV WNANSTI WNAQSSL WNASYL WNGGSTL WNGPSSL

WEGTTTV WESNSTL WESQSSV WESSYV WHGGESV WNANSTL WNAQSSV WNASYV WNGGSTV WNGPSSV

WEGTTV WESNSTV WESQSTF WESTNF WHGGSGV WNANSTV WNAQSTF WNATNF WNGGSYF WNGPSTF

WEGTTYF WESNSV WESQSTI WESTNI WHGGSHY WNANSV WNAQSTI WNATNI WNGGSYI WNGPSTI

WEGTTYI WESNSYF WESQSTL WESTNL WHGGSSV WNANSYF WNAQSTL WNATNL WNGGSYL WNGPSTL

WEGTTYL WESNSYI WESQSTV WESTNV WHGSIPY WNANSYI WNAQSTV WNATNV WNGGSYV WNGPSTV

WEGTTYV WESNSYL WESQSV WESTQF WHIGSPV WNANSYL WNAQSV WNATQF WNGGTNF WNGPSYF

WEGTYF WESNSYV WESQSYF WESTQI WHMGSQL WNANSYV WNAQSYF WNATQI WNGGTNI WNGPSYI

WEGTYI WESNTF WESQSYI WESTQL WHTGSQL WNANTF WNAQSYI WNATQL WNGGTNL WNGPSYL

WEGTYL WESNTI WESQSYL WESTQV WHVMDSV WNANTI WNAQSYL WNATQV WNGGTNV WNGPSYV

WEGTYV WESNTL WESQSYV WESTSF WHWRSVG WNANTL WNAQSYV WNATSF WNGGTQF WNGPTNF

WEGYNF WESNTNF WESQTF WESTSI WIAGGSV WNANTNF WNAQTF WNATSI WNGGTQI WNGPTNI

WEGYNI WESNTNI WESQTI WESTSL WIGGSLV WNANTNI WNAQTI WNATSL WNGGTQL WNGPTNL

WEGYNL WESNTNL WESQTL WESTSNF WIGGSMV WNANTNL WNAQTL WNATSNF WNGGTQV WNGPTNV

WEGYNV WESNTNV WESQTNF WESTSNI WIGPRIV WNANTNV WNAQTNF WNATSNI WNGGTSF WNGPTQF

WEGYQF WESNTQF WESQTNI WESTSNL WIGRSQV WNANTQF WNAQTNI WNATSNL WNGGTSI WNGPTQI

WEGYQI WESNTQI WESQTNL WESTSNV WIGTSSV WNANTQI WNAQTNL WNATSNV WNGGTSL WNGPTQL

WEGYQL WESNTQL WESQTNV WESTSQF WIHGSSV WNANTQL WNAQTNV WNATSQF WNGGTSV WNGPTQV

WEGYQV WESNTQV WESQTQF WESTSQI WIVFTSV WNANTQV WNAQTQF WNATSQI WNGGTTF WNGPTSF

WEGYSF WESNTSF WESQTQI WESTSQL WKGRGSL WNANTSF WNAQTQI WNATSQL WNGGTTI WNGPTSI

WEGYSI WESNTSI WESQTQL WESTSQV WKIISEV WNANTSI WNAQTQL WNATSQV WNGGTTL WNGPTSL

WEGYSL WESNTSL WESQTQV WESTSSF WLFGSVV WNANTSL WNAQTQV WNATSSF WNGGTTV WNGPTSV

WEGYSV WESNTSV WESQTSF WESTSSI WLGGPSV WNANTSV WNAQTSF WNATSSI WNGGTYF WNGPTTF

WEGYTF WESNTTF WESQTSI WESTSSL WLGGSSV WNANTTF WNAQTSI WNATSSL WNGGTYI WNGPTTI

WEGYTI WESNTTI WESQTSL WESTSSV WLIGHLV WNANTTI WNAQTSL WNATSSV WNGGTYL WNGPTTL

WEGYTL WESNTTL WESQTSV WESTSTF WLIGSSV WNANTTL WNAQTSV WNATSTF WNGGTYV WNGPTTV

WEGYTV WESNTTV WESQTTF WESTSTI WLTGSSV WNANTTV WNAQTTF WNATSTI WNGLGSV WNGPTYF

WEGYYF WESNTV WESQTTI WESTSTL WMGGGSV WNANTV WNAQTTI WNATSTL WNGNNF WNGPTYI

WEGYYI WESNTYF WESQTTL WESTSTV WMGKLSV WNANTYF WNAQTTL WNATSTV WNGNNI WNGPTYL

WEGYYL WESNTYI WESQTTV WESTSV WMPESSV WNANTYI WNAQTTV WNATSV WNGNNL WNGPTYV

WEGYYV WESNTYL WESQTV WESTSYF WMPGSSG WNANTYL WNAQTV WNATSYF WNGNNV WNGQNF

WEMSSSD WESNTYV WESQTYF WESTSYI WMSWSLV WNANTYV WNAQTYF WNATSYI WNGNQF WNGQNI

WEPGWIV WESNYF WESQTYI WESTSYL WMWTHMV WNANYF WNAQTYI WNATSYL WNGNQI WNGQNL

WESGSNF WESNYI WESQTYL WESTSYV WNAGSNF WNANYI WNAQTYL WNATSYV WNGNQL WNGQNV

WESGSNI WESNYL WESQTYV WESTTF W AGS I WNANYL WNAQTYV WNATTF WNGNQV WNGQQF

WESGSNL WESNYV WESQYF WESTTI WNAGSNL WNANYV WNAQYF WNATTI WNGNSF WNGQQI

WESGSNV WESPSNF WESQYI WESTTL WNAGSNV WNAPSNF WNAQYI WNATTL WNGNSI WNGQQL

WESGSQF WESPSNI WESQYL WESTTNF WNAGSQF WNAPSNI WNAQYL WNATTNF WNGNSL WNGQQV

WESGSQI WESPSNL WESQYV WESTTNI WNAGSQI WNAPSNL WNAQYV WNATTNI WNGNSNF WNGQSF

WESGSQL WESPSNV WESSNF WESTTNL WNAGSQL WNAPSNV WNASNF WNATTNL WNGNSNI WNGQSI

WESGSQV WESPSQF WESSNI WESTTNV WNAGSQV WNAPSQF WNASNI WNATTNV WNGNSNL WNGQSL

WESGSSF WESPSQI WESSNL WESTTQF WNAGSSF WNAPSQI WNASNL WNATTQF WNGNSNV WNGQSNF

WESGSSI WESPSQL WESSNV WESTTQI WNAGSSI WNAPSQL WNASNV WNATTQI WNGNSQF WNGQSNI

WESGSSL WESPSQV WESSQF WESTTQL WNAGSSL WNAPSQV WNASQF WNATTQL WNGNSQI WNGQSNL

WESGSSV WESPSSF WESSQI WESTTQV WNAGSSV WNAPSSF WNASQI WNATTQV WNGNSQL WNGQSNV

WESGSTF WESPSSI WESSQL WESTTSF WNAGSTF WNAPSSI WNASQL WNATTSF WNGNSQV WNGQSQF

WESGSTI WESPSSL WESSQV WESTTSI WNAGSTI WNAPSSL WNASQV WNATTSI WNGNSSF WNGQSQI

WESGSTL WESPSSV WESSSF WESTTSL WNAGSTL WNAPSSV WNASSF WNATTSL WNGNSSI WNGQSQL

WESGSTV WESPSTF WESSSI WESTTSV W AGSTV WNAPSTF WNASSI WNATTSV WNGNSSL WNGQSQV

WESGSYF WESPSTI WESSSL WESTTTF WNAGSYF WNAPSTI WNASSL WNATTTF WNGNSSV WNGQSSF

WESGSYI WESPSTL WESSSNF WESTTTI W AGSYI WNAPSTL WNASSNF WNATTTI WNGNSTF WNGQSSI

WESGSYL WESPSTV WESSSNI WESTTTL WNAGSYL WNAPSTV WNASSNI WNATTTL WNGNSTI WNGQSSL

WESGSYV WESPSYF WESSSNL WESTTTV WNAGSYV WNAPSYF WNASSNL WNATTTV WNGNSTL WNGQSSV

WESGTNF WESPSYI WESSSNV WESTTV WNAGTNF WNAPSYI WNASSNV WNATTV WNGNSTV WNGQSTF WNGQSTI WNGTNI WNSGSYI WNSPSTL WNSSSNF WNSTTTI WQANSSI WQAQSQL WQASTYL WQGGSQV

WNGQSTL WNGTNL WNSGSYL WNSPSTV WNSSSNI WNSTTTL WQANSSL WQAQSQV WQASTYV WQGGSSF

WNGQSTV WNGTNV WNSGSYV WNSPSYF WNSSSNL WNSTTTV WQANSSV WQAQSSF WQASYF WQGGSSI

WNGQSV WNGTQF WNSGTNF WNSPSYI WNSSSNV WNSTTV WQANSTF WQAQSSI WQASYI WQGGSSL

WNGQSYF WNGTQI WNSGTNI WNSPSYL WNSSSQF WNSTTYF WQANSTI WQAQSSL WQASYL WQGGSSV

WNGQSYI WNGTQL WNSGTNL WNSPSYV WNSSSQI WNSTTYI WQANSTL WQAQSSV WQASYV WQGGSTF

WNGQSYL WNGTQV WNSGTNV WNSPTNF WNSSSQL WNSTTYL WQANSTV WQAQSTF WQATNF WQGGSTI

WNGQSYV WNGTSF WNSGTQF WNSPTNI WNSSSQV WNSTTYV WQANSV WQAQSTI WQAT I WQGGSTL

WNGQTF WNGTSI WNSGTQI WNSPTNL WNSSSSF WNSTYF WQANSYF WQAQSTL WQAT L WQGGSTV

WNGQTI WNGTSL WNSGTQL WNSPTNV WNSSSSI WNSTYI WQANSYI WQAQSTV WQATNV WQGGSVV

WNGQTL WNGTSNF WNSGTQV WNSPTQF WNSSSSL WNSTYL WQANSYL WQAQSV WQATQF WQGGSYF

WNGQTNF WNGTSNI WNSGTSF WNSPTQI WNSSSSV WNSTYV WQANSYV WQAQSYF WQATQI WQGGSYI

WNGQTNI WNGTSNL WNSGTSI WNSPTQL WNSSSTF WNSYNF WQANTF WQAQSYI WQATQL WQGGSYL

WNGQTNL WNGTSNV WNSGTSL WNSPTQV WNSSSTI WNSYNI WQANTI WQAQSYL WQATQV WQGGSYV

WNGQTNV WNGTSQF WNSGTSV WNSPTSF WNSSSTL WNSYNL WQANTL WQAQSYV WQATSF WQGGTNF

WNGQTQF WNGTSQI WNSGTTF WNSPTSI WNSSSTV WNSYNV WQANT F WQAQTF WQATSI WQGGTNI

WNGQTQI WNGTSQL WNSGTTI WNSPTSL WNSSSV WNSYQF WQANTNI WQAQTI WQATSL WQGGTNL

WNGQTQL WNGTSQV WNSGTTL WNSPTSV WNSSSYF WNSYQI WQANTNL WQAQTL WQATSNF WQGGTNV

WNGQTQV WNGTSSF WNSGTTV WNSPTTF WNSSSYI WNSYQL WQANTNV WQAQT F WQATSNI WQGGTQF

WNGQTSF WNGTSSI WNSGTYF WNSPTTI WNSSSYL WNSYQV WQANTQF WQAQTNI WQATSNL WQGGTQI

WNGQTSI WNGTSSL WNSGTYI WNSPTTL WNSSSYV WNSYSF WQANTQI WQAQTNL WQATSNV WQGGTQL

WNGQTSL WNGTSSV WNSGTYL WNSPTTV WNSSTF WNSYSI WQANTQL WQAQTNV WQATSQF WQGGTQV

WNGQTSV WNGTSTF WNSGTYV WNSPTYF WNSSTI WNSYSL WQANTQV WQAQTQF WQATSQI WQGGTSF

WNGQTTF WNGTSTI WNSNNF WNSPTYI WNSSTL WNSYSV WQANTSF WQAQTQI WQATSQL WQGGTSI

WNGQTTI WNGTSTL WNSNNI WNSPTYL WNSSTNF WNSYTF WQANTSI WQAQTQL WQATSQV WQGGTSL

WNGQTTL WNGTSTV WNSNNL WNSPTYV WNSSTNI WNSYTI WQANTSL WQAQTQV WQATSSF WQGGTS

WNGQTTV WNGTSV WNSNNV WNSQNF WNSSTNL WNSYTL WQANTSV WQAQTSF WQATSSI WQGGTTF

WNGQTV WNGTSYF WNSNQF WNSQNI WNSSTNV WNSYTV WQANTTF WQAQTSI WQATSSL WQGGTTI

WNGQTYF WNGTSYI WNSNQI WNSQNL W SSTQF WNSYYF WQANTTI WQAQTSL WQATSSV WQGGTTL

WNGQTYI WNGTSYL WNSNQL WNSQNV WNSSTQI WNSYYI WQANTTL WQAQTSV WQATSTF WQGGTTV

WNGQTYL WNGTSYV WNSNQV WNSQQF W SSTQL WNSYYL WQANTTV WQAQTTF WQATSTI WQGGTYF

WNGQTYV WNGTTF WNSNSF WNSQQI WNSSTQV WNSYYV WQANTV WQAQTTI WQATSTL WQGGTYI

WNGQYF WNGTTI WNSNSI WNSQQL WNSSTSF WPGWHLV WQANTYF WQAQTTL WQATSTV WQGGTYL

WNGQYI WNGTTL WNSNSL WNSQQV WNSSTSI WPIWISV WQANTYI WQAQTTV WQATSV WQGGTYV

WNGQYL WNGTTNF WNSNSNF WNSQSF WNSSTSL WPMQKTV WQANTYL WQAQTV WQATSYF WQGNNF

WNGQYV WNGTTNI WNSNSNI WNSQSI WNSSTSV WPPGRSV WQANTYV WQAQTYF WQATSYI WQGNNI

WNGSNF WNGTTNL WNSNSNL WNSQSL WNSSTTF WPQGDSV WQANYF WQAQTYI WQATSYL WQGNNL

WNGSNI WNGTTNV WNSNSNV WNSQSNF WNSSTTI WQAGSNF WQANYI WQAQTYL WQATSYV WQGNNV

WNGSNL WNGTTQF WNSNSQF WNSQSNI WNSSTTL WQAGSNI WQANYL WQAQTYV WQATTF WQGNQF

WNGSNV WNGTTQI WNSNSQI WNSQSNL WNSSTTV WQAGS L WQANYV WQAQYF WQATTI WQGNQI

WNGSQF WNGTTQL WNSNSQL WNSQSNV WNSSTV WQAGSNV WQAPSNF WQAQYI WQATTL WQGNQL

WNGSQI WNGTTQV WNSNSQV WNSQSQF W SSTYF WQAGSQF WQAPSNI WQAQYL WQATT F WQGNQV

WNGSQL WNGTTSF WNSNSSF WNSQSQI WNSSTYI WQAGSQI WQAPS L WQAQYV WQATT I WQG SF

WNGSQV WNGTTSI WNSNSSI WNSQSQL W SSTYL WQAGSQL WQAPSNV WQASNF WQATT L WQGNSI

WNGSSF WNGTTSL WNSNSSL WNSQSQV WNSSTYV WQAGSQV WQAPSQF WQASNI WQATTNV WQGNSL

WNGSSI WNGTTSV WNSNSSV WNSQSSF WNSSYF WQAGSSF WQAPSQI WQASNL WQATTQF WQGNSNF

WNGSSL WNGTTTF WNSNSTF WNSQSSI WNSSYI WQAGSSI WQAPSQL WQASNV WQATTQI WQGNSNI

WNGSSNF WNGTTTI WNSNSTI WNSQSSL WNSSYL WQAGSSL WQAPSQV WQASQF WQATTQL WQGNSNL

WNGSSNI WNGTTTL WNSNSTL WNSQSSV WNSSYV WQAGSSV WQAPSSF WQASQI WQATTQV WQGNSNV

WNGSSNL WNGTTTV WNSNSTV WNSQSTF WNSTNF WQAGSTF WQAPSSI WQASQL WQATTSF WQGNSQF

WNGSSNV WNGTTV WNSNSV WNSQSTI WNSTNI WQAGSTI WQAPSSL WQASQV WQATTSI WQGNSQI

WNGSSQF WNGTTYF WNSNSYF WNSQSTL WNSTNL WQAGSTL WQAPSSV WQASSF WQATTSL WQGNSQL

WNGSSQI WNGTTYI WNSNSYI WNSQSTV WNSTNV WQAGSTV WQAPSTF WQASSI WQATTSV WQGNSQV

WNGSSQL WNGTTYL WNSNSYL WNSQSV WNSTQF WQAGSYF WQAPSTI WQASSL WQATTTF WQGNSSF

WNGSSQV WNGTTYV WNSNSYV WNSQSYF WNSTQI WQAGSYI WQAPSTL WQASSNF WQATTTI WQGNSSI

WNGSSSF WNGTYF WNSNTF WNSQSYI WNSTQL WQAGSYL WQAPSTV WQASSNI WQATTTL WQGNSSL

WNGSSSI WNGTYI WNSNTI WNSQSYL WNSTQV WQAGSYV WQAPSYF WQASSNL WQATTTV WQGNSSV

WNGSSSL WNGTYL WNSNTL WNSQSYV WNSTSF WQAGT F WQAPSYI WQASSNV WQATTV WQGNSTF

WNGSSSV WNGTYV WNSNTNF WNSQTF WNSTSI WQAGTNI WQAPSYL WQASSQF WQATTYF WQGNSTI

WNGSSTF WNGYNF WNSNTNI WNSQTI WNSTSL WQAGTNL WQAPSYV WQASSQI WQATTYI WQGNSTL

WNGSSTI WNGYNI WNSNTNL WNSQTL WNSTSNF WQAGTNV WQAPTNF WQASSQL WQATTYL WQGNSTV

WNGSSTL WNGYNL WNSNTNV WNSQTNF WNSTSNI WQAGTQF WQAPTNI WQASSQV WQATTYV WQGNSV

WNGSSTV WNGYNV WNSNTQF WNSQTNI WNSTSNL WQAGTQI WQAPTNL WQASSSF WQATYF WQGNSYF

WNGSSV WNGYQF WNSNTQI WNSQTNL WNSTSNV WQAGTQL WQAPTNV WQASSSI WQATYI WQGNSYI

WNGSSYF WNGYQI WNSNTQL WNSQTNV WNSTSQF WQAGTQV WQAPTQF WQASSSL WQATYL WQGNSYL

WNGSSYI WNGYQL WNSNTQV WNSQTQF WNSTSQI WQAGTSF WQAPTQI WQASSSV WQATYV WQGNSYV

WNGSSYL WNGYQV WNSNTSF WNSQTQI WNSTSQL WQAGTSI WQAPTQL WQASSTF WQAYNF WQGNTF

WNGSSYV WNGYSF WNSNTSI WNSQTQL WNSTSQV WQAGTSL WQAPTQV WQASSTI WQAYNI WQGNTI

WNGSTF WNGYSI WNSNTSL WNSQTQV WNSTSSF WQAGTSV WQAPTSF WQASSTL WQAYNL WQGNTL

WNGSTI WNGYSL WNSNTSV WNSQTSF WNSTSSI WQAGTTF WQAPTSI WQASSTV WQAYNV WQGNTNF

WNGSTL WNGYSV WNSNTTF WNSQTSI WNSTSSL WQAGTTI WQAPTSL WQASSV WQAYQF WQGNTNI

WNGSTNF WNGYTF WNSNTTI WNSQTSL WNSTSSV WQAGTTL WQAPTSV WQASSYF WQAYQI WQGNTNL

WNGSTNI WNGYTI WNSNTTL WNSQTSV WNSTSTF WQAGTTV WQAPTTF WQASSYI WQAYQL WQGNTNV

WNGSTNL WNGYTL WNSNTTV WNSQTTF WNSTSTI WQAGTYF WQAPTTI WQASSYL WQAYQV WQGNTQF

WNGSTNV WNGYTV WNSNTV WNSQTTI WNSTSTL WQAGTYI WQAPTTL WQASSYV WQAYSF WQGNTQI

WNGSTQF WNGYYF WNSNTYF WNSQTTL WNSTSTV WQAGTYL WQAPTTV WQASTF WQAYSI WQGNTQL

WNGSTQI WNGYYI WNSNTYI WNSQTTV WNSTSV WQAGTYV WQAPTYF WQASTI WQAYSL WQGNTQV

WNGSTQL WNGYYL WNSNTYL WNSQTV WNSTSYF WQANNF WQAPTYI WQASTL WQAYSV WQGNTSF

WNGSTQV WNGYYV WNSNTYV WNSQTYF WNSTSYI WQA I WQAPTYL WQASTNF WQAYTF WQGNTSI

WNGSTSF WNNGRDY WNSNYF WNSQTYI WNSTSYL WQANNL WQAPTYV WQASTNI WQAYTI WQGNTSL

WNGSTSI WNSGSNF WNSNYI WNSQTYL WNSTSYV WQA V WQAQNF WQASTNL WQAYTL WQGNTSV

WNGSTSL WNSGSNI WNSNYL WNSQTYV WNSTTF WQANQF WQAQNI WQASTNV WQAYTV WQGNTTF

WNGSTSV WNSGSNL WNSNYV WNSQYF WNSTTI WQANQI WQAQNL WQASTQF WQAYYF WQGNTTI

WNGSTTF WNSGSNV WNSPSNF WNSQYI WNSTTL WQANQL WQAQNV WQASTQI WQAYYI WQGNTTL

WNGSTTI WNSGSQF WNSPSNI WNSQYL WNSTTNF WQANQV WQAQQF WQASTQL WQAYYL WQGNTTV

WNGSTTL WNSGSQI WNSPSNL WNSQYV WNSTTNI WQANSF WQAQQI WQASTQV WQAYYV WQGNTV

WNGSTTV WNSGSQL WNSPSNV WNSSNF WNSTTNL WQANSI WQAQQL WQASTSF WQEGSSS WQGNTYF

WNGSTV WNSGSQV WNSPSQF WNSSNI WNSTTNV WQANSL WQAQQV WQASTSI WQGGNSV WQGNTYI

WNGSTYF WNSGSSF WNSPSQI WNSSNL WNSTTQF WQANSNF WQAQSF WQASTSL WQGGSKV WQGNTYL

WNGSTYI WNSGSSI WNSPSQL WNSSNV WNSTTQI WQANSNI WQAQSI WQASTSV WQGGSNF WQGNTYV

WNGSTYL WNSGSSL WNSPSQV WNSSQF W STTQL WQANSNL WQAQSL WQASTTF WQGGSNI WQGNYF

WNGSTYV WNSGSSV WNSPSSF WNSSQI WNSTTQV WQANSNV WQAQSNF WQASTTI WQGGSNL WQGNYI

WNGSYF WNSGSTF WNSPSSI WNSSQL WNSTTSF WQANSQF WQAQSNI WQASTTL WQGGSNV WQGNYL

WNGSYI WNSGSTI WNSPSSL WNSSQV WNSTTSI WQANSQI WQAQSNL WQASTTV WQGGSPV WQGNYV

WNGSYL WNSGSTL WNSPSSV WNSSSF WNSTTSL WQANSQL WQAQSNV WQASTV WQGGSQF WQGPSNF

WNGSYV WNSGSTV WNSPSTF WNSSSI WNSTTSV WQANSQV WQAQSQF WQASTYF WQGGSQI WQGPSNI

WNGTNF WNSGSYF WNSPSTI WNSSSL WNSTTTF WQANSSF WQAQSQI WQASTYI WQGGSQL WQGPSNL WQGPSNV WQGSNF WQGTT L WQSNSNL WQSQSL WQSSTTF WTGGSGV WVANTTL WVAQTSV WVATSTF

WQGPSQF WQGSNI WQGTTNV WQSNSNV WQSQSNF WQSSTTI WTGIESR WVANTTV WVAQTTF WVATSTI

WQGPSQI WQGSNL WQGTTQF WQSNSQF WQSQSNI WQSSTTL WTGKSSV WVANTV WVAQTTI WVATSTL

WQGPSQL WQGSNV WQGTTQI WQSNSQI WQSQSNL WQSSTTV WTGMSSV WVANTYF WVAQTTL WVATSTV

WQGPSQV WQGSQF WQGTTQL WQSNSQL WQSQSNV WQSSTV WTLGSSV WVANTYI WVAQTTV WVATSV

WQGPSSF WQGSQI WQGTTQV WQSNSQV WQSQSQF WQSSTYF WTNGSSK WVANTYL WVAQTV WVATSYF

WQGPSSI WQGSQL WQGTTSF WQSNSSF WQSQSQI WQSSTYI WTQPSSV WVANTYV WVAQTYF WVATSYI

WQGPSSL WQGSQV WQGTTSI WQSNSSI WQSQSQL WQSSTYL WTWKDGM WVANYF WVAQTYI WVATSYL

WQGPSSV WQGSSF WQGTTSL WQSNSSL WQSQSQV WQSSTYV WVAGSNF WVANYI WVAQTYL WVATSYV

WQGPSTF WQGSSI WQGTTSV WQSNSSV WQSQSSF WQSSYF WVAGSNI WVANYL WVAQTYV WVATTF

WQGPSTI WQGSSL WQGTTTF WQSNSTF WQSQSSI WQSSYI WVAGSNL WVANYV WVAQYF WVATTI

WQGPSTL WQGSSNF WQGTTTI WQSNSTI WQSQSSL WQSSYL WVAGSNV WVAPSNF WVAQYI WVATTL

WQGPSTV WQGSSNI WQGTTTL WQSNSTL WQSQSSV WQSSYV WVAGSQF WVAPSNI WVAQYL WVATTNF

WQGPSYF WQGSSNL WQGTTTV WQSNSTV WQSQSTF WQSTNF WVAGSQI WVAPSNL WVAQYV WVATTNI

WQGPSYI WQGSSNV WQGTTV WQSNSV WQSQSTI WQSTNI WVAGSQL WVAPSNV WVASNF WVATTNL

WQGPSYL WQGSSQF WQGTTYF WQSNSYF WQSQSTL WQSTNL WVAGSQV WVAPSQF WVASNI WVATTNV

WQGPSYV WQGSSQI WQGTTYI WQSNSYI WQSQSTV WQSTNV WVAGSSF WVAPSQI WVASNL WVATTQF

WQGPTNF WQGSSQL WQGTTYL WQSNSYL WQSQSV WQSTQF WVAGSSI WVAPSQL WVASNV WVATTQI

WQGPTNI WQGSSQV WQGTTYV WQSNSYV WQSQSYF WQSTQI WVAGSSL WVAPSQV WVASQF WVATTQL

WQGPTNL WQGSSSF WQGTYF WQSNTF WQSQSYI WQSTQL WVAGSSV WVAPSSF WVASQI WVATTQV

WQGPTNV WQGSSSI WQGTYI WQSNTI WQSQSYL WQSTQV WVAGSTF WVAPSSI WVASQL WVATTSF

WQGPTQF WQGSSSL WQGTYL WQSNTL WQSQSYV WQSTSF WVAGSTI WVAPSSL WVASQV WVATTSI

WQGPTQI WQGSSSV WQGTYV WQSNTNF WQSQTF WQSTSI WVAGSTL WVAPSSV WVASSF WVATTSL

WQGPTQL WQGSSTF WQGYNF WQSNTNI WQSQTI WQSTSL WVAGSTV WVAPSTF WVASSI WVATTSV

WQGPTQV WQGSSTI WQGYNI WQSNTNL WQSQTL WQSTSNF WVAGSYF WVAPSTI WVASSL WVATTTF

WQGPTSF WQGSSTL WQGYNL WQSNTNV WQSQTNF WQSTSNI WVAGSYI WVAPSTL WVASS F WVATTTI

WQGPTSI WQGSSTV WQGYNV WQSNTQF WQSQTNI WQSTS L WVAGSYL WVAPSTV WVASSNI WVATTTL

WQGPTSL WQGSSV WQGYQF WQSNTQI WQSQTNL WQSTSNV WVAGSYV WVAPSYF WVASSNL WVATTTV

WQGPTSV WQGSSYF WQGYQI WQSNTQL WQSQTNV WQSTSQF WVAGTNF WVAPSYI WVASSNV WVATTV

WQGPTTF WQGSSYI WQGYQL WQSNTQV WQSQTQF WQSTSQI WVAGTNI WVAPSYL WVASSQF WVATTYF

WQGPTTI WQGSSYL WQGYQV WQSNTSF WQSQTQI WQSTSQL WVAGT L WVAPSYV WVASSQI WVATTYI

WQGPTTL WQGSSYV WQGYSF WQSNTSI WQSQTQL WQSTSQV WVAGTNV WVAPTNF WVASSQL WVATTYL

WQGPTTV WQGSTF WQGYSI WQSNTSL WQSQTQV WQSTSSF WVAGTQF WVAPT I WVASSQV WVATTYV

WQGPTYF WQGSTI WQGYSL WQSNTSV WQSQTSF WQSTSSI WVAGTQI WVAPT L WVASSSF WVATYF

WQGPTYI WQGSTL WQGYSV WQSNTTF WQSQTSI WQSTSSL WVAGTQL WVAPTNV WVASSSI WVATYI

WQGPTYL WQGSTNF WQGYTF WQSNTTI WQSQTSL WQSTSSV WVAGTQV WVAPTQF WVASSSL WVATYL

WQGPTYV WQGSTNI WQGYTI WQSNTTL WQSQTSV WQSTSTF WVAGTSF WVAPTQI WVASSSV WVATYV

WQGQNF WQGSTNL WQGYTL WQSNTTV WQSQTTF WQSTSTI WVAGTSI WVAPTQL WVASSTF WVAWSSV

WQGQNI WQGSTNV WQGYTV WQSNTV WQSQTTI WQSTSTL WVAGTSL WVAPTQV WVASSTI WVAYNF

WQGQNL WQGSTQF WQGYYF WQSNTYF WQSQTTL WQSTSTV WVAGTSV WVAPTSF WVASSTL WVAYNI

WQGQNV WQGSTQI WQGYYI WQSNTYI WQSQTTV WQSTSV WVAGTTF WVAPTSI WVASSTV WVAYNL

WQGQQF WQGSTQL WQGYYL WQSNTYL WQSQTV WQSTSYF WVAGTTI WVAPTSL WVASSV WVAYNV

WQGQQI WQGSTQV WQGYYV WQSNTYV WQSQTYF WQSTSYI WVAGTTL WVAPTSV WVASSYF WVAYQF

WQGQQL WQGSTSF WQLSQPV WQSNYF WQSQTYI WQSTSYL WVAGTTV WVAPTTF WVASSYI WVAYQI

WQGQQV WQGSTSI WQSGSNF WQSNYI WQSQTYL WQSTSYV WVAGTYF WVAPTTI WVASSYL WVAYQL

WQGQSF WQGSTSL WQSGSNI WQSNYL WQSQTYV WQSTTF WVAGTYI WVAPTTL WVASSYV WVAYQV

WQGQSI WQGSTSV WQSGSNL WQSNYV WQSQYF WQSTTI WVAGTYL WVAPTTV WVASTF WVAYSF

WQGQSL WQGSTTF WQSGSNV WQSPSNF WQSQYI WQSTTL WVAGTYV WVAPTYF WVASTI WVAYSI

WQGQSNF WQGSTTI WQSGSQF WQSPSNI WQSQYL WQSTTNF WVANNF WVAPTYI WVASTL WVAYSL

WQGQSNI WQGSTTL WQSGSQI WQSPSNL WQSQYV WQSTTNI WVANNI WVAPTYL WVASTNF WVAYSV

WQGQSNL WQGSTTV WQSGSQL WQSPSNV WQSSNF WQSTTNL WVANNL WVAPTYV WVASTNI WVAYTF

WQGQSNV WQGSTV WQSGSQV WQSPSQF WQSSNI WQSTTNV WVANNV WVAQNF WVAST L WVAYTI

WQGQSQF WQGSTYF WQSGSSF WQSPSQI WQSSNL WQSTTQF WVANQF WVAQNI WVASTNV WVAYTL

WQGQSQI WQGSTYI WQSGSSI WQSPSQL WQSSNV WQSTTQI WVANQI WVAQNL WVASTQF WVAYTV

WQGQSQL WQGSTYL WQSGSSL WQSPSQV WQSSQF WQSTTQL WVANQL WVAQNV WVASTQI WVAYYF

WQGQSQV WQGSTYV WQSGSSV WQSPSSF WQSSQI WQSTTQV WVANQV WVAQQF WVASTQL WVAYYI

WQGQSSF WQGSYF WQSGSTF WQSPSSI WQSSQL WQSTTSF WVANSF WVAQQI WVASTQV WVAYYL

WQGQSSI WQGSYI WQSGSTI WQSPSSL WQSSQV WQSTTSI WVANSI WVAQQL WVASTSF WVAYYV

WQGQSSL WQGSYL WQSGSTL WQSPSSV WQSSSF WQSTTSL WVANSL WVAQQV WVASTSI WVDGSSV

WQGQSSV WQGSYV WQSGSTV WQSPSTF WQSSSI WQSTTSV WVANSNF WVAQSF WVASTSL WVDMSSV

WQGQSTF WQGTNF WQSGSYF WQSPSTI WQSSSL WQSTTTF WVANSNI WVAQSI WVASTSV WVDQSVW

WQGQSTI WQGT I WQSGSYI WQSPSTL WQSSSNF WQSTTTI WVANSNL WVAQSL WVASTTF WVEGQSK

WQGQSTL WQGT L WQSGSYL WQSPSTV WQSSSNI WQSTTTL WVANSNV WVAQSNF WVASTTI WVEGSSV

WQGQSTV WQGTNV WQSGSYV WQSPSYF WQSSSNL WQSTTTV WVANSQF WVAQSNI WVASTTL WVEGSSW

WQGQSV WQGTQF WQSGTNF WQSPSYI WQSSSNV WQSTTV WVANSQI WVAQSNL WVASTTV WVFGDSH

WQGQSYF WQGTQI WQSGTNI WQSPSYL WQSSSQF WQSTTYF WVANSQL WVAQSNV WVASTV WVFMSSV

WQGQSYI WQGTQL WQSGTNL WQSPSYV WQSSSQI WQSTTYI WVANSQV WVAQSQF WVASTYF WVFWSSI

WQGQSYL WQGTQV WQSGTNV WQSPTNF WQSSSQL WQSTTYL WVANSSF WVAQSQI WVASTYI WVGASSV

WQGQSYV WQGTSF WQSGTQF WQSPTNI WQSSSQV WQSTTYV WVANSSI WVAQSQL WVASTYL WVGDGPL

WQGQTF WQGTSI WQSGTQI WQSPTNL WQSSSSF WQSTYF WVANSSL WVAQSQV WVASTYV WVGEGSV

WQGQTI WQGTSL WQSGTQL WQSPTNV WQSSSSI WQSTYI WVANSSV WVAQSSF WVASYF WVGEISV

WQGQTL WQGTSNF WQSGTQV WQSPTQF WQSSSSL WQSTYL WVANSTF WVAQSSI WVASYI WVGFISS

WQGQTNF WQGTSNI WQSGTSF WQSPTQI WQSSSSV WQSTYV WVANSTI WVAQSSL WVASYL WVGGAEF

WQGQTNI WQGTSNL WQSGTSI WQSPTQL WQSSSTF WQSYNF WVANSTL WVAQSSV WVASYV WVGGASV

WQGQTNL WQGTSNV WQSGTSL WQSPTQV WQSSSTI WQSYNI WVANSTV WVAQSTF WVATNF WVGGDGV

WQGQTNV WQGTSQF WQSGTSV WQSPTSF WQSSSTL WQSYNL WVANSV WVAQSTI WVATNI WVGGESD

WQGQTQF WQGTSQI WQSGTTF WQSPTSI WQSSSTV WQSYNV WVANSYF WVAQSTL WVATNL WVGGESE

WQGQTQI WQGTSQL WQSGTTI WQSPTSL WQSSSV WQSYQF WVANSYI WVAQSTV WVATNV WVGGFIV

WQGQTQL WQGTSQV WQSGTTL WQSPTSV WQSSSYF WQSYQI WVANSYL WVAQSV WVATQF WVGGFVV

WQGQTQV WQGTSSF WQSGTTV WQSPTTF WQSSSYI WQSYQL WVANSYV WVAQSYF WVATQI WVGGGHV

WQGQTSF WQGTSSI WQSGTYF WQSPTTI WQSSSYL WQSYQV WVANTF WVAQSYI WVATQL WVGGGSV

WQGQTSI WQGTSSL WQSGTYI WQSPTTL WQSSSYV WQSYSF WVANTI WVAQSYL WVATQV WVGGISV

WQGQTSL WQGTSSV WQSGTYL WQSPTTV WQSSTF WQSYSI WVANTL WVAQSYV WVATSF WVGGLSV

WQGQTSV WQGTSTF WQSGTYV WQSPTYF WQSSTI WQSYSL WVANTNF WVAQTF WVATSI WVGGPFV

WQGQTTF WQGTSTI WQSNNF WQSPTYI WQSSTL WQSYSV WVANTNI WVAQTI WVATSL WVGGQSV

WQGQTTI WQGTSTL WQSNNI WQSPTYL WQSSTNF WQSYTF WVANTNL WVAQTL WVATSNF WVGGSAV

WQGQTTL WQGTSTV WQSNNL WQSPTYV WQSSTNI WQSYTI WVANTNV WVAQTNF WVATSNI WVGGSDE

WQGQTTV WQGTSV WQSNNV WQSQNF WQSST L WQSYTL WVANTQF WVAQTNI WVATSNL WVGGSGV

WQGQTV WQGTSYF WQSNQF WQSQNI WQSSTNV WQSYTV WVANTQI WVAQT L WVATSNV WVGGSHV

WQGQTYF WQGTSYI WQSNQI WQSQNL WQSSTQF WQSYYF WVANTQL WVAQTNV WVATSQF WVGGSKD

WQGQTYI WQGTSYL WQSNQL WQSQNV WQSSTQI WQSYYI WVANTQV WVAQTQF WVATSQI WVGGSKR

WQGQTYL WQGTSYV WQSNQV WQSQQF WQSSTQL WQSYYL WVANTSF WVAQTQI WVATSQL WVGGSNF

WQGQTYV WQGTTF WQSNSF WQSQQI WQSSTQV WQSYYV WVANTSI WVAQTQL WVATSQV WVGGSNH

WQGQYF WQGTTI WQSNSI WQSQQL WQSSTSF WRGTSPV WVANTSL WVAQTQV WVATSSF WVGGSNI

WQGQYI WQGTTL WQSNSL WQSQQV WQSSTSI WRIGFEN WVANTSV WVAQTSF WVATSSI WVGGSNL

WQGQYL WQGTTNF WQSNSNF WQSQSF WQSSTSL WSSGYLH WVANTTF WVAQTSI WVATSSL WVGGSNS

WQGQYV WQGTT I WQSNSNI WQSQSI WQSSTSV WTGG KV WVANTTI WVAQTSL WVATSSV WVGGSNV WVGGSQF WVGNTSF WVGQTNI WVGTSI WVMGSSV WVSNTQV WVSQTQF WVSTSQI YEAGSSF YEAPSQI

