DEATON AIMEE (US)
GANSNER JOHN (US)
MCININCH JAMES (US)
SCHLEGEL MARK (US)
GARFINKEL BENJAMIN P (US)
WO2014190157A1 | 2014-11-27 | |||
WO2012135246A2 | 2012-10-04 | |||
WO2020021108A2 | 2020-01-30 | |||
WO2016085852A1 | 2016-06-02 | |||
WO1999014226A2 | 1999-03-25 | |||
WO2013036868A1 | 2013-03-14 | |||
WO2011005861A1 | 2011-01-13 | |||
WO2013075035A1 | 2013-05-23 | |||
WO2007091269A2 | 2007-08-16 | |||
WO2010141511A2 | 2010-12-09 | |||
WO2007117686A2 | 2007-10-18 | |||
WO2009014887A2 | 2009-01-29 | |||
WO2011031520A1 | 2011-03-17 | |||
WO2019055633A1 | 2019-03-21 | |||
WO2014179620A1 | 2014-11-06 | |||
WO2014179627A2 | 2014-11-06 | |||
WO1994002595A1 | 1994-02-03 | |||
WO2000022113A1 | 2000-04-20 | |||
WO2000022114A1 | 2000-04-20 |
US8101348B2 | 2012-01-24 | |||
US6858225B2 | 2005-02-22 | |||
US6815432B2 | 2004-11-09 | |||
US8158601B2 | 2012-04-17 | |||
US8058069B2 | 2011-11-15 | |||
US3687808A | 1972-08-29 | |||
US4469863A | 1984-09-04 | |||
US4476301A | 1984-10-09 | |||
US5023243A | 1991-06-11 | |||
US5177195A | 1993-01-05 | |||
US5188897A | 1993-02-23 | |||
US5264423A | 1993-11-23 | |||
US5276019A | 1994-01-04 | |||
US5278302A | 1994-01-11 | |||
US5286717A | 1994-02-15 | |||
US5321131A | 1994-06-14 | |||
US5399676A | 1995-03-21 | |||
US5405939A | 1995-04-11 | |||
US5453496A | 1995-09-26 | |||
US5455233A | 1995-10-03 | |||
US5466677A | 1995-11-14 | |||
US5476925A | 1995-12-19 | |||
US5519126A | 1996-05-21 | |||
US5536821A | 1996-07-16 | |||
US5541316A | 1996-07-30 | |||
US5550111A | 1996-08-27 | |||
US5563253A | 1996-10-08 | |||
US5571799A | 1996-11-05 | |||
US5587361A | 1996-12-24 | |||
US5625050A | 1997-04-29 | |||
US6028188A | 2000-02-22 | |||
US6124445A | 2000-09-26 | |||
US6160109A | 2000-12-12 | |||
US6169170B1 | 2001-01-02 | |||
US6172209B1 | 2001-01-09 | |||
US6239265B1 | 2001-05-29 | |||
US6277603B1 | 2001-08-21 | |||
US6326199B1 | 2001-12-04 | |||
US6346614B1 | 2002-02-12 | |||
US6444423B1 | 2002-09-03 | |||
US6531590B1 | 2003-03-11 | |||
US6534639B1 | 2003-03-18 | |||
US6608035B1 | 2003-08-19 | |||
US6683167B2 | 2004-01-27 | |||
US6858715B2 | 2005-02-22 | |||
US6867294B1 | 2005-03-15 | |||
US6878805B2 | 2005-04-12 | |||
US7015315B1 | 2006-03-21 | |||
US7041816B2 | 2006-05-09 | |||
US7273933B1 | 2007-09-25 | |||
US7321029B2 | 2008-01-22 | |||
USRE39464E | 2007-01-09 | |||
US5034506A | 1991-07-23 | |||
US5166315A | 1992-11-24 | |||
US5185444A | 1993-02-09 | |||
US5214134A | 1993-05-25 | |||
US5216141A | 1993-06-01 | |||
US5235033A | 1993-08-10 | |||
US1910564562A | 1910-06-02 | |||
US5264564A | 1993-11-23 | |||
US5405938A | 1995-04-11 | |||
US5434257A | 1995-07-18 | |||
US5470967A | 1995-11-28 | |||
US5489677A | 1996-02-06 | |||
US5541307A | 1996-07-30 | |||
US5561225A | 1996-10-01 | |||
US5596086A | 1997-01-21 | |||
US5602240A | 1997-02-11 | |||
US5608046A | 1997-03-04 | |||
US5610289A | 1997-03-11 | |||
US5618704A | 1997-04-08 | |||
US5623070A | 1997-04-22 | |||
US5663312A | 1997-09-02 | |||
US5633360A | 1997-05-27 | |||
US5677437A | 1997-10-14 | |||
US5677439A | 1997-10-14 | |||
US5539082A | 1996-07-23 | |||
US5714331A | 1998-02-03 | |||
US5719262A | 1998-02-17 | |||
US4981957A | 1991-01-01 | |||
US5118800A | 1992-06-02 | |||
US5319080A | 1994-06-07 | |||
US5359044A | 1994-10-25 | |||
US5393878A | 1995-02-28 | |||
US5446137A | 1995-08-29 | |||
US5466786A | 1995-11-14 | |||
US5514785A | 1996-05-07 | |||
US5519134A | 1996-05-21 | |||
US5567811A | 1996-10-22 | |||
US5576427A | 1996-11-19 | |||
US5591722A | 1997-01-07 | |||
US5597909A | 1997-01-28 | |||
US5610300A | 1997-03-11 | |||
US5627053A | 1997-05-06 | |||
US5639873A | 1997-06-17 | |||
US5646265A | 1997-07-08 | |||
US5658873A | 1997-08-19 | |||
US5670633A | 1997-09-23 | |||
US5700920A | 1997-12-23 | |||
US4845205A | 1989-07-04 | |||
US0513030A | ||||
US5134066A | 1992-07-28 | |||
US5175273A | 1992-12-29 | |||
US5367066A | 1994-11-22 | |||
US5432272A | 1995-07-11 | |||
US5457187A | 1995-10-10 | |||
US5459255A | 1995-10-17 | |||
US5484908A | 1996-01-16 | |||
US5502177A | 1996-03-26 | |||
US5525711A | 1996-06-11 | |||
US5552540A | 1996-09-03 | |||
US5587469A | 1996-12-24 | |||
US5594121A | 1997-01-14 | |||
US5596091A | 1997-01-21 | |||
US5614617A | 1997-03-25 | |||
US5681941A | 1997-10-28 | |||
US5750692A | 1998-05-12 | |||
US6015886A | 2000-01-18 | |||
US6147200A | 2000-11-14 | |||
US6166197A | 2000-12-26 | |||
US6222025B1 | 2001-04-24 | |||
US6235887B1 | 2001-05-22 | |||
US6380368B1 | 2002-04-30 | |||
US6528640B1 | 2003-03-04 | |||
US6639062B2 | 2003-10-28 | |||
US6617438B1 | 2003-09-09 | |||
US7045610B2 | 2006-05-16 | |||
US7427672B2 | 2008-09-23 | |||
US7495088B1 | 2009-02-24 | |||
US7399845B2 | 2008-07-15 | |||
US8278283B2 | 2012-10-02 | |||
US8278425B2 | 2012-10-02 | |||
US20040171570A1 | 2004-09-02 | |||
US8278426B2 | 2012-10-02 | |||
US6268490B1 | 2001-07-31 | |||
US6525191B1 | 2003-02-25 | |||
US6670461B1 | 2003-12-30 | |||
US6770748B2 | 2004-08-03 | |||
US6794499B2 | 2004-09-21 | |||
US6998484B2 | 2006-02-14 | |||
US7053207B2 | 2006-05-30 | |||
US7034133B2 | 2006-04-25 | |||
US7084125B2 | 2006-08-01 | |||
US7569686B1 | 2009-08-04 | |||
US7741457B2 | 2010-06-22 | |||
US8022193B2 | 2011-09-20 | |||
US8030467B2 | 2011-10-04 | |||
US20080039618A1 | 2008-02-14 | |||
US20090012281A1 | 2009-01-08 | |||
US20130190383A1 | 2013-07-25 | |||
US8314227B2 | 2012-11-20 | |||
US20130096289A1 | 2013-04-18 | |||
US20130011922A1 | 2013-01-10 | |||
US20110313020A1 | 2011-12-22 | |||
US20120157511A1 | 2012-06-21 | |||
US7858769B2 | 2010-12-28 | |||
US8106022B2 | 2012-01-31 | |||
US4828979A | 1989-05-09 | |||
US4948882A | 1990-08-14 | |||
US5218105A | 1993-06-08 | |||
US5525465A | 1996-06-11 | |||
US5541313A | 1996-07-30 | |||
US5545730A | 1996-08-13 | |||
US5552538A | 1996-09-03 | |||
US5578717A | 1996-11-26 | |||
US5580731A | 1996-12-03 | |||
US5591584A | 1997-01-07 | |||
US5109124A | 1992-04-28 | |||
US5118802A | 1992-06-02 | |||
US5138045A | 1992-08-11 | |||
US5414077A | 1995-05-09 | |||
US5486603A | 1996-01-23 | |||
US5512439A | 1996-04-30 | |||
US5578718A | 1996-11-26 | |||
US4587044A | 1986-05-06 | |||
US4605735A | 1986-08-12 | |||
US4667025A | 1987-05-19 | |||
US4762779A | 1988-08-09 | |||
US4789737A | 1988-12-06 | |||
US4824941A | 1989-04-25 | |||
US4835263A | 1989-05-30 | |||
US4876335A | 1989-10-24 | |||
US4904582A | 1990-02-27 | |||
US4958013A | 1990-09-18 | |||
US5082830A | 1992-01-21 | |||
US5112963A | 1992-05-12 | |||
US5214136A | 1993-05-25 | |||
US5245022A | 1993-09-14 | |||
US5254469A | 1993-10-19 | |||
US5258506A | 1993-11-02 | |||
US5262536A | 1993-11-16 | |||
US5272250A | 1993-12-21 | |||
US5292873A | 1994-03-08 | |||
US5317098A | 1994-05-31 | |||
US5371241A | 1994-12-06 | |||
US5391723A | 1995-02-21 | |||
US5416203A | 1995-05-16 | |||
US5451463A | 1995-09-19 | |||
US5510475A | 1996-04-23 | |||
US5512667A | 1996-04-30 | |||
US5565552A | 1996-10-15 | |||
US5567810A | 1996-10-22 | |||
US5574142A | 1996-11-12 | |||
US5585481A | 1996-12-17 | |||
US5587371A | 1996-12-24 | |||
US5595726A | 1997-01-21 | |||
US5597696A | 1997-01-28 | |||
US5599923A | 1997-02-04 | |||
US5599928A | 1997-02-04 | |||
US5688941A | 1997-11-18 | |||
US6294664B1 | 2001-09-25 | |||
US6320017B1 | 2001-11-20 | |||
US6576752B1 | 2003-06-10 | |||
US6783931B1 | 2004-08-31 | |||
US6900297B1 | 2005-05-31 | |||
US7037646B1 | 2006-05-02 | |||
US8106022B2 | 2012-01-31 | |||
US7427605B2 | 2008-09-23 | |||
US6054299A | 2000-04-25 | |||
US4683202A | 1987-07-28 | |||
US5854033A | 1998-12-29 | |||
US5770722A | 1998-06-23 | |||
US5874219A | 1999-02-23 | |||
US5744305A | 1998-04-28 | |||
US5677195A | 1997-10-14 | |||
US5445934A | 1995-08-29 |
JIM VADOLAS ET AL: "SLN124, a GalNac-siRNA targeting transmembrane serine protease 6, in combination with deferiprone therapy reduces ineffective erythropoiesis and hepatic iron-overload in a mouse model of [beta]-thalassaemia", BRITISH JOURNAL OF HAEMATOLOGY, vol. 194, no. 1, 4 May 2021 (2021-05-04), pages 200 - 210, XP071013251, ISSN: 0007-1048, DOI: 10.1111/BJH.17428
BELIVEAU ET AL., CELL CHEMICAL BIOLOGY, vol. 26, 2019, pages 1559 - 1572
GANZ T., BLOOD, vol. 117, no. 17, 2011, pages 4425 - 4433
FINBERG, K.E. ET AL., BLOOD, vol. 115, 2010, pages 3817 - 3826
WANG, C.Y. ET AL., FRONT. PHARMACOL, vol. 5, 2014, pages 114
LIMA ET AL., CELL, vol. 150, 2012, pages 883 - 894
DIAS, N. ET AL., MOL CANCER THER, vol. 1, 2002, pages 347 - 355
ELBASHIR ET AL., EMBO, vol. 20, 2001, pages 6877 - 6888
CHURANA, RNA, vol. 14, 2007, pages 1714 - 1719
KIM ET AL., NAT BIOTECH, vol. 23, 2005, pages 222 - 226
NIELSEN ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
"Biotechnology and Medicine", 2008, WILEY-VCH, article "Modified Nucleosides in Biochemistry"
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 - 330
ENGLISCH ET AL., ANGEWANDTE CHEMIE, INTERNATIONAL EDITION, vol. 30, 1991, pages 613
MANOHARAN ET AL., BIORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 - 2770
ELMEN, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 1, 2005, pages 439 - 447
MOOK, OR ET AL., MOL CANE THER, vol. 6, no. 3, 2007, pages 833 - 843
GRUNWELLER, A. ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, no. 12, 2003, pages 3185 - 3193
CHATTOPADHYAYA ET AL., J. ORG. CHEM., vol. 74, 2009, pages 118 - 134
NUC. ACIDS SYMP. SERIES, vol. 52, 2008, pages 133 - 134
FLUITER ET AL., MOL. BIOSYST., vol. 10, 2009, pages 1039
LETSINGER ET AL., PROC. NATL. ACID. SCI. USA, vol. 86, 1989, pages 6553 - 6556
MANOHARAN ET AL., BIORG. MED. CHEM. LET., vol. 4, 1994, pages 1053 - 1060
MANOHARAN ET AL.: "660", ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538
SAISON-BEHMOARAS ET AL., EMBO J, vol. 10, 1991, pages 1111 - 1118
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783
MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937
LAM ET AL., NATURE, vol. 354, 1991, pages 82 - 84
SIMEONI ET AL., NUCL. ACIDS RES, vol. 31, 2003, pages 2717 - 2724
KUBO, T. ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 365, no. 1, 2007, pages 54 - 61
LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 1173 - 1177
MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 4, 1994, pages 1053
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765
SAISON-BEHMOARAS ET AL., EMBO J., vol. 10, 1991, pages 111
AKHTAR SJULIAN RL, TRENDS CELL. BIOL, vol. 2, no. 5, 1992, pages 139 - 144
DORN, G. ET AL., NUCLEIC ACIDS, vol. 32, 2004, pages e49
TAN, PH ET AL., GENE THER, vol. 12, 2005, pages 59 - 66
MAKIMURA, H. ET AL., BMC NEUROSCI, vol. 3, 2002, pages 18
SHISHKINA, GT., NEUROSCIENCE, vol. 129, 2004, pages 521 - 528
THAKKER, ER. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 101, 2004, pages 17270 - 17275
AKANEYA,Y. ET AL., J. NEUROPHYSIOL., vol. 93, 2005, pages 594 - 602
SOUTSCHEK, J. ET AL., NATURE, vol. 432, 2004, pages 173 - 178
KIM SH ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 129, no. 2, 2008, pages 107 - 116
SORENSEN, DR ET AL., J. MOL. BIOL, vol. 327, 2003, pages 761 - 766
VERMA, UN ET AL., CLIN. CANCER RES., vol. 9, 2003, pages 1291 - 1300
ARNOLD, AS, J. HYPERTENS., vol. 25, 2007, pages 197 - 205
ZIMMERMANN, TS ET AL., NATURE, vol. 441, 2006, pages 111 - 114
CHIEN, PY ET AL., CANCER GENE THER., vol. 12, 2005, pages 321 - 328
PAL, A ET AL., INT J. ONCOL., vol. 26, 2005, pages 1087 - 1091
BONNET ME ET AL., PHARM. RES., 2008
AIGNER A, J. BIOMED. BIOTECHNOL., 2006, pages 71659
LIU, S., MOL. PHARM., vol. 3, 2006, pages 472 - 487
TOMALIA, DA ET AL., BIOCHEM. SOC. TRANS., vol. 35, 2007, pages 61 - 67
YOO, H. ET AL., PHARM. RES., vol. 16, 1999, pages 1799 - 1804
COUTURE, A ET AL., TIG, vol. 12, 1996, pages 5 - 10
GASSMANN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 1292
ALLEN, LVPOPOVICH NG.ANSEL HC.: "Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems", 2004, LIPPINCOTT WILLIAMS & WILKINS
LIZARDI ET AL., BIOLTECHNOLOGY, vol. 6, 1988, pages 1197
HIGUCHI ET AL.: "Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO., pages: 301
LEUNGSHAH: "Controlled Release of Drugs: Polymers and Aggregate Systems", 1989, VCH PUBLISHERS, pages: 185 - 215
BARANY, PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 189 - 193
GUATELLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1874 - 1878
