FIELD OF INVENTION

[0001 ]The present invention relates generally to the administration of a TNF-a inhibitor, preferably a dominant negative inhibitor of soluble TNF-a for the prevention or treatment of symptoms associated with stroke.

BACKGROUND OF THE INVENTION

[0002] Stroke is a leading cause of death and disability and a growing problem to global healthcare. In the US alone, over 700,000 people per year suffer a major stroke. Even more disturbing, this already troubling situation is expected to worsen as the "baby boomer" population reaches advanced age. Of those who survive a stroke, approximately 90% will have long-term impairment of movement, sensation, memory or reasoning, ranging from mild to severe. The total cost to the US healthcare system is estimated to be over $50 billion per year. Strokes may be caused by a rupture of a cerebral artery ("hemorrhagic stroke") or a blockage in a cerebral artery due to a thromboembolism ("ischemic stroke").

[0003]Currently, ischemic stroke treatment may be accomplished via pharmacological elimination of the thromboembolism and/or mechanical elimination of the thromboembolism. Pharmacological elimination may be accomplished via the administration of thombolytics (e.g., streptokinase, urokinase, tissue plasminogen activator (TPA» and/or anticoagulant drugs (e.g., heparin, warfarin) designed to dissolve and prevent further growth of the thromboembolism. Pharmacologic treatment is non-invasive and generally effective in dissolving the

thromboembolism. Notwithstanding this, significant drawbacks exist with the use of current treatments.

SUMMARY OF INVENTION

In contrast to the prior art, principles of the present disclosure provide a method of treating stroke or symptoms associated with stroke or focal cerebral ischemia comprising administering a therapeutically effective amount of a dominant negative TNF-a inhibitor to a subject in need thereof, whereby said symptoms are improved in said subject. In some embodiment, the dominant negative inhibitor is XProl595. Phrased in another way, the present disclosure is directed to a method of treating stroke and/or symptoms associated with stroke by

administration to a subject in need thereof a DN-TNF polypeptide that inhibits the activity of soluble TNF- but not transmembrane TNF-a.

BRIEF DESCRIPTION OF THE DRAWINGS

[0004]FIG. 1A shows the nucleic acid sequence of human TNF-a (SEQ ID NO: 1). An additional six histidine codons, located between the start codon and the first amino acid, are underlined.

[0005JFIG. IB shows the amino acid sequence of human TNF-a (SEQ ID NO: 2) with an additional 6 histidines (underlined) between the start codon and the first amino acid. Amino acids changed in exemplary TNF-a variants are shown in bold.

[0006]FIG. 2 shows the positions and amino acid changes in certain TNF-a variants.

[0007]FIG. 3 Genetic ablation of soluble TNF does not change microglial cell density and morphology or behavioral phenotype under naive conditions. (A,B) To assess exploratory behavior, the total number of arm entries in the Y-maze (A) and spontaneous alternation (B) were measured. (C-E) To assess spontaneous locomotor activity and anxiety-related behavior, total distance travelled (C), center/perimeter ratio (D) and number of rearings (vertical activity) (E) were measured in the open field. (F,G) Motor coordination was assessed with the rotarod test (F) and strength was measured by grip strength analysis (G). No differences were observed between groups (Student's t-test, n = 5-15 mice/group). (H) Representative

immunohistochemical photomicrographs of Ibal+ cells in the cingulate gyrus of the neocortex (upper panel) and magnifications of Ibal+ microglia in the neocortex (lower panel). (I,J) Quantification of the number of Ibal+ microglial cells/area in the neocortex of naive mTNFwt/wt and mTNFA/A mice (I) and quantification of the neocortical volume of naive mTNFwt/wt and mTNFA/A mice (J) showed no significant differences between groups

(Student's t-test, n = 6 mice/group). Scale bars: 10 μπι. Results are expressed as mean ± SEM.

[0008] FIG. 4 Genetic ablation of solTNF reduces infarct volumes after pMCAO with no changes in locomotor- activity and anxiety-related behaviors assessed in the open field test. (A) Toluidine blue staining of brain sections from mTNFwt/wt and mTNFA/A 1 and 5 days after pMCAO. Ctx, cortex; IF, infarct; Str, striatum.

[0009](B) Estimation of cortical infarct volume in mTNFA/A mice and mTNFwt/wt littermates showed significantly decreased infarct volumes both at 1 and 5 days after surgery (*p < 0.05, one-tailed Student's t-test, n = 7-18 mice/group). (C-E) The open field test was conducted on mTNFA/A mice and TNFwt/wt littermates 2 days after pMCAO. Locomotor and stress-related behavior were measured as total distance traveled (C), center/perimeter ratio (D), and number of rearings (E). Results are expressed as mean ± SEM (n = 8-9 mice/group). No significant differences were measured between groups, Student's t-test. 170x223mm (300 x 300 DPI).

[0010] FIG. 5 Rung walk, rotarod and grip strength assessments of mTNFA/A and mTNFwt/wt mice after pMCAO. Motor coordination and asymmetry by rung walk analysis was assessed 2 days after pMCAO and expressed as total number of missteps of the contralateral, right front limb compared to the unaffected left limb (paired Student's t-test) (A). Motor coordination with the rotarod test was assessed 3 and 5 days after pMCAO as time spent on the rod (Student's t- test) (B). Neuromuscular function was measured by grip strength analysis and expressed as Δ grip strength (change from baseline grip strength) (paired Student's t- test) (C). Results are expressed as mean ± SEM (n = 6-15 mice/group). *p<0.05. 134x171mm (300 x 300 DPI)

[0011] FIG. 6 Gene expression profiling 1 day following pCMAO. Differential gene expression was evaluated 1 day after pMCAO in mTNFwt/wt and mTNFA/A mice, and compared to corresponding sham and naive mice brain tissue expression. For each gene, results are expressed as percent of WT ± SEM after normalization to β-tubulin gene expression (n = 5-6 mice/group). *p<0.05 one-way ANOVA, Tukey test; ^A p<0.05, Student's t test. 151x158mm (300 x 300 DPI)

[0012] FIG. 7 Protein expression analysis 1 day after pCMAO. Western blot quantification of TNFRl, MBP and MAG in the brain of naive, sham and pCMAO mice. Results are expressed as mean ± SEM (n = 6 mice/group). *p<0.05 and **p<0.005, Student's t-test. 152x66mm (300 x 300 DPI)

[0013] FIG 8 Systemic anti-TNF therapy does not affect infarct volume after focal cerebral ischemia. (A) Toluidine blue staining of brain sections from mice treated with either saline, XProl 595 or etanercept and allowed either 6h, 24h or 5d survival. IF, infarct; Str, striatum. Scale bar: 1 mm. (B) Direct infarct volume measurements showed no difference in infarct volumes between saline-, XProl 595- and etancercept-treated mice at either 6h (n = 8-15/group), 24h (n = 15/group) or 5d (n = 14-17/group) (One-Way ANOVA). A significant drop in infarct size was observed in all three groups 5d after pMCAO compared to 6h and 24h (*P < 0.05, **P < 0.01).

[0014] FIG 9 Anti-TNF therapy improves functional outcomes after focal cerebral ischemia. (A) Neuromuscular function presented as grip strength (g), showing post-surgical weakness in both left and right front paws in saline- and XPro 1595 -treated mice 3 and 5d after pMCAO compared to baseline grip strength. Etanercept-treated mice showed no loss of grip strength on the left paw but a significant reduction in grip strength 3 and 5d after pMCAO. (B) Grip strength analysis at 24h after pMCAO showed that asymmetry (Δ grip strength) was evident in saline- treated mice (***P < 0.001, paired t test) and to a lesser extent in XProl 595-treated mice (*P < 0.05), but no asymmetry was observed in etanercept-treated or sham mice (n = 6-14/group)(left graph). Grip strength analysis at 5d showed that asymmetry was still present in saline-treated mice (*P < 0.05) but not in sham, XProl 595- and etanercept-treated mice (n = 13-17/group)(right graph). (C) The horizontal rod test showed that only saline-treated mice displayed asymmetry both 24h (left graph) and 5d (right graph) after pMCAO as saline-treated mice displayed significantly more slips on the right hind limb compared to their left left limb after pMCAO (**P< 0.01, paired t test), whereas sham, XProl 595- and etanercept-treated mice did not display any asymmetry (n = 6-17/group). (D) Assessment of motor function using the rotarod test showed that saline-treated mice subjected to focal cerebral ischemia did not display normal learning skills at 24h (left graph) and 5d (right graph) whereas both XProl 595- and etanercept-treated mice displayed normal learning skills (T1 -T4) both at 24h and 5d, comparable to sham mice (One-way ANOVA, n = 5-6/group). L, left; R, right; T, trial.

[0015] FIG. 10 Analysis of brain microglial and macrophage responses after anti-TNF therapy.

[0016](A) Gating strategy showing that a FSC/SSC dot plot was used to define Gate 1 comprising leukocytes, monocytes and granolocytes. Hereafter, Gate 2 was defined to include singlet cells using a FSC-A/FSC-H dot plot, and Gate 3 to ensure that only live cells were included in the further analysis. Flow cytometry dot plots examples showing granolocytes as CD45highGrl+. The microglia population as CD45dimCDl lb+ and macrophages

CD45highCDl lb+ both not expressing Grl . (B) Flow cytometry analysis of

CD1 lb+CD45dimGrl- microglia (upper left graph) after pMCAO showed that the number of microglia was significantly increased at 6h and 24h in saline-, Xprol595- and etanercept-treated mice compared to the respective unlesioned control mice. In addition, the number of microglia was significantly increased in XProl 595-treated mice compared to saline-treated mice at 24h after pMCAO. Furthermore, MFI for CD45 in microglia (lower left graph) was significantly increased at 24h in XProl 595- and etanercept-treated mice compared to saline-treated mice. Flow cytometry analysis of CD1 lb+CD45high leukocytes (upper right graph) showed a significant increase in the number of infiltrating leukocytes in all treatment groups at 24h compared to unlesioned control mice. No change in MFI for CD45 in leukocytes (lower right graph) was observed. Note that the number of microglia at all time points was significantly higher than the number of leukocytes at all time points (compare cell numbers in upper left graph with upper right graph) (n = 4-6/group). (C) Representative photomicrographs of CD1 lb- immunostained sections 6h, 24h and 5d after pMCAO. The distribution of CD1 lb+ cells appeared to be similar in saline-, XProl 595- and etanercept-treated mice at all three time points investigated (shown for saline-treated mice only). Scale bar: 100 μπι. cc: corpus callosum, IF: infarct. (D) Brain CD1 lb and iNOS mRNA levels, analysed by qPCR, showed that anti-TNF therapy did not affect CD1 lb or iNOS mRNA levels in the brain after pMCAO. Brain IL-1 β mRNA levels were found to be significantly increased at 24h in etanercept-treated mice, compared to 6h and 5d and compared to saline- and XPro 1595 -treated mice at 24h. Argl mRNA levels were found to be significantly increased in saline-treated mice at 24h compared to 6h and 5d and in XProl 595-treated mice at 24h compared to 5d. IL-10 mRNA levels were found to be significantly decreased in XProl 595-treated mice 24h and 5d after pMCAO compared to 6h. (One-way ANOVA, n = 4-6/group). (*P < 0.05, **P < 001).

[0017] FIG 11 Liver and brain TNF expression following anti-TNF therapy. (A) TNF mRNA+ cells (arrows) were located in the infarct and peri-infarct at 6h, 24h and 5d after pMCAO (shown for saline-treated mice). Scale bar: 30 μπι. qPCR analysis showed that brain TNF mRNA levels increased transiently at 24h but with no differences between saline-, XProl 595, and etanercept- treated mice (n = 4-6/group). (B) A few TNF mRNA+ cells were located in the liver preferentially at 6h (shown for saline-treated mouse) but also to some extent in etanercept- treated mice at 24h (shown for etanercept-treated mouse). Scale bar: 30 μηι. qPCR analysis showed that liver TNF mRNA levels were significantly decreased in saline-treated mice at 24h compared to 6h and in XProl 595-treated mice at 24h compared to 6h and 5d (*P < 0.05, **P < 0.01, n = 3- 6/group). (C) TNF staining of sections from ischemic saline-treated mice that had survived 6h (inserts), 24h and 5d after pMCAO. At 6h, TNF protein was present in all mice; however, expression was less in XProl 595- and etanercept-treated mice. At 24h and 5d TNF protein expression was localized to cells located in the infarct and in the peri-infarct (left panel: shown in low magnification for 24h) and cells displayed microglial/leukocyte morphology (high magnifications). Scale bars = 200 μπι (low magnifications) and 20 μπι (high magnifications). (D) Semi-quantitative analysis of western blotting analysis for TNF levels 6h and 24h after pMCAO demonstrating reduced TNF levels at 6h in XProl 595- (27.9% ± 3.3%) and etanercept- treated (16.2% ± 2.3%) mice compared to saline-treated mice (100% ± 1.3%)(***P < 0.001, One-way ANOVA, followed by Bonferroni post-test). At 24h, TNF protein levels were comparable in saline- (100% ± 50.3%), XProl595- (102.7% ± 3.4%) and etanercept-treated (93.2% ± 20.4%) mice (rTNF: murine recombinant TNF). (E) Flow cytometry profiles gated on CD1 lb+CD45+ cells showing primarily microglial TNF expression in the ischemic cortex 24h after pMCAO (upper panel). Estimation of the number of TNF+ microglia (upper panel) showed that the number of TNF+ microglia increased significantly over time with significantly more TNF+ microglia at 24h in saline- and XProl 595-treated mice compared to unlesioned control mice. In etanercept-treated mice, the number of TNF+ microglia increased significantly already at 6h compared to unlesioned control mice. TNF+ macrophages and TNF+ granluocytes (lower panel) were only present at 24h after pMCAO and were very low in numbers compared to

TNF+ microglia. There were no differences between treatment groups, (n = 4-6/group, **P < 0.01; ****P < 0.0001).

[0018] FIG 12 The effect of anti-TNF therapy on the number of granulocytes in the infarct. (A) Representative photomicrographs of TB-stained brain sections from saline-, XProl 595-, and etanercept-treated mice allowed 24h survival after focal cerebral ischemia demonstrating infiltration of polymorphonucleated cells into the ischemic infarct. Colocalization of polymorphonucleated cells in TB-stained sections with a granulocyte (Grl) marker was verified using immunohistochemistry in saline-treated mice allowed 24h survival. Scale bars: left 30 μηι and right 10 μηι. (B) Estimation of the number of infiltrating polymorphonucleated cells per mm2 within the infarct showed a significantly increased number of cells in saline-treated mice (58.6 ± 14.1 granulocytes/mm2) compared to XProl595-treated mice (17.4 ± 3.0

granulocytes/mm2) 24h after ischemia (*P < 0.05, One-way ANOVA, followed by Bonfferoni post-test; n = 4-8/group). (C) Flow cytometry analysis of the number of infiltrating

CD1 lb+CD45highGrl+ cells in the ipsilateral neocortex in unlesioned control mice and 6h and 24h hours after pMCAO showing a significant increase in the total number of infiltrating granulocytes in saline-, XProl 595- and etancercept-treated mice at 24h compared to unlesioned control mice. No difference between treatment groups was observed (n 4-6/group).

[0019] FIG 13 The effect of anti-TNF on the APR after focal cerebral ischemia. (A-D) Changes in liver (A) CXCL10, CXCL1 CCL2, IL-1 β, SAA2 and SAP mRNA levels in saline-,

XProl595- and etanercept-treated mice 6h, 24h and 5d after pMCAO. (*P < 0.05, **P < 0.01, One-way ANOVA followed by Bonferroni post-test, n = 3-6/group). In all experiments, data were normalized to a sham group with a mean value of 1. Scale bar: 30 μπι. (B) Flow cytometry analysis of spleen samples 6h and 24h after pMCAO showing a decrease in numbers of T cells (CD45+CD3+) in XProl 595- and etanercept-treated mice 24h after pMCAO compared to unlesioned control mice. At 24h, the number of T cells were decreased in etanercept-treated mice compared to saline-treated mice. The number of monocytes (CD1 lb+CD45highGrl-) was found to change significantly only in XProl 595-treated mice with at significant increase at 6h and a significant decrease at 24h compared to unlesioned XProl 595-treated mice. No change was found in saline- and etanercept-treated mice. The number of granuloctes

(CD1 lb+CD45highGrl+) was found to increase significantly at 6h in all groups compared to unlesioned control mice and to significantly decrease at 24h in saline- and XProl 595-treated mice at 24h compared to unlesioned control mice. (C) Flow cytometry analysis of blood samples showed that the number of T cells significantly increased at 6h in saline-treated, but not in Xprol595- and etanercept- treated, mice compared to unlesioned control mice. Furthermore, the total number of T cells was significantly increased in saline-treated mice compared to XProl595- and etanercept-treated mice at 6h. At 24h, the total number of T cells were significantly decreased in all treatment groups. No change was observed at any time point in blood monocytes. The number of granulocytes were found to be significantly increased in the blood in saline-treated mice 6h after pMCAO compared to unlesioned control mice but also compared to XProl595- and etanercept- treated mice with 6h survival. (*P < 0.05, n = 4- 6/group)

[0020]FIG. 14 The effect of anti-TNF therapy on microvesicle counts and size. (A) Estimations of the total numbers of microvesicles after focal cerebral ischemia showing altered counts with anti- TNF therapy. (B) Estimation of the mean diameter of microvesicles after focal cerebral ischemia.