WVGGSQI WVGNTSI WVGQT L WVGTSL WVMQSSA WVSNTSF WVSQTQI WVSTSQL YEAGSSI YEAPSQL

WVGGSQL WVGNTSL WVGQTNV WVGTSNF WVNGISV WVSNTSI WVSQTQL WVSTSQV YEAGSSL YEAPSQV

WVGGSQV WVG TS WVGQTQF WVGTSNI WVNGKSF WVSNTSL WVSQTQV WVSTSSF YEAGSSV YEAPSSF

WVGGSSD WVGNTTF WVGQTQI WVGTSNL WVNNSVA WVSNTSV WVSQTSF WVSTSSI YEAGSTF YEAPSSI

WVGGSSF WVGNTTI WVGQTQL WVGTSNV WVNPSSV WVSNTTF WVSQTSI WVSTSSL YEAGSTI YEAPSSL

WVGGSSI WVGNTTL WVGQTQV WVGTSQF WVPGIKV WVSNTTI WVSQTSL WVSTSSV YEAGSTL YEAPSSV

WVGGSSL WVGNTTV WVGQTSF WVGTSQI WVPGLFL WVSNTTL WVSQTSV WVSTSTF YEAGSTV YEAPSTF

WVGGSSM WVGNTV WVGQTSI WVGTSQL WVQFSQV WVSNTTV WVSQTTF WVSTSTI YEAGSYF YEAPSTI

WVGGSSN WVGNTYF WVGQTSL WVGTSQV WVQNSSY WVSNTV WVSQTTI WVSTSTL YEAGSYI YEAPSTL

WVGGSSQ WVGNTYI WVGQTSV WVGTSSF WVQSSSV WVSNTYF WVSQTTL WVSTSTV YEAGSYL YEAPSTV

WVGGSSV WVGNTYL WVGQTTF WVGTSSI WVQWSSG WVSNTYI WVSQTTV WVSTSV YEAGSYV YEAPSYF

WVGGSTF WVGNTYV WVGQTTI WVGTSSL WVSGGSV WVSNTYL WVSQTV WVSTSYF YEAGTNF YEAPSYI

WVGGSTI WVGNWKV WVGQTTL WVGTSSR WVSGRSD WVSNTYV WVSQTYF WVSTSYI YEAGTNI YEAPSYL

WVGGSTL WVGNYF WVGQTTV WVGTSSV WVSGSNF WVSNYF WVSQTYI WVSTSYL YEAGTNL YEAPSYV

WVGGSTV WVGNYI WVGQTV WVGTSTF WVSGS I WVSNYI WVSQTYL WVSTSYV YEAGTNV YEAPTNF

WVGGSVT WVGNYL WVGQTYF WVGTSTI WVSGS L WVSNYL WVSQTYV WVSTTF YEAGTQF YEAPTNI

WVGGSVV WVGNYV WVGQTYI WVGTSTL WVSGSNV WVSNYV WVSQYF WVSTTI YEAGTQI YEAPTNL

WVGGSYF WVGPIDV WVGQTYL WVGTSTV WVSGSQF WVSPSNF WVSQYI WVSTTL YEAGTQL YEAPTNV

WVGGSYI WVGPSNF WVGQTYV WVGTSV WVSGSQI WVSPSNI WVSQYL WVSTT F YEAGTQV YEAPTQF

WVGGSYL WVGPSNI WVGQYF WVGTSYF WVSGSQL WVSPSNL WVSQYV WVSTT I YEAGTSF YEAPTQI

WVGGSYV WVGPSNL WVGQYI WVGTSYI WVSGSQV WVSPSNV WVSSNF WVSTT L YEAGTSI YEAPTQL

WVGGTNF WVGPSNV WVGQYL WVGTSYL WVSGSSE WVSPSQF WVSSNI WVSTTNV YEAGTSL YEAPTQV

WVGGTNI WVGPSQF WVGQYV WVGTSYV WVSGSSF WVSPSQI WVSSNL WVSTTQF YEAGTSV YEAPTSF

WVGGT L WVGPSQI WVGRISF WVGTTF WVSGSSI WVSPSQL WVSSNV WVSTTQI YEAGTTF YEAPTSI

WVGGTNV WVGPSQL WVGRSSS WVGTTI WVSGSSL WVSPSQV WVSSQF WVSTTQL YEAGTTI YEAPTSL

WVGGTQF WVGPSQV WVGRSSV WVGTTL WVSGSSV WVSPSSF WVSSQI WVSTTQV YEAGTTL YEAPTSV

WVGGTQI WVGPSSF WVGSNF WVGTTNF WVSGSTF WVSPSSI WVSSQL WVSTTSF YEAGTTV YEAPTTF

WVGGTQL WVGPSSI WVGSNI WVGTTNI WVSGSTI WVSPSSL WVSSQV WVSTTSI YEAGTYF YEAPTTI

WVGGTQV WVGPSSL WVGSNL WVGTTNL WVSGSTL WVSPSSV WVSSSF WVSTTSL YEAGTYI YEAPTTL

WVGGTSF WVGPSSV WVGSNV WVGTTNV WVSGSTV WVSPSTF WVSSSI WVSTTSV YEAGTYL YEAPTTV

WVGGTSI WVGPSTF WVGSQF WVGTTQF WVSGSYF WVSPSTI WVSSSL WVSTTTF YEAGTYV YEAPTYF

WVGGTSL WVGPSTI WVGSQI WVGTTQI WVSGSYI WVSPSTL WVSSSNF WVSTTTI YEANNF YEAPTYI

WVGGTSV WVGPSTL WVGSQL WVGTTQL WVSGSYL WVSPSTV WVSSSNI WVSTTTL YEANNI YEAPTYL

WVGGTTF WVGPSTV WVGSQV WVGTTQV WVSGSYV WVSPSYF WVSSSNL WVSTTTV YEANNL YEAPTYV

WVGGTTI WVGPSYF WVGSSF WVGTTSF WVSGTNF WVSPSYI WVSSSNV WVSTTV YEA V YEAQNF

WVGGTTL WVGPSYI WVGSSI WVGTTSI WVSGTNI WVSPSYL WVSSSQF WVSTTYF YEANQF YEAQNI

WVGGTTV WVGPSYL WVGSSL WVGTTSL WVSGTNL WVSPSYV WVSSSQI WVSTTYI YEANQI YEAQ L

WVGGTYF WVGPSYV WVGSSMV WVGTTSV WVSGTNV WVSPTNF WVSSSQL WVSTTYL YEANQL YEAQNV

WVGGTYI WVGPT F WVGSSNF WVGTTTF WVSGTQF WVSPTNI WVSSSQV WVSTTYV YEANQV YEAQQF

WVGGTYL WVGPTNI WVGSSNI WVGTTTI WVSGTQI WVSPTNL WVSSSSF WVSTYF YEANSF YEAQQI

WVGGTYV WVGPT L WVGSSNL WVGTTTL WVSGTQL WVSPTNV WVSSSSI WVSTYI YEANSI YEAQQL

WVGGVSV WVGPTNV WVGSSNV WVGTTTV WVSGTQV WVSPTQF WVSSSSL WVSTYL YEANSL YEAQQV

WVGGWII WVGPTQF WVGSSQF WVGTTV WVSGTSF WVSPTQI wvssssv WVSTYV YEANSNF YEAQSF

WVGGYHR WVGPTQI WVGSSQI WVGTTYF WVSGTSI WVSPTQL WVSSSTF wvswssv YEANSNI YEAQSI

WVGGYSE WVGPTQL WVGSSQL WVGTTYI WVSGTSL WVSPTQV WVSSSTI WVSYNF YEANSNL YEAQSL

WVGISFW WVGPTQV WVGSSQV WVGTTYL WVSGTSV WVSPTSF WVSSSTL WVSYNI YEANSNV YEAQSNF

WVGKGLW WVGPTSF WVGSSSF WVGTTYV WVSGTTF WVSPTSI WVSSSTV WVSYNL YEANSQF YEAQSNI

WVGKSAV WVGPTSI WVGSSSI WVGTYF WVSGTTI WVSPTSL wvsssv WVSYNV YEANSQI YEAQSNL

WVGKSGK WVGPTSL WVGSSSL WVGTYI WVSGTTL WVSPTSV WVSSSYF WVSYQF YEANSQL YEAQSNV

WVGKSYG WVGPTSV WVGSSSV WVGTYL WVSGTTV WVSPTTF WVSSSYI WVSYQI YEANSQV YEAQSQF

WVGKYTV WVGPTTF WVGSSTF WVGTYV WVSGTYF WVSPTTI WVSSSYL WVSYQL YEANSSF YEAQSQI

WVGLTSW WVGPTTI WVGSSTI WVGVSAV WVSGTYI WVSPTTL WVSSSYV WVSYQV YEANSSI YEAQSQL

WVGNHSV WVGPTTL WVGSSTL WVGVSSV WVSGTYL WVSPTTV WVSSTF WVSYSF YEANSSL YEAQSQV

WVGNNF WVGPTTV WVGSSTV WVGWDSL WVSGTYV WVSPTYF WVSSTI WVSYSI YEANSSV YEAQSSF

WVGNNI WVGPTYF WVGSSV WVGWFSV WVS F WVSPTYI WVSSTL WVSYSL YEANSTF YEAQSSI

WVGNNL WVGPTYI WVGSSYF WVGWPSV WVSNNI WVSPTYL WVSSTNF WVSYSV YEANSTI YEAQSSL

WVGNNV WVGPTYL WVGSSYI WVGWSSV WVSNNL WVSPTYV WVSSTNI WVSYTF YEANSTL YEAQSSV

WVGNQF WVGPTYV WVGSSYL WVGYNF WVSNNV WVSQNF WVSSTNL WVSYTI YEANSTV YEAQSTF

WVGNQI WVGPYSG WVGSSYV WVGYNI WVSNQF WVSQNI WVSSTNV WVSYTL YEANSV YEAQSTI

WVGNQL WVGQNF WVGSTF WVGY L WVSNQI WVSQNL WVSSTQF WVSYTV YEANSYF YEAQSTL

WVGNQV WVGQNI WVGSTI WVGYNV WVSNQL WVSQNV WVSSTQI WVSYYF YEANSYI YEAQSTV

WVGNSF WVGQ L WVGSTL WVGYQF WVSNQV WVSQQF WVSSTQL WVSYYI YEANSYL YEAQSV

WVGNSI WVGQNV WVGSTNF WVGYQI WVSNSF WVSQQI WVSSTQV WVSYYL YEANSYV YEAQSYF

WVGNSL WVGQQF WVGSTNI WVGYQL WVS SI WVSQQL WVSSTSF WVSYYV YEANTF YEAQSYI

WVGNSNF WVGQQHR WVGSTNL WVGYQV WVSNSL WVSQQV WVSSTSI WVTESSV YEANTI YEAQSYL

WVGNSNI WVGQQI WVGSTNV WVGYSF WVSNSNF WVSQSF WVSSTSL WVVGDKV YEANTL YEAQSYV

WVGNSNL WVGQQL WVGSTQF WVGYSI WVSNSNI WVSQSI WVSSTSV WVVGDSG YEANTNF YEAQTF

WVGNSNV WVGQQV WVGSTQI WVGYSL WVSNSNL WVSQSL WVSSTTF WVVGSSH YEANTNI YEAQTI

WVGNSQF WVGQSF WVGSTQL WVGYSSV WVSNSNV WVSQSNF WVSSTTI WVVGSSV YEANTNL YEAQTL

WVGNSQI WVGQSI WVGSTQV WVGYSV WVSNSQF WVSQSNI WVSSTTL WVWGSAG YEANTNV YEAQTNF

WVGNSQL WVGQSL WVGSTSF WVGYTF WVSNSQI WVSQSNL WVSSTTV WVWGSYV YEANTQF YEAQT I

WVGNSQV WVGQSNF WVGSTSI WVGYTI WVSNSQL WVSQSNV WVSSTV WVYGSSY YEANTQI YEAQT L

WVGNSSF WVGQSNI WVGSTSL WVGYTL WVSNSQV WVSQSQF WVSSTYF WVYHSSH YEANTQL YEAQTNV

WVGNSSI WVGQSNL WVGSTSV WVGYTV WVSNSSF WVSQSQI WVSSTYI WWGGALV YEANTQV YEAQTQF

WVGNSSL WVGQSNV WVGSTTF WVGYYF WVS SSI WVSQSQL WVSSTYL WWGGSLV YEANTSF YEAQTQI

WVGNSSV WVGQSQF WVGSTTI WVGYYI WVSNSSL WVSQSQV WVSSTYV WWQDGIV YEANTSI YEAQTQL

WVGNSTF WVGQSQI WVGSTTL WVGYYL WVSNSSV WVSQSSF WVSSYF WWWGSSG YEANTSL YEAQTQV

WVGNSTI WVGQSQL WVGSTTV WVGYYV WVSNSTF WVSQSSI WVSSYI WYFWSIG YEANTSV YEAQTSF

WVGNSTL WVGQSQV WVGSTV WVHGLVN WVSNSTI WVSQSSL WVSSYL WYGEISV YEANTTF YEAQTSI

WVGNSTV WVGQSSF WVGSTYF WVHGPSL WVS STL WVSQSSV WVSSYV WYGGSMY YEANTTI YEAQTSL

WVGNSV WVGQSSI WVGSTYI WVHGPSV WVSNSTV WVSQSTF WVST F WYGGWSA YEANTTL YEAQTSV

WVGNSYF WVGQSSL WVGSTYL WVHGSKF WVSNSV WVSQSTI WVST I WYLGISV YEANTTV YEAQTTF

WVGNSYI WVGQSSV WVGSTYV WVHHSPV WVSNSYF WVSQSTL WVST L WYTYSKY YEANTV YEAQTTI

WVGNSYL WVGQSTF WVGSYF WVIGGVR WVSNSYI WVSQSTV WVSTNV YAGGNSN YEANTYF YEAQTTL

WVGNSYV WVGQSTI WVGSYI WVIISSD WVSNSYL WVSQSV WVSTQF YAGMSIY YEANTYI YEAQTTV

WVGNTF WVGQSTL WVGSYL WVIMISV WVSNSYV WVSQSYF WVSTQI YAGQSSP YEANTYL YEAQTV

WVGNTI WVGQSTV WVGSYV WVIPSHV WVSNTF WVSQSYI WVSTQL YAKGNSS YEANTYV YEAQTYF

WVGNTL WVGQSV WVGTNF WVIWSVV WVSNTI WVSQSYL WVSTQV YDGGQSV YEANYF YEAQTYI

WVGNTNF WVGQSYF WVGTNI WVKGSAY WVSNTL WVSQSYV WVSTSF YEAGSNF YEANYI YEAQTYL

WVGNT I WVGQSYI WVGTNL WVLGEEV WVSNTNF WVSQTF WVSTSI YEAGSNI YEANYL YEAQTYV

WVGNT L WVGQSYL WVGTNV WVLGFPV WVSNTNI WVSQTI WVSTSL YEAGSNL YEA YV YEAQYF

WVGNTNV WVGQSYV WVGTQF WVLGILV WVSNTNL WVSQTL WVSTSNF YEAGSNV YEAPSNF YEAQYI

WVGNTQF WVGQTF WVGTQI WVLGSDT WVSNTNV WVSQTNF WVSTSNI YEAGSQF YEAPSNI YEAQYL

WVGNTQI WVGQTI WVGTQL WVLGSSE WVSNTQF WVSQTNI WVSTSNL YEAGSQI YEAPSNL YEAQYV

WVGNTQL WVGQTL WVGTQV WVLGSSV WVSNTQI WVSQTNL WVSTSNV YEAGSQL YEAPSNV YEASNF

WVGNTQV WVGQT F WVGTSF WVMGLQQ WVSNTQL WVSQTNV WVSTSQF YEAGSQV YEAPSQF YEASNI YEASNL YEATTQF YEGNSNI YEGQSI YEGSTSL YESGSNL YESNYV YESQYF YESTTI YNAGSYI

YEASNV YEATTQI YEGNSNL YEGQSL YEGSTSV YESGSNV YESPSNF YESQYI YESTTL YNAGSYL

YEASQF YEATTQL YEGNSNV YEGQSNF YEGSTTF YESGSQF YESPSNI YESQYL YESTTNF YNAGSYV

YEASQI YEATTQV YEGNSQF YEGQSNI YEGSTTI YESGSQI YESPSNL YESQYV YESTTNI YNAGTNF

YEASQL YEATTSF YEGNSQI YEGQSNL YEGSTTL YESGSQL YESPSNV YESSNF YESTTNL YNAGTNI

YEASQV YEATTSI YEGNSQL YEGQSNV YEGSTTV YESGSQV YESPSQF YESSNI YESTTNV YNAGTNL

YEASSF YEATTSL YEGNSQV YEGQSQF YEGSTV YESGSSF YESPSQI YESSNL YESTTQF YNAGTNV

YEASSI YEATTSV YEGNSSF YEGQSQI YEGSTYF YESGSSI YESPSQL YESSNV YESTTQI YNAGTQF

YEASSL YEATTTF YEGNSSI YEGQSQL YEGSTYI YESGSSL YESPSQV YESSQF YESTTQL YNAGTQI

YEASSNF YEATTTI YEGNSSL YEGQSQV YEGSTYL YESGSSV YESPSSF YESSQI YESTTQV YNAGTQL

YEASSNI YEATTTL YEGNSSV YEGQSSF YEGSTYV YESGSTF YESPSSI YESSQL YESTTSF YNAGTQV

YEASSNL YEATTTV YEGNSTF YEGQSSI YEGSYF YESGSTI YESPSSL YESSQV YESTTSI YNAGTSF

YEASSNV YEATTV YEGNSTI YEGQSSL YEGSYI YESGSTL YESPSSV YESSSF YESTTSL YNAGTSI

YEASSQF YEATTYF YEGNSTL YEGQSSV YEGSYL YESGSTV YESPSTF YESSSI YESTTSV YNAGTSL

YEASSQI YEATTYI YEGNSTV YEGQSTF YEGSYV YESGSYF YESPSTI YESSSL YESTTTF YNAGTSV

YEASSQL YEATTYL YEGNSV YEGQSTI YEGTNF YESGSYI YESPSTL YESSSNF YESTTTI YNAGTTF

YEASSQV YEATTYV YEGNSYF YEGQSTL YEGTNI YESGSYL YESPSTV YESSSNI YESTTTL YNAGTTI

YEASSSF YEATYF YEGNSYI YEGQSTV YEGTNL YESGSYV YESPSYF YESSSNL YESTTTV YNAGTTL

YEASSSI YEATYI YEGNSYL YEGQSV YEGTNV YESGTNF YESPSYI YESSSNV YESTTV YNAGTTV

YEASSSL YEATYL YEGNSYV YEGQSYF YEGTQF YESGTNI YESPSYL YESSSQF YESTTYF YNAGTYF

YEASSSV YEATYV YEGNTF YEGQSYI YEGTQI YESGTNL YESPSYV YESSSQI YESTTYI YNAGTYI

YEASSTF YEAYNF YEGNTI YEGQSYL YEGTQL YESGTNV YESPTNF YESSSQL YESTTYL YNAGTYL

YEASSTI YEAYNI YEGNTL YEGQSYV YEGTQV YESGTQF YESPTNI YESSSQV YESTTYV YNAGTYV

YEASSTL YEAYNL YEGNTNF YEGQTF YEGTSF YESGTQI YESPTNL YESSSSF YESTYF YNANNF

YEASSTV YEAYNV YEGNTNI YEGQTI YEGTSI YESGTQL YESPTNV YESSSSI YESTYI YNANNI

YEASSV YEAYQF YEGNTNL YEGQTL YEGTSL YESGTQV YESPTQF YESSSSL YESTYL YNANNL

YEASSYF YEAYQI YEGNTNV YEGQTNF YEGTSNF YESGTSF YESPTQI YESSSSV YESTYV YNANNV

YEASSYI YEAYQL YEGNTQF YEGQTNI YEGTSNI YESGTSI YESPTQL YESSSTF YESYNF YNANQF

YEASSYL YEAYQV YEGNTQI YEGQTNL YEGTSNL YESGTSL YESPTQV YESSSTI YESYNI YNANQI

YEASSYV YEAYSF YEGNTQL YEGQTNV YEGTSNV YESGTSV YESPTSF YESSSTL YESYNL YNANQL

YEASTF YEAYSI YEGNTQV YEGQTQF YEGTSQF YESGTTF YESPTSI YESSSTV YESYNV YNANQV

YEASTI YEAYSL YEGNTSF YEGQTQI YEGTSQI YESGTTI YESPTSL YESSSV YESYQF YNANSF

YEASTL YEAYSV YEGNTSI YEGQTQL YEGTSQL YESGTTL YESPTSV YESSSYF YESYQI YNANSI

YEASTNF YEAYTF YEGNTSL YEGQTQV YEGTSQV YESGTTV YESPTTF YESSSYI YESYQL YNANSL

YEAST I YEAYTI YEGNTSV YEGQTSF YEGTSSF YESGTYF YESPTTI YESSSYL YESYQV YNANSNF

YEAST L YEAYTL YEGNTTF YEGQTSI YEGTSSI YESGTYI YESPTTL YESSSYV YESYSF YNANSNI

YEASTNV YEAYTV YEGNTTI YEGQTSL YEGTSSL YESGTYL YESPTTV YESSTF YESYSI YNANSNL

YEASTQF YEAYYF YEGNTTL YEGQTSV YEGTSSV YESGTYV YESPTYF YESSTI YESYSL YNANSNV

YEASTQI YEAYYI YEGNTTV YEGQTTF YEGTSTF YESNNF YESPTYI YESSTL YESYSV YNANSQF

YEASTQL YEAYYL YEGNTV YEGQTTI YEGTSTI YESNNI YESPTYL YESSTNF YESYTF YNANSQI

YEASTQV YEAYYV YEGNTYF YEGQTTL YEGTSTL YESNNL YESPTYV YESSTNI YESYTI YNANSQL

YEASTSF YEGFSVV YEGNTYI YEGQTTV YEGTSTV YESNNV YESQNF YESSTNL YESYTL YNANSQV

YEASTSI YEGGASF YEGNTYL YEGQTV YEGTSV YESNQF YESQNI YESSTNV YESYTV YNANSSF

YEASTSL YEGGNQV YEGNTYV YEGQTYF YEGTSYF YESNQI YESQNL YESSTQF YESYYF YNANSSI

YEASTSV YEGGSNF YEGNYF YEGQTYI YEGTSYI YESNQL YESQNV YESSTQI YESYYI YNANSSL

YEASTTF YEGGSNI YEGNYI YEGQTYL YEGTSYL YESNQV YESQQF YESSTQL YESYYL YNANSSV

YEASTTI YEGGSNL YEGNYL YEGQTYV YEGTSYV YESNSF YESQQI YESSTQV YESYYV YNANSTF

YEASTTL YEGGSNV YEGNYV YEGQYF YEGTTF YESNSI YESQQL YESSTSF YEVNSDA YNANSTI

YEASTTV YEGGSQF YEGPSNF YEGQYI YEGTTI YESNSL YESQQV YESSTSI YFDGESR YNANSTL

YEASTV YEGGSQI YEGPSNI YEGQYL YEGTTL YESNSNF YESQSF YESSTSL YFGGVSV YNANSTV

YEASTYF YEGGSQL YEGPSNL YEGQYV YEGTTNF YESNSNI YESQSI YESSTSV YFNGSSV YNANSV

YEASTYI YEGGSQV YEGPSNV YEGSNF YEGTTNI YESNSNL YESQSL YESSTTF YFNWKHK YNANSYF

YEASTYL YEGGSSF YEGPSQF YEGSNI YEGTTNL YESNSNV YESQSNF YESSTTI YFSKSSR YNANSYI

YEASTYV YEGGSSI YEGPSQI YEGSNL YEGTTNV YESNSQF YESQSNI YESSTTL YGGGSPV YNANSYL

YEASYF YEGGSSL YEGPSQL YEGSNV YEGTTQF YESNSQI YESQSNL YESSTTV YGGGSSF YNANSYV

YEASYI YEGGSSV YEGPSQV YEGSQF YEGTTQI YESNSQL YESQSNV YESSTV YGMGSSL YNANTF

YEASYL YEGGSTF YEGPSSF YEGSQI YEGTTQL YESNSQV YESQSQF YESSTYF YGPLSSW ΥΝΑΝΤΊ

YEASYV YEGGSTI YEGPSSI YEGSQL YEGTTQV YESNSSF YESQSQI YESSTYI YHDYSSE YNANTL

YEATNF YEGGSTL YEGPSSL YEGSQV YEGTTSF YESNSSI YESQSQL YESSTYL YHEVNSV YNANTNF

YEATNI YEGGSTV YEGPSSV YEGSSF YEGTTSI YESNSSL YESQSQV YESSTYV YHGGRSV YNANTNI

YEATNL YEGGSYF YEGPSTF YEGSSI YEGTTSL YESNSSV YESQSSF YESSYF YHGGSSK YNANTNL

YEATNV YEGGSYI YEGPSTI YEGSSL YEGTTSV YESNSTF YESQSSI YESSYI YHGGSSV YNANTNV

YEATQF YEGGSYL YEGPSTL YEGSSNF YEGTTTF YESNSTI YESQSSL YESSYL YHGNRSV YNANTQF

YEATQI YEGGSYV YEGPSTV YEGSSNI YEGTTTI YESNSTL YESQSSV YESSYV YIAGTID YNANTQI

YEATQL YEGGTNF YEGPSYF YEGSSNL YEGTTTL YESNSTV YESQSTF YESTNF YIGGSSD YNANTQL

YEATQV YEGGTNI YEGPSYI YEGSSNV YEGTTTV YESNSV YESQSTI YESTNI YIGGSSV YNANTQV

YEATSF YEGGTNL YEGPSYL YEGSSQF YEGTTV YESNSYF YESQSTL YESTNL YIGRSSV YNANTSF

YEATSI YEGGTNV YEGPSYV YEGSSQI YEGTTYF YESNSYI YESQST YESTNV YIGVQYE YNANTSI

YEATSL YEGGTQF YEGPTNF YEGSSQL YEGTTYI YESNSYL YESQSV YESTQF YKEPRHV YNANTSL

YEATSNF YEGGTQI YEGPTNI YEGSSQV YEGTTYL YESNSYV YESQSYF YESTQI YKGDFSV YNANTSV

YEATS I YEGGTQL YEGPTNL YEGSSSD YEGTTYV YESNTF YESQSYI YESTQL YKGGHHV YNANTTF

YEATS L YEGGTQV YEGPTNV YEGSSSF YEGTYF YESNTI YESQSYL YESTQV YKGGSDV YNANTTI

YEATSNV YEGGTSF YEGPTQF YEGSSSI YEGTYI YESNTL YESQSYV YESTSF YKGGSEN YNANTTL

YEATSQF YEGGTSI YEGPTQI YEGSSSL YEGTYL YESNTNF YESQTF YESTSI YKGGSVV YNANTTV

YEATSQI YEGGTSL YEGPTQL YEGSSSV YEGTYV YESNTNI YESQTI YESTSL YKGGWDV YNANTV

YEATSQL YEGGTSV YEGPTQV YEGSSTF YEGYNF YESNTNL YESQTL YESTSNF YLGGNNE YNANTYF

YEATSQV YEGGTTF YEGPTSF YEGSSTI YEGYNI YESNTNV YESQTNF YESTSNI YLHGHEA YNANTYI

YEATSSF YEGGTTI YEGPTSI YEGSSTL YEGYNL YESNTQF YESQTNI YESTSNL YMGGSPV YNANTYL

YEATSSI YEGGTTL YEGPTSL YEGSSTV YEGYNV YESNTQI YESQTNL YESTSNV YMGWSSN YNANTYV

YEATSSL YEGGTTV YEGPTSV YEGSSV YEGYQF YESNTQL YESQTNV YESTSQF YMWGTSV YNANYF

YEATSSV YEGGTYF YEGPTTF YEGSSYF YEGYQI YESNTQV YESQTQF YESTSQI YNAGSNF YNANYI

YEATSTF YEGGTYI YEGPTTI YEGSSYI YEGYQL YESNTSF YESQTQI YESTSQL YNAGSNI YNANYL

YEATSTI YEGGTYL YEGPTTL YEGSSYL YEGYQV YESNTSI YESQTQL YESTSQV YNAGSNL YNANYV

YEATSTL YEGGTYV YEGPTTV YEGSSYV YEGYSF YESNTSL YESQTQV YESTSSF YNAGSNV YNAPSNF

YEATSTV YEGGVSQ YEGPTYF YEGSTF YEGYSI YESNTSV YESQTSF YESTSSI YNAGSQF YNAPSNI

YEATSV YEGNNF YEGPTYI YEGSTI YEGYSL YESNTTF YESQTSI YESTSSL YNAGSQI YNAPSNL

YEATSYF YEGNNI YEGPTYL YEGSTL YEGYSV YESNTTI YESQTSL YESTSSV YNAGSQL YNAPSNV

YEATSYI YEGNNL YEGPTYV YEGSTNF YEGYTF YESNTTL YESQTSV YESTSTF YNAGSQV YNAPSQF

YEATSYL YEGNNV YEGQNF YEGSTNI YEGYTI YESNTTV YESQTTF YESTSTI YNAGSSF YNAPSQI

YEATSYV YEGNQF YEGQNI YEGSTNL YEGYTL YESNTV YESQTTI YESTSTL YNAGSSI YNAPSQL

YEATTF YEGNQI YEGQNL YEGSTNV YEGYTV YESNTYF YESQTTL YESTSTV YNAGSSL YNAPSQV

YEATTI YEGNQL YEGQNV YEGSTQF YEGYYF YESNTYI YESQTTV YESTSV YNAGSSV YNAPSSF

YEATTL YEGNQV YEGQQF YEGSTQI YEGYYI YESNTYL YESQTV YESTSYF YNAGSTF YNAPSSI

YEATTNF YEGNSF YEGQQI YEGSTQL YEGYYL YESNTYV YESQTYF YESTSYI YNAGSTI YNAPSSL

YEATTNI YEGNSI YEGQQL YEGSTQV YEGYYV YESNYF YESQTYI YESTSYL YNAGSTL YNAPSSV

YE ATT L YEGNSL YEGQQV YEGSTSF YESGSNF YESNYI YESQTYL YESTSYV YNAGSTV YNAPSTF

YE ATTN V YEGNSNF YEGQSF YEGSTSI YESGSNI YESNYL YESQTYV YESTTF YNAGSYF YNAPSTI YNAPSTL YNASSNF YNATTTI YNGNSSL YNGQSQV YNGSTYV YNSGSSL YNSPSQV YNSSQF YNSTTQL

YNAPSTV YNASSNI YNATTTL YNGNSSV YNGQSSF YNGSYF YNSGSSV YNSPSSF YNSSQI YNSTTQV

YNAPSYF YNASSNL YNATTTV YNGNSTF YNGQSSI YNGSYI YNSGSTF YNSPSSI YNSSQL YNSTTSF

YNAPSYI YNASSNV YNATTV YNGNSTI YNGQSSL YNGSYL YNSGSTI YNSPSSL YNSSQV YNSTTSI

YNAPSYL YNASSQF YNATTYF YNGNSTL YNGQSSV YNGSYV YNSGSTL YNSPSSV YNSSSF Y STTSL

YNAPSYV YNASSQI YNATTYI YNGNSTV YNGQSTF YNGTNF YNSGSTV YNSPSTF YNSSSI YNSTTSV

YNAPTNF YNASSQL YNATTYL YNGNSV YNGQSTI YNGTNI YNSGSYF YNSPSTI YNSSSL YNSTTTF

YNAPTNI YNASSQV YNATTYV YNGNSYF YNGQSTL YNGTNL YNSGSYI YNSPSTL YNSSSNF YNSTTTI

YNAPTNL YNASSSF YNATYF YNGNSYI YNGQSTV YNGTNV YNSGSYL YNSPSTV YNSSSNI YNSTTTL

YNAPTNV YNASSSI YNATYI YNGNSYL YNGQSV YNGTQF YNSGSYV YNSPSYF YNSSS L YNSTTTV

YNAPTQF YNASSSL YNATYL YNGNSYV YNGQSYF YNGTQI YNSGTNF YNSPSYI YNSSSNV YNSTTV

YNAPTQI YNASSSV YNATYV YNGNTF YNGQSYI YNGTQL YNSGTNI YNSPSYL YNSSSQF YNSTTYF

YNAPTQL YNASSTF Y AYNF YNGNTI YNGQSYL YNGTQV YNSGTNL YNSPSYV YNSSSQI YNSTTYI

YNAPTQV YNASSTI YNAYNI YNGNTL YNGQSYV YNGTSF YNSGTNV YNSPTNF YNSSSQL YNSTTYL

YNAPTSF YNASSTL Y AYNL YNGNTNF YNGQTF YNGTSI YNSGTQF YNSPTNI YNSSSQV YNSTTYV

YNAPTSI YNASSTV YNAYNV YNGNTNI YNGQTI YNGTSL YNSGTQI YNSPTNL YNSSSSF Y STYF

YNAPTSL YNASSV YNAYQF YNGNTNL YNGQTL YNGTSNF YNSGTQL YNSPTNV YNSSSSI Y STYI

YNAPTSV YNASSYF YNAYQI YNGNTNV YNGQTNF YNGTSNI YNSGTQV YNSPTQF YNSSSSL Y STYL

YNAPTTF YNASSYI YNAYQL YNGNTQF YNGQTNI YNGTSNL YNSGTSF YNSPTQI YNSSSSV Y STYV

YNAPTTI YNASSYL YNAYQV YNGNTQI YNGQTNL YNGTSNV YNSGTSI YNSPTQL YNSSSTF YNSYNF

YNAPTTL YNASSYV YNAYSF YNGNTQL YNGQTNV YNGTSQF YNSGTSL YNSPTQV YNSSSTI YNSYNI

YNAPTTV YNASTF YNAYSI YNGNTQV YNGQTQF YNGTSQI YNSGTSV YNSPTSF YNSSSTL YNSYNL

YNAPTYF YNASTI YNAYSL YNGNTSF YNGQTQI YNGTSQL YNSGTTF YNSPTSI YNSSSTV YNSYNV

YNAPTYI YNASTL YNAYSV YNGNTSI YNGQTQL YNGTSQV YNSGTTI YNSPTSL YNSSSV YNSYQF

YNAPTYL YNAST F YNAYTF YNGNTSL YNGQTQV YNGTSSF YNSGTTL YNSPTSV YNSSSYF YNSYQI

YNAPTYV YNASTNI YNAYTI YNGNTSV YNGQTSF YNGTSSI YNSGTTV YNSPTTF YNSSSYI YNSYQL

YNAQNF YNASTNL YNAYTL YNGNTTF YNGQTSI YNGTSSL YNSGTYF YNSPTTI YNSSSYL YNSYQV

YNAQNI YNASTNV YNAYTV YNGNTTI YNGQTSL YNGTSSV YNSGTYI YNSPTTL YNSSSYV YNSYSF

YNAQNL YNASTQF YNAYYF YNGNTTL YNGQTSV YNGTSTF YNSGTYL YNSPTTV YNSSTF YNSYSI

YNAQNV YNASTQI YNAYYI YNGNTTV YNGQTTF YNGTSTI YNSGTYV YNSPTYF YNSSTI YNSYSL

YNAQQF YNASTQL YNAYYL YNGNTV YNGQTTI YNGTSTL YNSNNF YNSPTYI YNSSTL Y SYS

YNAQQI YNASTQV YNAYYV YNGNTYF YNGQTTL YNGTSTV YNSNNI YNSPTYL YNSSTNF YNSYTF

YNAQQL YNASTSF YNFGDSL YNGNTYI YNGQTTV YNGTSV YNSNNL YNSPTYV YNSSTNI YNSYTI

YNAQQV YNASTSI YNGGDSP YNGNTYL YNGQTV YNGTSYF YNSNNV YNSQNF YNSSTNL YNSYTL

YNAQSF YNASTSL YNGGPSV YNGNTYV YNGQTYF YNGTSYI YNSNQF YNSQNI YNSSTNV YNSYTV

YNAQSI YNASTSV YNGGSNF YNGNYF YNGQTYI YNGTSYL YNSNQI YNSQNL YNSSTQF Y SYYF

YNAQSL YNASTTF YNGGSNI YNGNYI YNGQTYL YNGTSYV YNSNQL YNSQNV YNSSTQI YNSYYI

YNAQSNF YNASTTI YNGGSNL YNGNYL YNGQTYV YNGTTF YNSNQV YNSQQF YNSSTQL YNSYYL

YNAQSNI YNASTTL YNGGSNV YNGNYV YNGQYF YNGTTI YNSNSF YNSQQI YNSSTQV YNSYYV

YNAQSNL YNASTTV YNGGSQF YNGPSNF YNGQYI YNGTTL YNSNSI YNSQQL YNSSTSF YNWGQSS

YNAQSNV YNASTV YNGGSQI YNGPSNI YNGQYL YNGTTNF YNSNSL YNSQQV YNSSTSI YPGGNSA

YNAQSQF YNASTYF YNGGSQL YNGPSNL YNGQYV YNGTTNI YNSNSNF YNSQSF YNSSTSL YPGGRAS

YNAQSQI YNASTYI YNGGSQV YNGPSNV YNGSNF YNGTTNL YNSNSNI YNSQSI YNSSTSV YPGPNAF

YNAQSQL YNASTYL YNGGSSF YNGPSQF YNGSNI YNGTTNV YNSNSNL YNSQSL YNSSTTF YPGQQSL

YNAQSQV YNASTYV YNGGSSI YNGPSQI YNGSNL YNGTTQF YNSNSNV YNSQSNF YNSSTTI YPPFSSP

YNAQSSF YNASYF YNGGSSL YNGPSQL YNGSNV YNGTTQI YNSNSQF YNSQSNI YNSSTTL YQADSAN

YNAQSSI YNASYI YNGGSSV YNGPSQV YNGSQF YNGTTQL YNSNSQI YNSQSNL YNSSTTV YQAGSNF

YNAQSSL YNASYL YNGGSTF YNGPSSF YNGSQI YNGTTQV YNSNSQL YNSQSNV YNSSTV YQAGSNI

YNAQSSV YNASYV YNGGSTI YNGPSSI YNGSQL YNGTTSF YNSNSQV YNSQSQF YNSSTYF YQAGSNL

YNAQSTF YNATNF YNGGSTL YNGPSSL YNGSQV YNGTTSI YNSNSSF YNSQSQI YNSSTYI YQAGSNV

YNAQSTI YNATNI YNGGSTV YNGPSSV YNGSSF YNGTTSL YNSNSSI YNSQSQL YNSSTYL YQAGSQF

YNAQSTL YNATNL YNGGSYF YNGPSTF YNGSSI YNGTTSV YNSNSSL YNSQSQV YNSSTYV YQAGSQI

YNAQSTV YNATNV YNGGSYI YNGPSTI YNGSSL YNGTTTF YNSNSSV YNSQSSF YNSSYF YQAGSQL

YNAQSV YNATQF YNGGSYL YNGPSTL YNGSSNF YNGTTTI YNSNSTF YNSQSSI YNSSYI YQAGSQV

YNAQSYF YNATQI YNGGSYV YNGPSTV YNGSSNI YNGTTTL YNSNSTI YNSQSSL YNSSYL YQAGSSF

YNAQSYI YNATQL YNGGTNF YNGPSYF YNGSSNL YNGTTTV YNSNSTL YNSQSSV YNSSYV YQAGSSI

YNAQSYL YNATQV YNGGTNI YNGPSYI YNGSSNV YNGTTV YNSNSTV YNSQSTF YNSTNF YQAGSSL

YNAQSYV YNATSF YNGGTNL YNGPSYL YNGSSQF YNGTTYF YNSNSV YNSQSTI YNSTNI YQAGSSV

YNAQTF YNATSI YNGGTNV YNGPSYV YNGSSQI YNGTTYI YNSNSYF YNSQSTL YNSTNL YQAGSTF

YNAQTI YNATSL YNGGTQF YNGPTNF YNGSSQL YNGTTYL YNSNSYI YNSQSTV YNSTNV YQAGSTI

YNAQTL YNATS F YNGGTQI YNGPTNI YNGSSQV YNGTTYV YNSNSYL YNSQSV YNSTQF YQAGSTL

YNAQTNF YNATSNI YNGGTQL YNGPTNL YNGSSSF YNGTYF YNSNSYV YNSQSYF YNSTQI YQAGSTV

YNAQTNI YNATSNL YNGGTQV YNGPTNV YNGSSSI YNGTYI YNSNTF YNSQSYI YNSTQL YQAGSYF

YNAQTNL YNATSNV YNGGTSF YNGPTQF YNGSSSL YNGTYL YNSNTI YNSQSYL YNSTQV YQAGSYI

YNAQTNV YNATSQF YNGGTSI YNGPTQI YNGSSSV YNGTYV YNSNTL YNSQSYV YNSTSF YQAGSYL

YNAQTQF YNATSQI YNGGTSL YNGPTQL YNGSSTF YNGWRAV YNSNTNF YNSQTF YNSTSI YQAGSYV

YNAQTQI YNATSQL YNGGTSV YNGPTQV YNGSSTI YNGYNF YNSNTNI YNSQTI YNSTSL YQAGTNF

YNAQTQL YNATSQV YNGGTTF YNGPTSF YNGSSTL YNGYNI YNSNTNL YNSQTL YNSTSNF YQAGTNI

YNAQTQV YNATSSF YNGGTTI YNGPTSI YNGSSTV YNGYNL YNSNTNV YNSQTNF YNSTSNI YQAGTNL

YNAQTSF YNATSSI YNGGTTL YNGPTSL YNGSSV YNGYNV YNSNTQF YNSQTNI YNSTSNL YQAGTNV

YNAQTSI YNATSSL YNGGTTV YNGPTSV YNGSSYF YNGYQF YNSNTQI YNSQTNL YNSTSNV YQAGTQF

YNAQTSL YNATSSV YNGGTYF YNGPTTF YNGSSYI YNGYQI YNSNTQL YNSQTNV YNSTSQF YQAGTQI

YNAQTSV YNATSTF YNGGTYI YNGPTTI YNGSSYL YNGYQL YNSNTQV YNSQTQF YNSTSQI YQAGTQL

YNAQTTF YNATSTI YNGGTYL YNGPTTL YNGSSYV YNGYQV YNSNTSF YNSQTQI YNSTSQL YQAGTQV

YNAQTTI YNATSTL YNGGTYV YNGPTTV YNGSTF YNGYSF YNSNTSI YNSQTQL YNSTSQV YQAGTSF

YNAQTTL YNATSTV YNGIPNV YNGPTYF YNGSTI YNGYSI YNSNTSL YNSQTQV Y STSSF YQAGTSI

YNAQTTV YNATSV YNGNNF YNGPTYI YNGSTL YNGYSL YNSNTSV YNSQTSF YNSTSSI YQAGTSL

YNAQTV YNATSYF YNGNNI YNGPTYL YNGSTNF YNGYSV YNSNTTF YNSQTSI Y STSSL YQAGTSV

YNAQTYF YNATSYI YNGNNL YNGPTYV YNGSTNI YNGYTF YNSNTTI YNSQTSL YNSTSSV YQAGTTF

YNAQTYI YNATSYL YNGNNV YNGQNF YNGSTNL YNGYTI YNSNTTL YNSQTSV YNSTSTF YQAGTTI

YNAQTYL YNATSYV YNGNQF YNGQNI YNGSTNV YNGYTL YNSNTTV YNSQTTF YNSTSTI YQAGTTL

YNAQTYV YNATTF YNG QI YNGQNL YNGSTQF YNGYTV YNSNTV YNSQTTI YNSTSTL YQAGTTV

YNAQYF YNATTI YNGNQL YNGQNV YNGSTQI YNGYYF YNSNTYF YNSQTTL YNSTSTV YQAGTYF

YNAQYI YNATTL YNGNQV YNGQQF YNGSTQL YNGYYI YNSNTYI YNSQTTV YNSTSV YQAGTYI

YNAQYL Y ATT F YNGNSF YNGQQI YNGSTQV YNGYYL YNSNTYL YNSQTV Y STSYF YQAGTYL

YNAQYV YNATTNI YNGNSI YNGQQL YNGSTSF YNGYYV YNSNTYV YNSQTYF YNSTSYI YQAGTYV

YNAS F Y ATT L YNGNSL YNGQQV YNGSTSI YNLWSSV YNSNYF YNSQTYI YNSTSYL YQANNF

YNASNI YNATTNV YNGNSNF YNGQSF YNGSTSL YNSGSNF YNSNYI YNSQTYL YNSTSYV YQANNI

YNASNL YNATTQF YNGNSNI YNGQSI YNGSTSV YNSGSNI YNSNYL YNSQTYV YNSTTF YQANNL

YNASNV YNATTQI YNGNSNL YNGQSL YNGSTTF YNSGSNL YNSNYV YNSQYF YNSTTI YQANNV

YNASQF YNATTQL YNGNSNV YNGQSNF YNGSTTI YNSGSNV YNSPSNF YNSQYI YNSTTL YQANQF

YNASQI YNATTQV YNGNSQF YNGQSNI YNGSTTL YNSGSQF YNSPSNI YNSQYL YNSTTNF YQANQI

YNASQL YNATTSF YNG SQI YNGQSNL YNGSTTV YNSGSQI YNSPSNL YNSQYV YNSTTNI YQANQL

YNASQV YNATTSI YNGNSQL YNGQSNV YNGSTV YNSGSQL YNSPSNV YNSSNF YNSTTNL YQANQV

YNASSF YNATTSL YNGNSQV YNGQSQF YNGSTYF YNSGSQV YNSPSQF YNSSNI YNSTTNV YQANSF

YNASSI YNATTSV YNGNSSF YNGQSQI YNGSTYI YNSGSSF YNSPSQI YNSSNL YNSTTQF YQANSI

YNASSL YNATTTF YNGNSSI YNGQSQL YNGSTYL YNSGSSI YNSPSQL YNSSNV YNSTTQI YQANSL YQANSNF YQAQSF YQASTSL YQGGSNF YQGNYI YQGQTYL YQGTSYL YQSNQI YQSQNL YQSSTQF