We claim: 1. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Transmembrane protease, serine 6 (TMPRSS6) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding TMPRSS6, and wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-7. 2. The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sense strand comprising at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequences of the sense strands in any one of Tables 2-7 and an antisense strand comprising at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequences of the antisense strands in any one of Tables 2-7. 3. The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sense strand comprising at least 15 contiguous nucleotides differing by no more than two nucleotides from any one of the nucleotide sequences of the sense strands in any one of Tables 2-7 and an antisense strand comprising at least 15 contiguous nucleotides differing by no more than two nucleotides from any one of the nucleotide sequences of the antisense strands in any one of Tables 2-7. 4. The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sense strand comprising at least 15 contiguous nucleotides differing by no more than one nucleotide from any one of the nucleotide sequences of the sense strands in any one of Tables 2-7 and an antisense strand comprising at least 15 contiguous nucleotides differing by no more than one nucleotide from any one of the nucleotide sequences of the antisense strands in any one of Tables 2-7. 5. The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sense strand comprising a nucleotide sequence selected from the group consisting of any one of the nucleotide sequences of the sense strands in any one of Tables 2-7 and an antisense strand comprising a nucleotide sequence selected from the group consisting of any one of the nucleotide sequences of the antisense strands in any one of Tables 2-7. 6. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Transmembrane protease, serine 6 (TMPRSS6) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 187-210; 227-254;322-363; 362-390; 398-420; 404-429; 410-435; 439-461; 443-467; 448-474; 460-483; 466-488; 496-519; 519-542; 526-548; 557-593; 641-671; 652- 676; 687-713; 725-762; 757-794; 886-908; 921-951; 956-987; 1051-1082; 1233-1269; 1279-1313; 1313-1341; 1327-1351; 1415-1439; 1447-1480; 1464-1486; 1486-1509; 1559-1589; 1571-1595; 1579-1609; 1707-1735; 1738-1764; 1806-1828; 1864-1886; 1934-1966; 1967-1991; 2008-2031; 2015-2043; 2042-2072; 2287-2311; 2297-2354; 2336-2361; 2360-2384; 2416-2438; 2481-2510; 2496-2527; 2526-2558; 2665-2693; 2693-2719; 2707-2729; 2799-2821; 2851-2874; 2971-2999; 2981-3006; and 3155-3195 of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:2. 7. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Transmembrane protease, serine 6 (TMPRSS6) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 230-252, 324-346, 560-578, 560-582, 2338-2360, 3163-3185, 3169-3191, and 3172-3194 of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:2. 8. A double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of Transmembrane protease, serine 6 (TMPRSS6) in a cell, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the nucleotide sequence of nucleotides 560-578, 2338-2360, and 3169-3191 of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:2. 9. The dsRNA agent of any one of claims 1-8, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1556360, AD- 1571158, AD-1571033, AD-1554875, AD-1571160, AD-1555117, AD-1554911, and AD-1556915. 10. The dsRNA agent of any one of claims 1-9, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than three nucleotides from any one of the antisense strand nucleotide sequences of a duplex selected from the group consisting of AD-1556360, AD- 1571158, and AD-1571033. 11. The dsRNA agent of any one of claims 1-10, wherein the dsRNA agent comprises at least one modified nucleotide. 12. The dsRNA agent of any one of claims 1-11, wherein substantially all of the nucleotides of the sense strand; substantially all of the nucleotides of the antisense strand comprise a modification; or substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a modification. 13. The dsRNA agent of any one of claims 1-12, wherein all of the nucleotides of the sense strand comprise a modification; all of the nucleotides of the antisense strand comprise a modification; or all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification. 14. The dsRNA agent of any one of claims 11-13, wherein at least one of the modified nucleotides is selected from the group a deoxy-nucleotide, a 3’-terminal deoxythimidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a 2’-5’-linked ribonucleotide (3’-RNA), a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’- amino-modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, a 2’- methoxyethyl modified nucleotide, a 2’-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a nucleotide comprising a 5'-methylphosphonate group, a nucleotide comprising a 5’ phosphate or 5’ phosphate mimic, a nucleotide comprising vinyl phosphonate, a glycol nucleic acid (GNA), a glycol nucleic acid S-Isomer (S-GNA), a nucleotide comprising 2-hydroxymethyl-tetrahydrofuran-5-phosphate, a nucleotide comprising 2’- deoxythymidine-3’phosphate, a nucleotide comprising 2’-deoxyguanosine-3’-phosphate, and a terminal nucleotide linked to a cholesteryl derivative and a dodecanoic acid bisdecylamide group; and combinations thereof. 15. The dsRNA agent of any one of claims 11-13, wherein the modifications on the nucleotides are selected from the group consisting of LNA, HNA, CeNA, 2′-methoxyethyl, 2′-O-alkyl, 2′-O- allyl, 2′-C- allyl, 2′-fluoro, 2′-deoxy, 2’-hydroxyl, and glycol; and combinations thereof. 16. The dsRNA agent of any one of claims 11-13, wherein at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a glycol modified nucleotide (GNA), a nucleotide comprising a 2’ phosphate, and, a vinyl-phosphonate nucleotide; and combinations thereof. 17. The dsRNA agent of any one of claims 1-16, wherein the double stranded region is 19-30 nucleotide pairs in length. 18. The dsRNA agent of claim 17, wherein the double stranded region is 19-25 nucleotide pairs in length. 19. The dsRNA agent of claim 17, wherein the double stranded region is 19-23 nucleotide pairs in length. 20. The dsRNA agent of claim 17, wherein the double stranded region is 23-27 nucleotide pairs in length. 21. The dsRNA agent of claim 17, wherein the double stranded region is 21-23 nucleotide pairs in length. 22. The dsRNA agent of any one of claims 1-21, wherein each strand is independently no more than 30 nucleotides in length. 23. The dsRNA agent of any one of claims 1-22, wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length. 24. The dsRNA agent of any one of claims 1-23, wherein the region of complementarity is at least 17 nucleotides in length. 25. The dsRNA agent of any one of claims 1-24, wherein the region of complementarity is between 19 and 23 nucleotides in length. 26. The dsRNA agent of any one of claims 1-25, wherein the region of complementarity is 19 nucleotides in length. 27. The dsRNA agent of any one of claims 1-26, wherein at least one strand comprises a 3’ overhang of at least 1 nucleotide. 28. The dsRNA agent of any one of claims 1-26, wherein at least one strand comprises a 3’ overhang of at least 2 nucleotides. 29. The dsRNA agent of any one of claims 1-28, further comprising a ligand. 30. The dsRNA agent of claim 29, wherein the ligand is conjugated to the 3’ end of the sense strand of the dsRNA agent. 31. The dsRNA agent of claim 29, wherein the ligand is conjugated to the 5’ end of the sense strand of the dsRNA agent. 32 The dsRNA agent of any one of claims 29-31, wherein the ligand is an N- acetylgalactosamine (GalNAc) derivative. 33. The dsRNA agent of any one of claims 29-32, wherein the ligand is one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker. 34. The dsRNA agent of claim 32 or 33, wherein the ligand is . 35. The dsRNA agent of claim 34, wherein the dsRNA agent is conjugated to the ligand as shown in the following schematic and, wherein X is O or S. 36. The dsRNA agent of claim 35, wherein the X is O. 37. The dsRNA agent of claim 34, wherein the dsRNA agent is conjugated to the ligand as shown in the following schematic 38. The dsRNA agent of any one of claims 1-37, wherein the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage. 39. The dsRNA agent of claim 38, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 3’-terminus of one strand. 40. The dsRNA agent of claim 39, wherein the strand is the antisense strand. 41. The dsRNA agent of claim 39, wherein the strand is the sense strand. 42. The dsRNA agent of claim 39, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 5’-terminus of one strand. 43. The dsRNA agent of claim 42, wherein the strand is the antisense strand. 44. The dsRNA agent of claim 42, wherein the strand is the sense strand. 45. The dsRNA agent of claim 38, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at both the 5’- and 3’-terminus of one strand. 46. The dsRNA agent of claim 45, wherein the strand is the antisense strand. 47. The dsRNA agent of any one of claims 1-46, comprising 6-8 phosphorothioate or methylphosphonate internucleotide linkages. 48. The dsRNA agent of any one of claims 1-47, wherein the base pair at the 1 position of the 5′- end of the antisense strand of the duplex is an AU base pair. 49. The dsRNA agent of any one of claims 1-48, wherein the sense strand comprises at least 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- GACGCCACGCAUGCUGUGUGU -3’(SEQ ID NO: 119). 50. The dsRNA agent of any one of claims 1-49, wherein the sense strand comprises at least 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- GACGCCACGCAUGCUGUGUGU -3’(SEQ ID NO: 119). 51. The dsRNA agent of any one of claims 1-50, wherein the sense strand comprises the nucleotide sequence of 5’- GACGCCACGCAUGCUGUGUGU -3’(SEQ ID NO: 119). 52. The dsRNA agent of any one of claims 1-51, wherein the sense strand consists of the nucleotide sequence of 5’- GACGCCACGCAUGCUGUGUGU -3’(SEQ ID NO: 119). 53. The dsRNA agent of any one of claims 1-52, wherein the antisense strand comprises at least 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- ACACACAGCAUGCGUGGCGUCAC -3’ (SEQ ID NO: 245). 54. The dsRNA agent of any one of claims 1-53, wherein the antisense strand comprises at least 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- ACACACAGCAUGCGUGGCGUCAC -3’ (SEQ ID NO: 245). 55. The dsRNA agent of any one of claims 1-54, wherein the antisense strand comprises at least 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- ACACACAGCAUGCGUGGCGUCAC -3’ (SEQ ID NO: 245). 56. The dsRNA agent of any one of claims 1-55, wherein the antisense strand comprises the nucleotide sequence of 5’- ACACACAGCAUGCGUGGCGUCAC -3’ (SEQ ID NO: 245). 57. The dsRNA agent of any one of claims 1-56, wherein the antisense strand consists of the nucleotide sequence of 5’- ACACACAGCAUGCGUGGCGUCAC -3’ (SEQ ID NO: 245). 58. The dsRNA agent of any one of claims 1-57, wherein the sense strand comprises the nucleotide sequence of 5’- GACGCCACGCAUGCUGUGUGU -3’(SEQ ID NO: 119) and the antisense strand comprises the nucleotide sequence of 5’- ACACACAGCAUGCGUGGCGUCAC -3’ (SEQ ID NO: 245). 59. The dsRNA agent of any one of claims 1-58, wherein the sense strand differs by no more than 3 modified nucleotides from the nucleotide sequence of 5’- gsascgccacGfCfAfugcugugugu-3’ (SEQ ID NO:371) wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; and s is a phosphorothioate linkage. 60. The dsRNA agent of any one of claims 1-59, wherein the antisense strand differs by no more than 3 modified nucleotides from the nucleotide sequence of 5’- asdCsacdAcdAgcaudGcGfuggcgucsasc -3’ (SEQ ID NO: 497), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; wherein dA, dG, and dC are 2`-deoxyadenosine-3`-phosphate, 2`-deoxyguanosine-3`-phosphate, and 2`-deoxycytidine-3`-phosphate respectively; and s is a phosphorothioate linkage. 61. The dsRNA agent of any one of claims 1-60, wherein the sense strand comprises the nucleotide sequence of 5’- gsascgccacGfCfAfugcugugugu-3’ (SEQ ID NO: 371) and the antisense strand comprises the nucleotide sequence of 5’- asdCsacdAcdAgcaudGcGfuggcgucsasc -3’ (SEQ ID NO: 497), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; wherein dA, dG, and dC are 2`-deoxyadenosine-3`- phosphate, 2`-deoxyguanosine-3`-phosphate, and 2`-deoxycytidine-3`-phosphate respectively; and s is a phosphorothioate linkage. 62. The dsRNA agent of any one of claims 1-61, wherein the sense strand comprises the nucleotide sequence of 5’- gsascgccacGfCfAfugcuguguguL96 -3’ (SEQ ID NO: 371) and the antisense strand comprises the nucleotide sequence of 5’- asdCsacdAcdAgcaudGcGfuggcgucsasc -3’ (SEQ ID NO: 497), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; wherein dA, dG, and dC are 2`- deoxyadenosine-3`-phosphate, 2`-deoxyguanosine-3`-phosphate, and 2`-deoxycytidine-3`-phosphate respectively; s is a phosphorothioate linkage, and L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4- hydroxyprolinol. 63. The dsRNA agent of any one of claims 1-61, wherein the sense strand comprises the nucleotide sequence of 5’- gsascgccacGfCfAfugcugugugu -3’ (SEQ ID NO: 371) and the antisense strand comprises the nucleotide sequence of 5’- asdCsacdAcdAgcaudGcGfuggcgucsasc -3’ (SEQ ID NO: 497), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; wherein dA, dG, and dC are 2`-deoxyadenosine-3`- phosphate, 2`-deoxyguanosine-3`-phosphate, and 2`-deoxycytidine-3`-phosphate respectively; and s is a phosphorothioate linkage, wherein the 3’-end of the sense strand is conjugated to the ligand as shown in the following schematic: and, wherein X is O. 64. The dsRNA agent of any one of claims 1-48, wherein sense strand comprises at least 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- CCUUUGGAAUAAAGCUGCCUU -3’(SEQ ID NO: 844). 65. The dsRNA agent of any one of claims 1-48 and 64, wherein the sense strand comprises at least 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- CCUUUGGAAUAAAGCUGCCUU -3’(SEQ ID NO: 844). 66. The dsRNA agent of any one of claims 1-48, 64 and 65, wherein the sense strand comprises the nucleotide sequence of 5’- CCUUUGGAAUAAAGCUGCCUU -3’(SEQ ID NO: 844). 67. The dsRNA agent of any one of claims 1-48 and 64-66, wherein the sense strand consists of the nucleotide sequence of 5’- CCUUUGGAAUAAAGCUGCCUU -3’(SEQ ID NO: 844). 68. The dsRNA agent of any one of claims 1-48 and 64-67, wherein the antisense strand comprises at least 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- AAGGCAGCUUUAUUCCAAAGGGC -3’ (SEQ ID NO: 1868). 69. The dsRNA agent of any one of claims 1-48 and 64-68, wherein the antisense strand comprises at least 19 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- AAGGCAGCUUUAUUCCAAAGGGC -3’ (SEQ ID NO: 1868). 70. The dsRNA agent of any one of claims 1-48 and 64-69, wherein the antisense strand comprises at least 21 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- AAGGCAGCUUUAUUCCAAAGGGC -3’ (SEQ ID NO: 1868). 71. The dsRNA agent of any one of claims 1-48 and 64-70, wherein the antisense strand comprises the nucleotide sequence of 5’- AAGGCAGCUUUAUUCCAAAGGGC -3’ (SEQ ID NO: 1868). 72. The dsRNA agent of any one of claims 1-48 and 64-71, wherein the antisense strand consists of the nucleotide sequence of 5’- AAGGCAGCUUUAUUCCAAAGGGC -3’ (SEQ ID NO: 1868). 73. The dsRNA agent of any one of claims 1-48 and 64-72, wherein the sense strand comprises the nucleotide sequence of 5’- CCUUUGGAAUAAAGCUGCCUU -3’(SEQ ID NO: 844) and the antisense strand comprises the nucleotide sequence of 5’- AAGGCAGCUUUAUUCCAAAGGGC - 3’ (SEQ ID NO: 1868). 