Background

Medicinal treatment of pain can be for the provision of immediate relief such as for example injury-related pain, or for post-surgery pain-relief as well as for provision of long- term relief for those suffering from chronic or persistent pain. Whilst there are multiple medications and pain-relieving/pain-killing strategies which may be employed for the treatment of differing conditions and in different scenarios, there is an agreed World Health Organisation pain ladder which provides guidelines for the selection of the type and level of analgesia i.e. medication which acts to relieve pain which is suitable for the initial treatment of different categories of pain.

Opioids have been used for thousands of years as analgesics and to this day are the recommended first treatment of choice on the three step WHO analgesic ladder recommended for the treatment of moderate and severe pain.

Opioid receptors and signalling pathways have evolved over millions of years to mediate endogenous pain control and reward in mammals. It has been documented that in addition to the desired pain control, this reward signal reinforces both beneficial behaviours such as feeding and reproduction as well as accounting for negative behaviours including opioid abuse and addiction. The prototypical opioid agent, morphine is the gold standard to which all narcotic medications are compared and remains one of the most effective drugs available for treating severe pain. It is well known that there are adverse effects associated with the use of opioid-based drugs, both during the initial stages of drug-treatment (commencement of therapy), or where an existing therapy is amended i.e. the dose level or dose-frequency is altered (increased), or when a patient is rotated onto an alternative opioid analgesic. It is also well established that prolonged opioid treatment can lead to undesirable side effects/behaviours including constipation, immunosuppression, respiratory depression, hyperanalgesia, tolerance, physical dependency, and addiction. For these reasons it is recommended that the prescription of opioids is carefully monitored by health care providers.

It has long been a goal of the pharmaceutical industry to provide an opioid-based treatment for pain in which these negative side-effects, and particularly the drug tolerance, are mitigated. This is because increased levels of drug tolerance lead to increasing levels of medication to provide the required level of pain-relief with associated risk of additional adverse-effects (dependency/addiction) for the subject as well as an escalating cost of both initial treatment, and increased likelihood of dependency/addiction costs for the health care provider.

The fact that more than 1 in 10 adults experience persistent widespread body pain underlines the scale of the potential problem for the future in relation to opioid side effects, Jones G, et al. 2007. Arthritis Rheum 56: 1669. As indicated hereinbefore whilst opioid analgesics are the primary drugs of choice for treating severe pain, such as persistent widespread body pain, their analgesic effects "wear-off" after repeated exposure i.e. the patient develops tolerance: Stannard C. 2011. Curr Opin Supp Palliat Care 5 150; Furlan A, ef al. 2006. CMAJ 174: 1589; Noble M, et al. 2010. Cochrane Database Syst Rev CD006605; Eisenberg E, McNicol E, Carr D. 2006. Cochrane Database Syst Rev CD006146. Patients become resistant to opioid pain relief through adaptive processes of tolerance, which leads to a requirement for escalating levels of opioid dosing (either by higher dose levels and/or by increased dose frequency) or the hazardous practive of opioid rotation (Agarin T, Trescot AM, Agarin A, Lesanics D, Decastro C. 2015. Pain Physician. 18:E307).

Associated with such patient resistance to opioid-based analgesia are an increased potential for misuse, addiction as well as significant side-effects including respiratory depression. Mu opioid receptors are responsible for the beneficial and detrimental effects of opioid drugs such as morphine. Mu receptors are uniquely distributed throughout the ascending and descending pain pathways and in brain regions involved in the affective component of pain. It is well established that prolonged treatment with opioid-based drugs, leads to opioid tolerance and a series of associated debilitating side-effects including respiratory depression, which is the primary cause of death during opioid overdose. There are increasing numbers of drug deaths linked to opioid use/misure in Scotland and elsewhere in the world Baldacchino A, et al. 2010. J Psychopharm 24: 1289; Agarin T, et al. 2015. Pain Physician. 18:E307). This underlines why the search for an opioid-based treatment for pain, which lacks the adverse effect of drug tolerance remains a key target for the global pharmaceutical industry.

Despite numerous attempts to develop alternative analgesics for severe pain there are currently no drugs likely to replace opioids, which continue to provide the sole source of pain relief to numerous patients with persistent severe pain.

It is an objective of the present invention to provide an approach that mitigates the negative side-effects commonly associated with opioid drugs and in particular to provide a treatment which improves opioid analgesia and reduces analgesic tolerance. It is a particular objective of the present invention to provide a treatment for chronic pain in which analgesic tolerance is blocked or reduced.

Summary of the Invention The present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular for the mitigation of opioid analgesic tolerance.

According to a particular aspect the present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance wherein the opioid analgesic tolerance is reduced in a subject undergoing opioid-based pain treatment or wherein the development of opioid analgesic tolerance is inhibited in a subject beginning opioid-based pain treatment. According to an aspect the present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance, including reduction of opioid analgesic tolerance in a subject undergoing opioid-based pain treatment or inhibition of the development of opioid analgesic tolerance in a subject beginning opioid-based pain treatment, wherein the c- Src inhibitor is a potent c-Src inhibitor, or a potent and selective c-Src inhibitor, or a c-Src inhibitor with a K _d for c-Src of between 0.1 and 0.5, preferably between 0.1 and 0.4, more preferably between 0.15 and 0.3 nM. According to a particular embodiment the present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance in accordance with any one, or combination of one or more of the aspects as detailed herein, wherein the c-Src inhibitor is a compound of general Formula I:

I or a pharmaceutically acceptable salt thereof, wherein R ₂ , R3, R _4l Rs, N, Q, X ₂ and Z are as defined hereinafter.

According to a preferred embodiment the present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance wherein the c-Src inhibitor is a compound of general Formula l(a) as defined hereinafter, and especially wherein the c-Src inhibitor is A/-(2-chloro-6-methylphenyl)-2-[[6-[4-(2-hydroxyethyl)-1-pip erazinyl]-2-methyl-4- pyrimidinyl]amino]-5-thiazole carboxamide monohydrate, also known as dasatinib or the free-amide or an alternative pharmaceutically acceptable salt thereof.

According to a further embodiment the present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular treating opioid analgesic tolerance wherein the opioid analgesic tolerance is reversed in a subject undergoing opioid-based pain treatment and preferably wherein the c-Src inhibitor is a compound of Formula I, preferably Formula l(a), and especially wherein the c-Src inhibitor is dasatinib or the free-amide or an alternative pharmaceutically acceptable salt thereof.

According to another embodiment the present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular opioid analgesic tolerance in accordance with any one, or combination of one or more of the aspects as detailed herein, wherein the c-Src inhibitor is a compound of general Formula

II

II or a pharmaceutically acceptable salt thereof, wherein Ri, R ₂ , F¾ and X are as detailed hereinafter. According to another embodiment the present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular opioid analgesic tolerance wherein the c-Src inhibitor is a compound of general Formula I I, or a Group A compound of Formula II, and preferably is 4-amino-5-(4-chlorophenyl)-7- (dimethylethyl)pyrazolo[3,4-c pyrimidine, also known as (PP2) or a pharmaceutically acceptable salt thereof.

According to a yet further embodiment the present invention provides pharmaceutical compositions for use in accordance with any of the aspects as defined herein. According to another embodiment the present invention provides pharmaceutical compositions for use in the treatment of pain wherein the composition comprises the combination of at least one opioid analgesic and at least one c-Src inhibitor.

According to a still further embodiment the present invention provides pharmaceutical compositions for use in the treatment of pain wherein the composition comprises the combination of at least one opioid analgesic and at least one c-Src inhibitor and wherein the composition is suitable for oral administration.

These and additional aspects and embodiments of the present invention are detailed in the description hereinafter.

Description The Applicants have identified a new target protein in the pain pathway, c-Src, which when inhibited, for the first time demonstrates dramatic reductions in opioid tolerance in a mouse model. As detailed herein the Applicants have used mouse strains engineered to lack opioid receptors and/or components of opioid signalling pathways to confirm that this c-Src inhibition provides a similar level of attenuation of tolerance to that observed in mice lacking the -arrestin2 protein, known to be instrumental in morphine analgesic tolerance (Bohn L, Lefkowitz R, Gainetdinov R, Peppel K, Caron M, Lin F. 1999. Science 286: 2495). The c-Src inhibitory-based approach developed by the Applicant, has the potential for the selective stimulation of analgesia without the undesirable opioid tolerance associated with current drug therapies. As also discussed hereinafter this c-Src inhibitory-based approach has the potential to reduce undesirable side-effects of opioids, such as opioid tolerance, but without increasing their potential for addiction.

The Applicants have demonstrated that compounds that inhibit c-Src, c-Src inhibitors, inhibit the development of opioid-induced analgesic tolerance, specifically morphine analgesic tolerance. The Applicants have also demonstrated that certain c-Src inhibitors reverse opioid-induced analgesic tolerance, specifically morphine analgesic tolerance, once it has already developed. The experimental results demonstrating these effects are discussed hereinafter and are illustrated in the accompanying Figures.

Accordingly the present invention provides c-Src inhibitors for use in mitigating side- effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance, and particularly c-Src inhibitors for use in reducing opioid analgesic tolerance in a subject undergoing opioid-based pain treatment or wherein the development of opioid analgesic tolerance is inhibited in a subject beginning opioid-based pain treatment. The Applicants have demonstrated that the inhibition of a specific protein target, c-Src, reduces opioid tolerance in mice dosed with morphine. The experimental results provided herein demonstrate that the c-Src inhibitors, dasatinib and PP2 inhibit the development of morphine analgesic tolerance in mice. Importantly, the Applicants have additionally demonstrated that the c-Src inhibitor, dasatinib, reverses morphine tolerance once it has already developed. It is also proposed herein that this c-Src-inhibitor based approach would also reduce other undesirable side-effects of opioids without increasing their potential for addiction. Without wishing to be bound to any particular theory it is proposed herein that use of opioid agonists biased against c-Src activation, may provide analgesia with fewer side effects.

Accordingly the present invention provides c-Src inhibitors for use in mitigating side- effects associated with analgesic opioids including the mitigation of opioid analgesic tolerance.

The experimental results herein have for the first time provided a potential solution to the long-standing need for pain management programmes which are capable of delivering effective opioid-based analgesia, with reduction or elimination of the associated undesirable side-effects associated with analgesic opioids including: opioid-induced drug tolerance; respiratory depression, constipation, immunosuppression; hyperalgesia and the like.

Accordingly the present invention provides c-Src inhibitors for use in mitigating one or more side-effects associated with analgesic opioids wherein the side-effects are one or more of opioid-induced drug tolerance, respiratory depression, constipation, immunosuppression and/or hyperalgesia.

The present invention additionally provides a combination of a c-Src inhibitor and an opioid-based analgesic for use in the treatment of pain. c-Src INHIBITORS

Any suitable c-Src inhibitor may be used. The identification of any known compound as a suitable c-Src inhibitor is considered to be within the ordinary skill of the skilled person. The testing of whether any particular compound not previously known to be a c-SRC inhibitor can be accomplished using any one of the general methods as reported in the literature, and in particular methods detailed and referred to herein.

Exemplary c-Src inhibitors suitable for use herein are compounds of general Formula I and/or general Formula II as detailed herein.

The compounds of general Formula I are known inhibitors of protein tyrosine kinases, and especially as inhibitors of the Src- family kinases such as Lck, Fyn, Lyn, Src, Yes, Hck, Fgr and Blk. In particular, the c-Src inhibitory potential of dasatinib, a compound of Formula I, has been reported by Montani et al. (Montani D, Bergot E, Gunther S, Savale L, Bergeron A, Bourdin A, Bouvaist H, Canuet M, Pison C, Macro M, Poubeau P, Girerd B., Natali D, Guignabert C, Perros F, O'Callaghan DS, Jais X, Tubert-Bitter P, Zalcman G, Sitbon O, Simonneau G, Humbert M. Pulmonary arterial hypertension in patients treated by dasatinib. Circulation. 2012;125:2128-2137.).

The compounds of general Formula II are known inhibitors of tyrosine kinase, and in particular as Src-family tyrosine kinase inhibitors. In particular PP2, a compound of general Formula II, is known as a selective c-Src kinase inhibitor. Brandvold et al. (Brandvold KR, Steffey ME, Fox CC, Soellner MB. Development of a highly selective c- Src kinase inhibitor. ACS chemical biology. 2012;7(8): 1393-1398.) refer to the selective c-Src kinase inhibitor, PP2, as previously reported by Hanke et al. (Hanke JH, Gardner JP, Changelian PS, Brissette WH, Weringer EJ, Pollock DA, Connelly PA. Discovery of a novel, potent, and Src family-selective tyrosine kinase inhibitor. Study of Lck- and FynT- dependent T cell activation. J. Biol. Chem. 1996;271 :695-701 .

The present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance wherein the c-Src inhibitor is a compound of general Formula I:

where Q is: a 5-membered heteroaryl ring; a 6-membered heteroaryl ring; or an aryl ring; optionally substituted with one or more R1 ;

Z is : a single bond, -R15C=CH- or -(CH ₂ ) _m -, where m is 1 to 2;

X, and X2 are each hydrogen, or together form =0 or =S; R1 is : hydrogen or R6, where R6 is alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, heterocyclo, or heterocycloalkyl, each of which is unsubstituted or substituted with Z1 , Z2 and one or more (preferably, one or two) Z3, -OH, -OR6, -SH, -SR6 -C0 ₂ H, -C(0)qR6, or - 0-C(0)qR6 where q is 1 or 2, -S03H or -S(0)qR6, halo, cyano, nitro, -Z4-

NR7R8, -Z4-N(R9)-Z5-NR10R1 1 , -Z4-N(R12)-Z5-R6 or -P(0)(OR6) ₂ ;

R2 and R3 are each independently: hydrogen, R6, -Z4-R6, or -Z13-NR7R8 ; R4 and R5 : are each independently hydrogen or R6 ; are -Z4-N(R9)-Z5-NR10R 1 , -N (R9) Z4R6 ; or together with the nitrogen atom to which they are attached complete a 3- to 8- membered saturated or unsaturated heterocyclic ring which is unsubstituted or substituted with Zl, Z2 and Z3, which heterocyclic ring may optionally have fused to it a benzene ring itself unsubstituted or substituted with Zl, Z2 and Z3 ;

R7, R8, R9, R10, R1 1 and R12: are each independently hydrogen or R6; R7 and R8 may together be alkylene, alkenylene or heteroalkyl, completing a 3-to 8-membered saturated or unsaturated ring with the nitrogen atom to which they are attached, which ring is unsubstituted or substituted with Z1 , Z2 and Z3 ; or any two of R9, R10 and R1 1 may together be alkylene or alkenylene completing a 3-to 8-membered saturated or unsaturated ring together with the nitrogen atoms to which they are attached, which ring is unsubstituted or substituted with Z1 , Z2 and Z3;

R13 is: cyano, nitro; -NH ₂ , -NHOalkyl, -OH, -NHOaryl, -NHCOOalkyl, -NHCOOaryl,- NHS02alkyl, -NHS02aryl, aryl, heteroaryl, -Oalkyl, or -Oaryl ;

R14 is : nitro, -COOalkyl, or -COOaryl ;

R15 is: hydrogen, alkyl, aryl, arylalkyl, or cycloalkyl ;

