TREATMENT OF EPITHELIAL FRAGILITY DISORDERS FIELD OF THE INVENTION

The present invention provides compounds, compositions, methods and medicaments for use in treating epithelial fragility disorders such as, for example, Meesmann epithelial corneal dystrophy (MECD). BACKGROUND OF THE INVENTION

Epithelia function as barrier tissues that very often form the interface between the human body and its external environment. A classic example is the anterior epithelium of the cornea of the eye, which forms the outermost cellular covering of the ocular surface (Irvine et al., 2003). Keratins are intermediate filament proteins that polymerise in particular combinations to form a dense cytoskeletal meshwork of filaments within the cytoplasm of epithelial cells (McLean and Irvine, 2007). Through the study of many genetic disorders characterised by abnormal fragility and/or overgrowth of specific subsets of epithelial cells and tissues within the human body, the primary function of this network of filaments has been shown to be that of imparting mechanical strength to epithelial cells and tissues (Irvine and McLean, 1999; McLean and Irvine, 2007). Genetic mutations in the genes encoding keratins generally lead to epithelial fragility diseases, also known as keratinizing disorders.

Meesmann epithelial corneal dystrophy (MECD) is an hereditary eye disorder that is inherited in an autosomal dominant manner (Irvine et al., 2003). The molecular basis of MECD centres on dominant-negative mutations in either of the genes encoding keratins K3 or Kl 2, which are expressed specifically in the keratinocyte cells of the anterior corneal epithelium (Irvine et al., 1997). Since then, a total of 16 distinct disease-causing mutations have been reported in Kl 2 and a total of 2 mutations reported in the K3 gene in MECD patients and families, see intermediate

filament mutation database, http://www.interfil.org/ (Szeverenyi et al., 2008). The vast majority of MECD mutations, like that of all the other keratin disorders, are point mutations leading to amino acid substitutions within the keratin rod domain. Such mutations are well-known to be highly detrimental to keratin cytoskeletal function in a dominant-acting fashion (Irvine and McLean, 1999).

MECD has a characteristic slit-lamp appearance of a myriad of fine round epithelial cysts which become visible by 12 months of age and increase in number throughout life. Patients are usually asymptomatic until adulthood where rupture of the corneal microcysts may cause erosions, producing clinical symptoms such as photophobia, contact lens intolerance and intermittent diminution of visual acuity. Rarely, subepithelial scarring causes irregular corneal astigmatism and permanent visual impairment. Histological examination shows a disorganised and thickened epithelium with widespread cytoplasmic vacuolation and numerous small, round, debris-laden intraepithelial cysts. The Kl 2 mutation R135T appears to be a common cause of the MECD due to a founder effect, with many hundreds of patients identified with this particular genetic mutation in Germany and elsewhere in Western Europe (Corden et al., 2000; Irvine et al., 1997). Recently, we identified another founder mutation in the British population, L132P in the K12 gene, in a number of apparently unrelated families (unpublished data). Interestingly, this mutation consistently gives rise to an unusually severe phenotype in these families, possibly due to the specific amino acid change from leucine to a helix-breaking proline residue in the Kl 2 polypeptide, which is a substitution well-known to be particularly disruptive to alpha-helical structures in protein domains such as the keratin rod domain (Smith et al., 1999).

Despite these significant discoveries, little progress has been made towards developing therapies for these disorders or other dominantly inherited genetic diseases.

SUMMARY OF THE INVENTION The present invention is based on the finding that compounds which are capable of modulating the expression of one or more keratin genes — particularly those which harbour mutations resulting in the production of damaged, mutated and/or defective keratin, may be particularly useful in the treatment of epithelial fragility disorders. As such, in a first aspect, the present invention provides a compound capable of modulating the expression of one or more keratin genes for treating an epithelial fragility disorder.

In a second aspect the present invention provides the use of a compound capable of modulating the expression of one or more keratin genes in the manufacture of a medicament for treating an epithelial fragility disorder.

In a third aspect, the present invention provides a method of treating an epithelial fragility disorder, said method comprising the step of administering to a subject a therapeutically effective amount of a compound capable of modulating the expression of one or more keratin genes. The present inventors have found that certain epithelial fragility disorders occur as a result of the expression of one or more mutated or defective keratin genes and that, by modulating the expression of these mutated or defective genes and preventing or reducing the production of their proteinaceous products (which are themselves damaged, mutated and/or defective), it may be possible to treat, cure or prevent epithelial fragility disorders.

The term "epithelial fragility disorders" should be understood to include any disease or disorder involving the expression of one or more mutated keratin gene(s), resulting in fragile epithelial tissues. In view of the involvement of keratin genes,

"epithelial fragility disorders" may otherwise be known as "keratinopathies" or "keratinizing disorders".

The present invention provides compounds, compositions, medicaments and/or methods which may be used to treat diseases involving epithelial tissues such as, for example, those which occur in the integumentary (for example skin), digestive, respiratory, urinary, visual (for example cornea), reproductive, endocrine and sensory systems.

