[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No.62/858,010, filed June 6, 2019, the entire contents of which are incorporated herein by reference.

TECHNICAL FIELD

[0002] The present disclosure relates to genetically modified rodent models (e.g., mouse models) for pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis), and methods of using the same to identify candidate agents to treat or prevent lung fibrosis.

STATEMENT OF GOVERNMENT SUPPORT

[0003] This invention was made with government support under P01HL114501 and R01HL133801 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND

[0004] Pulmonary fibrosis is a devastating disorder that affects five million people worldwide. However, the actual numbers may be significantly higher as a possible consequence of misdiagnosis. Typically, patients develop pulmonary fibrosis in their forties and fifties with symptoms that include shortness of breath, chronic cough, fatigue, loss of appetite and rapid weight loss. The mean survival time following diagnosis is less than 5 years (Giri, S. N. (2003) Annu Rev Pharmacol Toxicol 43, 73-95). Since pulmonary fibrosis is a very complex disease, the prediction of longevity of patients after diagnosis varies greatly.

[0005] Previous experimental evidence suggested that fibrotic lung diseases are

inflammatory disorders at their inception. For example, pulmonary fibrosis develops in mice with ectopic expression of the inflammatory mediator tumor necrosis factor a (TNF-a) in the lung (Miyazaki et al., (1995) J Clin Invest 96, 250-259). Additionally, in a bleomycin mouse model of pulmonary fibrosis, the fibrosis is preceded by profound inflammation, including the production of high levels of TNF-a (Piguet et al., (1989) J Exp Med 170, 655-663). Importantly, TNF-a-deficient or TNF-a receptor-deficient mice are resistant against bleomycin-induced pulmonary fibrosis (Ortiz et al., (1998) Exp Lung Res 24, 721-743). These results led to the assumption that fibrosis might be avoided when the inflammatory cascade was interrupted before irreversible tissue injury occurred and accounts for the initial enthusiasm for corticosteroid and cytotoxic therapy of pulmonary fibrosis. However, treatments intended to suppress inflammation have limited success in reducing the fibrotic progress. (Giri, S. N. (2003) Annu Rev Pharmacol Toxicol 43, 73-95). Other studies have attempted to show that fibrotic lung disorder is not an inflammatory disorder. For example, development of fibrotic lung disease can be triggered by adenoviral transfer of TGF-b to the lungs of animals with only a transient inflammatory response. These observations suggest that pulmonary fibrosis results from sequential lung injury with a subsequent wound healing response rather than chronic injury. Therefore, a therapeutic strategy based on modification of fibroblast replication and matrix deposition was established. However, no beneficial clinical effect was observed in patients after colchicine treatment (interferes with intracellular collagen processing) or penicillamine treatment (collagen cross-link inhibitor).

[0006] Accordingly, there is a need for efficient and reliable animal models that are useful for identifying candidate drugs that are effective in preventing or treating pulmonary fibrosis.

SUMMARY OF THE PRESENT TECHNOLOGY

[0007] In one aspect, the present disclosure provides a genetically modified murine genome comprising at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4); and a transgene including a fusion protein (CreERT2) that comprises a Cre recombinase (Cre) fused to a tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2), wherein the fusion protein is operably linked to an alveolar type 2 epithelial cell (AEC2) expression control sequence, and wherein the mitofusin nucleic acid sequence is MFN1 and/or MFN2. The at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) may be derived from a mammal selected from the group consisting of a mouse, a rat, and a human. In some embodiments, the at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) is a full length cDNA sequence of MFN1 and/or MFN2.

[0008] Additionally or alternatively, in some embodiments, the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) comprises the sequence of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18.

[0009] In any of the preceding embodiments of the genetically modified murine genome described herein, the at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) comprises a 5’ flanking loxP site and a 3’ flanking loxP site that are oriented in an identical direction. In certain embodiments, the 5’ flanking loxP site and/or the 3’ flanking loxP site comprises the sequence of any one of SEQ ID NOs: 3-12. The sequences of the 5’ flanking loxP site and the 3’ flanking loxP site may be identical or different.

[0010] Additionally or alternatively, in some embodiments, the genetically modified murine genome of the present technology, further comprises a detectable reporter gene such as a fluorescent reporter gene or a bioluminescent reporter gene. In certain embodiments, the transgene comprises a detectable reporter gene such as a fluorescent reporter gene or a bioluminescent reporter gene. Examples of suitable fluorescent reporter genes include, but are not limited to, GFP, YFP, CFP, RFP, TagBFP, Azurite, EBFP2, mKalama1, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, mTFP1, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, EYFP, Citrine, Venus, SYFP2, TagYFP, Monomeric Kusabira-Orange, mKOk, mKO2, mOrange, mOrange2, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP, TagRFP657, IFP1.4, iRFP, mKeima Red, LSS-mKate1, LSS- mKate2, PA-GFP, PAmCherry1, PATagRFP, Kaede (green), Kaede (red), KikGR1 (green), KikGR1 (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), PSmOrange, and Dronpa. Examples of bioluminescent reporter genes include, but are not limited to, Aequorin, firefly luciferase, Renilla luciferase, red luciferase, luxAB, and nanoluciferase.

[0011] In any and all embodiments of the genetically modified murine genome disclosed herein, the AEC2 expression control sequence has a length ranging from 100 base pairs (bps) to 5 kilobases (kb). Additionally or alternatively, in some embodiments, the AEC2 expression control sequence is a surfactant protein C (Sftpc) promoter or a surfactant protein B (Sftpb) promoter.

[0012] Additionally or alternatively, in certain embodiments, the Cre recombinase (Cre) is fused to the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2) via a peptide linker. The Cre recombinase (Cre) may be fused to the N-terminus or C-terminus of the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2). In some embodiments, the Cre recombinase (Cre) comprises the sequence of SEQ ID NO: 19 and/or the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2) comprises the sequence of SEQ ID NO: 20. [0013] Additionally or alternatively, in some embodiments, the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) and the transgene are located on different or identical chromosomes. In certain embodiments, the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) is configured to be deleted or excised when the genetically modified murine genome is contacted with an effective amount of tamoxifen.

[0014] In one aspect, the present disclosure provides a rodent comprising any genetically modified murine genome described herein, wherein the rodent is homozygous for a floxed full-length MFN1 nucleic acid sequence and/or a floxed full-length MFN1 nucleic acid sequence. In some embodiments, the rodent of the present technology does not comprise endogenous MFN1 and/or MFN2 genomic nucleic acid sequences that lack flanking loxP sites. The rodent may be a rat or a mouse. Additionally or alternatively, in some

embodiments, the floxed full-length MFN1 nucleic acid sequence has been knocked into a wild-type MFN1 locus, and/or wherein the floxed full-length MFN2 nucleic acid sequence has been knocked into a wild-type MFN2 locus.

[0015] In any of the preceding embodiments of the rodent of the present technology, the rodent develops lung fibrosis after being exposed to an effective amount of tamoxifen, and optionally an effective amount of bleomycin. Signs or symptoms of lung fibrosis may include one or more of weight loss, low-grade fevers, fatigue, arthalgias, myalgias, shortness of breath, respiratory distress, aching joints, or shallow breathing. In some embodiments, the rodent is fertile and is capable of transmitting the genetically modified murine genome to its offspring.

[0016] Additionally or alternatively, in some embodiments, the AEC2 cells of the rodent exhibit one or more signs of mitochondrial damage selected from the group consisting of fragmented mitochondria with decreased mitochondrial area, increased mitochondrial number, enlarged mitochondria with irregular and disrupted cristae, increased mitochondrial area, decreased mtDNA copy number, and reduced mitophagy after being exposed to an effective amount of tamoxifen. In any and all embodiments of the rodent described herein, the rodent exhibits excessive scar formation, increased localization of fibroblastic aggregates in lungs, increased lung collagen deposition, elevated expression of vimentin, a-smooth muscle actin, and/or collagen III, and altered lipid metabolism after being exposed to an effective amount of tamoxifen. In certain embodiments, altered lipid metabolism comprises reduced levels of one or more of cholesterol, ceramides, phosphatidic acids, phosphatidylethanolamine, phosphatidylserine, plasmalogen phosphatidylethanolamine, phosphatidylglycerol, monoacylglycerol, diacylglycerol, acylcarnitines,

glycerophospholipids, sphingolipids, and phosphatidylcholines with long unsaturated aliphatic chains.

[0017] In another aspect, the present disclosure provides a method for identifying a candidate agent for preventing lung fibrosis comprising (a) administering a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent has been exposed to an amount of tamoxifen that is effective to induce fibrosis, and (b) monitoring the development of lung fibrosis in the rodent of step (a), wherein a reduction in or delayed onset of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that has been exposed to an amount of tamoxifen that is effective to induce fibrosis and that has not received the candidate agent indicates that the candidate agent is effective in preventing lung fibrosis.

[0018] In one aspect, the present disclosure provides a method for identifying a candidate agent for treating lung fibrosis comprising (a) administering a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent exhibits lung fibrosis after being exposed to an effective amount of tamoxifen, and (b) monitoring the progression of lung fibrosis in the rodent of step (a), wherein amelioration of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that exhibits lung fibrosis after being exposed to an effective amount of tamoxifen and that has not received the candidate agent indicates that the candidate agent is effective in treating lung fibrosis. In another aspect, the present disclosure provides a method for determining an effective amount of a candidate agent for treating lung fibrosis comprising (a) administering a test amount of a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent exhibits lung fibrosis after being exposed to an effective amount of tamoxifen, and (b) monitoring the progression of lung fibrosis in the rodent of step (a), wherein amelioration of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that exhibits lung fibrosis after being exposed to an effective amount of tamoxifen and that has not received the candidate agent indicates that the test amount of the candidate agent is effective in treating lung fibrosis. In some embodiments of the methods disclosed herein, amelioration of lung fibrosis comprises reduced scar formation, decreased localization of fibroblastic aggregates in lungs, decreased lung collagen deposition, reduced expression of vimentin, ^-smooth muscle actin, and/or collagen III, and increased levels of one or more of lipids selected from among cholesterol, ceramides, phosphatidic acids, phosphatidylethanolamine, phosphatidylserine, plasmalogen

phosphatidylethanolamine, phosphatidylglycerol, monoacylglycerol, diacylglycerol, acylcarnitines, glycerophospholipids, sphingolipids, and phosphatidylcholines with long unsaturated aliphatic chains.

[0019] In yet another aspect, the present disclosure provides a method for determining an effective amount of a candidate agent for preventing lung fibrosis comprising (a)

administering a test amount of a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent has been exposed to an amount of tamoxifen that is effective to induce fibrosis, and (b) monitoring the development of lung fibrosis in the rodent of step (a), wherein a reduction in or delayed onset of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that has been exposed to an amount of tamoxifen that is effective to induce fibrosis and that has not received the candidate agent indicates that the test amount of the candidate agent is effective in preventing lung fibrosis.

[0020] In any and all embodiments of the methods disclosed herein, the lung fibrosis is caused by connective tissue or collagen diseases (e.g., rheumatoid arthritis, scleroderma), exposure to asbestos, metal dusts or organic substances, sarcoidosis, and exposure to medical drugs and radiation. Additionally or alternatively, in some embodiments of the methods disclosed herein, the candidate agent is an antibody agent, a peptide, a polypeptide, a fusion protein, a small molecule, a siRNA, an antisense RNA, a sgRNA, or a shRNA.

[0021] Also disclosed herein are kits comprising any embodiment of the rodent of the present technology and instructions for assaying the effectiveness of a candidate agent for treating or preventing lung fibrosis.

[0022] Also provided herein are methods of producing any embodiment of the genetically modified murine genome described herein comprising: (a) providing a first rodent having in its genome at least one floxed full-length mitofusin nucleic acid sequence, wherein the mitofusin nucleic acid sequence is MFN1 and/or MFN2, and wherein the first rodent does not comprise the transgene; (b) mating the first rodent with a second rodent, wherein the second rodent comprises in its genome the transgene, and wherein the second rodent does not comprise the at least one floxed full-length mitofusin nucleic acid sequence; and (c) selecting a progeny rodent from step (b) comprising the at least one floxed full-length mitofusin nucleic acid sequence, and the transgene; wherein each of the at least one floxed full-length mitofusin nucleic acid sequence and the transgene are located at distinct genomic sites in the progeny rodent. In some embodiments, the first rodent comprises a floxed full-length MFN1 nucleic acid sequence and a floxed full-length MFN2 nucleic acid sequence. Additionally or alternatively, in some embodiments, the flanking loxP sites of the floxed full-length MFN1 nucleic acid sequence are either identical to or distinct from the flanking loxP sites of the floxed full-length MFN2 nucleic acid sequence. In any and all embodiments of the methods disclosed herein, the first rodent is homozygous for the floxed full-length MFN1 nucleic acid sequence and/or the floxed full-length MFN2 nucleic acid sequence.

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] FIG.1A shows a schema demonstrating the generation of mice with tamoxifen- inducible tdTomato labeling in AEC2 cells. tdTomato reporter mice (Rosa26 ^tdTomato+/+ ) were crossed with Sftpc ^CreERT2+/+ mice.

[0024] FIG.1B shows a functional enrichment map generated using genes differently expressed between AEC2 cells with and those without bleomycin treatment, using the threshold of an adjusted p < 0.001 and a fold change > 1.2.

[0025] FIG.1C shows a heatmap showing upregulated genes under the annotation “mitochondrial organization (GO:0007005)” in AEC2 cells treated with bleomycin (BLM), compared to those treated with PBS.

[0026] FIG.1D shows the expression of Mfn1, Mfn2 and Dnm1l mRNA in AEC2 cells 5 days after PBS (n = 4 mice) or BLM (n = 4 mice) treatment. For each gene, the fold change of FPKM (fragments per kilobase of exon model per million mapped reads) was calculated relative to the PBS group. The data are presented as mean±s.e.m. (NS, not-significant; ***adjusted p < 0.001 vs. PBS group).

[0027] FIG.1E shows a heatmap showing downregulated genes under the annotation “mitochondrial organization (GO:0007005)” in AEC2 cells treated with bleomycin, compared to those treated with PBS.

[0028] FIG.1F shows the representative TEM (transmission electron microscopy) images (50,000×) showing mitochondrial damage in AEC2 cells from Sftpc ^CreERT2+/- mice before and after bleomycin treatment (scale bar 500 nm). [0029] FIG.1G shows the representative TEM images before and after bleomycin treatment (12,000×; scale bar 2 mm).

[0030] FIG.1H shows the quantification of mitochondrial number per mm² of cytosolic area from the representative TEM images before and after bleomycin treatment.

[0031] FIG.1I shows the mitochondrial area (mm²) per mm² of cytosolic area from the representative TEM images before and after bleomycin treatment. For FIGs.1G-1H, each dot represents one AEC2 cell and the line indicates mean. For each mouse, 5-19 AEC2 cells were randomly sampled (*p < 0.05, ***p < 0.001, vs. no bleomycin treatment by unpaired Student’s t-test. (before bleomycin, n=3 mice; after bleomycin, n=2 mice).

[0032] FIG.2A shows a schema demonstrating the generation of AEC2 cell specific mice deficient in Mfn1 or Mfn2 using a tamoxifen-inducible Sftpc-promoter driven CreERT2.

Sftpc ^CreERT2+/- mice were used as controls.

[0033] FIG.2B shows the genotyping of DNA extracted from CD45(-)EpCAM(+) cells and CD45(-)EpCAM(-) cells isolated from control and Mfn1 ^{i DAEC2} mice 6 weeks after tamoxifen injection (n=3 per group).

[0034] FIG.2C shows the representative immunoblots of AEC2 cell lysates obtained 3 weeks after tamoxifen-induced deletion, showing decreased protein levels of MFN1 or MFN2 in the respective knockout cells (n=3 mice per group).

