Treatment and prevention of diseases

Background

The present application relates to treatment and prevention of inflammatory diseases and conditions, including autoimmune diseases and those diseases characterized by an uncontrolled immune response.

Electrophilic molecules have gained attention for their roles in mediating inflammatory processes. Upon generation, these molecules contain electron-poor atoms (electrophiles) that seek out nucleophilic residues commonly found in nucleotides, amino acids, and other small molecules throughout the cell, thereby leading to a Michael addition reaction. While this reaction is reversible, nucleophilic functional groups on proteins (cysteine, lysine, and histidine residues) are prone to adduct formation from electrophiles, potentially altering the signaling or enzymatic functionality depending on the location of the post translational modification (PTM). In some instances, electrophilic molecules can have immunomodulatory properties, such as Tecfidera (dimethyl fumarate (DMF). Tecfidera has been approved for the treatment of MS and psoriasis for decades, though the specific mechanism of action of DMF remains widely unknown.

Summary

In one aspect, the present disclosure provides a method of modulating inflammatory cytokines including TNFa, IL-6, IL- lb, CXCL-10, IRAK4, major histocompatibility complex II (MHC II), and NFKB in a subject. According to some embodiments, expression and / or secretion of at least one of TNFa, IL-6, IL-lb, CXCL- 10, IRAK4, major histocompatibility complex II (MHC II), and NFKB in the cell of a subject is provided by the methods herein. In some instances, the cell is a white blood cell, such as a macrophage. In other instances, the cell is a cancer cell, for example expressing IRG1. According to some embodiments of the disclosure, the methods herein include modulating levels of itaconate. According to some embodiments, methods herein include modulating levels of itaconate by administration of non-endogenous itaconate and / or an itaconate mimetic. According to some embodiments, levels of itaconate are modulated endogenously. In some embodiments, endogenous modulation of itaconate includes modulation of expression of IRG1, such as by administering one or more of: a silencing RNA, such as a short interfering RNA (siRNA) targeting the IRG1 gene, activating RNA (aRNA) targeting IRG1 gene region, and subjecting the cell to CRISPR using a guide RNA (gRNA) which will alter the nucleotide sequence of the IRG1 gene in the genome of the subject. Although the concept of targeting genes and other biological targets is known appreciated in the art, a nucleic acid may be said to “target” a gene or other nucleic acid if it is able to hybridize to a sequence of that gene or other nucleic acid and induce its desired effect.

In one aspect, the present disclosure provides a method of treating or preventing a disease or a condition in a subject. In some aspects, the present disclosure includes decreasing expression and / or secretion of at least one of IFNP, TNFa, IL-6, IL-lb, CXCL-10, IRAK4, and NFKB in a cell in a subject. In some instances, the cell is a white blood cell, such as a macrophage. In other instances, the cell is a cancer cell expressing IRG1. According to some instances, the method includes modulating levels of itaconate. According to some instances, levels of itaconate are modulated endogenously including modulating levels of IRG1 expression as disclosed herein. In some embodiments, levels of itaconate are modulated by administration of non-endogenous itaconate. In some embodiments, IRG1 expression is increased. In some such embodiments, itaconate levels are increased. According to some embodiments, the disease or condition may be selected from the group consisting of, Aicardi-Goutieres syndrome, systemic lupus erythematosus, type I diabetes, rheumatoid arthritis, Sjogrens syndrome, dermatom ositis, chilblain lesions necrotizing vasculitis, interstitial lung disease, panniculitis lipodystrophy, spondyloenchondro-dysplasia rheumatoid arthritis, sickle cell disease, juvenile idiopathic arthritis, ankylosing spondylitis, Crohn’s Disease, ulcerative colitis, plaque psoriasis, hidradenitis suppurativa, uveitis, arthritis, experimental autoimmune encephalomyelitis, multicentric Castleman’s disease, pristane-induced lupus, plasmacytoma, giant cell arteritis, systemic sclerosis-associated interstitial lung disease, cytokine release syndrome, COVID-19, systemic sclerosis, polyarticular juvenile idiopathic arthritis, or systemic juvenile idiopathic arthritis, cryopyrin-associated periodic syndrome, tumor necrosis factor receptor-associated periodic syndrome, hyperimmunoglobulin D syndrome/mevalonate kinase deficiency, familial Mediterranean fever, Still disease, pelvic inflammatory disease, granuloma inguinale, donovanosis, infections including plague, tularemia, and meningitis; bacterial infection, infections of the blood, abdomen (stomach area), lungs, skin, bones, joints, and urinary tract, lupus, inflammatory bowel disease, Hodgkin lymphoma, diffuse large B-cell lymphoma, mucosa-associ ted lymphoid tissue lymphoma, primary effusion lymphoma, adult T-cell lymphoma/leukemia, ulcerative colitis, psoriatic arthritis, multiple sclerosis, celiac disease, and Parkinson's disease. In some embodiments, IRG1 expression is decreased. In some such embodiments, itaconate levels are decreased. According to some embodiments, the disease or condition may be selected from the group consisting of cancer, such as oral squamous cell carcinoma, colorectal cancer, hepatocellular carcinoma, breast cancer and myeloma