YQANSNI YQAQSI YQASTSV YQGGSNI YQGNYL YQGQTYV YQGTSYV YQSNQL YQSQNV YQSSTQI

YQANSNL YQAQSL YQASTTF YQGGSNL YQGNYV YQGQYF YQGTTF YQSNQV YQSQQF YQSSTQL

YQANSNV YQAQSNF YQASTTI YQGGSNV YQGPSNF YQGQYI YQGTTI YQSNSF YQSQQI YQSSTQV

YQANSQF YQAQSNI YQASTTL YQGGSQF YQGPSNI YQGQYL YQGTTL YQSNSI YQSQQL YQSSTSF

YQANSQI YQAQSNL YQASTTV YQGGSQI YQGPSNL YQGQYV YQGTTNF YQSNSL YQSQQV YQSSTSI

YQANSQL YQAQSNV YQASTV YQGGSQL YQGPSNV YQGSNF YQGTTNI YQSNSNF YQSQSF YQSSTSL

YQANSQV YQAQSQF YQASTYF YQGGSQV YQGPSQF YQGSNI YQGTTNL YQSNSNI YQSQSI YQSSTSV

YQANSSF YQAQSQI YQASTYI YQGGSSF YQGPSQI YQGSNL YQGTTNV YQSNSNL YQSQSL YQSSTTF

YQANSSI YQAQSQL YQASTYL YQGGSSI YQGPSQL YQGSNV YQGTTQF YQSNSNV YQSQSNF YQSSTTI

YQANSSL YQAQSQV YQASTYV YQGGSSL YQGPSQV YQGSQF YQGTTQI YQSNSQF YQSQSNI YQSSTTL

YQANSSV YQAQSSF YQASYF YQGGSSV YQGPSSF YQGSQI YQGTTQL YQSNSQI YQSQSNL YQSSTTV

YQANSTF YQAQSSI YQASYI YQGGSTF YQGPSSI YQGSQL YQGTTQV YQSNSQL YQSQSNV YQSSTV

YQANSTI YQAQSSL YQASYL YQGGSTI YQGPSSL YQGSQV YQGTTSF YQSNSQV YQSQSQF YQSSTYF

YQANSTL YQAQSSV YQASYV YQGGSTL YQGPSSV YQGSSF YQGTTSI YQSNSSF YQSQSQI YQSSTYI

YQA ST YQAQSTF YQATNF YQGGSTV YQGPSTF YQGSSI YQGTTSL YQSNSSI YQSQSQL YQSSTYL

YQANSV YQAQSTI YQATNI YQGGSYF YQGPSTI YQGSSL YQGTTSV YQSNSSL YQSQSQV YQSSTYV

YQANSYF YQAQSTL YQATNL YQGGSYI YQGPSTL YQGSSNF YQGTTTF YQSNSSV YQSQSSF YQSSYF

YQANSYI YQAQSTV YQATNV YQGGSYL YQGPSTV YQGSSNI YQGTTTI YQSNSTF YQSQSSI YQSSYI

YQANSYL YQAQSV YQATQF YQGGSYV YQGPSYF YQGSSNL YQGTTTL YQSNSTI YQSQSSL YQSSYL

YQANSYV YQAQSYF YQATQI YQGGTNF YQGPSYI YQGSSNV YQGTTTV YQSNSTL YQSQSSV YQSSYV

YQANTF YQAQSYI YQATQL YQGGTNI YQGPSYL YQGSSQF YQGTTV YQSNSTV YQSQSTF YQSTNF

YQANTI YQAQSYL YQATQV YQGGTNL YQGPSYV YQGSSQI YQGTTYF YQSNSV YQSQSTI YQSTNI

YQANTL YQAQSYV YQATSF YQGGTNV YQGPTNF YQGSSQL YQGTTYI YQSNSYF YQSQSTL YQSTNL

YQANTNF YQAQTF YQATSI YQGGTQF YQGPTNI YQGSSQV YQGTTYL YQSNSYI YQSQSTV YQSTNV

YQANTNI YQAQTI YQATSL YQGGTQI YQGPTNL YQGSSSF YQGTTYV YQSNSYL YQSQSV YQSTQF

YQANTNL YQAQTL YQATS F YQGGTQL YQGPTNV YQGSSSI YQGTYF YQSNSYV YQSQSYF YQSTQI

YQANTNV YQAQTNF YQATS I YQGGTQV YQGPTQF YQGSSSL YQGTYI YQSNTF YQSQSYI YQSTQL

YQANTQF YQAQTNI YQATS L YQGGTSF YQGPTQI YQGSSSV YQGTYL YQSNTI YQSQSYL YQSTQV

YQANTQI YQAQTNL YQATSNV YQGGTSI YQGPTQL YQGSSTF YQGTYV YQSNTL YQSQSYV YQSTSF

YQANTQL YQAQTNV YQATSQF YQGGTSL YQGPTQV YQGSSTI YQGWWSV YQSNTNF YQSQTF YQSTSI

YQANTQV YQAQTQF YQATSQI YQGGTSV YQGPTSF YQGSSTL YQGYNF YQSNTNI YQSQTI YQSTSL

YQANTSF YQAQTQI YQATSQL YQGGTTF YQGPTSI YQGSSTV YQGYNI YQSNTNL YQSQTL YQSTSNF

YQANTSI YQAQTQL YQATSQV YQGGTTI YQGPTSL YQGSSV YQGYNL YQSNTNV YQSQTNF YQSTSNI

YQANTSL YQAQTQV YQATSSF YQGGTTL YQGPTSV YQGSSYF YQGYNV YQSNTQF YQSQTNI YQSTSNL

YQANTSV YQAQTSF YQATSSI YQGGTTV YQGPTTF YQGSSYI YQGYQF YQSNTQI YQSQTNL YQSTSNV

YQAIMTTF YQAQTSI YQATSSL YQGGTYF YQGPTTI YQGSSYL YQGYQI YQSNTQL YQSQTNV YQSTSQF

YQANTTI YQAQTSL YQATSSV YQGGTYI YQGPTTL YQGSSYV YQGYQL YQSNTQV YQSQTQF YQSTSQI

YQANTTL YQAQTSV YQATSTF YQGGTYL YQGPTTV YQGSTF YQGYQV YQSNTSF YQSQTQI YQSTSQL

YQANTTV YQAQTTF YQATSTI YQGGTYV YQGPTYF YQGSTI YQGYSF YQSNTSI YQSQTQL YQSTSQV

YQANTV YQAQTTI YQATSTL YQGNNF YQGPTYI YQGSTL YQGYSI YQSNTSL YQSQTQV YQSTSSF

YQANTYF YQAQTTL YQATSTV YQGNNI YQGPTYL YQGSTNF YQGYSL YQSNTSV YQSQTSF YQSTSSI

YQANTYI YQAQTTV YQATSV YQGNNL YQGPTYV YQGSTNI YQGYSV YQSNTTF YQSQTSI YQSTSSL

YQANTYL YQAQTV YQATSYF YQGNNV YQGQNF YQGSTNL YQGYTF YQSNTTI YQSQTSL YQSTSSV

YQANTYV YQAQTYF YQATSYI YQGNQF YQGQNI YQGSTNV YQGYTI YQSNTTL YQSQTSV YQSTSTF

YQANYF YQAQTYI YQATSYL YQGNQI YQGQNL YQGSTQF YQGYTL YQSNTTV YQSQTTF YQSTSTI

YQANYI YQAQTYL YQATSYV YQGNQL YQGQNV YQGSTQI YQGYTV YQSNTV YQSQTTI YQSTSTL

YQANYL YQAQTYV YQATTF YQGNQV YQGQQF YQGSTQL YQGYYF YQSNTYF YQSQTTL YQSTSTV

YQANYV YQAQYF YQATTI YQGNSF YQGQQI YQGSTQV YQGYYI YQSNTYI YQSQTTV YQSTSV

YQAPSNF YQAQYI YQATTL YQG SI YQGQQL YQGSTSF YQGYYL YQSNTYL YQSQTV YQSTSYF

YQAPSNI YQAQYL YQATT F YQGNSL YQGQQV YQGSTSI YQGYYV YQSNTYV YQSQTYF YQSTSYI

YQAPSNL YQAQYV YQATTNI YQGNSNF YQGQSF YQGSTSL YQIQSSW YQSNYF YQSQTYI YQSTSYL

YQAPSNV YQAS F YQATT L YQGNS I YQGQSI YQGSTSV YQSGSNF YQSNYI YQSQTYL YQSTSYV

YQAPSQF YQASNI YQATTNV YQGNS L YQGQSL YQGSTTF YQSGSNI YQSNYL YQSQTYV YQSTTF

YQAPSQI YQASNL YQATTQF YQGNSNV YQGQSNF YQGSTTI YQSGSNL YQSNYV YQSQYF YQSTTI

YQAPSQL YQASNV YQATTQI YQGNSQF YQGQSNI YQGSTTL YQSGSNV YQSPSNF YQSQYI YQSTTL

YQAPSQV YQASQF YQATTQL YQGNSQI YQGQSNL YQGSTTV YQSGSQF YQSPSNI YQSQYL YQSTTNF

YQAPSSF YQASQI YQATTQV YQGNSQL YQGQSNV YQGSTV YQSGSQI YQSPSNL YQSQYV YQSTTNI

YQAPSSI YQASQL YQATTSF YQGNSQV YQGQSQF YQGSTYF YQSGSQL YQSPSNV YQSSNF YQSTTNL

YQAPSSL YQASQV YQATTSI YQGNSSF YQGQSQI YQGSTYI YQSGSQV YQSPSQF YQSSNI YQSTTNV

YQAPSSV YQASSF YQATTSL YQGNSSI YQGQSQL YQGSTYL YQSGSSF YQSPSQI YQSSNL YQSTTQF

YQAPSTF YQASSI YQATTSV YQGNSSL YQGQSQV YQGSTYV YQSGSSI YQSPSQL YQSSNV YQSTTQI

YQAPSTI YQASSL YQATTTF YQGNSSV YQGQSSF YQGSYF YQSGSSL YQSPSQV YQSSQF YQSTTQL

YQAPSTL YQASSNF YQATTTI YQGNSTF YQGQSSI YQGSYI YQSGSSV YQSPSSF YQSSQI YQSTTQV

YQAPSTV YQASS I YQATTTL YQGNSTI YQGQSSL YQGSYL YQSGSTF YQSPSSI YQSSQL YQSTTSF

YQAPSYF YQASS L YQATTTV YQGNSTL YQGQSSV YQGSYV YQSGSTI YQSPSSL YQSSQV YQSTTSI

YQAPSYI YQASSNV YQATTV YQGNSTV YQGQSTF YQGTNF YQSGSTL YQSPSSV YQSSSF YQSTTSL

YQAPSYL YQASSQF YQATTYF YQGNSV YQGQSTI YQGTNI YQSGSTV YQSPSTF YQSSSI YQSTTSV

YQAPSYV YQASSQI YQATTYI YQGNSYF YQGQSTL YQGTNL YQSGSYF YQSPSTI YQSSSL YQSTTTF

YQAPTNF YQASSQL YQATTYL YQGNSYI YQGQSTV YQGTNV YQSGSYI YQSPSTL YQSSSNF YQSTTTI

YQAPTNI YQASSQV YQATTYV YQGNSYL YQGQSV YQGTQF YQSGSYL YQSPSTV YQSSSNI YQSTTTL

YQAPTNL YQASSSF YQATYF YQGNSYV YQGQSYF YQGTQI YQSGSYV YQSPSYF YQSSSNL YQSTTTV

YQAPTNV YQASSSI YQATYI YQGNTF YQGQSYI YQGTQL YQSGTNF YQSPSYI YQSSSNV YQSTTV

YQAPTQF YQASSSL YQATYL YQGNTI YQGQSYL YQGTQV YQSGTNI YQSPSYL YQSSSQF YQSTTYF

YQAPTQI YQASSSV YQATYV YQGNTL YQGQSYV YQGTSF YQSGTNL YQSPSYV YQSSSQI YQSTTYI

YQAPTQL YQASSTF YQAYNF YQGNTNF YQGQTF YQGTSI YQSGTNV YQSPTNF YQSSSQL YQSTTYL

YQAPTQV YQASSTI YQAYNI YQGNTNI YQGQTI YQGTSL YQSGTQF YQSPTNI YQSSSQV YQSTTYV

YQAPTSF YQASSTL YQAYNL YQGNTNL YQGQTL YQGTSNF YQSGTQI YQSPTNL YQSSSSF YQSTYF

YQAPTSI YQASSTV YQAYNV YQGNTNV YQGQTNF YQGTSNI YQSGTQL YQSPTNV YQSSSSI YQSTYI

YQAPTSL YQASSV YQAYQF YQGNTQF YQGQTNI YQGTSNL YQSGTQV YQSPTQF YQSSSSL YQSTYL

YQAPTSV YQASSYF YQAYQI YQGNTQI YQGQTNL YQGTSNV YQSGTSF YQSPTQI YQSSSSV YQSTYV

YQAPTTF YQASSYI YQAYQL YQGNTQL YQGQTNV YQGTSQF YQSGTSI YQSPTQL YQSSSTF YQSYNF

YQAPTTI YQASSYL YQAYQV YQGNTQV YQGQTQF YQGTSQI YQSGTSL YQSPTQV YQSSSTI YQSYNI

YQAPTTL YQASSYV YQAYSF YQGNTSF YQGQTQI YQGTSQL YQSGTSV YQSPTSF YQSSSTL YQSYNL

YQAPTTV YQASTF YQAYSI YQGNTSI YQGQTQL YQGTSQV YQSGTTF YQSPTSI YQSSSTV YQSYNV

YQAPTYF YQASTI YQAYSL YQGNTSL YQGQTQV YQGTSSF YQSGTTI YQSPTSL YQSSSV YQSYQF

YQAPTYI YQASTL YQAYSV YQGNTS YQGQTSF YQGTSSI YQSGTTL YQSPTSV YQSSSYF YQSYQI

YQAPTYL YQAST F YQAYTF YQGNTTF YQGQTSI YQGTSSL YQSGTTV YQSPTTF YQSSSYI YQSYQL

YQAPTYV YQASTNI YQAYTI YQGNTTI YQGQTSL YQGTSSP YQSGTYF YQSPTTI YQSSSYL YQSYQV

YQAQNF YQASTNL YQAYTL YQGNTTL YQGQTSV YQGTSSV YQSGTYI YQSPTTL YQSSSYV YQSYSF

YQAQNI YQASTNV YQAYTV YQGNTTV YQGQTTF YQGTSTF YQSGTYL YQSPTTV YQSSTF YQSYSI

YQAQNL YQASTQF YQAYYF YQGNTV YQGQTTI YQGTSTI YQSGTYV YQSPTYF YQSSTI YQSYSL

YQAQNV YQASTQI YQAYYI YQGNTYF YQGQTTL YQGTSTL YQSNNF YQSPTYI YQSSTL YQSYSV

YQAQQF YQASTQL YQAYYL YQGNTYI YQGQTTV YQGTSTV YQSNNI YQSPTYL YQSSTNF YQSYTF

YQAQQI YQASTQV YQAYYV YQGNTYL YQGQTV YQGTSV YQSNNL YQSPTYV YQSSTNI YQSYTI

YQAQQL YQASTSF YQESQSV YQGNTYV YQGQTYF YQGTSYF YQSNNV YQSQNF YQSSTNL YQSYTL

YQAQQV YQASTSI YQGGEHN YQGNYF YQGQTYI YQGTSYI YQSNQF YQSQNI YQSSTNV YQSYTV

1 1 YQSYYF YVANSYI YVAQST YVATNV YVGGQSK YVGNSV YVGQSSV YVGSTYL YVIGSSG YVSNSV

YQSYYI YVA SYL YVAQSV YVATQF YVGGRSV YVGNSYF YVGQSTF YVGSTYV YVIKSSV YVSNSYF

YQSYYL YVANSYV YVAQSYF YVATQI YVGGSAH YVGNSYI YVGQSTI YVGSYF YVILSHY YVSNSYI

YQSYYV YVANTF YVAQSYI YVATQL YVGGSDV YVGNSYL YVGQSTL YVGSYI YVIYRSV YVSNSYL

YRGGFSV YVANTI YVAQSYL YVATQV YVGGSFE YVGNSYV YVGQSTV YVGSYL YVLGNSV YVSNSYV

YRGGNLV YVANTL YVAQSYV YVATSF YVGGSKW YVGNTF YVGQSV YVGSYV YVLGSNV YVSNTF

YRGGYSV YVANTNF YVAQTF YVATSI YVGGSLR YVGNTI YVGQSYF YVGTNF YVLHSDV YVSNTI

YRG PS YVANTNI YVAQTI YVATSL YVGGSLV YVGNTL YVGQSYI YVGTNI YVLIEFE YVSNTL

YRGYNSF YVANTNL YVAQTL YVATSNF YVGGSMI YVGNT F YVGQSYL YVGTNL YVLMRSA YVSNTNF

YRHGRIV YVANTNV YVAQTNF YVATSNI YVGGSMV YVGNT I YVGQSYV YVGTNV YVLRLSH YVSNTNI

YRSFSGY YVANTQF YVAQTNI YVATSNL YVGGSNF YVGNT L YVGQTF YVGTQF YVMASSV YVSNTNL

YSDGNLV YVANTQI YVAQTNL YVATSNV YVGGSNI YVGNTNV YVGQTI YVGTQI YVMQSSV YVSNTNV

YSDGSMS YVANTQL YVAQTNV YVATSQF YVGGSNL YVGNTQF YVGQTL YVGTQL YVNGKSV YVSNTQF

YSGGKSV YVANTQV YVAQTQF YVATSQI YVGGSNV YVGNTQI YVGQT F YVGTQV YVNGSSV YVSNTQI

YSGGRSV YVANTSF YVAQTQI YVATSQL YVGGSQF YVGNTQL YVGQTNI YVGTSF YVNWQSV YVSNTQL

YSGGSSV YVANTSI YVAQTQL YVATSQV YVGGSQI YVGNTQV YVGQT L YVGTSI YVPFSSS YVSNTQV

YSGGVSV YVANTSL YVAQTQV YVATSSF YVGGSQL YVGNTSF YVGQTNV YVGTSL YVPGSSV YVSNTSF

YSGPSLN YVANTSV YVAQTSF YVATSSI YVGGSQR YVGNTSI YVGQTQF YVGTSNF YVPKSGI YVSNTSI

YSGPSSM YVANTTF YVAQTSI YVATSSL YVGGSQV YVGNTSL YVGQTQI YVGTSNI YVPTSSD YVSNTSL

YSGWANV YVANTTI YVAQTSL YVATSSV YVGGSSF YVG TS YVGQTQL YVGTSNL YVPWSSV YVSNTSV

YSKGSSD YVANTTL YVAQTSV YVATSTF YVGGSSG YVGNTTF YVGQTQV YVGTSNV YVQGLQV YVSNTTF

YSQSSSV YVANTTV YVAQTTF YVATSTI YVGGSSI YVGNTTI YVGQTSF YVGTSQF YVQGSKM YVSNTTI

YTGAWDQ YVANTV YVAQTTI YVATSTL YVGGSSK YVGNTTL YVGQTSI YVGTSQI YVQMSSV YVSNTTL

YTGGEYS YVANTYF YVAQTTL YVATSTV YVGGSSL YVGNTTV YVGQTSL YVGTSQL YVQNPSV YVSNTTV

YVAESQD YVANTYI YVAQTTV YVATSV YVGGSSS YVGNTV YVGQTSV YVGTSQV YVQWSSV YVSNTV

YVAGIKV YVANTYL YVAQTV YVATSYF YVGGSSV YVGNTYF YVGQTTF YVGTSSF YVRGSMV YVSNTYF

Y AGSAV YVANTYV YVAQTYF YVATSYI YVGGSTF YVGNTYI YVGQTTI YVGTSSI YVSADSV YVSNTYI

YVAGS F YVANYF YVAQTYI YVATSYL YVGGSTI YVGNTYL YVGQTTL YVGTSSL YVSGSAV YVSNTYL

Y AGSNI YVANYI YVAQTYL YVATSYV YVGGSTL YVGNTYV YVGQTTV YVGTSSV YVSGSNF YVSNTYV

YVAGS L YVANYL YVAQTYV YVATTF YVGGSTV YVGNYF YVGQTV YVGTSTF YVSGSNI YVSNYF

Y AGS YVANYV YVAQYF YVATTI YVGGSVV YVGNYI YVGQTYF YVGTSTI YVSGSNL YVSNYI

YVAGSQF YVAPSNF YVAQYI YVATTL YVGGSYF YVGNYL YVGQTYI YVGTSTL YVSGSNV YVSNYL

Y AGSQI YVAPSNI YVAQYL YVATTNF YVGGSYI YVGNYV YVGQTYL YVGTSTV YVSGSQF YVSNYV

YVAGSQL YVAPSNL YVAQYV YVATT I YVGGSYL YVGPSNF YVGQTYV YVGTSV YVSGSQI YVSPSNF

YVAGSQV YVAPSNV YVASNF YVATT L YVGGSYQ YVGPSNI YVGQYF YVGTSYF YVSGSQL YVSPSNI

YVAGSSF YVAPSQF YVASNI YVATTNV YVGGSYV YVGPSNL YVGQYI YVGTSYI YVSGSQV YVSPSNL

YVAGSSI YVAPSQI YVAS L YVATTQF YVGGTNF YVGPSNV YVGQYL YVGTSYL YVSGSSF YVSPSNV

Y AGSSL YVAPSQL YVASNV YVATTQI YVGGTNI YVGPSQF YVGQYV YVGTSYV YVSGSSI YVSPSQF

YVAGSSV YVAPSQV YVASQF YVATTQL YVGGTNL YVGPSQI YVGRLPD YVGTTF YVSGSSL YVSPSQI

Y AGSTF YVAPSSF YVASQI YVATTQV YVGGTNV YVGPSQL YVGRSIV YVGTTI YVSGSSV YVSPSQL

Y AGSTI YVAPSSI YVASQL YVATTSF YVGGTQF YVGPSQV YVGRSSE YVGTTL YVSGSTF YVSPSQV

Y AGSTL YVAPSSL YVASQV YVATTSI YVGGTQI YVGPSSF YVGSNF YVGTTNF YVSGSTI YVSPSSF

Y AGST YVAPSSV YVASSF YVATTSL YVGGTQL YVGPSSI YVGSNI YVGTTNI YVSGSTL YVSPSSI

Y AGSYF YVAPSTF YVASSI YVATTSV YVGGTQV YVGPSSL YVGSNL YVGTTNL YVSGSTV YVSPSSL

Y AGSYI YVAPSTI YVASSL YVATTTF YVGGTSF YVGPSSV YVGSNV YVGTTNV YVSGSYF YVSPSSV

Y AGSYL YVAPSTL YVASSNF YVATTTI YVGGTSI YVGPSTF YVGSQF YVGTTQF YVSGSYI YVSPSTF

Y AGSYV YVAPSTV YVASSNI YVATTTL YVGGTSL YVGPSTI YVGSQI YVGTTQI YVSGSYL YVSPSTI

YVAGTNF YVAPSYF YVASSNL YVATTTV YVGGTSV YVGPSTL YVGSQL YVGTTQL YVSGSYV YVSPSTL

YVAGTNI YVAPSYI YVASSNV YVATTV YVGGTTF YVGPSTV YVGSQV YVGTTQV YVSGTNF YVSPSTV

YVAGTNL YVAPSYL YVASSQF YVATTYF YVGGTTI YVGPSYF YVGSSDV YVGTTSF YVSGTNI YVSPSYF

YVAGTNV YVAPSYV YVASSQI YVATTYI YVGGTTL YVGPSYI YVGSSF YVGTTSI YVSGTNL YVSPSYI

YVAGTQF YVAPTNF YVASSQL YVATTYL YVGGTTV YVGPSYL YVGSSI YVGTTSL YVSGTNV YVSPSYL

YVAGTQI YVAPTNI YVASSQV YVATTYV YVGGTYF YVGPSYV YVGSSL YVGTTSV YVSGTQF YVSPSYV

YVAGTQL YVAPTNL YVASSSF YVATYF YVGGTYI YVGPT F YVGSSNF YVGTTTF YVSGTQI YVSPTNF

YVAGTQV YVAPTNV YVASSSI YVATYI YVGGTYL YVGPT I YVGSSNI YVGTTTI YVSGTQL YVSPTNI

YVAGTSF YVAPTQF YVASSSL YVATYL YVGGTYV YVGPT L YVGSSNL YVGTTTL YVSGTQV YVSPTNL

YVAGTSI YVAPTQI YVASSSV YVATYV YVGGVQG YVGPTNV YVGSSNV YVGTTTV YVSGTSF YVSPTNV

YVAGTSL YVAPTQL YVASSTF YVAYNF YVGGWAS YVGPTQF YVGSSQF YVGTTV YVSGTSI YVSPTQF

Y AGTSV YVAPTQV YVASSTI YVAYNI YVGGWTY YVGPTQI YVGSSQI YVGTTYF YVSGTSL YVSPTQI

YVAGTTF YVAPTSF YVASSTL YVAYNL YVGGYSV YVGPTQL YVGSSQL YVGTTYI YVSGTSV YVSPTQL

YVAGTTI YVAPTSI YVASSTV YVAYNV YVGHQSD YVGPTQV YVGSSQV YVGTTYL YVSGTTF YVSPTQV

YVAGTTL YVAPTSL YVASSV YVAYQF YVGIISV YVGPTSF YVGSSSF YVGTTYV YVSGTTI YVSPTSF

YVAGTTV YVAPTSV YVASSYF YVAYQI YVGISMI YVGPTSI YVGSSSI YVGTYF YVSGTTL YVSPTSI

YVAGTYF YVAPTTF YVASSYI YVAYQL YVGISSV YVGPTSL YVGSSSL YVGTYI YVSGTTV YVSPTSL

YVAGTYI YVAPTTI YVASSYL YVAYQV YVGKSVV YVGPTSV YVGSSSR YVGTYL YVSGTYF YVSPTSV

YVAGTYL YVAPTTL YVASSYV YVAYSF YVGLGSV YVGPTTF YVGSSSV YVGTYV YVSGTYI YVSPTTF

YVAGTYV YVAPTTV YVASTF YVAYSI YVGLSKI YVGPTTI YVGSSTF YVGVGSV YVSGTYL YVSPTTI

YVAISSQ YVAPTYF YVASTI YVAYSL YVGLSPV YVGPTTL YVGSSTI YVGVSGM YVSGTYV YVSPTTL

YVA F YVAPTYI YVASTL YVAYSV YVGLSSH YVGPTTV YVGSSTL YVGYHYV YVSKGSV YVSPTTV

YVANNI YVAPTYL YVASTNF YVAYTF YVGMWDS YVGPTYF YVGSSTV YVGYNF YVSMWST YVSPTYF

YVA L YVAPTYV YVAST I YVAYTI YVGNNF YVGPTYI YVGSSV YVGYNI YVSNNF YVSPTYI

YVANNV YVAQ F YVAST L YVAYTL YVGNNI YVGPTYL YVGSSYF YVGYNL YVSNNI YVSPTYL

YVANQF YVAQ I YVASTNV YVAYTV YVGNNL YVGPTYV YVGSSYI YVGYNV YVSNNL YVSPTYV

YVANQI YVAQ L YVASTQF YVAYYF YVGNNV YVGQ F YVGSSYL YVGYQF YVSNNV YVSQNF

YVANQL YVAQ V YVASTQI YVAYYI YVGNQF YVGQNI YVGSSYV YVGYQI YVSNQF YVSQNI

YVANQV YVAQQF YVASTQL YVAYYL YVGNQI YVGQ L YVGSTF YVGYQL YVSNQI YVSQNL

YVANSF YVAQQI YVASTQV YVAYYV YVGNQL YVGQNV YVGSTI YVGYQV YVSNQL YVSQNV

YVA SI YVAQQL YVASTSF YVDESSR YVGNQV YVGQQF YVGSTL YVGYSF YVSNQV YVSQQF

YVANSL YVAQQV YVASTSI YVDFLSV YVGNSF YVGQQI YVGSTNF YVGYSI YVSNSF YVSQQI

YVANSNF YVAQSF YVASTSL YVDGSSW YVGNSI YVGQQL YVGSTNI YVGYSL YVSNSI YVSQQL

YVANSNI YVAQSI YVASTSV YVEGSQS YVGNSL YVGQQV YVGSTNL YVGYSV YVSNSL YVSQQV

YVANSNL YVAQSL YVASTTF YVEVSSY YVGNSNF YVGQSF YVGSTNV YVGYTF YVSNSNF YVSQSF

YVANSNV YVAQS F YVASTTI YVFASSK YVGNSNI YVGQSI YVGSTQF YVGYTI YVSNSNI YVSQSI

YVANSQF YVAQSNI YVASTTL YVFGSFV YVGNSNL YVGQSL YVGSTQI YVGYTL YVSNSNL YVSQSL

YVANSQI YVAQS L YVASTTV YVGAASV YVGNSNV YVGQSNF YVGSTQL YVGYTV YVSNSNV YVSQSNF

YVA SQL YVAQSNV YVASTV YVGDDSV YVGNSQF YVGQSNI YVGSTQV YVGYYF YVSNSQF YVSQSNI

YVANSQV YVAQSQF Y ASTYF YVGFSSV YVGNSQI YVGQSNL YVGSTSF YVGYYI YVSNSQI YVSQS L

YVANSSF YVAQSQI YVASTYI YVGGASE YVGNSQL YVGQSNR YVGSTSI YVGYYL YVSNSQL YVSQSNV

YVA SSI YVAQSQL Y ASTYL YVGGDSV YVGNSQV YVGQSNV YVGSTSL YVGYYV YVSNSQV YVSQSQF

YVA SSL YVAQSQV YVASTYV YVGGFSF YVGNSSF YVGQSQF YVGSTSV YVHGSSV YVSNSSF YVSQSQI

YVANSSV YVAQSSF YVASYF YVGGGSV YVGNSSI YVGQSQI YVGSTTF YVHGSVV YVSNSSI YVSQSQL

YVANSTF YVAQSSI YVASYI YVGGIYA YVGNSSL YVGQSQL YVGSTTI YVHGTSL YVSNSSL YVSQSQV

YVANSTI YVAQSSL YVASYL YVGGIYG YVGNSSV YVGQSQV YVGSTTL YVHGVSV YVSNSSV YVSQSSF

YVA STL YVAQSSV YVASYV YVGGKST YVGNSTF YVGQSSF YVGSTTV YVHISSH YVSNSTF YVSQSSI

YVA ST YVAQSTF YVATNF YVGGLQV YVGNSTI YVGQSSI YVGSTV YVIAWMH YVSNSTI YVSQSSL

YVANSV YVAQSTI YVATNI YVGGPLV YVGNSTL YVGQSSK YVGSTYF YVIGNVL YVSNSTL YVSQSSV

YVANSYF YVAQSTL YVATNL YVGGQEV YVGNSTV YVGQSSL YVGSTYI YVIGSDV YVSNSTV YVSQSTF YVSQSTI YVSSSNL YVSTIML YVSTTV

YVSQSTL YVSSSNV YVSTNV YVSTTYF

YVSQSTV YVSSSQF YVSTQF YVSTTYI

YVSQSV YVSSSQI YVSTQI YVSTTYL

YVSQSYF YVSSSQL YVSTQL YVSTTYV

YVSQSYI YVSSSQV YVSTQV YVSTYF

YVSQSYL YVSSSSF YVSTSF YVSTYI

YVSQSYV YVSSSSI YVSTSI YVSTYL

YVSQTF YVSSSSL YVSTSL YVSTYV

YVSQTI Y SSSSV YVSTS F YVSY F

YVSQTL YVSSSTF YVSTSNI YVSYNI

YVSQTNF YVSSSTI YVSTSNL YVSYNL

YVSQTNI YVSSSTL YVSTSNV YVSYNV

YVSQTNL YVSSSTV YVSTSQF YVSYQF

YVSQTIMV Y SSSV YVSTSQI YVSYQI

YVSQTQF YVSSSYF YVSTSQL YVSYQL

YVSQTQI YVSSSYI YVSTSQV YVSYQV

YVSQTQL YVSSSYL YVSTSSF YVSYSF

YVSQTQV YVSSSYV YVSTSSI YVSYSI

YVSQTSF YVSSTF YVSTSSL YVSYSL

YVSQTSI YVSSTI YVSTSSV YVSYSV

YVSQTSL YVSSTL YVSTSTF YVSYTF

YVSQTSV YVSST F YVSTSTI YVSYTI

YVSQTTF YVSSTNI YVSTSTL YVSYTL

YVSQTTI YVSST L YVSTSTV YVSYTV

YVSQTTL YVSSTNV YVSTSV YVSYYF

YVSQTTV YVSSTQF YVSTSYF YVSYYI

YVSQTV YVSSTQI YVSTSYI YVSYYL

YVSQTYF YVSSTQL YVSTSYL YVSYYV

YVSQTYI YVSSTQV YVSTSYV YVVGKKV

YVSQTYL YVSSTSF YVSTTF YVVGSSQ

YVSQTYV YVSSTSI YVSTTI YVWKSSV

YVSQYF YVSSTSL YVSTTL YVYGDSV

YVSQYI YVSSTSV YVSTTNF YVYTKPF

YVSQYL YVSSTTF YVSTTNI YVYVESY

YVSQYV YVSSTTI YVSTTNL YWDMSEV

YVSSNF YVSSTTL YVSTTNV YWGEFSV

YVSSNI YVSSTTV YVSTTQF YWGGSDV

YVSSNL YVSSTV YVSTTQI YWGGSSV

YVSSNV YVSSTYF YVSTTQL YWGHSSN

YVSSQF YVSSTYI YVSTTQV YWGKLDN

YVSSQI YVSSTYL YVSTTSF YWGTSHV

YVSSQL YVSSTYV YVSTTSI YWGYYSV

YVSSQV YVSSYF YVSTTSL YYGEKDV

YVSSSF YVSSYI YVSTTSV YYGGSLV

YVSSSI YVSSYL YVSTTTF YYGGSSV

YVSSSL YVSSYV YVSTTTI YYGPSPH

YVSSSNF YVSTNF YVSTTTL YYGTVKE

YVSSS I YVSTNI YVSTTTV

TABLE 3

GYNVRD GFRLHH GFQFKT ATRLQD GHRHQG GYNFQS GYNIKT GCRVKD GINLKG GFKYND

AFRLRE GFRVQD GSRHHH GFRLHG AFRLRC GYQIKG GNRHHN ANRLQH GINLKQ GFKYQN

GYRVKT GYNVRG AHRHQG GFHHQG GHHTHN GYRVKS GSQSRH GIQIQD GINLNN GFKYQQ

GNRTQN GYNVRT GIRINS GTRTHN GYKVRG CCKIRD CIRLQS ATHTHN GINLQG GFKCRD

GHQTRH GSHSRN ATQHRH ANQHRH AHQLHD GSHLRN GFHLHN ASRLHN GINIRD GFKCRN

GCQIRT GSRTQD GHHLQN ATRHHN GIRVQT ANRLQN ATRTHG GYNFKD GINIKG GFKCRQ

GYRVQG GFRLHN AFHLRG GFRIQT GTRTHG CFRFND CCNLRG AHHHQD GINIKS GFKCKS

GINIRT GFRVND ANHHRH GCRLKD GNHSRD GFQIKD GCQFKT GFNFKS GINIKD GFKCKD

AHQHRH GIRLNS GIKIRS ATHHHN GCRLNT GYKFQT CYRFNS GYKFKG GINIKQ GFKCKN

CFNFRS AFHHHG CFQFQD ANRSQN GCQIRS AHQTHG GNRTHN GTRSHH GININS GFKCNG

GYRFND GSHHRG ATHTRN GF RG ASRHQN GCKLRG CCKIRG CIRLKS GININE GFNLRT

ATQHRD CFNFRT GCNFRT ANRLHH GTRLQH CINFRG GIRVNT GFHHHD GINIQT GFNLKG

CFKFQG ATHHRD GIRIND GCRIQT GNRLQN GHQLHG ATRSQG GTQSQN GINIQD GFNIKG

CIQLRT GCRLQG GHQHRD GCRIQG GFRTQG ASHTRH GTHLHN GFNFNG GINVKG GFNINN

GFQFKS GIRVKS AFQHHD GSQLRN GFRLND GYKVRT GIRVQD GNHHRG GINFRT GFNIQD

ATQSRD GFQVRS GCRFNG GYKFKT GFRSHN ANHSRN AFQHHG GYKFQG GINFKG GFNIQN

CIRFQD GFRVKG AFQHRG GIKIRD AHRHHG GTRSHN GSQHRD ANRHHD GINFND GFNIQQ

GSRLHN CCQFRD CIRLQG GYRVNG AFHHQG GIQFNG GSRSQD GYQLKG GINFQD GFNVKQ

GSRHHN GFNLRT AFHHHN CFRLRS GFQIQT ANRLQG GHHLQG GHRSQN GINYRD GFNVNG

GYKLRD ATQHRG GHHLQD ASQHRH GTQSRH GSQLRH GNRTHH ATRHHG GINYKG GFNVND

GIRFNS ASHLRN CCQFRG GINVRG ANRHHG GFQIQS GSRLQH GFHLQN GINYNN GFNVQS

GFKIRT AHQTRH AFRTRD GINVRS ASHLRG ATRHHH GCQVRG AHRSQN GINYQT GFNFRE

GFRSQD CIRFQG GFRINS GHRSHH GFHHHG GIQLKG GTRHHD ATRHQD GINCRT GFNFKN

GNRLHN AHQLQN GSRLHH ATRTHN ASQHRD GSQTRH GFQLKD GFRHHD GINCRE GFNFNS

GFNLRG GYRING GIRFQT GFRSQG GTHHRD CINFRD GFKFQS GCNLRS GINCKT GFNFNE

GFNFKT GHRTHH GSRLHD GNRHQN AHQSRN CIRIQD GYQIQS GSRHHG GINCNS GFNFQS

CFKLRS CIRLKD GCQLRS GFRING CYQFKG GNRTHG GCQFKG CCQLRD GINCNQ GFNFQT

GTRLHD GFKFNT GCQLRT GYQIKD GCKIRG CYKFRS GCNVRT AFRSRD GINCQD GFNFQN

GYKIRG GYRVKD GIRVQG ASQLRN GCRFNT GHQTQD GHQSQD GIKVRD GINCQN GFNYKT

GYNIRS GFQHQH GYRVQT ANHTRH GCRFQS GIKVRG CFKFNT GSRSQG GINQNG GFNCKG

GTRLHH AHQTHN GNRLHH GCQVRT CYNFRD GCQLRD ANRHHH AFHLRD GINQNE GFNCND

GHHLHH GIQFQD GNQHRN GNRLHG ASHHRD GFNFQS GNRLQH GFQLQG GINQNQ GFNCQS

GFQFKD GIKLRD GIQFQG GFHLHH GIRVQS GFRVNG GYQLKT GFQLKG GIQLNQ GFQLKT

AHRHQN GFRVNT CIRLQD CFQFQG CIKIRD ANRHQG CCRFQD CCRLQG GIQLQT GFQLNN

GIRING GHQLQG GYNVRS GTQTRH GHQLHD GCQIRD GYRLNG GFNFKD GIQINS GFQLQD

GNHLRG AHRHHD GFKIRG GFRLHD AHQTQG GIRVNS CIQVRT GFHLHD GIQINQ GFQLQN

GSHTRH CYKFRD CYRFNG GFQFND GTRSQD CIQVRG GFHLHG GCQVRS GIQVNN GFQIRT

GIRLQS CFRFNT AFRLRH GFKLRT GFQFNS CIRIQG ATHSRN GIQFKS GIQVQT GFQIND

AHRTQD GTRLHG GYKVRD ANHLRD CFKFNG GFRVKS GFHLQD GYNFQD GIQFRS GFQINN

CIQIRD GIKFRS GHRHQD GIRFNT GHRHHD GINFQT CYQFQG AHHTRD GIQFRD GFQFRD

ASHLRH GFNLRS AFRLRG GTQSRD GNHHRD GNRHQG CCQLRS GYNLQT GIQFNN GFQFRN

GNQTRD GCRVKT AFRLRG GYNFQG GYRLND GFKLRS GFRLQH CIKLRT GIQFQQ GFQFQE

AHRHQD AHRSQD CIRLKG ASRLHG AHRSHD ASQHRG CCQVRG GNRTQG GIQYRN GFQCKQ

CFKFQS GCRIKG CYKFRG CCQLRT GHRHHG ANHTHN GCNIRG GHQSHG GIQYQQ GFQCNQ

AHRLQH AHQLQD CFQFKS GTRTQD GHQLHH GCRFNS GFRVQT CCQFRS GIQCNS GFQQKT

GNHLRD GCRIQD GYQFQG GYRINS CFRIRS GFKVRG GFQTHN GIRLKQ GIQCQT GFQQKQ

GYRVND GIQVRT GFQHHH GTRHQG GNQTRH AHRSHH GIKVRS GIRLNT GIQQRE GYRLKG

GIRVKT AHQTHD GNRLHD ANRLHD GFKLRG GTRTHD CIRLQT GIRLQS GIQQKT GYRLKQ

GSRHQN CFRIRG GSHSRH GHHHQN CYRFND GTRSQG ANRSHN GIRLQE GIQQKE GYRLNE

CIRFKG GCNFRS GYRLQS ATQLRH GNHTRG CIKFRD GYQLQD GIRIRE GIQQKN GYRLQD

CFKLRG CFRIRT AHQTQN CIRFQS GHRSQH GHQTQG GSHLRG GIRIKQ GIQQQQ GYRLQE

AFQHHH ATRLHG GCQIRG CIQVRD GNQSRH ATRLHH GCQLKT GIRIQN GFRLRS GYRIRG

GYKIRT GTHTRG GFKFQD GYKLRS GYQIQG CFQFQS GFHLQG GIRIQQ GFRLNN GYRIRD

GFQTRH CFQFKD GCNFRD ASHTRN GCRFND CIRIKG GFHTHN GIRVKN GFRIKT GYRIKE

CCQIRG GNRLQG ANRHQD AHHLHD GIQLQD CFRVRD ASRHQG GIRVQE GFRING GYRINT

AFHHHD CFRLRG GSHTRD GYQFKD ATHSRH ATHLRD ASHSRH GIRFKT GFRINT GYRVKG

GFQFNG GTRHQD AFRCRE GSRHQD GYRLNS GIRVND AHHTQD GIRFKD GFRVRN GYRVKN

GTRHHH ATHSRD ANHSRH GFN RT GCNLRG GYRVNS CCRFKG GIRFQN GFRVQD GYRVKQ

GIRLQT GCNIRT CIQIRT ASQLRG CYQFQS GSRHQG GNHLHH GIRYRD GFRFRN GYRVNG

AFRHQG GIRLNT AHRHHH GHRHQH GYRLNT ASRLQD ANQTRH GIRYRE GFRFRQ GYRVNT

AFQHQH ANHLRG ASQTRD GCRLQD GYNFQT GFQSRH GSRTHH GIRYRN GFRFQG GYRVNQ

CFRLRT GNHSRH AHRTHH GFN RS GCRFQT CFKFKS GTRSHG GIRYKS GFRYRG GYRFRQ

GFRLKS GIQFKG GFKLRD GHRTQH GHRTQN CFQLQG AHHTQG GIRYKN GFRYRN GYRFNT

GCKFRG GFQLQN GCQFQT GSRLHG ATQLRD GTRHHG ASRHHH GIRQKQ GFRYKN GYRFND

GNHTRH GFKFKD GSQTRD ANRLQD ANRHHN CCRLQD ANRTQD GIRQQG GFRYKQ GYRFQT

GIRVKD GYKLRG CIQFRS GTHTRD GSRTHN CCRLKG AHQSQG GIKLKG GFRCRS GYRYNT

GTQTRD GFNIRT GFRSHG AHRTQN AHHLHH GFQFNT CYNFKT GIKLNS GFRCKS GYRYNN

CYKFQT GNQSRN GINVRD GHHLQH AHQLHH ATRLHD GYQLQG GIKLNE GFRCKT GYRYNQ

GCNLRT GFNFKG GFKFKG ATHTRH ANQHHN AHHTHG ANQSRH GIKLQE GFRCKN GYRCNS

GHQTHN GYQFKG GHQSHN GYRIND ASHHRG GIQLQG GFQIKG GIKIRS GFRCQD GYRCNQ

GIKLRS GFRTHN GNQTRN GSRLQN ANRLHG GCKLRT GYNFKS GIKIRT GFRQKT GYRQNG

GIRLNG GFRSHH GIRINT GCRIKD GFRVKT CIRFKS AHQLHG GIKIKS GFRQKD GYRQQD

GNRLQD CINLRD CFQVRG GIRIQT GCRINT GFKIRS GSRHQH GIKIQQ GFRQNT GYKLRQ

ASRLQG ANQLRH CIQLRS ATRHQG ANQTHN GIKIRT CCRIKT GIKVNN GFRQND GYKLKG

CCRVRT GIRIQS ANQLRD ASQLRH AHQLHN GSRTHG GFQSQN GIKVQD GFKLKS GYKLKS

CFKLRT GIRVKG GYQFQS GIKFRT GFRHQN GSRTQG CIQFQT GIKFRE GFKLKD GYKLNQ

GYQIKT AHRTHD GNHHHH GYQLKD GFKVRD GFRVKD GSRSHN GIKFNT GFKLNT GYKLQG

CYKFRT ATRSRD AHHLHN GTRTQG CYKFNT GYQIQD GFRLNS GIKFNE GFKLQS GYKINS

AFQHRD GFRLQT AFRTRN GFKFQG GIQFQS ASRTQG CYQFQT GIKFQT GFKIKG GYKVRD

GHQLQD GNHTRD CYRFRT GFHSQN GINVRT GFRTQH CINLRT GIKFQD GFKIKS GYKVQN

AHQSRH GFNFQD AHHLQD GIKLRT CIKLRD GSQSRD AFRTRG GIKYNT GFKIKQ GYKFKG

GNHHRH GFNVRD CCQLRG ATRTQG GNQHRD GHQTHG GYQFQD GIKYQQ GFKIND GYKFNN

GCRVQT AHQSQN GFNFQG ANRTHN CCRFKD CIRLKT GTQHHN GIKCRS GFKIQS GYKFQG

ASRSRD GFRVQG AHQLQG GNQHRH GTRHQH GYRVQS GCKIRT GIKCNN GFKIQN GYKFQT

GTHSRH GHQSRD AFQLHD ASRHHN GYQFKS GHHSHN ATHSQN GIKCQG GFKVRD GYKYRG

GSRLQG GFQHQN CFQFKG GYKIRS GCKFRS GCQFQD GCQFQG GIKCQQ GFKFNT GYKYNS

GIRLND GYKLRT GCRLQT GCRIKS GTRTHH CIQIRS CCKLRD GIKQKG GFKFQE GYKCRS

GSHSRG GSHLRH GNQSRD GIRVNG GFRHQG GIKFRD GHQSQG GINLRQ GFKYKS GYKCKD GYKCNT GCNLQD GQNFRN GENYNE AIQIQS AFQYQQ ACRIRG AQKIRG AENLRE CINFNT