[0035] FIG.2D shows the representative TEM images (upper row, 12,000×, scale bar 2mm; lower row, 50,000×, scale bar 500 nm) illustrating the mitochondrial ultrastructural changes in Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells (n=3 mice per group) with disrupted cristae marked with white arrowheads.

[0036] FIG.2E shows the quantification of the mitochondrial number per mm ² of cytosolic area in each AEC2 cell, using TEM images (12,000×).

[0037] FIG.2F shows the mitochondrial area (mm ² ) per mm ² of cytosolic area in each AEC2 cell, using TEM images (12,000×). For FIGs.2E and 2F, each dot represents one AEC2 cell, and the line indicates mean. For each group, 4-12 AEC2 cells were randomly sampled from each mouse (n=3 per group; *p < 0.05, **p < 0.01, ***p < 0.001, vs. control by unpaired Student’s t-test). [0038] FIG.2G shows the representative TEM images (5,000×) of the bronchial epithelium in control (Sftpc ^CreERT2+/- ), Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice (n = 3 mice per group; scale bar 5 mm).

[0039] FIG.2H shows the representative Masson’s trichrome-stained sections (100× magnification) of murine left lung at 28-32 weeks post tamoxifen-induced deletion (control, n=20; Mfn1 ^{i DAEC2} , n=10; Mfn2 ^{i DAEC2} , n=9; scale bar 3 mm).

[0040] FIG. 3A shows the representative TEM images (12,000×; scale bar 2 mm) in Mfn1 ^-/- AEC2 cells before (n=3 mice) and after bleomycin treatment (n=2 mice).

[0041] FIG. 3B shows the representative TEM images (12,000×; scale bar 2 mm) in Mfn2 ^-/- AEC2 cells before (n=3 mice) and after bleomycin treatment (n=2 mice).

[0042] FIG. 3C shows the quantification of mitochondria area of each mitochondrion (data presented as the median [interquartile range], and the comparison performed by Mann-Whitney U test). The percentage of total mitochondria after bleomycin treatment is shown in the order control, Mfn1 ^-/- , and Mfn2 ^-/- for each mitochondrial area value.

[0043] FIG.3D shows the mitochondrial number per mm ² of cytosolic area in each AEC2 cell.

[0044] FIG. 3E shows the mitochondrial area (mm ² ) in each AEC2 cell. For FIGs. 3D-3E, each dot represents one AEC2 cell; *p < 0.05, ***p < 0.001, vs. control by unpaired Student’s t-test), using TEM images (12,000×) of control, Mfn1 ^-/- or Mfn2 ^-/- AEC2 cells 8 days after bleomycin treatment (n=2 mice per group). For each mouse, 6-19 AEC2 cells were randomly sampled.

[0045] FIG. 3F shows the body weight changes of control, Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice after bleomycin treatment. Data are mean ±s.e.m. (results from 3 independent experiments; * Mfn1 ^{i DAEC2} vs. control, # Mfn2 ^{i DAEC2} vs. control; * and #, p < 0.05, ** and ##, p < 0.01, ###, p < 0.001, by unpaired Student’s t-test).

[0046] FIG. 3G shows the Kaplan–Meier survival curves of control, Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice after bleomycin treatment (results from 3 independent experiments; **p < 0.01, ***p < 0.001, by log-rank test).

[0047] FIG.3H shows the Masson’s trichrome staining (left panel, 100× magnification, scale bar 200 mm) and IHC staining of collagen III (right panel, 200× magnification, scale bar 200 mm) in lung sections of control, Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice14 days after bleomycin treatment (control n = 10, Mfn1 ^{i DAEC2} n = 12, Mfn2 ^{i DAEC2} n = 3).

[0048] FIG.3I shows the acid-soluble collagen levels in the right lung from control (PBS n = 6, bleomycin n = 17), Mfn1 ^{i DAEC2} (PBS n = 4, bleomycin n = 13) and Mfn2 ^{i DAEC2} (PBS n = 5, bleomycin n = 16) mice 14 days after PBS or bleomycin treatment, quantified by Sircol assay. Data are presented as mean ±s.e.m. (#, bleomycin vs. PBS, * vs. control mice; *p < 0.05, *** and ### p < 0.001 by one-way ANOVA with post-hoc Bonferroni test).

[0049] FIG.4A shows a schema demonstrating the generation of mice with AEC2 cell specific tamoxifen-inducible deletion of MFN1 and MFN2 (a.k.a. Mfn1/2 ^-/- ). Sftpc ^CreERT2+/+ or Sftpc ^CreERT2+/- mice were used as controls.

[0050] FIG.4B shows the genotyping of CD45(-)EpCAM(+) cells isolated from Mfn1/2 ^{i ^AEC2} mice (n = 3 mice; lane 1 to lane 3 serves as the positive control).

[0051] FIG.4C shows the representative immunoblots of AEC2 cell lysates obtained 6 weeks after tamoxifen-induced deletion, showing decreased protein levels of both MFN1 and MFN2 in the Mfn1/2 ^-/- AEC2 cells (n=3 mice per group).

[0052] FIG. 4D shows the representative TEM images (upper row, 12,000×; lower row, 50,000×) illustrating the mitochondrial ultrastructural changes in Sftpc ^CreERT2+/- and Mfn1/2 ^-/- AEC2 cells (n=3 mice per group) with disrupted cristae marked with white arrowheads (scale bar, upper row 2 mm, lower row 500 nm.

[0053] FIG. 4E shows the Kaplan–Meier survival curves of Mfn1/2 ^{i ^AEC2} mice (n=22) and Sftpc ^CreERT2+/+ mice (n=23) (p < 0.01 by log-rank test).

[0054] FIG. 4F shows the representative Masson’s trichrome-stained lung sections (upper panel, 100× magnification; lower panel, 200× magnification) 17 weeks post tamoxifen-induced deletion (Sftpc ^CreERT2+/+ , n=6; Mfn1/2 ^{i DAEC2} , n=11; scale bar, upper panel 4 mm, lower panel 200 mm).

[0055] FIG.4G shows the representative IHC staining of vimentin, alpha-smooth muscle actin (a-SMA), and collagen III (Col-III) (200× magnification; n=3 per group; scale bar 200 mm).

[0056] FIG. 4H shows the representative immunofluorescent staining of 5x5 tiled confocal images (using 40× objective) of frozen murine lung sections stained for podoplanin (green), surfactant protein-C (SP-C) (yellow), ER-TR7 (magenta), and Hoechst 33342 stain (blue) (n=3 per group; scale bar 50mm).

[0057] FIG. 4I shows the representative immunofluorescence staining confocal images of podoplanin (green), SP-C (yellow), ER-TR7 (magenta) and Hoechst 33342 nuclear stain (blue) using lung sections of Sftpc ^CreERT2+/- , Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice (n = 2 mice per group; scale bar 20 mm).

[0058] FIG.5A shows a scatterplot showing genes (orange) that are differentially expressed (adjusted p < 0.05) and have the same regulation direction in both Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells after bleomycin treatment, compared to the control.

[0059] FIG. 5B shows a functional enrichment map to illustrate the common GO terms enriched on differentially expressed genes of Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells after bleomycin treatment.

[0060] FIG.5C shows a heatmap to demonstrate the changes in the expression of genes related to purine metabolism under the annotation“purine ribonucleoside triphosphate metabolic process (GO: GO:0009205)” based on the functional enrichment results FIG.5B.

[0061] FIG.5D shows a heatmap to demonstrate the changes in the expression of genes related to lipid metabolism under the annotation“fatty acid metabolic process (GO:0006631)” based on the functional enrichment results FIG.5B.

[0062] FIG. 5E shows a functional enrichment map generated using genes differently expressed between Mfn1/2 ^-/- AEC2 cells and control AEC2 cells, using the threshold of an adjusted p < 0.05.

[0063] FIG.5F shows the differentially regulated genes related to glycolysis, asparagine (Asn) synthesis, de novo serine/glycine synthesis, and mitochondrial one-carbon metabolism in Sftpc ^CreERT2+/+ versus MFN1/2 ^-/- AEC2 cells. For each gene, the fold change of FPKM is calculated relative to Sftpc ^CreERT2+/+ control (G6P, glucose-6-phosphate; G3P, glyceraldehyde- 3-phosphate;OAA, oxaloacetate; Asp, aspartate; Asn, asparagine; 3P-OH-pyruvate, 3- phosphohydropyruvate; P-ser, 3-phosphoserine; Ser, serine; Gly, glycine; THF, tetrahydrofolate; MTHF, methyltetrahydrofolate; FTHF, formyltetrahydropholate). The data are presented as mean ±s.e.m. (NS, not-significant; *adjusted p < 0.05, **adjusted p < 0.01, ***adjusted p < 0.001 vs. Sftpc ^CreERT2+/+ ). [0064] FIGs. 6A-6B show representative TEM images of lamellar bodies (LB) in control, Mfn1- and Mfn2-deficient AEC2 cells at baseline (25,000×) and 8 days after bleomycin treatment (50,000×) (n=2-3 mice per group; scale bar 500 nm) (FIG.6A) and in Sftpc ^CreERT2+/- and Mfn1/2 ^-/- AEC2 cells (25,000×; n=3 mice per group; scale bar 1 mm) (FIG.6B, left panel). Quantification of the percentage of LB with disorganized lipid membranes in AEC2 cells by TEM image analysis (12,000×) (FIG. 6B, right panel). Each dot represents one AEC2 cell. For each group, 5-11 AEC2 cells were randomly sampled from each mouse (Sftpc ^CreERT2+/- mice as control, n=3; Mfn1/2 ^{i ^AEC2} mice, n=2) (***p < 0.001, vs. control by unpaired Student’s t- test).

[0065] FIG.6C shows a heat map of differential changes of specific lipid contents in control, Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells (n=4 samples from 8 mice per group, AEC2 cells from 2 mice are pooled to form 1 sample) 8 days after bleomycin treatment.

[0066] FIG.6D shows a bar graph of differential changes of specific lipid contents in control, Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells (n=4 samples from 8 mice per group, AEC2 cells from 2 mice are pooled to form 1 sample) 8 days after bleomycin treatment. The fold changes of specific lipid contents in AEC2 cells after bleomycin treatment relative to those after PBS treatment (n=3 per group) were calculated and log-transformed (base 2) (*p < 0.05, **p < 0.01, calculated fold change vs. 1 by unpaired Student’s t-test). Data are presented as mean ±s.e.m.

[0067] FIG.6E shows the lipidomic analysis in Sftpc ^CreERT2+/+ and Mfn1/2 ^-/- AEC2 cells (n=4 mice per group; *p < 0.05, **p < 0.01, ***p < 0.001, vs. Sftpc ^CreERT2+/+ AEC2 cells by unpaired Student’s t-test). Data are presented as mean ±s.e.m.

[0068] FIG. 6F shows a schema outlining the generation of mice with tamoxifen-inducible Fasn knockout in AEC2 cells.

[0069] FIG. 6G shows the immunoblots showing MFN1, MFN2, TIM23 and b-actin expression in AEC2 cells from control or Fasn ^iDAEC2 mice.

[0070] FIG. 6H shows the Kaplan-Meier survival curves (*p < 0.05, by log-rank test) after bleomycin treatment.

[0071] FIG. 6I shows the body weight changes (control n=27, Fasn ^iDAEC2 n=22) after bleomycin treatment. Data are presented as mean ±s.e.m. (*p < 0.05, by unpaired Student’s t- test) [0072] FIG. 6J shows the acid-soluble collagen depositions in right lung (control n=7, Fasn ^iDAEC2 n=4) after bleomycin treatment. Data are presented as mean ±s.e.m. (*p < 0.05, by unpaired Student’s t-test)

[0073] FIG. 6K shows the representative Masson’s Trichrome stained lung sections (200× magnification; scale bar 200 mm) of mice 14 days after bleomycin treatment (n=5 per group).

[0074] FIG.7A shows the representative flow cytometry protocol and gating strategy to isolate tdTomato(+) cells from whole lung cell suspensions, with DAPI staining to exclude non-viable cells.

[0075] FIG.7B shows a schema demonstrating the protocol for the isolation AEC2 cells using magnetic-activated cell sorting (MACS) by CD45 negative selection and EpCAM positive selection. MACS.

[0076] FIG. 7C shows the representative flow cytometric analysis and gating strategy of EpCAM purity of AEC2 cells isolated by MACS as measured by flow cytometric analysis. Shown is representative flow cytometric analysis and gating strategy of EpCAM positive cells in whole lung cell suspensions (upper left panel) and CD45(-)EpCAM(+) cells (lower left panel) with the percentage of EpCAM positive cells quantified (right panel) in the respective populations (n = 3 mice per group; data are mean±s.e.m.).

[0077] FIG. 7D shows the purity of AEC2 cells isolated by MACS. Representative flow cytometric analysis and gating strategy of SP-C of AEC2 cells isolated by MACS as measured by flow cytometric analysis. Shown is the analysis of cells in whole lung cell suspensions (upper left panel) and CD45(-)EpCAM(+) cells (lower left panel) with the percentage of SP-C positive cells quantified (right panel) in the respective populations (n = 3 mice per group; data are mean±s.e.m.).

[0078] FIG. 7E shows the representative confocal images of SP-C positive cells by immunofluorescence staining of CD45(-)EpCAM(-) cells (negative control, left panel) or CD45(-)EpCAM(+) cells (middle panel), with quantification of the percentage of SP-C (+) cells (right panel; data are mean±s.e.m.; n = 6 mice, and 3 high-powered fields are obtained per mice by confocal microscopy using a 63X/1.4 oil immersion objective; scale bar 10 mm).

[0079] FIG. 8A shows the representative TEM images (scale bar, upper panel 1 mm, lower panel 500 nm) highlighting swollen mitochondria with regional decreased electron density and disrupted cristae (marked by asterisk) in AEC2 cells after bleomycin treatment (before bleomycin, n=3 mice; after bleomycin, n=2 mice).

[0080] FIG. 8B shows the quantification of mitochondrial area of each mitochondrion in AEC2 cells before and after bleomycin treatment. For each mouse, 5-19 AEC2 cells were randomly sampled. Data presented are median [interquartile range], and the comparison is performed by Mann-Whitney U test.

[0081] FIG. 8C shows the immunoblots showing the expression of MFN1, MFN2, OPA1, DRP1, TIM23, and b-actin in AEC2 cell lysates 8 days after PBS or BLM treatment (PBS, n = 2 mice; BLM, n = 4 mice)

[0082] FIG. 8D shows the quantification of MFN1, MFN2, OPA1, DRP1 by densitometric analysis through normalization to b-actin, expressed as the fold change relative to control (data are mean±s.e.m., ** p < 0.01 vs control, by unpaired Student’s t-test)

[0083] FIG. 8E shows the Volcano plot differently expressed genes between AEC2 cells isolated from mice treated with bleomycin and from mice treated with PBS control; threshold of an adjusted p < 0.001 and a fold change > 1.2.

[0084] FIG. 9A shows the representative TEM images (50,000×; scale bar 500 nm) highlighting two distinct mitochondrial morphologies in Mfn2 ^-/- AEC2 cells; 1) relatively normal mitochondria with enlarged size but regular cristae, and 2) abnormal mitochondria with disrupted and irregular cristae (marked by asterisk). The arrows point to the residual cristae in a swollen mitochondrion (upper panel, left image).

[0085] FIG. 9B shows the quantification of mitochondrial area of each mitochondrion in AEC2 cells. For each mouse, 4-12 AEC2 cells were randomly sampled. Data presented are median [interquartile range], with comparison by Mann-Whitney U test.

[0086] FIG. 10A shows the immunoblots for MFN1 (upper panel) and MFN2 (lower panel) expression in Mfn1- or Mfn2- depleted MLE 12 cells generated using shRNA lentiviral transduction (n=3 technical repeats).