According to some embodiments of the methods provided herein, IRG1 expression is increased. Such methods may include administering to the subject one or more of subjecting the cell to CRISPR or zinc-finger nuclease to the IRG1 gene in the genome of the subject or activating RNA (aRNA).

Additionally, the methods of the present disclosure may include inhibiting an activity of IRG1. Such methods may include administering to the subject one or more of an IRG1 inhibitor, such as citraconate. The method may include decreasing expression of IRG1, such as by administering a silencing RNA, such as a short interfering RNA (siRNA) targeting the IRG1 gene to the cell, or by subjecting the cell to CRISPR using a guide RNA (gRNA) which will alter the nucleotide sequence of the IRG1 gene in the genome of the subject.

In some instances, blood may be collected from patients to be treated, and target cells (such as macrophages, monocytes, or so forth) isolated. These cells would then be treated with the nucleic acid to increase expression or activity of IRG1, or to silence it, and then be reintroduced to the circulatory system of the patient.

In one aspect, the present disclosure provides a method of treating or preventing a disease or condition in a subject, which includes decreasing IFNP production by reducing a quantity of endogenously-produced itaconate in a cell. In some instances, the cell is a white blood cell, such as a macrophage. The method may include inhibiting an activity of IRG1. The method may include administering to the subject one or more of an IRG1 inhibitor, such as citraconate. The method may include decreasing expression of IRG1, such as by administering an interfering RNA to the subject, or by subjecting a cell of the subject to CRISPR. The disease or condition may be selected from the group consisting of, Aicardi-Goutieres syndrome, systemic lupus erythematosus, type I diabetes, rheumatoid arthritis, Sjogrens syndrome, dermatomyositis, chilblain lesions necrotizing vasculitis, interstitial lung disease, panniculitis lipodystrophy, and spondyloenchondro- dysplasia.

In one aspect, the present disclosure provides a method of decreasing interferon beta (IFNP) secretion by a cell, including reducing a quantity of endogenously -produced itaconate in the cell. In some instances, the cell is a white blood cell, such as a macrophage. The method may include inhibiting an activity of IRG1. The method may include administering to the subject one or more of an IRG1 inhibitor, such as citraconate. The method may include decreasing expression of IRG1, such as by administering an interfering RNA to the subject, or by subjecting a cell of the subject to CRISPR.

In one aspect, the present disclosure provides a method of treating or preventing a disease or condition in a subject, which includes increasing IFNP production or secretion by increasing a quantity of endogenously-produced itaconate in a cell. In some instances, the cell is a white blood cell, such as a macrophage. The method may include administering to the subject one or more of itaconate and / or a mimetic, as described herein. The disease or condition may be selected from the group consisting of multiple sclerosis and relapsing-remitting multiple sclerosis (RRMS).