74. The dsRNA agent of any one of claims 1-48 and 64-73, wherein the sense strand differs by no more than 3 modified nucleotides from the nucleotide sequence of 5’- cscsuuugGfaAfUfAfaagcugccuu -3’ (SEQ ID NO: 2095) wherein a, g, c and u are 2′-O-methyl (2′- OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; and s is a phosphorothioate linkage. 75. The dsRNA agent of any one of claims 1-48 and 64-74, wherein the antisense strand differs by no more than 3 modified nucleotides from the nucleotide sequence of 5’- asAfsggdCa(G2p)cuuuauUfcCfaaaggsgsc -3’ (SEQ ID NO: 2324), wherein a, g, c and u are 2′-O- methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; wherein G2p is guanosine-2`-phosphate; and s is a phosphorothioate linkage. 76. The dsRNA agent of any one of claims 1-48 and 64-75, wherein the sense strand comprises the nucleotide sequence of 5’- cscsuuugGfaAfUfAfaagcugccuu -3’ (SEQ ID NO: 2095) and the antisense strand comprises the nucleotide sequence of 5’- asAfsggdCa(G2p)cuuuauUfcCfaaaggsgsc - 3’ (SEQ ID NO: 2324), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; wherein G2p is guanosine-2`-phosphate; and s is a phosphorothioate linkage. 77. The dsRNA agent of any one of claims 1-48 and 64-76, wherein the sense strand comprises the nucleotide sequence of 5’- cscsuuugGfaAfUfAfaagcugccuuL96 -3’ (SEQ ID NO: 2095) and the antisense strand comprises the nucleotide sequence of 5’- asAfsggdCa(G2p)cuuuauUfcCfaaaggsgsc - 3’ (SEQ ID NO: 2324), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; wherein G2p is guanosine-2`-phosphate; s is a phosphorothioate linkage, and L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4- hydroxyprolinol. 78. The dsRNA agent of any one of claims 1-48 and 64-76, wherein the sense strand comprises the nucleotide sequence of 5’- cscsuuugGfaAfUfAfaagcugccuu -3’ (SEQ ID NO: 2095) and the antisense strand comprises the nucleotide sequence of 5’- asAfsggdCa(G2p)cuuuauUfcCfaaaggsgsc - 3’ (SEQ ID NO: 2324), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; wherein G2p is guanosine-2`-phosphate, s is a phosphorothioate linkage, and wherein the 3’-end of the sense strand is conjugated to the ligand as shown in the following schematic: and, wherein X is O. 79. The dsRNA agent of any one of claims 1-48, wherein the sense strand comprises at least 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- UCACCUGCUUCUUCUGGUU-3’(SEQ ID NO: 1686). 80. The dsRNA agent of any one of claims 1-48 and 79, wherein the sense strand comprises the nucleotide sequence of 5’- UCACCUGCUUCUUCUGGUU-3’(SEQ ID NO: 1686). 81. The dsRNA agent of any one of claims 1-48, 79 and 80, wherein the sense strand consists of the nucleotide sequence of 5’- UCACCUGCUUCUUCUGGUU-3’(SEQ ID NO: 1686). 82. The dsRNA agent of any one of claims 1-48 and 79-81, wherein the antisense strand comprises at least 17 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of 5’- AACCAGAAGAAGCAGGUGA-3’ (SEQ ID NO: 1790). 83. The dsRNA agent of any one of claims 1-48 and 79-82, wherein the antisense strand comprises the nucleotide sequence of 5’- AACCAGAAGAAGCAGGUGA-3’ (SEQ ID NO: 1790). 84. The dsRNA agent of any one of claims 1-48 and 79-83, wherein the antisense strand consists of the nucleotide sequence of 5’- AACCAGAAGAAGCAGGUGA-3’ (SEQ ID NO: 1790). 85. The dsRNA agent of any one of claims 1-48 and 79-84, wherein the sense strand comprises the nucleotide sequence of 5’- UCACCUGCUUCUUCUGGUU-3’(SEQ ID NO: 1686) and the antisense strand comprises the nucleotide sequence of 5’- AACCAGAAGAAGCAGGUGA -3’ (SEQ ID NO:1790). 86. The dsRNA agent of any one of claims 1-48 and 79-85, wherein the sense strand differs by no more than 3 modified nucleotides from the nucleotide sequence of 5’- UfcAfcCfuGfcUfuCfuUfcUfgGfsusUf -3’ (SEQ ID NO: 1974), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; and s is a phosphorothioate linkage. 87. The dsRNA agent of any one of claims 1-48 and 79-86, wherein the antisense strand differs by no more than 3 modified nucleotides from the nucleotide sequence of 5’- asAfscCfaGfaAfgAfaGfcAfgGfusGfsa -3’ (SEQ ID NO: 2203), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; and s is a phosphorothioate linkage. 88. The dsRNA agent of any one of claims 1-48 and 79-87, wherein the sense strand comprises the nucleotide sequence of 5’- UfcAfcCfuGfcUfuCfuUfcUfgGfsusUf-3’ (SEQ ID NO: 1974) and the antisense strand comprises the nucleotide sequence of 5’- asAfscCfaGfaAfgAfaGfcAfgGfusGfsa -3’ (SEQ ID NO: 2203), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; and s is a phosphorothioate linkage. 89. The dsRNA agent of any one of claims 1-48 and 79-88, wherein the sense strand comprises the nucleotide sequence of 5’- Q191sUfcAfcCfuGfcUfuCfuUfcUfgGfsusUf -3’ (SEQ ID NO: 1974) and the antisense strand comprises the nucleotide sequence of 5’- asAfscCfaGfaAfgAfaGfcAfgGfusGfsa -3’ (SEQ ID NO: 2203), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; s is a phosphorothioate linkage, and Q191 is N-[tris(GalNAc-alkyl)-amidododecanoyl]-(S)-pyrrolidin- 3-ol-phosphorothioate (p-C12-(GalNAc-alkyl)3). 90. The dsRNA agent of any one of claims 1-48 and 79-88, wherein the sense strand comprises the nucleotide sequence of 5’- UfcAfcCfuGfcUfuCfuUfcUfgGfsusUf -3’ (SEQ ID NO: 1974) and the antisense strand comprises the nucleotide sequence of 5’- asAfscCfaGfaAfgAfaGfcAfgGfusGfsa -3’ (SEQ ID NO: 2203), wherein a, g, c and u are 2′-O-methyl (2′-OMe) A, G, C, and U respectively; Af, Gf, Cf and Uf are 2′-fluoro A, G, C and U respectively; and s is a phosphorothioate linkage, wherein the 5’-end of the sense strand is conjugated to the ligand as shown in the following schematic: . 91. A cell containing the dsRNA agent of any one of claims 1-90. 92. A pharmaceutical composition for inhibiting expression of a gene encoding Transmembrane protease, serine 6 (TMPRSS6) comprising the dsRNA agent of any one of claims 1-90. 93. The pharmaceutical composition of claim 92, wherein dsRNA agent is in an unbuffered solution. 94. The pharmaceutical composition of claim 93, wherein the unbuffered solution is saline or water. 95. The pharmaceutical composition of claim 92, wherein said dsRNA agent is in a buffer solution. 96. The pharmaceutical composition of claim 95, wherein the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. 97. The pharmaceutical composition of claim 96, wherein the buffer solution is phosphate buffered saline (PBS). 98. A method of inhibiting expression of a Transmembrane protease, serine 6 (TMPRSS6) gene in a cell, the method comprising contacting the cell with the dsRNA agent of any one of claims 1-90, or the pharmaceutical composition of any one of claims 92-97, thereby inhibiting expression of the TMPRSS6 gene in the cell. 99. The method of claim 98, wherein the cell is within a subject. 100. The method of claim 98, wherein the subject is a human. 101. The method of claim 98 or 100, wherein the subject has a TMPRSS6-associated disorder. 102. The method of claim 101, wherein the TMPRSS6-associated disorder is a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis. 103. The method of claim 101, wherein the TMPRSS6-associated disorder is selected from the group consisting of hereditary hemochromatosis, β-thalassemia, polycythemia vera, myelodysplastic syndrome, congenital dyserythropoietic anemias, pyruvate kinase deficiency, erythropoietic porphyria, Parkinson’s Disease, Alzheimer’s Disease and Friedreich’s Ataxia. 104. The method of claim 101, wherein the TMPRSS6-associated disorder is β-thalassemia. 105. The method of claim 104, wherein the β-thalassemia is thalassemia major. 106. The method of claim 104, wherein the β-thalassemia is thalassemia intermedia. 107. The method of claim 101, wherein the TMPRSS6-associated disorder is polycythemia vera. 108. The method of any one of claims 98-107, wherein contacting the cell with the dsRNA agent inhibits the expression of TMPRSS6 by at least 50%, 60%, 70%, 80%, 90%, or 95%. 109. The method of any one of claims 98-108, wherein inhibiting expression of TMPRSS6 decreases TMPRSS6 protein level in serum of the subject by at least 50%, 60%, 70%, 80%, 90%, or 95%. 110. The method of any one of claims 98-109, wherein contacting the cell with the dsRNA agent increases the expression of hepcidin by at least 50%, 60%, 70%, 80%, 90%, or 95%. 111. The method of any one of claims 98-110, wherein increasing expression of hepicidin increases hepicidin protein level in serum of the subject by at least 50%, 60%, 70%, 80%, 90%, or 95%. 112. A method of treating a subject having a disorder that would benefit from reduction in Transmembrane protease, serine 6 (TMPRSS6) expression, comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims 1-58, or the pharmaceutical composition of any one of claims 50-55, thereby treating the subject having the disorder that would benefit from reduction in TMPRSS6 expression. 113. A method of preventing at least one symptom in a subject having a disorder that would benefit from reduction in Transmembrane protease, serine 6 (TMPRSS6) expression, comprising administering to the subject a prophylactically effective amount of the dsRNA agent of any one of claims 1-48, or the pharmaceutical composition of any one of claims 50-55, thereby preventing at least one symptom in the subject having the disorder that would benefit from reduction in TMPRSS6 expression. 114. The method of claim 112 or 113, wherein the disorder is a TMPRSS6-associated disorder. 115. The method of claim 114, wherein the TMPRSS6-associated disorder is a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis. 116. The method of claim 115, wherein the TMPRSS6-associated disorder is selected from the group consisting of hereditary hemochromatosis, β-thalassemia, polycythemia vera, myelodysplastic syndrome, congenital dyserythropoietic anemias, pyruvate kinase deficiency, erythropoietic porphyria, Parkinson’s Disease, Alzheimer’s Disease and Friedreich’s Ataxia. 117. The method of claim 114, wherein the TMPRSS6-associated disorder is β-thalassemia. 118. The method of claim 117, wherein the β-thalassemia is thalassemia major. 119. The method of claim 117, wherein the β-thalassemia is thalassemia intermedia. 120. The method of claim 114, wherein the TMPRSS6-associated disorder is polycythemia vera. 121. The method of any one of claims 112-120, wherein the subject is a human. 122. The method of any one of claims 112-121, wherein the administration of the agent to the subject causes a decrease in iron level, a decrease in ferritin level, a decrease in a transferrin saturation level, an increase in hemoglobin level, an increase in hematocrit level, and/or a decrease in TMPRSS6 protein accumulation. 123. The method of any one of claims 112-122, wherein the dsRNA agent is administered to the subject at a dose of about 0.01 mg/kg to about 50 mg/kg. 124. The method of any one of claims 112-123, wherein the dsRNA agent is administered to the subject subcutaneously. 125. The method of any one of claims 112-123, wherein the dsRNA agent is administered to the subject intravenously. 126. The method of any one of claims 112-125, further comprising determining the level of TMPRSS6 in a sample(s) from the subject. 127. The method of claim 126, wherein the level of TMPRSS6 in the subject sample(s) is a TMPRSS6 protein level in a blood, serum or liver sample(s). 128. The method of any one of claims 112-127, further comprising determining the level of iron and/or hepcidin in a sample(s) from the subject. 129. The method of any one of claims 112-128, further comprising administering to the subject an additional therapeutic agent for treatment of a TMPRSS6-associated disorder. 130. The method of claim 129, wherein the additional therapeutic agent is an iron chelator. 131 The method of claim 130, wherein the iron chelator is selected from the group consisting of deferiprone, deferoxamine, and deferasirox. 132. A kit comprising the dsRNA agent of any one of claims 1-90 or the pharmaceutical composition of any one of claims 92-97. 133. A vial comprising the dsRNA agent of any one of claims 1-90 or the pharmaceutical composition of any one of claims 92-97. 134. A syringe comprising the dsRNA agent of any one of claims 1-90 or the pharmaceutical composition of any one of claims 92-97. 135. An RNA-induced silencing complex (RISC) comprising an antisense strand of the dsRNA agent of any one of claims 1-90. |