[0087] FIG. 10B shows MitoTracker green staining of MLE 12 cells infected with shRNA targeted to MFN1 or MFN2. The mitochondrial fluorescent dye MitoTracker green was used to label mitochondria (left panel; scale bar 5 mm). Lines with higher knockdown efficiency were selected for live-cell confocal imaging (a 3-dimensional reconstruction image from 2.46- m m-thick z stacks through a 63×/1.4 oil immersion objective) and the percentages of cells with < 50% tubular mitochondria were quantified (right panel). Three high power fields were randomly selected, and 21-45 cells quantified in each high power field. Data are mean±s.e.m. (*p < 0.05, **p < 0.01, vs. control by unpaired Student’s t-test).

[0088] FIG.10C shows the immunoblots for Mfn1 and Mfn2 siRNA knockdown efficacy in the human AEC2 cell line A549.

[0089] FIG. 10D shows the representative mitochondrial morphology (live-cell confocal images of MitoTracker green staining, 3-dimensional reconstruction images from 2-mm-thick z stacks through a 63×/1.4 oil immersion objective) in the human AEC2 cell line A549 (n=5 random-selected fields for each condition; scale bar 10 mm).

[0090] FIG.10E shows the representative TEM images (50,000×) of mitochondria in MLE 12 cells (n=5 random-selected fields under 5,000× per cell line; scale bar 500 nm).

[0091] FIG.10F shows the representative flow cytometric analysis of mitophagy induced by oligomycin/antimycin (OA) in MLE 12 cells using mtKeima (left panel). Mitophagy intensity was quantified based on the cell percentage in the upper gate, and the fold change was calculated relative to the solvent group (right panel). Data are mean±s.e.m. of triplicates (n=2 technical repeats; ***p < 0.001, vs control by unpaired Student’s t-test).

[0092] FIG.11A shows the distribution of the mitochondrial area of each mitochondrion (data presented as the median [interquartile range] in Mfn1 ^-/- cells, with comparisons assessed by Mann-Whitney U test).

[0093] FIG.11B shows the distribution of the mitochondrial area of each mitochondrion (data presented as the median [interquartile range] in Mfn2 ^-/- cells, with comparisons assessed by Mann-Whitney U test).

[0094] FIG.11C and FIG.11E show the number of mitochondria per mm² of cytosolic area in Mfn1 ^-/- AEC2 cells, and Mfn2 ^-/- AEC2 cells, respectively, with or without bleomycin treatment.

[0095] FIG.11D and FIG.11F show the total mitochondrial area (mm²) of each mitochondrion in Mfn1 ^-/- AEC2 cells, and Mfn2 ^-/- AEC2 cells, respectively, with or without bleomycin treatment. For FIGs.11C to 11F, each dot represents one AEC2 cell with the line indicating mean; *p < 0.05, **p < 0.01, ***p < 0.001, vs. no bleomycin by unpaired Student’s t-test), using TEM images (12,000×). For each mouse, 4-12 AEC2 cells were randomly sampled (before bleomycin, n=3 mice; after bleomycin, n=2 mice). [0096] FIG.11G shows the mtDNA/gDNA copy number ratios as assesses by real-time qPCR _{in isolated control, Mfn1} ^-/- _{, and Mfn2} ^-/- _{AEC2 cells with or without bleomycin treatment (NS,} non-significant, by one-way ANOVA with post-hoc Bonferroni test).

[0097] FIGs. 12A to 12C show the total protein (FIG. 12A), total cells (FIG. 12B) and macrophages (FIG. 12C) measured in the bronchoalveolar lavage fluid (BALF) of mice exposed to bleomycin (5 days) or PBS (data presented as mean±s.e.m.; # bleomycin vs. PBS group, * vs. control; *p < 0.05, ## p < 0.01, ### p < 0.001, by one-way ANOVA with post- hoc Bonferroni test).

[0098] FIGs. 13A to 13C show the distribution of the mitochondrial area of each mitochondrion (data presented as the median [interquartile range], and the comparison performed by Mann-Whitney U test) (FIG.13A), and the number of mitochondria per mm ² of cytosolic area (FIG. 13B) as well as the individual mitochondrial area (mm²) of each mitochondrion (FIG.13C) in each AEC2 cell (FIGs. 13B-12C, each dot represents one AEC2 cell, with the line indicating mean; ***p < 0.001, vs. SftpcCreERT2+/- AEC2 cells by unpaired Student’s t-test), using TEM images (12,000×). For each mouse, 5-12 AEC2 cells were randomly sampled (n=3 mice for each group).

[0099] FIG.13D shows the real-time PCR quantification of mtDNA copy number per nuclear genome in Sftpc ^CreERT2+/+ and Mfn1/2 ^-/- AEC2 cells (data presented as mean±s.e.m.; ***p < 0.001, by unpaired Student’s t-test).

[0100] FIG.13E shows the representative TEM images (upper panel, 25,000×, scale bar 1 mm; lower panel, 50,000×, scale bar 500 nm) that highlight mitochondria with disrupted cristae (marked by asterisk), showing cristae with abnormal morphology or irregular alignment (lower panel, left image), or focal loss of cristae (lower panel, middle image). The arrows mark relatively“normal” mitochondria for comparison (lower panel, right image).

[0101] FIG. 14 shows the representative immunofluorescent staining images, showing 5×5 tiled confocal images (using 40× objective) of frozen Mfn1/2 ^iDAEC2 mouse lung sections stained for podoplanin (green), surfactant protein-C (SP-C) (yellow), ER-TR7 (magenta), and Hoechst 33342 stain (blue) (scale bar 50 mm).

[0102] FIG.15 shows the representative TEM images (50,000×) (n=2 mice per groups, and 3- 4 randomly sampled AEC2 cells per mouse) and Masson’s trichrome stained lung sections and immunohistochemical staining of collagen III (n=5 mice per group) from control (PolgA ^+/+ ) and PolgA ^D257A/D257A mice (scale bar, left panel, 500 nm; middle and right panel, 200 mm). [ _{0103] FIG. 16A shows a schema demonstrating the generation of Mfn1} ^{iDAEC2/tdTomato-AEC2} _{and Mfn2} ^{iDAEC2/tdTomato-AEC2} _mice. [0104] FIG. 16B shows the genotyping of tdTomato(+) cells from control ^{tdTomato-AEC2} and Mfn1 ^{iDAEC2/tdTomato-AEC2} mice 6 weeks after tamoxifen injection (n=4 mice per group; lane 1 to lane 3 serve as positive control).

[0105] FIG. 16C shows the representative flow cytometry histograms demonstrating the percentage of tdTomato positive SP-C positive AEC2 cells. Data are presented as mean±s.e.m. (c, right panel; n=3 mice per group; NS, non-significant, by unpaired Student’s t-test).

[0106] FIG. 16D shows a scatterplot to demonstrate genes (orange) that are differentially e _{xpressed (adjusted p < 0.05) and have the same directional regulation in both Mfn1} ^-/- _{and Mfn2} - ^/- _{AEC2 cells at baseline, when compared to the control.}

[0107] FIG. 16E shows the mRNA expression of Atf4, Atf5, and genes related to de novo serine/glycine synthesis by transcriptome RNA-seq analysis. For each gene, the fold change of FPKM is calculated relative to control. The data are presented as mean±s.e.m. (**adjusted p < 0.01, ***adjusted p < 0.001 vs. control).

[0108] FIG.16F shows a functional enrichment map showing the common GO terms enriched i _{n the differentially expressed genes of Mfn1} ^-/- _{and Mfn2} ^-/- _{AEC2 cells at baseline.}

[0109] FIGs. 17A-17B show the representative TUNEL staining of murine lung sections obtained 5 days after bleomycin treatment (FIG. 17A) with corresponding quantification of TUNEL positive tdTomato(+) cells (FIG.17B). Data are mean±s.e.m. (n = 2 mice per group, and 5-7 high-powered tiled images per mouse are obtained by confocal microscopy using a 25X/0.8 oil immersion objective; scale bar 100 mm; NS, non-significant, by unpaired Student’s t-test).

[0110] FIGs. 17C-17D shows the representative flow cytometric analysis of whole lung cell suspensions obtained 5 days after bleomycin treatment (FIG. 17C) with quantification of the percentage of DAPI-positive cells in the tdTomato(+) population (FIG. 17D). Data are mean±s.e.m. (n = 4 mice per group; NS, non-significant, by unpaired Student’s t-test).

4838-0889-0557.1 [0111] FIG.17E shows the mRNA expressions of Mki67 in AEC2 cells at day 5 after PBS or bleomycin treatment (n = 4 mice per group). The fold change of FPKM was calculated relative to PBS group. The data are presented as mean±s.e.m. (NS, non-significant).

[0112] FIG. 17F shows the representative immunofluorescent staining of Ki-67 (green) and Hoechst 33342 nuclear staining (blue) in lung sections with tdTomato-labeled AEC2 cells, obtained 10 days after bleomycin treatment (n = 2 mice per group, and 3 high-powered tiled images per mice are taken by confocal microscopy using a 25X/0.8 oil immersion objective; scale bar 100 mm).

[0113] FIG. 17G shows the differential mRNA expression of genes related to fatty acid synthesis, activation and import in pathways identified by functional enrichment analyses in _{control, Mfn1} ^-/- _{and Mfn2} ^-/- _{AEC2 cells 5 days after PBS or BLM exposure. The fold change} of FPKM values were calculated by normalizing to control AEC2 cells with PBS treatment. The data are presented as mean±s.e.m. (# PBS vs. BLM, * knockout vs. control; *adjusted p < 0.05, ## and **adjusted p < 0.01, ### and ***adjusted p < 0.001).

[0114] FIG. 18A shows the mRNA expression of genes related to mitochondrial stress responses. The fold change of FPKM is calculated relative to Sftpc ^CreERT2+/+ control. The data are presented as mean±s.e.m. (n = 3 mice per group; **adjusted p < 0.01, ***adjusted p < 0.001 vs. Sftpc ^CreERT2+/+ ).

[0115] FIG.18B shows a scatterplot demonstrating the common genes (dark gray) regulated _{in Mfn1/2} ^-/- _{AEC2 cells at baseline and in AEC2 cells after bleomycin treatment, compared to} the respective controls.

[0116] FIG. 18C shows the functional enrichment analyses that were then performed on the common genes from FIG.18B.

[0117] FIG.18D shows a gene-set enrichment analysis (GSEA) based on Kyoto Encyclopedia of Genes and Genomes (KEGG) database revealed upregulated purine metabolism in Mfn1/2- ^/- AEC2 cells at baseline (upper panel) and in AEC2 cells after bleomycin treatment (lower panel).

[0118] FIG.19A (left panel) shows the abbreviations of various lipid species, and FIG.19A (right panel) shows the percentages of various lipid species in AEC2 cells (n=4 samples; lipids with percentage less than 0.5% are marked by red color). [0119] FIGs. 19B-19C show the lipidomic analysis of lipid species (FIG. 19B) and _{phosphatidic acid species (FIG. 19C) present in AEC2 cells from control, Mfn1} ^iDAEC2 _{and Mfn2} ^iDAEC2 _{mice (n=3 mice per group) (* denotes Mfn1} ^-/- _{vs. control, and # denotes Mfn2} ^-/- vs. control; * and # p < 0.05, ** and ## p < 0.01, by unpaired Student’s t-test). All the data in FIGs. 19A-19C are presented as mean±s.e.m.

[0120] FIG. 20A-20C show the acylcarnitines (FIG. 20A), phosphatidylcholine (FIG. 20B) and phosphatidylglycerol (FIG.20C) species in control, Mfn1- and Mfn2-deficient AEC2 cells (n=4 samples from 8 mice per group, AEC2 cells from 2 mice are pooled to form 1 sample) 8 days after bleomycin treatment. The fold changes of specific lipid contents in AEC2 cells after bleomycin treatment relative to those after PBS treatment (n=3 per group) were calculated and log-transformed (base 2) (­ or ¯, p < 0.05, calculated fold changes vs. 1 by unpaired Student’s t-test). d

[0121] FIG.20D shows the surfactant protein genes (Sftpb and Sftpc) in AEC2 cells at day 5 after PBS or bleomycin treatment (# PBS vs. bleomycin, # adjusted p < 0.05, # adjusted p < 0.01, and ### adjusted p < 0.001). All the data in FIG.20A-20D are presented as mean±s.e.m.

[0122] FIGs. 21A-21D show the lipidomic analysis of acylcarnitine (FIG. 21A), phosphatidylglycerol (FIG. 21B), diacylglycerol (FIG. 21C), and various _{glycerophospholipids and sphingolipids (FIG. 21D) in Sftpc} ^CreERT2+/+ _{and Mfn1/2} ^-/- _{AEC2 cells (n=4 mice per group; *p < 0.05, **p < 0.01, ***p < 0.001, vs. Sftpc} ^CreERT2+/+ _by unpaired Student’s t-test).

[0123] FIG.21E shows the mRNA expression of Sftpb and Sftpc genes. The fold change of FPKM is calculated relative to control (n=3 mice per group). Data in FIGs. 21A-21E are presented as mean±s.e.m.

[0124] FIG. 22 shows a schematic representation showing that loss of MFN1 or MFN2 aggravates lung fibrosis by superimposing abnormal lipid metabolism on extensive mitochondrial damage in AEC2 cells.

[0125] FIG.23A shows the full immunoblots from the FIG.2C.

[0126] FIG.23B shows the full immunoblots from the FIG.4C.

[0127] FIG.23C shows the full immunoblots from the FIG.6G.

[0128] FIG.23D shows the full immunoblots from the FIG.8C. [0129] FIG.23E shows the full immunoblots from the FIG.10A.

[0130] FIG.23F shows the full immunoblots from the FIG.10C.

[0131] FIG.24 shows functional enrichment analyses of differential transcripts that exhibit a fold change that is > 1.2 (adjusted p < 0.001) between AEC2 cells isolated from mice treated with bleomycin and AEC2 cells from control.

[0132] FIG.25 shows functional enrichment analyses of differential transcripts (adjusted p < 0.05) between Mfn1-/- (column 2) or Mfn2-/- (column 3) AEC2 cells vs. control AEC2 cells at baseline.

[0133] FIG.26 shows functional enrichment analyses of differential transcripts (adjusted p < 0.05) between Mfn1-/- (column 2) or Mfn2-/- (column 3) AEC2 cells vs. control AEC2 cells isolated from mouse lungs 5 days after bleomycin treatment.

[0134] FIG.27 shows functional enrichment analyses of differential transcripts (adjusted p < 0.05) between Mfn1-/- Mfn2-/- double mutant AEC2 cells and control AEC2 cells at baseline.

DETAILED DESCRIPTION

[0135] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology.

[0136] The present disclosure relates to genetically modified rodent models (e.g., mouse models) for pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis), and methods of using the same to identify candidate agents to treat or prevent lung fibrosis.

[0137] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, immunology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A

Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.);

MacPherson et al. (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir’s Handbook of Experimental Immunology. Methods to detect and measure levels of polypeptide gene expression products (i.e., gene translation level) are well-known in the art and include the use of polypeptide detection methods such as antibody detection and quantification techniques. (See also, Strachan & Read, Human Molecular Genetics, Second Edition. (John Wiley and Sons, Inc., NY, 1999)).

[0138] The present disclosure demonstrates that co-deletion of mitofusins in alveolar type 2 epithelial cells (AEC2) results in significant morbidity and mortality associated with disordered mitochondrial dynamics, including impairment of surfactant lipid metabolism, and the development of spontaneous lung fibrosis. Accordingly, the genetically modified rodent models disclosed herein directly link mitochondrial damage-associated lipid metabolism in AEC2 cells and lung fibrosis. Mitochondrial damage was exclusively introduced in AEC2 cells using the AEC2 cell specific Sftpc-promoter. Persistent mitochondrial damage in AEC2 cells is pathogenic in the lung fibrotic process in IPF lungs and murine models. These findings indicate that IPF may be“single-cell” disease affecting AEC2 cells, which may in turn promote the activation of highly activated fibroblasts and myofibroblasts. Without wishing to be bound by theory, it is believed that injury to AEC2 cells hampers the maintenance of the epithelial cell barrier integrity, which in turn may encourage the aberrant alveolar repair process leading to the extensive lung remodeling observed in IPF.