In another aspect, a method of treating or preventing a disease or a condition in a subject, including administering to the subject at least one of itaconate and / or a mimetic. The method may include decreasing production of TNF alpha (TNFa) in the subject. The method may include decreasing secretion of TNF alpha (TNFa) by a cell. The method may include increasing the quantity of endogenously-produced itaconate by a cell of the subject. The disease or condition may be rheumatoid arthritis, sickle cell disease, juvenile idiopathic arthritis, ankylosing spondylitis, Crohn’s Disease, ulcerative colitis, plaque psoriasis, hidradenitis suppurativa, and uveitis. In another aspect, the method may include attenuating a response to lipopolysaccharide (LPS), resiquimod (R848), polyinosinic:polycytidylic acid (Poly (I:C)), or cyclic [G (2’,5’)pA (3’,5’)p] (2,3 cGAMP) in the subject. In one aspect, the response to the disease or condition may involve activation of Toll-like receptor (TLR) 4 (TLR4), TLR3, TLR7, TLR8, and/or cGAS/STING. In some aspects, the method may include attenuating a response to viral or bacterial infection. In one aspect, the method may include decreasing production of IL-6 in the subject. In one aspect, the method may include decreasing secretion of IL-6 by a cell of the subject. The method may include increasing the quantity of endogenously -produced itaconate by a cell of the subject. In some embodiments the method may include administering itaconate or an itaconate mimetic to the subject. The disease or condition may be arthritis, experimental autoimmune encephalomyelitis, multicentric Castleman’s disease, pristane-induced lupus, plasmacytoma, rheumatoid arthritis, giant cell arteritis, systemic sclerosis-associated interstitial lung disease, cytokine release syndrome, COVID-19, systemic sclerosis, polyarticular juvenile idiopathic arthritis, or systemic juvenile idiopathic arthritis.

In one aspect, the method may include decreasing production of IL-lb in the subject. The method may include decreasing secretion of IL-lb by a cell of the subject. The method may include increasing the quantity of endogenously-produced itaconate by a cell of the subject. In some embodiments the method may include administering itaconate or an itaconate mimetic to the subject. The disease or condition is selected from the group consisting of: cryopyrin-associated periodic syndrome, tumor necrosis factor receptor- associated periodic syndrome, hyperimmunoglobulin D syndrome/mevalonate kinase deficiency, familial Mediterranean fever, Still disease, or systemic juvenile idiopathic arthritis.

In one aspect, the method may include decreasing production of CXCL10 in the subject. The method may include decreasing secretion of CXCL10 by a cell of the subject. The method may include increasing the quantity of endogenously-produced itaconate by a cell of the subject. In some embodiments the method may include administering itaconate or an itaconate mimetic to the subject. The disease or condition may be pelvic inflammatory disease, granuloma inguinale, donovanosis, infections including plague, tularemia, and meningitis; bacterial infection; and infections of the blood, abdomen (stomach area), lungs, skin, bones, joints, and urinary tract.

In an aspect, the method may include reducing IRAK4 activity or expression in the subject. The method may include administering to the subject at least one itaconate and/or mimetic. The disease or condition may be lupus, rheumatoid arthritis, plaque psoriasis, and inflammatory bowel disease. In one aspect, the method may include reducing NFKB activity or expression in the subject. The method may include reducing NFKB expression in the subject. The method may include administering to the subject at least one itaconate and/or mimetic. The disease or condition may be Hodgkin lymphoma, diffuse large B-cell lymphoma, mucosa-associated lymphoid tissue lymphoma, primary effusion lymphoma, adult T-cell lymphoma/leukemia, ulcerative colitis, Crohn's disease, rheumatoid arthritis, systemic lupus erythematosus, psoriatic arthritis, giant cell arthritis, type 1 diabetes, multiple sclerosis, celiac disease, and Parkinson's disease, as well as susceptibility of several cancers, such as oral squamous cell carcinoma, colorectal cancer, hepatocellular carcinoma, breast cancer and myeloma.