In particular, the present invention provides compounds, compositions, medicaments and methods for use in treating diseases involving the epithelial tissues of the eye, for example the cornea and in particular diseases such as Meesmann epithelial corneal dystrophy (MECD). MECD is characterised by the occurrence of fine epithelial cysts in the anterior portion of the cornea which consists of stratified non-cornified epithelium. These cysts increase in number through the lifetime of the sufferer and, in adulthood, may rupture to bring about a variety of clinical symptoms - including, for example, photophobia, contact lens intolerance and intermittent diminution of visual acuity. MECD is known to occur as a result of the expression of mutated forms of the

K3 and/or Kl 2 keratin genes. Accordingly, where the invention relates to the treatment of MECD, the compounds provided by this invention modulate the expression of the K3 and/or Kl 2 keratin genes.

The term "modulate" should be taken to encompass compounds which either inhibit (i.e. decrease) and/or increase the expression of keratin genes and it should be

understood that the present invention encompasses the use of compounds which are capable of modulating both mutated and wild type keratin genes. In a preferred embodiment, the compounds provided by this invention may selectively modulate the expression of one or more mutated keratin genes. Compounds capable of selective modulation may be particularly useful in instances where a diseased epithelial tissue is known to express wild-type copies of the one or more keratin genes involved in the disease as well as mutated and/or otherwise defective copies of the same gene(s). By using compounds capable of selective modulation, it may be possible to inhibit only the expression of the mutated/defective keratin gene(s). One of skill in the art will readily understand that a mutated or defective keratin gene may comprise one or more mutations which take the form of single/multiple base insertions, deletions, inversions and/or substitutions. In addition, a mutated keratin gene may yield a mutated protein product which itself comprises one or more amino acid insertions, deletions, inversions and/or substitutions. Typically, the epithelial fragility disorders which are treatable using the compounds, compositions, methods and/or medicaments described herein, may arise from the expression of one or more mutated keratin genes which comprise one or more point mutations i.e. single base substitutions which in turn result in amino acid substitutions within a keratin protein. The present invention should not be construed as being limited to one particular compound or indeed to the modulation of a single keratin gene. One of skill in the art will appreciate that a method, medicament or composition provided by this invention may comprise one or more compounds intended to modulate one or more keratin genes. Advantageously therefore, two or more compounds capable of modulating the expression of one or more keratin genes may be administered (either

using a method or medicament described herein) together, as a combination or separately to treat an epithelial fragility disorder. Additionally, or alternatively, where the invention concerns a composition, that composition may comprise one or more compounds capable of modulating the expression of one or more keratin genes. The compounds provided by this invention may be oligonucleotides, preferably antisense oligonucleotides which may take the form of, for example DNA and/or RNA. In one embodiment, the oligonucleotides are RNA molecules which may be known to those skilled in this field as small/short interfering and/or silencing RNA and which will be referred to hereinafter as siRNA. Such RNA oligonucleotides may be in the form of native RNA duplexes or duplexes which have been modified in some way (for example by chemical modification) to be nuclease resistant. Additionally, or alternatively, the RNA oligonucleotides may take the form of short hairpin RNA (shRNA) expression or plasmid constructs which correspond to or comprise the siRNAs described herein. As described above, the oligonucleotides provided by this invention are designed so as to modulate the expression of one or more mutated keratin genes. Advantageously, the oligonucleotides may comprise a sequence identical to a keratin gene positioned 5' and/or 3' (i.e. upstream or downstream) of a mutation known to be associated with disease. In one embodiment, the present invention provides oligonucleotides which comprise sequences identical to portions of the keratin genes, K3 and/or K 12, which, as stated above, are known to be associated with epithelial fragility disorders. Preferably, the "portions" of the K3 and/or Kl 2 gene further comprise mutations known to be associated with disease.

Preferably, the oligonucleotide is about 10-30 nucleotides in length, preferably 15-25 nucleotides, more preferably 16-24 nucleotides and even more preferably 17-23 nucleotides in length. Typically, the oligonucleotides provided by this invention are 21-23 nucleotides in length. In one embodiment the oligonucleotide may comprise 19 residues identical to sequences 5' and/or 3' (upstream and/or downstream) of a mutated residue present in a mutated keratin gene, a single residue identical to the mutated residue within the mutated keratin gene and two residues (for example two uracil residues) added to the 3' end of the oligonucleotide to enhance their uptake by the RNA-induced silencing complex and thereby their activity. Oligonucleotides having this general structure may be referred to as 19+2 oliconucleotides having a total of 21 residues.

The present inventors have discovered that by designing oligonucleotides (preferably siRNA oligonucleotides) having any of the abovementioned features and in particular the 19+2 structure, it is possible to selectively target and modulate (i.e. inhibit) the expression of mutated keratin gene sequences associated with epithelial fragility disorders such as MECD. Without wishing to be bound by theory, the inventors hypothesise that certain siRNA sequences are capable of selectively targeting the mutated keratin gene sequences and mediating the RNA interference pathway. In this way, expression of only the mutated keratin gene sequence is prevented - leaving any wild-type keratin gene expression to continue generating functional keratin.

In addition, the inventors have observed that depending on where the residue identical to the mutated residue present in the mutated keratin gene is positioned, the oligonucleotide can be made more or less specific to the mutated keratin gene sequence. For example, the nucleotide which is identical to the mutated residue in the

keratin gene may occupy any position within the oligonucleotide. By way of a further example, where the oligonucleotide conforms to the 19+2 format, the first position in the oligonucleotide (i.e. position No: 1 or the residue at the 5' end of the oligonucleotide), or any other of positions 2 through 19 may be occupied by a residue which is identical to a mutated residue present in a mutated keratin gene.

Highly specific oligonucleotides should preferably only inhibit expression of the mutated keratin gene whereas those with less or lower specificity may also inhibit the expression of wild type keratin gene.