[0139] Although it is technically difficult to access the role of mitochondrial fusion proteins MFN1 and MFN2 in regulating lipid metabolism in human AEC2 cells from healthy and IPF lungs, the present disclosure demonstrates that MFN1 and MFN2 regulate lipid metabolism in murine AEC2 cells, which has important ramifications for surfactant lipid production in these cells and the development of lung fibrosis. The Examples described herein confirm that mitochondrial fragmentation and increased synthesis of cholesterol, ceramides, and specific glycerophospholipids in response to bleomycin-induced mitochondrial damage. Without wishing to be bound by theory, it is believed that in response to mitochondrial damage, AEC2 cells upregulate these lipids to maintain surfactant lipid production under conditions of AEC2 cell injury. Loss of surfactant integrity leads to loss of normal lung physiology and may promote the development of lung fibrosis.

Definitions

[0140] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms“a”,“an” and“the” include plural referents unless the content clearly dictates otherwise. For example, reference to“a cell” includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.

[0141] As used herein, the term“about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).

[0142] As used herein, the term“biological sample” means sample material derived from living cells. Biological samples may include tissues, cells, protein or membrane extracts of cells, and biological fluids (e.g., ascites fluid or cerebrospinal fluid (CSF)) isolated from a subject, as well as tissues, cells and fluids present within a subject. Biological samples of the present technology include, but are not limited to, samples taken from breast tissue, renal tissue, the uterine cervix, the endometrium, the head or neck, the gallbladder, parotid tissue, the prostate, the brain, the pituitary gland, kidney tissue, muscle, the esophagus, the stomach, the small intestine, the colon, the liver, the spleen, the pancreas, thyroid tissue, heart tissue, lung tissue, the bladder, adipose tissue, lymph node tissue, the uterus, ovarian tissue, adrenal tissue, testis tissue, the tonsils, thymus, blood, hair, buccal, skin, serum, plasma, CSF, semen, prostate fluid, seminal fluid, urine, feces, sweat, saliva, sputum, mucus, bone marrow, lymph, and tears. Biological samples can also be obtained from biopsies of internal organs.

Biological samples can be obtained from subjects for diagnosis or research or can be obtained from non-diseased individuals, as controls or for basic research. Samples may be obtained by standard methods including, e.g., venous puncture and surgical biopsy. In certain

embodiments, the biological sample is a tissue sample obtained by needle biopsy. [0143] As used herein, a "control" is an alternative sample used in an experiment for comparison purpose. A control can be "positive" or "negative." For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed.

[0144] As used herein,“Cre recombinase” or“Cre” refers to a tyrosine recombinase enzyme derived from the P1 bacteriophage. The Cre enzyme (38kDa) is a member of the integrase family of site specific recombinases, and uses a topoisomerase I-like mechanism to carry out site specific recombination events between two DNA recognition sites (LoxP sites). The products of Cre-mediated recombination at loxP sites are dependent upon the location and relative orientation of the loxP sites.

[0145] As used herein, the term“effective amount” refers to a quantity sufficient to achieve a desired effect, e.g., an amount which results in the deletion/excision of a floxed full-length mitofusin nucleic acid sequence, or the induction of lung fibrosis, or the prevention of or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein. In the context of therapeutic or prophylactic applications, the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled artisan will be able to determine appropriate dosages depending on these and other factors. The compositions can also be administered in combination with one or more additional therapeutic compounds. In the methods described herein, the therapeutic compositions may be administered to a subject having one or more signs or symptoms of a disease or condition described herein. As used herein, a "therapeutically effective amount" of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.

[0146] As used herein,“expression” includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function. [0147] As used herein, an“expression control sequence” refers to polynucleotide sequences which are necessary to affect the expression of coding sequences to which they are operably linked. Expression control sequences are sequences which control the transcription, post- transcriptional events and translation of nucleic acid sequences. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence. The term“control sequences” is intended to encompass, at a minimum, any component whose presence is essential for expression, and can also encompass an additional component whose presence is advantageous, for example, leader sequences.

[0148] As used herein, the terms“floxing” or“flanking by LoxP” refer to the sandwiching of a DNA sequence (which is then said to be floxed) between two lox P sites. Floxing a gene sequence allows it to be conditionally deleted (knocked out), translocated or inverted via Cre recombinase activity in a specific tissue in vivo and/or during a particular temporal window. The products of Cre mediated recombination depend upon the orientation of the loxP sites. A DNA sequence found between two loxP sites oriented in the same direction will be excised as a circular loop of DNA, whereas intervening DNA between two loxP sites that are opposingly orientated will be inverted. In some embodiments, a loxP site may be inserted at one or both ends of a DNA sequence using CRISPR/Cas9, sgRNA, and donor DNA oligonucleotide including the loxP site.

[0149] The term "fusion protein" as used herein refers to a hybrid polypeptide which comprises protein domains from at least two different proteins. One protein may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy-terminal (C-terminal) protein thus forming an "amino-terminal fusion protein" or a "carboxy-terminal fusion protein," respectively. A protein may comprise different domains, for example, a Cre recombinase (Cre) and a tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2). In some embodiments, the mutation in the estrogen ligand-binding domain prevents binding of its natural ligand (17b-estradiol) at normal physiological concentrations, but renders the ERT2 domain responsive to 4-hydroxy (OH)-tamoxifen. Fusion of Cre with ERT2 leads to the ERT2-dependent cytoplasmic sequestration of Cre by Hsp90, thereby preventing Cre-mediated recombination events in the nucleus. However, binding of 4OH- tamoxifen leads to a disruption of the interaction with Hsp90, permitting access of Cre- ERTM to the nucleus and initiation of recombination. In some embodiments, a protein is in a complex with, or is in association with, a nucleic acid, e.g., DNA. Any of the proteins provided herein may be produced by any method known in the art. For example, the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4.sup.th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference.

[0150] As used herein, the term“gene” means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression.

[0151] As used herein, the terms“individual”,“patient”, or“subject” can be an individual organism, a vertebrate, a mammal, or a human. In some embodiments, the individual, patient or subject is a human or a rodent (e.g., mouse).

[0152] The term "mutation," as used herein, refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4.sup.th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)).

[0153] As used herein,“loxP” is a 34 base pair (bp) site on the bacteriophage P1 and includes an asymmetric 8 bp sequence, variable except for the middle two bases, flanked by two sets of symmetric, 13 bp sequences. The wild-type loxP site sequence is

ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 3). The 13 bp sequences are palindromic but the 8 bp spacer is not, thus giving the loxP sequence a certain direction. If the two loxP sites are in the same orientation, the floxed sequence (sequence flanked by two loxP sites) is excised; however if the two loxP sites are in the opposite orientation, the floxed sequence is inverted. Examples of alternate loxP sites include

'N' indicates bases which may vary, and lowercase letters indicate bases that have been mutated from the wild-type.

[0154] As used herein,“mitofusins” refer to the Mfn1 and Mfn2 fusogenic proteins which belong to the family of ubiquitous transmembrane GTPases, and are embedded in the outer membrane of the mitochondria. Human Mfn1 (741 residues) and Mfn2 (757 residues) are nuclear encoded by 18 exons on chromosome 3 (3q26.33) and 20 exons on chromosome 1 (1p36.22), respectively. Mfn1 and Mfn2 share approximately 80% sequence similarity and the same relevant structural motifs. Their essential amino-terminal GTPase domain contains five motifs, each of them playing a crucial function in binding and hydrolyzing GTP. Mfn1 and Mfn2 also possess two coiled-coil domains (also called heptad-repeat domains, HR1 and HR2).

[0155] As used herein,“operably linked” means that expression control sequences are positioned relative to the nucleic acid of interest to initiate, regulate or otherwise control transcription of the nucleic acid of interest. In some embodiments, transcription of a polynucleotide operably linked to an expression control element (e.g., a promoter) is controlled, regulated, or influenced by the expression control element.

[0156] As used herein, the term“polynucleotide” or“nucleic acid” means any RNA or DNA, which may be unmodified or modified RNA or DNA. Polynucleotides include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is mixture of single- and double-stranded regions, and hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double- stranded regions. In addition, polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.

[0157] As used herein, the terms“polypeptide,”“peptide” and“protein” are used interchangeably herein to mean a polymer comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. Polypeptide refers to both short chains, commonly referred to as peptides, glycopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. Polypeptides include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques that are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.

[0158] As used herein,“prevention” or“preventing” of a disease or medical condition refers to a compound that, in a statistical sample, reduces the occurrence of the disease or medical condition in the treated sample relative to an untreated control sample, or delays the onset of one or more symptoms of the disease or medical condition relative to the untreated control sample.

[0159] The term“promoter” as used herein refers to any sequence that regulates the expression of a coding sequence, such as a gene. Promoters may be constitutive, inducible, repressible, or tissue-specific, for example. A“promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors. In some embodiments, the promoter is an alveolar type 2 epithelial cell (AEC2) promoter such as surfactant protein C (Sftpc) or surfactant protein B (Sftpb).

[0160] As used herein, the term“recombinant” when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the material is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non- recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.

[0161] A“transgenic animal” is a non-human animal, such as a mammal, generally a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene as described herein. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, and the like. A“transgene” is exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and thus remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. Knock-in animals, which include a gene insertion, are included in the definition of transgenic animals.

[0162] “Treating” or“treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, i.e., arresting its development; (ii) relieving a disease or disorder, i.e., causing regression of the disorder; (iii) slowing progression of the disorder; and/or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder. In some embodiments, treatment means that the symptoms associated with the disease are, e.g., alleviated, reduced, cured, or placed in a state of remission.

[0163] It is also to be appreciated that the various modes of treatment of disorders as described herein are intended to mean“substantial,” which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved. The treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.

Pulmonary Fibrosis

[0164] Pulmonary fibrosis is not seen as a separate entity but develops usually in the context of environmental exposures or as an accompaniment of a syndrome. Common causes are exposure to asbestos, metal dusts or organic substances, sarcoidosis (a disease characterized by the formation of granulomas), exposure to medical drugs and radiation. Often pulmonary fibrosis is associated with connective tissue or collagen diseases such as rheumatoid arthritis and scleroderma (Giri, S. N. (2003) Annu Rev Pharmacol Toxicol 43, 73-95).

[0165] Pathologically, the disease is characterized by chronic inflammation and collagen production within fibroblastic foci in the lung. Myofibroblasts are a distinguishing feature of fibroblastic foci. The disease typically proceeds with scarring of the lung and the alveoli which become lined by fibrotic tissue. When the scar forms, the tissue becomes thicker causing an irreversible loss in efficiency of the tissue's ability to transfer oxygen into the bloodstream.

[0166] Several growth factors have been implicated in the pathogenesis of pulmonary fibrosis. These factors have been identified by virtue of their ability to stimulate fibroblast division and extracellular matrix (ECM) production, as well as their presence in the lungs and lung fluids of patients or animals with fibrotic lung disease. These growth factors include TGF-b, insulin-like growth factor (IGF)-I, platelet-derived growth factor (PDGF), members of the fibroblast growth factor (FGF) family and keratinocyte growth factor (KGF) (Krein, P. M., and Winston, B. W. (2002) Chest 122, 289S-293S). Since pulmonary fibrosis is a very complex disease, the prediction of longevity of patients after diagnosis varies greatly.

Genetically Modified Rodent Models of the Present Technology and Uses Thereof

[0167] In one aspect, the present disclosure provides a genetically modified murine genome comprising at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4); and a transgene including a fusion protein (CreERT2) that comprises a Cre recombinase (Cre) fused to a tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2), wherein the fusion protein is operably linked to an alveolar type 2 epithelial cell (AEC2) expression control sequence, and wherein the mitofusin nucleic acid sequence is MFN1 and/or MFN2. The at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) may be derived from a mammal selected from the group consisting of a mouse, a rat, and a human. In some embodiments, the at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) is a full length cDNA sequence of MFN1 and/or MFN2.

[0168] Exemplary MFN1 and/or MFN2 nucleic acid sequences are provided below:

48

4

[0169] Additionally or alternatively, in some embodiments, the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) comprises the sequence of SEQ ID 4838- NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18.

[0170] In any of the preceding embodiments of the genetically modified murine genome described herein, the at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) comprises a 5’ flanking loxP site and a 3’ flanking loxP site that are oriented in an identical direction. In certain embodiments, the 5’ flanking loxP site and/or the 3’ flanking loxP site comprises the sequence of any one of SEQ ID NOs: 3-12. The sequences of the 5’ flanking loxP site and the 3’ flanking loxP site may be identical or different. Additionally or alternatively, in some embodiments, the genetically modified murine genome of the present technology comprises a floxed full-length MFN1 nucleic acid sequence and a floxed full- length MFN2 nucleic acid sequence that are located at distinct genomic sites. In a further embodiment, the 5’ and 3’ flanking loxP sites of the floxed full-length MFN1 nucleic acid sequence are distinct from the 5’ and 3’ flanking loxP sites of the floxed full-length MFN2 nucleic acid sequence.

[0171] Additionally or alternatively, in some embodiments, the genetically modified murine genome of the present technology, further comprises a detectable reporter gene such as a fluorescent reporter gene, a chemiluminescent reporter gene, or a bioluminescent reporter gene. In certain embodiments, the transgene comprises a detectable reporter gene such as a fluorescent reporter gene, a chemiluminescent reporter gene, or a bioluminescent reporter gene. Examples of suitable fluorescent reporter genes include, but are not limited to, GFP, YFP, CFP, RFP, TagBFP, Azurite, EBFP2, mKalama1, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, mTFP1, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, EYFP, Citrine, Venus, SYFP2, TagYFP, Monomeric Kusabira-Orange, mKOk, mKO2, mOrange, mOrange2, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP,

TagRFP657, IFP1.4, iRFP, mKeima Red, LSS-mKate1, LSS-mKate2, PA-GFP,

PAmCherry1, PATagRFP, Kaede (green), Kaede (red), KikGR1 (green), KikGR1 (red), PS- CFP2, PS-CFP2, mEos2 (green), mEos2 (red), PSmOrange, and Dronpa. Examples of bioluminescent reporter genes include, but are not limited to, Aequorin, firefly luciferase, Renilla luciferase, red luciferase, luxAB, and nanoluciferase. Examples of suitable chemiluminescent reporter genes include b-galactosidase, horseradish peroxidase (HRP), and alkaline phosphatase. Peroxidases generate peroxide that oxidizes luminol in a reaction that generates light, whereas alkaline phosphatases remove a phosphate from a substrate molecule, destabilizing it and initiating a cascade that results in the emission of light.

[0172] In any and all embodiments of the genetically modified murine genome disclosed herein, the AEC2 expression control sequence has a length ranging from 100 base pairs (bps) to 5 kilobases (kb). In certain embodiments, the AEC2 expression control sequence has a length of about 100 bps, about 150 bps, about 200 bps, about 250 bps, about 300 bps, about 350 bps, about 400 bps, about 450 bps, about 500 bps, about 550 bps, about 600 bps, about 650 bps, about 700 bps, about 750 bps, about 800 bps, about 850 bps, about 900 bps, about 950 bps, about 1.1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, about 2.1 kb, about 2.2 kb, about 2.3 kb, about 2.4 kb, about 2.5 kb, about 2.6 kb, about 2.7 kb, about 2.8 kb, about 2.9 kb, about 3.1 kb, about 3.2 kb, about 3.3 kb, about 3.4 kb, about 3.5 kb, about 3.6 kb, about 3.7 kb, about 3.8 kb, about 3.9 kb, about 4.1 kb, about 4.2 kb, about 4.3 kb, about 4.4 kb, about 4.5 kb, about 4.6 kb, about 4.7 kb, about 4.8 kb, about 4.9 kb, or about 5 kb. Values and ranges intermediate to the recited values are also contemplated. Additionally or alternatively, in some

embodiments, the AEC2 expression control sequence is a surfactant protein C (Sftpc) promoter or a surfactant protein B (Sftpb) promoter.