In an aspect, the method may include decreasing expression of the major histocompatibility complex II (MHC II) expression in the subject. The method may include administering to the subject at least one itaconate and/or mimetic.

In an aspect, the method may include reducing or preventing an inflammatory response in a subject.

In an aspect, the disease or condition may be an autoimmune disease or condition.

In one aspect, the present disclosure includes a method of treating a cancer in a patient. The method includes decreasing expression of IRG1 in a cell or tumor of the subject. The method may include administering a small interfering RNA targeting an IRG1 gene to the cell or tumor. In another aspect, the method may include administering a small molecule inhibitor of IRG1 to the patient.

In an aspect, the present disclosure provides a method of upregulating glycolysis and/or gluconeogenesis by reducing a quantity of endogenously-produced itaconate in the subject or cell. The method may include upregulating glycolysis and/or gluconeogenesis by reducing a quantity of endogenously-produced itaconate, such as by reducing IRG1 expression and/or activity.

In an aspect, the present disclosure provides a THP-1 cell which lacks IRG1 activity or expression.

In an aspect, the present disclosure provides a method of reducing ubiquitin levels in a cell. In one aspect, the method may include decreasing an activity of IRG1 in the cell. In one aspect, the method may include decreasing a quantity of endogenous itaconate in the cell. In an aspect, the present disclosure provides a method of decreasing proteosomal degradation in a cell. In one aspect, the method includes decreasing an activity of IRG1 in the cell. In another aspect, the method includes decreasing a quantity of endogenous itaconate in the cell.

In one aspect, the present disclosure provides a method of increasing ubiquitin levels in a cell, including contacting the cell with an itaconate mimetic. In one aspect, the present disclosure provides a method of increasing proteosomal degradation in a cell, including contacting the cell with an itaconate mimetic.

Brief Description of the Drawings

FIG. l is a schematic illustrating certain human inflammatory/immune pathways;

FIGs. 2A-2E and 3 A-3D illustrate results of assays conducted on human macrophages treated to reduce or eliminate IRG1 expression;

FIGs. 4A-4C and 5A-5E provide parameters for and results of RNAseq analysis in IRG1 knockout cells relative to wild type;

FIGs. 6A-6E illustrate (6A) a scheme for and (6B-6E) results of a proteomic study of IRG1 knockout cells;

FIGs. 7A-7D provide bar graphs quantifying amounts of various cytokines before and after treatment of IRG1+ and IRG1- cells;

FIGs. 8A-8L illustrate the impact of itaconate mimetics such as dimethyl fumarate (DMF) and monomethyl fumarate (MMF) on mRNA levels and protein expression;

FIGs. 9A=9F provide bar graphs quantifying mRNA levels for various cytokines before and after treatment of IRG1+ and IRG1- cells with various stimulants;

FIGs. 10A-10D illustrate the effect of stimulants (including cGAMP and poly I:C) on transcription and protein levels in cells; FIGs. 11 A and 1 IB depict IRG1 protein levels as regulated via various cellular pathways (including TBK1 and IRF3);

FIGs. 12A-12D illustrate the impact of IRG1 knockout on transcription involving NFKB and on protein ubiquitination levels; and

FIGs. 13A-13E provide several graphs demonstrating the consequences of IRG1 silencing in primary human macrophages and induced pluripotent stem cells (IPSCs).

Detailed Description

The present disclosure provides methods of modulating inflammatory cytokines through modulation of aconitate decarboxylase (ACOD1, also known as and referred to throughout as IRG1) and a catalytic product thereof, itaconate, via endogenous expression of IRG1 or itaconate, or administration of an itaconate and / or an itaconate mimetic. It further provides methods of treatment and prevention of diseases and conditions in subjects, including inflammatory and autoimmune diseases, comprising modulating inflammatory cytokines through modulation of aconitate decarboxylase (ACOD1, also known as and referred to throughout as IRG1) and a catalytic product thereof, itaconate, via endogenous expression of IRG1 or itaconate, or administration of an itaconate and / or an itaconate mimetic.