[0021 ](C) Correlation analysis of the total count of microvesicles and the infarct size at 6h (top), 24h (middle) and 5d (bottom) after focal cerebral ischemia showing a significant correlation in saline-treated mice at 24h. Area fill for 24h is shown in grey. (*P < 0.05; **P < 0.01; ***P < 0.001, ****p < 0.0001, Pearson r correlation analysis and One-way ANOVA, followed by Bonferroni post-test; n = 3-24/group).

[0022]Figure 15 shows thermal stimulation using the Hargreave's test, showing a significant increase in latency time to withdraw paws between in saline-treated mice probably as a consequence of increased injury in the ipsilateral sensory cortex. In contrast, XProl 595-treated mice showed a decrease in latency time, whereas etanercept-treated mice showed no change (*P <0.05).

DETAILED DESCRD7TION

[0023] Although significant efforts to identify effective therapies for the treatment of symptoms associated with or caused by stroke have been undertaken, to date there is a dearth of such therapies. As such, there is a significant need to develop effective therapies to prevent or treat symptoms associated with stroke. [0024]An aspect of the invention relates to a method of treating and/or preventing symptoms associated with stroke comprising administering a therapeutically effective amount of a dominant negative TNF-a inhibitor to a subject in need thereof, whereby said symptoms are improved in said subject.

[0025]In an embodiment, the said administering comprises administration of a DN-TNF polypeptide.

[0026] In an embodiment, said dominant negative TNF-a inhibitor comprises a variant sequence relative to wild-type TNF-a.

[0027]In an embodiment, said dominant negative TNF-a inhibitor inhibits soluble TNF-a but does not inhibit signaling by transmembrane TNF-a.

[0028]In an embodiment, said variant comprises the amino acid substitutions A145R/I97T or VI M/R31 C/C69V/Y87H/C 101 /A 145R.

[0029]In an embodiment, said dominant negative TNF-a inhibitor is PEGylated.

[0030]In an embodiment, said dominant negative TNF-a inhibitor is XProl595.

[0031]In an embodiment, said symptoms are selected from the group consisting of sensory- motor functions including numbness, weakness or paralysis in the face, arm or leg, especially on one side of the body, loss of balance and/or coordination, speech, vision and cognitive functions including impairment in learning and memory.

[0032]In an embodiment, said administering comprises intraventricular injection, epidural injection, oral administration, intravenous administration and/or topical administration.

[0033]In an embodiment, said symptoms are improved to a greater extent when said dominant negative TNF-a inhibitor, than when a non-selective inhibitor of TNF- a is administered.

[0034]In an embodiment, said stroke is ischemic and/or hemorrhagic stroke.

[0035]In an aspect, the invention relates to a the method of treating and/or preventing stroke comprising administering a therapeutically effective amount of a dominant negative TNF-a inhibitor to a subject. [0036] In another aspect, the invention relates to a dominant negative TNF-a inhibitor for use in the treatment and/or prevention of symptoms associated with stroke.

[0037]In an embodiment, said dominant negative TNF-a inhibitor is a DN-TNF polypeptide.

[0038]In an embodiment, said dominant negative TNF-a inhibitor comprises a variant sequence relative to wild-type TNF-a.

[0039]In an embodiment, said dominant negative TNF-a inhibitor inhibits soluble TNF-a but does not inhibit signaling by transmembrane TNF-a.

[0040]In an embodiment, said dominant negative TNF-a inhibitor inhibits soluble TNF-a but does not inhibit signaling by transmembrane TNF-a.

[0041 ]In an embodiment, said variant comprises the amino acid substitutions Al 45R/I97T or VI M/R31 C/C69V/Y87H/C 101 /A 145R.

[0042 ]In an embodiment, said dominant negative TNF-a inhibitor is PEGylated.

[0043 ]In an embodiment, said dominant negative TNF-a inhibitor is XProl595.

[0044 ]In an embodiment, said symptoms are selected from the group consisting of sensory- motor functions including numbness, weakness or paralysis in the face, arm or leg, especially on one side of the body, loss of balance and/or coordination, speech, vision and cognitive functions including impairment in learning and memory.

[0045]In an embodiment, said inhibitor is administered by a route selected from the group consisting of intraventricular injection, epidural injection, oral administration, intravenous administration and/or topical administration.

[0046]In an embodiment, wherein symptoms are improved to a greater extent when said dominant negative TNF-a inhibitor, than when a non-selective inhibitor of TNF- a is administered.

[0047]In an embodiment, said stroke is ischemic and/or hemorrhagic stroke.

[0048]In an aspect, the invention relates to a composition comprising a dominant negative TNF- α inhibitor according to the invention. [0049]In an aspect, the invention relates to a dominant negative TNF-a inhibitor for use in the treatment and/or prevention of stroke. In an embodiment, said stroke is ischemic and/or hemorrhagic stroke.

[0050]One such strategy is described herein. Tumor necrosis factor (TNF) is a pleiotropic cytokine important in the regulation of numerous physiological and pathological processes such as inflammation, autoimmunity, neurodegeneration, neuroprotection, demyelination and remyelination. There are two active forms of TNF, soluble-TNF (solTNF) and transmembrane- TNF (tmTNF) whose biological responses are primarily mediated by two distinct receptors TNFRl and TNFR2, respectively. TNFRl has a death domain and signaling through this receptor has been implicated in both neuronal and oligodendrocyte death whereas signaling through TNFR2 has been implicated in neuroprotection and remyelination. It has recently been demonstrated that systemic delivery of a selective inhibitor of solTNF, XProl595, which binds solTNF forming inactive heterodimers, significantly improves functional recovery, reduces axonal damage and promotes remyelination in experimental autoimmune encephalomyelitis (EAE), an animal model of multiple sclerosis. In contrast, inhibition of solTNF and tmTNF with the non-specific TNF inhibitor, etanercept (decoy TNFR2 which blocks solTNF, tmTNF and lymphotoxin), proved neither therapeutic nor neuroprotective in EAE.

[0051]Moreover, as disclosed herein, treatment with TNF inhibitors effectively improved functional outcome in a stroke model. In some embodiments, selective soluble TNF- a inhibitors and non-selective TNF- a inhibitors both improved functional outcome in a stroke model. In some embodiments, however, the two classes of inhibitors provided for differential effects and functional outcomes in the stroke model. - In one embodiment, no increase in TNF producing microglia at 6 hours after (experimental) stroke (Figure 4E, Clausen et al., in press).

- In another embodiment, significant reduction in the number of infiltrating granulocytes/mm ² in the ischemic infarct at 24 hours (Figure 5B, Clausen et al., in press).

- In a further embodiment, no increase in liver CXCL10 mRNA levels at 24 hours after

(experimental) stroke, no significant decrease in CXCL1 mRNA levels at 6 hours, and no change in SAA2 mRNA levels (Figure 6A, Clausen et al., in press). - In yet an embodiment no significant reduction in spleen T cells compared to saline at 24 hours (Figure 6B, Clausen et al., in press), which is the case for etanercept.

- In yet a further embodiment, significant increase in microvesicle numbers at 6 hours compared to saline (Figure 7 A, Clausen et al., in press)

[0052]Accordingly, principles of the present disclosure provide compositions and methods for treating symptoms associated with stroke. The methods comprise administering to a patient in need thereof an inhibitor of TNF-a. In some embodiments, the methods comprise administering to a patient in need thereof an inhibitor of TNF-a that inhibits signaling of soluble TNF-a but not transmembrane TNF-a. In some embodiments, the inhibitor is a dominant negative inhibitor of soluble TNF-a. In some embodiments, the dominant negative inhibitor of TNF-a is

XProl 595.

By stroke is meant when the blood supply to the brain is interrupted, usually because a blood vessel bursts or is blocked by a clot. This cuts off the supply of oxygen and nutrients, causing damage to the brain tissue.

[0053] By symptoms associated with or caused by stroke is meant sudden weakness or numbness of the face, arm or leg, most often on one side of the body. Other symptoms include: confusion, difficulty speaking or understanding speech; difficulty seeing with one or both eyes; difficulty walking, dizziness, loss of balance or coordination; severe headache with no known cause; fainting or unconsciousness.

[0054]Inhibitors of TNF-a

[0055] In some embodiments, inhibitors of TNFa may be non-selective inhibitors, such as, but not limited to etanercept, infliximab, adalimumab and the like. Preferred inhibitors of TNFa may be dominant negative TNFa proteins, referred to herein as "DNTNF-a," "DN-TNF-a proteins," "TNFa variants," "TNFa variant proteins," "variant TNF-a," "variant TNF-a," and the like.

[0056] By "variant TNF-a" or "TNF-a proteins" is meant TNFa or TNF-a proteins that differ from the corresponding wild type protein by at least 1 amino acid. Thus, a variant of human TNF-a is compared to SEQ ID NO: 1 DN-TNF-α proteins are disclosed in detail in U.S. Patent No. 7,446,174, which is incorporated herein in its entirety by reference. As used herein variant TNF-a or TNF-a proteins include TNF-a monomers, dimers or trimers. Included within the definition of "variant TNF-a" are competitive inhibitor TNF-a variants. While certain variants as described herein, one of skill in the art will understand that other variants may be made while retaining the function of inhibiting soluble but not transmembrane TNF-a.

[0057]Thus, the proteins of the invention are antagonists of wild type TNF-a. By "antagonists of wild type TNF-a" is meant that the variant TNF-a protein inhibits or significantly decreases at least one biological activity of wild-type TNF-a.

[0058]In a preferred embodiment the variant is antagonist of soluble TNF-a, but does not significantly antagonize transmembrane TNF-a, e.g., DN- TNF-a protein as disclosed herein inhibits signaling by soluble TNF-a, but not transmembrane TNF-a. By "inhibits the activity of TNF-a" and grammatical equivalents is meant at least a 10% reduction in wild-type, soluble TNF-a, more preferably at least a 50% reduction in wild-type, soluble TNF-a activity, and even more preferably, at least 90% reduction in wild-type, soluble TNF-a activity. Preferably, there is an inhibition in wild-type soluble TNF-a activity in the absence of reduced signaling by transmembrane TNF-a. In a preferred embodiment, the activity of soluble TNF-a is inhibited while the activity of transmembrane TNF-a is substantially and preferably completely maintained.

[0059]The TNF proteins of the invention have modulated activity as compared to wild type proteins. In a preferred embodiment, variant TNF-a proteins exhibit decreased biological activity (e.g. antagonism) as compared to wild type TNF-a, including but not limited to, decreased binding to a receptor (p55, p75 or both), decreased activation and/or ultimately a loss of cytotoxic activity. By "cytotoxic activity" herein refers to the ability of a TNF-a variant to selectively kill or inhibit cells. Variant TNF-a proteins that exhibit less than 50% biological activity as compared to wild type are preferred. More preferred are variant TNF-a proteins that exhibit less than 25%, even more preferred are variant proteins that exhibit less than 15%, and most preferred are variant TNF-a proteins that exhibit less than 10% of a biological activity of wild-type TNF-a. Suitable assays include, but are not limited to, caspase assays, TNF-a cytotoxicity assays, DNA binding assays, transcription assays (using reporter constructs), size exclusion chromatography assays and radiolabeling/immuno-precipitation,), and stability assays (including the use of circular dichroism (CD) assays and equilibrium studies), according to methods know in the art.

[0060]In one embodiment, at least one property critical for binding affinity of the variant TNF-a proteins is altered when compared to the same property of wild type TNF-a and in particular, variant TNF-a proteins with altered receptor affinity are preferred. Particularly preferred are variants of TNF-a with altered affinity toward oligomerization to wild type TNF-a. Thus, the invention provides variant TNF-a proteins with altered binding affinities such that the variant TNF-a proteins will preferentially oligomerize with wild type TNF-a, but do not substantially interact with wild type TNF receptors, i.e., p55, p75. "Preferentially" in this case means that given equal amounts of variant TNF-a monomers and wild type TNF-a monomers, at least 25% of the resulting trimers are mixed trimers of variant and wild type TNF-a, with at least about 50% being preferred, and at least about 80-90% being particularly preferred. In other words, it is preferable that the variant TNF-a proteins of the invention have greater affinity for wild type TNF-a protein as compared to wild type TNF-a proteins. By "do not substantially interact with TNF receptors" is meant that the variant TNF-a proteins will not be able to associate with either the p55 or p75 receptors to significantly activate the receptor and initiate the TNF signaling pathway(s). In a preferred embodiment, at least a 50% decrease in receptor activation is seen, with greater than 50%, 76%, 80-90% being preferred.

[0061 ]In some embodiments, the variants of the invention are antagonists of both soluble and transmembrane TNF-a. However, as described herein, preferred variant TNF-a proteins are antagonists of the activity of soluble TNF-a but do not substantially affect the activity of transmembrane TNF-a. Thus, a reduction of activity of the heterotrimers for soluble TNF-a is as outlined above, with reductions in biological activity of at least 10%, 25, 50, 75, 80, 90, 95, 99 or 100% all being preferred. However, some of the variants outlined herein comprise selective inhibition; that is, they inhibit soluble TNF-a activity but do not substantially inhibit transmembrane TNF-a. In these embodiments, it is preferred that at least 80%, 85, 90, 95, 98, 99 or 100% of the transmembrane TNF-a activity is maintained. This may also be expressed as a ratio; that is, selective inhibition can include a ratio of inhibition of soluble to transmembrane TNF-α. For example, variants that result in at least a 10: 1 selective inhibition of soluble to transmembrane TNF-a activity are preferred, with 50: 1, 100:1 , 200: 1, 500: 1, 1000: 1 or higher find particular use in the invention. Thus one embodiment utilizes variants, such as double mutants at positions 87/145 as outlined herein, that substantially inhibit or eliminate soluble TNF-a activity (for example by exchanging with homotrimeric wild-type to form heterotrimers that do not bind to TNF-a receptors or that bind but do not activate receptor signaling) but do not significantly affect (and preferably do not alter at all) transmembrane TNF-a activity.

Without being bound by theory, the variants exhibiting such differential inhibition allow the decrease of inflammation without a corresponding loss in immune response, or when in the context of the appropriate cell, without a corresponding demyelination of neurons.

[0062 ]In one embodiment, the affected biological activity of the variants is the activation of receptor signaling by wild type TNF-a proteins. In a preferred embodiment, the variant TNF-a protein interacts with the wild type TNF-a protein such that the complex comprising the variant TNF-a and wild type TNF-a has reduced capacity to activate (as outlined above for "substantial inhibition"), and in preferred embodiments is incapable of activating, one or both of the TNF receptors, i.e. p55 TNF-R or p75 TNF-R. In a preferred embodiment, the variant TNF-a protein is a variant TNF-a protein which functions as an antagonist of wild type TNF-a. Preferably, the variant TNF-a protein preferentially interacts with wild type TNF-a to form mixed trimers with the wild type protein such that receptor binding does not significantly occur and/or TNF-a signaling is not initiated. By mixed trimers is meant that monomers of wild type and variant TNF-a proteins interact to form heterotrimeric TNF-a. Mixed trimers may comprise 1 variant TNF-a protein: 2 wild type TNF-a proteins, 2 variant TNF-a proteins: 1 wild type TNF-a protein. In some embodiments, trimers may be formed comprising only variant TNF-a proteins.