[0173] Additionally or alternatively, in certain embodiments, the Cre recombinase (Cre) is fused to the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2) via a peptide linker. The Cre recombinase (Cre) may be fused to the N-terminus or C-terminus of the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2). In some embodiments, the Cre recombinase (Cre) comprises the sequence of SEQ ID NO: 19 and/or the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2) comprises the sequence of SEQ ID NO: 20.

[0174] Additionally or alternatively, in some embodiments, the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) and the transgene are located on different or identical chromosomes. In certain embodiments, the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) is configured to be deleted or excised when the genetically modified murine genome is contacted with an effective amount of tamoxifen.

[0175] In one aspect, the present disclosure provides a rodent comprising any genetically modified murine genome described herein, wherein the rodent is homozygous for a floxed full-length MFN1 nucleic acid sequence and/or a floxed full-length MFN1 nucleic acid sequence. In some embodiments, the rodent of the present technology does not comprise endogenous MFN1 and/or MFN2 genomic nucleic acid sequences that lack flanking loxP sites. The rodent may be a rat or a mouse. Additionally or alternatively, in some

embodiments, the floxed full-length MFN1 nucleic acid sequence has been knocked into a wild-type MFN1 locus, and/or wherein the floxed full-length MFN2 nucleic acid sequence has been knocked into a wild-type MFN2 locus.

[0176] In any of the preceding embodiments of the rodent of the present technology, the rodent develops lung fibrosis after being exposed to an effective amount of tamoxifen, and optionally an effective amount of bleomycin. Signs or symptoms of lung fibrosis may include one or more of weight loss, low-grade fevers, fatigue, arthalgias, myalgias, shortness of breath, respiratory distress, aching joints, or shallow breathing. In some embodiments, the

rodent is fertile and is capable of transmitting the genetically modified murine genome to its offspring.

[0177] Additionally or alternatively, in some embodiments, the AEC2 cells of the rodent exhibit one or more signs of mitochondrial damage selected from the group consisting of fragmented mitochondria with decreased mitochondrial area, increased mitochondrial number, enlarged mitochondria with irregular and disrupted cristae, increased mitochondrial area, decreased mtDNA copy number, and reduced mitophagy after being exposed to an effective amount of tamoxifen. In any and all embodiments of the rodent described herein, the rodent exhibits excessive scar formation, increased localization of fibroblastic aggregates in lungs, increased lung collagen deposition, elevated expression of vimentin, a-smooth muscle actin, and/or collagen III, and altered lipid metabolism after being exposed to an effective amount of tamoxifen. In certain embodiments, altered lipid metabolism comprises reduced levels of one or more of cholesterol, ceramides, phosphatidic acids,

phosphatidylethanolamine, phosphatidylserine, plasmalogen phosphatidylethanolamine, phosphatidylglycerol, monoacylglycerol, diacylglycerol, acylcarnitines,

glycerophospholipids, sphingolipids, and phosphatidylcholines with long unsaturated aliphatic chains.

[0178] In another aspect, the present disclosure provides a method for identifying a candidate agent for preventing lung fibrosis comprising (a) administering a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent has been exposed to an amount of tamoxifen that is effective to induce fibrosis, and (b) monitoring the development of lung fibrosis in the rodent of step (a), wherein a reduction in or delayed onset of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that has been exposed to an amount of tamoxifen that is effective to induce fibrosis and that has not received the candidate agent indicates that the candidate agent is effective in preventing lung fibrosis.

[0179] In one aspect, the present disclosure provides a method for identifying a candidate agent for treating lung fibrosis comprising (a) administering a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent exhibits lung fibrosis after being exposed to an effective amount of tamoxifen, and (b) monitoring the progression of lung fibrosis in the rodent of step (a), wherein amelioration of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that exhibits lung fibrosis after being exposed to an effective amount of tamoxifen and that has not 4838-

received the candidate agent indicates that the candidate agent is effective in treating lung fibrosis. In another aspect, the present disclosure provides a method for determining an effective amount of a candidate agent for treating lung fibrosis comprising (a) administering a test amount of a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent exhibits lung fibrosis after being exposed to an effective amount of tamoxifen, and (b) monitoring the progression of lung fibrosis in the rodent of step (a), wherein amelioration of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that exhibits lung fibrosis after being exposed to an effective amount of tamoxifen and that has not received the candidate agent indicates that the test amount of the candidate agent is effective in treating lung fibrosis. In some embodiments of the methods disclosed herein, amelioration of lung fibrosis comprises reduced scar formation, decreased localization of fibroblastic aggregates in lungs, decreased lung collagen deposition, reduced expression of vimentin, ^-smooth muscle actin, and/or collagen III, and increased levels of one or more of lipids selected from among cholesterol, ceramides, phosphatidic acids, phosphatidylethanolamine, phosphatidylserine, plasmalogen

phosphatidylethanolamine, phosphatidylglycerol, monoacylglycerol, diacylglycerol, acylcarnitines, glycerophospholipids, sphingolipids, and phosphatidylcholines with long unsaturated aliphatic chains.

[0180] In yet another aspect, the present disclosure provides a method for determining an effective amount of a candidate agent for preventing lung fibrosis comprising (a)

administering a test amount of a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent has been exposed to an amount of tamoxifen that is effective to induce fibrosis, and (b) monitoring the development of lung fibrosis in the rodent of step (a), wherein a reduction in or delayed onset of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that has been exposed to an amount of tamoxifen that is effective to induce fibrosis and that has not received the candidate agent indicates that the test amount of the candidate agent is effective in preventing lung fibrosis.

[0181] In any and all embodiments of the methods disclosed herein, the lung fibrosis is caused by connective tissue or collagen diseases (e.g., rheumatoid arthritis, scleroderma), exposure to asbestos, metal dusts or organic substances, sarcoidosis, and exposure to medical drugs and radiation. Additionally or alternatively, in some embodiments of the methods

4838-

disclosed herein, the candidate agent is an antibody agent, a peptide, a polypeptide, a fusion protein, a small molecule, a siRNA, an antisense RNA, a sgRNA, or a shRNA.

[0182] Also disclosed herein are kits comprising any embodiment of the rodent of the present technology and instructions for assaying the effectiveness of a candidate agent for treating or preventing lung fibrosis. The kits can also contain a control sample or a series of control samples, which can be assayed and compared to the test sample. Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package, along with instructions for interpreting the results of the assays performed using the kit. The kits of the present technology may contain a written product on or in the kit container. In certain embodiments, the use of the reagents can be according to the methods of the present technology. Additionally or alternatively, the kits further comprise reagents for detecting levels of vimentin, a-smooth muscle actin, collagen, and one or more lipids selected from among cholesterol, ceramides, phosphatidic acids,

phosphatidylethanolamine, phosphatidylserine, plasmalogen phosphatidylethanolamine, phosphatidylglycerol, monoacylglycerol, diacylglycerol, acylcarnitines,

glycerophospholipids, sphingolipids, and phosphatidylcholines with long unsaturated aliphatic chains. The written product describes how to use the reagents contained in the kit, e.g., for screening for a candidate agent that prevents or treats lung fibrosis.

[0183] Also disclosed herein are methods of producing any embodiment of the genetically modified murine genome described herein comprising: (a) providing a first rodent having in its genome at least one floxed full-length mitofusin nucleic acid sequence, wherein the mitofusin nucleic acid sequence is MFN1 and/or MFN2, and wherein the first rodent does not comprise the transgene; (b) mating the first rodent with a second rodent, wherein the second rodent comprises in its genome the transgene, and wherein the second rodent does not comprise the at least one floxed full-length mitofusin nucleic acid sequence; and (c) selecting a progeny rodent from step (b) comprising the at least one floxed full-length mitofusin nucleic acid sequence, and the transgene; wherein each of the at least one floxed full-length mitofusin nucleic acid sequence and the transgene are located at distinct genomic sites in the progeny rodent. In some embodiments, the first rodent comprises a floxed full-length MFN1 nucleic acid sequence and a floxed full-length MFN2 nucleic acid sequence. Additionally or alternatively, in some embodiments, the flanking loxP sites of the floxed full-length MFN1 nucleic acid sequence are either identical to or distinct from the flanking loxP sites of the floxed full-length MFN2 nucleic acid sequence. In any and all embodiments of the methods 4838- disclosed herein, the first rodent is homozygous for the floxed full-length MFN1 nucleic acid sequence and/or the floxed full-length MFN2 nucleic acid sequence.

EXAMPLES

[0184] The present technology is further illustrated by the following examples, which should not be construed as limiting in any way.

Example 1: Materials and Methods

[0185] Mice. Mfn1 ^loxp/loxp (stock 029901-UCD) and Mfn2 ^loxp/loxp (stock 029902-UCD) mice were both generated by David C Chan (Chen et al., Cell 130, 548-562 (2007)), and were purchased from Mutant Mouse Resource & Research Centers (MMRRC). Sftpc ^CreERT2+/+ mice were shared from Dr. Brigid Hogan. PolgA ^D257A/D257A mice were purchased from the Jackson Laboratory. Fasn ^loxp/loxp mice were kindly provided by Dr. Clay F Semenkovich, Washington University School of Medicine. To generate mice with tamoxifen-inducible Mfn1, Mfn2, Mfn1/2 or FASN deletion specifically in AEC2 cells, Mfn1 ^loxp/loxp , Mfn2 ^loxp/loxp and Fasn ^loxp/loxp were crossed to Sftpc ^CreERT2+/+ mice. To induce recombination by CreERT2, 6 consecutive intraperitoneal tamoxifen (100 mg/kg/dose; catalog T5648, Sigma-Aldrich) injections, prepared using sunflower seed oil (Catalog S5007, Sigma-Aldrich), were given from 5 weeks of age. Sftpc ^CreERT2+/- or Sftpc ^CreERT2+/+ mice were used as control for experiments. Additionally, ROSA26 ^tdTomato+/+ mice (stock 007914) were purchased from the Jackson Laboratory, and were bred with Sftpc ^CreERT2+/+ to express tamoxifen-inducible tdTomato fluorescence in AEC2 cells. To sort AEC2 cells with loss of MFN1 or MFN2 through tamoxifen-inducible tdTomato fluorescence, ROSA26 ^tdTomato+/+ mice were crossed to Mfn1 ^loxp/loxp or Mfn2 ^loxp/loxp mice to respectively generate Mfn1 ^loxp/loxp ROSA26 ^tdTomato+/+ or Mfn2 ^loxp/loxp ROSA26 ^tdTomato+/+ mice, which were subsequently crossed to

Mfn1 ^loxp/loxp Sftpc ^CreERT2+/+ or Mfn2 ^loxp/loxp Sftpc ^CreERT2+/+ mice. ROSA26 ^tdTomato+/- Sftpc ^CreERT2+/- mice were used as the control. All animal experiments and procedures were approved by the Institutional Animal Care and Use Committee at Weill Cornell Medicine.

[0186] Bleomycin model of lung fibrosis. 12-week-old sex and weight matched mice were used for bleomycin instillations. Induction of anesthesia was performed in the induction chamber by 3.5% Isoflurane, and 0.5 -0.75 mg/kg bleomycin (Catalog 13877, Cayman Chemical Company) in 50mL phosphate-buffered saline (PBS) was then given by intra- tracheal instillation, through gel-loading tips under the assistance of direct laryngoscopy using the otoscope. Control mice received intra-tracheal instillation of 50mL PBS only. The 4838-

weight of mice was recorded before and every 2 days after bleomycin treatment. Mice were euthanized at different time points after bleomycin instillation for sample harvest as outlined in the manuscript and figure legends.

[0187] Sircol assay. Murine lungs were harvested 14 days after bleomycin or PBS instillation for quantification of the acid soluble collagen, using the Sircol assay (Catalog S1000, Biocolor). Murine lungs were first perfused using PBS, and the right lungs were obtained for the measurements, according to the manufacturer’s instructions.

[0188] Bronchoalveolar lavage. After the mouse was euthanized, the trachea was intubated with a 20-gauge catheter (Terumo). Murine lungs were lavaged with 0.7-ml ice cold PBS 3 times (a total of 2.1 ml), and the BALF was collected. After centrifugation at 500g for 5 minutes at 4 °C, the supernatant was aliquoted and stored at -80 °C; BALF protein

concentration was measured using BCA protein assay kit (Thermo Fisher). Cell pellets were re-suspended in 100mL PBS. The cell number was quantified using 10mL cell suspension by a Countess II Automated Cell Counter (Thermo Fisher), and cytospin slides were prepared using 40mL of the cell suspension with 160mL of PBS (500 r.p.m. for 5 minutes). Slides were stained using the Hemacolor Rapid staining kit (EMD Millipore), and the numbers of macrophages, leukocytes and neutrophils were counted in a total of at least 200 cells.

[0189] Isolation of murine AEC2 cells through MACS separation. AEC2 cells were isolated from murine lungs as previously described. Briefly, mice were euthanized by intraperitoneal injection of 8 mg pentobarbital, and a thoracotomy was performed. Murine lungs were perfused through the right ventricle using PBS, and then inflated with 1.5mL dispase (Catalog 354235, BD Biosciences) and 0.5mL 1% low-melting point agarose (Catalog 16520-050, Invitrogen). After cooling on ice for 2 minutes, the lungs were excised and were transferred to a 50ml polypropylene tube containing 2mL dispase. After digestion for 45 minutes at room temperature, the lungs were homogenized manually using the plunger of a 1mL syringe in a 10cm petri dish with Dulbecco’s modified Eagle’s medium (DMEM) containing 200 U/mL DNase (Catalog D-4527, Sigma-Aldrich). After filtration sequentially through 100mm, 40mm (BD Biosciences), and 0.22mm (EMD Millipore) strainers, and centrifugation, whole lung cell suspensions were obtained. Whole lung cell suspensions were negatively selected for CD45 (CD45 microbeads Catalog 130-052-301, Miltenyi Biotec), followed by positive selection with biotin-conjugated anti-EpCAM antibody (Catalog 13-5791-82, eBioscience) and streptavidin microbeads (Catalog 130-048-102, Miltenyi Biotec), through MACS separation columns. The resulting CD45(-)EpCAM(+) population was enriched for AEC2 4838-

cells (purity ~94% by flow cytometric analysis and quantification by immunofluorescence staining; please see flow cytometric and immunofluorescence staining methods below).

[0190] Immunofluorescent staining of isolated AEC2 Cells. To quantify the AEC2 purity in MACS-isolated CD45(-)EpCAM(+) populations, immunofluorescent staining of surfactant protein C (SP-C) was performed using cytospin slides. Briefly, after isolation, the

CD45(-)EpCAM(+) cells were fixed by 4% PFA in a flow cytometry tube for 12 minutes under room temperature, and were transferred to slides by cytospin centrifugation at 350 rpm for 3 minutes. The CD45(-)EpCAM(-) population was used to prepare cytospin slides for negative control. Blocking and permeabilization were performed at room temperature for 1 hour, using the buffer containing 5% normal goat serum (Vector Laboratories) and 0.3% Triton X-100 (Sigma-Aldrich) in tris-buffered saline (TBS). Cells were incubated overnight with a primary antibody generated to SP-C (1: 1000 in blocking buffer, EMD Millipore ABC99) in a humidified chamber at 4 °C. Sixteen to 24hours later, the cells were incubated with the Alexa Fluor-488-conjugated secondary antibody (Thermo Fisher) for 1 hour under room temperature. Hoechst 33342 (1:1000 dilution in TBS) was used to stain the nucleus. The slides were mounted using Prolong Gold antifade solution (Invitrogen), and the images of the slides were obtained by confocal microscopy (Zeiss LSM 880 laser scanning microscope).