The present invention may include oligonucleotides identical to keratin gene K3 sequences which comprise the following mutations: R503P and/or E509K. In addition, the present invention encompasses oligonucleotides identical to keratin gene K12 sequences which comprise the following mutations: R135T, L132P, M129T, Q130P, L132H, N133K, R135G, R135I, R135S, A137P, L140P, V143L, I426S, I426V, Y429D Y429C and/or R430P. By way of example, oligonucleotides designed to inhibit - (preferably selectively inhibit), the expression of a mutated Kl 2 gene which comprises a mutation resulting in the amino acid change L132P (the nucleotide mutation comprising a T>C point mutation) may take the form of any of the oligonucleotides listed as K12_419c.l through to K12_419c.l9 detailed in Table 1. In a further embodiment, oligonucleotides designed to inhibit (preferably selectively inhibit), the expression of a mutated Kl 2 gene which comprises a mutation resulting in the amino acid change R135T (the nucleotide mutation comprising a G>C point mutation), may take the form of any of the oligonucleotides listed as K12_428c.l through to K12_428c.l9 in Table 22.

Preferably, and particularly where the K12 L132P mutation is concerned, the oligonucleotides for use in the medicaments, methods and compositions provided herein are provided in the 19+2 format described above and comprise a residue identical to the mutated residue of the Kl 2 gene at the 4, 5, 9, 10, 11, 12 or 15 position. Where the K12R135T mutation is concerned, useful oligonucleotides may comprise a residue identical to the mutated residue of the Kl 2 gene at the 5, 6, 8, 9, 12, 13 or 14 position. As stated above, one of skill in the art using the high throughput methods described herein can readily determine which particular oligonucleotides exhibit the greatest selectivity for a particular mutated keratin gene. In a further aspect, the present invention provides the oligonucleotides listed in

Tables 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 and/or 22 for treating an epithelial fragility disorder.

In addition, the invention relates to methods of treating subjects suffering from epithelial fragility disorders, said method comprising the step of administering one or more of the oligonucleotides listed in Tables 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 and/or 22.

In addition, the invention also relates to the use of any of the oligonucleotides presented in Tables 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 and/or 22 for treating an epithelial fragility disorder. By analysing the sequence of those mutated keratin genes known to be involved in epithelial fragility disorders and by using algorithms such as BIOPREDSJ, one of skill in the art could easily determine or computationally predict nucleic acid sequences that have an optimal knockdown effect for a given gene (see for example: http://www.biopredsi.org/start.html). Accordingly, the skilled man may generate and test an array or library of different oligonucleotides to determine whether or not they

are capable of modulating the expression of a keratin gene and/or their specificity for a particular muated keratin gene. In addition, the skilled man will appreciate that when generating oligonucleotides in the abovementioned 19+2 format), in order to produce an oligonucleotide in which there is a residue identical to the muated keratin gene residue present at each possible poition of the oligonucleotide (i.e. at one of positions one through 19), it will be necessary to generate 19 different oligonucleotides each of which will also also possess nucleotides identical to sequences of the keratin gene positioned 5' and/or 3' of the muated residue.

In order to determine the effectivness or selectivity of each of the oligonucleotides provide by this invention, the compounds may be subjected to a high throughput assay system as described herein (see also detailed description section).

Thus, in a fifth aspect, the present invention provides a method for determining whether or not a compound (for example a (test) agent) is capable of modulating the expression of a keratin gene, said method comprising the steps of contacting the compound with a system comprising said keratin gene and determining the test agent modulates the expression of the keratin gene in the system.

One of skill will appreciate that by comparing the results with those of a control method in which a compound or test agent has not been contacted with a system comprising said keratin gene, it may be possible to determine whether or not the compound or test agent is capable of modulating the expression of the keratin gene. Where, relative to the control assay, the level of keratin gene expression is less, this is indicative of a compound which is capable of modulating the expression of a keratin gene. Where the level of expression is the same or greater than that observed in the control assay, the compound is most likely not capable of modulating the expression of a keratin gene or enhances the expression of a keratin gene.

In order to determine whether or not a compound selectively inhibits the expression of a mutated keratin gene, the compound may be contacted with a system comprising both the mutated and wild type forms of the keratin gene known to be associated with an epithelial fragility disorder and the level of expression of both the mutated and wild type forms of the keratin gene determined. Where the level of expression of the wild type and mutated keratin genes are shown to be identical (or not statistically different) - even after addition of the compound, this may be indicative of a compound which either does not modulate the expression of either types of gene, or which inhibits both - i.e. is not selective. Where the expression of one of the mutated or wild type forms of the gene is shown to be less than that of the other, this is indicative of a compound which is specific for a particular form of the gene - i.e. is capable of modulating either the mutated form or the wild type form.

Preferably, the compound capable of modulating a keratin gene and which is used in any of the methods provided by the fifth aspect of this invention, is an oligonucleotide such as an siRNA molecule. Furthermore, in order to determine the level of expression of the keratin gene (either the mutated and/or wild type forms) the keratin genes may be fused to a reporter gene such as, for example a luciferase reporter gene. In one embodiment, the keratin gene is a Kl 2 and/or K3 keratin gene and a method in which wild type and/or mutated forms of these genes are used, would be particularly useful in identifying compounds potentially useful in the treatment of MECD. Where the method requires the use of a mutated form of the K3 and/or Kl 2 genes, those mutated forms described herein and known to be associated with MECD may be particularly useful.