[0063 ]The variant TNF-a antagonist proteins of the invention are highly specific for TNF-a antagonism relative to TNF-beta antagonism. Additional characteristics include improved stability, pharmacokinetics, and high affinity for wild type TNF-a. Variants with higher affinity toward wild type TNF-a may be generated from variants exhibiting TNF-a antagonism as outlined above. [0064]Similarly, variant TNF-a proteins, for example are experimentally tested and validated in in vivo and in in vitro assays. Suitable assays include, but are not limited to, activity assays and binding assays. For example, TNF-a activity assays, such as detecting apoptosis via caspase activity can be used to screen for TNF-a variants that are antagonists of wild type TNF-a. Other assays include using the Sytox green nucleic acid stain to detect TNF-induced cell permeability in an Actinomycin-D sensitized cell line. As this stain is excluded from live cells, but penetrates dying cells, this assay also can be used to detect TNF-a variants that are agonists of wild-type TNF-a. By "agonists of "wild type TNF-a" is meant that the variant TNF-a protein enhances the activation of receptor signaling by wild type TNF-a proteins. Generally, variant TNF-a proteins that function as agonists of wild type TNF-a are not preferred. However, in some embodiments, variant TNF-a proteins that function as agonists of wild type TNF-a protein are preferred. An example of an NF kappaB assay is presented in Example 7 of U.S. Patent 7,446,174, which is expressly incorporated herein by reference.

[0065]In a preferred embodiment, binding affinities of variant TNF-a proteins as compared to wild type TNF-a proteins for naturally occurring TNF-a and TNF receptor proteins such as p55 and p75 are determined. Suitable assays include, but are not limited to, e.g., quantitative comparisons comparing kinetic and equilibrium binding constants, as are known in the art. Examples of binding assays are described in Example 6 of U.S. Patent 7,446,174, which is expressly incorporated herein by reference.

[0066]In a preferred embodiment, the variant TNF-a protein has an amino acid sequence that differs from a wild type TNF-a sequence by at least 1 amino acid, with from 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 amino acids all contemplated, or higher. Expressed as a percentage, the variant TNF-a proteins of the invention preferably are greater than 90% identical to wild-type, with greater than 95, 97, 98 and 99% all being contemplated. Stated differently, based on the human TNF-a sequence of FIG. IB (SEQ ID NO: 2), variant TNF-a proteins have at least about 1 residue that differs from the human TNF-a sequence, with at least about 2, 3, 4, 5, 6, 6 or 8 different residues. Preferred variant TNF-a proteins have 3 to 8 different residues. As will be evident to one of skill in the art the sequence in FIG IB includes an N-terminal 6 His tag. [0067]A % amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence in the aligned region. The "longer" sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored). In a similar manner, "percent (%) nucleic acid sequence identity" with respect to the coding sequence of the polypeptides identified is defined as the percentage of nucleotide residues in a candidate sequence that are identical with the nucleotide residues in the coding sequence of the cell cycle protein. A preferred method utilizes the BLASTN module of WU-BLAST-2 set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively.

[0068]TNF-a proteins may be fused to, for example, to other therapeutic proteins or to other proteins such as Fc or serum albumin for therapeutic or pharmacokinetic purposes. In this embodiment, a TNF-a protein of the present invention is operably linked to a fusion partner. The fusion partner may be any moiety that provides an intended therapeutic or pharmacokinetic effect. Examples of fusion partners include but are not limited to Human Serum Albumin, a therapeutic agent, a cytotoxic or cytotoxic molecule, radionucleotide, and an Fc, etc. As used herein, an Fc fusion is synonymous with the terms "immunoadhesin", "Ig fusion", "Ig chimera", and "receptor globulin" as used in the prior art (Chamow et al., 1996, Trends Biotechnol 14:52- 60; Ashkenazi et al, 1997, Curr Opin Immunol 9:195-200, both incorporated by reference). An Fc fusion combines the Fc region of an immunoglobulin with the target-binding region of a TNF-a protein, for example. See for example U.S. Pat. Nos. 5,766,883 and 5,876,969, both of which are incorporated by reference.

[0069]In a preferred embodiment, the variant TNF-a proteins comprise variant residues selected from the following positions 21, 23, 30, 31, 32, 33, 34, 35, 57, 65, 66, 67, 69, 75, 84, 86, 87, 91, 97, 101, 111, 112, 115, 140, 143, 144, 145, 146, and 147. Preferred amino acids for each position, including the human TNF-a residues, are shown in FIG. 3. Thus, for example, at position 143, preferred amino acids are Glu, Asn, Gin, Ser, Arg, and Lys; etc. Preferred changes include: VIM, Q21 C, Q21 R, E23C, R31C, N34E, V91E, Q21R, N30D, R31C, R31I, R31D, R31E, R32D, R32E, R32S, A33E, N34E, N34V, A35S, D45C, L57F, L57W, L57Y, K65D, K65E, K651, K65M, K65N, K65Q, K65T, K65S, K65V, K65W, G66K, G66Q, Q67D, Q67K, Q67R, Q67S, Q67W, Q67Y, C69V, L75E, L75K, L75Q, A84V, S86Q, S86R, Y87H, Y87R, V91E, I97R, I97T, CI 01 A, Al 11R, Al 1 IE, Kl 12D, Kl 12E, Yl 15D, Yl 15E, Yl 15F, Yl 15H, Yl 151, Yl 15K, Yl 15L, Yl 15M, Yl 15N, Yl 15Q, Yl 15R, Yl 15S, Yl 15T, Yl 15W, D140K, D140R, D143E, D143K, D143L, D143R, D143N, D143Q, D143R, D143S, F144N, A145D, A145E, A145F, A145H, A145K, A145M, A145N, A145Q, A145R, A145S, A145T, A145Y, E146K, E146L, E146M, E146N, E146R, E146S and S147R. These may be done either individually or in combination, with any combination being possible. However, as outlined herein, preferred embodiments utilize at least 1 to 8, and preferably more, positions in each variant TNF-a protein. [0070]In an additional aspect, the invention provides TNF-a variants selected from the group consisting of XENP268 XENP344, XENP345, XENP346, XENP550, XENP551, XENP557, XENP1593, XENP1594, and XENP1595 as outlined in Example 3 OF U.S. PATENT

7,662,367, which is incorporated herein by reference.

[0071 ]In an additional aspect, the invention provides methods of forming a TNF-a heterotrimer in vivo in a mammal comprising administering to the mammal a variant TNF-a molecule as compared to the corresponding wild-type mammalian TNF-a, wherein said TNF-a variant is substantially free of agonistic activity.

[0072 ]In an additional aspect, the invention provides methods of screening for selective inhibitors comprising contacting a candidate agent with a soluble TNF-a protein and assaying for TNF-a biological activity; contacting a candidate agent with a transmembrane TNF-a protein and assaying for TNF-a biological activity, and determining whether the agent is a selective inhibitor. The agent may be a protein (including peptides and antibodies, as described herein) or small molecules.

[0073 ]In a further aspect, the invention provides variant TNF-a proteins that interact with the wild type TNF-a to form mixed trimers incapable of activating receptor signaling. Preferably, variant TNF-a proteins with 1, 2, 3, 4, 5, 6 and 7 amino acid changes are used as compared to wild type TNF-a protein. In a preferred embodiment, these changes are selected from positions 1, 21, 23, 30, 31, 32, 33, 34, 35, 57, 65, 66, 67, 69, 75, 84, 86, 87, 91, 97, 101, 111, 112, 115, 140, 143, 144, 145, 146 and 147. In an additional aspect, the non-naturally occurring variant TNF-α proteins have substitutions selected from the group of substitutions consisting of V1M,Q21C, Q21R, E23C, N34E, V91E, Q21R, N30D, R31C, R311, R31D, R31E, R32D, R32E, R32S, A33E, N34E, N34V, A35S, D45C, L57F, L57W, L57Y, K65D, K65E, K651, K65M, K65N, K65Q, K65T, K65S, K65V, K65W, G66K, G66Q, Q67D, Q67K, Q67R, Q67S, Q67W, Q67Y, C69V, L75E, L75K, L75Q, A84V, S86Q, S86R, Y87H, Y87R, V91E, I97R, I97T, ClOl A, Al 11R, Al 1 IE, Kl 12D, Kl 12E, Yl 15D, Yl 15E, Yl 15F, Yl 15H, Yl 151, Y115K, Y115L, Y115M, Y115N, Y115Q, Y115R, Y115S, Y115T, Y115W, D140K, D140R, D143E, D143K, D143L, D143R, D143N, D143Q, D143R, D143S, F144N, A145D, A145E, A145F, A145H, A145K, A145M, A145N, A145Q, A145R, A145S, A145T, A145Y, E146K, E146L, E146M, E146N, E146R, E146S and S147R.

[0074]In another preferred embodiment, substitutions may be made either individually or in combination, with any combination being possible. Preferred embodiments utilize at least one, and preferably more, positions in each variant TNF-a protein. For example, substitutions at positions 31, 57, 69, 75, 86, 87, 97, 101, 115, 143, 145, and 146 may be combined to form double variants. In addition triple, quadruple, quintuple and the like, point variants may be generated.

[0075]In one aspect, the invention provides TNF-a variants comprising the amino acid substitutions A145R/I97T. In one aspect, the invention provides TNF-a variants comprising the amino acid substitutions VIM, R31C, C69V, Y87H, ClOl, and A145R. In a preferred embodiment, this variant is PEGylated.

[0076]In a preferred embodiment, the variant is XProl 595, a PEGylated protein comprising VIM, R31C, C69V, Y87H, ClOl, and A145R mutations relative to the wild type human sequence.

[0077]For purposes of the present invention, the areas of the wild type or naturally occurring TNF-a molecule to be modified are selected from the group consisting of the Large Domain

(also known as II), Small Domain (also known as I), the DE loop, and the trimer interface. The Large Domain, the Small Domain and the DE loop are the receptor interaction domains. The modifications may be made solely in one of these areas or in any combination of these areas. The Large Domain preferred positions to be varied include: 21, 30, 31, 32, 33, 35, 65, 66, 67, 111, 112, 115, 140, 143, 144, 145, 146 and/or 147. For the Small Domain, the preferred positions to be modified are 75 and/or 97. For the DE Loop, the preferred position modifications are 84, 86, 87 and/or 91. The Trimer Interface has preferred double variants including positions 34 and 91 as well as at position 57. In a preferred embodiment, substitutions at multiple receptor interaction and/or trimerization domains may be combined. Examples include, but are not limited to, simultaneous substitution of amino acids at the large and small domains (e.g. A145R and I97T), large domain and DE loop (A145R and Y87H), and large domain and trimerization domain (A145R and L57F). Additional examples include any and all combinations, e.g., I97T and Y87H (small domain and DE loop). More specifically, theses variants may be in the form of single point variants, for example Kl 12D, Yl 15K, Yl 151, Yl 15T, A145E or A145R. These single point variants may be combined, for example, Yl 151 and A145E, or Yl 151 and A145R, or Yl 15T and A145R or Yl 151 and A145E; or any other combination.

[0078]Preferred double point variant positions include 57, 75, 86, 87, 97, 115, 143, 145, and 146; in any combination. In addition, double point variants may be generated including L57F and one of Yl 151, Y115Q, Y115T, D143K, D143R, D143E, A145E, A145R, E146K or E146R. Other preferred double variants are Y115Q and at least one of D143N, D143Q, A145K, A145R, or E146K; Yl 15M and at least one of D143N, D143Q, A145K, A145R or E146K; and L57F and at least one of A145E or 146R; K65D and either D143K or D143R, K65E and either D143K or D143R, Y115Q and any of L75Q, L57W, L57Y, L57F, I97R, I97T, S86Q, D143N, E146K, A145R and I97T, A145R and either Y87R or Y87H; N34E and V91E; L75E and Yl 15Q; L75Q and Yl 15Q; L75E and A145R; and L75Q and A145R.

[0079]Further, triple point variants may be generated. Preferred positions include 34, 75, 87, 91, 115, 143, 145 and 146. Examples of triple point variants include V91 E, N34E and one of Y115I, Y115T, D143K, D143R, A145R, A145E E146K, and E146R. Other triple point variants include L75E and Y87H and at least one of Y115Q, A145R, Also, L75K, Y87H and Y115Q. More preferred are the triple point variants V91E, N34E and either A145R or A145E.

[0080]Variant TNF-a proteins may also be identified as being encoded by variant TNF-a nucleic acids. In the case of the nucleic acid, the overall homology of the nucleic acid sequence is commensurate with amino acid homology but takes into account the degeneracy in the genetic code and codon bias of different organisms. Accordingly, the nucleic acid sequence homology may be either lower or higher than that of the protein sequence, with lower homology being preferred. In a preferred embodiment, a variant TNF-a nucleic acid encodes a variant TNF-a protein. As will be appreciated by those in the art, due to the degeneracy of the genetic code, an extremely large number of nucleic acids may be made, all of which encode the variant TNF-a proteins of the present invention. Thus, having identified a particular amino acid sequence, those skilled in the art could make any number of different nucleic acids, by simply modifying the sequence of one or more codons in a way which does not change the amino acid sequence of the variant TNF-a.

[0081 ]In one embodiment, the nucleic acid homology is determined through hybridization studies. Thus, for example, nucleic acids which hybridize under high stringency to the nucleic acid sequence shown in FIG. IB (SEQ ID NO: 2) or its complement and encode a variant TNF- α protein is considered a variant TNF-a gene. High stringency conditions are known in the art; see for example Maniatis et al, Molecular Cloning: A Laboratory Manual, 2d Edition, 1989, and Short Protocols in Molecular Biology, ed. Ausubel, et al., both of which are hereby incorporated by reference. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in

Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993), incorporated by reference. Generally, stringent conditions are selected to be about 5-10°C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C. for short probes (e.g. 10 to 50 nucleotides) and at least about 60°C. for long probes (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. In another embodiment, less stringent hybridization conditions are used; for example, moderate or low stringency conditions may be used, as are known in the art; see Maniatis and Ausubel, supra, and Tijssen, supra. In addition, nucleic acid variants encode TNF-a protein variants comprising the amino acid substitutions described herein. In one embodiment, the TNF-a variant encodes a polypeptide variant comprising the amino acid substitutions A145R/I97T. In one aspect, the nucleic acid variant encodes a polypeptide comprising the amino acid substitutions VIM, R31C, C69V, Y87H, ClOl, and A145R, or any 1, 2, 3, 4 or 5 of these variant amino acids.

[0082]The variant TNF-a proteins and nucleic acids of the present invention are recombinant. As used herein, "nucleic acid" may refer to either DNA or RNA, or molecules which contain both deoxy- and ribonucleotides. The nucleic acids include genomic DNA, cDNA and oligonucleotides including sense and anti-sense nucleic acids. Such nucleic acids may also contain modifications in the ribose-phosphate backbone to increase stability and half-life of such molecules in physiological environments. The nucleic acid may be double stranded, single stranded, or contain portions of both double stranded or single stranded sequence. As will be appreciated by those in the art, the depiction of a single strand ("Watson") also defines the sequence of the other strand ("Crick"); thus the sequence depicted in FIG. 1A (SEQ ID NO: 1) also includes the complement of the sequence. By the term "recombinant nucleic acid" is meant nucleic acid, originally formed in vitro, in general, by the manipulation of nucleic acid by endonucleases, in a form not normally found in nature. Thus an isolated variant TNF-a nucleic acid, in a linear form, or an expression vector formed in vitro by ligating DNA molecules that are not normally joined, are both considered recombinant for the purposes of this invention.

[0083 JBy "vector" is meant any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which can transfer gene sequences between cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors.

[0084] It is understood that once a recombinant nucleic acid is made and reintroduced into a host cell or organism, it will replicate non-recombinantly, i.e. using the in vivo cellular machinery of the host cell rather than in vitro manipulations; however, such nucleic acids, once produced recombinantly, although subsequently replicated non-recombinantly, are still considered recombinant for the purposes of the invention.

[0085]Similarly, a "recombinant protein" is a protein made using recombinant techniques, i.e. through the expression of a recombinant nucleic acid as depicted above. A recombinant protein is distinguished from naturally occurring protein by at least one or more characteristics. For example, the protein may be isolated or purified away from some or all of the proteins and compounds with which it is normally associated in its wild-type host, and thus may be substantially pure. For example, an isolated protein is unaccompanied by at least some of the material with which it is normally associated in its natural state, preferably constituting at least about 0.5%, more preferably at least about 5% by weight of the total protein in a given sample. A substantially pure protein comprises at least about 75% by weight of the total protein, with at least about 80% being preferred, and at least about 90% being particularly preferred. The definition includes the production of a variant TNF-a protein from one organism in a different organism or host cell. Alternatively, the protein may be made at a significantly higher concentration than is normally seen, through the use of a inducible promoter or high expression promoter, such that the protein is made at increased concentration levels. Furthermore, all of the variant TNF-a proteins outlined herein are in a form not normally found in nature, as they contain amino acid substitutions, insertions and deletions, with substitutions being preferred, as discussed below.