Z1 , Z2 and Z3 are each independently: hydrogen or Z6, where Z6 is alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylalkyl, cycloalkenyl, cycloalkenylalkyl, aryl, aralkyl, alkylaryl, cycloalkylaryl, heterocyclo, or heterocycloalkyl ; a group (i) which is itself substituted by one or more of the same or different groups (i); or a group (i) or (ii) which is substituted by one or more of the following groups of the definition of Z1 , Z2 and Z3 ; -OH, -OZ6, - SH, -SZ6, -C(0)qH, -C(0)qZ6, -S0 ₃ H, -S03H,-S(0)qZ6, S(0)qN(Z9)Z6, halo, cyano, nitro, -Z4-NZ7Z8, -Z4-N(Z9)-Z5-NZ7Z8, -Z4-N(Z10)-Z5-Z6, -Z4-N(Z10)-Z5-H, oxo, -O- C(0)-Z6; or any two of ZI, Z2, and Z3 may together be alkylene or alkenylene completing a 3-to 8-membered saturated or unsaturated ring together with the atoms to which they are attached; or any two of Z1 , Z2, and Z3 may together be -0-(CH2)r-0-, where r is 1 to 5, completing a 4-to 8-membered saturated or unsaturated ring together with the atoms to which they are attached;

Z4 and Z5 are each independently: a single bond, -Z11-S(0)q-Z12-, -Z11-C(0)-Z12-, - Z11-C(S)-Z12-, -Z11-0-Z12-, -Z11-S-Z12-, -Z11-0-C(0)-Z12-, or -Z11-C(0)-0-Z12-; Z7, Z8, Z9 and Z10 : are each independently hydrogen or Z6 ; or Z7 and Z8, or Z6 and Z10, may together be alkylene or alkenylene, completing a 3-to 8-membered saturated or unsaturated ring together with the atoms to which they are attached, which ring is unsubstituted or substituted with ZI, Z2 and Z3 ; or Z7 or Z8, together with Z9, may be alkylene or alkenylene completing a 3-to 8-membered saturated or unsaturated ring together with the nitrogen atoms to which they are attached, which ring is unsubstituted or substituted with Z1 , Z2 and Z3 ;

Z11 and Z12 are each independently; a single bond, alkylene, alkenylene, or alkynylene; and;

Z13 is; a single bond, -Z11-S(0)q-Z12-, -Z11-C(0)-Z12-, -Z11-C(S)-Z12-, -Z11-0-Z12-, - Z11-S-Z12-, -Z11-0-C(0)-Z12-, -Z11-C(0)-0-Z12-, -C(NR13)-, -C (CHR14)-, or -C (C (R14)2)-; Within compounds of Formula I:

The terms "alk" or "alkyl" refer to straight or branched chain hydrocarbon groups having 1 to 12 carbon atoms, preferably 1 to 8 carbon atoms. The expression"lower alkyl'Yefers to alkyl groups of 1 to 4 carbon atoms;

The term "alkenyl" refers to straight or branched chain hydrocarbon groups of 2 to 10, preferably 2 to 4, carbon atoms having at least one double bond. Where an alkenyl group is bonded to a nitrogen atom, it is preferred that such group not be bonded directly through a carbon bearing a double bond;

The term "alkynyl" refers to straight or branched chain hydrocarbon groups of 2 to 10, preferably 2 to 4, carbon atoms having at least one triple bond. Where an alkynyl group is bonded to a nitrogen atom, it is preferred that such group not be bonded directly through a carbon bearing a triple bond;

The term "alkylene" refers to a straight chain bridge of 1 to 5 carbon atoms connected by single bonds (e. g.,- (CH ₂ ) x- wherein x is 1 to 5), which may be substituted with 1 to 3 lower alkyl groups;

The term "alkenylene" refers to a straight chain bridge of 2 to 5 carbon atoms having one or two double bonds that is connected by single bonds and may be substituted with 1 to 3 lower alkyl groups. Exemplary alkenylene groups are-CH=CH-CH=CH-,-CH ₂ -CH=CH-, -CH ₂ -CH=CH-CH ₂ -,-C(CH ₃ ) ₂ CH=CH- and-CH (C ₂ H ₅ )-CH=CH-;

The term "alkynylene" refers to a straight chain bridge of 2 to 5 carbon atoms that has a triple bond therein, is connected by single bonds, and may be substituted with 1 to 3 lower alkyl groups. Exemplary alkynylene groups are -C=C-, -CH ₂ -C=C-, -CH(CH ₃ )-C=C- , and -C= C-CH(C ₂ H ₅ )CH ₂ -;

The terms "ar" or "aryl" refer to aromatic cyclic groups (for example 6 membered monocyclic, 10 membered bicyclic or 14 membered tricyclic ring systems) which contain 6 to 14 carbon atoms. Exemplary aryl groups include phenyl, naphthyl, biphenyl and anthracene;

The terms "cycloalkyl" and "cycloalkenyl "refer to cyclic hydrocarbon groups of 3 to 12 carbon atoms;

The terms "halogen" and "halo" refer to fluorine, chlorine, bromine and iodine; The term "unsaturated ring" includes partially unsaturated and aromatic rings; The terms "heterocycle", "heterocyclic" or "heterocyclo" refer to fully saturated or unsaturated, including non-aromatic (i. e."heterocycloalkyl) and aromatic (i. e."heteroaryl") cyclic groups, for example, 4 to 7 membered monocyclic, 7 to 11 membered bicyclic, or 10 to 15 membered tricyclic ring systems, which have at least one heteroatom in at least one carbon atom-containing ring. Each ring of the heterocyclic group containing a heteroatom may have 1 ,2, 3 or 4 heteroatoms selected from nitrogen atoms, oxygen atoms and/or sulfur atoms, where the nitrogen and sulfur heteroatoms may optionally be oxidized and the nitrogen heteroatoms may optionally be quaternized. The heterocyclic group may be attached at any heteroatom or carbon atom of the ring or ring system.

Exemplary monocyclic heterocyclic groups for compounds of Formula I include pyrrolidinyl, pyrrolyl, pyrazolyl, oxetanyl, pyrazolinyl, imidazolyl, imidazolinyl, imidazolidinyl, oxazolyl, oxazolidinyl, isoxazolinyl, isoxazolyl, thiazolyl, thiadiazolyl, thiazolidinyl, isothiazolyl, isothiazolidinyl, furyl, tetrahydrofuryl, thienyl, oxadiazolyl, piperidinyl, piperazinyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolodinyl, 2- oxoazepinyl, azepinyl, 4-piperidonyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, tetrahydropyranyl, morpholinyl, thiamorpholinyl, thiamorpholinyl sulfoxide, thiamorpholinyl sulfone, 1 ,3-dioxolane and tetrahydro-1 , 1-dioxothienyl, triazolyl, triazinyl, and the like.

Exemplary bicyclic heterocyclic groups for compounds of Formula I include indolyl, benzothiazolyl, benzoxazolyl, benzodioxolyl, benzothienyl, quinuclidinyl, quinolinyl, tetra- hydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuryl, chromonyl, coumarinyl, benzopyranyl, cinnolinyl, quinoxalinyl, indazolyl, pyrrolopyridyl, furopyridinyl (such as furo [2, 3-c] pyridinyl, furo [3, 2-b] pyridinyl] or furo [2, 3-b] pyridinyl), dihydroisoindolyl, dihydroquinazolinyl (such as 3,4-dihydro-4-oxo-quinazolinyl), tetrahydroquinolinyl and the like.

Exemplary tricyclic heterocyclic groups for compounds of Formula I include carbazolyl, benzidolyl, phenanthrolinyl, acridinyl, phenanthridinyl, xanthenyl and the like, and the term "heteroaryl" refers to aromatic heterocyclic groups.

Exemplary heteroaryl groups for compounds of Formula I include pyrrolyl, pyrazolyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furyl, thienyl, oxadiazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, triazolyl, triazinyl, and the like. In compounds of Formula I, where q is 1 or 2, "-C(0)qH" denotes -C(0)-H or -C(0)-OH ; "-C(0)qR6" or "-C(0)qZs" denote, respectively, -C(0)-R6 or -C(0)-OR6, or -C(0)-Z6 or - C(0)-OZ6 ; "-0-C(0)qR6" or "-0-C(0)qZ6" denote, respectively, -0-C(0)-R6 or- O- C(0)-OR6, or -0-C(0)-Z6 or -0-C(0)-OZ6 ; and "S(0)qR6 or "-S(0)qZ6" denote, respectively, -SO-R6 or -S02-R6, or-SO-Z6 or-S02-Z6.

Groups and substituents thereof are chosen to provide stable moieties and compounds throughout. The present invention further provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance wherein the c-Src inhibitor is a compound of general Formula 1(a) and salts thereof:

1(a)

wherein n is 1 or 2; A is selected from carbon and nitrogen; B is selected from nitrogen, oxygen and sulfur; the five membered ring comprising A and B is aromatic; X3 is oxygen or sulfur; and Rl, R2, R3, R4 and R5 are as described above.

There is particularly provided herein c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance wherein the c-Src inhibitor is a compound of general Formula l(a), and especially the use of A/-(2-chloro-6-methylphenyl)-2-[[6-[4-(2-hydroxyethyl)-1-pip erazinyl]-2-methyl-4- pyrimidinyl]amino]-5-thiazole carboxamide monohydrate, also known as dasatinib or the free-amide or an alternative pharmaceutically acceptable salt thereof.

There is also provided herein c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance wherein the opioid analgesic tolerance is reversed in a subject undergoing opioid-based pain treatment and preferably wherein the c-Src inhibitor is a compound of Formula I, preferably wherein the c-Src inhibitor is a compound of Formula l(a), and especially wherein the c-Src inhibitor is dasatinib or the free-amide or an alternative pharmaceutically acceptable salt thereof.

The present invention also provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance wherein the c-Src inhibitor is a compound of general Formula II, and pharmaceutically-acceptable salts thereof wherein; X is C(R4) or N;

R1 is phenyl, mono-or di-halophenyl, mono-or di-alkoxy(C1 -C4)phenyl, mono- or di- alkyl(C1 -C4)phenyl, perhaloalkyl(C1 -C4)phenyl or nitrophenyl or said preceding R1 groups mono-substituted on alkyl(C1 -C4) or R1 (C1 -C6)alkyl is pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, furyl or thienyl;

R2 is phenyl, mono-or di-halophenyl, mono-or di-alkoxy(C1 -C4)phenyl, mono- or di- alkyl(C1 -C4)phenyl, perhaloalkyl(C1 -C4)phenyl or nitrophenyl or said preceding R2 groups mono-substituted on alkyl(C1-C4) or R2 is H, alkyl(C1-C6), cycloalkyl(C1-C7), pyridyl, halobenzoyl, alkoxy(C1-C4)benzoyl, alkyl(C1-C4)benzoyl, perhaloalkyl(C1- C4)benzoyl, nitrobenzoyl, naphthyl, pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, furyl or thienyl;

R3 is H, alkyl(C1-C4), morpholinoalkyl(C1-C4), carboxyalkyl(C1-C3) or alkoxy(C1- C4)carbonylalkyl(C1-C3); and

R4 is phenyl, halophenyl, alkoxy(C1-C4)phenyl, alkyl(C1-C4)phenyl, perhaloalkyl(C1- C4)phenyl or said R, groups mono-substituted on alkyl(C1-C4) or R4 is cyano, H, halo, alkyl(C1-C6), alkoxy(C1-C4)carbonyl, alkanoyl(C1-C4), carbamoyl, or alkyl(C1- C4)carbamoyl.

Within compounds of Formula II; halo is chloro, bromo, iodo, or fluoro and alkyl is a straight chain or branched saturated hydrocarbon. The present invention provides c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance wherein the c-Src inhibitor is a Group A compound of general Formula II wherein; R1 is alkyl(C1 -C4)phenyl or chlorophenyl; and

R2 is t-butyl or cyclohexyl; preferably wherein; R1 is chlorophenyl; and

R2 is cyclohexyl; or

R1 is chlorophenyl; and

R2 is t-butyl; or

R1 is 4-methylphenyl; and

R2 is cyclohexyl; or

R1 is 4-methylphenyl; and

R2 is t-butyl.

There is also provided herein c-Src inhibitors for use in mitigating side-effects associated with analgesic opioids, and in particular mitigating opioid analgesic tolerance wherein the c-Src inhibitor is a compound of general Formula II, is preferably a Group A compound, and in particular wherein the c-Src inhibitor is 4-amino-5-(4-chlorophenyl)-7- (dimethylethyl)pyrazolo[3,4-c ]pyrimidine, also known as PP2 or a pharmaceutically acceptable salt thereof.

As used herein, the term "pharmaceutically acceptable salt" refers to those salts of the c- Src inhibitor compounds for use in accordance with the present invention which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art.

Pharmaceutically acceptable acid addition salts of certain compounds of the formula (I) or formula (II) may be readily prepared either in situ during the final isolation and purification of c-Src compounds suitable for use in accordance with the invention, or they may be prepared in a conventional manner by mixing together solutions of a suitable compound, such as a compound of Formula I or II, and the desired acid, as appropriate. For example, a solution of a free base may be treated with the appropriate acid, either neat or in a suitable solvent, and the resulting salt isolated either by filtration or by evaporation under reduced pressure of the reaction solvent. For a review on suitable salts, see "Handbook of Pharmaceutical Salts: Properties Selection, and Use" by Stahl and Wermuth (Wiley- VCH, Weinheim, Germany, 2002). Examples of pharmaceutically acceptable salts suitable for use herein include, but are not limited to, non-toxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Examples of suitable acid addition salts for use as detailed herein include: fumarate, acetate, adipate, aspartate, alginate, ascorbate, benzoate, besylate (benzenesulfonate), bicarbonate/carbonate, bisulphate/sulphate, borate, butyrate, camphorate, camsylate (camphorsulfonate), citrate, cyclamate, cyclopentanepropionate , dodecylsulfate, edisylate, esylate (ethanesulfonate),, formate, fumarate, gluceptate, gluconate, digluconate, glucuronate, glucoheptonate, glycerophosphate, hexafluorophosphate, hemisulfate, heptanoate, hexanoate, hibenzate, hydrochloride/chloride, hydrobromide/bromide, hydroiodide/iodide, 2- hydroxy-ethanesulfonate, isethionate, lactate, lactobionate, laurate, lauryl sulfate, malate, maleate, malonate, mesylate (methanesulfonate), methylsulphate, naphthylate, 2-napsylate (2-naphthalenesulfonate), nicotinate, nitrate, oleate, orotate, oxalate, palmitate, pamoate, pectinate, persulfate, 3- phenylpropionate, picrate, phosphate/hydrogen phosphate/dihydrogen phosphate, pivalate, propionate, pyroglutamate, saccharate, stearate, succinate, sulfate, tannate, tartrate, thiocyanate, p-tosylate(p-toluenesulfonate), trifluoroacetate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulphonate.