In other embodiments, the level of keratin gene expression (either the wild type or mutated form) may be determined by PCR techniques such as realtime PCR,

RT-PCR etc. and/or electrophoretic techniques well known in the art. Additionally, or alternatively, the level of gene expression may be indirectly assessed via a determination of the level of protein produced thereby. The level of keratin protein may be determined immunologically by, for example ELISA or Western Blot or via electrophoretic techniques such as PAGE.

In a sixth aspect, the present invention provides a pharmaceutical composition comprising any of the compounds described herein and which are capable of modulating the expression of a keratin gene (preferably, but not necessarily, a mutated keratin gene), for use in treating an epithelial fragility disorder, in association with a pharmaceutically acceptable excipient, carrier or diluent.

Preferably, the pharmaceutical compositions provided by this invention are formulated as sterile pharmaceutical compositions. Suitable excipients, carriers or diluents may include, for example, water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, ion exchangers, alumina, aluminium stearate, lecithin, serum proteins, such as serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water salts or electrolytes, such as protamine sulphate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycon, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polypropylene-block polymers, polyethylene glycol and wool fat and the like, or combinations thereof.

Said pharmaceutical formulation may be formulated, for example, in a form suitable for topical administration. For example the formulation for topical administration may be presented as an ointment, solution or a suspension in an

aqueous or non-aqueous liquid, or as an oil-in-water liquid emulsion. Such formulations may be particularly useful where the epithelial fragility disorder affects the eye.

Conveniently the pharmaceutical formulation may be packaged within a receptacle to allow direct application to the eye such that the eye (particularly the cornea) can be washed or bathed in the pharmaceutical formulation. For example the pharmaceutical formulation may be packaged within a receptacle capable of delivering a predetermined volume of the formulation to the diseased area, for example the cornea of the eye. Such receptacles are well known in the art and may include receptacles such as those used to deliver fluids, for example pharmaceutical formulations, to the eye. In one embodiment, the receptacle may take the form of a dropper - i.e. a receptacle capable of administering measured drops to a tissue.

A pharmaceutical composition and/or medicament provided by this invention may be formulated as described above such that it can be delivered to the anterior corneal epithelium of the eye either dropwise as a solution, or as an ointment or the like. Other means of administering the compounds, medicaments and/or compositions or of executing the methods of treatment described herein, may include, for example, the use of transfection protocols and the like. For example, the various compounds, medicaments or compositions described herein could be contacted with the diseased tissue (for example the cornea of the eye) under conditions suitable to permit uptake by the epithelial cells of said tissue. In this way, the expression of mutated forms of the keratin gene may be inhibited or reduced thereby reducing or eliminating the symptoms of the epithelial fragility disorder. Alternatively, cells derived or obtained from the diseased tissue of a subject suffering from an epithelial fragility disorder, may be cultured in vitro and contacted with any of the compounds, compositions

and/or medicaments described herein, such that the compounds are taken up by said cells. These cells may then be grafted back on to the patient so as to treat the epithelial fragility disorder. This may be particularly useful where the disease to be treated in MECD and the cells are epithelial cells of the cornea. One of skill in the art will appreciate that keratinocyte grafting has been used successfully to treat burns to the cornea of the eye.

In addition to the above, it is also envisaged that by using compounds capable of modulating (preferably inhibiting) the expression of both the wild type and mutated forms of a keratin gene known to be associated with an epithelial fragility disorder, it may be possible to partially or completely inhibit or ablate the expression of a particular keratin gene (i.e. inhibit both wild type and mutated keratin gene expression). Furthermore, having inhibited or ablated the expression of a keratin gene known to be involved in or causative of an epithelial fragility disorder, it may be possible to use replacement gene therapy to treat the disease. By way of example, in order to treat MECD, it may be possible to partially or completely inhibit the expression of either the K3 and/or Kl 2 keratin gene using a compound capable of modulating the expression of these genes, as provided by this invention. Following this, it may be possible to introduce a correct copy of the relevant gene (K3 and/or Kl 2) to re-establish wild type gene function. In one embodiment, the compound capable of modulating the expression of both the wild type and mutant forms of a keratin gene known to be involved in or causative of an epithelial fragility disorder may be included in some form of construct capable of being stably transfected or introduced into a cell. Molecules such as shRNA may be used and may be delivered to cells in the form of a plasmid optionally comprising a selection means (such as a gene imparting drug resistance). Similarly,

the replacement keratin gene may also be introduced or transfected into diseased cells by means of a shRNA molecule. Preferably, the replacement gene may be included in the same construct as the shRNA comprising the compound capable of modulating the expression of a keratin gene. One of skill in the art will appreciate that by using a compound capable of modulating (preferably inhibiting) the expression of one or more wild type/mutated keratin genes, and by designing and testing the compound in accordance with the criteria and methods described herein, it is possible to provide a compound capable of inhibiting and/or ablating keratin gene expression irrespective of the particular mutation involved. Such a compound would be particularly useful in the treatment of a disease such as an epithelial disorder where a number of different mutations may be responsible for the symptoms of the disease. An exemplary knockout-replacement gene therapy vector for use in inhibiting the Kl 2 gene (both wild type and mutated forms) and restoring wild type gene function is provided in Figure 3. One of skill in the art will appreciate that analogous vector systems for use with the K3 gene may readily be produced.