[0191] Flow cytometry analysis. Flow cytometric analyses of EpCAM or SP-C positivity were performed using a LSRFortessa cell analyzer (BD Biosciences). For the staining of EpCAM, cells were fixed by 1% PFA for 15 minutes at room temperature, followed by EpCAM binding with biotin-conjugated anti-EpCAM (1:50; eBioscience) and FcR blocking reagent (1:10; catalog 130-092-575, Miltenyi Biotec) for 1 hour on ice. After washing, a FITC-conjugated anti-biotin antibody (1:10; catalog 130-098-796, Miltenyi Biotec) was added for 10 minutes on ice in the dark. After further washing, the samples were used for flow cytometric analyses. SP-C intracellular staining for flow cytometric analysis was the same as the protocol for immunofluorescent SP-C staining using cytospin slides. mtKeima experiments were carried out to assess mitophagy induction. To induce mitophagy, cells with mtKeima expression were treated with the combination of oligomycin and antimycin A (4mM/5mM; Sigma-Aldrich) for 24 hours. Mitophagy measurement was performed by the pH-sensitive mtKeima fluorescence by the excitation using 405nm (for detecting mtKeima at pH 7.0) and 561nm (for detecting acidic mtKeima at pH 4.0) lasers, as previously described. The intensity of mitophagy was calculated by the ratio of cell percentage with acidic 4838- mtKeima (upper gate) to cell percentage with neural mtKeima (lower gate) (see also FIG. 10F). The flow cytometric data were analyzed with FlowJo analytical software (version 10) (BD Biosciences).

[0192] AEC2 cell isolation by tdTomato fluorescence. To isolate AEC2 cells through tdTomato fluorescence, whole lung cell suspension was obtained after digestion and homogenization of mouse lungs, as described for AEC2 cell isolation by MACS separation. DAPI (0.1 mg/mL) was added to assess cell viability. Flow cytometric cell sorting was then performed by an Influx cell sorter (BD Biosciences) (see also FIG.7A).

[0193] Genotyping for Mfn1 deletion in AEC2 cells. DNA samples were extracted from AEC2 cells obtained from Sftpc ^CreERT2+/- , Mfn1 ^{i DAEC2} , Mfn1/2 ^{i ^AEC2} , control ^{tdTomato-AEC2} , and Mfn1 ^{i DAEC2/tdTomato-AEC2} mice using DNeasy blood and tissue kit (Qiagen), and were used for genotyping through PCR reactions and the subsequent resolution by agarose gel

electrophoresis, based on the protocol by MMRRC (forward

[0194] Real-time qPCR for quantification of mtDNA copy number. DNA samples were extracted from isolated AEC2 cells, and were used for the real-time qPCR, using primers for Nd2 gene of mitochondrial genome and Pecam gene of nuclear genome and SYBR green PCR master mix (Applied Biosystems), in the ABI PRISM 7500 Real-Time PCR System (Applied Biosystems). mtDNA copy number was calculated relative to genomic DNA (gDNA) copy number, through the 2 ^{- ^ ^Ct} method.

[0195] Cell lines. The murine AEC2 cell line MLE 12 and human AEC2 cell line A549 were purchased from ATCC (CRL-2100 and CCL-185, respectively), and were maintained in RPMI 1640 medium containing 10% FBS and 1% penicillin-streptomycin (Gibco). For stable knockdown of Mfn1 or Mfn2 in MLE 12 cells, independent small hairpin RNA

(shRNA) targeting of Mfn1 (TRCN0000081398, TRCN0000081401, and TRCN0000081402; Sigma-Aldrich) or Mfn2 (TRCN0000080610, TRCN0000080611 and TRCN0000080612; Sigma-Aldrich) were used, and non-target shRNA (SHC016; Sigma-Aldrich) served as the control. MLE 12 cells were transduced by shRNA lentiviral particles, followed by puromycin (2mg/mL; catalog A11138-03, Gibco) positive selection for 10-14 days, and were then maintained in RPMI 1640 medium containing 2mg/mL puromycin and 0.5% penicillin- streptomycin. Retroviral packaging plasmids were gifts from David C Chan. The retroviral construct pCHAC-mt-mKeima was a gift from Richard Youle (Addgene plasmid #72342), and was used to express mtKeima in MLE 12 cells through retroviral transduction. Cell sorting by Influx sorter (BD Biosciences) was performed to obtain mtKeima-positive cells. Based on manufacturer’s instructions, A549 cells were transfected with non-targeting control siRNA (Dharmacon, D-001206-14-05) or siRNA targeting at human Mfn1 (Dharmacon SMARTpool, M-010670-01-0005) or Mfn2 (Dharmacon SMARTpool, M-012961-00-0005) mRNA using Lipofectamine® RNAiMAX Transfection Reagent (Life Technologies). The above cell lines were free of mycoplasma infection, assessed using EZ-PCR ^TM Mycoplasma detection kit (Biological Industries).

[0196] Immunoblots. Immunoblotting was performed using lysates of MLE 12 or MACS®- isolated AEC2 cells. Briefly, RIPA buffer with protease inhibitor cocktail (Cell Signaling Technology) was used to prepared the lysates, and the protein concentrations were measured using BCA protein assay (Thermo Fisher). Proteins were resolved by NuPAGE 4%-12% Bis- Tris gel or 3%-8% Tris-Acetate gel (Invitrogen) electrophoresis, followed by transfer to PVDF membranes (EMD Millipore). For immunoblots using A549 lysates, proteins were resolved using 8% Tris-glycine gels. The following primary antibodies were used to detect murine MFN1 (1:1000, Antibodies Incorporated 75-162), human MFN1 (1:1000, Proteintech 13798-1-AP), MFN2 (1:1000, Cell Signaling Technology 9482), OPA1 (1:1000, GeneTex GTX48589), DRP1 (1:500, BD Biosciences, 611112), FASN (1:1000, Cell Signaling

Technology 3180), TIM23 (1:1000, BD Biosciences 611223) and b-Actin (1:5000, Sigma- Aldrich A2228). The horseradish peroxidase (HRP)-conjugated secondary antibodies, anti- rabbit IgG (Santa Cruz sc-2004 or GeneTex 213110) and anti-mouse IgG (Santa Cruz sc- 2005 or BioLegend 405306), were used. Densitometric quantification of bands was carried out using FIJI running ImageJ software (version 1.52b), normalizing to b-actin as a loading control.

[0197] Lung histology and immunohistochemistry (IHC) staining. For histological examination, murine lungs were inflated by 1.2mL 4% paraformaldehyde (PFA) (Electron Microscopy Sciences), and then transferred to a 50-ml polypropylene tube containing 10mL 4% PFA. After 24-hours of fixation at 4 °C, the lobes of the mouse lungs were separated, and transferred to tissue cassettes (Tissue-Tek). The tissue cassettes were then immersed in 70% ethanol at 4 °C. Primary antibodies against vimentin (1:100, Cell Signaling Technology, 5741), a-smooth muscle actin (1:640, Cell Signaling Technology, 19245), and collagen III (1:1000, Abcam, ab7778) were used for IHC staining. For IHC staining, the paraffin- embedded lung sections were first baked and deparaffinized. To retrieve antigen, the slides were heated on the Bond III Autostainer at 99-100 °C, and the sections subjected to sequential incubation with an endogenous peroxidase block, primary antibody, secondary antibody, polymer, diaminobezidine, and hematoxylin. Finally, the sections were dehydrated in 100% ethanol, and mounted in Cytoseal XYL (Richard Allan Scientific). Appropriate positive and negative controls were included.

[0198] Immunofluorescent staining of mouse lung cryosections. To prepare lung

cryosections for immunofluorescent staining, murine lungs were inflated using 1.2mL 4% PFA. The lungs were then excised and transferred to a 50mL polypropylene tube containing 10mL 4% PFA for 24-hour fixation at 4 °C. After fixation, the lobes were separated, and transferred to 30% sucrose (Sigma-Aldrich) solution for 24 hours at 4 °C. Thereafter, the lung lobes were placed in a cryomold (Tissue-Tek), and embedded by optimum cutting

temperature (OCT) formulations. The samples were then stored at -80 °C, and 15-mm-thick cryosections were retrieved on silane-coated slides immediately before immunofluorescent staining. Blocking and permeation of the cryosections was performed using TBS buffer containing 5% normal donkey serum (Jackson ImmunoResearch) and 0.3% Triton X-100 (Sigma-Aldrich). Primary antibodies against SP-C (1:1000, EMD Millipore ABC99), podoplanin (1:100, R&D Systems AF3244), and Ki-67 (1:500, Abcam, ab15580), and secondary antibodies against goat IgG (linked to Alexa Fluor-488) or rabbit IgG (linked to Alexa Fluor-488 or Alexa Fluor-568) (1:500, Thermo Fisher), were all diluted in blocking buffer, and were used for staining the cryosections. A primary antibody against ER-TR7 was conjugated with Alexa Fluor-647, and was used to stain fibroblasts (1:50, Santa Cruz sc- 73355 AF647). Cryosections were covered with diluted primary antibodies and incubated in a humidified chamber overnight at 4 °C. Sixteen to 24 hours later, the cryosections were incubated with secondary antibodies for 1 hour under room temperature, with protection from light exposure. Hoechst 33342 (1:1000 dilution in TBS) was used to stain the nucleus. The slides were mounted using Prolong Gold antifade solution (Invitrogen), and the images of the slides were obtained by confocal microscopy.

[0199] TUNEL staining. Mouse lung cryosections were used for TUNEL staining by ApoAlert ^TM DNA fragmentation assay kit (Clontech), according to the manufacturer’s instructions with some modifications. Briefly, cryosections were permeabilized with PBS containing 0.2% Triton X-100 at 4 °C for 5 minutes. The samples were then covered with the equilibration buffer for 10 minutes at room temperature. The TdT incubation buffer was prepared according to the manufacturer’s protocol, and was added onto the samples. The slides were then placed in a humidified chamber with light protection, and were incubated at 37 °C for 1 hour. SSC (saline-sodium citrate) solution (2X) was then used to immerse the slides at room temperature for 15 minutes, and Hoechst 33342 (1:1000) was used to stain the nucleus. The slides were mounted using Prolong Gold antifade solution (Invitrogen), and the images were obtained by confocal microscopy.

[0200] Confocal microscopy. Confocal microscopy was used to obtain images of immunofluorescent staining, and for the visualization of mitochondria in MLE 12 and A549 cells. A Zeiss LSM 880 laser scanning microscope equipped with 25×/0.8, 40×/1.3, and 63×/1.4 oil immersion objectives was used for image acquisition. The fluorophores were excited with a 405nm laser diode (Hoechst 33342), a 488nm argon laser (Alexa Fluor-488), a 561nm diode-pumped solid-state laser (Alexa Fluor-568), or a 633nm HeNe laser (Alexa Fluor-647). To observe mitochondrial morphology in MLE 12 and A549 cells, cells were cultured in glass-bottom dishes (MatTek Corporation). Mitochondria were stained by 200nM MitoTracker Green (Invitrogen) at 37 °C for 30 minutes. DMEM medium free of phenol red was used to wash the cells and for maintaining the cells for live-cell imaging. The fluorescence of MitoTracker Green was excited by a 488nm argon laser. The morphology of mitochondria (fragmented or tubular) was determined and quantified as previously described.

[0201] Transmission Electron Microscopy (TEM). Fixatives for TEM sample preparation were composed of 4% paraformaldehyde, 2.5% glutaraldehyde, 0.02% picric acid in 0.1M sodium cacodylate buffer (pH 7.3). Murine lungs were inflated with 1.2mL TEM fixative, and were then excised and transferred to a 50mL polypropylene tube containing 10mL TEM fixative, and were submitted to the WCMC Microscopy and Image Analysis Core Facility for sample processing and image acquisition. A Jeol electron microscope (JEM-1400) was used to obtain images with an accelerating voltage of 100 kV. AEC2 cells were identified according to the appearance of lamellar bodies and the microvilli at the apical cell membrane. The quantification of the number (#/mm ² cytosolic area) and the area (mm ² ) of mitochondria or lamellar bodies was performed using FIJI running ImageJ software.

[0202] RNA-Seq analysis in AEC2 cells. RNA samples were obtained from MACS-isolated AEC2 cells from Sftpc ^CreERT2+/+ and Mfn1/2 ^{i ^AEC2} mice, or from AEC2 cells isolated by tdTomato(+) cell sorting from control ^{tdTomato-AEC2} , Mfn1 ^{i DAEC2/tdTomato-AEC2} , and

Mfn2 ^{i DAEC2/tdTomato-AEC2} mice. RNA was extracted using TRIzol reagent (Invitrogen), and was purified by the RNeasy Plus Mini Kit (Qiagen), together with DNA digestion with the RNA free DNase set (Qiagen). The RNA samples were then submitted to Genomic Resource Core Facility of WCMC. RNA quality was determined by 260:280 ratio and the RNA integrity number (RIN) determined by an Agilent Technologies 2100 Bioanalyzer. Only high quality RNA samples with a 260:280 ratio > 1.6 and a RIN > 7 were used for the library construction using the TruSeq Stranded mRNA Library Preparation kit (Illumina), according to manufacturer’s instructions. The cBot fluidic device (Illumina) was used to hybridize samples onto a flow cell and to generate clonal clusters of the DNA fragments. The sequencing was performed on the HiSeq4000 sequencer (Illumina). The raw sequencing reads in binary base call (BCL) format were processed through bcl2fastq 2.19 (Illumina) for FASTQ format conversion and demultiplexing. RNA reads were aligned and mapped to the mm9 mouse reference genome by TopHAEC2 (version 2.0.11) and transcriptome

reconstruction was performed by Cufflinks (version 2.1.1), with gene names based on National Center for Biotechnology Information (NCBI) Entrez Gene. The abundance of transcripts was measured with Cufflinks in Fragments Per Kilobase of exon model per Million mapped reads (FPKM). Differentially expressed genes were identified using the Limma package. To assess the differential expression, p-values were derived from linear modelling and empirical Bayes moderation and adjusted for multiple testing by the

Benjamini-Hochberg method. Gene ontology (GO) over-representation analysis was performed using the clusterProfiler package. GO terms related to“biological process” were used, and adjusted p-values for multiple testing were calculated based on the Benjamini- Hochberg method. The over-representative GO terms were constructed into a enrichment map ⁶⁴ where the geometric mean of the Jaccard and overlap coefficients between GO- associated gene sets was used at a cutoff of 0.5 to connect related GO terms. The enrichment maps were visualized by Cytoscape (version 3.6.1), and the functional clusters were highlighted and labeled manually. Heat maps were plotted using Heatmap Illustrator software (Heml 1.0) and the pheatmap package, based on the z scores calculated using the gene expressions by FPKM.

[0203] Lipidomic profiling in AEC2 cells. MACS-isolated AEC2 cells from 1 to 2 mice were snap frozen by liquid nitrogen immediately after isolation, and were stored at -80 °C before lipidomic profiling. Samples were submitted to the Columbia University Lipidomics Core Laboratory. Lipids were extracted from equal amounts of material (50 mg

protein/sample). Lipid extracts were prepared using a modified Bligh and Dyer procedure as described previously ^68,69 , spiked with appropriate internal standards, and analyzed using a 6490 Triple Quadrupole LC/MS system (Agilent Technologies). Glycerophospholipids and sphingolipids were separated with normal-phase HPLC as described before, with a few modifications. An Agilent Zorbax Rx-Sil column (inner diameter 2.1 x 100 mm) was used under the following conditions: mobile phase A (chloroform:methanol:1 M ammonium hydroxide, 89.9:10:0.1, v/v) and mobile phase B (chloroform:methanol:water:ammonium hydroxide, 55:39.9:5:0.1, v/v); 95% A for 2 min, linear gradient to 30% A over 18 min and held for 3 min, and linear gradient to 95% A over 2 min and held for 6 min. Sterols and glycerolipids were separated with reverse-phase HPLC using an isocratic mobile phase as before except with an Agilent Zorbax Eclipse XDB-C18 column (4.6 x 100 mm).