The c-Src inhibitory activity (IC ₅₀ ) of any particular compound, including compounds of general Formula I or II, can be determined using the following method: 96-well assay plates are coated with enolase (100 μΙ) (Sigma Inc.) for 1 h at 37 °C. and then blocked with 300 μΙ 0.5% BSA. A cell lysate containing the kinase of interest is prepared. The kinase of interest is produced by the baculovirus expression system in cells. The cells are lysed in 0.5% NP-40, 0.02M Tris, 150 mM NaCI and 1 % aprotinin. The kinase is immunoprecipitated from the lysate with the appropriate antibody and subsequent incubation with protein-A coated Sepharose (Sigma, Inc., St. Louis, Mo.) beads. The beads are washed four times in a 1 :10 bead to wash buffer volume ratio. They are resuspended to their final volume in kinase buffer and then aliquoted with an Eppendorf repeater pipet into appropriate assay wells. (Kinase buffer=25 mM HEPES, 3 mM MnC12, 0.1 mM Na3 V0 ₄ ). The test compound (of Formula I or II) and gamma- 32P-ATP are then added to assay wells. After the final 20 min incubation, the assay wells are washed with an 1 mM ATP/50 mM EDTA buffer in two 9 sec wash cycles on a Microcell 96 Harvestor (Skatron Instruments, Sterling, Va.).

Scintillant is added to each well and the plate is read on a Micro-Beta Wallac, Inc. (Gaithersburg, Md.) reader. Generally, only alternate rows on an assay plate are used due to the inability of the crosstalk correction program of the Micro-Beta to correct for the high energy beta in adjacent wells. Samples are run in triplicate, averaged and then plotted to determine an IC ₅₀ .

PROCESS FOR PREPARATION OF c-Src INHIBITORS As will be readily appreciated compounds of Formula (I), including the named compounds as discussed hereinbefore and in particular dasatinib can be prepared in accordance with any of the published methods. In particular the general methods of Schemes A through E, and Schemes I through XI as detailed in published international patent application WO2004/085388 and as provided for the compounds of Examples 1 to 580 therein and as incorporated herein by reference can be used to prepare compounds of Formula (I) as detailed herein. A copy of WO2004/085388 is provided herewith as Annex I.

Further methods for the preparation of compounds of Formula (I) can be prepared in accordance with the methods detailed in published international patent applications WO2005/077945.

As will be readily appreciated compounds of Formula (II), including the named compounds as discussed hereinbefore and in particular PP2 can be prepared in accordance with any of the published methods. In particular the general methods of reaction schemes I to III as detailed in US patent US 5,593,997 and as provided for the compounds of Examples 1 to 52 therein and, especially Example 31 , 4-amino-5-(4- chlorophenyl)-7-^butyl-pyrazolo-[3,4-c ]-pyr!mid!ne, also known as 4-amino-5-(4- chlorophenyl)-7-(dimethylethyl)pyrazolo[3,4-d]pyrimidine or PP2 and as incorporated herein by reference can be used to prepare compounds of Formula (II) as detailed herein. A copy of US 5,593,997 is provided herewith as Annex II.

Further methods for the preparation of compounds of Formula (I) can be prepared in accordance with the methods detailed in published international patent applications WO2005/077945. OPIOIDS

Opioid drugs act through mu, delta and kappa receptors; these are commonly referred to as MOPrs, DOPrs and KOPrs respectively, Dietis N, Rowbotham D, Lambert D. 2011. Br J Anaesth 107: 8. Opioid receptor activation inhibits adenylyl cyclase and voltage-activated Ca ²⁺ channels (VACCs) whilst activating inwardly rectifying K ⁺ channels. The coupling of opioid receptors to these inhibitory and activating effectors occurs through G-proteins, which dissociate into Gai/o and βγ subunits of the G- proteins. As reviewed by Hales TG, 2011. Br J Anaesth 107: 653, the inhibitory action of the βγ G-protein subunits on presynaptic VACCs reduces excitatory neurotransmission in the pain pathway. MOPrs throughout the pain pathway (from primary afferent nociceptive neurones, through the spinal cord to thalamic and cortical brain nuclei) mediate opioid analgesia. MOPrs can combine with DOPrs to form MOPr/DOPr heteromers. Whilst not wishing to be bound to any particular theory, it has been proposed that MOPr/DOPr heteromers mediate the actions of analgesic opioids on nociceptive neurones (e.g. Walwyn W, John S, Maga M, Evans C, and Hales TG. 2009. Mol Pharm 76: 134), where the need for DOPrs for the action of drugs that work through MOPrs suggests that the receptors form signalling complexes such as heteromers. MOPrs are also located in the ventral tegmental area (VTA), a brain nucleus within the reward pathway that mediates the addictive properties of opioids (Johnson S, North R. 1992. J Neurosci 12: 483 and Matsui A, Williams J., 2011. J Neurosci 31 : 17729).

As previously reported, (Matthes, H. W. er a/. 1996. Nature 383: 819), MOPrs are required for opioid analgesia. This is confirmed by the experimental results as discussed hereinafter and as illustrated in Figure 2A. Prolonged activation of MOPrs leads to tolerance, a process that involves a reduction in the availability of receptors on the cell surface through endocytosis (Williams J.T., et al. 2013. Pharmacol Rev 65: 223).

The Applicants have demonstrated the importance of receptor number via the experiments discussed hereinafter where it is clearly shown that mice lacking one allele encoding the MOPr, and referred to herein as heterozygous MOPr+/- mice, exhibit more rapid morphine tolerance than is seen in wild type (WT) mice containing both MOPr alleles. These results are illustrated in Figure 2B. Heterozygous MOPr+/- mice lacking one allele have half the number of MOPrs (proteins) when compared to the strain of WT mice used in the experimental results discussed hereinafter (Matthes, H. W. et al. 1996. Nature 383: 819).

MOPr activation leads to phosphorylation by G protein coupled receptor (GPCR) kinases (GRKs) and recruitment of p-arrestin2 ( -arr2) triggering receptor endocytosis, a process that is instrumental in the development of opioid-drug induced tolerance. Mice genetically engineered to lack -arr2 ( -arr2-/-) have been shown to develop negligible tolerance to opioid analgesia (Bohn L, Lefkowitz R, Gainetdinov R, Peppel K, Caron M, Lin F. 1999. Science 286: 2495). The Applicants have confirmed this observation in -arr2-/- mice. The results of these experiments are discussed hereinafter and are illustrated in Figure 3A. In addition to a deficit in morphine analgesic tolerance, -arr2-/- mice are also known to exhibit reduced respiratory depression and constipation (Raehal KM, Walker JK, Bohn LM. 2005. J Pharmacol Exp Ther. 314:1 195). As discussed hereinbefore, respiratory depression and constipation are also undesirable side-effects of opioid-based drug pain management therapies.

The sum of knowledge to date has led to a search for new opioid-based drugs that are biased agonists at the MOPr, which preferentially activate the G protein pathway without recruiting -arr2 (Raehal KM, Walker JKL, Bohn LM. 2005). J Pharmacol Exp Ther 314: 1 195.

The Applicants propose an alternative approach, in which components of the -arr2 signalling process are inhibited, in order to enable currently available opioid analgesics to provide persistent and consistent levels of analgesia without the undesirable side- effect of drug-induced tolerance to analgesia, and potentially without additional side- effects of opioids including respiratory depression and/or constipation. The Applicants' research, carrying out experiments and generation of results, suggests that a specific target protein, c-Src, is recruited to MOPrs by -arr2 (Walwyn W, Evans CJ, Hales TG. 2007. J Neurosci. 27: 5092). Whilst not wishing to be bound to any particular theory it is proposed herein that c-Src mediates the -arr2-dependent negative effects of opioid analgesics including (but perhaps not limited to) analgesic tolerance.

Desirable properties of c-Src inhibitors for use in accordance with the present invention include: high bioavailability and oral activity.

SRC FAMILY NON-RECEPTOR TYROSINE KINASES

The tyrosine kinase system is a very complicated system that may provide multiple targets to modify the side effects of opioid drugs. The present invention relates to the use of inhibitors of a particular member of the Src family of kinases, c-Src, for the mitigation of opioid analgesic tolerance. Src family kinases in general are non-receptor tyrosine kinase inhibitors. As discussed hereinafter, the Applicant has demonstrated a role for the tyrosine kinase c-Src, a member of the Src family of kinases, in the development of tolerance to the analgesic effects of morphine. Importantly, our experimental results indicate that inhibiting c-Src does not affect the rewarding properties of the opioid drug tested (morphine). In addition, our results have demonstrated that inhibition of c-Src does not cause basal analgesia in mice or constitutive receptor activity like the removal of BAR2. The results provided herein confirm that inhibition of c-Src is a potential therapeutic target for the development of medicaments for the reduction of side effects associated with analgesig opioids and in particular for the mitigation of or reduction of opioid tolerance without affecting reward.

Src family kinase (SFK) is a family of non-receptor tyrosine kinases with several members. These kinases are expressed at variable levels in different tissue types. There are 11 tyrosine kinases that are currently recognised to be part of the SFK family, including c-Src, Yes, Fyn, Fgr, Yrk, Lyn, Blk, Hck, and Lck. In the literature the nomenclature c-Src and Src are interchangeably used to refer to the c-Src tyrosine kinase within the SFK family. For the avoidance of doubt the term an Src inhibitor as referred to herein means a compound which inhibits c-Src and optionally one or more members of the Src family kinase member. In particular, the term c-Src inhibitor as referred to herein means a compound which is an inhibitor of c-Src, and is preferably a potent and/or potent and selective inhibitor of c-Src as defined hereinbefore. Within the SFK there are subfamilies, with Src, Yes, Fyn, and Fgr, forming the SrcA subfamily, Lck, Hck, BIk, and Lyn in the SrcB subfamily, and Frk in its own subfamily. Frk has homologs in invertebrates such as flies and worms, whilst Src homologs exist in organisms as diverse as unicellular choanoflagellates, The SrcA and SrcB subfamilies are specific to vertebrates

The expression of these Src family members (SFKs) are not the same throughout all tissues and cell types. C-Src, Fyn and Yes are expressed ubiquitously in all cell types while the others are generally found in hematopoietic cells. Furthermore, of which c-Src, Fyn, Yes, Lck and Lyn are expressed at a high level in brain tissue (Keenan et al., 2015, FEBS Letters, 589, 1995-2000).

The Src family kinases (SFKs) are structurally closely related and share the same regulatory domains. Tyrosine kinases of Src family members contain the same typical structure: myristoylated terminus, a region of positively charged residues, a short region with low sequence homology, SH3 and SH2 domains, a tyrosine kinase domain, and a short carboxy-terminal tail. There are two important regulatory tyrosine phosphorylation sites. It is possible to repress kinase activity by phosphorylation of Tyr-527 in the carboxy-terminal tail of Src by the NRTK Csk. By the experiment of v-Src, an oncogenic variant of Src, the importance of this phosphorylation site was confirmed. This oncogenic v-Src is a product of the Rous sarcoma virus and as a result of an carboxy-terminal truncation, v-Src lacks the negative regulatory site Tyr-527 leading this enzyme to be constitutively active that in turn causes uncontrolled growth of infected cells. Moreover, substitution of this tyrosine with phenylalanine in c-Src results in activation. A second regulatory phosphorylation site in Src is Tyr-416. This is an autophosphorylation site in the activation loop. It was found that a phosphorylation of Tyr-416 and Tyr-416 can suppressing the transforming ability of the activating Tyr-527→Phe mutation by Tyr- 416→Phe mutation leads to maximal stimulation of kinase activity.

Both the SH2 and SH3 domains are important for a negative regulation of Src activity. Mutations in the SH2 and SH3 domains that disrupt binding of phosphotyrosine lead to activation of kinase activity. As indicated hereinbefore Src family kinases (SRKs) were initially described in processes relating to cell proliferation and differentiation but they are now known to be widely expressed throughout the central nervous system in varying levels and involved in many different cellular processes (Salter and Kalia, 2004, Nature reviews. Neuroscience, 5,315-28). Neurones in particular express two different splice variants of c-Src that are known as N-Src (N1 and N2) as they have only been identified in neuronal cells (Keenan et al., 2015 as above). Their role in intracellular signalling appears to be complex. They can be directly activated by GPCRs, this is thought to occur via either the Ga or Θβγ subunits with differing receptor systems favouring different subunit linkages (Luttrell and Luttrell, 2004, Oncogene, 23, 7969-78). They are also involved in the activation of intracellular signalling processes and pathways through the formation of signalling complexes with BAR2 and GRK2. It has also been suggested they are involved in opioid receptor phosphorylation (Zhang ef al., 2009, The Journal of biological chemictry, 284, 1990-2000). c-Src has been identified in proximity to synaptic vesicles and it has been demonstrated that it will bind neuronal vesicular proteins including dynamin, a-adaptin and synapsin but does not directly phosphorylate these proteins suggesting that c-Src is involved in membrane trafficking in neuronal cells (Foster-Barber and Bishop, 1998, Proceedings of the National Academy of Sciences of the United States of America, 95, 4673-7). BAR2 not only mediates receptor desensitisation and internalisation but also the recruitment of c-Src following agonist binding. When BAR2 is bound to a GPCR it can provide a binding site for c-Src with the result that c-Src is part of a GPCR signalling complex with BAR2 (Luttrell and Luttrell, 2004 as above).

There are a number of nonreceptor tyrosine kinase inhibitors that are in clinical use for the treatment of malignancy. As detailed hereinbefore, Dasatinib is a c-Src inhibitor, and it is used clinically to treat leukaemia, it has the ability to cross the blood brain barrier without modification (Lagas et al., 2009, Clinical cancer research : an official journal of the American Association for Cancer Research, 15, 2344-15, and Porkka et al., 2008, Blood, 1 12,1005-12). Dasatinib is a potent c-Src inhibitor that is normally administered orally to patients despite a low oral bioavailability. It has a K d for c-Src of 0.21 nM but it has also been suggested to be able to target PDGFR with a K d of 0.63 nM (Karaman ef al., 2008, Nature biotechnology, 26, 127-32).

As detailed hereinbefore the tyrosine kinase inhibitor, 3-(4-chlorophenyl) 1 -(1 ,1 - dimethylethyl)-1 H- pyrazolo[3,4-d]pyrimidin-4-amine (PP2), is a specific inhibitor of c-Src. As reported by Bain et al., 2007, The Biochemical Journal, 408, 297-315, and Uitdehaag ef al., 2012, British journal of pharmacology, 166, 858-76). PP2 has been demonstrated in WT DRG neurones to replicate the enhanced constitutive MOP receptor inhibitory coupling to VACCs that occurs in BAR2-/- DRG neurones (Walwyn ef al., 2007, The Journal of neuroscience : the official journal of the Society for Neuroscience, 27, 5092- 104). This suggests that tyrosine kinase mediated phosphorylation may attenuate opioid analgesia and be a target to ameliorate opioid induced analgesic tolerance.