, , ndependently are H, halogen, OR 3 , or alkyl; and R 3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar. In one embodiment, the thermally destabilizing modification in C1 is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T; and optionally, at least one nucleobase in the mismatch pair is a 2’-deoxy nucleobase. In one example, the thermally destabilizing modification i . T1, T1’, T2’, and T3’ each independently represent a nucleotide comprising a modification providing the nucleotide a steric bulk that is less or equal to the steric bulk of a 2’-OMe modification. A steric bulk refers to the sum of steric effects of a modification. Methods for determining steric effects of a modification of a nucleotide are known to one skilled in the art. The modification can be at the 2’ position of a ribose sugar of the nucleotide, or a modification to a non-ribose nucleotide, acyclic nucleotide, or the backbone of the nucleotide that is similar or equivalent to the 2’ position of the ribose sugar, and provides the nucleotide a steric bulk that is less than or equal to the steric bulk of a 2’-OMe modification. For example, T1, T1’, T2’, and T3’ are each independently selected from DNA, RNA, LNA, 2’-F, and 2’-F-5’-methyl. In one embodiment, T1 is DNA. In one embodiment, T1’ is DNA, RNA or LNA. In one embodiment, T2’ is DNA or RNA. In one embodiment, T3’ is DNA or RNA. n 1 , n 3 , and q 1 are independently 4 to 15 nucleotides in length. n 5 , q 3 , and q 7 are independently 1-6 nucleotide(s) in length. n 4 , q 2 , and q 6 are independently 1-3 nucleotide(s) in length; alternatively, n 4 is 0. q 5 is independently 0-10 nucleotide(s) in length. n 2 and q 4 are independently 0-3 nucleotide(s) in length. Alternatively, n 4 is 0-3 nucleotide(s) in length. In one embodiment, n 4 can be 0. In one example, n 4 is 0, and q 2 and q 6 are 1. In another example, n 4 is 0, and q 2 and q 6 are 1, with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). In one embodiment, n 4 , q 2 , and q 6 are each 1. In one embodiment, n 2 , n 4 , q 2 , q 4 , and q 6 are each 1. In one embodiment, C1 is at position 14-17 of the 5’-end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 4 is 1. In one embodiment, C1 is at position 15 of the 5’- end of the sense strand In one embodiment, T3’ starts at position 2 from the 5’ end of the antisense strand. In one example, T3’ is at position 2 from the 5’ end of the antisense strand and q 6 is equal to 1. In one embodiment, T1’ starts at position 14 from the 5’ end of the antisense strand. In one example, T1’ is at position 14 from the 5’ end of the antisense strand and q 2 is equal to 1. In an exemplary embodiment, T3’ starts from position 2 from the 5’ end of the antisense strand and T1’ starts from position 14 from the 5’ end of the antisense strand. In one example, T3’ starts from position 2 from the 5’ end of the antisense strand and q 6 is equal to 1 and T1’ starts from position 14 from the 5’ end of the antisense strand and q 2 is equal to 1. In one embodiment, T1’ and T3’ are separated by 11 nucleotides in length (i.e. not counting the T1’ and T3’ nucleotides). In one embodiment, T1’ is at position 14 from the 5’ end of the antisense strand. In one example, T1’ is at position 14 from the 5’ end of the antisense strand and q 2 is equal to 1, and the modification at the 2’ position or positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2’-OMe ribose. In one embodiment, T3’ is at position 2 from the 5’ end of the antisense strand. In one example, T3’ is at position 2 from the 5’ end of the antisense strand and q 6 is equal to 1, and the modification at the 2’ position or positions in a non-ribose, acyclic or backbone that provide less than or equal to steric bulk than a 2’-OMe ribose. In one embodiment, T1 is at the cleavage site of the sense strand. In one example, T1 is at position 11 from the 5’ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1. In an exemplary embodiment, T1 is at the cleavage site of the sense strand at position 11 from the 5’ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1, In one embodiment, T2’ starts at position 6 from the 5’ end of the antisense strand. In one example, T2’ is at positions 6-10 from the 5’ end of the antisense strand, and q 4 is 1. In an exemplary embodiment, T1 is at the cleavage site of the sense strand, for instance, at position 11 from the 5’ end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1; T1’ is at position 14 from the 5’ end of the antisense strand, and q 2 is equal to 1, and the modification to T1’ is at the 2’ position of a ribose sugar or at positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2’-OMe ribose; T2’ is at positions 6-10 from the 5’ end of the antisense strand, and q 4 is 1; and T3’ is at position 2 from the 5’ end of the antisense strand, and q 6 is equal to 1, and the modification to T3’ is at the 2’ position or at positions in a non-ribose, acyclic or backbone that provide less than or equal to steric bulk than a 2’-OMe ribose. In one embodiment, T2’ starts at position 8 from the 5’ end of the antisense strand. In one example, T2’ starts at position 8 from the 5’ end of the antisense strand, and q 4 is 2. In one embodiment, T2’ starts at position 9 from the 5’ end of the antisense strand. In one example, T2’ is at position 9 from the 5’ end of the antisense strand, and q 4 is 1. In one embodiment, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 1, B3’ is 2’-OMe or 2’-F, q 5 is 6, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). In one embodiment, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 1, B3’ is 2’-OMe or 2’-F, q 5 is 6, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 6, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 7, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 6, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 7, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 1, B3’ is 2’-OMe or 2’-F, q 5 is 6, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 1, B3’ is 2’-OMe or 2’-F, q 5 is 6, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 5, T2’ is 2’-F, q 4 is 1, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; optionally with at least 2 additional TT at the 3’-end of the antisense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 5, T2’ is 2’-F, q 4 is 1, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; optionally with at least 2 additional TT at the 3’-end of the antisense strand; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent can comprise a phosphorus-containing group at the 5’-end of the sense strand or antisense strand. The 5’-end phosphorus-containing group can be 5’-end phosphate (5’-P), 5’-end phosphorothioate (5’-PS), 5’-end phosphorodithioate (5’-PS2), 5’-end vinylphosphonate (5’- VP), 5’-end methylphosphonate (MePhos), or 5’-deoxy-5’-C-malonyl ( ). When the 5’-end phosphorus-containing group is 5’-end vin l hos honate (5’-VP), the 5’-VP can be either 5’-E-VP isomer (i.e., trans-vinylphosphonate, ), 5’-Z-VP isomer (i.e., cis- vinylphosphonate, ), or mixtures thereof. In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5’-end of the sense strand. In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5’-end of the antisense strand. In one embodiment, the RNAi agent comprises a 5’-P. In one embodiment, the RNAi agent comprises a 5’-P in the antisense strand. In one embodiment, the RNAi agent comprises a 5’-PS. In one embodiment, the RNAi agent comprises a 5’-PS in the antisense strand. In one embodiment, the RNAi agent comprises a 5’-VP. In one embodiment, the RNAi agent comprises a 5’-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5’-E-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5’-Z-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5’-PS2. In one embodiment, the RNAi agent comprises a 5’-PS2 in the antisense strand. In one embodiment, the RNAi agent comprises a 5’-PS2. In one embodiment, the RNAi agent comprises a 5’-deoxy-5’-C-malonyl in the antisense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The RNAi agent also comprises a 5’-PS. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The RNAi agent also comprises a 5’-P. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The RNAi agent also comprises a 5’-VP. The 5’-VP may be 5’-E-VP, 5’-Z-VP, or combination thereof. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The RNAi agent also comprises a 5’- PS2. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-P. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-PS. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-VP. The 5’-VP may be 5’-E-VP, 5’-Z-VP, or combination thereof. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- PS2. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The RNAi agent also comprises a 5’-P. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The dsRNA agent also comprises a 5’-PS. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The RNAi agent also comprises a 5’-VP. The 5’-VP may be 5’-E-VP, 5’-Z-VP, or combination thereof. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The RNAi agent also comprises a 5’- PS2. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1. The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’-P. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’-PS. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’-VP. The 5’-VP may be 5’-E-VP, 5’-Z-VP, or combination thereof. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’- PS2. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’-deoxy-5’- C-malonyl. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The RNAi agent also comprises a 5’- P. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The RNAi agent also comprises a 5’- PS. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The RNAi agent also comprises a 5’- VP. The 5’-VP may be 5’-E-VP, 5’-Z-VP, or combination thereof. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The dsRNAi RNA agent also comprises a 5’- PS2. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- P. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- PS. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- VP. The 5’-VP may be 5’-E-VP, 5’-Z-VP, or combination thereof. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- PS2. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The RNAi agent also comprises a 5’- P. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The RNAi agent also comprises a 5’- PS. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The RNAi agent also comprises a 5’- VP. The 5’-VP may be 5’-E-VP, 5’-Z-VP, or combination thereof. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The RNAi agent also comprises a 5’- PS2. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1. The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- P. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- PS. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- VP. The 5’-VP may be 5’-E-VP, 5’-Z-VP, or combination thereof. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- PS2. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-P and a targeting ligand. In one embodiment, the 5’-P is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-PS and a targeting ligand. In one embodiment, the 5’- PS is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-VP (e.g., a 5’-E-VP, 5’-Z-VP, or combination thereof), and a targeting ligand. In one embodiment, the 5’-VP is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- PS2 and a targeting ligand. In one embodiment, the 5’- PS2 is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl and a targeting ligand. In one embodiment, the 5’-deoxy-5’-C-malonyl is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’-P and a targeting ligand. In one embodiment, the 5’-P is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’-PS and a targeting ligand. In one embodiment, the 5’-PS is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’-VP (e.g., a 5’-E-VP, 5’-Z-VP, or combination thereof) and a targeting ligand. In one embodiment, the 5’-VP is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’-PS2 and a targeting ligand. In one embodiment, the 5’-PS2 is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18- 23 of the antisense strand (counting from the 5’-end). The RNAi agent also comprises a 5’-deoxy-5’- C-malonyl and a targeting ligand. In one embodiment, the 5’-deoxy-5’-C-malonyl is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-P and a targeting ligand. In one embodiment, the 5’-P is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-PS and a targeting ligand. In one embodiment, the 5’- PS is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-VP (e.g., a 5’-E-VP, 5’-Z-VP, or combination thereof) and a targeting ligand. In one embodiment, the 5’-VP is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-PS2 and a targeting ligand. In one embodiment, the 5’- PS2 is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, T2’ is 2’-F, q 4 is 2, B3’ is 2’-OMe or 2’-F, q 5 is 5, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl and a targeting ligand. In one embodiment, the 5’-deoxy-5’-C-malonyl is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-P and a targeting ligand. In one embodiment, the 5’-P is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- PS and a targeting ligand. In one embodiment, the 5’-PS is at the 5’- end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- VP (e.g., a 5’-E-VP, 5’-Z-VP, or combination thereof) and a targeting ligand. In one embodiment, the 5’-VP is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’- PS2 and a targeting ligand. In one embodiment, the 5’-PS2 is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In one embodiment, B1 is 2’-OMe or 2’-F, n 1 is 8, T1 is 2’F, n 2 is 3, B2 is 2’-OMe, n 3 is 7, n 4 is 0, B3 is 2’-OMe, n 5 is 3, B1’ is 2’-OMe or 2’-F, q 1 is 9, T1’ is 2’-F, q 2 is 1, B2’ is 2’-OMe or 2’-F, q 3 is 4, q 4 is 0, B3’ is 2’-OMe or 2’-F, q 5 is 7, T3’ is 2’-F, q 6 is 1, B4’ is 2’-F, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5’-end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5’-end of the antisense strand). The RNAi agent also comprises a 5’-deoxy-5’-C-malonyl and a targeting ligand. In one embodiment, the 5’-deoxy-5’-C-malonyl is at the 5’-end of the antisense strand, and the targeting ligand is at the 3’-end of the sense strand. In a particular embodiment, an RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; and (iii) 2’-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 17, 19, and 21, and 2’-OMe modifications at positions 2, 4, 6, 8, 12, 14 to 16, 18, and 20 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5, 9, 11 to 13, 15, 17, 19, 21, and 23, and 2’F modifications at positions 2, 4, 6 to 8, 10, 14, 16, 18, 20, and 22 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the dsRNA agents have a two nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another particular embodiment, an RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’-F modifications at positions 1, 3, 5, 7, 9 to 11, 13, 15, 17, 19, and 21, and 2’-OMe modifications at positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 (counting from the 5’ end); and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2’F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another particular embodiment, a RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’-OMe modifications at positions 1 to 6, 8, 10, and 12 to 21, 2’-F modifications at positions 7, and 9, and a