[0086]Also included within the definition of variant TNF-a proteins of the present invention are amino acid sequence variants of the variant TNF-a sequences outlined herein and shown in the Figures. That is, the variant TNF-a proteins may contain additional variable positions as compared to human TNF-a. These variants fall into one or more of three classes: substitutional, insertional or deletional variants.

[0087]Amino acid substitutions are typically of single residues; insertions usually will be on the order of from about 1 to 20 amino acids, although considerably larger insertions may be tolerated. Deletions range from about 1 to about 20 residues, although in some cases deletions may be much larger. [0088]Using the nucleic acids of the present invention, which encode a variant TNF-a protein, a variety of expression vectors are made. The expression vectors may be either self-replicating extrachromosomal vectors or vectors which integrate into a host genome. Generally, these expression vectors include transcriptional and translational regulatory nucleic acid operably linked to the nucleic acid encoding the variant TNF-a protein. The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

[0089]Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.

[0090]In a preferred embodiment, when the endogenous secretory sequence leads to a low level of secretion of the naturally occurring protein or of the variant TNF-a protein, a replacement of the naturally occurring secretory leader sequence is desired. In this embodiment, an unrelated secretory leader sequence is operably linked to a variant TNF-a encoding nucleic acid leading to increased protein secretion. Thus, any secretory leader sequence resulting in enhanced secretion of the variant TNF-a protein, when compared to the secretion of TNF-a and its secretory sequence, is desired. Suitable secretory leader sequences that lead to the secretion of a protein are known in the art. In another preferred embodiment, a secretory leader sequence of a naturally occurring protein or a protein is removed by techniques known in the art and subsequent expression results in intracellular accumulation of the recombinant protein.

[0091]Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading frame. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. The transcriptional and translational regulatory nucleic acid will generally be appropriate to the host cell used to express the fusion protein; for example, transcriptional and translational regulatory nucleic acid sequences from Bacillus are preferably used to express the fusion protein in Bacillus. Numerous types of appropriate expression vectors, and suitable regulatory sequences are known in the art for a variety of host cells.

[0092 ]In general, the transcriptional and translational regulatory sequences may include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences. In a preferred embodiment, the regulatory sequences include a promoter and transcriptional start and stop sequences. Promoter sequences encode either constitutive or inducible promoters. The promoters may be either naturally occurring promoters or hybrid promoters. Hybrid promoters, which combine elements of more than one promoter, are also known in the art, and are useful in the present invention. In a preferred embodiment, the promoters are strong promoters, allowing high expression in cells, particularly mammalian cells, such as the CMV promoter, particularly in combination with a Tet regulatory element.

[0093 ]In addition, the expression vector may comprise additional elements. For example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in mammalian or insect cells for expression and in a prokaryotic host for cloning and amplification. Furthermore, for integrating expression vectors, the expression vector contains at least one sequence homologous to the host cell genome, and preferably two homologous sequences which flank the expression construct. The integrating vector may be directed to a specific locus in the host cell by selecting the appropriate homologous sequence for inclusion in the vector. Constructs for integrating vectors are well known in the art.

[0094]In addition, in a preferred embodiment, the expression vector contains a selectable marker gene to allow the selection of transformed host cells. Selection genes are well known in the art and will vary with the host cell used. A preferred expression vector system is a retroviral vector system such as is generally described in PCT US97/01019 and PCT US97/01048, both of which are hereby incorporated by reference. In a preferred embodiment, the expression vector comprises the components described above and a gene encoding a variant TNF-a protein. As will be appreciated by those in the art, all combinations are possible and accordingly, as used herein, the combination of components, comprised by one or more vectors, which may be retroviral or not, is referred to herein as a "vector composition".

[0095]A number of viral based vectors have been used for gene delivery. See for example U.S. Pat. No. 5,576,201, which is expressly incorporated herein by reference. For example, retroviral systems are known and generally employ packaging lines which have an integrated defective provirus (the "helper") that expresses all of the genes of the virus but cannot package its own genome due to a deletion of the packaging signal, known as the psi sequence. Thus, the cell line produces empty viral shells. Producer lines can be derived from the packaging lines which, in addition to the helper, contain a viral vector which includes sequences required in cis for replication and packaging of the virus, known as the long terminal repeats (LTRs). The gene of interest can be inserted in the vector and packaged in the viral shells synthesized by the retroviral helper. The recombinant virus can then be isolated and delivered to a subject. (See, e.g., U.S. Pat. No. 5,219,740.) Representative retroviral vectors include but are not limited to vectors such as the LHL, N2, LNSAL, LSHL and LHL2 vectors described in e.g., U.S. Pat. No. 5,219,740, incorporated herein by reference in its entirety, as well as derivatives of these vectors. Retroviral vectors can be constructed using techniques well known in the art. See, e.g., U.S. Pat. No. 5,219,740; Mann et al. (1983) Cell 33: 153-159.

[0096]Adenovirus based systems have been developed for gene delivery and are suitable for delivery according to the methods described herein. Human adenoviruses are double-stranded DNA viruses, which enter cells by receptor-mediated endocytosis. These viruses are particularly well suited for gene transfer because they are easy to grow and manipulate and they exhibit a broad host range in vivo and in vitro.

[0097]Adenoviruses infect quiescent as well as replicating target cells. Unlike retroviruses which integrate into the host genome, adenoviruses persist extrachromosomally thus minimizing the risks associated with insertional mutagenesis. The virus is easily produced at high titers and is stable so that it can be purified and stored. Even in the replication-competent form, adenoviruses cause only low level morbidity and are not associated with human malignancies. Accordingly, adenovirus vectors have been developed which make use of these advantages. For a description of adenovirus vectors and their uses see, e.g., Haj-Ahmad and Graham (1986) J. Virol. 57:267-274; Bert et al. (1993) J. Virol. 67:5911-5921; Mittereder et al. (1994) Human Gene Therapy 5:717-729; Seth et al. (1994) J. Virol. 68:933-940; Barr et al. (1994) Gene Therapy 1 :51 -58; Berkner, K. L. (1988) BioTechniques 6:616-629; Rich et al. (1993) Human Gene Therapy 4:461-476.

[0098] In a preferred embodiment, the viral vectors used in the subject methods are AAV vectors. By an "AAV vector" is meant a vector derived from an adeno-associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc. Typical AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, preferably the rep and/or cap genes, but retain functional flanking ITR sequences. Functional ITR sequences are necessary for the rescue, replication and packaging of the AAV virion. An AAV vector includes at least those sequences required in cis for replication and packaging (e.g., functional ITRs) of the virus. The ITRs need not be the wild-type nucleotide sequences, and may be altered, e.g., by the insertion, deletion or substitution of nucleotides, so long as the sequences provide for functional rescue, replication and packaging. For more on various AAV serotypes, see for example Cearley et al, Molecular Therapy, 16: 1710-1718, 2008, which is expressly incorporated herein in its entirety by reference.

[0099]AAV expression vectors may be constructed using known techniques to provide as operatively linked components in the direction of transcription, control elements including a transcriptional initiation region, the DNA of interest and a transcriptional termination region. The control elements are selected to be functional in a thalamic and/or cortical neuron.

Additional control elements may be included. The resulting construct which contains the operatively linked components is bounded (5' and 3') with functional AAV ITR sequences.

[00100]By "adeno-associated virus inverted terminal repeats" or "AAV ITRs" is meant the art- recognized regions found at each end of the AAV genome which function together in cis as origins of DNA replication and as packaging signals for the virus. AAV ITRs, together with the AAV rep coding region, provide for the efficient excision and rescue from, and integration of a nucleotide sequence interposed between two flanking ITRs into a mammalian cell genome. [00101]The nucleotide sequences of AAV ITR regions are known. See, e.g., Kotin, R. M.

(1994) Human Gene Therapy 5:793-801; Berns, K. I. "Parvoviridae and their Replication" in Fundamental Virology, 2nd Edition, (B. N. Fields and D. M. Knipe, eds.) for the AAV-2 sequence. As used herein, an "AAV ITR" need not have the wild-type nucleotide sequence depicted, but may be altered, e.g., by the insertion, deletion or substitution of nucleotides.

Additionally, the AAV ITR may be derived from any of several AAV serotypes, including without limitation, AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc. Furthermore, 5' and 3' ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., to allow for excision and rescue of the sequence of interest from a host cell genome or vector, and to allow integration of the heterologous sequence into the recipient cell genome when AAV Rep gene products are present in the cell.

[00102] Suitable DNA molecules for use in AAV vectors will include, for example, a gene that encodes a protein that is defective or missing from a recipient subject or a gene that encodes a protein having a desired biological or therapeutic effect (e.g., an enzyme, or a neurotrophic factor). The artisan of reasonable skill will be able to determine which factor is appropriate based on the neurological disorder being treated.

[00103]The selected nucleotide sequence is operably linked to control elements that direct the transcription or expression thereof in the subject in vivo. Such control elements can comprise control sequences normally associated with the selected gene. Alternatively, heterologous control sequences can be employed. Useful heterologous control sequences generally include those derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, the S V40 early promoter, mouse mammary tumor virus LTR promoter;

adenovirus major late promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region

(CMVTE), a rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like. In addition, sequences derived from nonviral genes, such as the murine metallothionein gene, will also find use herein. Such promoter sequences are commercially available from, e.g., Stratagene (San Diego, Calif). [00104]Once made, the TNF-a protein may be covalently modified. For instance, a preferred type of covalent modification of variant TNF-a comprises linking the variant TNF-a

polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol ("PEG"), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat. No. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337, incorporated by reference. These nonproteinaceous polymers may also be used to enhance the variant TNF-a's ability to disrupt receptor binding, and/or in vivo stability. In another preferred embodiment, cysteines are designed into variant or wild type TNF-a in order to incorporate (a) labeling sites for characterization and (b) incorporate PEGylation sites. For example, labels that may be used are well known in the art and include but are not limited to biotin, tag and fluorescent labels (e.g. fluorescein). These labels may be used in various assays as are also well known in the art to achieve characterization. A variety of coupling chemistries may be used to achieve PEGylation, as is well known in the art. Examples include but are not limited to, the technologies of

Shearwater and Enzon, which allow modification at primary amines, including but not limited to, lysine groups and the N-terminus. See, Kinstler et al, Advanced Drug Deliveries Reviews, 54, 477-485 (2002) and M J Roberts et al, Advanced Drug Delivery Reviews, 54, 459-476 (2002), both hereby incorporated by reference.

[00105]In one preferred embodiment, the optimal chemical modification sites are 21, 23, 31 and 45, taken alone or in any combination. In an even more preferred embodiment, a TNF-a variant of the present invention includes the R31 C mutation.

[00106]In a preferred embodiment, the variant TNF-a protein is purified or isolated after expression. Variant TNF-a proteins may be isolated or purified in a variety of ways known to those skilled in the art depending on what other components are present in the sample.

[00107]Treatment Methods

[00108]The terms "treatment", "treating", and the like, as used herein include amelioration or elimination of a disease or condition once it has been established or alleviation of the characteristic symptoms of such disease or condition. A method as disclosed herein may also be used to, depending on the condition of the patient, prevent the onset of a disease or condition or of symptoms associated with a disease or condition, including reducing the severity of a disease or condition or symptoms associated therewith prior to affliction with said disease or condition. Such prevention or reduction prior to affliction refers to administration of the compound or composition of the invention to a patient that is not at the time of administration afflicted with the disease or condition.

[00109]Combination treatments:

Treatments that currently are available for stroke are limited and include an acute ischemic stroke is treated in a hospital with intravenous/intraarterial thrombolysis in 4.5-6 hours or by thrombectomy, but the effect of such invasive approaches is limited, major adverse events including death may follow, and there is a controversy regarding the effectivity of intraarterial thrombolysis and thrombectomy.

[0011 OJPrevention of stroke in case of risk factors (primary prevention) or prevention of recurrent stroke (secondary prevention) may involve the administration of antiplatelet drugs, such as aspirin and dipyridamole to interfere with platelet aggregation on existing vascular plaques and reduce the risk of local thrombosis and embolisation. This may be combined with controlling other risk factors e.g. reduction of high blood pressure, the use of statins to decrease serum cholesterol, or treatment of diabetes. Relevant medicaments are: thrombolytic agents (thrombolytic agents are selected from the group consisting of tissue plasminogen activators including alteplase, reteplase, and tenecteplase, anistreplase, streptokinase, and urokinase), fibrinolytic agents, anti-thrombotic agents, anti-platelet aggregation agents (anti-platelet aggregation agents are selected from the group consisting of Irreversible cyclooxygenase inhibitors including Aspirin and Triflusal, Adenosine diphosphate (ADP) receptor inhibitors including Clopidogrel, Prasugrel, Ticagrelor, Ticlopidine, Phosphodiesterase inhibitors including Cilostazol, Protease-activated receptor- 1 (PAR-1) antagonists including Vorapaxar, Glycoprotein IIB/IIIA inhibitors including Abciximab, Eptifibatide, Tirofiban, Adenosine reuptake inhibitors including Dipyridamole, Thromboxane inhibitors, Thromboxane synthase inhibitors, Thromboxane receptor antagonists, including Terutroban and acetylsalisilic acid, epoprostenol, ilopros, abciximab, eptifibatid and defibrotid), anticoagulants, anti-hypertensive agents (anti -hypertensive agents are selected from the group consisting of Diuretics, Calcium channel blockers, ACE inhibitors, Angiotensin II receptor antagonists, Adrenergic receptor antagonists, Vasodilators, Benzodiazepines, Renin Inhibitors, Aldosterone receptor antagonists, Alpha-2 adrenergic receptor agonists, Endothelin receptor blockers), anti-diabetic agents (antidiabetic agents are selected from the group consisting of insulin derivatives, glyburide, glimepiride, glipizide, metformin, acarbose, miglitol, voglibose, Pioglitazone, and

Rosiglitazone), anti-dyslipidemia agents, cholesterol reducing agents, statins (statins are selected from the group consisting of atorvastatin, fluvastatin, lovastatin, pitavastatin, pravastatin, rosuvastatin, simvastatin, bezafibrat, and gemfibrozil). Hemorrhagic stroke may damage brain tissue due to bleeding into the brain parenchyma or the subarachnoid/subdural space.

Subarachnoid haemorrhage is accompanied by vasoconstriction in the acute phase, which may contribute to tissue damage due to ischemia. Likewise, hypoperfusion to the brain due to low blood pressure or hypoglycemia can cause ischemic stroke. Hence, there is a need for new therapies for the prevention and treatment neuronal cell damage and inflammation, particularly during stroke. There is a need for treatments which reduce the extent of tissue and especially neuronal cell death in general or e.g. during stroke, which are non-invasive, have different mechanism of action, and have fewer and/or less severe side effects than currently used treatments thrombolysis. Thus, there exists a need for developing therapeutic strategies to better treat stroke and associated symptoms. As described herein, DN-TNFs that inhibit soluble but not transmembrane TNF-a find use in treating stroke or symptoms associated with stroke. These molecules find particular use when combined with currently available stroke therapies as known in the art and as described herein. For instance, DN-TNFs, such as XProl 595 may be combined in a therapeutic regimen with other molecules. DN-TNFs as described herein may also be used following surgery to alleviate symptoms or treat stroke.

[0011 l]In one embodiment, treatment of the DN-TNF in a therapeutic regimen in combination with the co-therapies as described herein results in synergistic efficacy as compared to either of the treatments alone. By "synergistic" is meant that efficacy is more than the result of additive efficacy of the two treatments alone. [00112]In one embodiment, treatment of the DN-TNF in a therapeutic regimen includes the combination of steroidal anti-inflammatory molecules, such as but not limited to dexamethasone and the like or non-steroidal anti-inflammatory molecules.

[00113]Formulations

[00114]Depending upon the manner of introduction, the pharmaceutical composition may be formulated in a variety of ways. The concentration of the therapeutically active variant TNF-a protein in the formulation may vary from about 0.1 to 100 weight %. In another preferred embodiment, the concentration of the variant TNF-a protein is in the range of 0.003 to 1.0 molar, with dosages from 0.03, 0.05, 0.1, 0.2, and 0.3 millimoles per kilogram of body weight being preferred.