DETAILED DESCRIPTION

The present invention will now be described in detail and with reference to the following figures which show: Figure 1 : Screening of K12 mutation L132P specific siRNAs. The individual panels show the results of screening siRNAs at differing concentrations against wild- type or mutant K12-luciferase reporter constructs. Test siRNAs that inhibit mutant Kl 2 expression but that have little or no effect on the wild-type construct, the best example of which is K12_419c.9, are suitable for development as therapeutic agents for MECD due to this mutation.

Figure 2: shRNAs against K12wt-Luc. The results of screening shRNAs against targets in the Kl 2 3'UTR at differing concentrations against wild-type or mutant K12-luciferase reporter constructs.

Figure 3: Knockout-replacement gene therapy vector design for K 12. Strategy for treating MECD in a mutation-independent manner. A dual expression construct, typically in an integrating viral vector, contains an shRNA expression cassette to silence the endogenous wild-type and mutant target gene, say Kl 2. A second cassette expresses as replacement K12 cDNA under control of the K12 promoter. This K12 cDNA lacks the 3'UTR and uses the viral LTR for polyadenylation and therefore is resistant to the effect of the shRNA cassette. Thus, one vector knocks out the endogenous gene expression and replaces it.

Figure 4: shows the results of normaliised data for all 19 siRNAs and controls. A number of inhibitors are both potent and specific for the R125T mutant allele, of which the most useful for therapeutic applications were those at positions 5, 6, 8, 9, 12, 13, 14. Inhibitors at positions 2 and 15 also were discriminating but not so specific as others, as they slightly knock down the wild-type allele at high concentrations.

Materials and Methods Design of siRNA siRNAs (19+2 format; 19-nucleotide duplex with two 3' uracyl nucleotide overhangs) were synthesized by MWG Biotech AG (Anzingerstr, Germany) to screen all possible target sequences containing the L132P mutation previously described in a number of multigeneration MECD families (data not shown). This T>C point mutation occurs at position 419 in the Kl 2 cDNA sequence, numbering from the A in the initiating ATG

codon (gene named KRT12, GeneBank accession no. NC_000017). The sense and antisense strands for the mutation-specific siRNA reagent designated K12_419.1 are 5'-AGA AAC UAU GCA AAA UCC UU and 5'-GGA TTT TGC ATA GTT TCT UU, respectively. Sense and antisense strands for the series of mutation-specific siRNAs K12_419.2 through K12_419.19 were designed similarly, and the sense strands are listed in Table 1. The firefly luciferase gene targeting siRNA (siLuc) sequences for the sense and antisense strands are 5'-GUG CGU UGC UAG UAC CAA CUU and 5'-GTT GGT ACT AGC AAC GCT CUU, respectively. The nonspecific control NSC4 siRNA (an inverted bacterial β-galactosidase sequence) sense and antisense sequences are 5'-UAG CGA CUA AAC ACA UCA AUU and 5'-TTG ATG TGT TTA GTC GCT AUU, respectively. All the oligonucleotides above were synthesized by MWG Biotech AG. Design of shRNA expression plamids Four 29-mer shRNA expression plasmids targeting Kl 2 were obtained from OriGene Technologies, Inc (Rockville, MD). The sequences of the targets were presented in Table 2 (the plasmids were named by the number of the first base of the targets on the human Kl 2 cDNA). Empty pRS vector (OriGene Technologies) was used as negative control. Cloning and mutagenesis Total human corneal epithelial mRNA was extracted from human corneal tissue under standard procedures with NucleoSpin® Extract II (Promega Corporation, UK). Corneal epithelial cDNA was obtained by reverse transcription PCR. To generate a luciferase expression construct containing Kl 2 mRNA sequence, the full length Kl 2 cDNA without poly-A signal sequence was obtained by PCR with the following primer pair: K12M1F 5'-CCT TCC CCA GGC CAT GGA TCT (forward primer) and

K12M1R2 5'-CAA TTA ACT CTA TTA AAA CAA (reverse primer). The 50μl PCR reaction contained 5μl 2.5mM dNTPs, 5nM primers, Ix Promega PCR buffer, 3μl 1.5mM MgCl ₂ , 2μl 4% DMSO, lμl Expand High Fidelity Enzyme mix (Roche) and 24.5μl distilled water, 0.5μl template DNA from the above corneal cDNA pool. The program for the PCR was as follows: 94°C for 5 minutes; 94°C for 30 seconds, 53°C for 1 minute and 72°C for 2 minutes for 35 cycles; 72 ⁰ C for 5 minutes. Wild- type full length K12cDNA without poly- A signal sequence was cloned into vector pCR®2.1 (Invitrogen) and confirmed by direct sequencing of plasmid DNA. The mutation L132P was generated by QuickChange™ Site-Directed Mutagenesis Kit (Stratagene) following the manufacturer's protocol, using the wild-type K12cDNA pCR®2.1 plasmid as template. The primer pair for mutagenesis was as follows: 5'- ACT ATG CAA AAT CCT AAT GAT AGA TTA and 5'-TAA TCT ATC ATT AGG ATT TTG CAT AGT. To generate luciferase reporter expression constructs for siRNA screening, both wild-type and mutant Kl 2 cDNA were cloned into psiTEST- LUC-target vector (Yorkshire Bioscience Ltd, UK) by using the restriction enzyme sites Not I and BamH I. The generated constructs were designated as K12wt-Luc and K12L132P-Luc, respectively. A Renilla luciferase expression construct (pRL-CMV, Promega) was used as an internal control for both cell viability and transfection efficiency. Cell culture and Transient Transfection