A study in rats suggested that the tyrosine kinase inhibitor, imatinib, abolished morphine analgesic tolerance (Wang ef al., 2012, Nature medicine, 18, 385-7). In this study imatinib had been modified to allow it to cross the BBB as it is not able to do this when administered in its standard formulation. The tyrosine kinase target of imitanib is thought to be PDGFR for which it has a dissociation constant (K d ) of 14 nM (Karaman ef al., 2008 as above). Imitanib can bind to c-Src but with a much lower affinity(K d >10 μΜ) compared to its other kinase targets (Seeliger ef al., 2007, Structure, 15, 299-31 1 ). However c-Src substrates have also been implicated in PDGFR signalling (Amanchy ef al., 2009, Mol Oncol, 3, 439-50). There have been a number of different mechanisms for this suggested, with Src implicated in signalling upstream of the PDGFR (Tanimoto ef al., 2002, The Journal of biological chemistry, 277, 42997-43001 ) and also as an intermediate in downstream receptor signalling (Barone and Courtneidge, 1995, Nature, 378, 509-12). Together this suggests that the reduction in tolerance observed in the Wang et al (2012) study discussed hereinbefore may be mediated through c-Src inhibition of PDGFR signalling rather than a direct receptor effect. The effects of c-Src inhibition within the pain pathway

The Applicant has used two tyrosine kinase inhibitors to investigate the role of c-Src in opioid receptor signalling and the development of the side effects associated with the use of opioid drugs. PP2 is a selective inhibitor of c-Src that has been used predominately in vitro. It is unclear whether PP2 administered systemically crosses the BBB, however the benefit of using this drug is that it has an inactive analogue, PP3, that can be used as a matched control. The second drug that we have used is dasatinib, this a clinically licensed drug that is used for the treatment of leukaemia. It has been extensively tested in vivo and does cross the blood brain barrier (BBB). As dasatinib is not a selective inhibitor of c-Src an also affects a number of other tyrosine kinases and their receptors including PDGFRp. As detailed hereinafter the Applicant have shown that dasatinib prevented the development of tolerance in WT mice. Furthermore, dasatinib, PP2 (but not PP3) has also been shown by the Applicant to inhibit the development of morphine tolerance in MOP+/- mice. MOP+/- mice are a good model to study tolerance development as they are significantly tolerant to the analgesic effects of morphine after 5 days of treatment. Dasatinib also reversed morphine tolerance in MOP+/- mice. This is very exciting as it suggests that tolerance is not an irreversible process only recoverable on stopping morphine, but instead tyrosine kinase related signalling is involved in its maintenance. This suggests that there may be different processes involved and that dasatinib may be more effective as an adjunct approach to mitigating tolerance. The Applicant has also investigated whether the activation of c-Src by morphine requires MOP receptors, DOP receptors and/or BAR2 by assaying phospho-Src (the activated form of c-Src) in WT, MOP-/-, DOP-/- and BAR2-/- mice following morphine treatment. The effects of c-Src inhibition on the psychomotor effects of morphine

As also discussed hereinafter the Applicant has found that there were no significant alterations in reinforcement or locomotor activation when dasatinib was administered either alone or together with morphine to WT mice. PP2 directly applied to the VTA neurones of WT mice reduced the inhibition of sIPSC frequency by morphine, which resembled the reduced inhibitory effect of morphine in BAR2-/- neurones. This was unexpected given the behavioural findings. We also investigated the effects of a MEK inhibitor (SL327) on sIPSC frequency. We have demonstrated that MEK inhibition does not affect the ability of morphine to inhibit sIPSC frequency within the VTA. Taken together these data imply that MEK-ERK signalling is not involved in the vesicular release of GABA from presynaptic neurones within the VTA but that c-Src is involved in this process. Without wishing to be bound to any particular theory it is proposed herein that MOP receptors signal through BAR2 (perhaps with DOP receptors) to c-Src in which regulates the trafficking of GABAergic vesicles within the VTA.

The results herein have implicated c-Src in the development of morphine tolerance. It would be interesting to pursue a health informatics approach to investigate whether differences in opioid prescribing are apparent in patients receiving dasatinib and opioid drugs compared to those that are receiving opioid drugs alone. Furthermore, our results suggest that if patients received dasatinib alongside opioid drugs they may not experience tolerance to their analgesic effects and therefore would not require the same levels of dose escalation which at present it likely to occur in cancer patients. Our results also suggest that c-Src participates in the actions of morphine in analgesia and also within the VTA. The effects of inhibiting c-Src are similar to those observed in DOP-/- and BAR2-/- mice, in that there is a demonstrable reduction in analgesic tolerance. When PP2 is directly applied to WT VTA neurones the ability of morphine to inhibit sIPSC frequency resembles that within the BAR2-/- neurones. Inhibition of c-Src does not appear to affect locomotor activation produced by morphine or to alter morphine CPP. We have also demonstrated in SW620 cells that dasatinib and PP2 inhibit the phosphorylation of c-Src.

As demonstrated by the experimental results provided and discussed in detail herein the Applicant has found that dasatinib prevented the development of tolerance in WT mice. Furthermore, the Applicant has also now demonstrated that dasatinib, PP2 (but not PP3) inhibited the development of morphine tolerance in MOP+/- mice. The Applicant would propose that MOP+/- mice are a good model to study tolerance development because they have been shown to be significantly tolerant to the analgesic effects of morphine after 5 days of treatment. The Applicant has also shown that dasatinib also reversed morphine tolerance in MOP+/- mice. Without being bound to any particular theory the Applicant proposes that these preliminary reveral results suggest that tolerance is not an irreversible process only recoverable on stopping morphine, but rather that tyrosine kinase related signalling may be/is involved in its maintenance. This is the first time that the reversal of the development of existing tolerance has been shown.

Without being bound to any particular theory the Applicant proposes that opioid receptors in the pain and reward pathways differ in their BAR mediated signalling mechanisms. To investigate this the Applicant has investigated whether the BAR2/c-Src system is differentially involved in opioid signalling in nociceptive pain and reward. To do this the Applicant has utilised mice that lack MOP receptors, DOP receptors and BAR2. We will also study the effects of morphine administration on the behaviour of a mouse that lacks both BAR2 and DOP receptors (BAR2-/-//DOP-/-). For all of these mouse models the Applicant has investigated the effects of these genetic manipulations on basal analgesia, analgesic tolerance and the development of morphine preference.

DEFINITIONS

A c-Src inhibitor as defined herein means a compound which inhibits c-Src and optionally one or more members of the Src family kinase member. In particular, the term c-Src inhibitor as referred to herein means a compound which is an inhibitor of c-Src, and is preferably a potent, or a potent and selective inhibitor of c-Src as defined hereinbefore. Where the potency and/or selectivity of any particular c-Src inhibitor for use in accordance with the present invention is not immediately available to the skilled person, then suitable methods for the provision of such information would be known to, would be understood by and could be readily carried out by a person skilled in the art without undue burden. In addition to the methods detailed herein, Kd values can be readily determined using the methodology provided by Hulme, E. C. and Trevethick, M. A. (2010), Ligand binding assays at equilibrium: validation and interpretation. British Journal of Pharmacology, 161 : 1219-1237.

Drug tolerance as defined herein means, opioid induced analgesic tolerance. Drug tolerance is the process by which a subject taking a drug for a prolonged period requires an increased amount of medication (dose) to provide an equivalent level of pain-relief as provided by the originally prescribed dose-level (starting dose) i.e. escalation of dose- level and/or dose-frequency over time.

Mitigation of a side-effect associated with opioid analgesia as defined herein means, reduction of, elimination of, prevention of, or delayed-on set of side-effects. For the avoidance of doubt undesirable side-effects associated with analgesic opioids as defined herein include: opioid-induced drug tolerance; respiratory depression, constipation, immunosuppression; hyperalgesia and the like.

Mitigation of opioid analgesic tolerance in particular has long-been desirable in the field of chronic pain therapy because of the increased risks of the consequent adverse effects associated with prolonged opioid-based exposure. The proposed use of certain c-Src inhibitors offers a unique possibility to realise the goal of mitigation of opioid analgesic tolerance, particularly reduction of, prevention of, elimination of, or delayed-on set of opioid analgesic tolerance. Whilst the primary aim of the use of c-Src inhibitors for use in mitigating one or more side-effects associated with analgesic opioids, and particularly mitigation of opioid analgesic tolerance the Applicant has found that c-Src inhibitors may also be useful for the reversal of some side-effects associated with analgesic opiods. In particular the Applicant has found that certain c-Src inhibitor compounds can reverse pre-exisiting opioid analgesic tolerance. This is referred to herein as reversal of drug tolerance. In particular reversal of drug tolerance means that for a subject already taking a drug for a prolonged period and either experiencing or exhibiting signs of drug tolerance i.e. need for increased amounts of medication, the increased amount of medication can be dialled-back to the original dose-level (starting dose), either gradually or directly because the reason for the tolerance has been removed. Physical dependency as defined herein means physiological adaptation to a substance such that the absence of the substance produces symptoms of withdrawal. Physical dependency is a product of tolerance.

Opioid agonists biased against c-Src means drugs that activate the MOPr causing G protein mediated signalling that result in analgesia, without activating c-Src mediated side effects. As will be readily appreciated it is readily possible to determine whether any particular opioid agonist is suitable for such use either by review of published information relating to the agonist, or via carrying out a conventional assay to confirm c-Src activation. The conventional assay for c-Src activation is measurement of phosphorylated c-Src (activated c-Src) using a phospho-c-Src specific antibody as referred to hereinafter.

An opioid drug as defined herein means any opioid analgesic drug. All opioids presently available for the treatment of pain are known to carry the risks of undesirable side-effects including drug-induced tolerance. Suitable opioid drugs for which opioid induced analgesic tolerance may be treated via use of the present c-Src inhibitory approach include: morphine, (5a,6a)-7,8-didehydro-4,5-epoxy-17-methylmorphinan-3,6-diol, and analogues and derivatives thereof, such as hydromorphine also known as dihydromorphine, 3,6-dihydroxy-(5a,6a)-4,5-epoxy-17-methylmorphinan, and diamorphine; codeine also known as 3-methylmorphine, (5a,6a)-7,8-didehydro-4,5- epoxy-3-methoxy-17-methylmorphinan-6-ol; dihydrocodeine, 4,5-a-epoxy-3-methoxy-17- methylmorphinan-6-ol; buprenorphine, (2S)-2-[(5R,6R,7R, 14S)-9a-cycIopropylmethyI- 4,5-epoxy-6,14-ethano-3-hydroxy-6-methoxymorphinan-7-yl]-3,3 -dimethylbutan-2-ol; tramadol, 2-[(dimethylamino)methyl]-1-(3-methoxyphenyl)cyclohexanol; fentanyl also known as fentanil, A/-(1-(2-phenylethyl)-4-piperidinyl)-A/-phenylpropanamide; methadone, RS)-6-(dimethylamino)-4,4-diphenylheptan-3-one; oxycodone (5R,9R, 13S, 14S)-4,5o epoxy-14-hydroxy-3-methoxy-17-methylmorphinan-6-one); hydrocodone (4,5a-epoxy-3- methoxy-17-methylmorphinan-6-one); meptazinol, (RS)-3-(3-ethyI-1 -methylazepan-3- yl)phenol; tapentadol, 3-[(1 R,2R)-3-(dimethylamino)-1 -ethyl-2-methylpropyl]phenol hydrochloride; alfentanil, A/-{1-[2-(4-ethyl-5-oxo-4,5-dihydro-1 H-1 ,2,3,4-tetrazol-1- yl)ethyl]-4-(methoxymethyl)piperidin-4-yl}-A/-phenylpropanam ide; remifentanil, methyl 1- (3-methoxy-3-oxopropyl)-4-(/V-phenylpropanamido)piperidine-4 -carboxylate; pentazocine, (2RS,QRS, 1 1 RS)-6, 1 1 -dimethyi-3-(3-methylbut-2-en-1 -yi)-1 ,2,3,4,5,6- hexahydro-2,6-methano-3-benzazocin-8-ol or 2-dimethylallyI-5,9-dimethyl-2'- hydroxybenzomorphan; pethidine also known as meperidine, ethyl 1 -methyl-4- phenylpipehdine-4-carboxylate); dipipanone, 4,4-diphenyl-6-(1 -piperidinyl)-heptan-3-one.

Compositions and formulations

While it is possible that, for use in accordance with the invention, the one or more c-Src inhibitor compounds or pharmaceutically acceptable salts thereof may be administered as the bulk substance, it is usually preferable to present the active ingredient in a pharmaceutical formulation, for example, wherein the agent is in admixture with at least one pharmaceutically acceptable carrier selected with regard to the intended route of administration and standard pharmaceutical practice. The term "carrier" refers to a diluent, excipient, and/or vehicle with which an active compound is administered. The pharmaceutical compositions of the invention may contain combinations of more than one carrier. Such pharmaceutical carriers can be sterile liquids, such as water, saline solutions, aqueous dextrose solutions, aqueous glycerol solutions, and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin, 18th Edition. The choice of pharmaceutical carrier can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise, in addition to the carrier, any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), and/or solubilizing agent(s). The phrase "pharmaceutically acceptable", as used herein, refers to salts, molecular entities and other ingredients of compositions that are generally physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., human). Suitably, as used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government for use in mammals, and more particularly in humans, or listed in the U.S. Pharmacopoeia or other generally recognized texts, for example the International Union of Pure and Applied Chemistry (lUPAC) Handbook of Pharmaceutical Salts, 2011 Edition.

A "pharmaceutically acceptable excipient" means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable, and includes an excipient that is acceptable for veterinary use as well as human pharmaceutical use. A "pharmaceutically acceptable excipient" as used in the present application includes both one and more than one such excipient. The c-Src inhibitors for use in accordance with the present invention will normally, but not necessarily, be formulated into pharmaceutical compositions prior to administration to a patient. In one aspect, the invention is directed to use of a pharmaceutical composition comprising a c-Src inhibitor for the treatment of opioid tolerance. In another aspect the invention is directed to use of a pharmaceutical composition comprising a c-Src inhibitor of Formula I or II, or a pharmaceutically acceptable salt thereof, and together with at least one or more pharmaceutically acceptable carrier. The carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. The present invention further provides a pharmaceutical composition as defined herein for use as a medicament, for example for use as a medicament for use in the treatment of opioid tolerance.

The present invention is further related to use of a pharmaceutical composition comprising a c-Src inhibitor as defined hereinbefore for treatment of opioid tolerance.

It will be appreciated that pharmaceutical compositions for use in accordance with the present invention may be in the form of oral, parenteral, transdermal, inhalation, sublingual, topical, implant, nasal, or enterally administered (or other mucosally administered) suspensions, capsules or tablets, which may be formulated in conventional manner using one or more pharmaceutically acceptable carriers or excipients. In one aspect, the pharmaceutical composition is formulated for oral administration.

The pharmaceutical compositions for use in accordance with the invention include those in a form adapted for oral use in mammals including humans. The pharmaceutical compositions for use in accordance with the invention include those in a form adapted for oral use and may be used for the treatment or mitigation of one or more side-effects associated with opioid analgesia and in particular for the treatment or mitigation of opioid tolerance, in mammals including humans.

The pharmaceutical compositions for use in accordance with the invention include one or more c-Src inhibitors as defined hereinbefore and can be administered for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications for example as a single or sole-therapeutic agent or may be administered as part of a combination therapy as detailed hereinafter.

The one or more c-Src inhibitors, preferably compounds of Formula I or II, more preferably dasatinib and/or PP2, or pharmaceutically acceptable salts thereof, and further therapeutic agent(s), preferably one or more, opioid analgesic agents as detailed hereinafter may be employed in combination by administration simultaneously in a unitary pharmaceutical composition including both agents.