[00115]The pharmaceutical compositions of the present invention comprise a variant TNF-a protein in a form suitable for administration to a patient. In the preferred embodiment, the pharmaceutical compositions are in a water soluble form, such as being present as

pharmaceutically acceptable salts, which is meant to include both acid and base addition salts. "Pharmaceutically acceptable acid addition salt" refers to those salts that retain the biological effectiveness of the free bases and that are not biologically or otherwise undesirable, formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as acetic acid, propionic acid, gly colic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like. "Pharmaceutically acceptable base addition salts" include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Particularly preferred are the ammonium, potassium, sodium, calcium, and magnesium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine. In a preferred embodiment the formulation is as described in U.S. Pre-Grant Publication US20120088713, which is expressly incorporated herein by reference. For instance, the formulation comprises between 5 mg/ml and 500 mg/ml of a TNF inhibitor polypeptide; between 10 mM and 25 mM of a phosphate or citrate buffer; between 5% and 10% of a carbohydrate; and optionally NaCl, wherein the combined ionic strength of the buffer and the optional salt is an equivalent ionic strength of between 0.1M and 0.2M NaCl, wherein the formulation has a pH of between 6 and 7, is fluid at room temperature and at 37°, and has a viscosity of 10 centipoise or less at room temperature. 33

[00116]The pharmaceutical compositions may also include one or more of the following: carrier proteins such as serum albumin; buffers such as NaOAc; fillers such as microcrystalline cellulose, lactose, corn and other starches; binding agents; sweeteners and other flavoring agents; coloring agents; and polyethylene glycol. Additives are well known in the art, and are used in a variety of formulations. In a further embodiment, the variant TNF-a proteins are added in a micellular formulation; see U.S. Pat. No. 5,833,948, hereby incorporated by reference. Alternatively, liposomes may be employed with the TNF-a proteins to effectively deliver the protein. Combinations of pharmaceutical compositions may be administered. Moreover, the TNF-a compositions of the present invention may be administered in combination with other therapeutics, either substantially simultaneously or co-administered, or serially, as the need may be.

[00117]In one embodiment provided herein, antibodies, including but not limited to monoclonal and polyclonal antibodies, are raised against variant TNF-a proteins using methods known in the art. In a preferred embodiment, these anti-variant TNF-a antibodies are used for

immunotherapy. Thus, methods of immunotherapy are provided. By "immunotherapy" is meant treatment of a TNF-a related disorders with an antibody raised against a variant TNF-a protein. As used herein, immunotherapy can be passive or active. Passive immunotherapy, as defined herein, is the passive transfer of antibody to a recipient (patient). Active immunization is the induction of antibody and/or T-cell responses in a recipient (patient). Induction of an immune response can be the consequence of providing the recipient with a variant TNF-a protein antigen to which antibodies are raised. As appreciated by one of ordinary skill in the art, the variant TNF-a protein antigen may be provided by injecting a variant TNF-a polypeptide against which antibodies are desired to be raised into a recipient, or contacting the recipient with a variant TNF-a protein encoding nucleic acid, capable of expressing the variant TNF-a protein antigen, under conditions for expression of the variant TNF-a protein antigen.

[00118]In a preferred embodiment, variant TNF-a proteins are administered as therapeutic agents, and can be formulated as outlined above. Similarly, variant TNF-a genes (including both the full-length sequence, partial sequences, or regulatory sequences of the variant TNF-a coding regions) may be administered in gene therapy applications, as is known in the art. These variant TNF-a genes can include antisense applications, either as gene therapy (i.e. for incorporation into the genome) or as antisense compositions, as will be appreciated by those in the art.

[00119]In a preferred embodiment, the nucleic acid encoding the variant TNF-a proteins may also be used in gene therapy. In gene therapy applications, genes are introduced into cells in order to achieve in vivo synthesis of a therapeutically effective genetic product, for example for replacement of a defective gene. "Gene therapy" includes both conventional gene therapy where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective

DNA or mRNA. Antisense RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes in vivo. It has already been shown that short antisense

oligonucleotides can be imported into cells where they act as inhibitors, despite their low intracellular concentrations caused by their restricted uptake by the cell membrane. (Zamecnik et al., Proc. Natl. Acad. Sci. U.S.A. 83:4143-4146 (1986), incorporated by reference). The oligonucleotides can be modified to enhance their uptake, e.g. by substituting their negatively charged phosphodiester groups by uncharged groups.

[00120]There are a variety of techniques available for introducing nucleic acids into viable cells. The techniques vary depending upon whether the nucleic acid is transferred into cultured cells in vitro, or in vivo in the cells of the intended host. Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc. The currently preferred in vivo gene transfer techniques include transfection with viral (typically retroviral) vectors and viral coat protein-liposome mediated transfection (Dzau et al, Trends in Biotechnology 11 :205-210 (1993), incorporated by reference). In some situations it is desirable to provide the nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc. Where liposomes are employed, proteins which bind to a cell surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake, e.g. capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half-life. The technique of receptor-mediated endocytosis is described, for example, by Wu et al., J. Biol. Chem. 262:4429-4432 (1987); and Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 87:3410-3414 (1990), both incorporated by reference. For review of gene marking and gene therapy protocols see Anderson et al, Science 256:808-813 (1992), incorporated by reference.

[00121]In a preferred embodiment, variant TNF-a genes are administered as DNA vaccines, either single genes or combinations of variant TNF-a genes. Naked DNA vaccines are generally known in the art. Brower, Nature Biotechnology, 16:1304-1305 (1998). Methods for the use of genes as DNA vaccines are well known to one of ordinary skill in the art, and include placing a variant TNF-a gene or portion of a variant TNF-a gene under the control of a promoter for expression in a patient in need of treatment. The variant TNF-a gene used for DNA vaccines can encode full-length variant TNF-a proteins, but more preferably encodes portions of the variant TNF-a proteins including peptides derived from the variant TNF-a protein. In a preferred embodiment a patient is immunized with a DNA vaccine comprising a plurality of nucleotide sequences derived from a variant TNF-a gene. Similarly, it is possible to immunize a patient with a plurality of variant TNF-a genes or portions thereof as defined herein. Without being bound by theory, expression of the polypeptide encoded by the DNA vaccine, cytotoxic T-cells, helper T-cells and antibodies are induced which recognize and destroy or eliminate cells expressing TNF-a proteins.

[00122]In a preferred embodiment, the DNA vaccines include a gene encoding an adjuvant molecule with the DNA vaccine. Such adjuvant molecules include cytokines that increase the immunogenic response to the variant TNF-a polypeptide encoded by the DNA vaccine. Additional or alternative adjuvants are known to those of ordinary skill in the art and find use in the invention.

[00123]Pharmaceutical compositions are contemplated wherein a TNF-a variant of the present invention and one or more therapeutically active agents are formulated. Formulations of the present invention are prepared for storage by mixing TNF-a variant having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed., 1980, incorporated entirely by reference), in the form of lyophilized formulations or aqueous solutions. Lyophilization is well known in the art, see, e.g., U.S. Pat. No. 5,215,743, incorporated entirely by reference. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as histidine, phosphate, citrate, acetate, and other organic acids;

antioxidants including ascorbic acid and methionine; preservatives (such as

octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl orbenzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; sweeteners and other flavoring agents; fillers such as microcrystalline cellulose, lactose, corn and other starches; binding agents; additives; coloring agents; salt-forming counter-ions such as sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic surfactants such as TWEEN®., PLURONICS® or polyethylene glycol (PEG). In a preferred embodiment, the pharmaceutical composition that comprises the TNF-a variant of the present invention may be in a water-soluble form. The TNF- α variant may be present as pharmaceutically acceptable salts, which is meant to include both acid and base addition salts. "Pharmaceutically acceptable acid addition salt" refers to those salts that retain the biological effectiveness of the free bases and that are not biologically or otherwise undesirable, formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as acetic acid, propionic acid, gly colic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like. "Pharmaceutically acceptable base addition salts" include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Particularly preferred are the ammonium, potassium, sodium, calcium, and magnesium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as

isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine. The formulations to be used for in vivo administration are preferably sterile. This is readily accomplished by filtration through sterile filtration membranes or other methods.

[00124]Controlled Release

[00125]In addition, any of a number of delivery systems are known in the art and may be used to administer TNF-a variants of the present invention. Examples include, but are not limited to, encapsulation in liposomes, microparticles, microspheres (e.g. PLA/PGA microspheres), and the like. Alternatively, an implant of a porous, non-porous, or gelatinous material, including membranes or fibers, may be used. Sustained release systems may comprise a polymeric material or matrix such as polyesters, hydrogels, poly(vinylalcohol), polylactides, copolymers of L-glutamic acid and ethyl-L-gutamate, ethylene-vinyl acetate, lactic acid-glycolic acid copolymers such as the LUPRON DEPOT®, and poly-D-(-)-3-hydroxyburyric acid. It is also possible to administer a nucleic acid encoding the TNF-a of the current invention, for example by retroviral infection, direct injection, or coating with lipids, cell surface receptors, or other transfection agents. In all cases, controlled release systems may be used to release the TNF-a at or close to the desired location of action.

[00126]The pharmaceutical compositions may also include one or more of the following: carrier proteins such as serum albumin; buffers such as NaOAc; fillers such as microcrystalline cellulose, lactose, com and other starches; binding agents; sweeteners and other flavoring agents; coloring agents; and polyethylene glycol. Additives are well known in the art, and are used in a variety of formulations. In a further embodiment, the variant TNF-a proteins are added in a micellular formulation; see U.S. Pat. No. 5,833,948, incorporated entirely by reference. Alternatively, liposomes may be employed with the TNF-a proteins to effectively deliver the protein. Combinations of pharmaceutical compositions may be administered. Moreover, the TNF-a compositions of the present invention may be administered in combination with other therapeutics, either substantially simultaneously or co-administered, or serially, as the need may be. The pharmaceutical compositions may also include one or more of the following: carrier proteins such as serum albumin; buffers such as NaOAc; fillers such as microcrystalline cellulose, lactose, corn and other starches; binding agents; sweeteners and other flavoring agents; coloring agents; and polyethylene glycol. Additives are well known in the art, and are used in a variety of formulations. In a further embodiment, the variant TNF-a proteins are added in a micellular formulation; see U.S. Pat. No. 5,833,948, incorporated entirely by reference. Alternatively, liposomes may be employed with the TNF-a proteins to effectively deliver the protein. Combinations of pharmaceutical compositions may be administered. Moreover, the TNF-a compositions of the present invention may be administered in combination with other therapeutics, either substantially simultaneously or co-administered, or serially, as the need may be.

[00127]Dosage forms for the topical or transdermal administration of a DN-TNF -protein disclosed herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The DN-TNF -protein may be mixed under sterile conditions with a pharmaceutically-acceptable carrier, and with any preservatives, buffers, or propellants which may be required.

[00128]The ointments, pastes, creams and gels may contain, in addition to the DN-TNF-protein, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.

[00129]Powders and sprays can contain, in addition to the DN-TNF-protein, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

[00130]The administration of the variant TNF-a proteins of the present invention, preferably in the form of a sterile aqueous solution, may be done in any number of ways but is preferably administered centrally, directly into the spinal cord. In another embodiments administration may be done peripherally, i.e., not intracranially, in a variety of ways including, but not limited to, orally, subcutaneously, intravenously, intranasally, transdermally, intraperitoneally,

intramuscularly, intrapulmonary, vaginally, rectally, or intraocularly. In some instances, intracranially may be preferred. In some instances, for example, in the treatment of wounds, inflammation, etc., the variant TNF-a protein may be directly applied as a solution, salve, cream or spray. The TNF-a molecules of the present may also be delivered by bacterial or fungal expression into the human system (e.g., WO 04046346 A2, hereby incorporated by reference).

[00131]In a preferred embodiment, variant TNF-a proteins are administered as therapeutic agents, and can be formulated as outlined above. Similarly, variant TNF-a genes (including both the full-length sequence, partial sequences, or regulatory sequences of the variant TNF-a coding regions) may be administered in gene therapy applications, as is known in the art. These variant TNF-a genes can include antisense applications, either as gene therapy (i.e. for incorporation into the genome) or as antisense compositions, as will be appreciated by those in the art.

[00132]In a preferred embodiment, the nucleic acid encoding the variant TNF-a proteins may also be used in gene therapy. In gene therapy applications, genes are introduced into cells in order to achieve in vivo synthesis of a therapeutically effective genetic product, for example for replacement of a defective gene. "Gene therapy" includes both conventional gene therapy where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA. Antisense RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes in vivo. It has already been shown that short antisense

oligonucleotides can be imported into cells where they act as inhibitors, despite their low intracellular concentrations caused by their restricted uptake by the cell membrane. (Zamecnik et al., Proc. Natl. Acad. Sci. U.S.A. 83:4143-4146 (1986), incorporated entirely by reference). The oligonucleotides can be modified to enhance their uptake, e.g. by substituting their negatively charged phosphodiester groups by uncharged groups.

[00133]Dosage

[00134]Dosage may be determined depending on the disorder treated and mechanism of delivery. Typically, an effective amount of the compositions of the present invention, sufficient for achieving a therapeutic or prophylactic effect, range from about 0.000001 mg per kilogram body weight per day to about 10,000 mg per kilogram body weight per day. Suitably, the dosage ranges are from about 0.0001 mg per kilogram body weight per day to about 2000 mg per kilogram body weight per day. An exemplary treatment regime entails administration once every day or once a week or once a month. A DN-TNF protein may be administered on multiple occasions. Intervals between single dosages can be daily, weekly, monthly or yearly.

Alternatively, A DN-TNF protein may be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the agent in the subject. The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, a relatively low dosage is administered at relatively infrequent intervals over a long period of time. Some subjects continue to receive treatment for the rest of their lives. In therapeutic applications, a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, and preferably until the subject shows partial or complete amelioration of symptoms of disease. Thereafter, the patent can be administered a prophylactic regime.

[00135]Toxicity. Suitably, an effective amount (e.g., dose) of a DN-TNF protein described herein will provide therapeutic benefit without causing substantial toxicity to the subject.

Toxicity of the agent described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD50 (the dose lethal to 50% of the population) or the LD100 (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index. The data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in human. The dosage of the agent described herein lies suitably within a range of circulating concentrations that include the effective dose with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the subject's condition. See, e.g., Fingl et al, In: The Pharmacological Basis of Therapeutics, Ch. 1 (1975).

EXAMPLES

[00136] Example 1 Genetic Ablation of Soluble TNF is Associated With Neuroprotection After Focal Cerebral ischemia

[00137] Mice- Homozygous mTNF ^AM (Ruuls et al. 2001) breeders were obtained from the Department of Biochemistry, University of Lusanne, kindly provided by Dr. Tacchini-Cottier and established as heterozygous mTNF ^A/wt breeding colonies at the animal facility of the Biomedical Laboratory, University of Southern Denmark. All experiments were performed on age-matched (8-12 weeks old) male, homozygous mTNFA/A mice and mTNF ^wt/wt littermates. Animals were housed in ventilated cages at a 12 h light/dark cycle, under controlled temperature and humidity, and with free access to food and water. Mice were cared for in accordance with the protocols and guidelines approved by the Danish Animal Health Care Committee and all efforts were made to minimize pain and distress (J. No. 2011/561-1950 and 2013-15-2934- 00924). [00138]Body composition measurements- Body composition was examined immediately before surgery on fully sedated mice using non- invasive Dual-Energy X-ray Absorptiometry (DXA) (PDGmus 2,Version 1.44, Lunar Corporation). This method provides accurate assessments of total tissue mass (g), bone mineral density (BMD, g/cm2), bone mineral content (BMC, g), bone area (cm2), fat mass (g), % fat tissue and lean tissue mass (g).

[00139]Behavioral assessments- Open field test. The open field test was performed using an odor- free, non-transparent plastic square arena measuring 45 (W) x 45 (D) x 40 (H) cm. The arena was divided into three zones (wall, interperi and center) and spontaneous movements in each zone were tracked using the SMART 2.5 Video Tracking System (Panlab Harvard

Apparatus) connected to a high resolution color video camera (SSC-DC378P, Biosite). Mouse behavior was recorded over a 10 min period and total distance traveled (m), as well as time spent in each zone were automatically recorded. Rearing, as a measure of stereotypical mouse behavior, was manually recorded and expressed as total number of events. [00140]Rotarod. The accelerating rotarod test was performed in two parts: a 4-trial pre-training and a 4-trial test using the LE8200 system (Panlab Harvard Apparatus). The pre-training was performed the day prior to the rotarod test and conducted at constant speed of 4 rpm. Inclusion criteria required that, during pre-training, mice kept their balance on the rotating rod for a minimum of 30 sec. Mice that did not meet these criteria were excluded. The rotarod test was conducted with accelerating speed from 4 to 40 rpm over a 5 min period, with each mouse performing in total 4 trials. After each trial, mice were transferred back to their cage and allowed to rest for 20 min to prevent exhaustion or stress. The time spent on the rod before fall was automatically recorded and the total time spent on the rod was calculated (Bach et al. 2012).