A wide variety of electrophilic derivatives of the Krebs cycle-derived metabolite, itaconate, are immunomodulatory, yet these derivatives have overlapping and sometimes contradictory activities. Accordingly, the instant disclosure provides a genetic system to interrogate the immunomodulatory functions of endogenously produced itaconate in human macrophages. While not wishing to being bound by theory, it is believed that the production of itaconate is driven by multiple innate danger signals where it restrains inflammatory cytokine production. Endogenous itaconate directly targets cysteine 13 in IRAK4 disrupting IRAK4 autophosphorylation and activation, drives the destruction of NFKB, and modulates global ubiquitination patterns. As a result, cells lacking the ability to make itaconate massively overproduce inflammatory cytokines such as TNFa, IL6, and IL- ip in response to multiple innate signaling pathways. In contrast, the present disclosure demonstrates that the production of IFNP downstream of LPS depends on the production of itaconate, and that itaconate and itaconate mimetics inhibit inflammatory cytokine production. Accordingly, disclosed herein are methods of inhibiting cytokine production by increasing the local concentration of itaconate and/or itaconate mimetics. .

As the instant disclosure provides, electrophilic molecules described herein react with nucleophilic residues commonly found in nucleotides and those found in proteins, such as cysteine, lysine, and histidine, which can alter signaling pathways or the enzymatic function of target proteins. Since the late 1950s, electrophilic derivatives of fumarates such as the mixture found in FUMADERM™, dimethyl fumarate (TECFIDERA™), and monomethyl fumarate (BAFIERTAM™) have been used to treat autoimmune disorders such as psoriasis and Relapsing Remitting Multiple Sclerosis (RRMS), respectively. Although these molecules can modify KEAP1 thereby activating the antioxidant pathway regulated by NRF2, the mechanism of their immunosuppression remains largely undefined. Relatively recently, itaconate was identified as an upregulated metabolite in activated Ml inflammatory macrophages where it functions as an immunomodulatory electrophile.

As disclosed herein, itaconate is produced in response to the immune-responsive gene 1 (IRG1), also known as ACOD1, which was found as a gene strongly upregulated by LPS. IRG1 encodes the enzyme aconitate decarboxylase which converts the Krebs cycle intermediate cis-aconitate into itaconate, which can accumulate both intracellularly and extracellularly. After its production in cells, itaconate can be isomerized via the migration of the double bond to generate both mesoconate and citraconate with citraconate being the most electrophilic of these isomers, yet also the least studied. These molecules alkylate thiol groups in a wide array of proteins via 2,3-dicarboxypropylation or itaconylation, yet the functions of these modifications are still being deciphered. In addition to the production of these isomers, cells can also convert itaconate to itaconyl-CoA, whose accumulation, due to genetic mutations in CLYBL, leads to a deficiency in circulating vitamin B12. Although several reports have demonstrated that itaconate can make its way into a variety of cells, several early studies demonstrated that itaconate added to cells required millimolar concentrations and/or long incubation times to have effect. Therefore, esterified derivatives of itaconate were generated to increase cell permeability with the potential to release free itaconate due to the inherent esterase activity within the cell including 4-monoethyl itaconate (4EI), dimethyl itaconate (DI), and 4-octyl itaconate (401). Currently, there is debate as to whether these molecules are de-esterified to generate free itaconate within the cell, and it is likely that their de-esterification would be cell type and activation statusdependent.

Inflammation is a driver of a diverse set of human pathologies and molecules such as dimethyl fumarate (DMF) and monomethyl fumarate (MMF) have demonstrated an ability to suppress autoimmunity. 401 and similar itaconate derivatives demonstrate therapeutic benefit in pre-clinical models of inflammatory and infectious disease such as multiple sclerosis, pulmonary fibrosis, sepsis, cardiovascular disease, SARS-CoV-2 infection, lupus, and diabetic wound repair. However, improvements on the clinical efficacy associated with DMF and MMF, which have not been improved upon since the 1950s, would be valuable.