Alternatively, the combination may be administered separately in separate pharmaceutical compositions, each including one of the agents in a sequential manner wherein, for example, the c-Src inhibitor, preferably a compound of Formula I or II, more preferably dasatinib or PP2 or a pharmaceutically acceptable salt, thereof is administered first and the other agent, preferably an opioid analgesic second and vice versa. Such sequential administration may be close in time (e.g. simultaneously) or remote in time. For example, administration of the other agent several minutes to several dozen minutes after the administration of the first agent, and administration of the other agent several hours to several days after the administration of the first agent are within the scope of the invention, wherein the lapse of time is not limited. For example, one agent may be administered once a day, and the other agent may be administered 2 or 3 times a day, or one agent may be administered once a week, and the other agent may be administered once a day.

When administration is sequential, preferably the c-Src inhibitor as defined herein for use in accordance with the present invention is administered first. When administration is simultaneous, the combination may be administered either in the same or different pharmaceutical composition. When combined in the same formulation it will be appreciated that the compound and agents must be stable and compatible with each other and the other components of the formulation. When formulated separately they may be provided in any convenient formulation, conveniently in such manner as are known for such compounds in the art. During a treatment regime, it will be appreciated that administration of each agent of the combination may be repeated one or more times.

Furthermore, the agents may be administered in the same or different dosage forms, e.g. one agent may be administered topically and the other compound may be administered orally. Suitably, both agents are administered orally.

The combinations may be presented as a combination kit. By the term "combination kit" "or kit of parts" as used herein is meant the pharmaceutical composition or compositions that are used to administer the combination according to the invention. When the agents of the combination are administered simultaneously, the combination kit can contain the agents in a single pharmaceutical composition, such as a tablet, or in separate pharmaceutical compositions. When the agents are not administered simultaneously, the combination kit will contain each agent in separate pharmaceutical compositions either in a single package or in separate pharmaceutical compositions in separate packages. The combination kit can also be provided with instructions, such as dosage and administration instructions. Such dosage and administration instructions can be of the kind that are provided to a doctor, for example by a drug product label, or they can be of the kind that are provided by a doctor, such as instructions to a patient. When a c-Src inhibitor, preferably a compound of Formula I or II, more preferably dasatinib or PP2, or a pharmaceutically acceptable salt thereof is used in combination with one or more additional therapeutic agents, preferably an opioid analgesic, the dose of the c-Src inhibitor compound or agent may differ from that when the compound or agent is used alone. Appropriate doses will be readily appreciated by those skilled in the art. It will be appreciated that the amount of any compound for use in accordance with the invention and the one or more additional therapeutic agents required for use in combination therapies or treatment as detailed herein will vary with the nature of the condition being treated and the age and the condition of the patient and will be ultimately at the discretion of the attendant physician or veterinarian. The suitability of a potential combination of two or more compounds can be assessed on the basis of their in vitro or in vivo drug interactions. For the assessment of in vitro interactions, the interactions of the two, or more, selected compounds are investigated in vitro using standard dose-response assays over a range of individualised concentrations. The selection of suitable conditions and concentrations for carrying out such investigations would be within the remit of the skilled practitioner.

According to a further aspect there is provided a pharmaceutical composition for use in the mitigation of side-effects associated with opioid analgesia which composition comprises one or more c-Src inhibitors as defined hereinbefore, preferably a compound of Formula I or Formula II, more preferably dasatinib or PP2, and one or more pharmaceutically acceptable, carriers, diluents or excipients.

According to a further aspect there is provided a pharmaceutical composition for use in the mitigation of side-effects associated with opioid analgesia which composition comprises one or more c-Src inhibitors as defined hereinbefore, preferably a compound of Formula (I) or Formula II, more preferably dasatinib or PP2, in combination with one or more opioids and one or more pharmaceutically acceptable, carriers, diluents or excipients.

According to a further aspect there is provided a combination of one or more c-Src inhibitors as defined hereinbefore, preferably a compound of Formula (I) or Formula II, more preferably dasatinib or PP2, in combination with one or more opioids wherein the one or more opioid analgesics is selected from: morphine, (5a,6a)-7,8-didehydro-4,5- epoxy-17-methylmorphinan-3,6-diol, and analogues and derivatives thereof, such as hydromorphine also known as dihydromorphine, 3,6-dihydroxy-(5a,6a)-4,5-epoxy-17- methylmorphinan, and diamorphine; codeine also known as 3-methylmorphine, (5a, 6a)- 7,8-didehydro-4,5-epoxy-3-methoxy-17-methylmorphinan-6-ol; dihydrocodeine, 4,5-a- epoxy-3-methoxy-17-methylmorphinan-6-ol; buprenorphine, (2S)-2-[(5R,6R,7R, 14S)-9a- cyclopropylmethyl-4,5-epoxy-6, 14-ethano-3-hydroxy-6-methoxymorphinan-7-yl]-3,3- dimethylbutan-2-ol; tramadol, 2-[(dimethylamino)methyl]-1 -(3- methoxyphenyl)cyclohexanol; fentanyl also known as fentanil, A/-(1 -(2-phenylethyl)-4- piperidinyl)-A/-phenylpropanamide; methadone, RS)-6-(dimethylamino)-4,4- diphenylheptan-3-one; oxycodone (5R,9R, 3S,14S)-4,5a-epoxy-14-hydroxy-3-methoxy- 17-methylmorphinan-6-one); hydrocodone (4,5a-epoxy-3-methoxy-17-methylmorphinan- 6-one); meptazinol, (RS)-3-(3-ethyl-1 -methylazepan-3-yl)phenol; tapentadol, 3-[(1 R,2R)- 3-(dimethylamino)-1 -ethyl-2-methylpropyl]phenol hydrochloride; alfentanil, A/-{1 -[2-(4- ethyI-5-oxo-4,5-dihydro-1 H-1 ,2,3,4-tetrazol-1 -yI)ethyI]-4-(methoxymethyl)piperidin-4-yI}- A/-phenylpropanamide; remifentanil, methyl 1 -(3-methoxy-3-oxopropyl)-4-(A/- phenylpropanamido)piperidine-4-carboxylate; pentazocine, (2RS.6RS, 1 1 RS)-6, 1 1 - dimethyl-3-(3-methylbut-2-en-1 -yl)-1 ,2,3,4,5,6-hexahydro-2,6-methano-3-benzazocin-8-ol or 2-dimethylallyl-5,9-dimethyl-2'-hydroxybenzomorphan; pethidine also known as meperidine, ethyl 1 -methyl-4-phenylpiperidine-4-carboxylate); dipipanone, 4,4-diphenyl- 6-(1-piperidinyl)-heptan-3-one.

There is additionally provided a combination of one or more c-Src inhibitors and one or more opioid analgesics for use in mitigating one or more side-effects associated with analgesic opioids, preferably for mitigation of opioid analgesic tolerance wherein the c- Src inhibitor is dasatinib or PP2 and wherein the opioid is morphine.

If a combination of agents is administered, then the composition comprising one or more c-Src inhibitors as detailed hereinbefore may be administered to an individual prior to, simultaneously, separately or sequentially with other therapeutic regiments or co-agents as desired.

If a combination of agents is administered, then the different actives may be formulated for the same or different delivery, for example one active formulated for immediate and another for sustained release. If a combined therapy is to be administered the active agents may be formulated for the same or different routes of administration as desired.

Administration and Dose Ranges

c-Src inhibitor compounds for use in accordance with the invention intended for pharmaceutical or veterinary or use may be administered as crystalline or amorphous products. They may be obtained, for example, as solid plugs, powders, or films by methods such as precipitation, crystallization, freeze-drying, spray drying, or evaporative drying. Microwave or radio frequency drying may be used for this purpose.

They may be administered alone or in combination with one or more other c-Src inhibitors in accordance with the use of the present invention or in combination with one or more other therapeutic agents or drugs, and in particular one or more opioids as detailed hereinbefore (or as any combination thereof). Generally, they will be administered as a formulation in association with one or more pharmaceutically or veterinarily acceptable excipients. The term 'excipient' is used herein to describe any ingredient other than the c-Src compound(s). The choice of excipient will to a large extent depend on factors such as the particular mode of administration, the effect of the excipient on solubility and stability, and the nature of the dosage form.

Pharmaceutically and veterinarily acceptable excipients include one or more of: lubricants, binding agents, diluents, surface-active agents, anti-oxidants, colorants, flavouring agents, preservatives, flavour enhancers, preservatives, salivary stimulating agents, cooling agents, co-solvents (including oils), emollients, bulking agents, anti- foaming agents, surfactants and taste-masking agents.

Pharmaceutical and veterinary compositions suitable for use in the mitigation of one or more side-effects associated with opioid analgesia as detailed hereinbefore, and methods for their preparation will be readily apparent to those skilled in the art. Such compositions and methods for their preparation may be found, for example, in Gregory E. Hardee and J. Desmond Baggo, "Development and Formulation of Veterinary Dosage Forms", 2 ^nd Edition (CRC Press, 1998) and/or in Remington's Pharmaceutical Sciences, 19th Edition (Mack Publishing Company, 1995).

Formulations suitable for oral administration include solids, semi-solids or liquids such as tablets; soft or hard capsules; bolus; powders; lozenges (including liquid-filled); chews; multi and nano-particulates; gels; solid solutions; fast-dispersing dosage forms; fast- dissolving dosage forms; fast-disintegrating dosage forms; films; ovules; sprays; buccal/mucoadhesive patches; and liquid formulations. Liquid formulations include suspensions, solutions, elixirs and syrups. Oral administration may involve swallowing, so that the compound enters the gastrointestinal tract, and/or buccal, lingual or sublingual administration by which the compound enters the blood stream directly from the mouth. Liquid formulations may be employed as fillers in soft or hard capsules and typically comprise a carrier, for example, water, ethanol, polyethylene glycol, propylene glycol, methylcellulose, or a suitable oil, and one or more emulsifying agents and/or suspending agents. Liquid formulations may also be prepared by the reconstitution of a solid, for example, from a sachet.

Formulations for oral administration may be formulated to be immediate and/or modified release. Modified release formulations include delayed-, sustained-, pulsed-, controlled-, targeted and programmed release. The formulation of tablets is discussed in "Pharmaceutical Dosage Forms: Tablets, Vol. 1", by H. Lieberman and L. Lachman, Marcel Dekker, N. Y., N.Y., 1980 (ISBN 0-8247-6918-X). Tablets and capsules for oral administration may be in unit dose presentation form, and may contain conventional excipients such as binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, or polyvinylpyrrolidone; fillers, for example lactose, sugar, maize-starch, calcium phosphate, sorbitol or glycine; tabletting lubricants, for example magnesium stearate, talc, polyethylene glycol or silica; disintegrants, for example potato starch; or acceptable wetting agents such as sodium lauryl sulfate. The tablets may be coated according to methods well known in normal pharmaceutical practice. Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives, such as suspending agents, for example sorbitol, methyl cellulose, glucose syrup, gelatin, hydroxyethyl cellulose, carboxymethyl cellulose, aluminium stearate gel or hydrogenated edible fats, emulsifying agents, for example lecithin, sorbitan monooleate, or acacia; non-aqueous vehicles (which may include edible oils), for example almond oil, oily esters such as glycerine, propylene glycol, or ethyl alcohol; preservatives, for example methyl or propyl p-hydroxybenzoate or sorbic acid, and, if desired, conventional flavouring or colouring agents. c-Src inhibitor compounds, or compositions comprising one or more c-Src compounds and optionally one or more opioid analgesics for use in the mitigation of one or more side-effects associated with opioid analgesia as detailed hereinbefore, may also be administered parenterally, or by injection directly into the blood stream, into muscle, or into an internal organ. Suitable means for parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular, intrasynovial and subcutaneous. A preferred parenteral administration route is intramuscular. Suitable devices for parenteral administration include needle (including microneedle) injectors, needle-free injectors and infusion techniques.

There is provided herein a pharmaceutical or veterinary composition for use in the mitigation of one or more side-effects associated with opioid analgesia as detailed hereinbefore, wherein the composition is formulated for parenteral delivery comprising a c-Src inhibitor, particularly a compound of Formula I or II, or dasatinib and/or PP2, or a pharmacutically or veterinarily acceptable, salt thereof together with one or more pharmaceutically or veterinarily acceptable excipients. The present invention further provides said composition formulated for parenteral delivery as an immediate release, or as a modified release formulation suitable for intramuscular or intravenous administration. There is also provided herein a pharmaceutical or veterinary composition for use in the mitigation of one or more side-effects associated with opioid analgesia as detailed hereinbefore, wherein the composition is formulated for parenteral or oral delivery comprising a c-Src inhibitor, particularly a compound of Formula I or II, or dasatinib and/or PP2, or a pharmacutically or veterinarily acceptable, salt thereof in combination with one or more opioid analgesics as defined hereinbefore, and preferably wherein the one or more opioid analgesics is morphine or a derivative or analogue thereof, together with one or more pharmaceutically or veterinarily acceptable excipients. The present invention further provides said composition formulated for oral administration or parenteral delivery as an immediate release, or as a modified release formulation suitable for intramuscular or intravenous administration.

There is particularly provided herein a pharmaceutical or veterinary composition for use in the mitigation of one or more side-effects associated with opioid analgesia as detailed hereinbefore, wherein the composition is formulated for oral adminstration comprising one or more c-Src inhibitors, particularly a compound of Formula I or II, or dasatinib and/or PP2, or a pharmacutically or veterinarily acceptable, salt thereof together with one or more pharmaceutically or veterinarily acceptable excipients. The present invention further provides said composition formulated for parenteral delivery as an immediate release, or as a modified release formulation suitable for intramuscular or intravenous administration.

According to a further aspect still the present invention provides a pharmaceutical or veterinary composition for use in the mitigation of one or more side-effects associated with opioid analgesia as detailed hereinbefore, comprising a c-Src inhibitor, particularly a compound of Formula I or II, or dasatinib and/or PP2, or a pharmacutically or veterinarily acceptable, salt thereof, in combination with one or more opioid anagesics wherein the composition is formulated for immediate or modified release of the one or more c-Src inhibitors with delayed or later release of the one or more opioid analgesics. According to an aspect the present invention provides a pharmaceutical or veterinary composition formulated for oral, topical, intramuscular, rectal, subcutaneous or intravenous delivery comprising comprising one or more c-Src inhibitors, particularly a compound of Formula I or II, or dasatinib and/or PP2, or a pharmacutically or veterinarily acceptable, salt thereof together with one or more pharmaceutically or veterinarily acceptable excipients. The present invention further provides said composition formulated for delivery as an immediate release, slow release or as a modified release formulation.

The compositions for use in accordance with the invention may also be administered topically, (intra )dermally, or transdermally to the skin or mucosa. Typical formulations for this purpose include gels, hydrogels, lotions, solutions, creams, ointments, dusting powders, dressings, foams, films, skin patches, wafers, implants, sponges, fibres, bandages and microemulsions. Liposomes may also be used.

The compositions for use in accordance with the invention may be administered rectally or vaginally, for example, in the form of a suppository, pessary, or enema. Cocoa butter is a traditional suppository base, but various alternatives may be used as appropriate.

As detailed hereinbefore, compositions for use in accordance with the present invention may be formulated to be immediate and/or modified release. Modified release formulations include delayed-, sustained-, pulsed-, controlled-, targeted and programmed release.

DOSAGES

Typically, a physician will determine the actual dosage which will be most suitable for an individual human subject, or a veterinarian for an individual mammal (animal). The specific dose level and frequency of dosage for any particular human or animal may be varied and will depend upon a variety of factors including the condition being treated, the inhibitory activity of the specific c-Src inhibitor employed and the re-exisiting or proposed opioid analgesic treatment to be/being employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the humand or animal to be treated.