[00141]Grip strength test. Grip strength was measured 3 and 5 days after surgery using the grip strength meter (BIO-GT-3, BIOSEB) connected to a stainless steel grid. The mouse was pulled along the horizontal plane until the grip was released. The force applied by the mouse was automatically detected and recorded. Individual (right and left) and total (both) front paw strengths were measured before and after pMCAO and results plotted as□ grip strength in order to calculate asymmetry (changes in grip strength at day 3 and 5 compared to baseline). Each mouse was tested in 5 sequential trials and the highest force measured was selected as the final score for each mouse. No asymmetry was observed under baseline conditions (data not shown).

[00142]Rung walk test. Rung walk analysis was performed as described by Novrup et al. (2014) 2 days after induction of focal cerebral ischemia. Mice were allowed to transverse the rungs and filmed using a handheld GoPro HD camera with 48 fps. Data were evaluated frame by frame using VLC Mediaplayer (2.1.2, Rincewind). Left and right scores were calculated as follows: 6, complete miss; 5, touching the rung, but sliding off and losing balance; 4, touch, miss but no loss of balance; 3, replacement, mouse placed paw on rung but quickly removed it; 2, recorrection, aimed for rung but changed direction; 1, anterior or posterior placement; 0, perfect step. The total number of mistakes on each paw was plotted for analysis of asymmetry. Prior to surgery, mice were pre-trained in the rung walk test and no asymmetry was observed under baseline conditions (data not shown).

[00143]Y-maze test. Spontaneous alteration behavior and hence working memory was tested using the Y-maze test in naive mTNF ^AM and mTNF ^wt/wt as previously described. Each mouse was placed in the the arm designated (A) of the Y-maze field. The number of entries, except for the first two, into each arm (A, B, C) were recorded manually over a 8 min period and spontaneous alteration calculated based on these numbers.

[00144]Permanent focal cerebral ischemia- The distal part of the left middle cerebral artery (MCA) was permanently occluded (pMCAO) under surgical anaesthesia consisting of a mixture of Hypnorm® (fentanyl citrate 0.315 mg/ml and fluanisone 10 mg/ml, VetaPharma Ltd), Stesolid® (Diazepanum 5 mg/ml, Actavis) and distilled H20 in a 1 : 1 :2 ratio, as previously. The surgery was conducted on a 37°C heating pad to maintain a stable body temperature. An incision was made from the lateral part of the orbit to the external auditory meatus. The underlying superior pole of the parotid gland and the upper part of the temporal muscle were pushed in the distal direction after partial resection. A craniotomy was performed directly above the distal part of the MCA using a 0.8 mm high-speed microdrill. The bone was removed and the dura carefully opened. The distal part of the MCA was coagulated using bipolar forceps coupled to an electrosurgical unit (ICC 50, Erbe) ensuring a restricted cortical infarct. Post- operative treatment consisted of supplying the mice with physiological saline (0.9% NaCl) and Temgesic® (Buprenorphinum 0.3 mg/ml, RB Pharmaceuticals) three times during the first 24 h. The mice were allowed to survive for 1 or 5 days.

[00145]Sham mice were subjected to the same procedure, except the bipolar foreceps were applied in the superficial brain parenchyma next to the MCA, without coagulating the MCA.

[00146]Tissue processing and infarct volume analysis- Mice with 1 or 5 days post-surgical survival, in addition to naice control mice, were anesthetized with Pentobarbital (200 mg/ml)/Lidocain hydrochloride (20 mg/ml) (Glostrup Apotek, Denmark) prior to euthanation. The brains were removed, fresh-frozen in C02 snow and coronally cryo-sectioned into 30 μηι thick sections in 6 parallel series, 3 series were placed on microscope slides and 3 series in eppendorp tubes. Every sixth series was stained with Toludine Blue (TB) for visualization of the infarct area. The infarct was estimated on TB-stained serial sections utilizing the computer- assisted stereological test system CAST© 2000 (Olympus) and applying Cavalieri's principle for volume estimation. [00147]Immunohistochemistry- Naive mice were anesthetized with Pentobarbital (200 mg/ml)/Lidocainhydrochlorid (20 mg/ml) and transcardially perfused with 4%

paraformaldehyde (PFA) through the left ventricle. Brains were quickly removed and left in 4% PFA overnight, changed to 1% PFA and finally 0.1% PFA before they were cut horizontally on a vibratome (VT100S, Leica, Germany) into six 60 μιη-thick parallel series of free floating sections and cryoprotected in de Olmo's solution. One series from each animal was blocked for endogenous peroxidase activity using methanol and peroxidase in tris-buffered saline (TBS), then incubated with 10 % fetal bovine serum in 0.05 M TBS + 0.1 % Triton-XlOO (TBS-T) for 30 min. Sections were incubated with anti-Ibal primary antibody (rabbit, 1 :600, Wako) in TBS- T for 2 days at 4°C, followed by biotinylated anti-rabbit secondary antibody (1 :200, GE

Healthcare) in TBS-T for lh at RT. Sections were rinsed with TBS-T and incubated with horse radish peroxidase (HRP)-conjugated streptavidin (1 :200, GE Healthcare). Finally, sections were transferred to gelatine-coated glass slides, counter-stained with TB and coverslipped using Depex.

[00148]Neocortical volume estimation and quantification of Ibal ⁺ cells- The volume of the neocortex was estimated on one series of horizontally cut vibratome sections from naive control mice using Cavalieri's principle for volume estimation. The agranular insular cortex, orbital cortex, cingulate cortex, frontal cortex, pre-limbic cortex, granular insular cortex, retrosplenial agraular cortex, anterior parts of retrosplenial granular cortex, ectorhinal cortex, parietal cortex, temporal cortex and all areas of the occipital cortex (Lyck et al. 2007). Immunolabeled Ibal ⁺ cells were counted at a 60x magnification in the right hemisphere of 10-14 sections from each mouse by the use of CAST1 (Visiopharm). The number of Ibal ⁺ positive cells was recorded by systematically counting cells using a counting frame of 1,012.6 μπι2 and a X-Y step size of 350 μπι resulting in an area (a(step)) of 122,500 μπι2 to ensure that a representative sample consisting of a minimum of 100-200 cells were counted. The number of microglial cells per areal unit was calculated as previously described and expressed Ibal ⁺ cells/mm ² . The person performing the cell counting was blinded to the genotype.

[00149]Total RNA isolation and real time RT-PCR- Total RNA was extracted from one series of brain tissue with TRIZOL® according to manufacturer's instructions (Invitrogen). To ensure complete elimination of genomic DNA, RNA was further purified with RNeasy MinElute Cleanup Kit (Qiagen) in combination with DNA digestion using RNase-free DNase (Qiagen). Reverse transcription was performed with Omniscript (Qiagen), according to manufacturer's protocols. cDNA equal to 10-50 ng of initial total RNA was used as a template in each PCR reaction. Real time PCR was performed in the Rotor-Gene 3000 Real Time Cycler (Corbett Life Science) with QuantiTect SYBR Green PCR MasterMix (Qiagen). Relative expression was calculated by comparison with a standard curve, after normalization to β-actin gene expression.

[00150]Protein extraction and Western Blotting- One series of brain tissue was homogenized in 300 μΐ of RIPA buffer supplemented with Complete protease inhibitor cocktail (Roche

Diagnostics) and phosphatase inhibitor cocktail 1 (Sigma). The total protein concentration was quantified utilizing the Lowry assay. Proteins were resolved by SDS-PAGE on 8-11% gels, transferred to nitrocellulose and blocked in 5% non-fat milk in TBS-T. Membranes were probed overnight with antibodies against myelin associated glycoprotein (MAG) (mouse, 1 : 1,000, Santa Cruz Biotechnology), myelin basic protein (MBP) (mouse, 1 :5,000, Santa Cruz Biotechnology), TNFR1 (mouse, 1 :500, Santa Cruz Biotechnology), and β-tubulin (mouse, 1 :5,000, Sigma), followed by HRP-conjugated secondary antibodies (GE Healthcare/Amersham). Proteins were visualized with Super Signal West Pico chemiluminescent substrate (Thermo Scientific) and bands quantified with Quantity One software (Biorad). Data were normalized against β-tubulin and expressed as percent of naive mTNFwt/wt.

[00151 JStatistics- Real-time PCR was analyzed with one-way ANOVA followed by Tukey's test for multiple comparisons. For single comparisons, Student's t-test was applied. P values < 0.05 were considered statistically significant. Data are presented as mean ± SEM.

[00152]Results

[00153]Characterization of naive mTNF ^AM mice.

[00154]Studies were initiated by investigating whether the absence of solTNF caused any phenotypical abnormalities in mTNFA/A mice under naive conditions. First, a radiographic assessment of total body mass was obtained, bone mineral density, bone mineral content, bone area, % fat tissue, and % lean mass using the DXA scanner and found no difference between mTNF and mTNF ^wt mice. Since TNF knockout (TNF-/-) mice have been reported to show abnormalities in spatial memory and locomotor activity, whether mTNF ^AM mice displayed altered behavioral phenotypes was investigated. In the Y-maze for spontaneous alternation, which measures the willingness of rodents to explore new environments (activity involving areas of the brain such as hippocampus, septum, basal forebrain, and prefrontal cortex), it was found that the total number of Y-maze entries (Fig 3 A) and the spontaneous alternation percentage (%) (Fig. 3B) were comparable between mTNFA/A and mTNFwt/wt mice. In the open field test for spontaneous locomotion and anxiety-related behavior, no differences in all parameters evaluated including number of rearings (Fig. 3C), total distance traveled (Fig. 3D), and center/perimeter ratio (Fig. 3E) were found. Finally, the rotarod test showed comparable motor coordination (Fig. 3F) and the grip strength test comparable neuromuscular function (Fig. 3G) between mTNFA/A and mTNFwt/wt mice. Collectively, these data show that absence of solTNF does not compromise normal memory and/or locomotor function. Since TNF-/- mice do display abnormalities in such behaviors, this suggests that mTNF is not only sufficient but necessary for maintenance of normal function in mice. Since in previous studies a significant reduction of microglial cell number in the neocortex of TNF-/- mice compared to WT using flow cytometry was observed, the number of Ibal+ cells in the neocortex of mTNFA/A mice in comparison to mTNFwt/wt mice were assessed and found no difference in the density of Ibal + microglial cells between the two genotypes (Fig. 3H,I). Similarly, no appreciable morphological differences were observed neither in cell shape or branching (Fig. 3H). Total neocortex volume was measured in parallel, and no differences were observed (Fig.3 J). These data indicate that absence of solTNF does not result in microglial alterations in the brain and suggests that mTNF signaling is necessary and sufficient to maintain normal microglia homeostasis under naive conditions.

[00155]Genetic ablation of soluble TNF reduces infarct volume and improves asymmetry and neuromuscular function after pMCAO

[00156]To examine the effect of solTNF ablation on ischemic injury, infarct volumes between mTNFA/A and mTNFwt/wt mice after pMCAO (Fig. 4A,B) was compared. The volume of the injury was found to be significantly smaller in mTNFA/Δ mice 1 day after injury (Fig. 4B). Tissue sparing was maintained over time, as injury volume was still significantly reduced at 5 days after pMCAO in mTNFA/A mice compared to mTNFwt/wt littermates (Fig. 4B). To assess whether tissue sparing after pMCAO in mTNFA/A mice translated into improved locomotor and sensory-motor function, we assessed mouse behavior 2, 3 and 5 days after pMCAO with various tests. In the open field test 2 days after pMCAO, no difference was found between mTNFA/A and mTNFwt/wt mice in total distance traveled (Fig 4C), center/perimeter ratio (Fig 4D), and number of center and wall rearings (Fig. 4E). Rung walk analysis on day 2 showed that mTNFwt/wt mice displayed a clear asymmetry with significantly more missteps of their right front limbs compared to the left front limbs (Fig. 5A). This correlated with the large cortical infarct measured in mTNFwt/wt mice. In contrast, mTNFA/A mice did not show significant asymmetry of their front limbs (Fig. 5A), which may be due to the smaller cortical infarct and increased tissue sparing. The reduced infarct volume in mTNFA/A did not result in improved motor coordination, as mTNFA/A and mTNFwt/wt mice performed similarly on the rotarod at both 3 and 5 days after pMCAO (Fig. 5B). When neuromuscular function using the grip strength test on the front paws after pMCAO was analyzed a significant asymmetry with loss of grip strength in the contralateral side (right, R) in mTNFwt/wt mice at 3 and 5 days post pMCAO, compared to baseline values was observed. On the contrary, mTNFA/A did not show loss of grip strength in the contralateral side as a consequence of the infarct and no significant asymmetry was measured between the front paws (Fig. 5C).

[00157]Genetic ablation of soluble TNF does not result in changes of pro-inflammtory gene expression after pMCAO

[00158]To further investigate whether the functional improvement of mTNF Δ/Δ mice was associated with a modulation of the inflammatory response, the expression of pro -inflammatory cytokines and chemokines using real-time RT-PCR 1 day after pMCAO was investigated. It was found that IL- 1 , IL-6, CXCL 1 , CXCL 10, and CCL2 mRNA levels were significantly upregulated after stroke, but no significant difference was observed between mTNFA/A mice and mTNFwt/wt littermate controls (Fig. 6). Compared to naive mice, TNF mRNA expression was upregulated not only after pMCAO but in sham-operated mice as well. In sham conditions TNF mRNA upregulation was significantly higher in niTNFwt/wt controls as compared to mTNF Δ/Δ mice.

[00159]Assement of myelin and TNFRl protein expression in the brain after pMCAO

[00160]Based on previous observed effects of TNF on oligodendrocyte progenitor proliferation and myelination (Arnett et al. 2001), expression of select myelin proteins after pMCAO, namely MBP and MAG, was investigated and found no changes (Fig. 7). Since TNF has been shown to be neuroprotective through TNFRl, we evaluated TNFRl expression. Significant upregulation in mTNFA/A naive and sham mice compared to controls was found. Despite tendencies to increased TNFRl protein levels in mTNFA/A mice 1 day after pMCAO, no significant difference was observed between mTNFA/A and mTNFwt/wt mice (p = 0.08), which could be attributed to the influx of immune- inflammatory cells from the periphery (e.g. neutrophils, macrophages), all expressing high levels of TNFRl (Fig. 7).

[00161]Accordingly, the present study demonstrates that genetic ablation of solTNF is neuroprotective following focal cerebral ischemia. As such, selective TNF inhibitors, such as XProl595, that selectively target only solTNF may be prove beneficial in reducing lesion volume, inflammation and improving functional outcome following stroke.

[00162] Example 2 Systemically administered anti-TNF therapy ameliorates functional outcomes after focal cerebral ischemia

[00163] Animals

[00164]Adult male C57BL/6 mice (7-8 weeks, n=256) were purchased from Taconic Ltd.

(Denmark) and transferred to the Laboratory of Biomedicine, University of Southern Denmark, where they were allowed to acclimatize for 7 days (d) prior to surgery. Animals were housed under diurnal lighting conditions and given free access to food and water. All animal experiments were performed in accordance with the relevant guidelines and regulations approved by the Danish Animal Ethical Committee (J. no. 2011/561-1950 and 2013-15-2934- 00924).

[00165]Induction of permanent middle cerebral artery occlusion [00166]The distal part of the left middle cerebral artery (MCA) was permanently occluded under Hypnorm/Dormicum anesthesia [fentanyl citrate (0.315 mg/ml; Jansen-Cilag) and Fluanisone (10 mg/ml; Jansen-Cilag); and midazolam (5 mg/ml; Hoffmann-La Roche), respectively]. After surgery, mice were injected subcutaneously with 1 ml of 0.9% saline and allowed to recover in a 25°C controlled environment. Mice surviving for 5d were returned to the conventional animal facility after 24 hours (h). For post-surgical analgesia, mice were treated with Temgesic (0.001 mg/20 g buprenorphinum; Reckitt & Colman) three times at 8-hour intervals starting immediately prior to surgery.