deoxy-nucleotide (e.g. dT) at position 11 (counting from the 5’ end); and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 7, 9, 11, 13, 15, 17, and 19 to 23, and 2’-F modifications at positions 2, 4 to 6, 8, 10, 12, 14, 16, and 18 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another particular embodiment, a RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’-OMe modifications at positions 1 to 6, 8, 10, 12, 14, and 16 to 21, and 2’-F modifications at positions 7, 9, 11, 13, and 15; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 5, 7, 9, 11, 13, 15, 17, 19, and 21 to 23, and 2’-F modifications at positions 2 to 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another particular embodiment, a RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’-OMe modifications at positions 1 to 9, and 12 to 21, and 2’-F modifications at positions 10, and 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5, 7, 9, 11 to 13, 15, 17, 19, and 21 to 23, and 2’- F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another particular embodiment, a RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’-F modifications at positions 1, 3, 5, 7, 9 to 11, and 13, and 2’-OMe modifications at positions 2, 4, 6, 8, 12, and 14 to 21; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3, 5 to 7, 9, 11 to 13, 15, 17 to 19, and 21 to 23, and 2’-F modifications at positions 2, 4, 8, 10, 14, 16, and 20 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another particular embodiment, a RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’-OMe modifications at positions 1, 2, 4, 6, 8, 12, 14, 15, 17, and 19 to 21, and 2’-F modifications at positions 3, 5, 7, 9 to 11, 13, 16, and 18; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 25 nucleotides; (ii) 2’-OMe modifications at positions 1, 4, 6, 7, 9, 11 to 13, 15, 17, and 19 to 23, 2’-F modifications at positions 2, 3, 5, 8, 10, 14, 16, and 18, and deoxy-nucleotides (e.g. dT) at positions 24 and 25 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a four nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another particular embodiment, a RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2’-F modifications at positions 7, and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7, 8, 10 to 13, 15, and 17 to 23, and 2’-F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another particular embodiment, a RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2’-F modifications at positions 7, and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 23, and 2’-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); wherein the RNAi agents have a two nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In another particular embodiment, a RNAi agent of the present invention comprises: (a) a sense strand having: (i) a length of 19 nucleotides; (ii) an ASGPR ligand attached to the 3’-end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’-OMe modifications at positions 1 to 4, 6, and 10 to 19, and 2’-F modifications at positions 5, and 7 to 9; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 21 nucleotides; (ii) 2’-OMe modifications at positions 1, 3 to 5, 7, 10 to 13, 15, and 17 to 21, and 2’-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5’ end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5’ end); wherein the RNAi agents have a two nucleotide overhang at the 3’-end of the antisense strand, and a blunt end at the 5’-end of the antisense strand. In certain embodiments, the iRNA for use in the methods of the invention is an agent selected from agents listed in any one of Tables 2-7. These agents may further comprise a ligand. III. iRNAs Conjugated to Ligands Another modification of the RNA of an iRNA of the invention involves chemically linking to the iRNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the iRNA e.g., into a cell. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553- 6556). In other embodiments, the ligand is cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di- hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937). In certain embodiments, a ligand alters the distribution, targeting, or lifetime of an iRNA agent into which it is incorporated. In some embodiments a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. In some embodiments, ligands do not take part in duplex pairing in a duplexed nucleic acid. Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2- hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide. Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic. In certain embodiments, the ligand is a multivalent galactose, e.g., an N-acetyl-galactosamine. Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,O3- (oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine- imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP. Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non- peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB. The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell’s cytoskeleton, e.g., by disrupting the cell’s microtubules, microfilaments, or intermediate filaments. The drug can be, for example, taxol, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin. In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins, etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein. Ligand-conjugated iRNAs of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto. The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems® (Foster City, Calif.). Any other methods for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives. In the ligand-conjugated iRNAs and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside- conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks. When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis. A. Lipid Conjugates In certain embodiments, the ligand or conjugate is a lipid or lipid-based molecule. In one embodiment, such a lipid or lipid-based molecule binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non- kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, or (c) can be used to adjust binding to a serum protein, e.g., HSA. A lipid based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney. In certain embodiments, the lipid based ligand binds HSA. In one embodiment, it binds HSA with a sufficient affinity such that the conjugate will be distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed. In other embodiments, the lipid based ligand binds HSA weakly or not at all. In one embodiment, the conjugate will be distributed to the kidney. Other moieties that target to kidney cells can also be used in place of, or in addition to, the lipid based ligand. In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells. Also included are HSA and low density lipoprotein (LDL). B. Cell Permeation Agents In another aspect, the ligand is a cell-permeation agent, such as, a helical cell-permeation agent. In one embodiment, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. In one embodiment, the helical agent is an alpha-helical agent, which has a lipophilic and a lipophobic phase. The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 14). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:15) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO:16) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO:17) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized. An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand, e.g., PECAM-1 or VEGF. A “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond- containing peptide (e.g., α -defensin, β-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res.31:2717-2724, 2003). C. Carbohydrate Conjugates In some embodiments of the compositions and methods of the invention, an iRNA further comprises a carbohydrate. The carbohydrate conjugated iRNA is advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri-, and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8). In certain embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In certain embodiments, the monosaccharide is an N-acetylgalactosamine (GalNAc). GalNAc conjugates, which comprise one or more N-acetylgalactosamine (GalNAc) derivatives, are described, for example, in US 8,106,022, the entire content of which is hereby incorporated herein by reference. In some embodiments, the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells. In some embodiments, the GalNAc conjugate targets the iRNA to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes). In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments the GalNAc conjugate is conjugated to the 3’ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3’ end of the sense strand) via a linker, e.g., a linker as described herein. In some embodiments the GalNAc conjugate is conjugated to the 5’ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 5’ end of the sense strand) via a linker, e.g., a linker as described herein. In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker. In other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a tetravalent linker. In certain embodiments, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent. In certain embodiments, the double stranded RNAi agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers. In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker. The hairpin loop may also be formed by an extended overhang in one strand of the duplex. In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker. The hairpin loop may also be formed by an extended overhang in one strand of the duplex. In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of: NHAc Formula IV,
, Formula XXVI;
; XIX;
Formula XXXIV. In another embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is an N- acetylgalactosamine, such as Formula II. In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S . In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below: . Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to, (Formula XXXVI), when one of X or Y is an oligonucleotide, the other is a hydrogen. In some embodiments, a suitable ligand is a ligand disclosed in WO 2019/055633, the entire contents of which are incorporated herein by reference. In one embodiment the ligand comprises the structure below: In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker. In one embodiment, the double stranded RNAi agents of the invention comprise one or more GalNAc or GalNAc derivative attached to the iRNA agent. The GalNAc may be attached to any nucleotide via a linker on the sense strand or antsisense strand. The GalNac may be attached to the 5’-end of the sense strand, the 3’ end of the sense strand, the 5’-end of the antisense strand, or the 3’ – end of the antisense strand. In one embodiment, the GalNAc is attached to the 3’ end of the sense strand, e.g., via a trivalent linker. In other embodiments, the double stranded RNAi agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of linkers, e.g., monovalent linkers. In some embodiments, for example, when the two strands of an iRNA agent of the invention is part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3’-end of one strand and the 5’-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker. In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator or a cell permeation peptide. Additional carbohydrate conjugates and linkers suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference. D. Linkers In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable. The term "linker" or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, SO2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic, or substituted aliphatic. In one embodiment, the linker is about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms. A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In an exemplary embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum). Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases. A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a selected pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell. A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis. Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes. In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In certain embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions). i. Redox cleavable linking groups In certain embodiments, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (-S-S-). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media. ii. Phosphate-based cleavable linking groups In other embodiments, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are -O-P(O)(ORk)-O-, -O- P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(O)(ORk)-O-, -O-P(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O- P(S)(ORk)-S-, -S-P(S)(ORk)-O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O-, -S-P(O)(Rk)-O-, -S-P(S)(Rk)-O-, -S-P(O)(Rk)-S-, -O-P(S)( Rk)-S-, wherein Rk at each occurrence can be, independently, C1-C20 alkyl, C1-C20 haloalkyl, C6-C10 aryl, or C7-C12 aralkyl. Exemplary embodiments include -O- P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)-O-, -O-P(O)(OH)-S-, -S-P(O)(OH)-S- , -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P(O)(H)-O, -S-P(S)(H)-O-, - S-P(O)(H)-S-, and -O-P(S)(H)-S-. In certain embodiments a phosphate-based linking group is -O- P(O)(OH)-O-. These candidates can be evaluated using methods analogous to those described above. iii. Acid cleavable linking groups In other embodiments, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In certain embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula -C=NN-, C(O)O, or -OC(O). An exemplary embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above. iv. Ester-based linking groups In other embodiments, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula -C(O)O-, or -OC(O)-. These candidates can be evaluated using methods analogous to those described above. v. Peptide-based cleaving groups In yet other embodiments, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula – NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above. In some embodiments, an iRNA of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,