Quantification of lipid species was accomplished using multiple reaction monitoring (MRM) transitions that were developed in earlier studies in conjunction with referencing of appropriate internal standards: PA 14:0/14:0, PC 14:0/14:0, PE 14:0/14:0, PI 12:0/13:0, PS 14:0/14:0, SM d18:1/12:0, D7-cholesterol, CE 17:0, MG 17:0, 4ME 16:0 diether DG, D5-TG 16:0/18:0/16:0 (Avanti Polar Lipids, Alabaster, AL). Lipid levels for each sample were calculated relative to the spiked internal standards. For lipidomic analysis in AEC2 cells in the bleomycin model, the fold changes of the lipid levels in AEC2 cells after bleomycin treatment were calculated relative to the levels in AEC2 cells after PBS treatment, and were log ₂ -transformed. The heatmap was plotted based on the log ₂ (fold change), using Heatmap Illustrator software (Heml 1.0).

[0204] Statistical analysis. All data are represented as mean ±s.e.m. as outlined in the figure legends. Unpaired Student’s t-test was used for the comparisons between two groups, and one-way ANOVA with post-hoc Bonferroni test was used for multi-group comparisons. The log-rank test was used to compare the differences of the survival between two groups. The detailed statistical analyses for RNA-seq data were described in the method details of RNA- seq. A two-sided p value < 0.05 was statistically significant. All analyses were performed using SPSS version 17.0 (IBM Corporation) or GraphPad Prism version 5.0 (GraphPad Software).

Example 2: Altered Mitochondrial Structure in AEC2 Cells After Bleomycin

[0205] Little is known about the role of mitochondrial fission and fusion in AEC2 cells of the lung or in the pathogenesis of IPF. Intra-tracheal administration of bleomycin, which induces nuclear and mitochondrial DNA strand breaks and mitochondrial respiratory chain dysfunction, reproducibly induces lung fibrosis in mice and is widely used to explore the mechanisms of lung fibrosis. Transcriptomic studies in AEC2 cells from IPF lungs revealed altered genes related to mitochondrial regulation, including MFN2 upregulation. In this study, whether in vivo bleomycin administration induces similar transcriptomic responses in murine AEC2 cells was investigated. As shown in FIG.1A, to isolate AEC2 cell

populations, a unique AEC2 cell reporter mouse was generated by crossing Sftpc ^CreERT2+/+ mice with ROSA26 ^tdTomato+/+ mice, creating mice with tamoxifen-inducible tdTomato florescence in AEC2 cells (Sftpc ^CreERT2+/- ROSA26 ^tdTomato+/- , referred to as control ^{tdTomato-AEC2} ). As shown in FIG.7A, five days after bleomycin treatment AEC2 cells were isolated for RNA next-generation sequencing (RNA-seq) utilizing flow cytometric cell sorting of tdTomato positive cells. Functional enrichment analyses of differential transcripts between AEC2 cells isolated from mice treated with bleomycin and AEC2 cells from controls identified several significantly altered mitochondrial and metabolic cellular pathways, including“mitochondrial organization”,“apoptotic signaling”,“nucleotide metabolic process”,“regulation of protein transport”,“RNA transport”, and“autophagy” (FIG.1B and FIG.8E). Examination of genes included in the“mitochondrial organization” annotation revealed the upregulation of genes involved in mitochondrial dynamic regulation (such as Mfn1, Mfn2, Dnm1l, and March5) mitochondrial apoptotic control (such as Bcl2l1, Mcl1, Bax, Bid, and Bak1), and mitochondrial oxidative phosphorylation (such as Ndufb6, Ndufs6 and Ndufa12 for complex I, Sdhd for complex II, Cyc1, Cycs, Uqcrb, and Uqcrq for complex III, and Cox5a, Cox5b, Cox6a1 and Cox7c for complex IV) (FIGs.1C-1D and 24), while there was downregulation of genes involved in mitophagy (Pink1, Bnip3, and Atg13) (FIG. 1E). This data highlighted similar transcriptomic responses between murine AEC2 cells after bleomycin treatment and human AEC2 cells from IPF lungs.

[0206] Mitochondrial ultrastructural changes in AEC2 cells in the murine model of bleomycin-induced lung fibrosis was next examined through transmission electron microscopy (TEM). AEC2 cells of mice exposed to bleomycin (8 days post treatment) showed swollen mitochondria with disrupted cristae (FIG.1F and FIG.8A), which, when compared to the controls, had significantly decreased mitochondrial number (FIG.1H) and area (FIGs.1G and 1I and FIG.8B). Immunoblotting showed decreased OPA1 (for optic atrophy 1) protein levels with no change in DRP1 (for dynamin-1-like protein), MFN1 or MFN2 expression in AEC2 cells 8 days post bleomycin exposure (FIGs.8C-8D). [0207] Collectively, these data suggested that bleomycin altered mitochondrial dynamics, leading to mitochondrial fragmentation, and also alters the expression of several genes related to mitochondrial regulation in AEC2 cells.

Example 3: Loss of Mfn1 or Mfn2 in AEC2 cells promotes lung fibrosis

[0208] To elucidate the precise function of MFN1 and MFN2 in AEC2 cells, Mfn1 and Mfn2 genes in murine AEC2 cells were conditionally deleted. Specifically, genetically modified mice harboring Mfn1 or Mfn2 flanked by two loxP sites were crossed with Sftpc ^CreERT2+/+ mice (FIG.2A). AEC2 cells were isolated from murine lungs, through CD45 negative selection and subsequent EpCAM positive selection (FIGs.7B-7E). Tamoxifen treatment resulted in the selective deletion of Mfn1 and Mfn2 genes in AEC2 cells

(Mfn1 ^loxP/loxP Sftpc ^CreERT2+/- (Mfn1 ^{i DAEC2} ) and Mfn2 ^loxP/loxP Sftpc ^CreERT2+/- (Mfn2 ^{i DAEC2} ) mice respectively), as confirmed by genotyping (FIG.2B) and immunoblotting (FIG.2C). To access for potential off-target toxicity by CreERT2, heterozygous Sftpc ^CreERT2+/- transgenic mice were used as controls.

[0209] Given the pivotal role for MFN1 and MFN2 in regulating mitochondrial fusion, mitochondrial ultrastructural changes in Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells were first evaluated. TEM analysis confirmed that at baseline Mfn1 ^-/- AEC2 cells displayed fragmented mitochondria with decreased mitochondrial area, increased mitochondrial number, but normal cristae (FIGs.2D-2F and FIG.9B). In contrast, abnormally enlarged mitochondria with irregular and disrupted cristae were seen in the Mfn2 ^-/- AEC2 cells (FIG.9A). As shown in FIG.2G, these mitochondrial morphological changes were restricted to AEC2 cells and were not observed in other lung cells, such as bronchial epithelial cells. To confirm the above findings, MFN1 or MFN2 in the murine AEC2 cell line MLE 12 were depleted through shRNA lentiviral transduction (FIG.10A). As shown in FIG.10B, loss of MFN1 induced more mitochondrial fragmentation than loss of MFN2 in MLE 12 cells. Depletion of MFN1 or MFN2 in the human AEC2 cell line A549 also altered mitochondrial morphology (FIGs.10C- 10D). Ultrastructural examination further revealed the increased presence of abnormal mitochondria (swollen, irregular cristae) in MFN2-deficient MLE 12 cells (FIG. 10E). Such morphological changes might be indicative of a failure of MFN2-deficient MLE 12 cells to activate mitophagy for mitochondrial quality control. To verify the importance of MFN2 in mitophagy regulation, a mitophagy reporter system was generated using mtKeima fluorescent protein. As shown in FIG.10F, mitophagy induced by oligomycin and antimycin A was only mildly suppressed by MFN1 deficiency, but markedly suppressed by MFN2 deficiency in MLE 12 cells. Collectively, these data show that loss of either MFN1 or MFN2 alters mitochondrial morphology and turnover in AEC2 cells.

[0210] As shown in FIG.2H, despite evidence of mitochondrial dysfunction, Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice continued to thrive at 28-32 weeks post tamoxifen treatment, without remarkable lung pathologies. To investigate whether deficiency of MFN1 or MFN2 in AEC2 cells altered the development of lung fibrosis after bleomycin treatment, Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice were instilled with bleomycin. TEM analysis showed that Mfn1 or Mfn2 deletion enhanced bleomycin-induced mitochondrial damage in AEC2 cells (FIGs.3A-3B). After bleomycin treatment, compared to control AEC2 cells, Mfn1 ^-/- AEC2 cells showed decreased mitochondrial area and increased mitochondrial number, while Mfn2 ^-/- AEC2 cells showed increased mitochondrial area and decreased mitochondrial number (FIGs.3C-3E and FIGs.11A-11F). The data suggested that Mfn1 deletion led to excessive mitochondrial fragmentation, while Mfn2 deletion led to swollen mitochondria in AEC2 cells after bleomycin treatment. As shown in FIG.11G, bleomycin treatment and deletion of Mfn1 or Mfn2 did not alter the amount of mtDNA present in AEC2 cells.

[0211] In the bleomycin model, weight loss occurs with disease progression and correlates with the severity of lung fibrosis. Compared to control mice, both Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice demonstrated persistent weight loss (FIG.3F) and increased mortality (FIG.3G) after bleomycin exposure. Lungs from Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice also showed more intense Masson’s trichrome staining of fibrotic regions, along with increased immunohistochemical (IHC) staining for collagen III (FIG.3H). Quantification of acid-soluble collagen showed that Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice, compared to the control, had more lung collagen deposition after bleomycin treatment (FIG.3I). Compared to the control, Mfn1 ^{i DAEC2} or Mfn2 ^{i DAEC2} mice had similar protein levels in bronchoalveolar lavage fluid (BALF), and did not have increased inflammatory cell infiltrates after bleomycin treatment (FIGs.12A-12C).

[0212] These results demonstrate that the genetically modified rodents of the present technology are useful in methods for screening for a candidate agent that prevents or treats lung fibrosis.

Example 4: Loss of AEC2 cell Mfn1/2 Results in Spontaneous Lung Fibrosis

[0213] Single-gene deletion of Mfn1 or Mfn2 in AEC2 cells exacerbated bleomycin-induced lung fibrosis, but at baseline did not cause any obvious lung pathology. It was hypothesized that MFN1 and MFN2 may compensate for the loss of each other to maintain the basal function of AEC2 cells. Therefore, mice in which both Mfn1 and Mfn2 were simultaneously deleted in AEC2 cells (Mfn1 ^loxP/loxP Mfn2 ^loxP/loxP Sftpc ^CreERT2+/+ (Mfn1/2 ^{i ^AEC2} )) were generated and confirmed by genotyping and immunoblotting (FIG.4A-4C). TEM analysis of mitochondrial ultrastructure showed loss of both Mfn1/2 led to increased mitochondrial area (FIG.13A-13C), decreased mtDNA copy number (FIG.13D), and considerable

accumulation of abnormal mitochondria with disrupted cristae in AEC2 cells (FIG.4D and FIG.13E). Strikingly, 36.4% of mice deficient in both Mfn1 and Mfn2 in AEC2 cells died by 16 weeks post tamoxifen treatment, with equal penetrance in both sexes (FIG.4E). As shown in FIG.4F, the morphological and pathological assessment of lung sections from surviving (~17 weeks post tamoxifen treatment) Mfn1/2 ^{i DAEC2} mice revealed significant increases in Masson trichrome positive staining for collagen deposition, indicative of lung fibrosis. All the remaining surviving mice which displayed signs of respiratory distress (i.e. gasping) developed severe and widespread fibrosis involving both lungs. Such trichrome positive regions principally extended from the sub-pleural parenchyma, with no predilection toward right or left lungs, and the pattern of progression resembled those observed in human IPF. IHC staining of the fibrotic zone showed strong positivity for several fibrotic markers, including vimentin, a-smooth muscle actin, and collagen III (FIG.4G). Immunofluorescent staining of Mfn1/2 ^{i ^AEC2} murine lungs also demonstrated increased localization of ER-TR7 positive fibroblastic aggregates (FIG.4H), which were surrounded by AEC2 cells (FIG.14), possibly indicative of more fibrosis. Morphological features of fibrosis or distinct fibroblastic aggregations were not observed in the lungs of Mfn1 ^{i DAEC2} , Mfn2 ^{i DAEC2} ,

Sftpc ^CreERT2+/- or Sftpc ^CreERT2+/+ mice (FIG.4I).

[0214] Collectively, the above results show that Mfn1/2 ^{i ^AEC2} mice develop spontaneous lung fibrosis, which is associated with extensive mitochondrial damage in AEC2 cells.

[0215] These results demonstrate that the genetically modified rodents of the present technology are useful in methods for screening for a candidate agent that prevents or treats lung fibrosis.

Example 5: MFN1/2 Regulate Lipid Metabolism in AEC2 Cells

[0216] Deletion of either Mfn1 or Mfn2 in murine AEC2 cells aggravated bleomycin- induced lung fibrosis, while deletion of both induced spontaneous lung fibrosis. Given that both bleomycin and depletion of MFN1/2 can impair mitochondrial respiration through mtDNA damage, whether mtDNA damage-associated mitochondrial bioenergetic failure in AEC2 cells can directly induce lung fibrosis was next examined. Mice with a mutation in mtDNA polymerase ^ (PolgA ^D257A/D257A ), the polymerase responsible for proofreading during mtDNA replication, display accumulation of mtDNA mutations and failure of mitochondrial bioenergetics, leading to premature aging and shortened lifespan. As shown in FIG.15, PolgA ^D257A/D257A mice have increased swollen mitochondria in AEC2 cells, but did not demonstrate any pathological changes indicative of the development of spontaneous lung fibrosis, up to the age of 36-40 weeks.

[0217] These findings indicate that the phenotype of lung fibrosis may be specific to Mfn1/2 ^{i ^AEC2} mice and independent to bioenergetic failure alone.

[0218] To assess AEC2 cell injury and proliferation in the bleomycin-induced lung fibrosis mouse model and to explore the biological processes affected in AEC2 cells after deletion of Mfn1 or Mfn2, Mfn1 ^loxP/loxP Sftpc ^CreERT2+/- ROSA26 ^tdTomato+/- (Mfn1 ^{i DAEC2/tdTomato-AEC2} ) and Mfn2 ^loxP/loxP Sftpc ^CreERT2+/- ROSA26 ^tdTomato+/- (Mfn2 ^{i DAEC2/tdTomato-AEC2} ) mice were generated (FIG.16A), and performed transcriptomic profiling in Mfn1- and Mfn2-deficient AEC2 cells. The generation of these mice allowed for tamoxifen-inducible tdTomato fluorescent labeling in Mfn1- and Mfn2-deficient AEC2 cells, and was confirmed by demonstrating excision of the floxed allele after tamoxifen injection (FIGs.16B-16C). In the bleomycin-induced lung fibrosis model, it was not observed that Mfn1 ^-/- or Mfn2 ^-/- AEC2 cells had significantly increased cell death 5 days after bleomycin administration (FIGs.17A-17D). The expression levels of the proliferative marker Mki67 (RNA-Seq data) in AEC2 cells did not significantly increase (FIG.17E), and was not significantly different between controls and Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice 5 days after bleomycin exposure (FIG.26). Minimal Ki67 positive nuclear staining was further observed in tdTomato positive AEC2 cells, 10 days after bleomycin treatment (FIG.17F).