[00167]Group size and study design

[00168]The size of the ischemic infarct was measured in three separate randomized, double- blinded, vehicle-controlled studies in mice allowed to survive for 6 hours (n = 30), 1 day (n = 60) and 5 days (n = 74) after induction of permanent middle cerebral artery occlusion

(pMCAO). In order to evaluate the effect of ischemia on functional outcome and the acute phase response, a group of sham-treated mice were included at all time points (total n = 35).

Furthermore, unmanipulated controls were included in flow cytometric and microparticle analyses (total n = 27). A total of 12 mice were excluded due to lack of infarct in mice subjected to pMCAO or presence of unintended infarcts in shams. Mortality was 1.8% and there were no difference in mortality between the different treatment groups.

[00169]Pharmacological treatment

[00170]XProl 595 or etanercept (Enbrel, Amgen-Wyeth) were administered once, intravenously (i.v.) at a dose of 10 mg/kg, 30min after surgery. Saline was used as vehicle. Mice subjected to sham surgery were given an i.v. injection of saline 30min after surgery. The peak concentration in serum (Cmax) after murine i.v. dosing of XProl595 at 10 mg/kg was 945.7 Dg/mL and the terminal half-life was 19.1 hr (data not shown).

[00171]Physiological parameters

[00172]Mice were weighed at the time of pre-training, before surgery, and 1, 3 and 5d after surgery. Rectal temperature was measured prior to and 30min and 3h after surgery.

[00173]Behavioral tests [00174]Functional outcomes were evaluated 1, 3 and 5d after pMCAO using different behavioral tests designed to detect motor deficits. Prior to behavioral testing, mice were allowed to acclimatize in the behavior room.

[00175]Grip strength test: The grip strength meter (BIO-GT-3, BIOSEB) was used to study neuromuscular function in mice subjected to pMCAO and sham surgery. The peak amount of force was recorded in 5 sequential trials and the highest grip value was recorded as the score. The grip strength was analyzed in individual (left and right) front paws prior to (baseline) and 1, 3 and 5 days after pMCAO. The unit of force measured is presented as grams (g). Asymmetry between paws in individual mice following pMCAO was calculated and are presented as delta (□) grip strength (g). Mice that were allowed to survive for 1 d were tested on day 1 and mice that were allowed to survive for 5d on day 3 and 5.

[00176]Horizontal rod test: In order to test motor coordination, dynamic balance and asymmetry, mice were placed on the centre of a horizontal rod, located 80 cm above the floor. Mice were allowed to explore and walk the rod for 3min. The frequency of right and left hindlimb slips was recorded and the total distance travelled was tracked using the SMART video tracking software (Panlab).

[00177]Rotarod performance test: To evaluate drug-induced differences, motor

coordination/performance and balance, we performed the rotarod test (LE8200, Panlab Harvard Apparatus). The test comprised a pre-training part prior to surgery (30 sec at 4 rotations per minute (rpm)) and a trial part consisting of 4 trials (Tl - T4) 1 or 5d after surgery. Mice were placed on the rotarod set in accelerating mode. Speed of the rotor was accelerated from 4 to 40 rpm over 5 min. Time spent on the rotarod in each trial for each mouse was recorded.

[00178]Tissue processing

[00179]Fresh frozen tissue: Mice were killed by cervical dislocation, and brains and livers were quickly removed, frozen in C02 and stored at -80°C until further processing. Blood samples were collected in EDTA-coated Eppendorf tubes, spun 2x lOmin at 3,000g, 4°C, and stored at - 80°C until further processing. Brains were cut coronally in 6 parallel series of 30 μπι and liver samples into 30 μπι cryostat sections and stored at -80 °C until further processing. [00180]Perfusion fixed tissue: Mice were deeply anesthetized with an overdose of pentobarbital containing lidocaine and perfused through the left ventricle using 4% paraformaldehyde (PFA) as previously described. Brains were cut coronally in 6 parallel series as free-floating 60 μηι thick sections and stored in a cryoprotective solution at -12°C or into 12 parallel series as 20 μιη thick cryostat sections and stored at -20°C until further processing.

[00181]Flow cytometric analysis: Mice were anesthetized i.p. with an overdose of pentobarbital containing lidocaine and perfused through the left ventricle using phosphate-buffered saline (PBS) as previously described. Prior to perfusion, 80 μΐ blood was collected from each mouse using EDTA-coated capillaries and placed in Hanks' balanced salt solution as previously described. Furthermore, spleen and ipsi- and contralateral cortices were quickly removed and processed as previously described.

[00182]Infarct volumetric analysis

[00183]Every sixth section was stained with toluidine blue (TB) for direct infarct volume estimation using the Cavalieri principle as previously described. In addition, in order to correct for edema, the volume of the contralateral and the nonischemic ipsilateral cortex and the volume of injury spanning from 1,080 μηι anterior to 1,080 μηι posterior of the anterior commissure was compared using an indirect method of infarct volume estimation.

[00184]qPCR

[00185]Liver and brain mRNAs were extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. cDNA was prepared as previously described and qPCR analysis perfomed using the following conditions: 5min primer extension at 25°C, followed by 25min reverse trancription at 55 °C and finally 5min enzyme inactivation at 95°C as previously described. Samples were run against standard curves generated from serially diluted cDNA from liver samples obtained from mice subjected to pMCAO. Primer sets were designed by

PrimerDesign Ltd. and analysed using SYBR green as previously described [20]. Primer sets were:

[00186]SAA2 (forward: TTCATTTATTGGGGAGGCTT (SEQ ID NO: 3) and

reverse: GCCAGCTTCCTTCATGTCAG (SEQ ID NO: 4)), [00187] SAP (forward: CAAGGCGGCAGAGTTCAC (SEQ ID NO: 5) and reverse:

GGAGAGGATTTTTATTTGGC (SEQ ID NO: 6)),

[00188]CCL2 (forward: TGAAGTTGACCCGTAAATCTGAA (SEQ ID NO: 7) and

[00189]reverse: AGGCATCACAGTCCGAGTC (SEQ ID NO: 8)),

[00190]IL-1 β (forward: TGTAATGAAGACGGCACAC (SEQ ID NO: 9) and reverse:

TCTTCTTTGGGTATTGCTTGG (SEQ ID NO: 10)),

[00191]CXCL1 (forward: GCTGGGATTCACCTCAAGAAC (SEQ ID NO: 11) and reverse: TGTGGCTATGACTTCGGTTTG (SEQ ID NO: 12)),

[00192]CXCL10 (forward: CATCCCGAGCCAACCTTCC (SEQ ID NO: 13) and reverse: CACTCAGACCCAGCAGGAT (SEQ ID NO : 14)),

[00193 ]IL- 10 (forward: AGGACTTTAAGGGTTACT (SEQ ID NO: 15) and reverse:

AATGCTCCTTGATTTCTG (SEQ ID NO: 16)),

[00194]iNOS (forward: GGACAGCACAGAATGTTCCAGAA (SEQ ID NO: 17) and reverse: CAAAATCTCTCCACTGCCCCAG (SEQ ID NO: 18)), and

[00195]TNF (forward: GCCTCCCTCTCATCAGTTCTAT (SEQ ID NO: 19)

and reverse: TTTGCTACGACGTGGGCTA (SEQ ID NO: 20)).

Argl primers (Mm00475988_ml) were purchased from Life technologies. Liver results were reported relative to the expression of the housekeeping gene glyceraldehyde phosphate dehydrogenase (GAPDH) [20]. All data were normalized to the corresponding sham group, which at all time points represented a mean value of 1. Brain TNF, IL-1 β and CD1 lb mRNA qPCR analyses were performed as previously described.

[00196]Immunohistochemistry

[00197]Immunohistochemical staining for TNF was performed using the alkaline phosphatase- conjugated rabbit anti-TNF antibody (Sigma- Aldrich) as described in Lambertsen et al.

Visualization of the Mac-1 antigen (CD1 lb; AbDSerotec) on fresh frozen sections and the Grl antigen (Ly-6G and Ly-6C, BD Biosciences) on free-floating vibratome sections was performed with the streptavidin/horseradish peroxidase technique. Substitution of the primary antibody with serum IgG or specific isotype controls gave no signal.

[00198]Western blotting

[00199]Total protein was extracted in 1% lysis buffer (RIP A, Merck Millipore) containing a soluble protease inhibitor cocktail (Roche Diagnostics) according to Lambertsen et al. Protein concentrations were estimated using the Bradford Protein Quantification method. Western blotting analysis for TNF (Abeam, 1 :2,000) was performed using 20 μg protein extract separated on bis/tris 4-12% SDS-PAGE gels (Nupage, Invitrogen) essentially as previously described. SeeBlue Plus2 prestained standard (Invitrogen) was used as a molecular weight marker and 0.5ng 17 kDa murine recombinant TNF (Sigma Aldrich) was included as a positive control. Densitometry was performed using ImageJ analysis software (version 1.47v) (NIH) following recommendations of the Image J developers. Analysis was performed on two independent gels with n=2/group.

[00200]Flow cytometry

[00201]Flow cytometry was performed essentially as previously described using the

FACSVerse (BD Biosciences) and data analysed using the FACSuite software. TNF+ microglia [CDl lb+CD45dim], TNF+ macrophages [CDl lb+CD45highGrl-] and TNF+ granulocytes [CD1 lb+CD45highGrl+] were identified as previously detailed. Control mice and mice allowed 6 and 24h survival after pMCAO were treated i.v. with either saline, XProl595 or etanercept 30min after surgery.

[00202]Prior to fixation, cells were stained for live/dead cells for 30min at 4°C using a Fixable Viability Dye eFluoro 506 (eBioscience) diluted in PBS. A total of 1,000,000 events were collected using FSC and SSC and analysis of the live/dead gate revealed comparable numbers of dead cells in all the samples. In addition blood and spleen samples were collected and analysed for CD45, CD1 lb, Grl, and CD3 expression.

[00203 ]Positive staining for TNF (Biolegend), CDl lb, CD45, Grl, and CD3 (BDPharmingen) was determined based on fluorescence levels of the respective isotype controls (Biolegend and BD Pharmingen). The Mean Fluorescence Intensity (MFI) was calculated as the geometric mean of each population in the TNF, CD45 and CD1 lb positive gates, respectively.

[00204]Estimation of polymorphonucleated cells within the infarcted cortex

[00205]The number of polymorphonuclear cells/mm2 as a measure for granulocyte infiltration 6h and Id after pMCAO was estimated based on nuclear morphology using TB-stained sections. In practice, calibrated high-power fields (40x) located within the infarct area, and spanning from 1,080 μπι anterior to 1,080 μπι posterior of the anterior commissure, were photographed and manually counted by a blinded observer on a minimum of 10 frames from each mouse.

[00206]Microvesicle analysis

[00207]In total, 1 ΟΟμΙ of plasma was diluted 1 : 10 in Dulbecco's sterile filtered PBS (Sigma) and centrifuged at 30,000g for lh to remove interfering lipoprotein particles. The pellet was resuspended in ΙΟΟμΙ PBS containing 0.1% bovine serum albumin (Sigma) diluted 1 : 10 in PBS immediately prior to analysis. Microvesicle size and concentration were determined by

Nanoparticle Tracking Analysis (NTA) using a NS500 analyser equipped with a 488 nm laser and NTA software (Nanosight Ltd) as previously described. Analysis settings were standardised using lOOnm colloidal silica microspheres (100, 150, 300 and 400 nm; Polysciences) and these data were used to verify size measurements and calibrate concentration measurements. Five 30- second videos were made for each sample. The sample was advanced with a 5-second delay between each recording using the script control facility. The videos were analysed in batch process mode using automatic blur and minimum expected particle size with an automatic detection threshold level 10, after visually checking that the five size profiles on the screen were in concordance.

[00208]Data analysis

[00209]Quantitative data are presented as means ± SEM. Weight and temperature analyses were performed using two-way repeated measures (RM) ANOVA. Infarct volumetric analysis, qPCR, flow cytometry, grip strength and microvesicle analyses were performed using one-way

ANOVA. Grip strength asymmetry and horizontal rod analyses were performed using paired t tests. Pearson correlation analysis was used to analyse correlations between liver chemokines and between microvesicle counts and infarct volumes. All statistical analyses were followed by the appropriate post hoc test and performed using Prism 6 software for Macintosh (GraphPad Software) and considered significant at P<0.05.

[00210]RESULTS

[0021 l]Systemically injected anti-TNF therapy does not affect infarct size after permanent focal cerebral ischemia

[00212]Focal cerebral ischemia produced a cortical infarct, which was visible in TB stained sections at 6h, 24h and 5d after pMCAO (Figure 8A). Comparison of mean infarct volumes showed that anti-TNF therapy targeting either solTNF using XProl595 or both solTNF and tmTNF using etanercept did not affect infarct size at 6h (P=0.79), 24h (P=0.76) or 5d (P=0.92) after pMCAO (Figure 8B). In line with previous studies[24], it was found that in all three groups infarct size had decreased at 5d, most likely as a result of edema resolution and resorption of infarcted tissue. Indirect infarct volumetric analysis also revealed no differences in edema formation between the different groups (data not shown). [00213]XProl 595 and etanercept improve functional outcome after focal cerebral ischemia

[00214]Behavior and motor function were evaluated in mice subjected to pMCAO and treated with either XProl595 or etanercept. To identify and validate significant behavioral

improvements, groups of mice subject to sham surgery were also included. A post-surgical weakness of both the left (L) and right (R) front paws in saline- and XPro 1595 -treated mice 3 and 5 days after pMCAO compared to normal baseline grip strength (Figure 9A) was detected. Etanercept-treated mice showed no difference on the left paw, however a significant reduction on the right paw (Figure 9A). XProl 595- and etanercept-treated mice performed significantly better on day 3 compared to saline-treated mice (Figure 9A). Further, grip strength analysis showed significant pMC AO-induced front paw asymmetry in saline-treated mice 24h and 5d after pMCAO as compared to sham mice and pre-treatment baseline grip strengths (represented by delta (□) values) (Figure 9B). Minor asymmetry was observed in XProl 595- treated mice at 24h, but not at 5d (Figure 9B). No asymmetry was observed in etanercept-treated mice. The grip strength data indicate that anti-TNF therapy ameliorates neuromuscular asymmetry normally caused by pMCAO.

[00215]The horizontal rod test supported the findings from the grip strength test in saline- treated mice, but showed no asymmetry of the hindlimbs in XProl 595- and etanercept-treated mice 24h and 5d after pMCAO (Figure 9C). No difference in distance travelled (cm) (P=0.52, data not shown) or speed (cm/sec) (P=0.82, data not shown) between sham and saline-treated pMCAO mice was found. Also, distance travelled and speed in anti-TNF-treated mice were comparable to sham and saline-treated mice. The rotarod test showed significantly altered motor learning skills in saline-treated mice 24h and 5d after pMCAO compared to sham mice, a change which was not observed in XProl 595- and etanercept-treated mice (Figure 9D). These data suggest that XProl 595 and etanercept improved motor learning skills after focal cerebral ischemia.

[00216]Physiological parameters

[00217]To exclude the possibility that the improved behavioral effects were merely a result of reduced core temperature, which is neuroprotective, rectal body temperature during and after anti-TNF therapy was monitored. Results showed that all groups experienced a significant anesthesia-induced drop in rectal temperature 30min and 3h after surgery (PO.001), an outcome induced by the immobilization of the mice, however there were no differences between treatment groups. Also, no differences were observed in changes in body weights (□ weight loss (g)) at any time point between treatment groups. However, all 4 groups of mice displayed a significant drop in weight from baseline to day 3 (PO.0001 for all groups) and day 5 (P<0.01 for saline, XProl 595 and etanercept); however the weight drop at day 5 was less in the sham group (PO.05).

[00218] Anti-TNF therapy affects microglial activation

[00219]It has been previously shown that TNF is produced by preferentially microglia

(CD1 lb+CD45dim cells) and macrophages (CD1 lb+CD45highGrl -cells) after pMCAO.