Interestingly, itaconate derivatives have overlapping, non-overlapping, and sometimes contradictory activities. For example, as disclosed herein, the ability to activate NRF2 is directly linked to the electrophilicity of itaconate and its derivatives, with itaconate being a weak electrophile while DI a strong electrophile. As such, DI is much a stronger NRF2 activator. DI is also a strong inhibitor of IKB^ expression, while the less electrophilic derivative 4EI is unable to repress IKB^ expression in the same model. In resting macrophages, neither DI nor 4OI led to the accumulation of itaconate, suggesting that these molecules are not effective pre-cursors for the intracellular accumulation of itaconate, at least without stimulation. DI and 401 also induce strong electrophilic stress responses in WT bone marrow-derived macrophages (BMDMs), while 4EI and exogenously added itaconate showed comparatively minimal NRF2 activation. Interestingly, BMDMs pretreated with itaconate showed enhanced production of IFNP while 401, DI, and 4EI did not. The diverse set of activities attributed to exogenously added itaconate provided herein, and its derivatives, which have overlapping, divergent, and sometimes contradictory activities, highlight the paucity of information regarding the targets and pathways regulated by endogenously produced itaconate in human macrophages.

The present disclosure provides a genetic system to better understand the immunomodulatory role of endogenously produced itaconate and its downstream metabolites in human macrophages. The present disclosure demonstrates that endogenously produced itaconate is a critical and broad negative regulator of inflammation that downregulates antigen presentation, inhibits MYC-dependent transcription, and a is a key negative regulator of inflammatory cytokine production. Additionally, the present disclosure discloses for the first time that itaconate production is driven by multiple innate immune signaling pathways including TLR3, TLR4, TLR7/8, and cGAS/STING, and that the loss of IRG1 /itaconate leads to the unrestrained production of TNFa, IL6, ILip, and CXCL10. Conversely, this disclosure demonstrates that the production of IFNP downstream of LPS depends upon the production of itaconate, yet itaconate itself is not sufficient to drive IFNP production. Using differential proteomics, IRAK4 and multiple components of the NFKB signaling pathway were identified, as well as several components of ubiquitin-mediated degradation including multiple El, E2, and E3 enzymes as critical targets of itaconate. The present disclosure provides evidence that endogenous itaconate negatively regulates the production of inflammatory cytokines through the inhibition of IRAK4 and by driving the degradation of NFKB. Together these data identify itaconate production in human macrophages as a critical negative regulator of innate-driven inflammation.

FIG. 1 provides a summary view of itaconate-related response pathways in a cell. Briefly, extracellular stimuli provoke a response in an immune cell in a pathway depending on the intracellular adapter protein MyD88 (for example, bacterially-derived lipopolysaccharides (LPS), which may indicate infection and/or sepsis, or single stranded RNA which can be evidence of a viral infection) or in a MyD88-independent fashion (again, LPS; double-stranded RNA, which can be evidence of viral infection; or free DNA, a sign of possible cellular stress or viral infection.) Generally, these stimuli are identified and transduced across the cell membrane by a toll -like receptor (TLR), setting off a signaling cascade within the cell that produces and/or responds to itaconate, which in turn generally suppresses the production of inflammatory cytokines. Itaconate, and the enzyme IRG1 that synthesizes it, are held in strict balance by the cell: generating too much itaconate, or for too long, can yield a threat to the subject that can go unmet; not enough, and the subject may have an uncontrolled and deleterious inflammatory response. Therefore, there is a need for therapies that aid in bringing itaconate-involved responses into balance.

As used herein, an “itaconate mimetic” means a compound that acts on a cell in similar way to itaconate. Some itaconate mimetics may covalently modify the protein targets of itaconate or may give rise to downstream cellular responses similar to those elicited by itaconate, or both.