GYKCQQ GCNIRT GQNFQD GENCRG AIQIQQ AFQCRG ACRINE AQKIKE AENLRQ CINFQE

GYKQKT GCNIQT GQNYNQ GENCRE AIQVRS AFQCKG ACRVRD AQKINS AENLQG CINYRT

GYKQNG GCNVQS GQNYQT GENCKG AIQVKT AFQCKQ ACRVRN AQKVKS AENLQE CINYNE

GYKQNE GCNVQE GQNCKQ GENCKQ AIQVND AFQCQD ACRVKE AQKVNS AENIRQ CINCRQ

GYNLNE GCNVQQ GQNQKE GENCQQ AIQFKE AFQQKG ACRFRD AQKVND AENIKE CINCKG

GYNLQD GCNFRT GQNQNN GENQQE AIQFQG AYRLKD ACRFRE AQKV AENINE CINCQN

GYNVRG GCNFQS GQQLQT GEQLKG AIQCKS AYRLNG ACRYRT AQKF T AENVRE CINQKS

GYNVKN GCNYND GQQIRT GEQIRG AIQCQD AYRLNS ACRCQN AQKYNG AENVKN CINQNE

GYNVKQ GCNYNE GQQIRD GEQIRS AIQCQQ AYRLND ACRQKS AQKCRE AENVQS CIQLKQ

GYNFKE GCNYQD GQQIKS GEQIRQ AIQQQT AYRLQS ACRQKQ AQKCKN AENVQD CIQLNS

GYNFNQ GCNCKE GQQIKT GEQIKE AFRLRT AYRIKN ACRQ AQKCNG AENFRT CIQLNE

GYNFQG GCNCNS GQQVRG GEQVRN AFRLRE AYRVQS ACKLRT AQKQQT AENFKT CIQLNN

GYNFQS GCNCNQ GQQVRD GEQVND AFRLKG AYRFRQ ACKLRE AQNLNS AENFNG CIQLQE

GYNFQQ GCNCQD GQQVKT GEQFRG AFRLKT AYRCKN ACKLNG AQNLQT AENFQG CIQIKG

GYNYKE GCNQKD GQQVKQ GEQFKN AFRLQN AYRCNN ACKIKD AQNLQE AENYKE CIQINS

GYNYNE GCNQKE GQQVNQ GEQYRN AFRIKS AYRQRD ACKING AQNVKE AENCNT CIQVRT

GYNYNN GCQLNT GQQFRT GEQYKS AFRIQD AYRQKN ACKINQ AQNVKQ AENCQT CIQVKG

GYNYQG GCQIKE GQQFKD GEQYNE AFRVKD AYKLKE ACKVRT AQNVNT AENCQD CIQVKE

GYNCKG GCQVQG GQQFKQ GEQYQS AFRVQD AYKLQS ACKFNS AQNYRE AENQKN CIQVNT

GYNCQD GCQFRS GQQFNT GEQCQS AFRFRT AYKLQN ACKFQS AQNYRN AENQND CIQVQT

GYNCQE GCQFNS GQQYRG GEQQNN AFRFRE AYKIRQ ACKFQT AQNYKQ AEQLRT CIQFKQ

GYNQKE GCQFQT GQQYKQ GEQQQS AFRFNT AYKINQ ACKYKQ AQNCRD AEQLNT CIQFNG

GYNQKN GCQYRN GQQCRG AIRIRG AFRFNN AYKIQT ACKYQQ AQNCND AEQIRQ CIQFQT

GYNQKQ GCQYNN GQQCKG AIRIQN AFRFQQ AYKVKN ACKCRT AQNQRQ AEQIKD CIQYKQ

GYNQQT GCQCRS GQQCNN AIRVRG AFRYRT AYKVQS ACKQRT AQNQNN AEQIKE CIQYQE

GYQLRN GCQCNG GQQCQT AIRVRQ AFRYKD AYKFRN ACKQKQ AQNQQQ AEQIQG CIQCKN

GYQLRQ GCQCQS GQQQRD AIRVKG AFRYQG AYKFQQ ACKQNS AQQLKN AEQVNT CIQCNT

GYQLKG GCQQRN GQQQKT AIRVQG AFRYQS AYKYRS ACNLRN AQQLNG AEQFNS CIQCQQ

GYQLQS GCQQKT GQQQNT AIRVQD AFRCRN AYKYNE ACNLNQ AQQVRT AEQFQG CIQQKS

GYQINS GCQQNS GQQQQN AIRYNS AFRCKT AYKYQD ACNLQG AQQVKT AEQFQD CIQQKE

GYQIQS GCQQNN GERLRS AIRCNG AFRCKD AYKCKG ACNLQT AQQVKE AEQYKD CIQQKQ

GYQVKN GQRLRG GERLRD AIRCNQ AFRCNG AYKQRE ACNVRE AQQFRG AEQYNG CIQQNN

GYQFRG GQRLNN GERLNN AIRQNQ AFRQKE AYKQRQ ACNVNN AQQFNG AEQYQN CFRIRS

GYQFRT GQRLQT GERLQS AIKLRQ AFRQQG AYKQKQ ACNVQT AQQFNE AEQCRG CFRING

GYQFNG GQRIRG GERIKT AIKIQG AFKLRG AYKQQD ACNVQD AQQFQG AEQCND CFRIND

GYQFNQ GQRING GERIKN AIKIQD AFKLRQ AYNLRS ACNFRE AQQYQS AEQCQG CFRIQD

GYQFQG GQRINS GERING AIKVRT AFKLQD AYNLKN ACNFKG AQQCKT AEQQKS CFRVRQ

GYQYRD GQRINT GERVQN AIKVQS AFKIKS AYNLND ACNFNG AQQCKD AEQQNS CFRVKN

GYQYKQ GQRINQ GERFNG AIKFKT AFKINT AYNVNS ACNFQT AQQCNS AEQQQE CFRVQT

GYQYNT GQRIQS GERFNS AIKFNG AFKVKS AYNVQS ACNYKD AQQCQG CIRLNS CFRFRD

GYQCRQ GQRIQD GERYRG AIKFNE AFKVKN AYNVQD ACNYNN AQQCQD CIRLQS CFRYQG

GYQQKD GQRVRG GERYRD AIKFQG AFKFKD AYNFRQ ACNYQN AQQCQQ CIRLQT CFRCRD

GYQQNS GQRVRN GERYRE AIKFQD AFKFQG AYNFKD ACNCRT AQQQNT CIRIRN CFRCQS

GYQQND GQRVNS GERYNE AIKFQN AFKYKQ AYNFKN ACNCQG AQQQQS CIRIKS CFRQRN

GCRLQS GQRVNN GERCRS AIKYRT AFKYNG AYNFQG ACNQRD AERLKG CIRIQE CFRQKG

GCRIRN GQRFRT GERCRE AIKYKS AFKYNN AYNFQS ACNQRE AERLKQ CIRVNS CFRQQS

GCRVRD GQRFKE GERCNT AIKYKT AFKQRG AYNYRG ACNQRN AERLQD CIRFRS CFKLNS

GCRVKS GQRFQE GERQRD AIKYQG AFKQRS AYNYRE ACNQKS AERINQ CIRFRE CFKLNE

GCRVQD GQRFQN GERQKE AIKCRG AFKQ E AYNYQQ ACNQKD AERIQN CIRFKS CFKLQG

GCRFRS GQRFQQ GERQQD AIKCRE AFKQNQ AYNCRN ACNQND AERIQQ CIRFNQ CFKIKN

GCRFRT GQRYRG GEKLRE AIKCQS AFKQQN AYNCKD ACNQNN AERVRE CIRFQS CFKIKQ

GCRYRG GQRYKS GEKIKN AIKCQE AFNLRN AYNCNT ACQLKQ AERVKT CIRYRS CFKINS

GCRYRT GQRYKT GEKIQS AIKCQN AFNLKT AYNQRD ACQIRE AERVQS CIRYNT CFKINE

GCRYKD GQRYKN GEKIQQ AIKQRT AFNLQS AYNQRE ACQING AERFKG CIRYQG CFKIQD

GCRYNE GQRCRS GEKVRD AIKQNQ AFNIRE AYNQQG ACQIQN AERFKS CIRYQT CFKIQE

GCRCRS GQRCNG GEKVRN AIKQQG AFNVRN AYNQQE ACQFRS AERFNG CIRYQE CFKVKT

GCRCRD GQRCQS GEKVNT AINLRD AFNVNQ AYQLNQ ACQFNQ AERFQG CIRYQQ CFKVKD

GCRCRE GQRQNS GEKVQQ AINLKE AFNVQG AYQLQG ACQFQT AERYKE CIRQRT CFKVQS

GCRCRN GQRQQN GEKFKS AINLND AFNFQT AYQLQQ ACQYKT AERYNG CIRQRE CFKFKT

GCRCKN GQKLKT GEKFNQ AINIRT AFNYRD AYQIRQ ACQYNS AERCRE CIRQKN CFKFQT

GCRCQG GQKLKN GEKYRN AINIQN AFNYQE AYQIND ACQCRG AERCKG CIRQQQ CFKFQE

GCRCQT GQKLQD GEKYNS AINVRG AFNYQN AYQIQE ACQCKN AERCKS CIKLKS CFKYRG

GCRQKG GQKIRQ GEKYQG AINVKN AFNCRG AYQVKE ACQCQT AERCQG CIKLND CFKYKE

GCRQQE GQKINE GEKYQN AINVKQ AFNCKS AYQVNG ACQCQD AERQRQ CIKIRQ CFKCRN

GCKLRG GQKIQT GEKCRE AINVQQ AFNCNG AYQVQG ACQCQN AERQKS CIKINN CFKCKN

GCKLRD GQKVKN GEKCRQ AINFRN AFNCND AYQFRG ACQQNS AERQKN CIKVKT CFKCNN

GCKLRQ GQKVQD GEKCNE AINFKS AFNCNE AYQFKT ACQQND AERQND CIKVQT CFKCQG

GCKLKG GQKFRD GEKQRQ AINFNN AFNQKD AYQFKE AQRIRS AEKLRN CIKVQD CFKQRT

GCKLKE GQKFKE GEKQKQ AI FQD AFNQNE AYQFKQ AQRIRT AEKLRQ CIKFRS CFKQRN

GCKLKQ GQKFKQ GEKQNS AINYRT AFNQNN AYQYKG AQRIKD AEKLKE CIKFKE CFKQKT

GCKIRS GQKFNN GEKQNT AINYRQ AFNQQS AYQYNS AQRIKE AEKLQS CIKFQS CFNLRT

GCKIRT GQKFNQ GEKQNE AINYNG AFNQQT AYQYQD AQRINS AEKLQN CIKYNQ CFNLND

GCKIKE GQKFQE GEKQQN AINYND AFNQQQ AYQCKQ AQRIQS AEKIKE CIKYQE CFNLNE

GCKINT GQKYRQ GENLRS AINYNE AFQLQT AYQCND AQRVRE AEKING CIKCND CFNIRG

GCKVRG GQKYKS GENLQD AINYQT AFQIRG AYQCQG AQRVKE AEKINS CIKQRG CFNIKG

GCKVNN GQKYKE GENIQG AINYQD AFQIKT AYQCQS AQRVND AEKINT CIKQRQ CFNIQG

GCKVQQ GQKYQG GENIQQ AINCRE AFQVRS AYQQKT AQRVQE AEKIQD CINLKN CFNIQS

GCKFRD GQKCKN GENVRT AINCNS AFQVKD AYQQKE AQRYRT AEKVKN CINLQT CFNIQE

GCKFKQ GQKCQT GENVKN AINQRS AFQVNS AYQQNS AQRYRD AEKVQD CINIRQ CFNVRE

GCKYRT GQKQND GENVNQ AINQRT AFQVNT AYQQNQ AQRYKG AEKFKN CINIKD CFNVKS

GCKCQE GQKQQN GENVQT AINQKG AFQVNE AYQQQT AQRYNT AEKFKQ CINING CFNVKT

GCKQRD GQNLRN GENFRE AINQNQ AFQFKN ACRLRG AQRYQD AEKFNE CININS CFNVQN

GCNLRT GQNLKG GENFKT AINQQT AFQFNG ACRLRT AQRCND AEKFNN CINIQQ CFNFRD

GCNLRN GQNIKG GENFNG AIQLKS AFQFQS ACRLKS AQRQNT AEKFQG CINVRE CFNFQT

GCNLKT GQNINE GENYRS AIQLNN AFQFQT ACRLNT AQRQQN AEKYRD CINVRQ CFNYKG

GCNLNS GQNVRD GENYRT AIQIRE AFQYNQ ACRLQG AQRQQQ AEKQNG CINFRS CFNYKE

GCNLNE GQNVQQ GENYKG AIQIQG AFQYQD ACRLQQ AQKLRT AENLRS CINFRQ CFNYKN CFNYKQ CYQFNG CQRFRD CERQKG GYRING GCQQRE AENLNN GYKYQD AYRCKD CYKFRE