[0219] As shown in FIG.16D, transcriptomic profiling at baseline showed Mfn2 deletion, compared to Mfn1 deletion, resulted in more robust changes in gene expressions in AEC2 cells (FIG.25). Specifically, Mfn2 ^-/- AEC2 cells, but not Mfn1 ^-/- AEC2 cells, activated genes involved in ATF5-mediated mitochondrial unfolded protein responses (UPR ^MT ) (Atf5, Lonp1, Clpp, and Hspa9), ATF4-mediated stress pathways (Atf4, Ddit3, Asns, Chac1, Pck2, and Trib3), along with genes involved in de novo serine/glycine synthesis pathways (Phgdh, Psat1, Shmt2) (FIG.16E). Neither Mfn1 ^-/- or Mfn2 ^-/- AEC2 cells activated genes related to UPR ^ER , such as Hspa5, Atf6, Pdia2, Ero1l, Xbp1, Hsp90b1, and Calr. Furthermore, in addition to“organelle fusion”, the common metabolic biological processes revealed by functional enrichment analyses included“lipid localization”,“nucleotide phosphate metabolic process”, and“alcohol metabolic process” (FIG.16F).

[0220] In the bleomycin-induced lung fibrosis model, increased common genes which were regulated in both Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells was found (FIG.5A and FIG.26).

Functional enrichment analyses of these common genes identified“fatty acid and

acylglycerol metabolic process”,“carbohydrate derivative biosynthetic and nucleoside triphosphate metabolic process” and“cofactor metabolic process” as the major metabolic processes affected in both Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells after bleomycin treatment (FIG. 5B). Examination of genes found included in the“carbohydrate derivative biosynthetic and nucleoside triphosphate metabolic process”, upregulation of genes involving oxidative respiratory complexes, and genes involving purine metabolism, particularly nucleoside diphosphate kinase, adenylate kinase, polyribonucleotide nucleotidyltransferase, and adenosine monophosphate deaminase (FIG.5C). Moreover, a number of genes involved in lipid metabolism were differentially regulated between control and Mfn1 ^-/- or Mfn2 ^-/- AEC2 cells (FIG.5D), with the downregulation of genes related to fatty acid synthesis, long-chain fatty acid transport, fatty acid activation, elongation and modification (FIG.17G).

[0221] The above transcriptomic results suggest upregulated purine metabolism and downregulated lipid metabolism in Mfn1 ^-/- or Mfn2 ^-/- AEC2 cells after bleomycin.

Considering Mfn1/2 ^{i ^AEC2} mice develop spontaneous lung fibrosis, whether the transcriptomic response in Mfn1/2 ^-/- AEC2 cells at baseline resembled those in the Mfn1 ^-/- or Mfn2 ^-/- AEC2 cells after bleomycin treatment, and whether Mfn1/2 ^-/- AEC2 cells had functional annotations in common with control AEC2 cells after bleomycin treatment were evaluated. Functional enrichment analyses comparing isolated AEC2 cell transcripts from Mfn1/2 ^{i ^AEC2} and Sftpc ^CreERt2+/+ (control) mice showed that Mfn1/2-deletion markedly affected“nucleoside phosphate metabolic process” in AEC2 cells (FIG.5E and FIG.27), of which purine metabolism is the major biological pathway included in this annotation. Compared to control AEC2 cells, Mfn1/2-deletion in AEC2 cells activated profound ATF5-mediated UPR ^MT , and ATF4-mediated stress response pathways (FIG.18A), along with activation of de novo glycolytic serine/glycine synthesis pathways and mitochondrial one-carbon metabolism (FIG.5F).

[0222] Together, the results from transcriptomic analyses suggested upregulation of purine metabolism in Mfn1/2 ^-/- AEC2 cells. [0223] The overlapping genes identified in Mfn1/2 ^-/- AEC2 cells with those identified AEC2 cells after bleomycin treatment were next compared (FIG.18B). Functional enrichment analysis of these overlapping genes confirmed that altered“purine metabolism” and “oxidative phosphorylation” are common biological processes altered in Mfn1/2 ^-/- AEC2 cells and in AEC2 cells after bleomycin treatment (FIG.18C). Gene-set enrichment analysis (GSEA) based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) database further revealed that Mfn1/2 ^-/- AEC2 cells, compared with AEC2 cells after bleomycin treatment, markedly enhance the upregulation of purine metabolism (FIG.18D). Collectively, transcriptomic upregulation of purine metabolism was a common prominent feature in both Mfn1/2 ^-/- AEC2 cells and Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells after bleomycin treatment.

[0224] These results demonstrate that the genetically modified rodents of the present technology are useful in methods for screening for a candidate agent that prevents or treats lung fibrosis.

Example 6: Loss of MFN1/2 Alters Lamellar Body Structure in AEC2 Cells

[0225] Purine synthesis and phospholipid synthesis share common upstream substrates, including serine and derivatives from glycolysis. Changes in the preferential flux of these substrates towards purine metabolism (as observed in Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells after bleomycin treatment, and in Mfn1/2 ^-/- AEC2 cells) and away from lipid synthesis pathways (as observed in Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells after bleomycin treatment) may alter the innate function of the AEC2 cells to generate phospholipids for surfactant production. As previously mentioned, AEC2 cells require proper lipid metabolism to continuously produce and store (in lamellar bodies) lung surfactant, a lipoprotein complex primarily composed of lipids (90%) (particularly phosphatidylcholines and phosphatidylglycerol, and cholesterol). In this study, disrupted and disorganized lipid membranes in the lamellar bodies of Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells treated with bleomycin was observed. This was in stark contrast to control AEC2 cells treated with bleomycin or to control, Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells, which all showed relatively normal lamellar body structure with organized and densely- packed lipid membranes (FIG.6A). Unlike M - or Mfn2 ^-/- AEC2 cells, that showed no disrupted lamellar body structure at baseline, Mfn1/2 ^-/- AEC2 cell lamellar bodies displayed severe disorganization of lipid lamellae (FIG.6B), suggestive of disrupted lipid homeostasis in Mfn1/2 ^-/- AEC2 cells. [0226] These results demonstrate that the genetically modified rodents of the present technology are useful in methods for screening for a candidate agent that prevents or treats lung fibrosis.

Example 7: Mfn1/2 Deletion Impairs Lipid Metabolism in AEC2 Cells

[0227] To evaluate if lipid metabolism was altered in AEC2 cells upon bleomycin treatment, high throughput targeted lipidomic profiling in AEC2 cells of control, Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice was performed at baseline and upon bleomycin treatment (8 days). At baseline, Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells did not show any significant alterations in lipid species, except for a modest increase in phosphatidic acid species (FIGs.19A-19C).

However, cholesterol, ceramides, phosphatidic acids, phosphatidylethanolamine,

phosphatidylserine and plasmalogen phosphatidylethanolamine were all increased in AEC2 cells 8 days after bleomycin exposure (FIGs.6C-6D). In contrast, these lipids were significantly decreased in Mfn1 ^-/- or Mfn2 ^-/- AEC2 cells treated with bleomycin. Specifically, acylcarnitines and phosphatidylcholines with long unsaturated aliphatic chains increased in control AEC2 cells treated with bleomycin, but not in the Mfn1 ^-/- or Mfn2 ^-/- AEC2 cells treated with bleomycin (FIG.20A-20B). Many phosphatidylglycerol species decreased in the Mfn1 ^-/- AEC2 cells treated with bleomycin, but not in the control AEC2 cells treated with bleomycin (FIG.20C). Surfactant protein gene (Sftpb, Sftpc) expression was significantly downregulated in control, Mfn1 ^-/- and Mfn2 ^-/- AEC2 cells treated with bleomycin (FIG.20D). These lipid profiling results confirm that deletion of either Mfn1 or Mfn2 perturbs lipid metabolism in murine AEC2 cells after bleomycin treatment.

[0228] The lipidome of Mfn1/2 ^-/- AEC2 cells was next evaluated. Strikingly, lipidomic changes in cholesterol, acylcarnitine, monoacylglycerol, diacylglycerol, phosphatidylserine, and phosphatidylglycerol were distinctly apparent in the Mfn1/2 ^-/- AEC2 cells, when compared to controls (FIG.6E). Specifically, long-chain acylcarnitines significantly were found to be decreased in Mfn1/2 ^-/- AEC2 cells, when compared to control AEC2 cells (FIG. 21A). Phosphatidylglycerol synthesized in mitochondria were the major phospholipid species affected in Mfn1/2 ^-/- AEC2 cells (FIG.21B). Furthermore, diacylglycerol, which is derived from phosphatidic acid, is required for the synthesis of glycerophospholipids in the ER. Several diacylglycerol species (FIG.21C) and certain glycerophospholipids and sphingolipids (FIG.21D) were all markedly decreased in the Mfn1/2 ^-/- AEC2 cells.

Surfactant protein gene (Sftpb, Sftpc) expression was not altered between control and Mfn1/2- ^/- AEC2 cells (FIG.21E). The above results together strongly implicate perturbed lipid metabolism in Mfn1/2 ^-/- AEC2 cells.

[0229] These results demonstrate that the genetically modified rodents of the present technology are useful in methods for screening for a candidate agent that prevents or treats lung fibrosis.

Example 8: Impaired Lipid Synthesis in AEC2 Cells Promotes Lung Fibrosis

[0230] To test the hypothesis that loss of surfactant associated lipid metabolism in AEC2 cells contributes to the development of lung fibrosis (FIG.22a), lipid synthesis in AEC2 cells was compromised. FASN encodes the principal enzyme that catalyzes the synthesis of palmitoyl-CoA, the substrate required for glycerophospholipid and sphingolipid synthesis (FIG.17G). Mice with tamoxifen-inducible Fasn deletion in AEC2 cells

(Fasn ^loxP/loxP Sftpc ^CreERT2+/- , referred to as Fasn ^iDAEC2 ) were generated by crossing

Sftpc ^CreERT2+/+ with Fasn ^loxP/loxp mice (FIG.6F). Fasn is mainly expressed in AEC2 cells, and immunoblots of AEC2 cell lysates showed FASN depletion after tamoxifen injection (FIG.6G). Notably, Fasn-deletion did not alter the expression levels of MFN1 and MFN2 (FIG.6G). Exposure of Fasn ^iDAEC2 mice to bleomycin resulted in higher mortality (FIG. 6H), more weight loss (FIG.6I), and increased collagen deposition and lung fibrosis (FIG. 6J-6K), when compared to Sftpc ^CreERT2+/- controls.

[0231] These findings confirmed that defective lipid metabolism in AEC2 cells promotes bleomycin-induced lung fibrosis, and supports our hypothesis that impaired regulation of lipid metabolism in AEC2 cells of Mfn1 ^{i DAEC2} , Mfn2 ^{i DAEC2} , and Mfn1/2 ^{i DAEC2} mice contributes to development of lung fibrosis (FIG.22A).

[0232] The results demonstrate that AEC2 cells require mitofusins to engage lipid metabolic rewiring programs to respond to mitochondrial damage. MFN1 or MFN2 deficiency abolished the lipogenic metabolic response in AEC2 cells under bleomycin-induced mitochondrial damage and demonstrated that impaired regulation of lipid metabolism in the Mfn1/2 ^{i ^AEC2} mice drives lung fibrosis. These findings are also consistent with mitofusins, particularly MFN2, directly regulating the interaction between the mitochondrial outer membrane and the ER. Consistently, such distinct functions of MFN1 and MFN2 are highlighted by the observation that Mfn2 ^{i DAEC2} mice developed more severe lung fibrosis than the Mfn1 ^{i DAEC2} mice. [0233] Intra-tracheal bleomycin administration induces acute lung inflammation and epithelial cell injury, followed by epithelial cell repair and fibrotic reactions. However, any difference in inflammation or altered AEC2 cell death or proliferation in Mfn1 ^{i DAEC2} and Mfn2 ^{i DAEC2} mice were not observed, suggesting AEC2 cell dysfunction may promote lung fibrosis independent of inflammation and cell injury. Mechanistically, data generated using PolgA ^D257A/D257A mice indicates that failure of mitochondrial bioenergetics alone may not account for the phenotypes observed in the Mfn1 ^{i DAEC2} , Mfn2 ^{i DAEC2} , or Mfn1/2 ^{i ^AEC2} mice. Without wishing to be bound by theory, it is believed that transcriptional alterations in key enzymes important for lipid metabolism including the fatty acid synthesis enzyme, FASN regulate lipid synthesis in AEC2 cells after bleomycin treatment. Through AEC2 cell- specific deletion of Fasn, it was confirmed that loss of lipid synthesis in AEC2 cells, upon mitochondrial damage exacerbates lung fibrosis in murine models. Perturbed long-chain fatty acid synthesis in AEC2 cells aggravates bleomycin-induced lung fibrosis. These results are also supported by abnormal lipid profiles in the BALF and altered lipid synthesis in the lungs and AEC2 cells from IPF patients. These results also re-emphasize the critical role for and the proper composition of alveolar surfactant in maintaining the function and the intactness of the lung during lung injury.

[0234] The results described herein also demonstrate that alterations in the lipidome of the lung microenvironment may promote the activation of fibroblasts and myofibroblasts. For example, FASN is a TGF- b-regulated target in fibroblasts in vitro and in response to bleomycin in vivo and pharmacologically inhibiting this pathway reverses the pro-fibrotic response in the lung, suggesting that lipid synthesis plays a distinct role in AEC2 cells and fibroblasts of the lung.

[0235] In addition to altered lipid metabolism another metabolic feature of cells with mitochondrial damage was observed, namely, the upregulation of de novo purine synthesis, a common feature between Mfn1/2 ^-/- AEC2 cells at baseline and Mfn1 ^-/- or Mfn2 ^-/- AEC2 cells after bleomycin treatment. Without wishing to be bound by theory, it is believed that the robust upregulation of purine metabolism in AEC2 cells may promote lung fibrosis indirectly by impairing lipid metabolism in AEC2 cells. The correct regulation of purine and lipid metabolism during mitochondrial damage is important for the diversion and utilization of common upstream substrates shared by both of these pathways, and the present disclosure demonstrates that mitofusins and mitochondrial fusion are essential in balancing such metabolic reprogramming. [0236] The biological significance of increased purine synthesis upregulation may occur as a compensatory mechanism to ATP synthesis when mitochondrial bioenergetic function is impaired. Altered purine synthesis has been shown to promote lung inflammation and collagen deposition in murine models and inhibiting purine synthesis may offer therapeutic potential for IPF. Collectively, the marked upregulation of purine metabolism in Mfn1/2 ^-/- AEC2 cells and in bleomycin-treated Mfn1- or Mfn2-deficient AEC2 cells may play a direct role in promoting lung fibrosis.

[0237] It was herein shown that impaired mitochondrial damage-associated changes in lipid metabolism in AEC2 cells alter the crucial production of cholesterol and phospholipids required for surfactant synthesis and alveolar homeostasis in the lungs, and that loss of surfactant lipids as regulated by MFN1/2 disrupts the maintenance of epithelial barrier intactness and drives the fibrotic process. Thus, futile lipid metabolism or the failure of the AEC2 cell to engage in the correct metabolic and transcriptional program in response to mitochondrial damage, drives AEC2 cell injury and subsequent disordered fibrotic remodeling in the pathogenesis of lung fibrosis.

[0238] These results demonstrate that the genetically modified rodents of the present technology are useful in methods for screening for a candidate agent that prevents or treats lung fibrosis.

EQUIVALENTS

[0239] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions, or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. [0240] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[0241] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third, and upper third, etc. As will also be understood by one skilled in the art all language such as“up to,” “at least,”“greater than,”“less than,” and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

[0242] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all Figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.