(Formula XLIV), when one of X or Y is an oligonucleotide, the other is a hydrogen. In certain embodiments of the compositions and methods of the invention, a ligand is one or more “GalNAc” (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker. In one embodiment, a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XLV) – (XLVI):
wherein: q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different; P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH 2 , CH 2 NH or CH 2 O; Q 2A , Q 2B , Q 3A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C are independently for each occurrence absent, alkylene, substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO 2 , N(R N ), C(R’)=C(R’’), C≡C or C(O); R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5C are each independently for each occurrence absent, NH, O, S, CH2, C(O)O, C(O)NH, NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CO, CH=N-O, O or heterocyclyl; L 2A , L 2B , L 3A , L 3B , L 4A , L 4B , L 5A , L 5B and L 5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R a is H or amino acid side chain. Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XLIX): , wherein L 5A , L 5B and L 5C represent a monosaccharide, such as GalNAc derivative. Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII. Representative U.S. Patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Patent Nos.4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928;5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; and 8,106,022, the entire contents of each of which are hereby incorporated herein by reference. It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds. “Chimeric” iRNA compounds or “chimeras,” in the context of this invention, are iRNA compounds, such as, dsRNAi agents, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, or increased binding affinity for the target nucleic acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art. In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison- Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2- di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate. IV. Delivery of an iRNA of the Invention The delivery of an iRNA of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject susceptible to or diagnosed with a TMPRSS6-associated disorder, e.g., a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject. Alternatively, in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below. In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol.2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue. RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, PH., et al (2005) Gene Ther.12:59-66; Makimura, H., et al (2002) BMC Neurosci.3:18; Shishkina, GT., et al (2004) Neuroscience 129:521-528; Thakker, ER., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya,Y., et al (2005) J. Neurophysiol.93:594-602). Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA to the target tissue and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432:173-178). In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH, et al (2008) Journal of Controlled Release 129(2):107- 116) that encases an iRNA. The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic- iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR, et al (2003) J. Mol. Biol 327:761-766; Verma, UN, et al (2003) Clin. Cancer Res.9:1291-1300; Arnold, AS et al (2007) J. Hypertens.25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN, et al (2003), supra), "solid nucleic acid lipid particles" (Zimmermann, TS, et al (2006) Nature 441:111-114), cardiolipin (Chien, PY, et al (2005) Cancer Gene Ther.12:321-328; Pal, A, et al (2005) Int J. Oncol.26:1087-1091), polyethyleneimine (Bonnet ME, et al (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol.71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, DA, et al (2007) Biochem. Soc. Trans.35:61-67; Yoo, H., et al (1999) Pharm. Res.16:1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Patent No.7,427,605, which is herein incorporated by reference in its entirety. A. Vector encoded iRNAs of the Invention iRNA targeting the TMPRSS6 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A, et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Patent No.6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292). Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication- defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells’ genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are known in the art. V. Pharmaceutical Compositions of the Invention The present invention also includes pharmaceutical compositions and formulations which include the iRNAs of the invention. In one embodiment, provided herein are pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the iRNA are useful for preventing or treating a TMPRSS6-associated disorder, e.g., a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a TMPRSS6 gene. In some embodiments, the pharmaceutical compositions of the invention are sterile. In another embodiment, the pharmaceutical compositions of the invention are pyrogen free. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a TMPRSS6 gene. In general, a suitable dose of an iRNA of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. Typically, a suitable dose of an iRNA of the invention will be in the range of about 0.1 mg/kg to about 5.0 mg/kg, such as, about 0.3 mg/kg and about 3.0 mg/kg. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every month, once every 3-6 months, or once a year. In certain embodiments, the iRNA is administered about once per month to about once per six months. After an initial treatment regimen, the treatments can be administered on a less frequent basis. Duration of treatment can be determined based on the severity of disease. In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that doses are administered at not more than 1, 2, 3, or 4 month intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered about once per month. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered quarterly (i.e., about every three months). In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered twice per year (i.e., about once every six months). The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to mutations present in the subject, previous treatments, the general health or age of the subject, and other diseases present. Moreover, treatment of a subject with a prophylactically or therapeutically effective amount, as appropriate, of a composition can include a single treatment or a series of treatments. The iRNA can be delivered in a manner to target a particular tissue (e.g., hepatocytes). Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Formulations include those that target the liver. The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers. A. Additional Formulations i. Emulsions The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 µm in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p.245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p.301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions can be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution either in the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion. Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199). Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p.199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic, and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.285). A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199). The application of emulsion formulations via dermatological, oral, and parenteral routes, and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.199). ii. Microemulsions In one embodiment of the present invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion can be defined as a system of water, oil, and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). iii. Microparticles An iRNA of the invention may be incorporated into a particle, e.g., a microparticle. Microparticles can be produced by spray-drying, but may also be produced by other methods including lyophilization, evaporation, fluid bed drying, vacuum drying, or a combination of these techniques. iv. Penetration Enhancers In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers and their use in manufacture of pharmaceutical compositions and delivery of pharmaceutical agents are well known in the art. v. Excipients In contrast to a carrier compound, a “pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Such agent are well known in the art. vi. Other Components The compositions of the present invention can additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings, or aromatic substances, and the like which do not deleteriously interact with the nucleic acid(s) of the formulation. Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol, or dextran. The suspension can also contain stabilizers. In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA and (b) one or more agents which function by a non-iRNA mechanism and which are useful in treating a TMPRSS63-associated disorder, e.g., a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis, e.g., hereditary hemochromatosis, β-thalassemia (e.g., β-thalassemia major and β-thalassemia intermiedia), polycythemia vera, myelodysplastic syndrome, congenital dyserythropoietic anemias, pyruvate kinase deficiency, erythropoietic porphyria, Parkinson’s Disease, Alzheimer’s Disease or Friedreich’s Ataxia. Toxicity and prophylactic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose prophylactically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured herein in the invention lies generally within a range of circulating concentrations that include the ED50, such as, an ED80 or ED90, with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the prophylactically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) or higher levels of inhibition as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography. In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents used for the prevention or treatment of a TMPRSS6-associated disorder, e.g., a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein. VI. Methods For Inhibiting TMPRSS6 Expression The present invention also provides methods of inhibiting expression of a TMPRSS6 gene in a cell. The methods include contacting a cell with an RNAi agent, e.g., double stranded RNA agent, in an amount effective to inhibit expression of TMPRSS6 in the cell, thereby inhibiting expression of TMPRSS6 in the cell. Contacting of a cell with an iRNA, e.g., a double stranded RNA agent, may be done in vitro or in vivo. Contacting a cell in vivo with the iRNA includes contacting a cell or group of cells within a subject, e.g., a human subject, with the iRNA. Combinations of in vitro and in vivo methods of contacting a cell are also possible. Contacting a cell may be direct or indirect, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In some embodiments, the targeting ligand is a carbohydrate moiety, e.g., a GalNAc3 ligand, or any other ligand that directs the RNAi agent to a site of interest. The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating”, “suppressing”, and other similar terms, and includes any level of inhibition. The phrase “inhibiting expression of a TMPRSS6” is intended to refer to inhibition of expression of any TMPRSS6 gene (such as, e.g., a mouse TMPRSS63 gene, a rat TMPRSS6 gene, a monkey TMPRSS6 gene, or a human TMPRSS6 gene) as well as variants or mutants of a TMPRSS6 gene. Thus, the TMPRSS6 gene may be a wild-type TMPRSS6 gene, a mutant TMPRSS6 gene, or a transgenic TMPRSS6 gene in the context of a genetically manipulated cell, group of cells, or organism. “Inhibiting expression of a TMPRSS6 gene” includes any level of inhibition of a TMPRSS6 gene, e.g., at least partial suppression of the expression of a TMPRSS6 gene. The expression of the TMPRSS6 gene may be assessed based on the level, or the change in the level, of any variable associated with TMPRSS6 gene expression, e.g., TMPRSS6 mRNA level or TMPRSS6 protein level. The expression of a TMPRSS6 may also be assessed indirectly based on the hepcidin mRNA level, hepcidin protein level, or iron levels in tissues or serum. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject. It is understood that TMPRSS6 is expressed predominantly in the liver. Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with TMPRSS6 expression compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control). In some embodiments of the methods of the invention, expression of a TMPRSS6 gene is inhibited by at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay. In some embodiments, expression of a TMPRSS6 gene is inhibited by at least 70%. It is further understood that inhibition of TMPRSS6 expression in certain tissues, e.g., in liver, without a significant inhibition of expression in other tissues, e.g., brain, may be desirable. In some embodiments, expression level is determined using the assay method provided in Example 2 with a 10 nM siRNA concentration in the appropriate species matched cell line. In certain embodiments, inhibition of expression in vivo is determined by knockdown of the human gene in a rodent expressing the human gene, e.g., an AAV-infected mouse expressing the human target gene (i.e., TMPRSS6), e.g., when administered as a single dose, e.g., at 3 mg/kg at the nadir of RNA expression. Knockdown of expression of an endogenous gene in a model animal system can also be determined, e.g., after administration of a single dose at, e.g., 3 mg/kg at the nadir of RNA expression. Such systems are useful when the nucleic acid sequence of the human gene and the model animal gene are sufficiently close such that the human iRNA provides effective knockdown of the model animal gene. RNA expression in liver is determined using the PCR methods provided in Example 2. Inhibition of the expression of a TMPRSS6 gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a TMPRSS6 gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an iRNA of the invention, or by administering an iRNA of the invention to a subject in which the cells are or were present) such that the expression of a TMPRSS6 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an iRNA or not treated with an iRNA targeted to the gene of interest). In some embodiments, the inhibition is assessed by the method provided in Example 2 using a 10nM siRNA concentration in the species matched cell line and expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula: (mRNAin control cells) - (mRNA in treated cells) • (mRNAin control cells) In other embodiments, inhibition of the expression of a TMPRSS6 gene may be assessed in terms of a reduction of a parameter that is functionally linked to TMPRSS6 gene expression, e.g., TMPRSS6 protein level in blood or serum from a subject. TMPRSS6 gene silencing may be determined in any cell expressing TMPRSS6, either endogenous or heterologous from an expression construct, and by any assay known in the art. Inhibition of the expression of a TMPRSS6 protein may be manifested by a reduction in the level of the TMPRSS6 protein that is expressed by a cell or group of cells or in a subject sample (e.g., the level of protein in a blood sample derived from a subject). As explained above, for the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells, or the change in the level of protein in a subject sample, e.g., blood or serum derived therefrom. A control cell, a group of cells, or subject sample that may be used to assess the inhibition of the expression of a TMPRSS6 gene includes a cell, group of cells, or subject sample that has not yet been contacted with an RNAi agent of the invention. For example, the control cell, group of cells, or subject sample may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent or an appropriately matched population control. The level of TMPRSS6 mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of TMPRSS6 in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the TMPRSS6 gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy TM RNA preparation kits (Qiagen®) or PAXgene TM (PreAnalytix TM , Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis. In some embodiments, the level of expression of TMPRSS6 is determined using a nucleic acid probe. The term “probe”, as used herein, refers to any molecule that is capable of selectively binding to a specific TMPRSS6. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules. Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to TMPRSS6 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix® gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of TMPRSS6 mRNA. An alternative method for determining the level of expression of TMPRSS6 in a sample involves the process of nucleic acid amplification or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Patent No.4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Patent No.5,854,033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of TMPRSS6 is determined by quantitative fluorogenic RT-PCR (i.e., the TaqMan TM System). In some embodiments, expression level is determined by the method provided in Example 2 using, e.g., a 10 nM siRNA concentration, in the species matched cell line. The expression levels of TMPRSS6 mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Patent Nos.5,770,722, 5,874,219, 5,744,305, 5,677,195 and 5,445,934, which are incorporated herein by reference. The determination of TMPRSS6 expression level may also comprise using nucleic acid probes in solution. In some embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR (qPCR). The use of these methods is described and exemplified in the Examples presented herein. In some embodiments, expression level is determined by the method provided in Example 2 using a 10nM siRNA concentration in the species matched cell line. The level of TMPRSS6 protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme- linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. In some embodiments, the efficacy of the methods of the invention are assessed by a decrease in TMPRSS6 mRNA or protein level (e.g., in a liver biopsy). In some embodiments of the methods of the invention, the iRNA is administered to a subject such that the iRNA is delivered to a specific site within the subject. The inhibition of expression of TMPRSS6 may be assessed using measurements of the level or change in the level of TMPRSS6 mRNA or TMPRSS6 protein in a sample derived from fluid or tissue from the specific site within the subject (e.g., liver or blood). As used herein, the terms detecting or determining a level of an analyte are understood to mean performing the steps to determine if a material, e.g., protein, RNA, is present. As used herein, methods of detecting or determining include detection or determination of an analyte level that is below the level of detection for the method used. VII. Prophylactic and Treatment Methods of the Invention The present invention also provides methods of using an iRNA of the invention or a composition containing an iRNA of the invention to inhibit expression of TMPRSS6, thereby preventing or treating a TMPRSS6-associated disorder, e.g., a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis. In the methods of the invention the cell may be contacted with the siRNA in vitro or in vivo, i.e., the cell may be within a subject. A cell suitable for treatment using the methods of the invention may be any cell that expresses a TMPRSS6 gene, e.g., a liver cell. A cell suitable for use in the methods of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell, including human cell in a chimeric non- human animal, or a non-human primate cell, e.g., a monkey cell or a chimpanzee cell), or a non- primate cell. In certain embodiments, the cell is a human cell, e.g., a human liver cell. In the methods of the invention, TMPRSS6 expression is inhibited in the cell by at least 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95, or to a level below the level of detection of the assay. The in vivo methods of the invention may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the TMPRSS6 gene of the mammal to which the RNAi agent is to be administered. The composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection. In certain embodiments, the compositions are administered by intramuscular injection. In one aspect, the present invention also provides methods for inhibiting the expression of a TMPRSS6 gene in a mammal. The methods include administering to the mammal a composition comprising a dsRNA that targets a TMPRSS6 gene in a cell of the mammal and maintaining the mammal for a time sufficient to obtain degradation of the mRNA transcript of the TMPRSS6 gene, thereby inhibiting expression of the TMPRSS6 gene in the cell. Reduction in gene expression can be assessed by any methods known in the art and by methods, e.g. qRT-PCR, described herein, e.g., in Example 2. Reduction in protein production can be assessed by any methods known it the art, e.g. ELISA. In certain embodiments, a puncture liver biopsy sample serves as the tissue material for monitoring the reduction in the TMPRSS6 gene or protein expression. In other embodiments, a blood sample serves as the subject sample for monitoring the reduction in the TMPRSS6 protein expression. The present invention further provides methods of treatment in a subject in need thereof, e.g., a subject diagnosed with a TMPRSS6-associated disorder, such as a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis, e.g., hereditary hemochromatosis, β- thalassemia (e.g., β-thalassemia major and β-thalassemia intermiedia), polycythemia vera, myelodysplastic syndrome, congenital dyserythropoietic anemias, pyruvate kinase deficiency, erythropoietic porphyria, Parkinson’s Disease, Alzheimer’s Disease or Friedreich’s Ataxia. In one embodiment, a subject having a TMPRSS6-associated disorder has hereditary hemochromatosis. In another embodiment, a subject having a TMPRSS6-associated disorder has β-thalassemia. In another embodiment, a subject having a TMPRSS6-associated disorder has polycythemia vera. The present invention further provides methods of prophylaxis in a subject in need thereof. The treatment methods of the invention include administering an iRNA of the invention to a subject, e.g., a subject that would benefit from a reduction of TMPRSS6 expression, in a prophylactically effective amount of a dsRNA targeting a TMPRSS6 gene or a pharmaceutical composition comprising a dsRNA targeting a TMPRSS6 gene. In one aspect, the present invention provides methods of treating a subject having a disorder that would benefit from reduction in TMPRSS6 expression, e.g., a TMPRSS6-associated disease, such as a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis, e.g., hereditary hemochromatosis, β-thalassemia (e.g., β-thalassemia major and β-thalassemia intermiedia), polycythemia vera, myelodysplastic syndrome, congenital dyserythropoietic anemias, pyruvate kinase deficiency, erythropoietic porphyria, Parkinson’s Disease, Alzheimer’s Disease or Friedreich’s Ataxia. Treatment of a subject that would benefit from a reduction and/or inhibition of TMPRSS6 gene expression includes therapeutic treatment (e.g., a subject is having elevated iron levels) and prophylactic treatment (e.g., the subject is not having elevated iron levels or a subject may be at risk of developing elevated iron levels). An iRNA of the invention may be administered as a “free iRNA.” A free iRNA is administered in the absence of a pharmaceutical composition. The naked iRNA may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the iRNA can be adjusted such that it is suitable for administering to a subject. Alternatively, an iRNA of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation. Subjects that would benefit from an inhibition of TMPRSS6 gene expression are subjects susceptible to or diagnosed with a TMPRSS6-associated disorder, such as a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis, e.g., hereditary hemochromatosis, β- thalassemia (e.g., β-thalassemia major and β-thalassemia intermiedia), polycythemia vera, myelodysplastic syndrome, congenital dyserythropoietic anemias, pyruvate kinase deficiency, erythropoietic porphyria, Parkinson’s Disease, Alzheimer’s Disease or Friedreich’s Ataxia. In an embodiment, the method includes administering a composition featured herein such that expression of the target a TMPRSS6 gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 1-6, 1-3, or 3-6 months per dose. In certain embodiments, the composition is administered once every 3-6 months. In one embodiment, the iRNAs useful for the methods and compositions featured herein specifically target RNAs (primary or processed) of the target TMPRSS6 gene. Compositions and methods for inhibiting the expression of these genes using iRNAs can be prepared and performed as described herein. Administration of the iRNA according to the methods of the invention may result prevention or treatment of a TMPRSS6-associated disorder, e.g., a disorder associated with iron overload and/or a disorder of ineffective erythropoiesis, e.g., hereditary hemochromatosis, β-thalassemia (e.g., β- thalassemia major and β-thalassemia intermiedia), polycythemia vera, myelodysplastic syndrome, congenital dyserythropoietic anemias, pyruvate kinase deficiency, erythropoietic porphyria, Parkinson’s Disease, Alzheimer’s Disease or Friedreich’s Ataxia. Subjects can be administered a therapeutic amount of iRNA, such as about 0.01 mg/kg to about 200 mg/kg. In one embodiment, the iRNA is administered subcutaneously, i.e., by subcutaneous injection. In another embodiment, the iRNA is administered intravenously, i.e., by intravenous injection. One or more injections may be used to deliver the desired dose of iRNA to a subject. The injections may be repeated over a period of time. The administration may be repeated on a regular basis. In certain embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as once per month to once a year. In certain embodiments, the iRNA is administered about once per month to about once every three months, or about once every three months to about once every six months. The invention further provides methods and uses of an iRNA agent or a pharmaceutical composition thereof for treating a subject that would benefit from reduction and/or inhibition of TMPRSS6 gene expression, e.g., a subject having a TMPRSS6-associated disease, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating these disorders. Accordingly, in some aspects of the invention, the methods which include either a single iRNA agent of the invention, further include administering to the subject one or more additional therapeutic agents. For example, in certain embodiments, an iRNA targeting TMPRSS6 is administered in combination with, e.g., an agent useful in treating a disorder associated with iron overload. For example, additional agents suitable for treating a subject that would benefit from reducton in TMPRSS6 expression, e.g., a subject having a disorder associated with iron overload, may include iron chelators (e.g., desferoxamine), folic acid, a blood transfusion, a phlebotomy, agents to manage ulcers, agents to increase fetal hemoglobin levels (e.g., hydroxyurea), agents to control infection (e.g., antibiotics and antivirals), agents to treat thrombotic state, or a stem cell or bone marrow transplant. A stem cell transplant can utilize stem cells from an umbilical cord, such as from a relative, e.g., a sibling. Exemplary iron chelators include desferoxamine, Deferasirox (Exjade), deferiprone, vitamin E, wheat germ oil, tocophersolan, and indicaxanthin. The iRNA agent and an additional therapeutic agent and/or treatment may be administered at the same time and/or in the same combination, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or at separate times and/or by another method known in the art or described herein. VIII. Kits In certain aspects, the instant disclosure provides kits that include a suitable container containing a pharmaceutical formulation of a siRNA compound, e.g., a double-stranded siRNA compound, or siRNA compound, (e.g., a precursor, e.g., a larger siRNA compound which can be processed into a siRNA compound, or a DNA which encodes an siRNA compound, e.g., a double- stranded siRNA compound, or ssiRNA compound, or precursor thereof). Such kits include one or more dsRNA agent(s) and instructions for use, e.g., instructions for administering a prophylactically or therapeutically effective amount of a dsRNA agent(s). The dsRNA agent may be in a vial or a pre-filled syringe. The kits may optionally further comprise means for administering the dsRNA agent (e.g., an injection device, such as a pre-filled syringe), or means for measuring the inhibition of TMPRSS6 (e.g., means for measuring the inhibition of TMPRSS6 mRNA, TMPRSS6 protein, and/or TMPRSS6 activity). Such means for measuring the inhibition of TMPRSS6 may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kits of the invention may optionally further comprise means for determining the therapeutically effective or prophylactically effective amount. In certain embodiments the individual components of the pharmaceutical formulation may be provided in one container, e.g., a vial or a pre-filled syringe. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation separately in two or more containers, e.g., one container for a siRNA compound preparation, and at least another for a carrier compound. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. The components can be combined according to a method described herein, e.g., to prepare and administer a pharmaceutical composition. The kit can also include a delivery device. This invention is further illustrated by the following examples which should not be construed as limiting. The entire contents of all references, patents and published patent applications cited throughout this application, as well as the informal Sequence Listing and Figures, are hereby incorporated herein by reference. EXAMPLES Example 1. iRNA Synthesis Source of reagents Where the source of a reagent is not specifically given herein, such reagent can be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology. siRNA Design siRNAs targeting the human Transmembrane protease, serine 6 (TMPRSS6) gene (human: NCBI refseqID NM_153609.4, NCBI GeneID: 164656) were designed using custom R and Python scripts. The human NM_153609.4 REFSEQ mRNA, has a length of 3197 bases. Detailed lists of the unmodified TMPRSS6 sense and antisense strand nucleotide sequences are shown in Tables 2, 4 and 6. Detailed lists of the modified TMPRSS6 sense and antisense strand nucleotide sequences are shown in Tables 3, 5 and 7. It is to be understood that, throughout the application, a duplex name without a decimal is equivalent to a duplex name with a decimal which merely references the batch number of the duplex. For example, AD-959917 is equivalent to AD-959917.1. siRNA Synthesis siRNAs were designed, synthesized, and prepared using methods known in the art. Briefly, siRNA sequences were synthesized on a 1 µmol scale using a Mermade 192 synthesizer (BioAutomation) with phosphoramidite chemistry on solid supports. The solid support was controlled pore glass (500-1000 Å) loaded with a custom GalNAc ligand (3’-GalNAc conjugates), universal solid support (AM Chemicals), or the first nucleotide of interest. Ancillary synthesis reagents and standard 2-cyanoethyl phosphoramidite monomers (2’-deoxy-2’-fluoro, 2’-O- methyl, RNA, DNA) were obtained from Thermo-Fisher (Milwaukee, WI), Hongene (China), or Chemgenes (Wilmington, MA, USA). Additional phosphoramidite monomers were procured from commercial suppliers, prepared in-house, or procured using custom synthesis from various CMOs. Phosphoramidites were prepared at a concentration of 100 mM in either acetonitrile or 9:1 acetonitrile:DMF and were coupled using 5-Ethylthio-1H-tetrazole (ETT, 0.25 M in acetonitrile) with a reaction time of 400 s. Phosphorothioate linkages were generated using a 100 mM solution of 3- ((Dimethylamino-methylidene) amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from Chemgenes (Wilmington, MA, USA)) in anhydrous acetonitrile/pyridine (9:1 v/v). Oxidation time was 5 minutes. All sequences were synthesized with final removal of the DMT group (“DMT-Off”). Upon completion of the solid phase synthesis, solid-supported oligoribonucleotides were treated with 300 µL of Methylamine (40% aqueous) at room temperature in 96 well plates for approximately 2 hours to afford cleavage from the solid support and subsequent removal of all additional base-labile protecting groups. For sequences containing any natural ribonucleotide linkages (2’-OH) protected with a tert-butyl dimethyl silyl (TBDMS) group, a second deprotection step was performed using TEA.3HF (triethylamine trihydrofluoride). To each oligonucleotide solution in aqueous methylamine was added 200 µL of dimethyl sulfoxide (DMSO) and 300 µL TEA.3HF and the solution was incubated for approximately 30 mins at 60 °C. After incubation, the plate was allowed to come to room temperature and crude oligonucleotides were precipitated by the addition of 1 mL of 9:1 acetontrile:ethanol or 1:1 ethanol:isopropanol. The plates were then centrifuged at 4 °C for 45 mins and the supernatant carefully decanted with the aid of a multichannel pipette. The oligonucleotide pellet was resuspended in 20 mM NaOAc and subsequently desalted using a HiTrap size exclusion column (5 mL, GE Healthcare) on an Agilent LC system equipped with an autosampler, UV detector, conductivity meter, and fraction collector. Desalted samples were collected in 96 well plates and then analyzed by LC-MS and UV spectrometry to confirm identity and quantify the amount of material, respectively. Duplexing of single strands was performed on a Tecan liquid handling robot. Sense and antisense single strands were combined in an equimolar ratio to a final concentration of 10 µM in 1x PBS in 96 well plates, the plate sealed, incubated at 100 °C for 10 minutes, and subsequently allowed to return slowly to room temperature over a period of 2-3 hours. The concentration and identity of each duplex was confirmed and then subsequently utilized for in vitro screening assays. Example 2. In vitro screening methods Cell culture and 384-well transfections For transfections, Hep3b cells (ATCC, Manassas, VA) were grown to near confluence at 37°C in an atmosphere of 5% CO 2 in Eagle’s Minimum Essential Medium (Gibco) supplemented with 10% FBS (ATCC) before being released from the plate by trypsinization. Transfection was carried out by adding 7.5 µl of Opti-MEM plus 0.1 µl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad CA. cat # 13778-150) to 2.5 µl of each siRNA duplex to an individual well in a 384-well plate. The mixture was then incubated at room temperature for 15 minutes. Forty µl of complete growth media without antibiotic containing ~1.5 x10 4 cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 10 nM, 1 nM, and 0.1 nM final duplex concentration. Total RNA isolation using DYNABEADS mRNA Isolation Kit (Invitrogen™, part #: 610-12) Cells were lysed in 75µl of Lysis/Binding Buffer containing 3 µL of beads per well and mixed for 10 minutes on an electrostatic shaker. The washing steps were automated on a Biotek EL406, using a magnetic plate support. Beads were washed (in 90µL) once in Buffer A, once in Buffer B, and twice in Buffer E, with aspiration steps in between. Following a final aspiration, complete 10µL RT mixture was added to each well, as described below. cDNA synthesis using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, Cat #4368813) A master mix of 1µl 10X Buffer, 0.4µl 25X dNTPs, 1µl Random primers, 0.5µl Reverse Transcriptase, 0.5µl RNase inhibitor and 6.6µl of H2O per reaction were added per well. Plates were sealed, agitated for 10 minutes on an electrostatic shaker, and then incubated at 37 degrees C for 2 hours. Following this, the plates were agitated at 80 degrees C for 8 minutes. Real time PCR Two microlitre (µl) of cDNA were added to a master mix containing 0.5µl of human GAPDH TaqMan Probe (4326317E), 0.5µl human TMPRSS6, 2µl nuclease-free water and 5µl Lightcycler 480 probe master mix (Roche Cat # 04887301001) per well in a 384 well plates (Roche cat # 04887301001). Real time PCR was done in a LightCycler480 Real Time PCR system (Roche). To calculate relative fold change, data were analyzed using the ΔΔCt method and normalized to assays performed with cells transfected with 10nM AD-1955, or mock transfected cells. IC 50 s were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD- 1955 or mock-transfected. The sense and antisense sequences of AD-1955 are: sense: cuuAcGcuGAGuAcuucGAdTsdT (SEQ ID NO: 18) and antisense UCGAAGuACUcAGCGuAAGdTsdT (SEQ ID NO: 19). The results of the single dose screen of the agents in Tables 2, 3, 6 and 7 in Hep3b cells are shown in Table 8. Table 1. Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'- phosphodiester bonds; and it is understood that when the nucleotide contains a 2’-fluoro modification, then the fluoro replaces the hydroxy at that position in the parent nucleotide (i.e., it is a 2’-deoxy-2’- fluoronucleotide).
e S E S N 0 2 1 2 2 2 3 2 4 2 5 2 6 2 7 2 8 2 9 2 0 3 1 3 2 3 3 3 4 3 5 3 6 3 7 3 8 3 9 3 0 4 1 4 2 4 3 4 4 4 5 4 d n a r U U U U U U U U U U t G S A C C U U U U U U U U U U U U U U U U C U A G G G U A G C G G U G G C U G U C U U U C C C U C C U A G G G U A A C A C U C C G U U U U A U U C C e s G U U C n A C U A G G G U G G G C C C C C A U G U C A U U C e A C U A G G U G C G U C U U U U U C U A G G A C U G U U G si t ' A U U U C C G A A C A U A G A C C C U G U U A C U U U n 3 C C U A U U U C C A A C A C G U C C A U C U G U A C G U A U U U C C U U U A G G U A o t U C A G U U C G G U U U A C d ' C G G U A U U U C C C C U U U C A A G C U U U C C U A U C U U U C G U G U U A G G U A U U U G G A C C G G n 5 U e c C U U C A U G U U U U U G C G G U A U U G G U U C G C A C C U U U U U C G G a G G G U A U G A G U C C C G e s n e A U C U C G G U A U A U U C G G U A G A G U C U U C U U C n u G A U C U U C G G U A U C C G U A C G G U G U U U U C e q S e U S G U C A C U A U U C C U G G U C G G G C C C C C C U U C C U U C U G G C A A U C C C U C C G U C U U C d ei e s U G C U A C U C G U C C A U A C U U C U C C C U G U U U C f C U G C U A C U U C U U U C C C C C A G A C A C U C U i n d e C S G U G C G G G U G U C A C U A U C C U G G C U C C U A G A G U U G A C A C U C C C G U C U A C C U G U C o m e n m 5 7 9 0 0 1 1 1 2 1 3 1 4 1 5 1 6 1 7 1 3 2 1 5 5 5 2 9 7 9 0 0 0 3 6 0 2 1 4 1 5 1 7 1 8 1. 1 0 2 1 2 v U a . 2 N 8 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 9 4 0 5 0 5 1 5 1 5 1 5 1 5 1 5 1 5 1 2 5 1 2 5 5 1 7 5 e x l e 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 7 1 b l p 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 0 4 a u D D D D D D D D D D D D D D D D D D D D D D D D D D 1 T D A A A A A A A A A A A A A A A A A A A A A A A A A A E M
Table 3. Modified Sense and Antisense Strand Sequences of TMPRSS6 dsRNA Agents
Table 4. Unmodified Sense and Antisense Strand Sequences of TMPRSS6 dsRNA Agent
Table 5. Modified Sense and Antisense Strand Sequences of TMPRSS6 dsRNA Agents
Table 6. Unmofidied Sense and Antisense Strand Sequences of TMPRSS6 dsRNA Agents
Table 7. Modified Sense and Antisense Strand Sequences of TMPRSS6 dsRNA Agents
Table 8. Single Dose Screen in Hep3b Cells
Example 3. In vivo Efficacy of dsRNA Duplexes in Non-Human Primates (NHP) Selected duplexes of interest, identified from the above in vitro studies, were evaluated in vivo in non-human primates. Figure 1 provides a depiction of the study design. In particular, 15 male Cynomolgus monkeys were divided into 5 groups of 3 each and were subcutaneously administered a single 3 mg/kg dose of AD-1556360, a single 10 mg/kg dose of AD- 1556360, a single 3 mg/kg dose of AD-1571158, or a single 3 mg/kg dose of AD-1571033, or PBS as a control (see Table 9). For each animal, two liver biopsy samples (one per lobe) of about 100 mg each were collected following 12 hours of fasting on Day 22, Day 57, and/or Day 85. Liver biopsy and serum samples were also collected from the animals 21 days prior to dosing. One mL of blood was collected into tubes without anticoagulant weekly from Day 1 for hepcidin level, iron level, transferrin saturation level, and red blood cell (RBC) count determinations. Following clotting, serum was aliquoted and stored at -80°C. Tissue mRNA was extracted and alayzed by the RT-QPCR method. TMPRSS6 mRNA levels were compared to the levels of the housekeeping gene, GAPDH. The values were then normalized to the average of PBS vehicle control group. The data were expressed as percent of baseline value, and presented as mean plus standard deviation. Iron and transferrin saturation levels were determined using commercially available kits from Roche. The results, shown in Figures 2-4, demonstrate that all three exemplary duplexes, AD- 1556360, AD-1571158, and AD-1571033, potently and durably inhibit the expression ofTMPRSS6 messenger RNA in vivo (Figure 2), potently and durably lower plasma iron levels (Figure 3), and potently and durably lower transferrin saturation levels (Figure 4). Transferrin saturation is a measure of the amount of iron bound to serum transferrin, and corresponds to the ratio of serum iron and total iron-binding capacity. Table 9. Treatment Groups EQUIVALENTS Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.