CFNCNG CYQFQT CQRFKD CEKLQQ GYKCQE GQRQND AENYRQ GCRFKQ AYKFNE CCRIKT

CFNCND CYQYKT CQRFNG CEKIRT GYNIKD GQKYNQ AEQLQQ GCRFNG ACRIKE CCRVNE

CFQLKS CYQYKE CQRFQD CEKVRN GYNYNG GQQYKS AEQIQE GCRCNN ACKFNQ CCRCNG

CFQLKE CYQYNE CQRYRS CEKVKS GYNQNS GEKVKT AEQCQT GCRQQQ ACKYNS CCKLQS

CFQLQT CYQYQE CQRYRN CEKVNS GYQLNQ GEQCNG CIRVRN GCNLND ACQLKN CCNFKE

CFQIRE CYQC E CQRYRQ CEKFKS GYQCKG GEQQNG CIRFRG GCNQNN ACQIQQ CQRLNT

CFQIKT CYQQRT CQRQRS CEKFKD GYQCQN AIRQNS CIKLRD GCQLRS AQRQKT CQRFQT

CFQINT CYQQRE CQRQRN CEKFNN GCRLNT AIKLQG CINCNQ GQKQRE AQKFKQ CQKVRN

CFQIQQ CYQQKQ CQRQKE CEKFQG GCNYQG AINFKE CFRFRN GQNINN AQKQNQ CQKVKT

CFQVKG CYQQNG CQRQNG CEKYRS GCQQQE AFRLKE CFNVNS GERCQE AQKQQD CQQCNN

CFQVQQ CCRLRS CQRQQQ CEKYKE GQRVQS AFRIRE CYRCKT GEQIRN AQKQQE CERQKD

CFQFRT CCRLNT CQKLNE CEKYNE GQKVNT AFKVKT CYKLQD AIKCQQ AERCQS CEKIQQ

CFQFRE CCRIRN CQKVKN CEKYQG GQKVND AFNCKD CYKCQN AINIKT AENVRT CENVKN

CFQFKS CCRIKQ CQKFNG CEKYQS GQKFQQ AFNCQS CCQLNQ AIQYNE AEQCNT RFFKIL

CFQFKE CCRINE CQKYRN CEKYQE GQNING AYQINS CQKVKD AFRIRG CIRLQN RFIQDV

CFQFQQ CCRINN CQKYRQ CEKCKQ GQNVNQ ACRFNS CQKVQQ AFKVRN CIRIQS VRFRVI

CFQYRS CCRVKG CQKYND CEKCNQ GQNQNT ACQYQN CQNFQS AFKFQD CIKCKT KRFKVV

CFQYRD CCRVQE CQKYQD CEKQKT GQNQQE AQRQRQ CERFRG AFNCRT CFRLNS KRFKVI

CFQYRE CCRFNN CQKYQQ CENLRS GEKCRS AQKVKD GIRINQ AFQLRG CFKLRS VRFQDV

CFQYKD CCRFQG CQKCRD CENLKS GENFRT AQNIKN GIRCKN AFQCNT CFKQNS VRFQDR

CFQYNS CCRYKE CQKCRE CENLQN GEQCNQ AQNVRG GINVKE AYKLKT CFNLRQ IRFKLL

CFQYQN CCRCQS CQKCRQ CENIRS AIKYRG AQNFQT GFKQRD ACNIRT CFNYNG VRFKLI

CFQCRG CCRCQN CQKCKS CENVNG AINCRD AQNCRE GYKYRS ACNVRS CFQIND VRFRVL

CFQQRT CCRQRQ CQKCQG CENVND AIQLND AQQINQ GYNFNS ACNVNS CFQQQQ KRFKLA

CFQQNG CCRQKT CQKQRQ CENVNE AFKFRD AQQQRN GCRFRN ACNYRD CYRFNS VRFQIR

CFQQNT CCRQKN CQKQKE CENFRT AFQCRT AERLQG GCRFQN ACQVRG CYKFNE VRFQLR

CFQQQD CCKLRS CQKQKN CENFRE AYRYQN AENFKN GCQIRE ACQVQT CYNFRT IRFKVV

CYRLNN CCKLRD CQNLRG CENYRD AYRQQS AENQQN GCQVND ACQQKG CYQIKT VRFKIL

CYRIKT CCKLRE CQNLRT CENYRE AYNCKG AEQIQS GCQFRN AQRLNS CYQCNN RFFQDV

CYRINS CCKLRQ CQNLRD CENYRQ AYNCNG CIRYNN GQRLKQ AQQYRT CCRYRQ VRFKIR

CYRVRE CCKLKG CQNLKG CENCKE ACRLRS CIRQQD GQRLQD CIRYKQ CCNQRT RFLKGA

CYRVKE CCKLKD CQNLNN CENQRQ ACRFKT CIKQRD GQNLQS CIKIQN CCQVQN VAFKDR

CYRVNQ CCKLKQ CQNLQN CENQKG ACKLNS CINFQN GQNFKS CINFNG CQKCKD VRFQDI

CYRFKE CCKLND CQNINS CENQKT ACKVNE CINCKE GQNYQE CINCKN CQNLRS VRFKVI

CYRFNT CCKIQG CQNINQ CENQNG ACKQNT CIQVND GQQFRG CFKLRQ CQNVKN VRFKLL

CYRFNQ CCKVRT CQNIQQ CENQQG ACNLRG CYRVNE GQQCRS CFNLNT CERQKS VRFKDI

CYRFQT CCKFKG CQNVKQ CEQLRG ACQIRT CYKIQE GERQQT CFNCNQ CENVRT RAIGVR

CYRYRG CCKFNS CQNFRG CEQLKE AQRVRS CYKVND GEKIRD CFQVRQ CENFND VRFKVV

CYRYRN CCKFNT CQNFKT CEQLNT AQKLRD CYNQQG GEQINN CFQCRT CEQCNN VRFKDV

CYRCRN CCKFND CQNFQT CEQINE AQKIKQ CYQIQT GEQINQ CYRVQG CEQQKG RRFKDL

CYRCQS CCKFQT CQNFQN CEQVQG AQKCKT CCQYQG AIKLKT CYRYQG GIRQRD RFIQAA

CYRQQS CCKYRE CQNYQS CEQVQQ AQNINQ CQKINT AIKIRT CYRQKT GIQIKN VRFRGL

CYKLRE CCKYKE CQNYQD CEQFRS AQNYRS CQKFQE AIKIKT CYNQKQ GIQVRN VRFKGV

CYKLNG CCKYNS CQNCQD CEQFRN AQNYRT CQKQNT AIQLNQ CYQCQS GFKIRT RAFKDR

CYKLNT CCKCKE CQNQKG CEQFKE AQNYNT CQNQRS AIQYRG CCRFNS GFN KS QFFKIV

CYKLQN CCKCKN CQNQNQ CEQFKN AQQYNG CQQVNE AFQCNE CCNFQQ GFNYKG VRFKLR

CYKLQQ CCKCQS CQQLND CEQFKQ AERCKQ CQQQNE AYRYKD CCQVQQ GYRQKS VRFQLV

CYKIRS CCKCQD CQQIRT CEQFNQ AEKCRN CERCNT ACRLQD CCQYNS GYKLKN KRFQDR

CYKIKE CCKQRE CQQIKG CEQFQS AENVNQ CEKQRT ACRFQT CQRFRG GYKYKQ VRFKDL

CYKVRS CCNLRT CQQIKN CEQYRD AENQNS CEQQKS AQRFKG CQKVNG GYNIRQ KRFQLR

CYKVKS CCNIQT CQQINS CEQYRQ AEQQKD GIRQRE AQRFQN CQNYRG GYNQKS KRFRVV

CYKFQE CCNVRQ CQQIQE CEQCNS CIKIKG GIKCNS AQKCQS CQNQKD GYQVRQ RFIQGR

CYKYRN CCNVKG CQQVQS CEQQRD CFRLRS GINFNQ AQKQRQ CENVQT GQKYRD KRFQIR

CYKYNS CCNVNN CQQFRN CEQQRE CFRLRT GFRLKE AQNLNG CEQVRN GQNVNE VRLRDI

CYKYNQ CCNVQG CQQFQD CEQQKD CFRYKS GFKLKG AQQLKS GIRLKN GQNCQE VRIRDL

CYKYQT CCNVQS CQQYRG GIRIKS CFNVKE GFKIKT AQQYNT GINFKN GQNQRE VRLKDL

CYKCRS CCNFRE CQQYKG GFRLQE CFNFKG GFKYRS AERIRD GINYQQ GQQLNE VRFRDI

CYKCRT CCNFKS CQQYKT GFNVRN CFQCQG GFNYKE AERQNQ GIQFKG GERQQS VRFKDA

CYKCKE CCNFQT CQQYQN GFNYKD CYKYRG GYKIQE AEKLQQ GIQCRN GEKLQE VRLRDL

CYNLKT CCNYQD CQQCRT GYKQRS CYNLND GYKVKT AEKVRG GFRLNS GEKIND VFFRIL

CYNLQQ CCNCNT CQQCKS GQRLKS CYNLQT GYNFRE AEKQKT GFRQQD GEQYNT LRFQIR

CYNIRG CCNCND CQQCNS AINVRQ CYNYRQ GYQLQQ AEQFKD GFNIND AIRING VRLRLA

CYNIRS CCNCQE CQQCQG AFRVNT CYQQKE GCRIRS CINIRS GYRIRN AIRQQS VRFQDL

CYNIRT CCNQKD CQQCQN AFNVND CCKIRD GCRQQT CININD GYRVRD AIKINQ KRIQIR

CYNIRD CCNQNT CQQCQQ AFQIKQ CCQQRS GQKIRS CINIQT GYNLKE AIKIQS RRIGVA

CYNING CCQLNG CQQQRN AYNQQQ CQRY GQQLKS CIQVRD GYQLKN AIKCNQ VFFRLI

CYNIQT CCQLNE CQQQNN ACQI T CQKLKG GQQYKD CFQFQN GYQVQD AIQLKD KRFRIV

CYNVRS CCQLQD CQQQQN ACQYRQ CQKQQG GEKLKG CFQYNQ GCRYNS AIQYRD IRARDV

CYNVQN CCQI T CERLRG AQKQKT CQNLNG GENLKG CYRYQN GCRQQD AFRQRG KFIQAI

CYNFNS CCQVRQ CERLRD AQQINS CQNVNT GENLNT CYRQRQ GQKQRG AFKYQD VRFRIL

CYNFND CCQVKS CERLKS AQQYNS CENIKE GENCNQ CYKIKS GQNLND AFQYRD VRFKVR

CYNYKD CCQVKD CERIQS AERIKQ CEQVQE GEQFQG CYKFNQ GQNVNG AYNIRQ VRFQVV

CYNYQG CCQVKN CERIQE CININQ GINLRG GEQFQQ CYNYKQ GQNQKD AYNIKQ RFIGVR

CYNYQD CCQVQE CERIQQ CFNFRS GINFQT AINLQE CYQFQG GERYNG ACKLKD KRIQDR

CYNCQN CCQFNG CERVKS CFQVNQ GIQLNT AFKQRE CCRIKS GENQNG ACQIRD VRFKAI

CYNQRE CCQYKS CERVNG CYRCND GIQIQN AFNLRT CCKLQG GEQLQG AQRIRG QFFRDL

CYNQQS CCQCRS CERVNS CYKQQE GFRYQE AYKLRQ CCKYKT GEQIKQ AQQYNQ VRFRDV

CYQLRN CCQCRT CERVND CYQCNG GFNFQD AYKFQT CCKQKD AIRFKN AEQIKN VRLKIL

CYQLQS CCQCRD CERFRE CYQCQT GFQQNG AYNQRN CCNLQE AIRYRT CIRLRN VRFRII

CYQLQE CCQCQD CERFQN CCRFKG GYRVRG AYQIKD CQRIQE AININD CIRIRE VRFRGI

CYQIKN CCQQQQ CERYKQ CERYKD GYKFNQ AYQFKG CQKVKG AINVNS CIQYNN VRFQLA

CYQIQS CQRLKD CERYND CEKCND GYNCKD ACRIKG CQQVKS AINYNT CIQYQD VRLKLI

CYQIQQ CQRLNQ CERYQD CEQCRD GYQVQG AQRVKQ CQQCRQ AFKIRN CFRCNG VRFALR

CYQVKD CQRLQT CERCKG GIKFRT GCKVRN AQKVQG CERQKN AFKINQ CFKIRN VFFRII

CYQFRD CQRIRQ CERCNE GFRCRG GCNFQQ AQNVQT GINVND AFNLNN CFKCNS VRFKIA

CYQFRQ CQRIKQ CERCQG GFKYRG GCQFRD AQQCKQ GIQFQG AYRIRQ CFNFQS VAFRLL

CYQFKS CQRVQG CERCQD GFNLNQ GCQFRE AEKLKT GYRYRG AYRVKN CFNCNS IGFKDR VRLKDV QAAGIV MCPISL CEHKAM PCPHKA MCIKTV

VRFQIL QGARAV GRHHNH EHFVQY YTPVSH QPVTQN

RFLAIV QGGADR ILHPYR TDDYIS DKFSAT WWCMPW

VRFQIV QFLAGI KELIGA KSVCKD QESVLW NSNCSW

VRLQIR QGAKVA HGYSTC VNRDNP EKYASK YYQIFD

KRIQVR QGAAGA CVKTSH CNMYHM SGAVKE HRFTPE

VRLQII QGGAVA KNDSER CTWRTK FHWHDD KVTWTL

RGFQIR QFAGAR LTYSSP IRALSI ITDQIP AKAFMS

KRFRIA QFLGVV LWIRFK AINEYM NCAYAT WPFCMM

VGFRIL QAAGLV VNVCSD PWHTDD FNYKIT RIHHMK

VRLKDI QFGKAV ICQVQC PRQGPD MTLYFF KFAAEV

RFFAAV QFIKLA HKPGCK DNPINT GWHWPV TWRLET

RGFQAR QFGAGA SDLFQQ GCHTVK HARFDD MWHDDQ

KRFRAL QFAGDV ARVSTC QRKNQY FLRLAA LMIIPW

KRFRLI QFAAAA PDKMVT ACQSWK WSTYWA ECSRSA

VAFRIL QFIRLA CEYLRG MVWERH RVKKCI WCIMIQ

VRLQLR QAAQAV FAKISI EWFKDV EQESVR GAAGDR

VRIKLV QFLRLA GVRACG VITHMA TFAVEH MKYARP

VFFKVR QFGGDI TYAYHF FQQVQH HKHHQA MGQVKR

VRFKAL QFGKIA AAICLS DQAVTM TKETRS QFTQHF

KRFKLR QFGRLR VLMACG SYFNYE FNTMEL DAMCKH

KRFRII QFAGAA YPPDVT NMPWEQ YGDECE YRAKDW

VRFKII QFLALV TIIMLS SVFGGV WFFGHC HAGYRK

VAFKLR QAGGII KINMIF ANEENL WPTHPN NFVNYH

IRLKVV QGAKDA TQQAMR QCFMKY WWLGRM RIDVEN

VRFQGV QFGAAR PGDPEH NIWTAY WGALCP HRMCLQ

QGARLV QALKGR CLTAVM HKLAMQ CKGLPC VSNWCC

QRGRAA QFGGLL QLHKKL QFLNYS FTFDSR PWEFHN

QFAKLA QFGQDV ESVTDM QAGWNI PQGCRD GDWESW

QFGRVV QFAAGV CYDHTW EWTVPH QYYWRW HMWGDS

QGIKAR QFAAGR CMLNIP GWFLYN HRPFPA AQTSAN

QFLADA QFGAGL MDREMA WCKMPE LGIKIK WARMGT

QRLAAI QFARVL KHSWYA ATRRGW SWVVHC FHMPGP

QGLGVV QFAALL QHMVRA SG TFT FEPLWG TPKDHW

QFFRIA QFAALV WYSVDW WQQMFC HLHRCT VWSDLM

QGGQDA QFAAIV PFDILP VTYFDG RHMVQW LRIGHV

QFAADL QFGQVV AYEYLG MLGFVW PSFPRK KFRCPN

QGLAGI QFGALV EQEYGW GSIPCC NPHFYG RMPKLL

QGAADA QFAAVV VKVPNY PSGSKA WTSCKF ATT F

QFIAAV QGLGDV CGVKEF MYNAHI CSQCHL NWTPYN

QAGRIR QFFADV VLHPWF RAQMPR FNICLD EKPDWV

QFGRVA QFAKLI KPTYKE TTGELK NCQKHN WAMGNR

QALRDI QRIGDV SIIVCM TFKQWD DTEDII YSPEGK

QGAKAV QALGVL HCDNNP DLHNWP DNQCNA AHNREM

QGGAIL QRLAAV WEGRGS DNMRPL CAQCQH HK RWT

QFIGLV QAGQLL YLTCHM ALVYNC PGIAEM HLHRNV

QGGAII QALAGV EHNIEY PTHGEN YFSLAF WVPPRP

QRAAGR QGFQGV HIADDS NQTDWV LVYVQW NEATRD

QFARAA QGIALA RARKIW EMNHGD HALYAH LDPCYQ

QGAALV QGLAIA CRQTSH GYMIWH SCGTTW IDVWGV

QFGKLA QFARIL NMNSQC HHSWCQ HKHVKL WHYHEA

QGIRGA QAAGII LTVPHD CTHEQH TMGMCS TICWVI

QRFKDA QFLGII FIFRVY MEIYDF YAMWNM HDHIMF

QRGRLV PTKEHA EANMHT GAIITV VQIEVG PQCMEN

QFAALA WQYIMG GHMESY FWHWQV YFPSTN IAEGQG

QGGAAA FEMWGG IDIHSY LASRRA CFQHYT QEWAVQ

QAGKIR WFNMSS FVVLRV WRFSKG RLNSLK PVCANL

QFLGLR VCYAVR HENCIA WRDYVY CNHDTP VGERLS

QGLGAL NQYYFS GQQSQK NNECWK QYRGEY GDCHVP

QFLGIR LCSASD SEFHYP YTDMTQ CCPTMS FFETHM

QGARAI EDFTTP CNRFVQ LTRSSE CYALLS RGGPLY

QFIRIA CVFCEY KCVPWP KGRMAI MYEMVI IDDWTI

QFLRIA YLTTFT TSVM T HDWNLQ RMPCAF QCVHSS

QAGGDR QSHKWR LSYDQL SGMWTW KVRADQ VSHCIC

QFFALA RRNVIM NPKIIP FINSQW VPRHRP ITEVYG

QFIAGI QLDLLG TMQQIA IMDADS NWLNRA LSKCFW

QFLAAV MIHVAN SNTQEF AYFRPG IAPYIV NCIHQP

QFAAVR VWDNPI MCGMLV TVWDMT CDWGMS WPVFNS

QFGKAL TWRNSN EKQGLH MPRIYV INKDHW TRGLPC

QFFRLA IPQNKK TTQKDI LW LLW CTNAIE LYICQG

QFGAVA GQDVKH DQLGCC HANAFA ACTAFM IKCLNV

QRGKIV NVMQEI WKNRRP MVDPVH GAASQR ATARRR

QFIRGR AGIKVF KFCIFD HKSCYP WDNWHV WWFQWF TABLE 4

AERCRC AFQSQG AHHHRN AHRHRD ANQHQG AQRCRG ASQSQN ATHSQD ATRSHG CCNFNS

AERCRE AFQSQH AHHLHD AHRHRG ANQHQH AQRCRQ ASQSRD ATHSQG ATRSHH CCNFNT

AERCRG AFQSQN AHHLHG AHRHRH ANQHQN AQRLRC ASQSRG ATHSQH ATRSHN CCNFQD

AERCRQ AFQSRD AHHLHH AHRHRN ANQHRD AQRLRE ASQSRH ATHSQN ATRSQD CCNFQG

AERLRC AFQSRG AHHLHN AHRLHD ANQHRG AQRLRG ASQSRN ATHSRD ATRSQG CCNFQS

AERLRE AFQSRH AHHLQD AHRLHG ANQHRH AQRLRQ ASQTHD ATHSRG ATRSQH CCNFQT

AERLRG AFQSRN AHHLQG AHRLHH ANQHRN AQRQRC ASQTHG ATHSRH ATRSQN CCNFRD

AERLRQ AFQTHD AHHLQH AHRLHN ANQLHD AQRQRE ASQTHH ATHSRN ATRSRD CCNFRG

AERQRC AFQTHG AHHLQN AHRLQD ANQLHG AQRQRG ASQTHN ATHTHD ATRSRG CCNFRS

AERQRE AFQTHH AHHLRD AHRLQG ANQLHH AQRQRQ ASQTQD ATHTHG ATRSRH CCNFRT

AERQRG AFQTHN AHHLRG AHRLQH ANQLHN AQRYRC ASQTQG ATHTHH ATRSRN CCNIKD

AERQRQ AFQTQD AHHLRH AHRLQN ANQLQD AQRYRE ASQTQH ATHTHN ATRTHD CCNIKG

AERYRC AFQTQG AHHLRN AHRLRD ANQLQG AQRYRG ASQTQN ATHTQD ATRTHG CCNIKS

AERYRE AFQTQH AHHSHD AHRLRG ANQLQH AQRYRQ ASQTRD ATHTQG ATRTHH CCNIKT

AERYRG AFQTQN AHHSHG AHRLRH ANQLQN ASHHHD ASQTRG ATHTQH ATRTHN CCNIND

AERYRQ AFQTRD AHHSHH AHRLRN ANQLRD ASHHHG ASQTRH ATHTQN ATRTQD CCNING

AFHHHD AFQTRG AHHSHN AHRSHD ANQLRG ASHHHH ASQTRN ATHTRD ATRTQG CCNINS

AFHHHG AFQTRH AHHSQD AHRSHG ANQLRH ASHHHN ASRHHD ATHTRG ATRTQH CCNINT

AFHHHH AFQTRN AHHSQG AHRSHH ANQLRN ASHHQD ASRHHG ATHTRH ATRTQN CCNIQD

AFHHHN AFRCRC AHHSQH AHRSHN ANQSHD ASHHQG ASRHHH ATHTRN ATRTRD CCNIQG

AFHHQD AFRCRE AHHSQN AHRSQD ANQSHG ASHHQH ASRHHN ATQHHD ATRTRG CCNIQS

AFHHQG AFRCRG AHHSRD AHRSQG ANQSHH ASHHQN ASRHQD ATQHHG ATRTRH CCNIQT

AFHHQH AFRCRQ AHHSRG AHRSQH ANQSHN ASHHRD ASRHQG ATQHHH ATRTRN CCNIRD

AFHHQN AFRHHD AHHSRH AHRSQN ANQSQD ASHHRG ASRHQH ATQHHN CCKFKD CCNIRG

AFHHRD AFRHHG AHHSRN AHRSRD ANQSQG ASHHRH ASRHQN ATQHQD CCKFKG CCNIRS

AFHHRG AFRHHH AHHTHD AHRSRG ANQSQH ASHHRN ASRHRD ATQHQG CCKFKS CCNIRT

AFHHRH AFRHHN AHHTHG AHRSRH ANQSQN ASHLHD ASRHRG ATQHQH CCKFKT CCNLKD

AFHHRN AFRHQD AHHTHH AHRSRN ANQSRD ASHLHG ASRHRH ATQHQN CCKFND CCNLKG

AFHLHD AFRHQG AHHTHN AHRTHD ANQSRG ASHLHH ASRHRN ATQHRD CCKFNG CCNLKS

AFHLHG AFRHQH AHHTQD AHRTHG ANQSRH ASHLHN ASRLHD ATQHRG CCKFNS CCNLKT

AFHLHH AFRHQN AHHTQG AHRTHH ANQSRN ASHLQD ASRLHG ATQHRH CCKFNT CCNLND

AFHLHN AFRHRD AHHTQH AHRTHN ANQTHD ASHLQG ASRLHH ATQHRN CCKFQD CCNLNG

AFHLQD AFRHRG AHHTQN AHRTQD ANQTHG ASHLQH ASRLHN ATQLHD CCKFQG CCNLNS

AFHLQG AFRHRH AHHTRD AHRTQG ANQTHH ASHLQN ASRLQD ATQLHG CCKFQS CCNLNT

AFHLQH AFRHRN AHHTRG AHRTQH ANQTHN ASHLRD ASRLQG ATQLHH CCKFQT CCNLQD

AFHLQN AFRLHD AHHTRH AHRTQN ANQTQD ASHLRG ASRLQH ATQLHN CCKFRD CCNLQG

AFHLRD AFRLHG AHHTRN AHRTRD ANQTQG ASHLRH ASRLQN ATQLQD CCKFRG CCNLQS

AFHLRG AFRLHH AHQHHD AHRTRG ANQTQH ASHLRN ASRLRD ATQLQG CCKFRS CCNLQT

AFHLRH AFRLHN AHQHHG AHRTRH ANQTQN ASHSHD ASRLRG ATQLQH CCKFRT CCNLRD

AFHLRN AFRLQD AHQHHH AHRTRN ANQTRD ASHSHG ASRLRH ATQLQN CCKIKD CCNLRG

AFHSHD AFRLQG AHQHHN ANHHHD ANQTRG ASHSHH ASRLRN ATQLRD CCKIKG CCNLRS

AFHSHG AFRLQH AHQHQD ANHHHG ANQTRH ASHSHN ASRSHD ATQLRG CCKIKS CCNLRT

AFHSHH AFRLQN AHQHQG ANHHHH ANQTRN ASHSQD ASRSHG ATQLRH CCKIKT CCNVKD

AFHSHN AFRLRC AHQHQH ANHHHN ANRHHD ASHSQG ASRSHH ATQLRN CCKIND CCNVKG

AFHSQD AFRLRD AHQHQN ANHHQD ANRHHG ASHSQH ASRSHN ATQSHD CCKING CCNVKS

AFHSQG AFRLRE AHQHRD ANHHQG ANRHHH ASHSQN ASRSQD ATQSHG CCKINS CCNVKT

AFHSQH AFRLRG AHQHRG ANHHQH ANRHHN ASHSRD ASRSQG ATQSHH CCKINT CCNVND

AFHSQN AFRLRH AHQHRH ANHHQN ANRHQD ASHSRG ASRSQH ATQSHN CCKIQD CCNVNG

AFHSRD AFRLRN AHQHRN ANHHRD ANRHQG ASHSRH ASRSQN ATQSQD CCKIQG CCNVNS

AFHSRG AFRLRQ AHQLHD ANHHRG ANRHQH ASHSRN ASRSRD ATQSQG CCKIQS CCNVNT

AFHSRH AFRQRC AHQLHG ANHHRH ANRHQN ASHTHD ASRSRG ATQSQH CCKIQT CCNVQD

AFHSRN AFRQRE AHQLHH ANHHRN ANRHRD ASHTHG ASRSRH ATQSQN CCKIRD CCNVQG

AFHTHD AFRQRG AHQLHN ANHLHD ANRHRG ASHTHH ASRSRN ATQSRD CCKIRG CCNVQS

AFHTHG AFRQRQ AHQLQD ANHLHG ANRHRH ASHTHN ASRTHD ATQSRG CCKIRS CCNVQT

AFHTHH AFRSHD AHQLQG ANHLHH ANRHRN ASHTQD ASRTHG ATQSRH CCKIRT CCNVRD

AFHTHN AFRSHG AHQLQH ANHLHN ANRLHD ASHTQG ASRTHH ATQSRN CCKLKD CCNVRG

AFHTQD AFRSHH AHQLQN ANHLQD ANRLHG ASHTQH ASRTHN ATQTHD CCKLKG CCNVRS

AFHTQG AFRSHN AHQLRD ANHLQG ANRLHH ASHTQN ASRTQD ATQTHG CCKLKS CCNVRT

AFHTQH AFRSQD AHQLRG ANHLQH ANRLHN ASHTRD ASRTQG ATQTHH CCKLKT CCQFKD

AFHTQN AFRSQG AHQLRH ANHLQN ANRLQD ASHTRG ASRTQH ATQTHN CCKLND CCQFKG

AFHTRD AFRSQH AHQLRN ANHLRD ANRLQG ASHTRH ASRTQN ATQTQD CCKLNG CCQFKS

AFHTRG AFRSQN AHQSHD ANHLRG ANRLQH ASHTRN ASRTRD ATQTQG CCKLNS CCQFKT

AFHTRH AFRSRD AHQSHG ANHLRH ANRLQN ASQHHD ASRTRG ATQTQH CCKLNT CCQFND

AFHTRN AFRSRG AHQSHH ANHLRN ANRLRD ASQHHG ASRTRH ATQTQN CCKLQD CCQFNG

AFQHHD AFRSRH AHQSHN ANHSHD ANRLRG ASQHHH ASRTRN ATQTRD CCKLQG CCQFNS

AFQHHG AFRSRN AHQSQD ANHSHG ANRLRH ASQHHN ATHHHD ATQTRG CCKLQS CCQFNT

AFQHHH AFRTHD AHQSQG ANHSHH ANRLRN ASQHQD ATHHHG ATQTRH CCKLQT CCQFQD

AFQHHN AFRTHG AHQSQH ANHSHN ANRSHD ASQHQG ATHHHH ATQTRN CCKLRD CCQFQG

AFQHQD AFRTHH AHQSQN ANHSQD ANRSHG ASQHQH ATHHHN ATRHHD CCKLRG CCQFQS

AFQHQG AFRTHN AHQSRD ANHSQG ANRSHH ASQHQN ATHHQD ATRHHG CCKLRS CCQFQT

AFQHQH AFRTQD AHQSRG ANHSQH ANRSHN ASQHRD ATHHQG ATRHHH CCKLRT CCQFRD

AFQHQ AFRTQG AHQSRH ANHSQN ANRSQD ASQHRG ATHHQH ATRHHN CCKVKD CCQFRG

AFQHRD AFRTQH AHQSRN ANHSRD ANRSQG ASQHRH ATHHQN ATRHQD CCKVKG CCQFRS

AFQHRG AFRTQN AHQTHD ANHSRG ANRSQH ASQHRN ATHHRD ATRHQG CCKVKS CCQFRT

AFQHRH AFRTRD AHQTHG ANHSRH ANRSQN ASQLHD ATHHRG ATRHQH CCKVKT CCQIKD

AFQHRN AFRTRG AHQTHH ANHSRN ANRSRD ASQLHG ATHHRH ATRHQN CCKVND CCQIKG

AFQLHD AFRTRH AHQTHN ANHTHD ANRSRG ASQLHH ATHHRN ATRHRD CCKVNG CCQIKS

AFQLHG AFRTRN AHQTQD ANHTHG ANRSRH ASQLHN ATHLHD ATRHRG CCKVNS CCQIKT

AFQLHH AFRYRC AHQTQG ANHTHH ANRSRN ASQLQD ATHLHG ATRHRH CCKVNT CCQIND

AFQLHN AFRYRE AHQTQH ANHTHN ANRTHD ASQLQG ATHLHH ATRHRN CCKVQD CCQING

AFQLQD AFRYRG AHQTQN ANHTQD ANRTHG ASQLQH ATHLHN ATRLHD CCKVQG CCQINS

AFQLQG AFRYRQ AHQTRD ANHTQG ANRTHH ASQLQN ATHLQD ATRLHG CCKVQS CCQI T

AFQLQH AHHHHD AHQTRG ANHTQH ANRTHN ASQLRD ATHLQG ATRLHH CCKVQT CCQIQD

AFQLQN AHHHHG AHQTRH ANHTQN ANRTQD ASQLRG ATHLQH ATRLHN CCKVRD CCQIQG

AFQLRD AHHHHH AHQTRN ANHTRD ANRTQG ASQLRH ATHLQN ATRLQD CCKVRG CCQIQS

AFQLRG AHHHHN AHRHHD ANHTRG ANRTQH ASQLRN ATHLRD ATRLQG CCKVRS CCQIQT

AFQLRH AHHHQD AHRHHG ANHTRH ANRTQN ASQSHD ATHLRG ATRLQH CCKVRT CCQIRD

AFQLRN AHHHQG AHRHHH ANHTRN ANRTRD ASQSHG ATHLRH ATRLQN CCNFKD CCQIRG

AFQSHD AHHHQH AHRHHN ANQHHD ANRTRG ASQSHH ATHLRN ATRLRD CCNFKG CCQIRS

AFQSHG AHHHQN AHRHQD ANQHHG ANRTRH ASQSHN ATHSHD ATRLRG CCNFKS CCQIRT

AFQSHH AHHHRD AHRHQG ANQHHH ANRTRN ASQSQD ATHSHG ATRLRH CCNFKT CCQLKD

AFQSHN AHHHRG AHRHQH ANQHHN AQRCRC ASQSQG ATHSHH ATRLRN CCNFND CCQLKG

AFQSQD AHHHRH AHRHQN ANQHQD AQRCRE ASQSQH ATHSHN ATRSHD CCNFNG CCQLKS CCQLKT CFKFND CFNLNG CFRFNS CIKLNT CIQFQD CIRLQG CYNFQS CYQLQT GCKFRD

CCQLND CFKFNG CFNLNS CFRFNT CIKLQD CIQFQG CIRLQS CYNFQT CYQLRD GCKFRG

CCQLNG CFKFNS CFNLNT CFRFQD CIKLQG CIQFQS CIRLQT CYNFRD CYQLRG GCKFRS

CCQLNS CFKFNT CFNLQD CFRFQG CIKLQS CIQFQT CIRLRD CYNFRG CYQLRS GCKFRT

CCQLNT CFKFQD CFNLQG CFRFQS CIKLQT CIQFRD CIRLRG CYNFRS CYQLRT GCKIKD

CCQLQD CFKFQG CFNLQS CFRFQT CIKLRD CIQFRG CIRLRS CYNFRT CYQVKD GCKIKG

CCQLQG CFKFQS CFNLQT CFRFRD CIKLRG CIQFRS CIRLRT CYNIKD CYQVKG GCKIKS

CCQLQS CFKFQT CFNLRD CFRFRG CIKLRS CIQFRT CIRVKD CYNIKG CYQVKS GCKIKT

CCQLQT CFKFRD CFNLRG CFRFRS CIKLRT CIQIKD CIRVKG CYNIKS CYQVKT GCKIND

CCQLRD CFKFRG CFNLRS CFRFRT CIKVKD CIQIKG CIRVKS CYNIKT CYQVND GCKING

CCQLRG CFKFRS CFNLRT CFRIKD CIKVKG CIQIKS CIRVKT CYNIND CYQVNG GCKINS

CCQLRS CFKFRT CFNVKD CFRIKG CIKVKS CIQIKT CIRVND CYNING CYQVNS GCKINT

CCQLRT CFKIKD CFNVKG CFRIKS CIKVKT CIQIND CIRVNG CYNINS CYQVNT GCKIQD

CCQVKD CFKIKG CFNVKS CFRIKT CIKV D CIQING CIRVNS CYNINT CYQVQD GCKIQG

CCQVKG CFKIKS CFNVKT CFRIND CIKVNG CIQINS CIRVNT CYNIQD CYQVQG GCKIQS

CCQVKS CFKIKT CFNVND CFRING CIKVNS CIQINT CIRVQD CYNIQG CYQVQS GCKIQT

CCQVKT CFKIND CFNVNG CFRINS CIKVNT CIQIQD CIRVQG CYNIQS CYQVQT GCKIRD

CCQVND CFKING CFNVNS CFRINT CIKVQD CIQIQG CIRVQS CYNIQT CYQVRD GCKIRG

CCQVNG CFKINS CFNVNT CFRIQD CIKVQG CIQIQS CIRVQT CYNIRD CYQVRG GCKIRS

CCQVNS CFKINT CFNVQD CFRIQG CIKVQS CIQIQT CIRVRD CYNIRG CYQVRS GCKIRT

CCQVNT CFKIQD CFNVQG CFRIQS CIKVQT CIQIRD CIRVRG CYNIRS CYQVRT GCKLKD

CCQVQD CFKIQG CFNVQS CFRIQT CIKVRD CIQIRG CIRVRS CYNIRT CYRFKD GCKLKG

CCQVQG CFKIQS CFNVQT CFRIRD CIKVRG CIQIRS CIRVRT CYNLKD CYRFKG GCKLKS

CCQVQS CFKIQT CFNVRD CFRIRG CIKVRS CIQIRT CYKFKD CYNLKG CYRFKS GCKLKT

CCQVQT CFKIRD CFNVRG CFRIRS CIKVRT CIQLKD CYKFKG CYNLKS CYRFKT GCKLND

CCQVRD CFKIRG CFNVRS CFRIRT CINFKD CIQLKG CYKFKS CYNLKT CYRFND GCKLNG

CCQVRG CFKIRS CFNVRT CFRLKD CINFKG CIQLKS CYKFKT CYNLND CYRFNG GCKLNS

CCQVRS CFKIRT CFQFKD CFRLKG CINFKS CIQLKT CYKFND CYNLNG CYRFNS GCKLNT

CCQVRT CFKLKD CFQFKG CFRLKS CINFKT CIQLND CYKFNG CYNLNS CYRFNT GCKLQD

CCRFKD CFKLKG CFQFKS CFRLKT CINFND CIQLNG CYKFNS CYNLNT CYRFQD GCKLQG

CCRFKG CFKLKS CFQFKT CFRLND CINFNG CIQLNS CYKFNT CYNLQD CYRFQG GCKLQS

CCRFKS CFKLKT CFQFND CFRLNG CINFNS CIQLNT CYKFQD CYNLQG CYRFQS GCKLQT

CCRFKT CFKLND CFQFNG CFRLNS CINFNT CIQLQD CYKFQG CYNLQS CYRFQT GCKLRD

CCRFND CFKLNG CFQFNS CFRLNT CINFQD CIQLQG CYKFQS CYNLQT CYRFRD GCKLRG

CCRFNG CFKLNS CFQFNT CFRLQD CINFQG CIQLQS CYKFQT CYNLRD CYRFRG GCKLRS

CCRFNS CFKLNT CFQFQD CFRLQG CINFQS CIQLQT CYKFRD CYNLRG CYRFRS GCKLRT

CCRFNT CFKLQD CFQFQG CFRLQS CI FQT CIQLRD CYKFRG CYNLRS CYRFRT GCKVKD

CCRFQD CFKLQG CFQFQS CFRLQT CINFRD CIQLRG CYKFRS CYNLRT CYRIKD GCKVKG

CCRFQG CFKLQS CFQFQT CFRLRD CINFRG CIQLRS CYKFRT CYNVKD CYRIKG GCKVKS

CCRFQS CFKLQT CFQFRD CFRLRG CINFRS CIQLRT CYKIKD CYNVKG CYRIKS GCKVKT

CCRFQT CFKLRD CFQFRG CFRLRS CINFRT CIQVKD CYKIKG CYNVKS CYRIKT GCKVND

CCRFRD CFKLRG CFQFRS CFRLRT CINIKD CIQVKG CYKIKS CYNVKT CYRIND GCKVNG

CCRFRG CFKLRS CFQFRT CFRVKD CINIKG CIQVKS CYKIKT CYNVND CYRING GCKVNS

CCRFRS CFKLRT CFQIKD CFRVKG CINIKS CIQVKT CYKIND CYNVNG CYRINS GCKVNT

CCRFRT CFKVKD CFQIKG CFRVKS CINIKT CIQVND CYKING CYNVNS CYRINT GCKVQD

CCRIKD CFKVKG CFQIKS CFRVKT CININD CIQVNG CYKINS CYNVNT CYRIQD GCKVQG

CCRIKG CFKVKS CFQIKT CFRVND CINING CIQVNS CYKINT CYNVQD CYRIQG GCKVQS

CCRIKS CFKVKT CFQIND CFRVNG CININS CIQVNT CYKIQD CYNVQG CYRIQS GCKVQT

CCRIKT CFKVND CFQING CFRVNS CININT CIQVQD CYKIQG CYNVQS CYRIQT GCKVRD

CCRIND CFKVNG CFQINS CFRVNT CINIQD CIQVQG CYKIQS CYNVQT CYRIRD GCKVRG

CCRING CFKVNS CFQINT CFRVQD CINIQG CIQVQS CYKIQT CYNVRD CYRIRG GCKVRS

CCRINS CFKVNT CFQIQD CFRVQG CINIQS CIQVQT CYKIRD CYNVRG CYRIRS GCKVRT

CCRINT CFKVQD CFQIQG CFRVQS CINIQT CIQVRD CYKIRG CYNVRS CYRIRT GCNFKD

CCRIQD CFKVQG CFQIQS CFRVQT CINIRD CIQVRG CYKIRS CYNVRT CYRLKD GCNFKG

CCRIQG CFKVQS CFQIQT CFRVRD CINIRG CIQVRS CYKIRT CYQFKD CYRLKG GCNFKS

CCRIQS CFKVQT CFQIRD CFRVRG CINIRS CIQVRT CYKLKD CYQFKG CYRLKS GCNFKT

CCRIQT CFKVRD CFQIRG CFRVRS CINIRT CIRFKD CYKLKG CYQFKS CYRLKT GCNFND

CCRIRD CFKVRG CFQIRS CFRVRT CINLKD CIRFKG CYKLKS CYQFKT CYRLND GCNFNG

CCRIRG CFKVRS CFQIRT CIKFKD CINLKG CIRFKS CYKLKT CYQFND CYRLNG GCNFNS

CCRIRS CFKVRT CFQLKD CIKFKG CINLKS CIRFKT CYKLND CYQFNG CYRLNS GCNFNT

CCRIRT CFNFKD CFQLKG CIKFKS CINLKT CIRFND CYKLNG CYQFNS CYRLNT GCNFQD

CCRLKD CFNFKG CFQLKS CIKFKT CINLND CIRFNG CYKLNS CYQFNT CYRLQD GCNFQG

CCRLKG CFNFKS CFQLKT CIKFND CINLNG CIRFNS CYKLNT CYQFQD CYRLQG GCNFQS

CCRLKS CFNFKT CFQLND CIKFNG CINLNS CIRFNT CYKLQD CYQFQG CYRLQS GCNFQT

CCRLKT CFNFND CFQLNG CIKFNS CINLNT CIRFQD CYKLQG CYQFQS CYRLQT GCNFRD

CCRLND CFNFNG CFQLNS CIKF T CINLQD CIRFQG CYKLQS CYQFQT CYRLRD GCNFRG

CCRLNG CFNFNS CFQLNT CIKFQD CI LQG CIRFQS CYKLQT CYQFRD CYRLRG GCNFRS

CCRLNS CFNFNT CFQLQD CIKFQG CINLQS CIRFQT CYKLRD CYQFRG CYRLRS GCNFRT

CCRLNT CFNFQD CFQLQG CIKFQS CI LQT CIRFRD CYKLRG CYQFRS CYRLRT GCNIKD

CCRLQD CFNFQG CFQLQS CIKFQT CINLRD CIRFRG CYKLRS CYQFRT CYRVKD GCNIKG

CCRLQG CFNFQS CFQLQT CIKFRD CINLRG CIRFRS CYKLRT CYQIKD CYRVKG GCNIKS

CCRLQS CFNFQT CFQLRD CIKFRG CINLRS CIRFRT CYKVKD CYQIKG CYRVKS GCNIKT

CCRLQT CFNFRD CFQLRG CIKFRS CINLRT CIRIKD CYKVKG CYQIKS CYRVKT GCNIND

CCRLRD CFNFRG CFQLRS CIKFRT CINVKD CIRIKG CYKVKS CYQIKT CYRVND GCNING

CCRLRG CFNFRS CFQLRT CIKIKD CINVKG CIRIKS CYKVKT CYQIND CYRVNG GCNINS

CCRLRS CFNFRT CFQVKD OKI KG CINVKS CIRIKT CYKVND CYQING CYRVNS GCNINT

CCRLRT CFNIKD CFQVKG CIKIKS CINVKT CIRIND CYKVNG CYQINS CYRVNT GCNIQD

CCRVKD CFNIKG CFQVKS CIKIKT CINVND CIRING CYKVNS CYQI T CYRVQD GCNIQG

CCRVKG CFNIKS CFQVKT CIKIND CINVNG CIRINS CYKVNT CYQIQD CYRVQG GCNIQS

CCRVKS CFNIKT CFQVND CIKING CINVNS CIRINT CYKVQD CYQIQG CYRVQS GCNIQT

CCRVKT CFNIND CFQVNG CIKINS CINVNT CIRIQD CYKVQG CYQIQS CYRVQT GCNIRD

CCRVND CFNING CFQVNS OKI NT CINVQD CIRIQG CYKVQS CYQIQT CYRVRD GCNIRG

CCRVNG CFNINS CFQVNT CIKIQD CINVQG CIRIQS CYKVQT CYQIRD CYRVRG GCNIRS

CCRVNS CFNINT CFQVQD CIKIQG CINVQS CIRIQT CYKVRD CYQIRG CYRVRS GCNIRT

CCRVNT CFNIQD CFQVQG CIKIQS CINVQT CIRIRD CYKVRG CYQIRS CYRVRT GCNLKD

CCRVQD CFNIQG CFQVQS CIKIQT CINVRD CIRIRG CYKVRS CYQIRT GCKFKD GCNLKG

CCRVQG CFNIQS CFQVQT CIKIRD CINVRG CIRIRS CYKVRT CYQLKD GCKFKG GCNLKS

CCRVQS CFNIQT CFQVRD CIKIRG CINVRS CIRIRT CYNFKD CYQLKG GCKFKS GCNLKT

CCRVQT CFNIRD CFQVRG CI KIRS CINVRT CIRLKD CYNFKG CYQLKS GCKFKT GCNLND

CCRVRD CFNIRG CFQVRS CIKIRT CIQFKD CIRLKG CYNFKS CYQLKT GCKFND GCNLNG

CCRVRG CFNIRS CFQVRT CIKLKD CIQFKG CIRLKS CYNFKT CYQLND GCKFNG GCNLNS

CCRVRS CFNIRT CFRFKD CIKLKG CIQFKS CIRLKT CYNFND CYQLNG GCKFNS GCNLNT

CCRVRT CFNLKD CFRFKG CIKLKS CIQFKT CIRLND CYNFNG CYQLNS GCKFNT GCNLQD

CFKFKD CFNLKG CFRFKS CIKLKT CIQFND CIRLNG CYNFNS CYQLNT GCKFQD GCNLQG

CFKFKG CFNLKS CFRFKT CIKLND CIQFNG CIRLNS CYNFNT CYQLQD GCKFQG GCNLQS

CFKFKS CFNLKT CFRFND CIKLNG CIQFNS CIRLNT CYNFQD CYQLQG GCKFQS GCNLQT

CFKFKT CFNLND CFRFNG CIKLNS CIQFNT CIRLQD CYNFQG CYQLQS GCKFQT GCNLRD GCNLRG GCRFRS GFHSQN GFNIKD GFQLKG GFRINS GHHLHD GHRLHG GIKVRS GIQIRT

GCNLRS GCRFRT GFHSRD GFNIKG GFQLKS GFRINT GHHLHG GHRLHH GIKVRT GIQLKD

GCNLRT GCRIKD GFHSRG GFNIKS GFQLKT GFRIQD GHHLHH GHRLHN GINFKD GIQLKG

GCNVKD GCRIKG GFHSRH GFNIKT GFQLND GFRIQG GHHLHN GHRLQD GINFKG GIQLKS

GCNVKG GCRIKS GFHSRN GFNIND GFQLNG GFRIQS GHHLQD GHRLQG GINFKS GIQLKT

GCNVKS GCRIKT GFHTHD GFNING GFQLNS GFRIQT GHHLQG GHRLQH GINFKT GIQLND

GCNVKT GCRIND GFHTHG GFNINS GFQLNT GFRIRD GHHLQH GHRLQN GINFND GIQLNG

GCNVND GCRING GFHTHH GFNINT GFQLQD GFRIRG GHHLQN GHRLRD GINFNG GIQLNS

GCNVNG GCRINS GFHTHN GFNIQD GFQLQG GFRIRS GHHLRD GHRLRG GINFNS GIQLNT

GCNVNS GCRINT GFHTQD GFNIQG GFQLQH GFRIRT GHHLRG GHRLRH GINFNT GIQLQD

GCNVNT GCRIQD GFHTQG GFNIQS GFQLQN GFRLHD GHHLRH GHRLRN GINFQD GIQLQG

GCNVQD GCRIQG GFHTQH GFNIQT GFQLQS GFRLHG GHHLRN GHRSHD GINFQG GIQLQS

GCNVQG GCRIQS GFHTQN GFNIRD GFQLQT GFRLHH GHHSHD GHRSHG GINFQS GIQLQT

GCNVQS GCRIQT GFHTRD GFNIRG GFQLRD GFRLHN GHHSHG GHRSHH GINFQT GIQLRD

GCNVQT GCRIRD GFHTRG GFNIRS GFQLRG GFRLKD GHHSHH GHRSHN GINFRD GIQLRG

GCNVRD GCRIRG GFHTRH GFNIRT GFQLRH GFRLKG GHHSHN GHRSQD GINFRG GIQLRS

GCNVRG GCRIRS GFHTRN GFNLKD GFQLRN GFRLKS GHHSQD GHRSQG GINFRS GIQLRT

GCNVRS GCRIRT GFKFKD GFNLKG GFQLRS GFRLKT GHHSQG GHRSQH GINFRT GIQVKD

GCNVRT GCRLKD GFKFKG GFNLKS GFQLRT GFRLND GHHSQH GHRSQN GINIKD GIQVKG

GCQFKD GCRLKG GFKFKS GFNLKT GFQSHD GFRLNG GHHSQN GHRSRD GINIKG GIQVKS

GCQFKG GCRLKS GFKFKT GFNLND GFQSHG GFRLNS GHHSRD GHRSRG GINIKS GIQVKT

GCQFKS GCRLKT GFKFND GFNLNG GFQSHH GFRLNT GHHSRG GHRSRH GINIKT GIQVND

GCQFKT GCRLND GFKFNG GFNLNS GFQSHN GFRLQD GHHSRH GHRSRN GININD GIQVNG

GCQFND GCRLNG GFKFNS GFNLNT GFQSQD GFRLQG GHHSRN GHRTHD GINING GIQVNS

GCQFNG GCRLNS GFKFNT GFNLQD GFQSQG GFRLQH GHHTHD GHRTHG GININS GIQVNT

GCQFNS GCRLNT GFKFQD GFNLQG GFQSQH GFRLQN GHHTHG GHRTHH GININT GIQVQD

GCQFNT GCRLQD GFKFQG GFNLQS GFQSQN GFRLQS GHHTHH GHRTHN GINIQD GIQVQG

GCQFQD GCRLQG GFKFQS GFNLQT GFQSRD GFRLQT GHHTHN GHRTQD GINIQG GIQVQS

GCQFQG GCRLQS GFKFQT GFNLRD GFQSRG GFRLRC GHHTQD GHRTQG GINIQS GIQVQT

GCQFQS GCRLQT GFKFRD GFNLRG GFQSRH GFRLRD GHHTQG GHRTQH GINIQT GIQVRD

GCQFQT GCRLRD GFKFRG GFNLRS GFQSRN GFRLRE GHHTQH GHRTQN GINIRD GIQVRG

GCQFRD GCRLRG GFKFRS GFNLRT GFQTHD GFRLRG GHHTQN GHRTRD GINIRG GIQVRS

GCQFRG GCRLRS GFKFRT GF KD GFQTHG GFRLRH GHHTRD GHRTRG GINIRS GIQVRT

GCQFRS GCRLRT GFKIKD GF KG GFQTHH GFRLRN GHHTRG GHRTRH GINIRT GIRFKD

GCQFRT GCRVKD GFKIKG GF KS GFQTHN GFRLRQ GHHTRH GHRTRN GINLKD GIRFKG

GCQIKD GCRVKG GFKIKS GF KT GFQTQD GFRLRS GHHTRN GIKFKD GINLKG GIRFKS

GCQIKG GCRVKS GFKIKT GFNVND GFQTQG GFRLRT GHQHHD GIKFKG GINLKS GIRFKT

GCQIKS GCRVKT GFKIND GFNVNG GFQTQH GFRQRC GHQHHG GIKFKS GINLKT GIRFND

GCQIKT GCRVND GFKING GFNVNS GFQTQN GFRQRE GHQHHH GIKFKT GINLND GIRFNG

GCQIND GCRVNG GFKINS GF NT GFQTRD GFRQRG GHQHHN GIKFND GINLNG GIRFNS

GCQING GCRVNS GFKINT GF QD GFQTRG GFRQRQ GHQHQD GIKFNG GINLNS GIRFNT

GCQINS GCRVNT GFKIQD GF QG GFQTRH GFRSHD GHQHQG GIKFNS GINLNT GIRFQD

GCQINT GCRVQD GFKIQG GF QS GFQTRN GFRSHG GHQHQH GIKFNT GINLQD GIRFQG

GCQIQD GCRVQG GFKIQS GF QT GFQVKD GFRSHH GHQHQN GIKFQD GINLQG GIRFQS

GCQIQG GCRVQS GFKIQT GFNVRD GFQVKG GFRSHN GHQHRD GIKFQG GINLQS GIRFQT

GCQIQS GCRVQT GFKIRD GF RG GFQVKS GFRSQD GHQHRG GIKFQS GINLQT GIRFRD

GCQIQT GCRVRD GFKIRG GF RS GFQVKT GFRSQG GHQHRH GIKFQT GINLRD GIRFRG

GCQIRD GCRVRG GFKIRS GF RT GFQVND GFRSQH GHQHRN GIKFRD GINLRG GIRFRS

GCQIRG GCRVRS GFKIRT GFQFKD GFQVNG GFRSQN GHQLHD GIKFRG GINLRS GIRFRT

GCQIRS GCRVRT GFKLKD GFQFKG GFQVNS GFRSRD GHQLHG GIKFRS GINLRT GIRIKD

GCQIRT GERCRC GFKLKG GFQFKS GFQVNT GFRSRG GHQLHH GIKFRT GINVKD GIRIKG

GCQLKD GERCRE GFKLKS GFQFKT GFQVQD GFRSRH GHQLHN GIKIKD GINVKG GIRIKS

GCQLKG GERCRG GFKLKT GFQFND GFQVQG GFRSRN GHQLQD GIKIKG GINVKS GIRIKT

GCQLKS GERCRQ GFKLND GFQFNG GFQVQS GFRTHD GHQLQG GIKIKS GINVKT GIRIND

GCQLKT GERLRC GFKLNG GFQFNS GFQVQT GFRTHG GHQLQH GIKIKT GINVND GIRING

GCQLND GERLRE GFKLNS GFQFNT GFQVRD GFRTHH GHQLQN GIKIND GINVNG GIRINS

GCQLNG GERLRG GFKLNT GFQFQD GFQVRG GFRTHN GHQLRD GIKING GINVNS GIRINT

GCQLNS GERLRQ GFKLQD GFQFQG GFQVRS GFRTQD GHQLRG GIKINS GINVNT GIRIQD

GCQLNT GERQRC GFKLQG GFQFQS GFQVRT GFRTQG GHQLRH GIKINT GINVQD GIRIQG

GCQLQD GERQRE GFKLQS GFQFQT GFRCRC GFRTQH GHQLRN GIKIQD GINVQG GIRIQS

GCQLQG GERQRG GFKLQT GFQFRD GFRCRE GFRTQN GHQSHD GIKIQG GINVQS GIRIQT

GCQLQS GERQRQ GFKLRD GFQFRG GFRCRG GFRTRD GHQSHG GIKIQS GINVQT GIRIRD

GCQLQT GERYRC GFKLRG GFQFRS GFRCRQ GFRTRG GHQSHH GIKIQT GINVRD GIRIRG

GCQLRD GERYRE GFKLRS GFQFRT GFRFKD GFRTRH GHQSHN GIKIRD GINVRG GIRIRS

GCQLRG GERYRG GFKLRT GFQHHD GFRFKG GFRTRN GHQSQD GIKIRG GINVRS GIRIRT

GCQLRS GERYRQ GFKVKD GFQHHG GFRFKS GFRVKD GHQSQG GIKIRS GINVRT GIRLKD

GCQLRT GFHHHD GFKVKG GFQHHH GFRFKT GFRVKG GHQSQH GIKIRT GIQFKD GIRLKG

GCQVKD GFHHHG GFKVKS GFQHHN GFRFND GFRVKS GHQSQN GIKLKD GIQFKG GIRLKS

GCQVKG GFHHHH GFKVKT GFQHQD GFRFNG GFRVKT GHQSRD GIKLKG GIQFKS GIRLKT

GCQVKS GFHHHN GFKVND GFQHQG GFRFNS GFRVND GHQSRG GIKLKS GIQFKT GIRLND

GCQVKT GFHHQD GFKVNG GFQHQH GFRFNT GFRVNG GHQSRH GIKLKT GIQFND GIRLNG

GCQVND GFHHQG GFKVNS GFQHQN GFRFQD GFRVNS GHQSRN GIKLND GIQFNG GIRLNS

GCQVNG GFHHQH GFKVNT GFQHRD GFRFQG GFRVNT GHQTHD GIKLNG GIQFNS GIRLNT

GCQVNS GFHHQN GFKVQD GFQHRG GFRFQS GFRVQD GHQTHG GIKLNS GIQFNT GIRLQD

GCQVNT GFHHRD GFKVQG GFQHRH GFRFQT GFRVQG GHQTHH GIKLNT GIQFQD GIRLQG

GCQVQD GFHHRG GFKVQS GFQHRN GFRFRD GFRVQS GHQTHN GIKLQD GIQFQG GIRLQS

GCQVQG GFHHRH GFKVQT GFQIKD GFRFRG GFRVQT GHQTQD GIKLQG GIQFQS GIRLQT

GCQVQS GFHHRN GFKVRD GFQIKG GFRFRS GFRVRD GHQTQG GIKLQS GIQFQT GIRLRD

GCQVQT GFHLHD GFKVRG GFQIKS GFRFRT GFRVRG GHQTQH GIKLQT GIQFRD GIRLRG

GCQVRD GFHLHG GFKVRS GFQIKT GFRHHD GFRVRS GHQTQN GIKLRD GIQFRG GIRLRS

GCQVRG GFHLHH GFKVRT GFQIND GFRHHG GFRVRT GHQTRD GIKLRG GIQFRS GIRLRT

GCQVRS GFHLHN GFNFKD GFQING GFRHHH GFRYRC GHQTRG GIKLRS GIQFRT GIRVKD

GCQVRT GFHLQD GFNFKG GFQINS GFRHHN GFRYRE GHQTRH GIKLRT GIQIKD GIRVKG

GCRFKD GFHLQG GFNFKS GFQI T GFRHQD GFRYRG GHQTRN GIKVKD GIQIKG GIRVKS

GCRFKG GFHLQH GFNFKT GFQIQD GFRHQG GFRYRQ GHRHHD GIKVKG GIQIKS GIRVKT

GCRFKS GFHLQN GFNFND GFQIQG GFRHQH GHHHHD GHRHHG GIKVKS GIQIKT GIRVND

GCRFKT GFHLRD GFNFNG GFQIQS GFRHQN GHHHHG GHRHHH GIKVKT GIQIND GIRVNG

GCRFND GFHLRG GFNFNS GFQIQT GFRHRD GHHHHH GHRHHN GIKVND GIQING GIRVNS

GCRFNG GFHLRH GFNFNT GFQIRD GFRHRG GHHHHN GHRHQD GIKVNG GIQINS GIRVNT

GCRFNS GFHLRN GFNFQD GFQIRG GFRHRH GHHHQD GHRHQG GIKVNS GIQINT GIRVQD

GCRFNT GFHSHD GFNFQG GFQIRS GFRHRN GHHHQG GHRHQH GIKVNT GIQIQD GIRVQG

GCRFQD GFHSHG GFNFQS GFQIRT GFRIKD GHHHQH GHRHQN GIKVQD GIQIQG GIRVQS

GCRFQG GFHSHH GFNFQT GFQLHD GFRIKG GHHHQN GHRHRD GIKVQG GIQIQS GIRVQT

GCRFQS GFHSHN GFNFRD GFQLHG GFRIKS GHHHRD GHRHRG GIKVQS GIQIQT GIRVRD

GCRFQT GFHSQD GFNFRG GFQLHH GFRIKT GHHHRG GHRHRH GIKVQT GIQIRD GIRVRG

GCRFRD GFHSQG GFNFRS GFQLHN GFRIND GHHHRH GHRHRN GIKVRD GIQIRG GIRVRS

GCRFRG GFHSQH GFNFRT GFQLKD GFRING GHHHRN GHRLHD GIKVRG GIQIRS GIRVRT GNHHHD GNRHHG GSHSRH GSRSRN GTQTHD GYKLNG GYQFNS GYRLNT IAAKGV IAFAVA