Human AD293 embryonic kidney cells (Invitrogen) were maintained in DMEM (Invitrogen) with 10% foetal calf serum (FCS, Invitrogen), supplemented with 2mM L-glutamine and ImM sodium pyruvate (growth media). Cells were incubated with 5% CO ₂ supplement at 37°C. The day before transfection, AD293 cells were seeded at 7x10 ³ cells/well in a 96- well plate resulting in 80% cell confluence at the time of

transfection. Cells were transfected with Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. Cells were co-transfected (in four replicates) with a mixture of 15ng firefly luciferase expression plasmid, Ing Renilla luciferase expression plasmid and siRNA (final concentration 0.01-6.25nM per transfection) or shRNA expression plasmid (5-300ng per transfection), which was diluted to 25μl in optiMEM medium (Invitrogen). One half of 1 μl Lipofectamine 2000 was diluted in 25μl of optiMEM medium and incubated at room temperature for 5 minutes. This mixture was added to the nucleic acid and incubated for 20 minutes at room temperature, before addition to the plated cells.

Measurement of luciferase acitivity

Twenty-four hours following transfection, for siRNA (or forty-eight hours for shRNA), the cells were lysed with 20μl Ix Passive Lysis Buffer (PLB, Promega Corporation) and shaken for 15 minutes on a table mixer (MixMate 230V, Eppendorf AG, Germany) at 800-1000 rpm at room temperature. Luciferase reporter activity then was measured with Dual-Luciferase® Reporter (DLR™) Assay System (Promega Corporation, USA) on a luminometer (LUMIstar OPTIMA, BMG LABTECH Ltd., UK) following the manufacturer's instructions. Thirty-six microliters of Luciferase Assay Reagent II (LAR II) for firefly luciferase reporter and Stop & Glo® Reagent for Renilla luciferase reporter activity were added at the time points of 0 and 9 seconds, respectively, followed by twelve readings for each reaction. The inhibitory effect of siRNA was represented by the induction of firefly luciferase activity in percentages, following normalisation to the Renilla transfection/viability control signal. Results

Identification of mutation-specific siRNA inhibitors for K12 mutation L132P

A sequence walk was performed with all 19 possible siRNA inhibitors (as shown in Table 1) designed to be specific for the Kl 2 L132P point mutation. For each inhibitor under test, the effect on K12-firefly luciferase reporter gene expression was determined in multiple replicate experiments over a range of siRNA molar concentrations (0, 0.01, 0.05, 0.25. 1.25 and 6.25 nM) against the wild-type Kl 2 and L132P mutant K12 reporter constructs. In each case, the data was normalised against the co-transfected Renilla luciferase to control for cell viability and transfection efficiency. The results of this experiment are presented graphically in Figure 1. Further controls used were a non-specific siRNA (NSC4), as a negative control, and a known potent siRNA against firefly luciferase (siLUC), as a positive control. The NSC4 negative control had no inhibitory effect on either the wild-type Kl 2 reporter or the L132P reporter, as predicted (Figure 1). Similarly, the siLUC positive control knocked down the expression of both wild-type and mutant constructs, roughly equally and over a wide range of siRNA concentrations (Figure 1).

Of the mutant-specific siRNAs under test, some inhibited both wild-type and L132P mutant Kl 2 equally, over a range of concentrations, such as K12_419c.l, or K12_419c.7 (Figure 1) and therefore did not discriminate the wild-type and mutant alleles. Some test inhibitors had little or no effect on expression of either the wild- type or mutant reporter gene expression, even at high concentrations, such as K12_419c.l3 or K12_419c.l6 (Figure 1). However, from the 19 test inhibitors, a number were able to specifically and potently inhibit the mutant allele with little or no effect on the wild-type allele, such as K12_419c.4, 5, 9, 10, 11, 12, 14 and 15 (Figure 1). Although all of these have good potential for therapeutic use, arguably the best

inhibitor for further development was K12_419c.9, where expression of the wild-type allele is not significantly knocked down, even at the highest concentrations, whereas the L132P mutant is potently knocked down even at the lowest siRNA concentration of 0.0 InM (Figure 1).

Comparing our data here to similar siRNA sequence walks against other point mutations, notably mutation N171K in the keratin K6a gene, where only inhibitor numbers 4 and 12 were mutant specific (Hickerson et al., 2008), there is no obvious pattern as to which inhibitors in the series of 19 will be potent or discriminating, from a given siRNA sequence walk across a given mutation. This is presumably due to sequence-context effects that are currently not predictable on the basis of primary sequence data alone. Thus, the inventive step here comes from the overall result of the walk in terms of efficacy and specificity of the individual inhibitors under test.

Tables 3-22 show the siRNA sequence walks for all the reported Kl 2 and K3 mutations that have been shown to cause MECD. The high-throughout reporter gene assay system described here can be used to screen these siRNAs to identify those suitable for mutation-specific gene silencing and therapy development aimed at specific disease-causing mutations.