A therapeutically effective amount of any c-Src inhibitor compound for use in accordance with the present invention can be determined by methods known in the art. As indicated hereinbefore the therapeutically effective quantities will depend on the age and on the general physiological condition of the subject, the route of administration and the pharmaceutical formulation used. The therapeutic doses will generally be between about 1 and 2000 mg/day, for example between about 500 mg and 2000 mg/day. The daily dose as employed for human treatment will range from 1 to 2000 mg, which may be administered in one or more daily doses, for example, depending on the route of administration and the condition of the subject. When the composition comprises dosage units, each unit will contain 1 mg to 2000 mg of active ingredient. When the dosage form is a tablet, the total weight of the tablet is suitably 1000mg or lower.

In order to select the most appropriate dosage forms and routes of administration considered appropriate for the treatment of the desired indication, c-Src compounds should be assessed for their biopharmaceutical properties, such as for example, solubility, solution stability (across a range of pHs), likely dose level and permeability. Both PP2 and dasatinib as detailed herein have been used in clinical trials and/or have been used commercially for purposes other than mitigation of side-effects associated with opioid analgesia.

The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example as one, two, three, four or more doses per day. If the compounds are administered transdermal^ or in extended release form the compounds could be dosed once a day or less. The compound is conveniently administered in unit dosage form; for example, containing 0.01 to 50 mg/kg of active ingredient.

These dosages are based on an average subject having a weight of about 20kg to 200Kg, and more particularly 50kg to 100kg. The physician or veterinarian or livestock owner will readily be able to determine doses for humans or animals whose weight falls outside this range.

In as much as it may be desirable to administer a combination of active compounds, as detailed hereinbefore, for example, for the purpose of treating a particular disease or condition, it is within the scope of the present invention that two or more pharmaceutical or veterinary compositions, at least one of which contains a c-Src inhibitor for use in accordance with the present invention, may conveniently be combined in the form of a kit suitable for co-administration of the compositions. An exemplary kit for use in accordance with the present invention comprises two or more separate pharmaceutical or veterinary compositions, at least one of which contains a c- Src inhibitor for use in accordance with the present invention, preferably a c-Src inhibitor of Formula I or Formula II, more preferably dasatinib or PP2, and suitable means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet.

A preferred exemplary kit for use in accordance with the present invention comprises two or more separate pharmaceutical or veterinary compositions, one of which contains a c- Src inhibitor for use in accordance with the present invention, preferably a c-Src inhibitor of Formula I or Formula II, more preferably dasatinib or PP2, and another separate pharmaceutrical or veterinary composition containing one or more opioid analgesics, as defined hereinbefore, and preferably morphine or a derivative or analogue thereof, and suitable means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet.

An example of such a kit for use in accordance with the present invention is the familiar blister pack used for the packaging of tablets, capsules and the like. Another example of a kit suitable for use in accordance with the present invention is a plurality of vials or other container, wherein one group of one or more vials contains a liquid formulation comprising a specific dosage of the c-Src inhibitor, as defined hereinbefore, and another group of one or more vials contains a liquid formulation comprising a specific dosing of an opioid analgesic such that the liquid formulation in each vial may be ready for direct injection into a human or animal.

According to a further aspect one or more inhibitors of c-Src, preferably one or more c- Src inhibitors of Formula I or II, more preferably dasatinib or PP2 can be administered simultaneously or concurrently with one or more opioids, preferably one or more of the opioid as detailed hereinbefore, and in particular with morphine or an analogue or derivative thereof for the provision of effective analgesia with mitigation of one or more side effects associated with opioid analgesia and in particular the inhibition of drug tolerance. According to a further aspect the c-Src and opioids are provided either in a kit format wherein the c-Src is to be administered prior to the opioid, or wherein the c-Src inhibitor and opioids are provided in a combined dosage form wherein the c-Src inhibitor containing-portion of the dosage form is formulated for immediate release and wherein the opioid inhibitor-containing portion of the dosage form is formulated for modified or delayed release. According to a further aspect dasatinib or PP2 can be administered simultaneously or concurrently with one or more opioids, preferably one or more of the opioid as detailed hereinbefore, and in particular with morphine or an analogue or derivative thereof for the provision of effective analgesia with mitigation of one or more side effects associated with opioid analgesia and in particular the inhibition of drug tolerance.

According to a further aspect the dasatinib or PP2 and morphine or an analogue or derivative thereof are provided either in a kit format wherein the dasatinib or PP2 is to be administered prior to the morphine or an analogue or derivative thereof, or wherein the c- Src inhibitor and morphine or an analogue or derivative thereof are provided in a combined dosage form wherein the dasatinib or PP2-containing portion of the dosage form is formulated for immediate release and wherein the morphine or an analogue or derivative thereof-containing portion of the dosage form is formulated for modified or delayed release.

TREATMENT

It is to be appreciated that references to mitigation of one or more side-effects associated with analgesic opioids as used herein includes inhibition, or reduction as well as treatment via the alleviation of established symptoms of a condition (side-effect) i.e. including prevention of progression or control.

As used herein, unless otherwise indicated, mitigation means treatment of a side-effect wherein "treat", "treating" or "treatment" in reference to a disease, state, disorder, side- effect or condition includes: (1 ) to ameliorate the disease or one or more of the biological manifestations of the disease via (2) to interfere with (a) one or more points in the biological cascade that leads to or is responsible for the disease or (b) one or more of the biological manifestations of the disease, (3) to alleviate one or more of the symptoms or effects associated with the disease, (4) to slow the progression of the disease or one or more of the biological manifestations of the disease, (5) to diminish the likelihood of severity of a disease or biological manifestations of the disease, (6) delaying the appearance of clinical symptoms of the disease, state, disorder or condition developing in a mammal that may be afflicted with or predisposed to the disease, state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition, (7) inhibiting the disease, state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or subclinical symptom thereof, or (8) relieving or attenuating the disease, i.e. causing regression of the disease, state, disorder or condition or at least one of its clinical or subclinical symptoms. For the avoidance of doubt the term disease in the preceding paragraph includes disease, state, disorder, side-effect or condition.

Regarding the use of the c-Src inhibitors, or c-Src compounds, or compositions containing the c-Src inhibitors, or c-Src compounds as defined herein for use in the mitigation of one or more side-effects associated with analgesic opioids, including mitigation of or inhibition of opioid analgesic induced in accordance with the present invention in humans, there is provided: a pharmaceutical composition comprising a c-Src inhibitor, or c-Src compounds, or compositions containing the c-Src inhibitors, or c-Src compounds optionally in combination with an opioid, together with one or more pharmaceutically acceptable, carrier, diluent or excipient; a composition comprising an c-Src inhibitor in combination with an opioid, for use as a medicament; a c-Src inhibitor, or a composition containing an c-Src inhibitor optionally in combination with an opioid for use in the mitigation of one or more side-effects associated with analgesic opioids, including mitigation of opioid analgesic induced drug tolerance; use of a c-Src inhibitor, or a composition containing an c-Src inhibitor optionally in combination with an opioid for the preparation of a pharmaceutical formulation for the for use in the mitigation of one or more side-effects associated with analgesic opioids, including mitigation of opioid analgesic induced drug tolerance; a c-Src inhibitor, or a composition containing a c-Src inhibitor optionally in combination with an opioid, for the preparation of a pharmaceutical composition for use in the mitigation of one or more side-effects associated with analgesic opioids, including mitigation of opioid analgesic induced drug tolerance;

Regarding the use of the compounds of the invention in animals, there is provided: a veterinary composition comprising a c-Src inhibitor in combination with an opioid together with one or more acceptable carrier, diluent or excipient. Brief description of Figures

Figure 1 : illustrates the reduction in morphine-induced analgesic tolerance by measurement of MPE over time (days) via inhibition of c-Src in different mouse types when treated with dasatinib (Drug X) or PP2 (Drug Y) and the reversal of morphine- induced analgesic tolerance in mice when dasatinib was administered 30 minutes prior to morphine. Figure 1A illustrates the results obtained using dasatinib and wild type C57BL/6 (WT) mice; Figure 1 B illustrates the results obtained using dasatinib in MOPr+/- mice; Figure 1 C illustrates the results obtained using PP2 in MOPr+/- mice; and Figure 1 D illustrates the results obtained using dasatinib when administered 30 minutes prior to morphine in in MOPr+/- mice.

Figure 2: illustrates morphine analgesia in WT and MOPr+/- mice which was assayed by measuring the latency for tail withdrawal from heated water.

Figure 3: illustrates the relative levels of morphine analgesic tolerance of different mouse genotypes. Detailed description of Figures

Figure 1 : The results illustrated in Figures 1A to 1 D illustrate that the inhibition of c-Src by either dasatinib (Drug X) or PP2 (Drug Y) reduces morphine analgesic tolerance are provided in graph-format. In Figure 1A, the results for the Vehicle confirmed that wild type C57BL/6 (WT) mice rapidly developed tolerance to morphine-induced analgesia when dosed with 10mg/Kg morphine subcutaneously (sc) once daily. For the avoidance of doubt, for matched vehicle injections in all the experiments detailed herein the vehicle contained the same constituents but without the active drug. As also shown in Figure 1 A this tolerance became profound after 10 days. In contrast, in WT mice where dasatinib was dosed daily at a level of 5mg/Kg, ip, 30 minutes (mins) before the injection of morphine at 10mg/Kg the tolerance to morphine-induced analgesia was abolished at day 10. The methods for provision of the desired mg/Kg solutions of dasatinib, PP2 and PP3 are detailed in hereinafter. Figure 1 B illustrates the results obtained where MOPr+/- mice were subjected to the same treatments as for Figure 1A. In Figure 1 B the tolerance to morphine (10mg/Kg, once daily, sc) developed faster and became more marked in MOPr+/- mice receiving vehicle, however, MOPr+/- mice receiving an ip injection of dasatinib 30 mins prior to morphine injection exhibited negligible tolerance. Figure 1 C illustrates the results obtained when MOPr+/- mice were dosed with PP2 and an inactive analogue thereof PP3 at 5mg/Kg, ip, 30 minutes prior to a daily injection of morphine (l Omg/Kg, sc). In the mice dosed with PP2 the tolerance to morphine-induced analgesia was significantly reduced whilst the mice dosed with the analogue rapidly developed tolerance. In Figure 1 D administration of dasatinib (5mg/Kg, ip) to MOPr+/- mice, on Day 4 of a daily morphine treatment programme, was demonstrated to cause reversal of tolerance to morphine-induced analgesia when the dasatinib was administered (5mg/Kg, ip) 30 mins before morphine treatment (10mg/Kg, sc). In sharp contrast no reversal of analgesic tolerance was found in mice on morphine treatment in which vehicle alone was administered on Day 4.

In the graphs of Figures 1A to 1 D, MPE represents maximal possible effect for prolongation of tail withdrawal latency which is limited to 15 seconds (s) to prevent tail damage. Statistics: Data are mean ± SEM, statistical significance was determined by one way repeated measures ANOVA with post hoc Tukey's test; *p < 0.05, **p < 0.01 , ***p < 0.001 . For the avoidance of doubt, statistical analysis reported herein for any of the Figures and for the relevant Experimental Results was performed using GraphPad Prism 5 software. Figure 2: In Figure 2 the results obtained when morphine analgesia in WT and MOPr+/- mice was assayed via measurement of the latency for tail withdrawal from water heated to 52°C are shown in graph-format. In Figure 2A the results obtained from treatment with different doses of morphine (0.1 , 1 or 10mg/Kg, sc, once daily) show a dose- dependent increase in tail withdrawal latency in both WT mice and in MOPr+/- mice but not in MOPr-/- mice. These results confirm the requirement for MOPrs in morphine- induced analgesia. The results illustrated in Figure 2A also show that the potency of morphine was reduced in MOPr+/- compared to WT mice. In Figure 2B the results obtained from treatment of WT and MOPr+/- mice B) with morphine (10mg/Kg, sc, once daily) show that the relative development tolerance to morphine-induced analgesia in WT and MOPr+/- mice. The results in Figure 2B show significantly less tolerance in WT mice between days 4 and 10 of morphine treatment. In the graphs of Figure 2A and 2B, MPE represents maximal possible effect for prolongation of tail withdrawal latency which is limited to 15s to prevent tail damage. Statistics: Data are mean ± SEM, statistical significance was determined by one way repeated measures ANOVA with post hoc Tukey's test; *p < 0.05, **p < 0.01 , ***p < 0.001 . Figure 3: In Figure 3 the results obtained when morphine analgesic tolerance and cause conditioned place preference (CPP) potency were assessed for different mouse varieties are shown in graph-format. In general mice lacking -arr2 are shown to exhibit reduced morphine analgesic tolerance and more potent CPP. In Figure 3A mice lacking one allele (β-arr 2+I-) and mice lacking both alleles ( -arr2-/-) of the β-allele 2 are shown to exhibit a significant reduction in analgesic tolerance to morphine when compared to WT mice. All the mice in the experiments illustrated in Figure 3A were dosed once daily with morphine (10mg/Kg, sc). In Figure 3B WT mice dosed daily with 10 mg/Kg morphine, sc was shown to CPP. The results illustrated in Figure 3C show that CPP was not caused by 3 mg/Kg sc in WT mice. The results illustrated in Figure 3D show that CPP was caused by a 10 mg/Kg morphine dose, sc in MOPr-/- mice. The results illustrated in Figure 3E show that mice that lack -arr2 have a significant increase in morphine preference compared to WT mice when dosed at 3mg/Kg sc. Statistics: Data are mean ± SEM, statistical significance was determined by one way repeated measures ANOVA with post hoc Tukey's test; *p < 0.05, **p < 0.01 , ***p < 0.001 .

EXPERIMENTAL METHODS

For the experiments herein involving c-Src inhibition, dasatinib (commercially available from Bristol-Myers Squibb) was dissolved in DMSO (Sigma-Aldrich) to give a 50 mg/ml stock. The final concentration of the dasatinib solution for injection was 1 mg/ml dasatinib to allow administration of 5 mg/Kg. This consisted of a 2% DMSO and 2% Kolliphor® EL (a polyoxyl 35 hydrogenated castor oil, also known as a PEG-35 castor oil available from Sigma-Aldrich) in a 0.9% saline solution. For the avoidance of doubt any suitable vehicle components and relative levels thereof, such as alternative solvents to DMSO and alternative emulsifying and solubilising agents to Kolliphor EL provided the resultant drug-compound containing solution is suitable for injection.

Using a similar procedure, PP2 was also dissolved in DMSO at its solubility limit of 25 mM and diluted in a 0.9% saline solution to give a final concentration of 1 mg/ml PP2 (16% DMSO and 16% Kolliphor EL).

PP3 (1 -phenyl-1 H-pyrazolo[3,4-d]pyrimidin-4-amine) has a higher solubility limit than dasatinib or PP2 and was made up in DMSO at 100 mM and diluted in a 0.9% saline solution to give a final concentration of 1 mg/ml of PP3 (5% DMSO and 5% Kolliphor® EL). These drugs were all administered via the intraperitoneal (IP) route. For the experiments as detailed herein, the matched vehicle injections contained all the constituents of the compound-containing injections with the exception of the active drug compound. Opioid analgesia:

Use of a clinically relevant opioid analgesic drug (morphine) to establish whether Drugs X (dasatinib) and Y (PP2) inhibit and/or reverse tolerance. Breeding Colony Maintenance and Housing

MOP-/- mice were first generated by Dr Brigitte Kieffer's lab in 1996 (Matthes et a/., 1996). They disrupted the Oprml gene utilising a technique called homologous recombination. This work involved the insertion of a neomycin resistant cassette into Exon 2 of the gene and was performed on embryonic stem cells from the 129/Sv mouse line, also known as the 129S1 mouse line, which is commercially available from The Jackson Laboratory (JAX), Connecticut, USA.