GNHHHG GNRHHH GSHSRN GSRTHD GTQTHG GYKLNS GYQFNT GYRLQD IAAKIA IAFAVI

GNHHHH GNRHHN GSHTHD GSRTHG GTQTHH GYKLNT GYQFQD GYRLQG IAAKIL IAFAVL

GNHHHN GNRHQD GSHTHG GSRTHH GTQTHN GYKLQD GYQFQG GYRLQS IAAKIR IAFAVR

GNHHQD GNRHQG GSHTHH GSRTHN GTQTQD GYKLQG GYQFQS GYRLQT IAAKIV IAFAVV

GNHHQG GNRHQH GSHTHN GSRTQD GTQTQG GYKLQS GYQFQT GYRLRD IAAKLA IAFGAA

GNHHQH GNRHQN GSHTQD GSRTQG GTQTQH GYKLQT GYQFRD GYRLRG IAAKLI IAFGAI

GNHHQN GNRHRD GSHTQG GSRTQH GTQTQN GYKLRD GYQFRG GYRLRS IAAKLL IAFGAL

GNHHRD GNRHRG GSHTQH GSRTQN GTQTRD GYKLRG GYQFRS GYRLRT IAAKLR IAFGAR

GNHHRG GNRHRH GSHTQN GSRTRD GTQTRG GYKLRS GYQFRT GYRVKD IAAKLV IAFGAV

GNHHRH GNRHRN GSHTRD GSRTRG GTQTRH GYKLRT GYQIKD GYRVKG IAAKVA IAFGDA

GNHHRN GNRLHD GSHTRG GSRTRH GTQTRN GYKVKD GYQIKG GYRVKS IAAKVI IAFGDI

GNHLHD GNRLHG GSHTRH GSRTRN GTRHHD GYKVKG GYQIKS GYRVKT IAAKVL IAFGDL

GNHLHG GNRLHH GSHTRN GTHHHD GTRHHG GYKVKS GYQIKT GYRVND IAAKVR IAFGDR

GNHLHH GNRLHN GSQHHD GTHHHG GTRHHH GYKVKT GYQIND GYRVNG IAAKVV IAFGDV

GNHLHN GNRLQD GSQHHG GTHHHH GTRHHN GYKVND GYQING GYRVNS IAAQAA IAFGGA

GNHLQD GNRLQG GSQHHH GTHHHN GTRHQD GYKVNG GYQINS GYRVNT IAAQAI IAFGGI

GNHLQG GNRLQH GSQHHN GTHHQD GTRHQG GYKVNS GYQINT GYRVQD IAAQAL IAFGGL

GNHLQH GNRLQN GSQHQD GTHHQG GTRHQH GYKVNT GYQIQD GYRVQG IAAQAR IAFGGR

GNHLQN GNRLRD GSQHQG GTHHQH GTRHQN GYKVQD GYQIQG GYRVQS IAAQAV IAFGGV

GNHLRD GNRLRG GSQHQH GTHHQN GTRHRD GYKVQG GYQIQS GYRVQT IAAQDA IAFGIA

GNHLRG GNRLRH GSQHQN GTHHRD GTRHRG GYKVQS GYQIQT GYRVRD IAAQDI IAFGIL

GNHLRH GNRLRN GSQHRD GTHHRG GTRHRH GYKVQT GYQIRD GYRVRG IAAQDL IAFGIR

GNHLRN GNRSHD GSQHRG GTHHRH GTRHRN GYKVRD GYQIRG GYRVRS IAAQDR IAFGIV

GNHSHD GNRSHG GSQHRH GTHHRN GTRLHD GYKVRG GYQIRS GYRVRT IAAQDV IAFGLA

GNHSHG GNRSHH GSQHRN GTHLHD GTRLHG GYKVRS GYQIRT IAAAAA IAAQGA IAFGLI

GNHSHH GNRSHN GSQLHD GTHLHG GTRLHH GYKVRT GYQLKD IAAAAI IAAQGI IAFGLL

GNHSHN GNRSQD GSQLHG GTHLHH GTRLHN GYNFKD GYQLKG IAAAAL IAAQGL IAFGLR

GNHSQD GNRSQG GSQLHH GTHLHN GTRLQD GYNFKG GYQLKS IAAAAR IAAQGR IAFGLV

GNHSQG GNRSQH GSQLHN GTHLQD GTRLQG GYNFKS GYQLKT IAAAAV IAAQGV IAFGVA

GNHSQH GNRSQN GSQLQD GTHLQG GTRLQH GYNFKT GYQLND IAAADA IAAQIA IAFG I

GNHSQN GNRSRD GSQLQG GTHLQH GTRLQN GYNFND GYQLNG IAAADI IAAQIL IAFG L

GNHSRD GNRSRG GSQLQH GTHLQN GTRLRD GYNFNG GYQLNS IAAADL IAAQIR IAFG R

GNHSRG GNRSRH GSQLQN GTHLRD GTRLRG GYNFNS GYQLNT IAAADR IAAQIV IAFGVV

GNHSRH GNRSRN GSQLRD GTHLRG GTRLRH GYNFNT GYQLQD IAAADV IAAQLA IAFKAA

GNHSRN GNRTHD GSQLRG GTHLRH GTRLRN GYNFQD GYQLQG IAAAGA IAAQLI IAFKAI

GNHTHD GNRTHG GSQLRH GTHLRN GTRSHD GYNFQG GYQLQS IAAAGI IAAQLL IAFKAL

GNHTHG GNRTHH GSQLRN GTHSHD GTRSHG GYNFQS GYQLQT IAAAGL IAAQLR IAFKAR

GNHTHH GNRTHN GSQSHD GTHSHG GTRSHH GYNFQT GYQLRD IAAAGR IAAQLV IAFKAV

GNHTHN GNRTQD GSQSHG GTHSHH GTRSHN GYNFRD GYQLRG IAAAGV IAAQVA IAFKDA

GNHTQD GNRTQG GSQSHH GTHSHN GTRSQD GYNFRG GYQLRS IAAAIA IAAQVI IAFKDI

GNHTQG GNRTQH GSQSHN GTHSQD GTRSQG GYNFRS GYQLRT IAAAIL IAAQVL IAFKDL

GNHTQH GNRTQN GSQSQD GTHSQG GTRSQH GYNFRT GYQVKD IAAAIR IAAQVR IAFKDR

GNHTQN GNRTRD GSQSQG GTHSQH GTRSQN GYNIKD GYQVKG IAAAIV IAAQVV IAFKDV

GNHTRD GNRTRG GSQSQH GTHSQN GTRSRD GYNIKG GYQVKS IAAALA IAARAA IAFKGA

GNHTRG GNRTRH GSQSQN GTHSRD GTRSRG GYNIKS GYQVKT IAAALI IAARAI IAFKGI

GNHTRH GNRTRN GSQSRD GTHSRG GTRSRH GYNIKT GYQVND IAAALL IAARAL IAFKGL

GNHTRN GQRCRC GSQSRG GTHSRH GTRSRN GYNIND GYQVNG IAAALR IAARAR IAFKGR

GNQHHD GQRCRE GSQSRH GTHSRN GTRTHD GYNING GYQVNS IAAALV IAARAV IAFKGV

GNQHHG GQRCRG GSQSRN GTHTHD GTRTHG GYNINS GYQVNT IAAAVA IAARDA IAFKIA

GNQHHH GQRCRQ GSQTHD GTHTHG GTRTHH GYNINT GYQVQD IAAA I IAARDI IAFKIL

GNQHHN GQRLRC GSQTHG GTHTHH GTRTHN GYNIQD GYQVQG IAAAVL IAARDL IAFKIR

GNQHQD GQRLRE GSQTHH GTHTHN GTRTQD GYNIQG GYQVQS IAAAVR IAARDR IAFKIV

GNQHQG GQRLRG GSQTHN GTHTQD GTRTQG GYNIQS GYQVQT IAAAVV IAARDV IAFKLA

GNQHQH GQRLRQ GSQTQD GTHTQG GTRTQH GYNIQT GYQVRD IAAGAA IAARGA IAFKLI

GNQHQN GQRQRC GSQTQG GTHTQH GTRTQN GYNIRD GYQVRG IAAGAI IAARGI IAFKLL

GNQHRD GQRQRE GSQTQH GTHTQN GTRTRD GYNIRG GYQVRS IAAGAL IAARGL IAFKLR

GNQHRG GQRQRG GSQTQN GTHTRD GTRTRG GYNIRS GYQVRT IAAGAR IAARGR IAFKLV

GNQHRH GQRQRQ GSQTRD GTHTRG GTRTRH GYNIRT GYRFKD IAAGAV IAARGV IAFKVA

GNQHRN GQRYRC GSQTRG GTHTRH GTRTRN GYNLKD GYRFKG IAAGDA IAARIA IAFKVI

GNQLHD GQRYRE GSQTRH GTHTRN GYKFKD GYNLKG GYRFKS IAAGDI IAARIL IAFKVL

GNQLHG GQRYRG GSQTRN GTQHHD GYKFKG GYNLKS GYRFKT IAAGDL IAARIR IAFKVR

GNQLHH GQRYRQ GSRHHD GTQHHG GYKFKS GYNLKT GYRFND IAAGDR IAARIV IAFKVV

GNQLHN GSHHHD GSRHHG GTQHHH GYKFKT GYNLND GYRFNG IAAGDV IAARLA IAFQAA

GNQLQD GSHHHG GSRHHH GTQHHN GYKFND GYNLNG GYRFNS IAAGGA IAARLI IAFQAI

GNQLQG GSHHHH GSRHHN GTQHQD GYKFNG GYNLNS GYRFNT IAAGGI IAARLL IAFQAL

GNQLQH GSHHHN GSRHQD GTQHQG GYKFNS GYNLNT GYRFQD IAAGGL IAARLR IAFQAR

GNQLQN GSHHQD GSRHQG GTQHQH GYKFNT GYNLQD GYRFQG IAAGGR IAARLV IAFQAV

GNQLRD GSHHQG GSRHQH GTQHQN GYKFQD GYNLQG GYRFQS IAAGGV IAARVA IAFQDA

GNQLRG GSHHQH GSRHQN GTQHRD GYKFQG GYNLQS GYRFQT IAAGIA IAARVI IAFQDI

GNQLRH GSHHQN GSRHRD GTQHRG GYKFQS GYNLQT GYRFRD IAAGIL IAARVL IAFQDL

GNQLRN GSHHRD GSRHRG GTQHRH GYKFQT GYNLRD GYRFRG IAAGIR IAARVR IAFQDR

GNQSHD GSHHRG GSRHRH GTQHRN GYKFRD GYNLRG GYRFRS IAAGIV IAARVV IAFQDV

GNQSHG GSHHRH GSRHRN GTQLHD GYKFRG GYNLRS GYRFRT IAAGLA IAFAAA IAFQGA

GNQSHH GSHHRN GSRLHD GTQLHG GYKFRS GYNLRT GYRIKD IAAGLI IAFAAI IAFQGI

GNQSHN GSHLHD GSRLHG GTQLHH GYKFRT GYNVKD GYRIKG IAAGLL IAFAAL IAFQGL

GNQSQD GSHLHG GSRLHH GTQLHN GYKIKD GYNVKG GYRIKS IAAGLR IAFAAR IAFQGR

GNQSQG GSHLHH GSRLHN GTQLQD GYKIKG GYNVKS GYRIKT IAAGLV IAFAAV IAFQGV

GNQSQH GSHLHN GSRLQD GTQLQG GYKIKS GYNVKT GYRIND IAAGVA IAFADA IAFQIA

GNQSQN GSHLQD GSRLQG GTQLQH GYKIKT GYNVND GYRING IAAGVI IAFADI IAFQIL

GNQSRD GSHLQG GSRLQH GTQLQN GYKIND GYNVNG GYRINS IAAGVL IAFADL IAFQIR

GNQSRG GSHLQH GSRLQN GTQLRD GYKING GYNVNS GYRINT IAAGVR IAFADR IAFQIV

GNQSRH GSHLQN GSRLRD GTQLRG GYKINS GYNVNT GYRIQD IAAGVV IAFADV IAFQLA

GNQSRN GSHLRD GSRLRG GTQLRH GYKINT GYNVQD GYRIQG IAAKAA IAFAGA IAFQLI

GNQTHD GSHLRG GSRLRH GTQLRN GYKIQD GYNVQG GYRIQS IAAKAI IAFAGI IAFQLL

GNQTHG GSHLRH GSRLRN GTQSHD GYKIQG GYNVQS GYRIQT IAAKAL IAFAGL IAFQLR

GNQTHH GSHLRN GSRSHD GTQSHG GYKIQS GYNVQT GYRIRD IAAKAR IAFAGR IAFQLV

GNQTHN GSHSHD GSRSHG GTQSHH GYKIQT GYNVRD GYRIRG IAAKAV IAFAGV IAFQVA

GNQTQD GSHSHG GSRSHH GTQSHN GYKIRD GYNVRG GYRIRS IAAKDA IAFAIA IAFQ I

GNQTQG GSHSHH GSRSHN GTQSQD GYKIRG GYNVRS GYRIRT IAAKDI IAFAIL IAFQVL

GNQTQH GSHSHN GSRSQD GTQSQG GYKIRS GYNVRT GYRLKD IAAKDL IAFAIR IAFQVR

GNQTQN GSHSQD GSRSQG GTQSQH GYKIRT GYQFKD GYRLKG IAAKDR IAFAIV IAFQVV

GNQTRD GSHSQG GSRSQH GTQSQN GYKLKD GYQFKG GYRLKS IAAKDV IAFALA IAFRAA

GNQTRG GSHSQH GSRSQN GTQSRD GYKLKG GYQFKS GYRLKT IAAKGA IAFALI IAFRAI

GNQTRH GSHSQN GSRSRD GTQSRG GYKLKS GYQFKT GYRLND IAAKGI IAFALL IAFRAL

GNQTRN GSHSRD GSRSRG GTQSRH GYKLKT GYQFND GYRLNG IAAKGL IAFALR IAFRAR

GNRHHD GSHSRG GSRSRH GTQSRN GYKLND GYQFNG GYRLNS IAAKGR IAFALV IAFRAV IAFRDA IAGKVI IAIKDV IALGVV IFAALA IFARAA IFFKGA IFGALI IFGRGV IFIRLV

IAFRDI IAGKVL IAIKGA IALKAA IFAALI IFARAI IFFKGI IFGALL IFGRIA IFIRVA

IAFRDL IAGKVR IAIKGL IALKAI IFAALL IFARAL IFFKGL IFGALR IFGRIV IFIRVL

IAFRDR IAGKVV IAIKGR IALKAL IFAALR IFARAR IFFKGR IFGALV IFGRLA IFIRVR

IAFRDV IAGQAA IAIKGV IALKAR IFAALV IFARAV IFFKGV IFGAVA IFGRLV IFIRVV

IAFRGA IAGQAI IAIKLA IALKAV IFAAVA IFARDA IFFKIA IFGAVI IFGRVA IFLAAA

IAFRGI IAGQAL IAIKLL IALKDA IFAAVI IFARDI IFFKIL IFGAVL IFGR I IFLAAI

IAFRGL IAGQAR IAIKLR IALKDI IFAAVL IFARDL IFFKIR IFGA R IFGRVL IFLAAL

IAFRGR IAGQAV IAIKLV IALKDL IFAAVR IFARDR IFFKIV IFGA V IFGRVR IFLAAR

IAFRGV IAGQDA IAIKVA IALKDR IFAAVV IFARDV IFFKLA IFGGAA IFGRVV IFLAAV

IAFRIA IAGQDI IAIKVL IALKDV IFAGAA IFARGA IFFKLI IFGGAI IFIAAA IFLADA

IAFRIL IAGQDL IAIKVR IALKGA IFAGAI IFARGI IFFKLL IFGGAL IFIAAL IFLADI

IAFRIR IAGQDR IAIKVV IALKGI IFAGAL IFARGL IFFKLR IFGGAR IFIAAR IFLADL

IAFRIV IAGQDV IAIQAA IALKGL IFAGAR IFARGR IFFKLV IFGGAV IFIAAV IFLADR

IAFRLA IAGQGA IAIQAL IALKGR IFAGAV IFARGV IFFKVA IFGGDA IFIADA IFLADV

IAFRLI IAGQGI IAIQAR IALKGV I FAG DA IFARIA IFFKVI IFGGDI IFIADL IFLAGA

IAFRLL IAGQGL IAIQAV IALKIA IFAGDI IFARIL IFFKVL IFGGDL IFIADR IFLAGI

IAFRLR IAGQGR IAIQDA IALKIL IFAGDL IFARIR IFFKVR IFGGDR IFIADV IFLAGL

IAFRLV IAGQGV IAIQDL IALKIR IFAGDR IFARIV IFFKVV IFGGDV IFIAGA IFLAGR

IAFRVA IAGQIA IAIQDR IALKIV IFAGDV IFARLA IFFQAA IFGGIA IFIAGL IFLAGV

IAFRVI IAGQIL IAIQDV IALKLA IFAGGA IFARLI IFFQAI IFGGIV IFIAGR IFLAIA

IAFRVL IAGQIR IAIQGA IALKLI IFAGGI IFARLL IFFQAL IFGGLA IFIAG IFLAIL

IAFRVR IAGQIV IAIQGL IALKLR IFAGGL IFARLR IFFQAR IFGGLV IFIALA IFLAIR

IAFRVV IAGQLA IAIQGR IALKLV IFAGGR IFARLV IFFQAV IFGGVA IFIALL IFLAIV

IAGAAA IAGQLI IAIQGV IALKVA IFAGGV IFARVA IFFQDA IFGGVI IFIALR IFLALA

IAGAAI IAGQLL IAIQLA IALKVI IFAGIA IFARVI IFFQDI IFGGVL IFIALV IFLALI

IAGAAL IAGQLR IAIQLL IALKVL IFAGIL IFARVL IFFQDL IFGGVR IFIA A IFLALR

IAGAAR IAGQLV IAIQLR IALKVR IFAGIR IFARVR IFFQDR IFGGVV IFIAVL IFLALV

IAGAAV IAGQVA IAIQLV IALKVV IFAGIV IFARVV IFFQDV IFGKAA IFIAVR IFLAVA

IAGADA IAGQVI IAIQVA IALQAA I FAG LA IFFAAA IFFQGA IFGKAI IFIA V IFLA I

IAGADI IAGQVL IAIQVL IALQAI I FAG LI IFFAAI IFFQGI IFGKAL IFIGAA IFLAVL

IAGADL IAGQVR IAIQVR IALQAL IFAGLL IFFAAL IFFQGL IFGKAR IFIGAL IFLAVR

IAGADR IAGQVV IAIQVV IALQAR IFAGLR IFFAAR IFFQGR IFGKAV IFIGAR IFLAVV

IAGADV IAGRAA IAIRAA IALQAV IFAGLV IFFAAV IFFQGV IFGKDA IFIGAV IFLGAA

IAGAGA IAGRAI IAIRAL IALQDA IFAGVA IFFADA IFFQIA IFGKDI IFIGDA IFLGAI

IAGAGI IAGRAL IAIRAR IALQDI IFAGVI IFFADI IFFQIL IFGKDL IFIGDL IFLGAL

IAGAGL IAGRAR IAIRAV IALQDL IFAGVL IFFADL IFFQIR IFGKDR IFIGDR IFLGAR

IAGAGR IAGRAV IAIRDA IALQDR IFAGVR IFFADR IFFQIV IFGKDV IFIGDV IFLGAV

IAGAG IAGRDA IAIRDL IALQDV IFAGVV IFFADV IFFQLA IFGKGA IFIGGA IFLGDA

IAGAIA IAGRDI IAIRDR IALQGA IFAKAA IFFAGA IFFQLI IFGKGI IFIGGV IFLGDI

IAGAIL IAGRDL IAIRDV IALQGI IFAKAI IFFAGI IFFQLL IFGKGL IFIGLA IFLGDL

IAGAIR IAGRDR IAIRGA IALQGL IFAKAL IFFAGL IFFQLR IFGKGR IFIGLV IFLGDR

IAGAIV IAGRDV IAIRGV IALQGR IFAKAR IFFAGR IFFQLV IFGKGV IFIGVA IFLGDV

IAGALA IAGRGA IAIRLA IALQGV IFAKAV IFFAGV IFFQVA IFGKIA IFIGVL IFLGGA

IAGALI IAGRG IAIRLV IALQIA IFAKDA IFFAIA IFFQ I IFGKIL IFIGVR IFLGGV

IAGALL IAGRIA IAIRVA IALQIL IFAKDI IFFAIL IFFQVL IFGKIR IFIGVV IFLGIA

IAGALR IAGRIV IAIRVL IALQIR IFAKDL IFFAIR IFFQVR IFGKIV IFIKAA IFLGIV

IAGALV IAGRLA IAIRVR IALQIV IFAKDR IFFAIV IFFQVV IFGKLA IFIKAL IFLGLA

IAGAVA IAGRLV IAIRVV IALQLA IFAKDV IFFALA IFFRAA IFGKLI IFIKAR IFLGLV

IAGA I IAGRVA IALAAA IALQLI IFAKGA IFFALI IFFRAI IFGKLL IFIKAV IFLGVA

IAGAVL IAGR I IALAAI IALQLR IFAKGI IFFALL IFFRAL IFGKLR IFIKDA IFLGVI

IAGAVR IAGRVL IALAAL IALQLV IFAKGL IFFALR IFFRAR IFGKLV IFIKDL IFLGVL

IAGAVV IAGRVR IALAAR IALQVA IFAKGR IFFALV IFFRAV IFGKVA IFIKDR IFLGVR

IAGGAA IAGRVV IALAAV IALQVI IFAKGV IFFAVA IFFRDA IFGKVI IFIKDV IFLGVV

IAGGAI IAIAAA IALADA IALQVL IFAKIA IFFAVI IFFRDI IFGKVL IFIKGA IFLKAA

IAGGAL IAIAAL IALADI IALQVR IFAKIL IFFAVL IFFRDL IFGKVR IFIKGL IFLKAI

IAGGAR IAIAAR IALADL IALQVV IFAKIR IFFAVR IFFRDR IFGKVV IFIKGR IFLKAL

IAGGAV IAIAAV IALADR IALRAA IFAKIV IFFAVV IFFRDV IFGQAA IFIKGV IFLKAR

IAGGDA IAIADA IALADV IALRAI IFAKLA IFFGAA IFFRGA IFGQAI IFIKLA IFLKAV

IAGGDI IAIADL IALAGA IALRAL IFAKLI IFFGAI IFFRGI IFGQAL IFIKLL IFLKDA

IAGGDL IAIADR IALAGI IALRAR IFAKLL IFFGAL IFFRGL IFGQAR IFIKLR IFLKDI

IAGGDR IAIADV IALAGL IALRAV IFAKLR IFFGAR IFFRGR IFGQAV IFIKLV IFLKDL

IAGGDV IAIAGA IALAGR IALRDA IFAKLV IFFGAV IFFRGV IFGQDA IFIKVA IFLKDR

IAGGIA IAIAGL IALAG IALRDI IFAKVA IFFGDA IFFRIA IFGQDI IFIKVL IFLKDV

IAGGIV IAIAGR IALAIA IALRDL IFAKVI IFFGDI IFFRIL IFGQDL IFIKVR IFLKGA

IAGGLA IAIAGV I A LAI L IALRDR IFAKVL IFFGDL IFFRIR IFGQDR IFIKVV IFLKGI

IAGGLV IAIALA I A LAIR IALRDV IFAKVR IFFGDR IFFRIV IFGQDV IFIQAA IFLKGL

IAGGVA IAIALL IALAIV IALRGA IFAKVV IFFGDV IFFRLA IFGQGA IFIQAL IFLKGR

IAGGVI IAIALR IALALA IALRGV I FAQ A A IFFGGA IFFRLI IFGQGI IFIQAR IFLKGV

IAGGVL IAIALV IALALI IALRIA IFAQAI IFFGGI IFFRLL IFGQGL IFIQAV IFLKIA

IAGGVR IAIAVA IALALR IALRIV IFAQAL IFFGGL IFFRLR IFGQGR IFIQDA IFLKIL

IAGGVV IAIAVL IALALV IALRLA IFAQAR IFFGGR IFFRLV IFGQGV IFIQDL IFLKIR

IAGKAA IAIAVR IALAVA IALRLV IFAQAV IFFGGV IFFRVA IFGQIA IFIQDR IFLKIV

IAGKAI IAIAVV IALA I IALRVA IFAQDA IFFGIA IFFRVI IFGQIL IFIQDV IFLKLA

IAGKAL IAIGAA IALAVL IALRVI IFAQDI IFFGIL IFFRVL IFGQIR IFIQGA IFLKLI

IAGKAR IAIGAL IALAVR IALRVL IFAQDL IFFGIR IFFRVR IFGQIV IFIQGL IFLKLR

IAGKAV IAIGAR IALAVV IALRVR IFAQDR IFFGIV IFFRVV IFGQLA IFIQGR IFLKLV

IAGKDA IAIGAV IALGAA IALRVV IFAQDV IFFGLA IFGAAA IFGQLI IFIQGV IFLKVA

IAGKDI IAIGDA IALGAI IFAAAA IFAQGA IFFGLI IFGAAI IFGQLL IFIQLA IFLKVI

IAGKDL IAIGDL IALGAL IFAAAI IFAQGI IFFGLL IFGAAL IFGQLR IFIQLL IFLKVL

IAGKDR IAIGDR IALGAR IFAAAL IFAQGL IFFGLR IFGAAR IFGQLV IFIQLR IFLKVR

IAGKDV IAIGDV IALGAV IFAAAR IFAQGR IFFGLV IFGAAV IFGQVA IFIQLV IFLKVV

IAGKGA IAIGGA IALGDA IFAAAV IFAQGV IFFGVA IFGADA IFGQ I IFIQVA IFLQAA

IAGKGI IAIGGV IALGDI IFAADA IFAQIA IFFG I IFGADI IFGQVL IFIQVL IFLQAI

IAGKGL IAIGLA IALGDL IFAADI IFAQIL IFFGVL IFGADL IFGQVR IFIQVR IFLQAL

IAGKGR IAIGLV IALGDR IFAADL IFAQIR IFFGVR IFGADR IFGQVV IFIQVV IFLQAR

IAGKGV IAIGVA IALGDV IFAADR IFAQIV IFFGVV IFGADV IFGRAA IFIRAA IFLQAV

IAGKIA IAIGVL IALGGA IFAADV IFAQLA IFFKAA IFGAGA IFGRAI IFIRAL IFLQDA

IAGKIL IAIGVR IALGGV IFAAGA IFAQLI IFFKAI IFGAGI IFGRAL IFIRAR IFLQDI

I AG KIR IAIGVV IALGIA IFAAGI IFAQLL IFFKAL IFGAGL IFGRAR IFIRAV IFLQDL

IAGKIV IAIKAA IALGIV IFAAGL IFAQLR IFFKAR IFGAGR IFGRAV IFIRDA IFLQDR

IAGKLA IAIKAL IALGLA IFAAGR IFAQLV IFFKAV IFGAGV IFGRDA IFIRDL IFLQDV

IAGKLI IAIKAR IALGLV IFAAGV IFAQ A IFFKDA IFGAIA IFGRDI IFIRDR IFLQGA

IAGKLL IAIKAV IALGVA IFAAIA I FAQ VI IFFKDI IFGAIL IFGRDL IFIRDV IFLQGI

IAGKLR IAIKDA IALGVI IFAAIL IFAQ L IFFKDL IFGAIR IFGRDR IFIRGA IFLQGL

IAGKLV IAIKDL IALGVL IFAAIR IFAQ R IFFKDR IFGAIV IFGRDV IFIRGV IFLQGR

IAGKVA IAIKDR IALGVR IFAAIV IFAQ V IFFKDV IFGALA IFGRGA IFIRLA IFLQGV IFLQIA IGAKIA IGFGAV IGGAAR IGIKVV IGLRVV IRFAAR IRGAGV IRLADA K A AG II

IFLQIL IGAKIL IGFGDA IGGAAV IGIQAA IRA AAA IRFAAV IRGAIA IRLADI KAAGIL

IFLQIR IGAKIR IGFGDI IGGADA IGIQAL IRAAAI IRFADA IRGAIV IRLADL KAAGIR

IFLQIV IGAKIV IGFGDL IGGADI IGIQAR IRAAAL IRFADI IRGALA IRLADR K A AG IV

IFLQLA IGAKLA IGFGDR IGGADL IGIQAV IRAAAR IRFADL IRGAVA IRLAGA K A AG LA

IFLQLI IGAKLI IGFGDV IGGADR IGIQDA IRAAAV IRFADR IRGAVI IRLAIA K A AG LI

IFLQLR IGAKLL IGFGIA IGGADV IGIQDL IRAADA IRFAGA IRGAVL IRLAVI KAAGLL

IFLQLV IGAKLR IGFGIV IGGAIA IGIQDR IRAADL IRFAGI IRGAVV IRLAVL KAAGLR

IFLQVA IGAKLV IGFGLA IGGAIV IGIQDV IRAADV IRFAGR IRGGAA IRLAVR KAAGLV

IFLQVI IGAKVA IGFGLV IGGALA IGIQGA IRAAGA IRFAIA IRGGAV IRLAVV KAAGVA

IFLQVL IGAKVI IGFGVA IGGALV IGIQGV IRA AG I IRFAIL IRGGDA IRLGAA KAAGVL

IFLQVR IGAKVL IGFGVI IGGAVA IGIQLA IRAAIA IRFAIR IRGGDV IRLGAV KAAGVR

IFLQVV IGAKVR IGFGVL IGGA I IGIQLV IRA AIR IRFAIV IRGGVA IRLGDV KAAGVV

IFLRAA IGAKVV IGFGVR IGGAVL IGIQVA IRAALA IRFALL IRGGVV IRLGVA KAAKAA

IFLRAI IGAQAA IGFGVV IGGAVR IGIQVL IRAALI IRFALR IRGKAA IRLKAA KAAKAI

IFLRAL IGAQAI IGFKAA IGGAVV IGIQVR IRAALL IRFAVI IRGKAI IRLKAI KAAKAL

IFLRAR IGAQAL IGFKAI IGGKAA IGIQVV IRAALR IRFAVV IRGKAL IRLKAL KAAKAR

IFLRAV IGAQAR IGFKAL IGGKAI IGIRAA IRA A VI IRFGAA IRGKAR IRLKAR KAAKAV

IFLRDA IGAQAV IGFKAR IGGKAL IGIRAV IRAAVL IRFGAI IRGKAV IRLKDA KAAKDA

IFLRDI IGAQDA IGFKAV IGGKAR IGIRDA IRAAVR IRFGDA IRGKDI IRLKDI KAAKDI

IFLRDL IGAQDI IGFKDA IGGKAV IGIRDV IRAGAA IRFGDI IRGKDL IRLKDL KAAKDL

IFLRDR IGAQDL IGFKDI IGGKDA IGIRVA IRAGAI IRFGDL IRGKDR IRLKDR KAAKDR

IFLRDV IGAQDR IGFKDL IGGKDI IGIRVV IRAGAL IRFGDR IRGKGA IRLKGA KAAKDV

IFLRGA IGAQDV IGFKDR IGGKDL IGLAAA IRAGDI IRFGGV IRGKGV IRLKIA KAAKGA

IFLRGV IGAQGA IGFKDV IGGKDR IGLAAI IRAGDL IRFGIA IRGKIA IRLKIV KAAKGI

IFLRIA IGAQGI IGF KG A IGGKDV IGLAAL IRAGDR IRFGLA IRGKLA IRLKVA KAAKGL

IFLRIV IGAQGL IGFKGI IGGKIA IGLAAR IRAGDV IRFGVA IRGKVI IRLKVI KAAKGR

IFLRLA IGAQGR IGFKGL IGGKIV IGLAAV IRAGGA IRFGVI IRGQAR IRLKVR KAAKGV

IFLRLV IGAQGV IGFKGR IGGKLA IGLADA IRAGGV IRFGVL IRGQDI IRLKVV KAAKIA

IFLRVA IGAQIA IGFKGV IGGKLV IGLADI IRAGIV IRFGVR IRGQDL IRLQAA KAAKII

IFLRVI IGAQIL IGFKIA IGGKVA IGLADL IRAGLV IRFGVV IRGQDR IRLQAI KAAKIL

IFLRVL IGAQIR IGFKIL IGGKVI IGLADR IRAGVL IRFKAA IRGQDV IRLQAR KAAKIR

IFLRVR IGAQIV IGFKIR IGGKVL IGLADV IRAGVR IRFKAI IRGQGA IRLQAV KAAKIV

IFLRVV IGAQLA IGFKIV IGGKVR IGLAGA IRAGVV IRFKAL IRGQIA IRLQDA KAAKLA

IGAAAA IGAQLI IGFKLA IGGKVV IGLAGV IRAK A A IRFKAR IRGQLA IRLQDI KAAKLI

IGAAAI IGAQLL IGFKLI IGGQAA IGLAIA IRAKAI IRFKDA IRGQVA IRLQDL KAAKLL

IGAAAL IGAQLR IGFKLL IGGQAI IGLAIV IRAKAL IRFKDI IRGQVI IRLQDR KAAKLR

IGAAAR IGAQLV IGFKLR IGGQAL IGLALA IRAKAR IRFKDL IRGQVL IRLQDV KAAKLV

IGAAAV IGAQVA IGFKLV IGGQAR IGLALV IRAKDA IRFKDR IRGQVR IRLQGA KAAKVA

IGAADA IGAQVI IGFKVA IGGQAV IGLAVA IRAKDL IRFKDV IRGQVV IRLQGV KAAKVI

IGAADI IGAQVL IGFKVI IGGQDA IGLA I IRAKDR IRFKGA IRGRAA IRLQIA KAAKVL

IGAADL IGAQVR IGFKVL IGGQDI IGLAVL IRAKGA IRFKGI IRGRAV IRLQIV KAAKVR

IGAADR IGAQVV IGFKVR IGGQDL IGLAVR IRAKGR IRFKIA IRGRDA IRLQLA KAAKVV

IGAADV IGARAA IGFKVV IGGQDR IGLAVV IRAKIA IRFKIL IRGRDV IRLQVA KAAQAA

IGAAGA IGARAI IGFQAA IGGQDV IGLGAA IRAKI- IRFKIR IRGRVA IRLQVR KAAQAI

IGAAGI IGARAL IGFQAI IGGQIA IGLGAV IRA KIR IRFKIV IRGRVV IRLRAA KAAQAL

IGAAGL IGARAR IGFQAL IGGQIV IGLGDA IRAKIV IRFKLA IRIAAA IRLRAV KAAQAR

IGAAGR IGARAV IGFQAR IGGQLA IGLGDV IRAKLA IRFKLL IRIAAR IRLRDA KAAQAV

IGAAGV IGARDA IGFQAV IGGQLV IGLGVA IRAKLR IRFKLR IRIAAV IRLRDV KAAQDA

IGAAIA IGARDI IGFQDA IGGQVA IGLGVV IRAKVA IRFKVA IRIADL IRLRVA KAAQDI

IGAAIL IGARDL IGFQDI IGGQVI IGLKAA IRAKVI IRFKVI IRIADR IRLRVV KAAQDL

IGAAIR IGARDR IGFQDL IGGQVL IGLKAI IRAKVL IRFKVL IRIADV KAAAAA KAAQDR

IGAAIV IGARDV IGFQDR IGGQVR IGLKAL IRAQ A A IRFKVR IRIAGA KAAAAI KAAQDV

IGAALA IGARGA IGFQDV IGGQVV IGLKAR IRAQAI IRFKVV IRIAGV KAAAAL KAAQGA

IGAALI IGARGV IGFQGA IGGRAA IGLKAV IRAQAL IRFQAI IRIALA KAAAAR KAAQGI

IGAALL IGARIA IGFQGI IGGRAV IGLKDA IRAQAR IRFQAR IRIAVL KAAAAV KAAQGL

IGAALR IGARIV IGFQGL IGGRDA IGLKDI IRAQAV IRFQAV IRIAVV KAAADA KAAQGR

IGAALV IGARLA IGFQGR IGGRDV IGLKDL IRAQDA IRFQDA IRIGAA KAAADI KAAQGV

IGAAVA IGARLV IGFQGV IGGRVA IGLKDR IRAQDI IRFQDL IRIGDA KAAADL KAAQIA

IGAA I IGARVA IGFQIA IGGRVV IGLKDV IRAQDL IRFQDR IRIGVA KAAADR KAAQII

IGAAVL IGARVI IGFQIL IGIAAA IGLKGA IRAQDR IRFQDV IRIKAL KAAADV KAAQIL

IGAAVR IGARVL IGFQIR IGIAAL IGLKGV IRAQGI IRFQGA IRIKAR KAAAGA KAAQIR

IGAAVV IGARVR IGFQIV IGIAAR IGLKIA IRAQGR IRFQGR IRIKDA KAAAGI KAAQIV

IGAGAA IGARVV IGFQLA IGIAAV IGLKIV IRAQGV IRFQGV IRIKDR KAAAGL KAAQLA

IGAGAI IGFAAA IGFQLI IGIADA IGLKLA IRAQI A IRFQIL IRIKDV KAAAGR KAAQLI

IGAGAL IGFAAI IGFQLL IGIADL IGLKLV IRAQI- IRFQIV IRIKGA KAAAGV KAAQLL

IGAGAR IGFAAL IGFQLR IGIADR IGLKVA IRAQIR IRFQLA IRIKLA KAAAIA KAAQLR

IGAGAV IGFAAR IGFQLV IGIADV IGLKVI IRAQIV IRFQLI IRIKLV KAAAII KAAQLV

IGAGDA IGFAAV IGFQVA IGIAGA IGLKVL IRAQ LA IRFQLR IRIKVA KAAAIL KAAQVA

IGAGDI IGFADA IGFQ I IGIAGV IGLKVR IRAQLI IRFQLV IRIKVL KAAAIR KAAQVI

IGAGDL IGFADI IGFQVL IGIALA IGLKVV IRAQLL IRFQVA IRIKVR KAAAIV KAAQVL

IGAGDR IGFADL IGFQVR IGIALV IGLQAA IRAQLV IRFQVR IRIQAA KAAALA KAAQVR

IGAGDV IGFADR IGFQVV IGIAVA IGLQAI IRAQVA IRFQVV IRIQAL KAAALI KAAQVV

IGAGIA IGFADV IGFRAA IGIAVL IGLQAL IRAQ VI IRFRAA IRIQAR KAAALL KAARAA

IGAGIV IGFAGA IGFRAI IGIAVR IGLQAR IRAQVL IRFRAI IRIQAV KAAALR KAARAI

IGAGLA IGFAGI IGFRAL IGIAVV IGLQAV IRAQVR IRFRAL IRIQDA KAAALV KAARAL

IGAGLV IG FAG L IGFRAR IGIGAA IGLQDA IRAQVV IRFRAV IRIQDL KAAAVA KAARAR

IGAGVA IGFAGR IGFRAV IGIGAV IGLQDI IRARAA IRFRDA IRIQDR KAAAVI KAARAV

IGAGVI IGFAG IGFRDA IGIGDA IGLQDL IRARAI IRFRDI IRIQDV KAAAVL KAARDA

IGAGVL IGFAIA IGFRDI IGIGDV IGLQDR IRARAL IRFRDL IRIQGA KAAAVR KAARDI

IGAGVR IGFAIL IGFRDL IGIGVA IGLQDV IRARAV IRFRDV IRIQGV KAAAVV KAARDL

IGAGVV IGFAIR IGFRDR IGIGVV IGLQGA IRARDA IRFRGA IRIQLA KAAGAA KAARDR

IGAKAA IGFAIV IGFRDV IGIKAA IGLQGV IRARDI IRFRGV IRIQLV KAAGAI KAARDV

IGAKAI IGFALA IGFRGA IGIKAL IGLQIA IRARDV IRFRIA IRIQVA KAAGAL KAARGA

IGAKAL IGFALI IGFRGV IGIKAR IGLQIV IRARGA IRFRIV IRIQVL KAAGAR KAARGI

IGAKAR IGFALL IGFRIA IGIKAV IGLQLA IRARGV IRFRLA IRIQVR KAAGAV KAARGL

IGAKAV IGFALR IGFRIV IGIKDA IGLQLV IRARIA IRFRLV IRIRAA KAAGDA KAARGR

IGAKDA IGFALV IGFRLA IGIKDL IGLQVA IRARIV IRFRVA IRIRAV KAAGDI KAARGV

IGAKDI IGFA A IGFRLV IGIKDR IGLQVI IRARLA IRFRVI IRIRDA KAAGDL KAARIA

IGAKDL IGFA I IGFRVA IGIKDV IGLQVL IRARLV IRFRVL IRIRDV KAAGDR KAARII

IGAKDR IGFAVL IGFRVI IGIKGA IGLQVR IRARVA IRFRVV IRIRVA KAAGDV K A ARIL

IGAKDV IGFAVR IGFRVL IGIKGV IGLQVV IRARVI IRGAAL IRIRVV KAAGGA KAARIR

IGAKGA IGFAVV IGFRVR IGIKLA IGLRAA IRARVL IRGAAR IRLAAA KAAGGI KAARIV

IGAKGI IGFGAA IGFRVV IGIKLV IGLRAV IRARVV IRGAAV IRLAAI KAAGGL KAARLA

IGAKGL IGFGAI IGGAAA IGIKVA IGLRDA IRFAAA IRGADA IRLAAL KAAGGR KAARLI

IGAKGR IGFGAL IGGAAI IGIKVL IGLRDV IRFAAI IRGADI IRLAAR KAAGGV KAARLL

IGAKGV IGFGAR IGGAAL IGIKVR IGLRVA IRFAAL IRGAGA IRLAAV KAAGIA KAARLR KAARLV KAFQAL KAGGIA KAGRLL KAIQAR KALGGR KALRLV KFAQAR KFFGGA KFFRIL

KAARVA KAFQAR KAGGII KAGRLR KAIQAV KALGGV KALRVA KFAQAV KFFGGI KFFRIR

KAAR I KAFQAV KAGGIL KAGRLV KAIQDA KALGIA KALRVI K FAQ DA KFFGGL KFFRIV

KAARVL KAFQDA KAGGIR KAGRVA KAIQDI KALGII KALRVL KFAQDI KFFGGR KFFRLA

KAARVR KAFQDI KAGGIV KAGR I KAIQDL KALGIL KALRVR KFAQDL KFFGGV KFFRLI

KAARVV KAFQDL KAGGLA KAGRVL KAIQDR KALGIR KALRVV KFAQDR KFFGIA KFFRLL

KAFAAA KAFQDR KAGGLI KAGRVR KAIQDV KALGIV KFAAAA KFAQDV KFFGII KFFRLR

KAFAAI KAFQDV KAGGLL KAGRVV KAIQGA KALGLA KFAAAI KFAQGA KFFGIL KFFRLV

KAFAAL KAFQGA KAGGLR KAIAAA KAIQGI KALGLI KFAAAL KFAQGI KFFGIR KFFRVA

KAFAAR KAFQGI KAGGLV KAIAAI KAIQGL KALGLR KFAAAR KFAQGL KFFGIV KFFRVI

KAFAAV KAFQGL KAGG A KAIAAL KAIQGR KALGLV KFAAAV KFAQGR KFFGLA KFFRVL

KAFADA KAFQGR KAGGVI KAIAAR KAIQGV KALGVA KFAADA KFAQGV KFFGLI KFFRVR

KAFADI KAFQGV KAGGVL KAIAAV KAIQIA KALGVI KFAADI K FAQ I A KFFGLL KFFRVV

KAFADL KAFQIA KAGGVR KAIADA KAIQIL KALGVL KFAADL KFAQII KFFGLR KFGAAA

KAFADR KAFQII KAGGVV KAIADI KAIQIR KALGVR KFAADR KFAQIL KFFGLV KFGAAI

KAFADV KAFQIL KAGKAA KAIADL KAIQIV KALGVV KFAADV KFAQIR KFFGVA KFGAAL

KAFAGA KAFQIR KAGKAI KAIADR KAIQLA KALKAA KFAAGA KFAQIV KFFGVI KFGAAR

KAFAGI KAFQIV KAGKAL KAIADV KAIQLI KALKAI KFAAGI K FAQ LA KFFGVL KFGAAV

KAFAGL KAFQLA KAGKAR KAIAGA KAIQLL KALKAL KFAAGL KFAQLI KFFGVR KFGADA

KAFAGR KAFQLI KAGKAV KAIAGL KAIQLR KALKAR KFAAGR KFAQLL KFFGVV KFGADI

KAFAGV KAFQLL KAGKDA KAIAGR KAIQLV KALKAV KFAAGV KFAQLR KFFKAA KFGADL

KAFAIA KAFQLR KAGKDI KAIAGV KAIQVA KALKDA KFAAIA KFAQLV KFFKAI KFGADR

KAFAII KAFQLV KAGKDL KAIAIA KAIQVI KALKDI KFAAII KFAQVA KFFKAL KFGADV

KAFAIL KAFQVA KAGKDR KAIAIL KAIQVL KALKDL KFAAIL KFAQVI KFFKAR KFGAGA

KAFAIR KAFQ I KAGKDV KAIAIR KAIQVR KALKDR KFAAIR KFAQVL KFFKAV KFGAGI

KAFAIV KAFQVL K AG KG A KAIAIV KAIQVV KALKDV KFAAIV KFAQVR KFFKDA KFGAGL

KAFALA KAFQVR KAGKGI KAIALA KAIRAA KALKGA KFAALA KFAQVV KFFKDI KFGAGR

KAFALI KAFQVV KAGKGL KAIALI KAIRAI KALKGI KFAALI KFARAA KFFKDL KFGAGV

KAFALL KAFRAA KAGKGR KAIALL KAIRAL KALKGL KFAALL KFARAI KFFKDR KFGAIA

KAFALR KAFRAI KAGKGV KAIALR KAIRAR KALKGR KFAALR KFARAL KFFKDV KFGAII

KAFALV KAFRAL KAGKIA KAIALV KAIRAV KALKGV KFAALV KFARAR KFFKGA KFGAIL

KAFAVA KAFRAR KAGKII KAIAVA KAIRDA KALKIA KFAAVA KFARAV KFFKGI KFGAIR

KAFAVI KAFRAV KAGKIL KAIAVI KAIRDI KALKII KFAA I KFARDA KFFKGL KFGAIV

KAFAVL KAFRDA KAGKIR KAIAVL KAIRDL KALKIL KFAAVL KFARDI KFFKGR KFGALA

KAFAVR KAFRDI KAGKIV KAIAVR KAIRDR KALKIR KFAAVR KFARDL KFFKGV KFGALI

KAFAVV KAFRDL KAGKLA KAIAVV KAIRDV KALKIV KFAAVV KFARDR KFFKIA KFGALL

KAFGAA KAFRDR KAGKLI KAIGAA KAIRGA KALKLA KFAGAA KFARDV KFFKII KFGALR

KAFGAI KAFRDV KAGKLL KAIGAI KAIRGI KALKLI KFAGAI KFARGA KFFKIL KFGALV

KAFGAL KAFRGA KAGKLR KAIGAL KAIRGL KALKLR KFAGAL KFARGI KFFKIR KFGAVA

KAFGAR KAFRGI KAGKLV KAIGAR KAIRGR KALKLV KFAGAR KFARGL KFFKIV KFGAVI

KAFGAV KAFRGL KAGKVA KAIGAV KAIRG KALKVA KFAGAV KFARGR KFFKLA KFGAVL

KAFGDA KAFRGR KAGKVI KAIGDA KAIRIA KALKVI K FAG DA KFARGV KFFKLI KFGAVR

KAFGDI KAFRGV KAGKVL KAIGDI KAIRIL KALKVL KFAGDI KFARIA KFFKLL KFGAVV

KAFGDL KAFRIA KAGKVR KAIGDL KAIRIR KALKVR KFAGDL KFARII KFFKLR KFGGAA

KAFGDR KAFRII KAGKVV KAIGDR KAIRIV KALKVV KFAGDR KFARIL KFFKLV KFGGAI

KAFGDV KAFRIL KAGQAA KAIGDV KAIRLA KALQAA KFAGDV KFARIR KFFKVA KFGGAL

KAFGGA KAFRIR KAGQAI KAIGGA KAIRLI KALQAI KFAGGA KFARIV KFFKVI KFGGAR

KAFGGI KAFRIV KAGQAL KAIGGI KAIRLL KALQAL KFAGGI KFARLA KFFKVL KFGGAV

KAFGGL KAFRLA KAGQAR KAIGGL KAIRLR KALQAR KFAGGL KFARLI KFFKVR KFGGDA

KAFGGR KAFRLI KAGQAV KAIGGR KAIRLV KALQAV KFAGGR KFARLL KFFKVV KFGGDI

KAFGGV KAFRLL KAGQDA KAIGGV KAIRVA KALQDA KFAGGV KFARLR KFFQAA KFGGDL

KAFGIA KAFRLR KAGQDI KAIGIA K AIR VI KALQDI K FAG I A KFARLV KFFQAI KFGGDR

KAFGII KAFRLV KAGQDL KAIGIL KAIRVL KALQDL KFAGII KFARVA KFFQAL KFGGDV

KAFGIL KAFRVA KAGQDR KAIGIR KAIRVR KALQDR KFAGIL KFARVI KFFQAR KFGGIA

KAFGIR KAFRVI KAGQDV KAIGIV KAIRVV KALQDV KFAGIR KFARVL KFFQAV KFGGII

KAFGIV KAFRVL KAGQGA KAIGLA KALAAA KALQGA KFAGIV KFARVR KFFQDA KFGGIL

KAFGLA KAFRVR KAGQGI KAIGLI KALAAI KALQGI K FAG LA KFARVV KFFQDI KFGGIR

KAFGLI KAFRVV KAGQGL KAIGLL KALAAL KALQGL KFAGLI KFFAAA KFFQDL KFGGIV

KAFGLL K AG AAA KAGQGR KAIGLR KALAAR KALQGR KFAGLL KFFAAI KFFQDR KFGGLA

KAFGLR KAGAAI KAGQGV KAIGLV KALAAV KALQGV KFAGLR KFFAAL KFFQDV KFGGLI

KAFGLV KAGAAL KAGQIA KAIGVA KALADA KALQIA KFAGLV KFFAAR KFFQGA KFGGLL

KAFG A KAGAAR KAGQII KAIGVI KALADI KALQII KFAG A KFFAAV KFFQGI KFGGLR

KAFG I K AG AAV KAGQIL KAIGVL KALADL KALQIL KFAGVI KFFADA KFFQGL KFGGLV

KAFG L KAGADA KAGQIR KAIGVR KALADR KALQIR KFAGVL KFFADI KFFQGR KFGGVA

KAFG R KAGADI KAGQIV KAIGVV KALADV KALQIV KFAGVR KFFADL KFFQGV KFGGVI

KAFGVV KAGADL KAGQLA KAIKAA KALAGA KALQLA KFAGVV KFFADR KFFQIA KFGGVL

KAFKAA KAGADR KAGQLI KAIKAI KALAGI KALQLI KFAKAA KFFADV KFFQII KFGGVR

KAFKAI KAGADV KAGQLL KAIKAL KALAGL KALQLR KFAKAI KFFAGA KFFQIL KFGGVV

KAFKAL KAGAGA KAGQLR KAIKAR KALAGR KALQLV KFAKAL KFFAGI KFFQIR KFGKAA

KAFKAR KAGAGI KAGQLV KAIKAV KALAG KALQVA KFAKAR KFFAGL KFFQIV KFGKAI

KAFKAV KAGAGL KAGQVA KAIKDA KALAIA KALQVI KFAKAV KFFAGR KFFQLA KFGKAL

KAFKDA KAGAGR KAGQ I KAIKDI KALAII KALQVL KFAKDA KFFAGV KFFQLI KFGKAR

KAFKDL KAGAGV KAGQVL KAIKDL KALAIL KALQVR KFAKDL KFFAIA KFFQLL KFGKAV

KAFKDR KAGAIA KAGQVR KAIKDR KALAIR KALQVV KFAKDR KFFAII KFFQLR KFGKDA

KAFKDV KAGAII KAGQVV KAIKDV KALAIV KALRAA KFAKDV KFFAIL KFFQLV KFGKDI

KAFKGA K AG AIL KAGRAA KAIKGA KALALA KALRAI KFAKGA KFFAIR KFFQVA KFGKDL

KAFKGI K AG AIR KAGRAI KAIKGI KALALI KALRAL KFAKGI KFFAIV KFFQVI KFGKDR

KAFKGL KAGAIV KAGRAL KAIKGL KALALR KALRAR KFAKGL KFFALA KFFQVL KFGKDV

KAFKGR K AG ALA KAGRAR KAIKGR KALALV KALRAV KFAKGR KFFALI KFFQVR KFGKGA

KAFKGV KAGALI KAGRAV KAIKG KALAVA KALRDA KFAKGV KFFALL KFFQVV KFGKGI

KAFKIA KAGALL KAGRDA KAIKIA KALA I KALRDI KFAKIA KFFALR KFFRAA KFGKGL

KAFKII KAGALR KAGRDI KAIKIL KALAVL KALRDL KFAKII KFFALV KFFRAI KFGKGR

KAFKIL KAGALV KAGRDL KAIKIR KALAVR KALRDR KFAKIR KFFAVA KFFRAL KFGKG

KAFKIR K AGAVA KAGRDR KAIKIV KALAVV KALRDV KFAKIV KFFAVI KFFRAR KFGKIA

KAFKIV KAGAVL KAGRDV KAIKLA KALGAA KALRGA KFAKLA KFFAVL KFFRAV KFGKII

KAFKLA KAGAVR KAGRGA KAIKLI KALGAI KALRGI KFAKLI KFFAVR KFFRDA KFGKIL

KAFKLI KAGAVV KAGRGI KAIKLL KALGAL KALRGL KFAKLL KFFA V KFFRDI KFGKIR

KAFKLL KAGGAA KAGRGL KAIKLR KALGAR KALRGR KFAKLR KFFGAA KFFRDL KFGKIV

KAFKLR KAGGAI KAGRGR KAIKLV KALGAV KALRGV KFAKLV KFFGAI KFFRDR KFGKLA

KAFKLV K AG GAL KAGRGV KAIKVA KALGDA KALRIA KFAKVA KFFGAL KFFRDV KFGKLI

KAFKVA KAGGAR KAGRIA KAIK I KALGDI KALRII KFAKVI KFFGAR KFFRGA KFGKLL

KAFKVI KAGGAV KAGRII KAIKVL KALGDL KALRIL KFAKVL KFFGAV KFFRGI KFGKLR

KAFKVL KAGGDA KAGRIL KAIKVR KALGDR KALRIR KFAKVR KFFGDA KFFRGL KFGKLV

KAFKVR KAGGDI KAGRIR KAIKVV KALGDV KALRIV KFAKVV KFFGDI KFFRGR KFGKVA

KAFKVV KAGGDL KAGRIV KAIQAA KALGGA KALRLA KFAQAA KFFGDL KFFRGV KFGKVI

KAFQAA KAGGDR KAGRLA KAIQAI KALGGI KALRLI KFAQAI KFFGDR KFFRIA KFGKVL

KAFQAI KAGGDV KAGRLI KAIQAL KALGGL KALRLR KFAQAL KFFGDV KFFRII KFGKVR KFGKVV KFIGDL KFIRIV KFLKVV KGAGDR KGARLA KGFQAL KGGKIV KGIGLV KG LAG L