Mutation-specific reagents could either be delivered in the form of native RNA duplexes, or chemically modified, nuclease-resistant RNA duplexes, into the anterior corneal epithelium in the form of ointment or eye drops, using formulation designed to enhance uptake of siRNA by corneal cells. Alternatively, short hairpin RNA (shRNA) expression constructs could be made corresponding to the mutation specific

siRNAs. These could be stably transfected either using an in vivo protocol in the eye of patients or more likely perhaps, by an ex vivo delivery route, whereby corneal epithelial cells are cultured from an MECD patient with a defined mutation, these are stably transfected with the therapeutic construct and then grafted back onto the ocular surface. Keratinocyte grafting has been successfully used and is in routine use for treatment of burns to the cornea, where cells derived from the unaffected eye are cultured and used to engraft the affected eye. Here, we envisage modifying this well- established technology by addition of a therapeutic gene transfer step. Stable delivery of the shRNA construct could be by plasmid with a selectable drug resistance marker to select stably transfected cells, or by use of a stable integrating virus vector, such as retroviral or lentiviral vectors.

Identification of potent shRNAs directed against wild-type Kl 2 An alternative means of achieving gene therapy for MECD is to use a knockout- replacement strategy. In this scenario, an RNAi reagent is used to inhibit the expression of both the wild-type and mutant target gene in the target cell type, such as Kl 2 in corneal keratinocytes in MECD, as completely or as completely as possible. Ideally, this should be in the form a stably transfected construct, such as a short hairpin RNA (shRNA), again, delivered as a plasmid containing a selectable drug resistance marker or using a stable integrating virus vector system. Simultaneously, either using a second expression cassette within the same construct as the shRNA, or by stable transfection of a second construct, the cells are also stably transfected or transduced with a replacement gene lacking the shRNA target site. The most convenient way to achieve this is to identify potent shRNAs against targets in 3'UTR of the target gene, in this case Kl 2. The replacement gene construct can then have the native 3'UTR removed and replaced with the 3'UTR from another gene or make use

of potent integrating viral long terminal repeat (LTR) sequences to achieve polyadenylation and mRNA processing in place of a mammalian 3'UTR sequence. The latter would be the method of choice when using a retroviral or lentiviral delivery system.

Here, we screened a number of shRNA sequences whose targets lie in the Kl 2 3'UTR sequence (Table 2), using the K12-firefly luciferase expression reporter gene system to identify those that are most potent in Kl 2 gene silencing. The results are shown in Figure 2. Of the four 29-mer shRNAs tested, two, designated pRS.K12.196 and pRS.K12.1434, were highly potent (Figure 2), being able to inhibit Kl 2 reporter gene expression by >50% at the lowest amount of plasmid transfected (5 ng/transfection). These reagents are therefore useful for development of a knockout-replacement gene therapy system for treating MECD due to a KL 12 mutation. An analogous system can readily be produced for the K3 gene or other genes. Such a system has the advantage of being mutation-independent i.e. a vector system as shown in Figure 3, equipped with a potent shRNA expression cassette and a replacement Kl 2 gene lacking the 3'UTR, could be used to treat all MECD patients carrying a dominant mutation in K 12, regardless of the particular mutation involved.

An alternative method to exploiting the non-coding 3'UTR would be to use si/shRNA targets within the coding sequence of the target gene, say Kl 2, and then generate a version of the Kl 2 cDNA that lacks the si/shRNA target by introducing a number of silent codon changes by site-directed mutagenesis. By this means, the Kl 2 protein sequence is unchanged but the DNA sequence can be substantially altered and no longer be recognised by si/shRNA.

Discussion

In recent years, RNA interference (RNAi) has come to the fore as a highly potent and specific means of silencing genes in a user-defined manner. RNAi is a naturally occurring gene silencing mechanism originally identified in C. elegans and subsequently in mammalian cells, where it is now routinely used as a research tool (Rana, 2007). This process of sequence specific, post-transcriptional inhibition of gene expression has great potential to be developed as a novel therapeutic approach for a number of disorders where gene inhibition is predicted to be therapeutic (Bumcrot et al., 2006). MECD represents a good model for RNAi therapy development since localized ocular application of small interfering RNA (siRNA) may be easier to achieve than systemic administration or use of integrating viral vector systems, both for proof-of-concept experiments in cell culture or animal models and ultimately, treatment of human subjects. Here, we have used a K12/luciferase reporter gene assay to systematically perform a sequence walk across the L132P mutation in order to identify siRNAs that potently and specifically inactivate this mutant allele without any gene silencing effect on the normal allele. Coupled with a suitable delivery system to the ocular surface, such reagents have huge potential for treatment of MECD.

Table 1 The sense strands of siRNAs against K12 L132P

Table 2 The target sequences of shRNA expression plasmids

Table 3 The sense strands of siRNAs against K12 R135T

Table 4 The sense strands of siRNAs against K12 M129T

Table 5 The sense strands of siRNAs against K12 Q130P

Table 6 The sense strands of siRNAs against K12 L132H

Table 7 The sense strands of siRNAs against K12 N133K

Table 8 The sense strands of siRNAs against K12 R135G

Table 9 The sense strands of siRNAs against K12 R135I

Table 10 The sense strands of siRNAs against K12 R135S

Table 11 The sense strands of siRNAs against Kl 2 A137P

Table 12 The sense strands of siRNAs against Kl 2 L140R

Table 13 The sense strands of siRNAs against K12 V143L (1)

Table 14 The sense strands of siRNAs against K12 V143L (2)