Continued breeding was performed with C57BL/6J mice and the mice are now commercially available fully backcrossed onto C57BL/6J background from The Jackson Laboratory (JAX), Connecticut, USA, under stock number 007559.

The DOP-/- mice used herein were first generated by Dr Brigitte Kieffer's lab. They inactivated the Oprdl gene by targeting Exon 1 for deletion with a neomycin cassette. This was inserted into embryonic stem cells from the 129/Sv mouse line and further breeding was performed with C57BL/6J mice (Filliol et al., 2000). The mice are now commercially available fully backcrossed onto C57BL/6J background from The Jackson Laboratory (JAX) (stock number 007557). The BAR2-/- mice were initially developed by Dr Robert Lefkowitz's lab in 1999. These mice were created by utilising a homologous recombination technique targeting Exon 2 of the β-arrestin 2 gene on Chromosome 1 1 . These mice were again created using embryonic stem cells from the mouse line 129/Sv and further breeding and backcrossing performed on the C57BL/6J background (Bohn et al., 1999). These mice are also commercially available from The Jackson Laboratory (JAX), under stock number 01 1 130. The MOP-/-, DOP-/- and BAR2-/- mice used in the experiments detailed herein were provided by Dr Wendy Walwyn at UCLA, these mice were maintained on a C57BL/6J background. All mice were maintained in the Medical Resource Unit of the University of Dundee in accordance with Home Office regulations. They had free access to food and water with 12 hour cycles of light and dark corresponding to day/ night externally. All of the experiments detailed herein were performed in the light phase. All work was performed by trained personnel in accordance with a UK Government Home Office project licence (Hales). For three days prior to each experiment mice were handled and habituated to the room where the tests were to take place. The room temperature was maintained between 19 and 21 °C. All experiments took place during daytime hours. All drug doses were calculated using individual body weight, maximum volume administered in a single injection was 200 μΐ_. Groups of mice were made up of equal numbers of males and females where possible and balanced numbers when not. Mice were aged from 7 weeks to 24 weeks of age at the time of their participation in the tasks.

Genotyping Genotyping was initially performed in-house using the following standard protocols but subsequently contracted to Transnetyx Inc., TN, USA.

Genomic DNA was extracted from ear clippings and sequenced using standard protocols. The protocol used is as follows. Extraction solution, commercially available from Sigma-Aldrich, 50 μΐ_ was added to the ear clip sample along with 12.5 μΙ_ of tissue preparation solution, also available from Sigma-Aldrich. These were allowed to incubate at room temperature for 10 minutes, then at 95°C on the heat block for a further 3 minutes. Neutralisation solution (50 μΙ_, Sigma-Aldrich) was then added to stop the reaction. The resulting genomic DNA was either used immediately for PCR or stored at - 20°C until required.

A master-mix was created for each PCR reaction as required (Table 1.1 ) and the samples set up on the thermo-cycler using the appropriate programme. The primers used for each reaction consisted of a forward, reverse and middle primer, the sequences of which can be viewed in Table 1 .2, they were obtained from Sigma-Aldrich. Following completion of the PCR reactions the samples were maintained at 4°C until an electrophoresis gel could be run. Table 1 .1 shows the PCR master-mix recipe use for each of the mouse genotypes. This was varied between the genotypes as detailed above. The primer sequences for each reaction can be viewed in Table 1 .2. The reagents were supplied by Sigma-Aldritch and Fisher Scientific.

TABLE 1 .1

Table 1 .2 shows the forward, reverse and middle primer sequences required genotyping each genetically modified mouse line.

TABLE 1 .2

Sequence Listing

SEQ ID NO 1. Forward mouse MOP-/- 5'_gagttaggagaatcaggagttcaag_3';

SEQ ID NO 2. Reverse mouse MOP-/- 5'Jgccatgaacattacgggcagac_3';

SEQ ID NO 3. Middle mouse MOP-/- 5'_accgcttcctcgtgctttacggta_3';

SEQ ID NO 4. Forward mouse DOP-/-5'Jccatcagagaacacgcagcacaa_3'; SEQ ID NO 5. Reverse mouse DOP-/- 5'_cgcctccggaccacgtgg_3';

SEQ ID NO 6. Middle mouse DOP-/- 5'_accgcttcctcgtgctttacggta_3';

SEQ ID NO 7. Forward mouse BAR2-/- 5'.tcttccctgccccgatttc.3';

SEQ ID NO 8. Reverse mouse BAR2-/-5'_aggtgagagccccaagatg_3';

SEQ ID NO 9. Middle mouse BAR2-/- 5'_atgtggaatgtgtgcgaggccagag_3';

We used 1 % agarose TAE gel with ethidium bromide (10 μΐ_ / 100 ml, Sigma-Aldrich) to run the MOP and BAR2 reactions and a 2% agarose TAE gel with ethidium bromide for the DOP reaction as this allowed better separation of the bands for this reaction. We added 10 pL of loading dye to each 50 μΙ_ PCR reaction and loaded 30 μΙ_ of each reaction to the gel. A 1 kb DNA ladder (available from Fisher Scientific as BP2578100) was used for the MOP and DOP reactions and a 100 bp DNA ladder (Invitrogen, available from ThermoFisher Scientific as product 15628019) for the BAR2 reaction. Electrophoresis gels were run at 100 V for 60 - 80 minutes until adequate band separation had occurred and imaged using a UV light source. For the MOP results we expect to see a WT band visible at 700 bp and a KO band visible at 400 bp. For the DOP reaction we expect to observe a band at 1000 bp and a KO band at 600 bp. The BAR2 reaction produced a WT band at 188 bp and a KO band at 400 bp. For all of the reactions one band was present to represent either WT or KO and heterozygote animals were identified by the presence of both bands.

Assessment of morphine analgesia

The hot water tail withdrawal assay was used to assess morphine analgesia. An electronic thermostatic circulating water bath (Thermostatic circulator bath Optima general purpose digital +5°C to 100°C, 12L stainless steel tank available from Fisher Scientific) was used to maintain a temperature within ± 0.1 °C. Prior to the start of each experiment a baseline tail withdrawal assay was performed using 48°C water with a maximum exposure time of 15 seconds. Any suitable tail withdrawal assay technique can be applied to establish a baseline. The tail assay method used in these experiments is a standard procedure, as reported by Lam H, Maga M, Pradhan A, Evans CJ, Maidment NT, Hales TG, Walwyn W. 201 1 . Mol Pain 7: 24 and the details of this method and how to perform it would be known to the skilled person. In the method used herein the distal 3 cm of the tail was immersed. Before and after each test the mice were maintained in their home cages. To investigate analgesic dose response, mice were treated with cumulative doses of morphine sulphate (Sigma-Aldrich) at 0.1 , 0.3, 1 , 3, 10 and 30 mg/Kg, with the morphine sulphate being passed through a 0.2 pm syringe filter prior to use. For the avoidance of doubt, references to morphine in relation to the experimental results herein mean morphine sulphate which may be diluted as appropriate according to the requirements of the particular experiment. The NaCI solution containing morphine sulphate suitable for a 30mg/Kg was diluted down to provide a solution for the lower dose levels in order that the mice were dosed with the same volume in each instance

Morphine was diluted in 0.9% NaCI to provide a solution suitable for injection and the mice were dosed via subcutaneous injections (SC). Thirty minutes after each morphine dose the tail withdrawal assay was performed. Results were calculated as a percentage of maximal possible effect (MPE) where the % MPE = 100*(drug latency - basal latency) / (15 s - basal latency). Once a mouse had reached the 15 second maximum it received no further doses of drug. Morphine tolerance

To investigate the development of analgesic tolerance to morphine mice were treated with 10 mg/Kg morphine sulphate sc once daily for 10 days. The injections were performed at the same time each day and all experiments took place during the light phase. On each experimental day a baseline tail withdrawal assay was performed using the circulating hot water bath (bath settings 48°C, 15 s maximum exposure time). Mice then received a 1 mg/Kg injection of morphine sulphate administered subcutaneously and a repeat tail withdrawal assay was performed 30 minutes later. Following this they received an injection of 10 mg/Kg morphine sulphate administered subcutaneously, with a repeat tail withdrawal assay again performed thirty minutes after the morphine dose.

Conditioned place preference (CPP)

We used a two compartment model of conditioned place preference to investigate morphine reinforcement in mice as described previously in the literature (Lam H, Maga M, Pradhan A, Evans CJ, Maidment NT, Hales TG, Walwyn W. 201 1. Mol Pain 7: 24).

One chamber had a wallcovering consisting of black and white horizontal stripes and the other black and white vertical stripes. The floor material was the same in each of the chambers; it consisted of 1 cm square wire grid flooring material. The grid direction of this material differs depending on its orientation. We utilised this property to provide a difference in the floor between each chamber. The direction of the grid matched the wall stripe direction in each chamber. Each test arena measured 28 x 28 cm and was 19 cm high. Two test arenas, each consisting of a two compartment apparatus, are contained within an operant box. The test apparatus was matched to mice of specific genders and only mice of the same gender were placed in the same operant box set-up. The majority of the mice placed in the same operant box for testing were cage mates, but this could not always be ensured for the male mice. These boxes are soundproofed and allowed the light levels to be controlled at approximately 70 lumens, the temperature of the room was maintained between 21 and 23°C.

This allowed habituation to handling, the experimental room and other mice to be used in the experiment i.e in the opposite chamber from where they received their first injection, and the distance that they travelled was tracked using the AnyMaze softwareGroups of 8 mice from each genotype were used for each dose of morphine that was tested, the test period, We recorded the time that they spent in each chamber and then compared the two. For experiments involving c-Src inhibition, dasatinib was dissolved in dimethyl sulfoxide (DMSO) to give a 50 mg/ml stock. The final concentration of the solution for injection was 1 mg/ml dasatinib to allow administration of 5 mg/Kg. This consisted of a 2% DMSO and 2% Kolliphor® EL (available from Sigma-Aldrich) in a 0.9% saline (aqueous NaCI) solution.

The matched vehicle injection contained the same constituents but without the active drug, PP2, commercially available from Tocris Bioscience, Bristol, United Kingdom, was also dissolved in DMSO at its solubility limit of 25 mM and diluted in a 0.9% saline solution to give a final concentration of 1 mg/ml (16% DMSO and 16% Kolliphor EL). The inactive compound, PP3, 1-phenyl-1 H-pyrazolo[3,4-c ]pyrimidin-4-amine, Both PP2 and PP3 are commercially available from Tocris Bioscience, Bristol, United Kingdom, has a higher solubility limit and was made up in DMSO at 100 mM and diluted in a 0.9% saline solution to give a final concentration of 1 mg/ml (5% DMSO and 5% Kolliphor® EL). These were all administered via the intraperitoneal (IP) route.

Cohorts of 16 mice comprising 8 males and 8 females were used in order to examine any potential gender-related effects. The results of using this type of cohort so far in studies of nociceptive pain, in which the ability of c-Src inhibitors to attenuate morphine tolerance were clearly detectable (as illustrated in Figure 1 ). Although the data are not provided herein results were independent of gender. Analgesic opioids were administered daily to WT and MOPr+/- mice cohorts for up to 14 and 7 days, respectively. The advantage of using MOPr+/- mice is the rapid development of profound analgesic tolerance.

The experimental results have established that administration of c-Src inhibitors attenuates the development of analgesic tolerance to morphine.

Dasatinib (Drug X) and PP2 (Drug Y) reduced analgesic tolerance when administered at 5mg/Kg, once a day, ip, to mice 30 min prior to sc morphine administration. These results are illustrated in Figure 1.

Experiments were also undertaken, which allowed morphine tolerance to develop (for 3 days in MOPr+/- mice) and then by administration of dasatinib (Drug X) once, 30 mins prior to morphine, on day 4 reversal of tolerance was observed, as illustrated in Figure 2D.

Analgesia and Tolerance The roles of MOP and DOP receptors, B-arrestin2 in analgesia. Role of MOP, DOP and BAR2 in morphine tolerance have been investigated.

The Applicant has confirmed in MOP-/- mice that morphine (10 mg/Kg) does not cause analgesia in the absence of MOP receptors. Morphine also does not inhibit VACC's in DRG neurones from MOP-/- mice. In MOP+/- mice the Applicant observed a reduced analgesic potency of morphine with a rightward shift in the dose response curve, whilst there did not appear to be a change in efficacy of the drug in opioid naive mice. This reduction in potency is significant, while the slope of the morphine dose response relationship remained unchanged. Table 2 provides a summary of the results obtained and in particular morphine ED 50 (mg/Kg) and slope values for morphine analgesia in WT, MOP+/-, DOP+/-, DOP-/-, BAR2-/- and BAR2-/-//DOP-/- mice. ^* P < 0.05 on Student's t test compared to WT.

TABLE 2 WT 1.2 ± 0.1 6.6 ± 1.2 29

MOP +/- 6.2 ± 0.8* 5.7 ± 1.1 15

DOP +/- 1.4 ± 0.2 6.8 ± 1.0 13

DOP -/- 1.8 ± 0.3* 2.6 ± 0.4* 14

BAR2 -/- 1.5 ± 0.4 8.2 ± 2.7 16

BAR2 -/- /DOP- 1.4 ± 0.2 3.3 ± 1.0 16

/-

Althought the Applicant has identified a significant difference in the baseline tail withdrawal latency between male and female mice that indicated a higher sensitivity of female mice to noxious heat, there were no significant differences between male and female mice in ED 50 or development of morphine tolerance. As the numbers in our groups were relatively small (a total of 29 mice in the analgesia experiment and a total of 16 mice in the tolerance experiment) it is considered likely that we would not be able to detect a subtle difference in morphine's actions between genders. To account for this within our results and attempt to avoid introducing bias by gender we kept the genders of all experimental groups balanced.

Our results show that MOP+/- mice exhibited a very rapid onset of tolerance following daily treatments with 10 mg/Kg morphine. They have significantly less analgesia at day 4 of the study protocol compared to day 1 . This contrasts with WT mice in which there was no significant difference in morphine analgesia until day 9 of the protocol. MOP+/- mice also developed a significantly greater degree of tolerance to the analgesic effects of morphine by day 10 than that observed for WT mice. These results support the proposal that MOP receptor number is important in the development of tolerance to morphine's analgesic effects. It is known that MOP+/- mice have 50% fewer MOP receptors than WT mice due to the deletion of one copy of the oprml gene. On the basis of our results we propose that in WT mice the development of morphine tolerance appears to be limited by the existence of an excess of MOP receptors. The fact that morphine has a similar analgesic efficacy in na ^' ive MOP+/- and WT mice suggests that the loss of 50% of the MOP receptors does not affect this and there are therefore spare receptors. The existence of spare receptors in WT mice presumably prevents a reduction in efficacy during morphine tolerance despite receptor down regulation. Our results demonstrate that the potency of morphine is affected by an absence of DOP receptors. As clearly shown by the results illustrated in Table 2, the ED 50 is significantly increased in the DOP-/- mice compared to the WT mice. The slope of the morphine analgesia dose response relationship is also significantly reduced in the DOP-/- mice compared to the WT mice. Without wishing to be bound to any particular theory we propose that this could be explained by a difference in the way that morphine interacts with MOP/DOP receptor oligomers compared to homomeric MOP receptors on nociceptive neurones. It is possible that binding of morphine to MOP receptors is influenced by occupancy of adjacent DOP receptors leading to cooperativity.