KFGQAA KFIGDR KFIRLA KFLQAA KGAGDV KGARLI KGFQAR KGGKLA KGIGVA KG LAG R

KFGQAI KFIGDV KFIRLI KFLQAI KGAGIA KGARLL KGFQAV KGGKLI KGIG I KG LAG V

KFGQAL KFIGGA KFIRLL KFLQAL KG AG II KGARLR KGFQDA KGGKLL KGIGVL KG LAI A

KFGQAR KFIGGI KFIRLR KFLQAR KGAGIL KGARLV KGFQDI KGGKLR KGIG R KG LAI I

KFGQAV KFIGGL KFIRLV KFLQAV KGAGIR KGARVA KGFQDL KGGKLV KGIGVV KG LAI L

KFGQDA KFIGGR KFIRVA KFLQDA KGAGIV KGAR I KGFQDR KGGKVA KGIKAA KG LAIR

KFGQDI KFIGGV KFIRVI KFLQDI KG AG LA KGARVL KGFQDV KGGK I KGIKAI KG LAI V

KFGQDL KFIGIA KFIRVL KFLQDL KG AG LI KGARVR KGFQGA KGGKVL KGIKAL KGLALA

KFGQDR KFIGIL KFIRVR KFLQDR KGAGLL KGARVV KGFQGI KGGKVR KGIKAR KGLALI

KFGQDV KFIGIR KFIRVV KFLQDV KGAGLR KGFAAA KGFQGL KGGKVV KGIKAV KGLALR

KFGQGA KFIGIV KFLAAA KFLQGA KGAGLV KGFAAI KGFQGR KGGQAA KGIKDA KGLALV

KFGQGI KFIGLA KFLAAI KFLQGI KGAG A KGFAAL KGFQGV KGGQAI KGIKDI KG LAVA

KFGQGL KFIGLI KFLAAL KFLQGL KGAGVI KGFAAR KGFQIA KGGQAL KGIKDL KG LA I

KFGQGR KFIGLL KFLAAR KFLQGR KGAG L KGFAAV KGFQII KGGQAR KGIKDR KGLAVL

KFGQGV KFIGLR KFLAAV KFLQGV KGAGVR KGFADA KGFQIL KGGQAV KGIKDV KGLAVR

KFGQIA KFIGLV KFLADA KFLQIA KGAG V KGFADI KGFQIR KGGQDA KGIKGA KG LAW

KFGQII KFIGVA KFLADI KFLQII KGAKAA KGFADL KGFQIV KGGQDI KGIKGI KGLGAA

KFGQIL KFIGVI KFLADL KFLQIL KGAKAI KG FAD R KGFQLA KGGQDL KGIKGL KGLGAI

KFGQIR KFIGVL KFLADR KFLQIR KGAKAL KGFADV KGFQLI KGGQDR KGIKGR KGLGAL

KFGQIV KFIGVR KFLADV KFLQIV KGAKAR KG FAG A KGFQLL KGGQDV KGIKGV KGLGAR

KFGQLA KFIGVV KFLAGA KFLQLA KGAKAV KGFAGI KGFQLR KGGQIA KGIKIA KGLGAV

KFGQLI KFIKAA KFLAGI KFLQLI KGAKDA KG FAG L KGFQLV KGGQII KGIKIL KGLGDA

KFGQLL KFIKAI KFLAGL KFLQLR KGAKDI KG FAG R KGFQVA KGGQIL KGIKIR KGLGDI

KFGQLR KFIKAL KFLAGR KFLQLV KGAKDL KG FAG V KGFQ I KGGQIR KGIKIV KGLGDL

KFGQLV KFIKAR KFLAGV KFLQVA KGAKDR KGFAIA KGFQVL KGGQIV KGIKLA KGLGDR

KFGQVA KFIKAV KFLAIA KFLQVI KGAKDV KGFAII KGFQVR KGGQLA KGIKLI KGLGDV

KFGQVI KFIKDA KFLAII KFLQVL KGAKGA KGFAIL KGFQVV KGGQLI KGIKLL KGLGIA

KFGQVL KFIKDI KFLAIL KFLQVR KGAKGI KGFAIR KGFRAA KGGQLL KGIKLR KGLGIV

KFGQVR KFIKDL KFLAIR KFLQVV KGAKGL KGFAIV KGFRAI KGGQLR KGIKLV KGLGLA

KFGQVV KFIKDR KFLAIV KFLRAA KGAKGR KGFALA KGFRAL KGGQLV KGIKVA KGLGLV

KFGRAA KFIKDV KFLALA KFLRAI KGAKG KGFALI KGFRAR KGGQVA KGIKVI KGLGVA

KFGRAI KFIKGA KFLALI KFLRAL KGAKIA KGFALL KGFRAV KGGQVI KGIKVL KGLGVI

KFGRAL KFIKGI KFLALR KFLRAR KGAKII KGFALR KGFRDA KGGQVL KGIKVR KGLGVL

KFGRAR KFIKGL KFLALV KFLRAV KGAKIL KGFALV KGFRDI KGGQVR KGIKVV KGLGVR

KFGRAV KFIKGR KFLAVA KFLRDA KGAKIR KGFA A KGFRDL KGGQVV KGIQAA KGLGVV

KFGRDA KFIKGV KFLA I KFLRDI KGAKIV KGFAVI KGFRDR KGGRAA KGIQAI KGLKAA

KFGRDI KFIKIA KFLAVL KFLRDL KGAKLA KGFAVL KGFRDV KGGRAI KGIQAL KGLKAI

KFGRDL KFIKIL KFLAVR KFLRDR KGAKLI KGFAVR KGFRGA KGGRAL KGIQAR KGLKAL

KFGRDR KFIKIR KFLAVV KFLRDV KGAKLL KG FA V KGFRGI KGGRAR KGIQAV KGLKAR

KFGRDV KFIKIV KFLGAA KFLRGA KGAKLR KGFGAA KGFRGL KGGRAV KGIQDA KGLKAV

KFGRGA KFIKLA KFLGAI KFLRGI KGAKLV KGFGAI KGFRGR KGGRDA KGIQDI KGLKDA

KFGRGI KFIKLI KFLGAL KFLRGL KGAKVA KGFGAL KGFRGV KGGRDI KGIQDL KGLKDI

KFGRGL KFIKLL KFLGAR KFLRGR KGAKVI KGFGAR KGFRIA KGGRDL KGIQDR KGLKDL

KFGRGR KFIKLR KFLGAV KFLRGV KGAKVL KGFGA KGFRII KGGRDR KGIQDV KGLKDR

KFGRGV KFIKLV KFLGDA KFLRIA KGAKVR KGFGDA KGFRIL KGGRDV KGIQGA KGLKDV

KFGRIA KFIKVA KFLGDI KFLRII KGAKVV KGFGDI KGFRIR KGGRIA KGIQGI KGLKGA

KFGRII KFIKVI KFLGDL KFLRIL KGAQAA KGFGDL KGFRIV KGGRIV KGIQGL KGLKGI

KFGRIL KFIKVL KFLGDR KFLRIR KGAQAI KGFGDR KGFRLA KGGRLA KGIQGR KGLKGL

KFGRIR KFIKVR KFLGDV KFLRIV KGAQAL KGFGDV KGFRLI KGGRLV KGIQGV KGLKGR

KFGRIV KFIKVV KFLGGA KFLRLA KGAQAR KGFGIA KGFRLL KGGRVA KGIQIA KGLKGV

KFGRLA KFIQAA KFLGGI KFLRLI KGAQAV KGFGII KGFRLR KGGR I KGIQIL KGLKIA

KFGRLI KFIQAI KFLGGL KFLRLR KGAQDA KGFGIL KGFRLV KGGRVL KGIQIR KGLKII

KFGRLL KFIQAL KFLGGR KFLRLV KGAQDI KGFGIR KGFRVA KGGRVR KGIQIV KGLKIL

KFGRLR KFIQAR KFLGGV KFLRVA KGAQDL KGFGIV KGFRVI KGGRVV KGIQLA KGLKIR

KFGRLV KFIQAV KFLGIA KFLRVI KGAQDR KGFGLA KGFRVL KGIAAA KGIQLI KGLKIV

KFGRVA KFIQDA KFLGII KFLRVL KGAQDV KGFGLI KGFRVR KGIAAI KGIQLL KGLKLA

KFGR I KFIQDI KFLGIL KFLRVR KGAQGA KGFGLL KGFRVV KGIAAL KGIQLR KGLKLI

KFGRVL KFIQDL KFLGIR KFLRVV KGAQGI KGFGLR KGGAAA KGIAAR KGIQLV KGLKLR

KFGRVR KFIQDR KFLGIV KGAAAA KGAQGL KGFGLV KGGAAI KGIAAV KGIQVA KGLKLV

KFGRVV KFIQDV KFLGLA KGAAAI KGAQGR KGFGVA KGGAAL KGIADA KGIQVI KGLKVA

KFIAAA KFIQGA KFLGLI KGAAAL KGAQGV KGFGVI KGGAAR KGIADI KGIQVL KG LK VI

KFIAAI KFIQGL KFLGLR KGAAAR KGAQIA KGFGVL KGGAAV KGIADL KGIQVR KGLKVL

KFIAAL KFIQGR KFLGLV KGAAAV KGAQII KGFGVR KGGADA KGIADR KGIQVV KGLKVR

KFIAAR KFIQGV KFLGVA KGAADA KGAQIL KGFGVV KGGADI KGIADV KGIRAA KGLKVV

KFIAAV KFIQIA KFLGVI KGAADI KGAQIR KGFKAA KGGADL KGIAGA KGIRAI KGLQAA

KFIADA KFIQIL KFLGVL KGAADL KGAQIV KGFKAI KGGADR KGIAGI KGIRAL KGLQAI

KFIADI KFIQIR KFLGVR KGAADR KGAQLA KGFKAL KGGADV KGIAGL KGIRAR KGLQAL

KFIADL KFIQIV KFLGVV KGAADV KGAQLI KGFKAR KGGAIA KGIAGR KGIRAV KGLQAR

KFIADR KFIQLA KFLKAA KGAAGA KGAQLL KGFKAV KGGAII KGIAGV KGIRDA KGLQAV

KFIADV KFIQLI KFLKAI KGAAGI KGAQLR KGFKDA KGGAIL KGIAIA KGIRDI KGLQDA

KFIAGA KFIQLL KFLKAL KGAAGL KGAQLV KGFKDI KGGAIR KGIAIL KGIRDL KGLQDI

KFIAGI KFIQLR KFLKAR KGAAGR KGAQVA KGFKDL KGGAIV KGIAIR KGIRDR KGLQDL

KFIAGL KFIQLV KFLKAV KGAAGV KGAQVI KGFKDR KGGALA KGIAIV KGIRDV KGLQDR

KFIAGR KFIQVA KFLKDA KGAAIA KGAQVL KGFKDV KGGALI KGIALA KGIRGA KGLQDV

KFIAGV KFIQVI KFLKDI KGAAII KGAQVR KGFKGA KGGALL KGIALI KGIRGV KGLQGA

KFIAIA KFIQVL KFLKDL KGAAIL KGAQVV KGFKGI KGGALR KGIALL KGIRIA KGLQGI

KFIAIL KFIQVR KFLKDR KGAAIR KGARAA KGFKGL KGGALV KGIALR KGIRIV KGLQGL

KFIAIR KFIQVV KFLKDV KGAAIV KGARAI KGFKGR KGGAVA KGIALV KGIRLA KGLQGR

KFIAIV KFIRAA KFLKGA KGAALA KGARAL KGFKGV KGGAVI KGIAVA KGIRLV KGLQGV

KFIALA KFIRAI KFLKGI KGAALI KGARAR KGFKIA KGGAVL KGIAVI KGIRVA KGLQIA

KFIALI KFIRAL KFLKGL KGAALL KGARAV KGFKII KGGAVR KGIAVL KGIRVI KGLQII

KFIALL KFIRAR KFLKGR KGAALR KGARDA KGFKIL KGGAVV KGIAVR KGIRVL KGLQIL

KFIALR KFIRAV KFLKGV KGAALV KGARDI KGFKIR KGGKAA KGIAVV KGIRVR KGLQIR

KFIALV KFIRDA KFLKIA KGAAVA KGARDL KGFKIV KGGKAI KGIGAA KGIRVV KGLQIV

KFIAVA KFIRDI KFLKII KGAA I KGARDR KGFKLA KGGKAL KGIGAI KGLAAA KGLQLA

KFIAVI KFIRDL KFLKIL KGAAVL KGARDV KGFKLI KGGKAR KGIGAL KGLAAI KGLQLI

KFIAVL KFIRDR KFLKIR KGAAVR KGARGA KGFKLL KGGKAV KGIGAR KGLAAL KGLQLR

KFIAVR KFIRDV KFLKIV KGAAVV KGARGI KGFKLR KGGKDA KGIGAV KGLAAR KGLQLV

KFIAVV KFIRGA KFLKLA KGAGAA KGARGL KGFKLV KGGKDI KGIGDA KGLAAV KGLQVA

KFIGAA KFIRGI KFLKLI KGAGAI KGARGR KGFKVA KGGKDL KGIGDI KG LAD A KGLQVI

KFIGAI KFIRGL KFLKLR KGAGAL KGARGV KGFKVI KGGKDR KGIGDL KGLADI KGLQVL

KFIGAL KFIRGR KFLKLV KGAGAR KGARIA KGFKVL KGGKDV KGIGDR KG LAD L KGLQVR

KFIGAR KFIRGV KFLKVA KGAGAV KGARII KGFKVR KGGKIA KGIGDV KG LAD R KGLQVV

KFIGAV KFIRIA KFLKVI KG AG DA KG ARIL KGFKVV KGGKII KGIGIA KGLADV KGLRAA

KFIGDA KFIRIL KFLKVL KGAGDI KGARIR KGFQAA KGGKIL KGIGIV KGLAGA KGLRAI

KFIGDI KFIRIR KFLKVR KGAGDL KGARIV KGFQAI KGGKIR KGIGLA KG LAG I KGLRAL KGLRAR KRAQLA KRFQDR KRGQVI KRIRDV KRLRLV LGFQGL QAARLA QAGGDR QAIQLI

KGLRAV KRAQLI KRFQGA KRGQVL KRIRGV KRLRVA LGFQVL QAARLI QAGGII QAIQVI

KGLRDA KRAQLR KRFQGL KRGQVR KRIRIA KRLRVI LGGAAA QAARLV QAGGIL QAIRAA

KGLRDI KRAQLV KRFQGR KRGRAI KRIRIV KRLRVL LGGADV QAARVA QAGGIR QAIRAI

KGLRDL KRAQVA KRFQIA KRGRAL KRIRLA KRLRVV LGGAVL QAARVI QAGGVI QAIRAV

KGLRDR KRAQVI KRFQII KRGRAV KRIRLV LAAAAL LGGKIA QAARVL QAGGVL QAIRDA

KGLRDV KRAQVR KRFQIL KRGRDA KRIRVA LAAAGR LGGKVL QAARVR QAGGVR QAIRDI

KGLRGA KRAQVV KRFQIR KRGRDI KRIRVL LAAAGV LGGQAL QAARVV QAGKAL QAIRDV

KGLRGV KRARAI KRFQIV KRGRDV KRIRVV LAAAIL LGGQVI QAFAAL QAGKAV QAIRIA

KGLRIA KRARAL KRFQLA KRGRGA KRLAAI LAAAVV LGIADA QAFAAR QAGKDI QAIRIR

KGLRIV KRARAV KRFQLL KRGRIA KRLAAR LAAGAR LGIAVA QAFAAV QAGKDV QAIRLA

KGLRLA KRARDA KRFQLR KRGRIV KRLAAV LAAGDI LGIGDV QAFADI QAGKIA QAIRLI

KGLRLV KRARDI KRFQLV KRGRLA KRLADA LAAGGA LGLAAV QAFADL Q AG KIR QAIRLR

KGLRVA KRARDV KRFQVA KRGRLV KRLADI LAAGGL LGLADA QAFADR QAGKLA QAIRLV

KGLRVI KRARGA KRFQVR KRGRVA KRLADL LAAGIV LGLADV QAFADV QAGKLV QAIRVA

KGLRVL KRARGI KRFQVV KRGR I KRLADR LAAGLV LGLGDV QAFAGI QAGKVI QAIRVV

KGLRVR KRARGL KRFRAA KRIAAL KRLADV LAAGVL LRAKIL QAFAGR QAGKVR QALAAI

KGLRVV KRARIA KRFRAI KRIAAR KRLAGA LAAKAA LRARVL QAFAIA QAGQAA QALAAL

KRAAAA KRARIV KRFRAL KRIADA KRLAGI LAAKAV LRFKAL QAFAIL QAGQAL QALAAV

KRAAAI KRARLA KRFRDA KRIADI KRLAGR LAAKGL LRFKDL QAFALR QAGQAR QALADA

KRAAAL KRARLI KRFRDL KRIADL KRLAGV LAAKIL LRFKGL QAFAVA QAGQDV QALADL

KRAAAV KRARLL KRFRGI KRIADR KRLAII LAAQDL LRFKII QAFAVR QAGQGI QALADR

KRAADL KRARLV KRFRGV KRIADV KRLAIL LAARGL LRFKIL QAFAVV QAGQIA QALADV

KRAADR KRARVA KRFRIA KRIAGA KRLAIR LAFAVL LRFKLI QAFGAI QAGQII QALAGL

KRAADV KRARVI KRFRII KRIAGI KRLALI LAFGGL LRFKVI QAFGAR QAGQLA QALAGV

KRAAGI KRARVL KRFRIV KRIAIL KRLALR LAFGLA LRFQII QAFGAV QAGQLL QALAIL

KRAAGL KRARVV KRFRLA KRIAIR KRLAVA LAFQII LRFQIR QAFGDA QAGQVR QALALA

KRAAIR KRFAAI KRFRLI KRIAIV KRLA I LAFQLI LRFQLI QAFGDI QAGRAA QALA I

KRAALA KRFAAL KRFRLL KRIALI KRLAVL LAFQVL LRFQVL QAFGDL QAGRAI QALAVL

KRAALL KRFAAR KRFRVI KRIALL KRLAVR LAGAAR LRFRVI QAFGDV QAGRAR QALAVR

KRAALR KRFAAV KRFRVL KRIALR KRLAVV LAGAAV LRIKAL QAFGGI QAGRAV QALAVV

KRAALV KRFADA KRFRVV KRIAVA KRLGAA LAG AD L LRIKVL QAFGGL QAGRDA QALGAI

KRAAVA KRFADI KRGAAR KRIAVL KRLGAI LAGAGA name QAFGGV QAGRDR QALGAL

KRAAVL KRFADR KRGADA KRIAVR KRLGAR LAG AG Name QAFGIL QAGRDV QALGDI

KRAAVV KRFAGA KRGADI KRIGAA KRLGAV LAGAII QAAAAA QAFGLL QAGRGI QALGDR

KRAGAA KRFAGI KRGADL KRIGAI KRLGDI LAGAIV QAAAAR QAFGLV QAGRGR QALGGR

KRAGAI KRFAGL KRGADV KRIGAL KRLGDL LAGALV QAAAAV QAFGVI QAGRGV QALGII

KRAGAL KRFAGR KRGAGV KRIGAV KRLGIA LAGAVL QAAADL QAFGVL QAGRIL QALGIL

KRAGAV KRFAGV KRGAIA KRIGDL KRLGLA LAGGDI QAAADR QAFGVR QAGRIR QALGIR

KRAGDA KRFAIA KRGAII KRIGDR KRLGVA LAGGVL QAAAII QAFKAA QAGRLA QALGIV

KRAGDI KRFAIL KRGAIR KRIGDV KRLGVL LAGKAL QAAAIL QAFKAI QAGRLL QALGLI

KRAGDL KRFAIR KRGALA KRIGGA KRLGVR LAGKDL QAAAIR QAFKAR QAGRLR QALGLR

KRAGDR KRFAIV KRGALL KRIGIA KRLGVV LAGQAL QAAALI QAFKAV QAGRVA QALGLV

KRAGGA KRFALA KRGALV KRIGIV KRLKAA LAGQGA QAAALR QAFKDA QAGR I QALGVA

KRAGGL KRFALR KRGAVA KRIGLA KRLKAI LAGQGL QAAALV QAFKDI QAIAAI QALGVL

KRAGGR KRFAVA KRGAVI KRIGVA KRLKAL LAGQVL QAAGDA QAFKDL QAIAAV QALGVV

KRAGGV KRFAVI KRGAVL KRIGVV KRLKAR LAGRAV QAAGDR QAFKDV QAIADI QALKAI

KRAGIA KRFAVR KRGGAA KRIKAI KRLKAV LAGRDL QAAGGA QAFKGA QAIADL QALKAV

KRAGII KRFAVV KRGGAI KRIKAL KRLKDA LAIAGV QAAGGI QAFKGI QAIADR QALKDV

KRAGIV KRFGAA KRGGAL KRIKAV KRLKDI LAIGDL QAAGGV QAFKGV QAIADV QALKGR

KRAGLA KRFGAI KRGGAV KRIKDA KRLKDL LAIKAL QAAGII QAFKIR QAIAIL QALKGV

KRAGLI KRFGAL KRGGDA KRIKDI KRLKDV LAIKDL QAAGIL QAFKLR QAIALL QALKIA

KRAGLL KRFGAR KRGGDL KRIKDL KRLKGI LAIKIL QAAGIV QAFKLV QAIAVI QALKII

KRAGLR KRFGAV KRGGDR KRIKDR KRLKGL LAIQGL QAAGLV QAFKVA QAIAVL QALKIR

KRAGLV KRFGDA KRGGDV KRIKDV KRLKGR LALAG QAAGVR QAFKVL QAIAVR QALKLA

KRAGVA KRFGDL KRGGLA KRIKGA KRLKGV LALQAA QAAKAR QAFKVR QAIGAI QALKLR

KRAGVI KRFGDR KRGGVI KRIKGI KRLKIA LFAGGI QAAKGL QAFQAI QAIGAL QALQAI

KRAGVL KRFGGA KRGGVL KRIKGL KRLKIL LFAKDI QAAKGV QAFQAV QAIGDI QALQAL

KRAGVR KRFGGR KRGKAI KRIKGR KRLKIR LFARGL QAAKII QAFQDI QAIGDR QALQAV

KRAKAA KRFGIA KRGKDI KRIKGV KRLKIV LFFGDI QAAKIV QAFQDR QAIGGL QALQDA

KRAKAI KRFGIL KRGKDL KRIKIL KRLKLA LFFQIL QAAKLA QAFQDV QAIGGR QALQDI

KRAKAL KRFGIR KRGKDR KRIKIV KRLKLR LFFQVL QAAKLI QAFQGI QAIGIL QALQDL

KRAKAR KRFGIV KRGKDV KRIKLA KRLKLV LFFRAL QAAKLV QAFQGR QAIGIR QALQDV

KRAKDA KRFGLA KRGKGI KRIKLI KRLKVA LFGAAA QAAKVA QAFQII QAIGIV QALQGA

KRAKDI KRFGLI KRGKGR KRIKLR KRLKVL LFGADA QAAKVI QAFQIR QAIGLA QALQGI

KRAKDL KRFGLR KRGKGV KRIKLV KRLKVV LFGADV QAAKVL QAFQIV QAIGLI QALQGL

KRAKDR KRFGLV KRGKIA KRIKVA KRLQAA LFGGVA QAAKVR QAFQLL QAIGLL QALQIA

KRAKDV KRFGVA KRGKII KRIKVI KRLQAI LFGGVL QAAKVV QAFQLR QAIGLR QALQLA

KRAKGL KRFG I KRGKIL KRIKVL KRLQAR LFGKGL QAAQAI QAFQLV QAIGLV QALQVR

KRAKGR KRFGVL KRGKIR KRIKVR KRLQDA LFGQGA QAAQAL QAFQVI QAIGVA QALRAI

KRAKII KRFG R KRGKIV KRIKVV KRLQDI LFIKVL QAAQAV QAFQVL QAIGVI QALRAV

KRAKIL KRFGVV KRGKLI KRIQAI KRLQDL LFIQIL QAAQDR QAFRAA QAIGVV QALRDA

KRAKIR KRFKAA KRGKLR KRIQAL KRLQDR LFIRDL QAAQGA QAFRAV QAIKAI QALRDI

KRAKIV KRFKAI KRGKLV KRIQAR KRLQGI LFIRVL QAAQGI QAFRDL QAIKAV QALRDV

KRAKLI KRFKAL KRGKVA KRIQDA KRLQGL LGAAAL QAAQGR QAFRDR QAIKDI QALRGA

KRAKLL KRFKAR KRGK I KRIQDI KRLQGR LGAADI QAAQIA QAFRGI QAIKDR QALRIA

KRAKLR KRFKAV KRGKVL KRIQDR KRLQGV LGAADL QAAQII QAFRGV QAIKDV QALRII

KRAKLV KRFKDA KRGKVR KRIQDV KRLQIA LGAAGL QAAQLA QAFRIR QAIKGV QALRIR

KRAKVI KRFKDI KRGQAA KRIQGA KRLQII LGAGAI QAAQLI QAFRIV QAIKIA QALRLA

KRAKVL KRFKDL KRGQAI KRIQGL KRLQIL LGAGAL QAAQLL QAFRLL QAIKIR QALRLR

KRAKVR KRFKGI KRGQAL KRIQGR KRLQIR LGAGAV QAAQLR QAFRLR QAIKLA QALRVA

KRAKVV KRFKGR KRGQAR KRIQGV KRLQLA LGAGDA QAAQLV QAFRLV QAIKLI QALRVV

KRAQAA KRFKGV KRGQAV KRIQIA KRLQLI LGAGVL QAAQVA QAFRVA QAIKLR QFAAAA

KRAQAI KRFKIA KRGQDA KRIQIR KRLQLR LGAKAL QAAQVL QAFRVI QAIKLV QFAAAI

KRAQAL KRFKIL KRGQDL KRIQIV KRLQLV LGAQAA QAAQVV QAFRVR QAIKVI QFAAAR

KRAQAV KRFKIV KRGQDR KRIQLA KRLQVI LGAQGI QAARAI QAGAAA QAIQAI QFAAAV

KRAQDA KRFKLA KRGQGA KRIQLI KRLRAA LGAQGL QAARAL QAGAAR QAIQAL QFAADI

KRAQDL KRFKLR KRGQGI KRIQLR KRLRAV LGAQVL QAARAR QAGAAV QAIQAV QFAADL

KRAQDR KRFKVA KRGQGL KRIQLV KRLRDA LGFAAL QAARDI QAGAIL QAIQDA QFAADR

KRAQGA KRFKVI KRGQGR KRIQVA KRLRDI LGFAIL QAARDL QAGAIR QAIQDI QFAADV

KRAQGI KRFKVL KRGQIL KRIQVR KRLRDL LGFAVL QAARDR QAGAIV QAIQDV QFAAGI

KRAQGL KRFKVR KRGQIR KRIQVV KRLRDV LGFGAV QAARGL QAGALL QAIQGA QFAAGR

KRAQGV KRFKVV KRGQLA KRIRAA KRLRGA LGFGDI QAARGR QAGALR QAIQGI QFAAGV

KRAQIA KRFQAA KRGQLI KRIRAV KRLRGV LGFGVA QAARGV QAGA I QAIQGR QFAAIA

KRAQII KRFQAR KRGQLL KRIRDA KRLRIA LGFGVI QAARIA QAGGAV QAIQIA QFAAIL

KRAQIL KRFQAV KRGQLR KRIRDI KRLRIV LGFKAL QAARII QAGGDI QAIQIR QFAAIV

KRAQIR KRFQDA KRGQVA KRIRDL KRLRLA LGFKVI QAARIV QAGGDL QAIQLA QFAALA QFAALL QFFQDR QF] AG I QFLKII QGFAGR QGGQIR QGLGVI QRFKAL QRIQAI RAGALV

QFAALV QFFQDV QF] AGL QFLKIL QGFAIR QGGQLA QGLGVL QRFKDA QRIQAR RAGAVI

QFAAVI QFFQGA QF] AGR QFLKLV QGFAIV QGGQLI QGLGVR QRFKDI QRIQDV RAGGAR

QFAAVR QFFQGR QF] AG QFLKVA QGFALA QGGQLR QGLGVV QRFKDR QRIQGI RAGGDI

QFAAVV QFFQGV QF] AIA QFLKVI QGFALR QGGQVI QGLKAA QRFKGR QRIQIA RAGKDA

QFAGAA QFFQII QF] AIR QFLKVV QGFALV QGGQVR QGLKAI QRFKIR QRIQLA RAGKIL

QFAGAI QFFQLA QF] ALR QFLQAR QGFAVA QGGQVV QGLKAL QRFKIV QRIQLI RAGKLR

QFAGAR QFFQLI QF] ALV QFLQDR QGFAVI QGGRDI QGLKAR QRFKLR QRIQVI RAGQAI

QFAGDA QFFQ I QF] AVR QFLQDV QGFAVL QGGRIV QGLKAV QRFKVI QRIQVL RAGQDI

QFAGDI QFFQVR QF] GAA QFLQGI QGFAVR QGGRVA QGLKDI QRFKVL QRIRAI RAGQIR

QFAGDL QFFQVV QF] GAI QFLQGL QGFGAR QGGRVR QGLKDL QRFKVR QRIRAL RAGQVL

QFAGDR QFFRAI QF] GAL QFLQGV QGFGDI QGIAAI QGLKDR QRFKVV QRIRDV RAGRDL

QFAGDV QFFRAR QF] GAR QFLQII QGFGDR QGIAAL QGLKDV QRFQAV QRIRGV RAIADA

QFAGGV QFFRDI QF] GAV QFLQIV QGFGII QGIADV QGLKGI QRFQDA QRIRVA RAIADI

QFAGII QFFRDL QF] GDA QFLQLA QGFGIL QGIAGA QGLKGR QRFQDL QRIRVL RAIAGV

QFAGIL QFFRDR QF] GDL QFLQLI QGFGIR QGIAGR QGLKIV QRFQGR QRLAAI RAIALL

QFAGIV QFFRGI QF] GDV QFLQLR QGFGIV QGIAGV QGLKVA QRFQGV QRLAAL RAIGAV

Q FAG LA QFFRGR QF] GGA QFLQLV QGFGLI QGIAIL QGLKVI QRFQIA QRLAAR RAIGVR

QFAGLI QFFRIA QF] GGV QFLQVA QGFGLL QGIAIV QGLKVL QRFQLA QRLAAV RAIKLA

QFAGLV QFFRII QF] GIA QFLQVI QGFGLR QGIALA QGLQAL QRFQLI QRLADI RAIKLR

QFAGVR QFFRLA QF] GIR QFLQVR QGFGLV QGIALI QGLQAV QRFQLL QRLADL RAIKVV

QFAKAA QFFRLI QF] GIV QFLQVV QGFG I QGIALL QGLQDI QRFQLR QRLAGR RAIQAI

QFAKAI QFFRLL QF] GLA QFLRAI QGFGVV QGIALR QGLQGI QRFQVL QRLAIV RAIRDI

QFAKAR QFFRLV QF] GLL QFLRDA QGFKAA QGIALV QGLQGR QRFRAA QRLALI RAIRIA

QFAKAV QFFRVA QF] GLR QFLRDI QGFKAI QGIAVI QGLQIL QRFRAI QRLALV RAIRLA

QFAKDA QFFRVR QF] GLV QFLRDR QGFKAV QGIAVL QGLQLA QRFRDA QRLAVR RALADI

QFAKDL QFGAAR QF] GVV QFLRGA QGFKDA QGIAVV QGLQLI QRFRDI QRLGDA RALAGV

QFAKDV QFGADA QF] KAI QFLRGI QGFKDI QGIGAA QGLRAA QRFRGA QRLGDR RALAIL

QFAKGA QFGADI QF] KAL QFLRGL QGFKDL QGIGAR QGLRAL QRFRIV QRLGGV RALAVV

QFAKGI QFGADL QF] KAR QFLRGR QGFKDV QGIGAV QGLRDI QRFRVV QRLGIV RALGAI

QFAKGV QFGADR QF] KDL QFLRGV QGFKGA QGIGDL QGLRDV QRGAAA QRLGLV RALGAV

QFAKII QFGAGA QF] KDR QFLRIA QGFKGL QGIGDR QGLRGV QRGAAV QRLGVI RALKAI

QFAKLA QFGAGI QF] KDV QFLRII QGFKGR QGIGIV QGLRLV QRGADA QRLGVV RALKGA

QFAKLI QFGAGL QF] KGR QFLRLA QGFKGV QGIGLV QGLRVI QRGADI QRLKDI RALKIL

QFAKLR QFGAII QF] KIA QFLRVL QGFKIR QGIGVI QGLRVL QRGADL QRLKDL RALKIR

QFAKVR QFGALI QF] KLA QFLRVV QGFKLA QGIGVL QRAAAI QRGADV QRLKLV RALKLV

QFAQAI QFGALV QF] KLI QGAAAI QGFKLR QGIGVR QRAAAL QRGAGR QRLKVA RALKVV

QFAQAR QFGAVA QF] KVI QGAADA QGFKVR QGIKAI QRAAAV QRGAGV QRLKVI RALQGA

QFAQAV QFGAVR QF] K V QGAADR QGFKVV QGIKAL QRAADA QRGAIR QRLKVR RALQLV

QFAQDI QFGGAI QF] QAR QGAAGA QGFQAI QGIKAR QRAADI QRGALR QRLKVV RALQVI

QFAQDV QFGGAL QF] QAV QGAAII QGFQAL QGIKAV QRAADV QRGGAI QRLQAI RFAAGA

QFAQGI QFGGAR QF] QDR QGAAIV QGFQDA QGIKDI QRAAGA QRGGAR QRLQGR RFAAGR

QFAQGR QFGGDI QF] QDV QGAALL QGFQDI QGIKDV QRAAGR QRGGDA QRLQIA RFAAIV

QFAQIA QFGGDL QF] QGI QGAALV QGFQDV QGIKGA QRAAGV QRGGDL QRLQII RFAALR

QFAQIR QFGGDR QF] QGV QGAA I QGFQGA QGIKGI QRAALA QRGGIA QRLQIL RFAAVR

QFAQLA QFGGLL QF] QIA QGAAVL QGFQGL QGIKGR QRAAVL QRGGIV QRLQLA RFAGAA

QFAQLR QFGGVI QF] QIV QGAGAA QGFQGR QGIKIV QRAGDI QRGGLV QRLQ I RFAGGA

QFAQVA QFGGVL QF] QLV QGAGDA QGFQGV QGIKLV QRAGDV QRGGVL QRLQVL RFAKAI

QFAQVV QFGGVR QF] QVA QGAGIR QGFQIA QGIKVA QRAGGI QRGKAR QRLRAL RFAKDR

QFARAA QFGKAI QF] RDA QGAGVA QGFQIL QGIKVI Q RAG LI QRGKDA QRLRDA RFAKDV

QFARAV QFGKAL QF] RDI QGAKAI QGFQLA QGIQAA QRAGLV QRGKDR QRLRDI RFAKVI

QFARDL QFGKAV QF] RDR QGAKAL QGFQLL QGIQAI QRAKAI QRGKGA QRLRIA RFAQGL

QFARDR QFGKDA QF] RGA QGAKAV QGFQLR QGIQAL QRAKAL QRGKGL QRLRIV RFAQGR

QFARIL QFGKDL QF] RGR QGAKDA QGFQVI QGIQAV QRAKDL QRGKGV QRLRLA RFAQVR

QFARIV QFGKDR QF] RIA QGAKDL QGFQVV QGIQDI QRAKGR QRGKII QRLRLV RFARDV

QFARLI QFGKDV QF] RIL QGAKDR QGFRAA QGIQDV QRAKIL QRGKIL QRLRVA RFARGV

QFARVA QFGKIA QF] RLA QGAKGI QGFRAI QGIQGA QRAKLI QRGKIV RAAAAR RFARIA

QFARVL QFGKIR QF] RLL QGAKII QGFRAV QGIQGI QRAK I QRGKLI RAAADI RFARLA

QFARVR QFGKIV QF .AAA QGAKIL QGFRDA QGIQGR QRAKVL QRGKLL RAAADV RFARVA

QFFAAA QFGKLA QF .AAL QGAKIV QGFRDI QGIQLA QRAKVV QRGKLR RAAAIA RFFAAV

QFFAAV QFGKLL QF -AAV QGAKLI QGFRDL QGIQLI QRAQAI QRGKLV RAAALV RFFGAR

QFFADA QFGKLR QF .ADA QGAKLL QGFRDR QGIQLL QRAQDA QRGQAL RAAA I RFFGVA

QFFADI QFGQAA QF -ADV QGAKVA QGFRIA QGIQVV QRAQDL QRGQDI RAAGDR RFFKAV

QFFADL QFGQAI QF .AG I QGAKVI QGFRIR QGIRAA QRAQDR QRGQDV RAAGGR RFFKDA

QFFADR QFGQAL QF .AGL QGAKVR QGFRIV QGIRAL QRAQIV QRGQGI RAAGVA RFFKIL

QFFADV QFGQDI QF .AGR QGAKVV QGFRLA QGIRAV QRAQLI QRGQGL RAAGVI RFFKLL

QFFAGA QFGQDL QF .AIR QGAQAR QGFRLI QGIRDI QRAQVI QRGQGR RAAKAI RFFQAV

QFFAGL QFGQDV QF -AIV QGAQDL QGFRLR QGIRDL QRARIA QRGQIV RAAKDA RFFQDV

QFFAII QFGQGA QF .ALR QGAQDR QGFRVL QGIRDV QRARII QRGRAA RAAKDV RFFRDA

QFFAIR QFGQGI QF -ALV QGAQGL QGFRVV QGIRGA QRARIL QRGRDA RAAKGA RFGAAA

QFFALA QFGQGR QF -AVI QGAQGR QGGAAA QGIRGV QRARIV QRGRIV RAAQDA RFGAGA

QFFALI QFGQIR QF -AVR QGAQGV QGGAAV QGIRIV QRARLL QRGRLA RAAQVA RFGALR

QFFALR QFGQIV QF .GAI QGAQIA QGGADR QGIRVI QRARVL QRGRLV RAARAI RFGGAA

QFFAVI QFGQLL QF .GAL QGAQIV QGGAIA QGIRVV QRARVV QRGRVI RAARAV RFGGDR

QFFAVR QFGQLR QF .GAR QGAQLA QGGAII QGLAAL QRFAAA QRGRVL RAARDA RFGGVR

QFFGAL QFGQLV QF -GAV QGAQLI QGGAIL QGLAAR QRFAAI QRIAAA RAARG RFGGVV

QFFGAV QFGQVA QF .GDA QGAQLV QGGAIR QGLADI QRFADI QRIAAR RAARLI RFGKDA

QFFGDR QFGQVL QF .GDL QGAQVR QGGALA QGLADV QRFADL QRIALI RAFADR RFGKDV

QFFGGA QFGQVV QF .GDV QGARAI QGGALR QGLAGI QRFADR QRIALV RAF All RFGKVR

QFFGGL QFGRAA QF .GGA QGARAV QGGAVA QGLAGR QRFAGA QRIAVI RAFAVR RFGQAR

QFFGGV QFGRAI QF .GGR QGARDA QGGAVL QGLAIA QRFAGR QRIAVR RAFGGV RFGQDR

QFFGVA QFGRAL QF .GIA QGARDI QGGAVR QGLAII QRFAII QRIGAV RAFGII RFGQGA

QFFGVR QFGRDA QF .Gil QGARDR QGGKAA QGLAIL QRFAIL QRIGDA RAFG R RFGQIR

QFFKAR QFGRIA QF .GIL QGARGA QGGKAI QGLAIR QRFALI QRIGDR RAFKDR RFGRDA

QFFKDI QFGRII QF .GIR QGARGR QGGKDI QGLAIV QRFALL QRIGDV RAFKDV RFGRLV

QFFKDV QFGRIL QF -GIV QGARIL QGGKII QGLALI QRFAVA QRIGGA RAFKGI RFIADR

QFFKIA QFGRIR QF .GLA QGARIR QGGKIR QGLALR QRFA I QRIGGV RAF KLA RFIAIA

QFFKIL QFGRIV QF .GLR QGARLA QGGKLI QGLA I QRFAVV QRIGIA RAFKLV RFIAIV

QFFKIV QFGRLA QF -GVL QGARLL QGGKLR QGLAVL QRFGAA QRIGVA RAFQLI RFIAVA

QFFKLA QFGRLR QF -GVV QGARLR QGGKVA QGLAVV QRFGAR QRIGVI RAFQVV RFIAVL

QFFKLI QFGRVA QF .KAR QGARLV QGGKVI QGLGAL QRFGGV QRIGVV RAFRGI RFIGLA

QFFKVA QFGRVV QF .KDL QGAR I QGGKVV QGLGAR QRFGII QRIKAR RAFRIA RFIGVR

QFFKVI QFIAAA QF .KDR QGFAAI QGGQAL QGLGDA QRFGIL QRIKDI RAFRLV RFIKGA

QFFKVL QFIAAL QF .KGI QGFAAV QGGQDA QGLGDV QRFGIV QRIKDL RAGAAR RFIKVA

QFFQAR QFIAAV QF .KGR QGFADA QGGQDI QGLGIV QRFGLI QRIKGV RAGADR RFIQAA

QFFQAV QFIADA QF .KGV QGFADI QGGQDR QGLGLA QRFGLV QRIKIA RAG AGR RFIQAL

QFFQDL QFIADV QF .KIA QGFAD QGGQIA QGLGLV QRFGVR QRIKLV RAG AI RFIQDA RFIQDV RRGQDV VAAKLL VAFAVV VAFRDI VAGKIR VAIAVI VAIRDI VALKII VFAAVI