Table 15 The sense strands of siRNAs against Kl 2 I426S

Table 16 The sense strands of siRNAs against Kl 2 I426V

Table 17 The sense strands of siRNAs against K12 Y429D

Table 18 The sense strands of siRNAs against K12 Y429C

Table 19 The sense strands of siRNAs against Kl 2 R430P

Table 20 The sense strands of siRNAs against K3 R503P

Table 21 The sense strands of siRNAs against K3 E509K

Table 22

Kl 2wt GAAλAAGAAACTATGCAAAATCTTAATGAT AG ATTAGCTTCCTACCTGGATAAGGTGCGAGCT

Kl 2R 13 ST GAAAAAGAAACTATGCAAAATCTTAATGAT ACAπ AGCTTCCTACCTGGAl AAGGTGCGAGCT

Kl 2.428c.1 TGCAAAATCTTAATGATACUU

Kl2_428c.2 GCAAAATCTTAATGATACAUU

Kl 2..42&C .3 CAAAATCTTAATGATA CATU U

Kl 2_428c.4 AAAATCTTAATGATA CATTUU

K12._428o5 AAATCTTAATGATACATTAUU

Kl2__428c.6 AATCn AATGATA CATTAGUU

Kl 2 428c.7 ATCTTAATGATACATTAGCUU

Kl 2, 428C.8 TCTTAATGATA CATTAGCTUU

Kl2_428c.9 CTTAATGATACATTAGCTTUU

Kl2_.428c.lO TTAATGATA CATTAGCTTCU U

K12. 428C.11 TAATGATA CATTAGCTTCCUU

K12. 428c.12 AATGATA CATTAGCTTCCTUU

Kl 2 428c.13 ATGATA CATTAGCTTCCTAUU

Kl 2. 428c .14 TGATA CATTAGCTrCCTACUU

K12. 428C.1S GATA CATT AGCTTCCTACCUU

Kl 2 428c.16 ATA CATTAGCTTCCTACCTUU

Ki 2.428c.17 TA CATTAGCTγCCTACCTGUU

K12..42&C.18 ACATTAGCTTCCTACCTGGUU

K12 428c.19 CATTAGCTTCCTACCTGGAUU

Sequence scan used for the K12 point mutation R135T. All 19 siRNAs were made and tested against wild-type and mutant luciferase reporter constructs in psiTest vector in 293 cells over a range of concentrations of inhibitor, normalising against negative control and Renilla lucferase co-transfection (to control for transfection efficiency and cell viability).

References

Bumcrot D, Manoharan M, Koteliansky V, Sah DW (2006) RNAi therapeutics: a potential new class of pharmaceutical drugs. Nat Chem Biol 2:711-719.

Corden LD, Swensson O, Swensson B, Smith FJD, Rochels R, Uitto J, McLean WHI (2000) Molecular genetics of Meesmann's corneal dystrophy: ancestral and novel mutations in keratin 12 (K 12) and complete sequence of the human KRT 12 gene. Exp Eye Res 70:41-49.

Hickerson RP, Smith FJD, Reeves RE, Contag CH, Leake D, Leachman SA, Milstone LM, McLean WHI, Kaspar RL (2008) Single-nucleotide-specific siRNA targeting in a dominant-negative skin model. J Invest Dermatol 128:594-605.

Irvine AD, Corden LD, Swensson O, Swensson B, Moore JE, Frazer DG, Smith FJD, Knowlton RG, Christophers E, Rochels R, Uitto J, McLean WHI (1997) Mutations in cornea-specific keratins K3 or Kl 2 cause Meesmann's corneal dystrophy. Nat Genet 16:184-187. Irvine AD, McLean WHI (1999) Human keratin diseases: the increasing spectrum of disease and subtlety of the phenotype-genotype correlation. Br J Dermatol 140:815- 828.

Irvine AD, Wang MX, McLean WHI (2003) Epithelial, basement membrane and Bowman's layer dystrophies. In: Ophthalmology Monographs: Corneal dystrophies and degenerations (Wang MX ed) American Academy of Ophthalmology: Oxford, UK, 19-43.

Kaspar RL (2005) Challenges in developing therapies for rare diseases including pachyonychia congenita. J Investig Dermatol Symp Proc 10:62-66.

Lewin AS, Glazer PM, Milstone LM (2005) Gene therapy for autosomal dominant disorders of keratin. J Investig Dermatol Symp Proc 10:47-61.

McLean WHI, Irvine AD (2007) Disorders of keratinisation: from rare to common genetic diseases of skin and other epithelial tissues. Ulster Med J 76:72-82.

Rana TM (2007) Illuminating the silence: understanding the structure and function of small RNAs. Nat Rev MoI Cell Biol 8:23-36. Smith FJD, Del Monaco M, Steijlen PM, Munro CS, Marta M, Coleman CM, Rietveld FJR, Uitto J, McLean WHI (1999) Novel proline substitution mutations in keratin 16 in two cases of pachyonychia congenita type 1. Br J Dermatol 141:1010- 1016.

Szeverenyi I, Cassidy AJ, Chung CW, Lee BT, Common JE, Ogg SC, Chen H, Sim SY, Goh WL, Ng KW, Simpson JA, Chee LL, Eng GH, Li B, Lunny DP, Chuon D, Venkatesh A, Khoo KH, McLean WHI, Lim YP, Lane EB (2008) The Human Intermediate Filament Database: comprehensive information on a gene family involved in many human diseases. Hum Mutat 29:351-360.