Our results have also confirmed that while DOP-/- mice do develop tolerance to morphine this is significantly reduced compared to WT mice after 10 days of once daily dosing and also confirms the importance of DOP receptors in the development of tolerance. BAR2-/- mice exhibited no significant alteration in ED 50 value for morphine analgesia but did show basal analgesia. This strongly suggests that removal of BAR2 does not appear to affect binding of morphine as the ED 50 and slope of the analgesic dose response curve to morphine are unaltered in the BAR2-/- mice.

BAR2-/- mice did develop tolerance to morphine over the course of our 10 day protocol, but this was significantly reduced when compared to the WT mice. We then investigated the double knockout BAR2-/-//DOP-/- mice. These mice did not show any morphine tolerance during our 10 day test protocol. They had the same measurable analgesic effect of morphine on day 1 of the protocol as on day 10. Removing both BAR2 and DOP receptors appears to have completely abolished tolerance to morphine.

BAR2-/- mice show basal analgesia, their baseline tail withdrawal times, in the absence of exogenously administered drug, are significantly prolonged when compared to the WT mice. We also observed a prolonged baseline tail withdrawal time in the BAR2-/-//DOP- /- mice. These mice show basal analgesia that is not significantly different to that observed in the BAR2-/- mice. DOP-/- mice baseline tail withdrawal times are not significantly prolonged when compared to those of the WT mice. From our results it appears that the removal of BAR2 allows constitutive signalling of MOP receptors to occur resulting in basal analgesia. There does not appear to be an involvement of DOP receptors in this process. However both BAR2 and DOP receptors are implicated in the development of tolerance to morphine. The results discussed, detailed and illustrated herein reveal the importance of MOP receptor number, DOP receptors and BAR2 in the development of tolerance to morphine. When there is a normal intact system, as in the WT mice, MOP and DOP receptors and BAR2 are all functioning, then there is an absence of basal analgesia and tolerance develops following repeated morphine administration. When DOP receptors are removed from this system (MOP receptors and BAR2 remain) morphine tolerance is significantly reduced and there is no basal analgesia. When BAR2 is removed leaving MOP and DOP receptors alone this causes basal analgesia and a reduction in the development of morphine tolerance. When both BAR2 and DOP receptors are removed, leaving MOP receptors alone, basal analgesia occurs with no demonstrable tolerance to morphine.

Psychomotor effects of morphine We have also conducted experiments to investigate the roles of MOP, DOP receptors and B-arrestin2 on locomotor effects of morphine and conditioned place preference in mice.

Our results confirmed that WT mice exhibited a robust dose dependent locomotor activation by morphine and they sensitised to these effects. The WT mice also exhibited a dose dependent relationship in the preference that they express for morphine in the CPP paradigm. None of the mice tested exhibited a significant preference for either chamber on the habituation day. The distance travelled in the 30 minutes after saline injection on day 1 was not significantly different across the genotypes tested.

Locomotor activation following morphine administration requires MOP receptors, it does not occur in the MOP-/- mice. MOP receptors are also required for the reinforcing effects of morphine. Our results confirmed that the MOP-/- mice expressed no preference for the morphine paired chamber during CPP.

Our results for the MOP+/- mice demonstrated a reduction in the potency of morphine for both locomotor activation and reinforcement. Locomotor activation in these mice is significantly reduced compared to WT mice. Even when the locomotor activation produced by the highest dose tested in the MOP+/- mice (morphine 30 mg/Kg) is compared to that produced by morphine (10 mg/Kg) in the WT mice we still observed a significant reduction in the locomotor activation produced by morphine. MOP+/- mice did not show any sensitisation to the locomotor activating effects of morphine even at a dose of 30 mg/Kg. These results suggests that MOP receptor number is critical for the process of sensitisation.

Our results for the MOP+/- mice also showed a dose dependency in the development of morphine preference, with no significant preference at 10 mg/Kg but a restored preference when the mice are conditioned with 30 mg/Kg morphine. Interestingly, the MOP+/- mice displayed a preference for the 10 mg/Kg morphine paired chamber during the first 300 s of the test period but this was extinguished by the last 300s (segment 600 - 900 s). This suggests a reduction in potency of morphine in these mice as we have observed for the analgesic and locomotor effects previously. This pattern of extinction observed in the MOP+/- mice conditioned with morphine (10 mg/Kg) did not occur in the other groups of mice tested. WT mice did not display a preference for the morphine paired chamber following conditioning with morphine 3 mg/Kg at any of the time points. There were no significant differences in the time spent in each chamber across the test period. This is also the case for the MOP-/- mice conditioned with morphine (10 mg/Kg). These results support our proposal that MOP receptors are important in this process, and in particular that MOP receptors alone are responsible for this effect and that receptor number may have a role in this process. Our results for the DOP-/- mice exhibited no significant alteration in locomotor activation at 10 mg/Kg morphine compared to the WT mice but interestingly did demonstrate increased sensitivity to its locomotor activating effects. They exhibited significant locomotor activation at the 3 mg/Kg dose which the WT mice do not. These results imply that the DOP receptor may be involved in limiting the sensitivity of the locomotor system to activation by morphine.

Our results for the DOP-/- mice exhibited no significant alteration in morphine preference compared to the WT mice at either the 3 mg/Kg or 10 mg/Kg morphine doses. These results support our proposal that DOP receptors are not involved in morphine reinforcement.

Our experimental protocol was the same for all genotypes, it involved an AM saline injection and a PM morphine injection separated by a 4 hour interval, testing took place at a time point midway between the administration points. It is conceivable that this protocol constituted enough of a circadian cue to allow our DOP-/- mice to develop morphine preference. BAR2-/- mice exhibited a significant reduction in locomotor activation following the administration of 10 mg/Kg morphine. We observed no significant locomotor activation following the administration of morphine 3 mg/Kg in either the BAR2-/- or WT mice.

Our results for the BAR2-/- mice did not demonstrate any sensitisation to the locomotor activating effects of morphine at the 10 mg/Kg dose, this is significantly different from the behaviour of the WT mice. The BAR2-/- mice exhibited a marked preference for the morphine paired chamber at both 3 and 10 mg/Kg morphine. While the WT and DOP-/- mice demonstrated a dose response relationship in the development of morphine preference, this relationship is lost in the BAR2-/- mice. The preference scores for morphine at 3 and 10 mg/Kg were not significantly different. This is likely because these doses lie at the top of the dose response relationship for morphine preference in these mice and reveal a significant increase in the potency of morphine to produce reinforcement when BAR2 is absent. BAR2-/-//DOP-/- mice also exhibited significantly reduced locomotor activation following administration of morphine 10 mg/Kg compared to WT mice. This is not significantly different to that observed in the BAR2-/- mice. These mice do not exhibit a significant preference for morphine following conditioning with morphine 3 mg/Kg, although there is a trend towards significance. They did demonstrate a preference for the morphine paired chamber following conditioning with morphine 10 mg/Kg. They exhibited no extinction of preference during the test period at either dose and their preference scores for morphine were not significantly different from those of the BAR2-/- mice.

Our results for the MOP-/- mice did not exhibit morphine preference. This confirms that the MOP receptor is required for the development of preference for opioid. By contrast, there were no significant differences between WT mice and DOP-/- mice in the development of morphine preference. Removing -8ΓΓ65ΐίη2 increased the sensitivity of the mice to the reinforcing effects of morphine and suggests that the potency of morphine to produce a preference is increased in this circumstance. Opioid receptor signalling within the VTA

We have also carried out experiments on VTA cell type identification, effect of opioid drugs on IPSC events within the VTA, DOD receptors within the VTA, the role of B- arrestin2 in signalling within the VTA, effect of naloxone on sIPSC frequency with the VTA.

The effects of c-Src on opioid receptor signalling As detailed hereinbefore PP2 and dasatanib as c-Src inhibitors. We used these compounds to investigate the effects of c-Src inhibition on locomotor activation by morphine and conditioned place preference to morphine. We also used PP2 to investigate the effects of c-Src inhbition and MEK inhibition on sIPSC frequency in the VTA.

Dasatinib, when administered prior to morphine, prevents the development of significant morphine tolerance in both WT and MOP+/- mice. It does not significantly alter basal tail withdrawal latency, this is interesting because BAR2-/- mice exhibit prolonged basal tail withdrawal latencies and this suggests that another signalling pathway may be responsible for this aspect of behaviour. PP2 also inhibits the development of morphine analgesic tolerance; this inhibition is not significantly different from that observed following the administration of dasatinib. Dasatinib also reversed the analgesic tolerance that had already developed to morphine in the MOP+/- mice. The observed reversal and return to almost full analgesia suggests that these effects can be rapidly reversed and implicated c-Src in these processes.

Dasatinib had no psychomotor effects when administered alone. Mice administered either vehicle or dasatinib injections prior to morphine exhibited a reduced locomotor response. This may be due to an effect of the components of the vehicle injection (DMSO / Kolliphor EL®) on locomotor activity or a behavioural effect due to a further period of restraint and injection. We have demonstrated that inhibition of c-Src does not produce reinforcement or aversion in the absence of morphine. Furthermore, when mice were treated with either vehicle or dasatinib prior to morphine during the conditioning phase of CPP there was no significant differences in the preference for the morphine paired chamber on test day. Dasatinib does not appear to affect morphine reinforcement. This contrasts with the differences that we observed in the BAR2-/- mice, which exhibited an increased sensitivity to morphine reinforcement compared to the WT mice. BAR2-/- mice exhibited a significant preference for morphine following conditioning with morphine at both 3 and 10 mg/Kg. This was not the case for WT mice or for WT mice administered dasatinib prior to morphine. In those mice reinforcement was only exhibited following conditioning with morphine at a higher dose (10mg/Kg), but not the lower dose (3mg/Kg). This suggests that c-Src is not implicated in this process of sensitisation to the reinforcing effects of morphine. The c-Src inhibitor, PP2, reduced the ability of morphine to inhibit sIPSC frequency in VTA neurones. The diminished sIPSC inhibition by morphine in the presence of PP2 was similar to that observed in recordings from BAR2-/- neurones. By contrast, PP3, an inactive chemical analogue of PP2, did not significantly alter the ability of morphine to inhibit sIPSC frequency compared to the WT neurones exposed to morphine alone. This suggests that BAR2 and c-Src are important components of the signalling pathway within the VTA in response to morphine. Systemic administration of the MEK inhibitor SL 327 has been demonstrated to inhibit locomotion in a dose dependent manner that involves D1 dopamine receptors in WT mice. We investigated whether inhibition of the MEK/ERK pathway using SL327 would affect the ability of morphine to inhibit sIPSC frequency within the VTA. There were no significant differences in the ability of morphine to inhibit sIPSC frequency in WT VTA neurones treated with morphine alone or WT VTA neurones treated with SL327 and morphine. These results suggest that the inhibition by morphine of vesicular release of GABA from presynaptic GABAergic neurones in the VTA does not involve the BAR2- MEK-ERK signalling pathway. Western Blot results have shown that_PP2 and dasatinib inhibit the phosphorylation of c- Src. Data (not shown herein) confirms via Western blot that PP2 and dasatinib inhibit the phosphorylation of c-Src in SW620 cells. To generate these results, SW620 cells were incubated with PP2, dasatinib and PP3 (10 μΜ) and DMSO control for 24 hours prior to collection. Primary antibodies were used against actin (loading control) total c- Src and phosphorylated c-Src (pc-Src). Both PP2 and dasatinib reduced pc-Src with DMSO and PP3 had no effect. Data (not shown herein) also confirms via Western blot c-Src inhibition in DRG neurones following systemic administration of PP2 and dasatinib. Dasatinib but not PP2 exhibited a reduction in pc-Src in DRG neurones collected post mortem from drug treated WT mice. GAPDH was used as a loading control for these experiments.

Further data (as discussed in relation to the Figures herein) demonstrates that the c-Src inhibitor dasatinib inhibits the development of morphine tolerance in WT mice. Dasatinib did not significantly alter baseline tail withdrawal when compared to vehicle injection on day 1 , t test p = 0.14, n = 8 in each group. Administration of dasatinib (5 mg/Kg) prior to the administration of morphine (10 mg/Kg) prevented the development of tolerance in WT mice, two way repeated measures ANOVA time p = 0.009, dasatinib administration p = 0.002. WT mice treated with dasatinib prior to morphine administration exhibited significantly more analgesia on day 10 compared to the vehicle treated mice, unpaired t test p = 0.003, n = 8 in each group. Dasatinib administration did not produce persistent analgesia in WT mice over a 10 day administration period, two way repeated measures ANOVA, time p = 0.2, treatment p = 0.8. Vertical lines represent ± SEM. *, p < 0.05, **, p < 0.01 , ***, p < 0.001 .

Additional data (as discussed in relation to the Figures herein) demonstrates that c-Src inhibition inhibits morphine tolerance in MOP+/- mice. Dasatinib does not cause basal analgesia in MOP+/- mice. Tail withdrawal times (not shown) and MPE 30 minutes after either vehicle or dasatinib injection were not significantly different, t test p = 0.1 1 n = 8 in each group. PP2 does not cause basal analgesia in MOP+/- mice. The tail withdrawal times (not shown) and MPE are not significantly different for the PP2 treated mice when compared to those that have received PP3, t-test p = 0.64, n = 12 in each group. Dasatinib (5 mg/kg) administered 30 minutes prior to morphine (10 mg/Kg) prevented the development of significant morphine tolerance in MOP+/- mice, two way repeated measures ANOVA, time p < 0.0001 , dasatinib treatment p = 0.0005, post hoc Bonferroni results are shown on the graph, n = 8 in each group. PP2 also inhibits the development of morphine tolerance. PP2 (5mg/Kg) administered IP 30 minutes prior to subcutaneous morphine (10 mg/Kg) administration prevented the morphine tolerance observed in the PP3 (5 mg/Kg IP) treated mice, two way repeated measures ANOVA, time p < 0.0001 , drug difference p < 0.0001 , post hoc Bonferrroni results are shown on the graph. Each treatment group was n = 12, (5 female and 7 male). Dasatinib reversed the development of tolerance in MOP+/- mice. 16 mice (5 male and 3 female in each group) were treated with morphine (10 mg/Kg) daily for three days, on days 4 and 5 one group received dasatinib (5 mg/Kg IP) 30 minutes prior to subcutaneous morphine administration and the other group received a vehicle injection at the equivalent time. The mice that received dasatinib exhibited a significantly greater morphine analgesia compared to the vehicle treated mice; two way repeated measures ANOVA revealed a significant difference between the two groups on days 4 and 5. The post hoc Bonferroni test results are shown on graph. Vertical lines represent ± SEM. *, p < 0.05, **, p < 0.01 , ***, p < 0.001 .