RFIQGR RRGQIV VAAKLR VAFGAA VAFRDL VAGKIV VAIAVL VAIRDL VALKIL VFAAVL

RFIQGV RRGQLV VAAKLV VAFGAI VAFRDR VAGKLA VAIAVR VAIRDR VALKIR VFAAVR

RFLAAI RRIALA VAAKVA VAFGAL VAFRDV VAGKLI VAIAVV VAIRDV VALKIV VFAAVV

RFLADR RRIGAV VAAKVI VAFGAR VAFRGA VAGKLL VAIGAA VAIRGA VALKLA VFAGAA

RFLAIV RRIGVA VAAKVL VAFGAV VAFRGI VAGKLR VAIGAI VAIRGI VALKLI VFAGAI

RFLALV RRIQVA VAAKVR VAFGDA VAFRGL VAGKLV VAIGAL VAIRGL VALKLR VFAGAL

RFLAVA RRLADV VAAKVV VAFGDI VAFRGR VAGKVA VAIGAR VAIRGR VALKLV VFAGAR

RFLGDR RRLAIA VAAQAA VAFGDL VAFRGV VAGKVI VAIGAV VAIRGV VALKVA VFAGAV

RFLGVR RRLGVV VAAQAI VAFGDR VAFRIA VAGKVL VAIGDA VAIRIA VALKVI VFAGDA

RFLKGA RRLKGV VAAQAL VAFGDV VAFRII VAGKVR VAIGDI VAIRIL VALKVL VFAGDI

RFLKVA RRLQAA VAAQAR VAFGGA VAFRIL VAGKVV VAIGDL VAIRIR VALKVR VFAGDL

RFLQAA RRLQDA VAAQAV VAFGGI VAFRIR VAGQAA VAIGDR VAIRIV VALKVV VFAGDR

RFLQGR RRLQGV VAAQDA VAFGGL VAFRIV VAGQAI VAIGDV VAIRLA VALQAA VFAGDV

RFLQIA RRLQVA VAAQDI VAFGGR VAFRLA VAGQAL VAIGGA VAIRLI VALQAI VFAGGA

RFLQLA VAAAAA VAAQDL VAFGGV VAFRLI VAGQAR VAIGGI VAIRLL VALQAL VFAGGI

RFLQVA VAAAAI VAAQDR VAFGIA VAFRLL VAGQAV VAIGGL VAIRLR VALQAR VFAGGL

RFLRGA VAAAAL VAAQDV VAFGII VAFRLR VAGQDA VAIGGR VAIRLV VALQAV VFAGGR

RGAAAR VAAAAR VAAQGA VAFGIL VAFRLV VAGQDI VAIGGV VAIRVA VALQDA VFAGGV

RGAADI VAAAAV VAAQGI VAFGIR VAFRVA VAGQDL VAIGIA VAIRVI VALQDI VFAGIA

RGAAII VAAADA VAAQGL VAFGIV VAFRVI VAGQDR VAIGIL VAIRVL VALQDL VFAGII

RGAAIV VAAADI VAAQGR VAFGLA VAFRVL VAGQDV VAIGIR VAIRVR VALQDR VFAGIL

RGAALI VAAADL VAAQGV VAFGLI VAFRVR VAGQGA VAIGIV VAIRVV VALQDV VFAGIR

RGAALV VAAADR VAAQIA VAFGLL VAFRVV VAGQGI VAIGLA VALAAA VALQGA VFAGIV

RGAA I VAAADV VAAQII VAFGLR VAGAAA VAGQGL VAIGLI VALAAI VALQGI VFAGLA

RGAGDR VAAAGA VAAQIL VAFGLV VAGAAI VAGQGR VAIGLL VALAAL VALQGL VFAGLI

RGAKLI VAAAGI VAAQIR VAFGVA VAGAAL VAGQGV VAIGLR VALAAR VALQGR VFAGLL

RGAQAI VAAAGL VAAQIV VAFGVI VAGAAR VAGQIA VAIGLV VALAAV VALQGV VFAGLR

RGAQGV VAAAGR VAAQLA VAFGVL VAGAAV VAGQII VAIGVA VALADA VALQIA VFAGLV

RGAQLA VAAAGV VAAQLI VAFGVR VAGADA VAGQIL VAIGVI VALADI VALQII VFAGVA

RGAQVA VAAAIA VAAQLL VAFGVV VAGADI VAGQIR VAIGVL VALADL VALQIL VFAGVI

RGAQVI VAAAII VAAQLR VAFKAA VAGADL VAGQIV VAIGVR VALADR VALQIR VFAGVL

RGAQVR VAAAIL VAAQLV VAFKAI VAGADR VAGQLA VAIGVV VALADV VALQIV VFAGVR

RGARAV VAAAIR VAAQVA VAFKAL VAGADV VAGQLI VAIKAA VALAGA VALQLA VFAGVV

RGARDA VAAAIV VAAQVI VAFKAR VAGAGA VAGQLL VAIKAI VALAGI VALQLI VFAKAA

RGARDI VAAALA VAAQVL VAFKAV VAGAGI VAGQLR VAIKAL VALAGL VALQLR VFAKAI

RGFAAA VAAALI VAAQVR VAFKDA VAGAGL VAGQLV VAIKAR VALAGR VALQLV VFAKAL

RGFAAI VAAALL VAAQVV VAFKDI VAGAGR VAGQVA VAIKAV VALAGV VALQVA VFAKAR

RGFAAL VAAALR VAARAA VAFKDL VAGAG VAGQVI VAIKDA VALAIA VALQVI VFAKAV

RGFADI VAAALV VAARAI VAFKDR VAGAIA VAGQVL VAIKDI VALAII VALQVL VFAKDA

RGFAGV VAAAVA VAARAL VAFKDV VAGAII VAGQVR VAIKDL VALAIL VALQVR VFAKDI

RGFALI VAAA I VAARAR VAFKGA VAGAIL VAGQVV VAIKDR VALAIR VALQVV VFAKDL

RGFGAV VAAAVL VAARAV VAFKGI VAGAIR VAGRAA VAIKDV VALAIV VALRAA VFAKDR

RGFGDA VAAAVR VAARDA VAFKGL VAGAIV VAGRAI VAIKGA VALALA VALRAI VFAKDV

RGFGDR VAAAVV VAARDI VAFKGR VAGALA VAGRAL VAIKGI VALALI VALRAL VFAKGA

RGFGDV VAAGAA VAARDL VAFKGV VAGALI VAGRAR VAIKGL VALALR VALRAR VFAKGI

RGFG A VAAGAI VAARDR VAFKIA VAGALL VAGRAV VAIKGR VALALV VALRAV VFAKGL

RGFGVL VAAGAL VAARDV VAFKII VAGALR VAGRDA VAIKGV VALAVA VALRDA VFAKGR

RGFKIA VAAGAR VAARGA VAFKIL VAGALV VAGRDI VAIKIA VALAVI VALRDI VFAKGV

RGFKVR VAAGAV VAARGI VAFKIR VAGAVA VAGRDL VAIKIL VALAVL VALRDL VFAKIA

RGFQAR VAAGDA VAARGL VAFKIV VAGAVI VAGRDR VAIKIR VALAVR VALRDR VFAKII

RGFQIR VAAGDI VAARGR VAFKLA VAGAVL VAGRDV VAIKIV VALAVV VALRDV VFAKIL

RGFQLI VAAGDL VAARGV VAFKLI VAGAVR VAGRGA VAIKLA VALGAA VALRGA VFAKIR

RGFQLR VAAGDR VAARIA VAFKLL VAGAVV VAGRGI VAIKLI VALGAI VALRGI VFAKIV

RGFQLV VAAGDV VAARII VAFKLR VAGGAA VAGRGL VAIKLL VALGAL VALRGL VFAKLA

RGFQVR VAAGGA VAARIL VAFKLV VAGGAI VAGRGR VAIKLR VALGAR VALRGR VFAKLI

RGFRVV VAAGGI VAARIR VAFKVA VAGGAL VAGRGV VAIKLV VALGAV VALRGV VFAKLL

RGGADI VAAGGL VAARIV VAFKVI VAGGAR VAGRIA VAIKVA VALGDA VALRIA VFAKLR

RGGADR VAAGGR VAARLA VAFKVL VAGGAV VAGRII VAIKVI VALGDI VALRII VFAKLV

RGGKLA VAAGG VAARLI VAFKVR VAGGDA VAGRIL VAIKVL VALGDL VALRIL VFAKVA

RGGKVA VAAGIA VAARLL VAFKVV VAGGDI VAGRIR VAIKVR VALGDR VALRIR VFAKVI

RGGQIA VAAGII VAARLR VAFQAA VAGGDL VAGRIV VAIKVV VALGDV VALRIV VFAKVL

RGGQVI VAAGIL VAARLV VAFQAI VAGGDR VAGRLA VAIQAA VALGGA VALRLA VFAKVR

RGIAAI VAAGIR VAARVA VAFQAL VAGGDV VAGRLI VAIQAI VALGGI VALRLI VFAKVV

RGIAAV VAAGIV VAARVI VAFQAR VAGGIA VAGRLL VAIQAL VALGGL VALRLR VFAQAA

RGIADA VAAGLA VAARVL VAFQAV VAGGII VAGRLR VAIQAR VALGGR VALRLV VFAQAI

RGIAGV VAAGLI VAARVR VAFQDA VAGGIL VAGRLV VAIQAV VALGGV VALRVA VFAQAL

RGIGAA VAAGLL VAARVV VAFQDI VAGGIR VAGRVA VAIQDA VALGIA VALRVI VFAQAR

RGIGAV VAAGLR VAFAAA VAFQDL VAGGIV VAGRVI VAIQDI VALGII VALRVL VFAQAV

RGIGVA VAAGLV VAFAAI VAFQDR VAGGLA VAGRVL VAIQDL VALGIL VALRVR VFAQDA

RGIGVV VAAG A VAFAAL VAFQDV VAGGLI VAGRVR VAIQDR VALGIR VALRVV VFAQDI

RGIQGA VAAG I VAFAAR VAFQGA VAGGLL VAGRVV VAIQDV VALGIV VFAAAA VFAQDL

RGLAAI VAAG L VAFAAV VAFQGI VAGGLR VAIAAA VAIQGA VALGLA VFAAAI VFAQDR

RGLAAV VAAG R VAFADA VAFQGL VAGGLV VAIAAI VAIQGI VALGLI VFAAAL VFAQDV

RGLADA VAAG V VAFADI VAFQGR VAGGVA VAIAAL VAIQGL VALGLR VFAAAR VFAQGA

RGLAGV VAAKAA VAFADL VAFQGV VAGGVI VAIAAR VAIQGR VALGLV VFAAAV VFAQGI

RGLA L VAAKAI VAFADR VAFQIA VAGGVL VAIAAV VAIQGV VALGVA VFAADA VFAQGL

RGLGAA VAAKAL VAFADV VAFQII VAGGVR VAIADA VAIQIA VALGVI VFAADI VFAQGR

RGLGA VAAKAR VAFAGA VAFQIL VAGGVV VAIADI VAIQIL VALGVL VFAADL VFAQGV

RGLKAI VAAKAV VAFAGI VAFQIR VAGKAA VAIADL VAIQIR VALGVR VFAADR VFAQIA

RGLQDL VAAKDA VAFAGL VAFQIV VAGKAI VAIADR VAIQIV VALGVV VFAADV VFAQII

RGLQDR VAAKDI VAFAGR VAFQLA VAGKAL VAIADV VAIQLA VALKAA VFAAGA VFAQIL

RGLQGA VAAKDL VAFAGV VAFQLI VAGKAR VAIAGA VAIQLI VALKAI VFAAGI VFAQIR

RGLQ I VAAKDR VAFAIA VAFQLL VAGKAV VAIAGI VAIQLL VALKAL VFAAGL VFAQIV

RRAADI VAAKDV VAFAII VAFQLR VAGKDA VAIAGL VAIQLR VALKAR VFAAGR VFAQLA

RRAGLV VAAKGA VAFAIL VAFQLV VAGKDI VAIAGR VAIQLV VALKAV VFAAGV VFAQLI

RRAKVV VAAKGI VAFAIR VAFQVA VAGKDL VAIAGV VAIQVA VALKDA VFAAIA VFAQLL

RRAQAV VAAKGL VAFAIV VAFQVI VAGKDR VAIAIA VAIQVI VALKDI VFAAII VFAQLR

RRAQDI VAAKGR VAFALA VAFQVL VAGKDV VAIAIL VAIQVL VALKDL VFAAIL VFAQLV

RRAQLV VAAKGV VAFALI VAFQVR VAGKGA VAIAIR VAIQVR VALKDR VFAAIR VFAQVA

RRAQVV VAAKIA VAFALL VAFQVV VAGKGI VAIAIV VAIQVV VALKDV VFAAIV VFAQVI

RRFGAI VAAKII VAFALR VAFRAA VAGKGL VAIALA VAIRAA VALKGA VFAALA VFAQVL

RRFGGV VAAKIL VAFALV VAFRAI VAGKGR VAIALI VAIRAI VALKGI VFAALI VFAQVR

RRFKDL VAAKIR VAFAVA VAFRAL VAGKGV VAIALL VAIRAL VALKGL VFAALL VFAQVV

RRFQAA VAAKIV VAFAVI VAFRAR VAGKIA VAIALR VAIRAR VALKGR VFAALR VFARAA

RRFQGV VAAKLA VAFAVL VAFRAV VAGKII VAIALV VAIRAV VALKGV VFAALV VFARAI

RRGAAI VAAKLI VAFAVR VAFRDA VAGKIL VAIAVA VAIRDA VALKIA VFAAVA VFARAL VFARAR VFFKGA VFGAIL VFGQVV VFIKDR VFLAIR VFLQVV VGAKGL VGFAIV VGFRAI

VFARAV VFFKGI VFGAIR VFGRAA VFIKDV VFLAIV VFLRAA VGAKGR VGFALA VGFRAL

VFARDA VFFKGL VFGAIV VFGRAI VFIKGA VFLALA VFLRAI VGAKGV VGFALI VGFRAR

VFARDI VFFKGR VFGALA VFGRAL VFIKGI VFLALI VFLRAL VGAKIA VGFALL VGFRAV

VFARDL VFFKGV VFGALI VFGRAR VFIKGL VFLALR VFLRAR VGAKII VGFALR VGFRDA

VFARDR VFFKIA VFGALL VFGRAV VFIKGR VFLALV VFLRAV VGAKIL VGFALV VGFRDI

VFARDV VFFKII VFGALR VFGRDA VFIKGV VFLAVA VFLRDA VGAKIR VGFA A VGFRDL

VFARGA VFFKIL VFGALV VFGRDI VFIKIA VFLA I VFLRDI VGAKIV VGFA I VGFRDR

VFARGI VFFKIR VFGAVA VFGRDL VFIKIL VFLAVL VFLRDL VGAKLA VGFAVL VGFRDV

VFARGL VFFKIV VFGAVI VFGRDR VFIKIR VFLAVR VFLRDR VGAKLI VGFAVR VGFRGA

VFARGR VFFKLA VFGAVL VFGRDV VFIKIV VFLAVV VFLRDV VGAKLL VGFA V VGFRGI

VFARGV VFFKLI VFGAVR VFGRGA VFIKLA VFLGAA VFLRGA VGAKLR VGFGAA VGFRGL

VFARIA VFFKLL VFGAVV VFGRGI VFIKLI VFLGAI VFLRGI VGAKLV VGFGAI VGFRGR

VFARII VFFKLR VFGGAA VFGRGL VFIKLL VFLGAL VFLRGL VGAKVA VGFGAL VGFRGV

VFARIL VFFKLV VFGGAI VFGRGR VFIKLR VFLGAR VFLRGR VGAKVI VGFGAR VGFRIA

VFARIR VFFKVA VFGGAL VFGRGV VFIKLV VFLGAV VFLRGV VGAKVL VGFGAV VGFRII

VFARIV VFFKVI VFGGAR VFGRIA VFIKVA VFLGDA VFLRIA VGAKVR VGFGDA VGFRIL

VFARLA VFFKVL VFGGAV VFGRII VFIKVI VFLGDI VFLRII VGAKVV VGFGDI VGFRIR

VFARLI VFFKVR VFGGDA VFGRIL VFIKVL VFLGDL VFLRIL VGAQAA VGFGDL VGFRIV

VFARLL VFFKVV VFGGDI VFGRIR VFIKVR VFLGDR VFLRIR VGAQAI VGFGDR VGFRLA

VFARLR VFFQAA VFGGDL VFGRIV VFIKVV VFLGDV VFLRIV VGAQAL VGFGDV VGFRLI

VFARLV VFFQAI VFGGDR VFGRLA VFIQAA VFLGGA VFLRLA VGAQAR VGFGIA VGFRLL

VFARVA VFFQAL VFGGDV VFGRLI VFIQAI VFLGGI VFLRLI VGAQAV VGFGII VGFRLR

VFARVI VFFQAR VFGGIA VFGRLL VFIQAL VFLGGL VFLRLR VGAQDA VGFGIL VGFRLV

VFARVL VFFQAV VFGGII VFGRLR VFIQAR VFLGGR VFLRLV VGAQDI VGFGIR VGFRVA

VFARVR VFFQDA VFGGIL VFGRLV VFIQAV VFLGGV VFLRVA VGAQDL VGFGIV VGFRVI

VFARVV VFFQDI VFGGIR VFGRVA VFIQDA VFLGIA VFLRVI VGAQDR VGFGLA VGFRVL

VFFAAA VFFQDL VFGGIV VFGRVI VFIQDI VFLGII VFLRVL VGAQDV VGFGLI VGFRVR

VFFAAI VFFQDR VFGGLA VFGRVL VFIQDL VFLGIL VFLRVR VGAQGA VGFGLL VGFRVV

VFFAAL VFFQDV VFGGLI VFGRVR VFIQDR VFLGIR VFLRVV VGAQGI VGFGLR VGGAAA

VFFAAR VFFQGA VFGGLL VFGRVV VFIQDV VFLGIV VGAAAA VGAQGL VGFGLV VGGAAI

VFFAAV VFFQGI VFGGLR VFIAAA VFIQGA VFLGLA VGAAAI VGAQGR VGFGVA VGGAAL

VFFADA VFFQGL VFGGLV VFIAAI VFIQGI VFLGLI VGAAAL VGAQGV VGFG I VGGAAR

VFFADI VFFQGR VFGGVA VFIAAL VFIQGL VFLGLR VGAAAR VGAQIA VGFGVL VGGAAV

VFFADL VFFQGV VFGGVI VFIAAR VFIQGR VFLGLV VGAAAV VGAQII VGFGVR VGGADA

VFFADR VFFQIA VFGGVL VFIAAV VFIQGV VFLGVA VGAADA VGAQIL VGFGVV VGGADI

VFFADV VFFQII VFGGVR VFIADA VFIQIA VFLGVI VGAADI VGAQIR VGFKAA VGGADL

VFFAGA VFFQIL VFGGVV VFIADI VFIQIL VFLGVL VGAADL VGAQIV VGFKAI VGGADR

VFFAGI VFFQIR VFGKAA VFIADL VFIQIR VFLG R VGAADR VGAQLA VGFKAL VGGADV

VFFAGL VFFQIV VFGKAI VFIADR VFIQIV VFLGVV VGAADV VGAQLI VGFKAR VGGAIA

VFFAGR VFFQLA VFGKAL VFIADV VFIQLA VFLKAA VGAAGA VGAQLL VGFKAV VGGAII

VFFAGV VFFQLI VFGKAR VFIAGA VFIQLI VFLKAI VGAAGI VGAQLR VGFKDA VGGAIL

VFFAIA VFFQLL VFGKAV VFIAGI VFIQLL VFLKAL VGAAGL VGAQLV VGFKDI VGGAIR

VFFAII VFFQLR VFGKDA VFIAGL VFIQLR VFLKAR VGAAGR VGAQVA VGFKDL VGGAIV

VFFAIL VFFQLV VFGKDI VFIAGR VFIQLV VFLKAV VGAAG VGAQVI VGFKDR VGGALA

VFFAIR VFFQVA VFGKDL VFIAGV VFIQVA VFLKDA VGAAIA VGAQVL VGFKDV VGGALI

VFFAIV VFFQVI VFGKDR VFIAIA VFIQVI VFLKDI VGAAII VGAQVR VGFKGA VGGALL

VFFALA VFFQVL VFGKDV VFIAIL VFIQVL VFLKDL VGAAIL VGAQVV VGFKGI VGGALR

VFFALI VFFQVR VFGKGA VFIAIR VFIQVR VFLKDR VGAAIR VGARAA VGFKGL VGGALV

VFFALL VFFQVV VFGKGI VFIAIV VFIQVV VFLKDV VGAAIV VGARAI VGFKGR VGGA A

VFFALR VFFRAA VFGKGL VFIALA VFIRAA VFLKGA VGAALA VGARAL VGFKGV VGGAVI

VFFALV VFFRAI VFGKGR VFIALI VFIRAI VFLKGI VGAALI VGARAR VGFKIA VGGAVL

VFFAVA VFFRAL VFGKGV VFIALL VFIRAL VFLKGL VGAALL VGARAV VGFKII VGGAVR

VFFAVI VFFRAR VFGKIA VFIALR VFIRAR VFLKGR VGAALR VGARDA VGFKIL VGGAVV

VFFAVL VFFRAV VFGKII VFIALV VFIRAV VFLKGV VGAALV VGARDI VGFKIR VGGKAA

VFFAVR VFFRDA VFGKIL VFIAVA VFIRDA VFLKIA VGAAVA VGARDL VGFKIV VGGKAI

VFFAVV VFFRDI VFGKIR VFIA I VFIRDI VFLKII VGAA I VGARDR VGFKLA VGGKAL

VFFGAA VFFRDL VFGKIV VFIAVL VFIRDL VFLKIL VGAAVL VGARDV VGFKLI VGGKAR

VFFGAI VFFRDR VFGKLA VFIAVR VFIRDR VFLKIR VGAAVR VGARGA VGFKLL VGGKAV

VFFGAL VFFRDV VFGKLI VFIAVV VFIRDV VFLKIV VGAAVV VGARGI VGFKLR VGGKDA

VFFGAR VFFRGA VFGKLL VFIGAA VFIRGA VFLKLA VGAGAA VGARGL VGFKLV VGGKDI

VFFGAV VFFRGI VFGKLR VFIGAI VFIRGI VFLKLI VGAGAI VGARGR VGFKVA VGGKDL

VFFGDA VFFRGL VFGKLV VFIGAL VFIRGL VFLKLR VGAGAL VGARGV VGFKVI VGGKDR

VFFGDI VFFRGR VFGKVA VFIGAR VFIRGR VFLKLV VGAGAR VGARIA VGFKVL VGGKDV

VFFGDL VFFRGV VFGKVI VFIGAV VFIRGV VFLKVA VGAGAV VGARII VGFKVR VGGKIA

VFFGDR VFFRIA VFGKVL VFIGDA VFIRIA VFLKVI VGAGDA VGARIL VGFKVV VGGKII

VFFGDV VFFRII VFGKVR VFIGDI VFIRIL VFLKVL VGAGDI VGARIR VGFQAA VGGKIL

VFFGGA VFFRIL VFGKVV VFIGDL VFIRIR VFLKVR VGAGDL VGARIV VGFQAI VGGKIR

VFFGGI VFFRIR VFGQAA VFIGDR VFIRIV VFLKVV VGAGDR VGARLA VGFQAL VGGKIV

VFFGGL VFFRIV VFGQAI VFIGDV VFIRLA VFLQAA VGAGDV VGARLI VGFQAR VGGKLA

VFFGGR VFFRLA VFGQAL VFIGGA VFIRLI VFLQAI VGAGIA VGARLL VGFQAV VGGKLI

VFFGGV VFFRLI VFGQAR VFIGGI VFIRLL VFLQAL VGAGII VGARLR VGFQDA VGGKLL

VFFGIA VFFRLL VFGQAV VFIGGL VFIRLR VFLQAR VGAGIL VGARLV VGFQDI VGGKLR

VFFGII VFFRLR VFGQDA VFIGGR VFIRLV VFLQAV VGAGIR VGARVA VGFQDL VGGKLV

VFFGIL VFFRLV VFGQDI VFIGGV VFIRVA VFLQDA VGAGIV VGARVI VGFQDR VGGKVA

VFFGIR VFFRVA VFGQDL VFIGIA VFIR I VFLQDI VGAGLA VGARVL VGFQDV VGGKVI

VFFGIV VFFRVI VFGQDR VFIGIL VFIRVL VFLQDL VGAGLI VGARVR VGFQGA VGGKVL

VFFGLA VFFRVL VFGQDV VFIGIR VFIRVR VFLQDR VGAGLL VGARVV VGFQGI VGGKVR

VFFGLI VFFRVR VFGQGA VFIGIV VFIRVV VFLQDV VGAGLR VGFAAA VGFQGL VGGKVV

VFFGLL VFFRVV VFGQGI VFIGLA VFLAAA VFLQGA VGAGLV VGFAAI VGFQGR VGGQAA

VFFGLR VFGAAA VFGQGL VFIGLI VFLAAI VFLQGI VGAG A VGFAAL VGFQGV VGGQAI

VFFGLV VFGAAI VFGQGR VFIGLL VFLAAL VFLQGL VGAGVI VGFAAR VGFQIA VGGQAL

VFFGVA VFGAAL VFGQGV VFIGLR VFLAAR VFLQGR VGAGVL VGFAAV VGFQII VGGQAR

VFFGVI VFGAAR VFGQIA VFIGLV VFLAAV VFLQGV VGAGVR VG FAD A VGFQIL VGGQAV

VFFGVL VFGAAV VFGQII VFIGVA VFLADA VFLQIA VGAGVV VGFADI VGFQIR VGGQDA

VFFGVR VFGADA VFGQIL VFIGVI VFLADI VFLQII VGAKAA VGFADL VGFQIV VGGQDI

VFFGVV VFGADI VFGQIR VFIGVL VFLADL VFLQIL VGAKAI VGFADR VGFQLA VGGQDL

VFFKAA VFGADL VFGQIV VFIGVR VFLADR VFLQIR VGAKAL VGFAD VGFQLI VGGQDR

VFFKAI VFGADR VFGQLA VFIGVV VFLADV VFLQIV VGAKAR VGFAGA VGFQLL VGGQDV

VFFKAL VFGADV VFGQLI VFIKAA VFLAGA VFLQLA VGAKAV VGFAGI VGFQLR VGGQIA

VFFKAR VFGAGA VFGQLL VFIKAI VFLAGI VFLQLI VGAKDA VG FAG L VGFQLV VGGQII

VFFKAV VFGAGI VFGQLR VFIKAL VFLAGL VFLQLR VGAKDI VGFAGR VGFQVA VGGQIL

VFFKDA VFGAGL VFGQLV VFIKAR VFLAGR VFLQLV VGAKDL VGFAG VGFQ I VGGQIR

VFFKDI VFGAGR VFGQVA VFIKAV VFLAGV VFLQVA VGAKDR VGFAIA VGFQVL VGGQIV

VFFKDL VFGAG VFGQVI VFIKDA VFLAIA VFLQVI VGAKDV VGFAII VGFQVR VGGQLA

VFFKDR VFGAIA VFGQVL VFIKDI VFLAII VFLQVL VGAKGA VGFAIL VGFQVV VGGQLI

VFFKDV VFGAII VFGQVR VFIKDL VFLAIL VFLQVR VGAKGI VGFAIR VGFRAA VGGQLL VGGQLR VGIKGA VGLAIA VGLQLR VRAQDI VRFKGA VRGGAV VRIAIV VRLAGI

VGGQLV VGIKGI VGLAII VGLQLV VRAQDL VRFKGR VRGGDA VRIALA VRLAGL

VGGQVA VGIKGL VGLAIL VGLQVA VRAQGA VRFKGV VRGGDI VRIALL VRLAGR

VGGQVI VGIKGR VGLAIR VGLQ I VRAQGL VRFKIA VRGGDV VRIALR VRLAIA

VGGQVL VGIKGV VGLAIV VGLQVL VRAQGR VRFKII VRGGIA VRIAVA VRLAII

VGGQVR VGIKIA VGLALA VGLQVR VRAQIA VRFKIL VRGGIV VRIAVL VRLAIL

VGGQVV VGIKIL VGLALI VGLQVV VRAQII VRFKIR VRGGLA VRIGAA VRLAIR

VGGRAA VGIKIR VGLALR VGLRAA VRAQIL VRFKIV VRGGLV VRIGAI VRLAIV

VGGRAI VGIKIV VGLALV VGLRAI VRAQLA VRFKLA VRGGVA VRIGAL VRLALA

VGGRAL VGIKLA VGLAVA VGLRAL VRAQLI VRFKLI VRGGVI VRIGAR VRLALI

VGGRAR VGIKLI VGLA I VGLRAR VRAQLL VRFKLL VRGGVL VRIGAV VRLALV

VGGRAV VGIKLL VGLAVL VGLRAV VRAQVA VRFKLR VRGGVR VRIGDA VRLAVI

VGGRDA VGIKLR VGLAVR VGLRDA VRAQVL VRFKVI VRGGVV VRIGDI VRLAVL

VGGRDI VGIKLV VGLAVV VGLRDI VRAQVR VRFKVR VRGKAA VRIGDL VRLAVR

VGGRDL VGIKVA VGLGAA VGLRDL VRARAA VRFKVV VRGKAI VRIGDR VRLGAI

VGGRDR VGIKVI VGLGAI VGLRDR VRARAI VRFQAA VRGKAR VRIGDV VRLGAL

VGGRDV VGIKVL VGLGAL VGLRDV VRARAL VRFQAR VRGKDA VRIGGA VRLGAR

VGGRIA VGIKVR VGLGAR VGLRGA VRARAV VRFQAV VRGKDI VRIGGV VRLGAV

VGGRIV VGIKVV VGLGAV VGLRGV VRARDA VRFQDA VRGKDL VRIGIA VRLGDA

VGGRLA VGIQAA VGLGDA VGLRIA VRARDL VRFQDI VRGKGA VRIGIV VRLGDI

VGGRLV VGIQAI VGLGDI VGLRIV VRARDV VRFQDL VRGKGI VRIGLA VRLGDV

VGGRVA VGIQAL VGLGDL VGLRLA VRARGA VRFQDR VRGKGL VRIGVA VRLGGA

VGGRVI VGIQAR VGLGDR VGLRLV VRARGI VRFQDV VRGKGV VRIGVI VRLGGV

VGGRVL VGIQAV VGLGDV VGLRVA VRARGL VRFQGA VRGKII VRIGVL VRLGIV

VGGRVR VGIQDA VGLGIA VGLRVI VRARGV VRFQGV VRGKIL VRIGVV VRLGLA

VGGRVV VGIQDI VGLGIV VGLRVL VRARII VRFQII VRGKIR VRIKAA VRLGLV

VGIAAA VGIQDL VGLGLA VGLRVR VRARIL VRFQIL VRGKIV VRIKAL VRLKAL

VGIAAI VGIQDR VGLGLV VGLRVV VRARIV VRFQIR VRGKLA VRIKAR VRLKAV

VGIAAL VGIQDV VGLGVA VRAAAA VRARLA VRFQIV VRGKLI VRIKDA VRLKDA

VGIAAR VGIQGA VGLGVI VRAAAI VRARLI VRFQLA VRGKLL VRIKDI VRLKDI

VGIAAV VGIQGI VGLGVL VRAAAR VRARLL VRFQLL VRGKLR VRIKDR VRLKDL

VGIADA VGIQGL VGLGVR VRAADA VRARLV VRFQLR VRGKLV VRIKDV VRLKDR

VGIADI VGIQGR VGLGVV VRAADI VRARVA VRFQLV VRGKVI VRIKGL VRLKDV

VGIADL VGIQGV VGLKAA VRAADL VRARVI VRFQVA VRGKVL VRIKGR VRLKGA

VGIADR VGIQIA VGLKAI VRAADR VRARVL VRFQVL VRGKVR VRIKIA VRLKGI

VGIADV VGIQIL VGLKAL VRAADV VRARVV VRFQVR VRGQAA VRIKIL VRLKGL

VGIAGA VGIQIR VGLKAR VRAAGI VRFAAA VRFQVV VRGQAL VRIKLA VRLKGR

VGIAGI VGIQIV VGLKAV VRAAGL VRFAAI VRFRAA VRGQAR VRIKLI VRLKIA

VGIAGL VGIQLA VGLKDA VRAAIA VRFAAL VRFRAI VRGQAV VRIKLL VRLKII

VGIAGR VGIQLI VGLKDI VRAAIV VRFAAR VRFRAL VRGQDA VRIKLR VRLKIL

VGIAGV VGIQLL VGLKDL VRAALA VRFAAV VRFRAV VRGQDL VRIKLV VRLKIR

VGIAIA VGIQLR VGLKDR VRAAVA VRFADA VRFRDA VRGQGI VRIKVA VRLKLA

VGIAIL VGIQLV VGLKDV VRAA I VRFADI VRFRDI VRGQGL VRIKVI VRLKLI

VGIAIR VGIQVA VGLKGA VRAAVL VRFADV VRFRDL VRGQGR VRIKVL VRLKLR

VGIAIV VGIQVI VGLKGI VRAGAI VRFAGA VRFRDV VRGQGV VRIKVR VRLKLV

VGIALA VGIQVL VGLKGL VRAGAR VRFAGI VRFRGA VRGQII VRIKVV VRLKVL

VGIALI VGIQVR VGLKGR VRAGDA VRFAGL VRFRGI VRGQIL VRIQAI VRLKVR

VGIALL VGIQVV VGLKGV VRAGDI VRFAGR VRFRGL VRGQIV VRIQAL VRLQAI

VGIALR VGIRAA VGLKIA VRAGDR VRFAIA VRFRGV VRGQLA VRIQDA VRLQAL

VGIALV VGIRAI VGLKII VRAGGI VRFAII VRFRIA VRGQLL VRIQDI VRLQAR

VGIAVA VGIRAL VGLKIL VRAGGL VRFAIL VRFRII VRGQLV VRIQDL VRLQAV

VGIA I VGIRAR VGLKIR VRAGGR VRFAIR VRFRIL VRGQVA VRIQDR VRLQDI

VGIAVL VGIRAV VGLKIV VRAGGV VRFAIV VRFRLA VRGQVI VRIQDV VRLQDL

VGIAVR VGIRDA VGLKLA VRAGIA VRFALA VRFRLI VRGQVL VRIQGL VRLQDV

VGIAVV VGIRDI VGLKLI VRAGLA VRFALI VRFRLL VRGQVR VRIQGV VRLQGA

VGIGAA VGIRDL VGLKLR VRAGLI VRFALL VRFRVA VRGQVV VRIQIL VRLQGL

VGIGAI VGIRDR VGLKLV VRAGLV VRFALR VRFRVI VRGRAA VRIQIR VRLQGR

VGIGAL VGIRDV VGLKVA VRAGVL VRFALV VRFRVL VRGRAI VRIQLA VRLQGV

VGIGAR VGIRGA VGLKVI VRAGVR VRFAVI VRFRVV VRGRAL VRIQLL VRLQII

VGIGAV VGIRGV VGLKVL VRAGVV VRFAVL VRGAAA VRGRAV VRIQLR VRLQIL

VGIGDA VGIRIA VGLKVR VRAKAA VRFAVV VRGAAI VRGRDA VRIQLV VRLQIR

VGIGDI VGIRIV VGLKVV VRAKAR VRFGAA VRGAAR VRGRDI VRIQVI VRLQLA

VGIGDL VGIRLA VGLQAA VRAKAV VRFGAI VRGADI VRGRDL VRIQVL VRLQLI

VGIGDR VGIRLV VGLQAI VRAKDA VRFGAL VRGADL VRGRDV VRIQVR VRLQLR

VGIGDV VGIRVA VGLQAL VRAKDI VRFGDA VRGADR VRGRGA VRIQVV VRLQVA

VGIGIA VGIRVI VGLQAR VRAKDR VRFGDI VRGADV VRGRGV VRIRAA VRLQVI

VGIGIV VGIRVL VGLQAV VRAKGA VRFGDL VRGAGA VRGRIA VRIRAI VRLQVL

VGIGLA VGIRVR VGLQDA VRAKGI VRFGGA VRGAGI VRGRIV VRIRAL VRLQVR

VGIGLV VGIRVV VGLQDI VRAKGR VRFGGI VRGAGL VRGRLA VRIRAV VRLQVV

VGIGVA VGLAAA VGLQDL VRAKG VRFGGL VRGAGR VRGRVA VRIRDA VRLRAI

VGIGVI VGLAAI VGLQDR VRAKII VRFGGV VRGAG VRGRVI VRIRDI VRLRAL

VGIGVL VGLAAL VGLQDV VRAKIR VRFGII VRGAIA VRGRVL VRIRDL VRLRAV

VGIGVR VGLAAR VGLQGA VRAKIV VRFGIL VRGAII VRGRVV VRIRDV VRLRDA

VGIGVV VGLAAV VGLQGI VRAKLI VRFGLL VRGAIL VRIAAA VRIRGA VRLRDI

VGIKAA VGLADA VGLQGL VRAKLR VRFGLV VRGAIV VRIADA VRIRIA VRLRDL

VGIKAI VGLADI VGLQGR VRAKLV VRFGVL VRGALA VRIADL VRIRLA VRLRDV

VGIKAL VGLADL VGLQGV VRAKVA VRFGVV VRGALI VRIADR VRIRVA VRLRGA

VGIKAR VGLADR VGLQIA VRAKVL VRFKAI VRGALV VRIAGA VRIRVI VRLRGV

VGIKAV VGLADV VGLQII VRAKVR VRFKAL VRGAVI VRIAGL VRIRVL VRLRIA

VGIKDA VGLAGA VGLQIL VRAQAA VRFKAR VRGAVL VRIAGR VRLAAA VRLRLA

VGIKDI VGLAGI VGLQIR VRAQAI VRFKDA VRGAVR VRIAGV VRLAAR VRLRLV

VGIKDL VGLAGL VGLQIV VRAQAL VRFKDI VRGAVV VRIAIA VRLAAV VRLRVA

VGIKDR VGLAGR VGLQLA VRAQAV VRFKDL VRGGAA VRIAIL VRLADA VRLRVI

VGIKDV VGLAG VGLQLI VRAQDA VRFKDV VRGGAL VRIAIR VRLADL VRLRVL