Consequently, whether anti-TNF therapy altered microglial/leukocyte responses in the brain was examined. To evaluate the effect of XProl 595 and etanercept on microglial/leukocyte reactions, the number of CD1 lb+CD45dim microglia and CD1 lb+CD45high leukocytes in the different treatment groups after pMCAO was investigated (Figure ΙΟΑ,Β)· The total number of

CD1 lb+CD45dim microglia was found to be significantly increased in all treatment groups at 6h and 24h after pMCAO compared to unlesioned control mice. Interestingly, when the CD1 lb+CD45dim microglial population was evaluated in mice treated with either XProl595 or etanercept and allowed 24h survival, the estimated number of CD1 lb+CD45dim microglia in the lesioned cortex had increased in etanercept-treated mice, though not quite significant, and significantly in XPro 1595 -treated mice as compared to saline treated mice (Figure 10B, upper left graph). Estimation of the number of infiltrating CD1 lb+CD45high leukocytes showed a significant increase in all treatment groups at 24h compared to unlesioned control mice, but otherwise revealed no difference among treatment groups (Figure 10B, upper right graph). The total number of CD1 lb+CD45dim microglia was also found to increase at 24h in the contralateral cortex (P<0.01) but no changes were found between treatment groups (P>0.05, data not shown). The total number of CD1 lb+CD45high leukocytes did not change in the contralateral cortex after pMCAO in any of the treatment goups (P>0.05, data not shown).

[00220]Since microglia and leukocytes become activated by pMCAO, it was investigated whether the cellular level of CD45 at 24h, a protein known to be involved in activation of hematopoietic cells, was affected. MFI analysis showed a significant increase in CD45 by microglia in XPro 1595 and etanercept treated mice as compared to saline treated mice (Figure 10B, lower left graph); however CD45 expression was comparable on leukocytes 24h after pMCAO (Figure 10B, lower right graph). Furthermore, since TNF has directly shown to regulate CD1 lb expression in mouse microglial cells, it was also investigated whether CD1 lb expression was affected by TNF treatment 24h after pMCAO. However, no differences were observed in the MFI for CD1 lb by microglia or leukocytes (P=0.73 and P=0.79, respectively, data not shown). MFI values for CD45 and CD1 lb did not change in the contralateral cortex, neither for microglia (P = 0.94 and P = 0.17, respectively, data not shown) nor for leukocytes (P = 0.07 and P = 0.33, respectively, data not shown). These results suggest that microglial activation is increased in the ipsilateral hemisphere in anti-TNF- treated mice. Using immunohistochemistry, CD1 lb+ cells were found to be distributed similarly in all 3 treatment groups (Figure IOC, shown for saline only). Based on the increased number of CD1 lb+CD45dim microglia 24h after pMCAO in anti-TNF treated mice, it was next investigated whether anti-TNF therapy affected the phenotype of microglial activation after pMCAO. Using qPCR, we found no differences in CD1 lb mRNA or iNOS mRNA levels between saline and anti-TNF treated groups (Figure 10D). In contrast, IL-Ι β mRNA levels were found to be significantly increased in etanercept-treated mice compared to saline-treated mice 24h after pMCAO, suggesting that blocking both solTNF and tmTNF increases mRNA levels of this pro- inflammatory cytokine. Even though Argl mRNA levels were found to change significantly over time in saline- and Xpro 1595 -treated mice, there were no difference between treatment groups at the different time points investigated. The same was true for IL-10 mRNA levels, which were found to change significantly over time in saline-treated mice but no differences were observed between treatment groups. These findings suggest that etanercept treatment may induce mRNA changes associated with a Ml phenotype at 24h, whereas no changes were observed between treatment groups in M2 phenotype.

[00221]Changes in TNF levels in mice treated with anti-TNF therapy

[00222]TNF mRNA+ cells were observed within the infarct and peri-infarct in all groups after pMCAO (Figure 11A, shown for saline only). Cells were most numerous at 24h, with very few cells observed at 5d. These findings were confirmed by qPCR, showing a transient increase in TNF mRNA at 24h (Figure 11 A). As part of the APR to brain injury, TNF mRNA+ cells were also found in the liver primarily 6h after pMCAO, as supported by qPCR analysis (Figure 1 IB). By 24h, there was a significant reduction in TNF mRNA transcription in the liver in saline- and XPro 1595 -treated mice, consistent with findings of very few TNF mRNA+ cells. To study whether anti-TNF therapy was capable of reducing TNF levels in the brain within the therapeutic window, we first performed immunohistochemistry on tissue from mice that had survived 6h, 24h and 5d after pMCAO (Figure 11C). At 6h, TNF+ microglial/leukocyte-like cells were located within the infarct and in the peri-infarct in saline-treated mice 6h after pMCAO (inserts in Figure 11C) and rarely observed in anti-TNF treated mice. At 24h and 5d, cells were found to be located in the infarct and in the peri-infarct (low magnifications in Figure l lC, shown for 24h only) in all treatment groups. The cells were found to have

micoglial/leukocyte-like morphology (high magnifications in Figure 11C). In order to support the findings of reduced TNF+ cells at 6h in anti- TNF treated mice, Western blotting for TNF was performed on brain tissue from mice with 6h and 24h survival (Figure 1 ID). Reduced TNF levels were found at 6h in XPro 1595 -treated mice, and even more so in etanercept-treated mice, as compared to saline-treated mice, suggesting that both types of anti-TNF therapies were capable of reducing TNF availability within 6h after pMCAO. At 24h, comparable TNF levels were found by Western blotting, supporting the immunohistochemistry data. Using flow cytometry, changes in the number of TNF producing microglia (TNF+CDl lb+CD45dim cells), macrophages (TNF+CDl lb+CD45highGrl - cells) and granulocytes

(TNF+CDl lb+CD45highGrl+ cells) 6h and 24h after pMCAO compared to unlesioned control mice (Figure 1 IE) were investigated. A tendency to reduced number of TNF+CDl lb+CD45dim microglia in Xprol 595-treated unlesioned control mice and mice with 6h survival was found, however this was not significant (Figure 1 IE, upper panel). At 24h, the number of

TNF+CDl lb+CD45dim microglia had increased significantly in all treatment groups compared to unlesioned control mice with no differences between treatment groups (Figure 1 IE). TNF+ macrophages (TNF+CDl lb+CD45highGrl - cells) and TNF+ granulocytes

(TNF+CDl lb+CD45highGrl+ cells) (Figure 1 IE, lower panel) were not detected by flow cytometry in the ischemic infarct until 24h after pMCAO and at this time point there were no differences between treatment groups. Note that at 24h, the total number of TNF-producing leukocytes was significantly lower than the number of TNF-producing microglia (Figure 1 IE, please compare upper graph with lower graph).

[00223] Anti-TNF therapy affects granulocyte infiltration into the infarct 24h after focal cerebral ischemia

[00224]As TNF facilitates granulocyte infiltration into the CNS, the number of granulocytes in the infarct 6 and 24h after pMCAO were counted(Figure 12). Based on their characteristic nuclear morphology (2-5 lobes), which was further verified using an anti-Grl antibody (Figure 12 A, left), comparable numbers/mm2 of granulocytes 6h after pMCAO, but increased numbers/mm2 in saline-treated mice 24h after pMCAO compared to anti-TNF-treated mice were observed (Figure 12B). Using flow cytometry, a significant increase in the number of CD1 lb+CD45highGrl+ granulocytes at 24h compared to unlesioned control mice were found, however the number was comparable in the whole ipsilateral cortex in all three groups at all time points investigated (Figure 12C).

[00225]Anti-TNF therapy affects the liver acute phase response after focal cerebral ischemia

[00226]Since anti-TNF therapy improved functional outcome without affecting infarct size, and since suppression of the APR previously has been shown to correlate with improvements in behavior in motivational tests, the peripheral APR was analyzed. Hepatic expression of chemokine ligand CXCLIO, involved in monocyte/macrophage and NK cell infiltration, was significantly altered by etanercept at 24h compared to 6h and 5d after pMCAO (Figure 13 A). CXCLIO mRNA levels in saline- and XPro 1595 -treated mice remained relatively constant over time, whereas a significant increase in etanercept-treated mice was observed. Since no effect was observed of blocking only solTNF on CXCLIO mRNA, these data suggest a close interplay between tmTNF and CXCLIO mRNA regulation in the liver. At 6h after pMCAO, mRNA levels of hepatic CXCLl, primarily involved in granulocyte infiltration, were significantly lower in etanercept-treated mice compared to XProl 595-treated mice (Figure 13A). At 5d, an overall drop in CXCLl mRNA in saline- and XPro 1595 -treated mice, but not in etanercept-treated mice was observed. These data suggest that liver CXCLl mRNA expression is affected differently by tmTNF and solTNF after pMCAO.

[00227]Hepatic CCL2, a chemokine primarily referred to as monocyte chemotactic protein, mRNA levels were only affected in XPro 1595 -treated mice, which displayed a transient increase 24h after pMCAO compared to both 6h and 5d (Figure 13 A), suggesting that solTNF plays a role in recruitment of monocytes into the liver.

[00228]The mRNA levels of IL-Ι β, which is known to be involved in neurotoxicity after focal cerebral ischemia, were significantly increased 24h after pMCAO in anti-TNF treated mice (Figure 13 A) but there were no differences between saline-, XProl595- and etanercept-treated mice.

[00229]Two late phase APR proteins, serum amyloid A2 (SAA2) and serum amyloid P- component (SAP), both of which are known to be regulated by proinflammatory cytokines such as TNF and IL-1 β, were also investigated (Figure 13 A). Anti-TNF therapy following pMCAO did not influence liver SAA2 or SAP mRNA levels. Liver SAP mRNA levels did not differ at any time point after pMCAO.

[00230]Flow cytometric analyses of spleen leukocyte populations (Figure 13B) showed that the number of CD45+CD3+ T cells in the spleen was significantly decreased in XProl595- and etanercept- treated mice 24h after pMCAO compared to unlesioned control mice. Furthermore, the number of T cells was significantly decreased in etanercept-treated mice compared to saline- treated mice at 24h (Figure 13B). These findings can possibly be explained by reports of increased caspase- induced apoptosis induction of T cells in spleen following treatment with anti-TNF therapies, such as infliximab. In the spleen significant changes in the total number of spleen CD1 lb+CD45highGrl - monocytes in XPro 1595 -treated mice with a significant increase at 6h and a significant decrease at 24h compared to unlesioned XProl 595-treated control mice were found (Figure 13B). No changes were observed in saline- or etanercept-treated mice and no significant difference was obeserved between groups. Also the total number of spleen CD1 lb+CD45highGrl+ granulocytes changed significantly over time compared to unlesioned control mice. There was as significant increase in all groups of mice at 6h and a significant decrease in saline- and XProl 595-treated mice at 24h (Figure 13B). Flow cytometric analyses of blood leukocyte populations (Figure 13C) showed a significant increase in circulating T cells in saline-treated mice at 6h and a significant decrease in all treatment groups at 24h compared to unlesioned control mice. At 6h, the total number of circulating T cells was also significantly increased in saline- treated mice compared to both XProl 595- and etanercept-treated mice. No changes were observed in the total number of circulating blood monocytes at any time point investigated or between treatment groups. In the blood, the total number of circulating granulocytes significantly increased in saline-treated mice compared to both unlesioned control mice and compared to XProl 595- and etanercept-treated mice allowed 6h survival. These results demonstrated that anti-TNF therapy decreased the total number of circulating T cells and granulocytes early (6h) after pMCAO.

[00231] Anti-TNF therapy impacts microvesicle size and number after focal cerebral ischemia

[00232] As microvesicle number and infarct size have been shown to correlate and possibly be an indicator of inflammation, microvesicle number and size after pMCAO was analyzed. Comparisons showed similar numbers in saline- (2.7±0.5xl010/mL) and anti-TNF -treated control mice (XProl 595: 3.3±0.2xl010/mL and etanercept 3.2±0.8x1010/mL). By 6h, we found significantly more microvesicles in XPro 1595 -treated mice compared to saline-treated mice (Figure 14A), an effect which was observed in both XProl 595- and etanercept-treated mice 5d after pMCAO. When investigating temporal changes, significant increases were observed in microvesicle numbers in all groups 5d after pMCAO compared to 6h survival.

[00233]Overall, the mean diameter of microvesicles changed over time but not within treatment groups groups. There was a general increase in the mean size at 6h compared to controls (saline: 170.8±5.3nm, XProl 595: 170.0±6.5nm, and etancercept: 190.0±5.0nm)(P < 0.05) and 5d after pMCAO compared to 24h after pMCAO (Figure 14B). The difference in microvesicle size over time most likely reflects differences in origin. Interestingly, at 24h a small yet significant correlation between microvesicle numbers and infarct volume in saline-treated mice, but not in anti-TNF -treated mice was observed (Figure 14C). This correlation was not observed at any other time point. Example 3 Aim of study.

The aim of the study is to investigate whether direct administration of XProl 595 to the brain of mice with experimentally induced stroke will reduce lesion size and improve functional recovery. The experimental stroke model comprises occlusion of a major blood vessel of the brain (the middle cerebral artery) in mice, and it is the inventors hypothesis that XProl 595 will reduce lesion size and improve functional outcome in experimental stroke model and that XProl 595 is superior to etanercept in doing so.

Materials and Methods

Mice suffering from the experimentally induced stroke were treated with XProl 595, etanercept or placebo either into the interconnected cavities in the brain or directly onto the brain tissue supplied by the middle cerebral artery (using micro-osmotic pumps).

Work package 1 - Procedure optimization/Standardization of delivery methods Drugs were administered topically using micro-osmotic pumps (2.5 mg/mL concentration/1 mL/hour) placed immediately above the middle cerebral artery on the surface of the brain after induction of experimental stroke allowing for direct administration to the infarct for 3 days or administered into the ventricles (10 mg/kg) 30 minutes after experimental stroke using stereotactic surgery.

Work package 2 - Surgeries and behavioral testing

Animals were induced with experimental stroke and treated. Groups consisted of 20 mice, which were based on a long-standing experience with this experimental model and power analyses. Surgeries were performed by a group of 3-4 people and blinded to the surgeon and the person administrating the drugs.

Group a: intraventricular XProl 595 treatment (10 mg/kg)

Group b: topical XProl595 treatment (2.5 mg/mL concentration/1 mL/hour)

Group c: intraventricular etanercept treatment (10 mg/kg)

Group d: topical etanercept treatment (2.5 mg/mL concentration/1 mL/hour)

Group e: controls receiving intraventricular placebo (saline) treatment

Group f: controls receiving topical placebo (saline) treatment

Animals were exposed to behavioral testing of sensory-motor functions by a person blinded to treatment groups. These tests include Rung Walk test, grip strength test, and Hargrave's tests, which all detect changes in sensory-motor functions. After 3 days, animals were sacrificed and tissue collected for analysis. Work package 3 - Tissue processing

Brain tissues were analyzed for lesion volume. In order to investigate whether blocking solTNF but sparing tmTNF reduces neuronal sensitivity to ischemia following a stroke, the size of the lesion 3 days after experimental stroke in mice was compared in the different groups

(XProl595, etanercept, saline). Brains were processed so that series of parallel tissue can be used for volume estimation and molecular and biological analyses. Work package 4 - Molecular and biological analyses

Brain tissue and plasma from the mice were analyzed for changes in specific immune parameters such as cytokine profiles (using mesoscale analysis, Western blotting and qPCR analysis), immuno histochemical analyses of activation of the different cell types of the brain (including microglia, astrocytes and neurons) in order to identify differences in inflammatory markers (among others CD1 lb, Arginase 1, GFAP) between the groups (Clausen et al., in press; Lambertsen et al., 2009). These analyses support the potential observed lesion size alterations. Work package 5 - Data analysis

We expect to prove that administration into the cavities of the brain (intraventricular) and onto the middle cerebral artery territory (topically via pumps) of XProl595 decreased the lesion of the brain tissue and improved functional outcome in our experimental stroke model.

Results

Intracerebroventricular injections in animals with 1 day survival after pMCAO resulted in an average 22% decrease in infarct size in XProl 595 treated animals and an average 23% decrease in Etancept-treated animals compared to saline.

In the pump studies, the animals had 3 days survival so far. Interestingly, XProl595 treatment resulted in an average decrease of 17%, whereas Etanercept resulted in an average 10% increase in infarct volume compared to saline.

Figure 15 shows that thermal stimulation using the Hargreave's test resulted in a significant increase in latency time to withdraw paws between in saline-treated mice probably as a consequence of increased injury in the ipsilateral sensory cortex. In contrast, XProl 595-treated mice showed a decrease in latency time, whereas etanercept-treated mice showed no change (*P <0.05). Short conclusion

It looks like tmTNF present at the lesion site is necessary for neuroprotection (decreased IFV and improved Hargreave's in Xprol 595-pump treated mice and increased IFV in etanercept- treated), whereas the ICV studies pomts towards a beneficial effect of removing solTNF overall (decrease in IFV in both groups). This actually fits well with the literature: anti-TNF therapy is beneficial, but removing tmTNF at the lesion site is detrimental.