As used herein, “subject” means a mammal, such as a human, with a condition, disease, disorder or symptom requiring treatment or therapy, including for example, those listed herein. In particular, the individual to be treated is a human.

As used herein, “effective amount” means an amount or dose of one or more itaconate mimetics described herein, or a pharmaceutically acceptable salt thereof that, upon single or multiple dose administration to an individual in need thereof, provides a desired effect in such an individual under diagnosis or treatment (z.e., may produce a clinically measurable difference in a condition of the individual). An effective amount may be determined by one of skill. In determining the effective amount for an individual, a number of factors are considered, including, but not limited to, the species of mammal, its size, age and general health, the specific disease or disorder involved, the degree of or involvement or the severity of the disease or disorder, the response of the individual, the particular itaconate mimetic administered, the mode of administration, the bioavailability characteristics of the preparation administered, the dose regimen selected, the use of concomitant medication, and other relevant circumstances.

Materials and Methods

Chemical Reagents

All assays performed were done using the following reagents: Phorbol 12-myristate 13-acetate (PMA;MilliporeSigma; P8139), 2-Mercaptoethanol (PME; Gibco; 21985-023), Lipopolysaccharides from Escherichia coli 055 :B5 (LPS; MilliporeSigma; L2880), Recombinant Human IFN-gamma Protein (IFNy; R&D Systems; 285-IF), Dulbecco's Phosphate-Buffered Saline (PBS; Gibco; 14-190-144), Resiquimod (R848; MilliporeSigma; SML0196-10MG), 2,3-cGAMP (cGAMP; Invivogen; tlrl-nacga23-5), Polyinosinic-polycytidylic acid sodium salt (POLY EC; MilliporeSigma; P1530-25mg), Dimethyl Fumarate (DMF; MilliporeSigma; 242926-25G), Monomethyl Fumarate (MMF; MilliporeSigma; 2756-87-8), Itaconate (MilliporeSigma; I29204-100G) made to a pH of 7.4 in PBS, 4-octyl itaconate (4OI) (MilliporeSigma; SML2338), TBK1 inhibitor (International Patent Publication No. WO2016057338A1). Generation of IRG1 KO THP-1 Cells

THP-1 cells (ATCC: TIB-202) were electroporated with crRNA + tracrRNA + Cas9 Nuclease (Integrated DNA Technologies: Hs.Cas9.ACODl. lAC; 1072532; 1081061; crRNA Sequence: UAUGUGAAACACUUCCGUAGGUUUUAGAGCUAUGCU (SEQ ID NO: 1); tracrRNA sequence:

AGC AU AGC A AGU U A A AAU A AGGC U AGU C C GUU AU C A ACU U G A A A A AGU GG CACCGAGUCGGUGCUUU (SEQ ID NO: 2)) on 4D-Nucleofector System (Lonza: AAF-1002B with AAF-1002X). A single IRG1 knock out THP1 cell clone was selected and confirmed by negative IRG1 protein production, negative itaconate production and RNA sequencing.

Culture of THP-1 cells

WT and IRG1 KO THP-1 cells were cultured in RPMI 1640 (RPMI; Gibco; A10491-01) with IX PME and 10% Heat Inactivated Fetal Bovine Serum (HI FBS; Gibco; 10082-147) up to a confluency of 1.0 x 10 ⁶ cells/mL. IRF3 KO THP-1 cells (Invivogen; thpd-koirf3) were cultured in RPMI 1640 (RPMI; Gibco; A10491-01) with 10% Heat Inactivated Fetal Bovine Serum (HI FBS; Gibco; 10082-147) up to a confluency of 1.0 x 10 ⁶ cells/mL. Prior to stimulation, cells were differentiated with PMA (100 nM) for 72 hr at a ratio of 800,000 cells/ 1 mL. Cells were then washed with PBS and fresh media was added back to the cells upon stimulation.

Antibodies and Immunoblot Analysis

Whole cell lysates were extracted by incubating pelleted cells in Pierce IP lysis buffer (Thermo Scientific; 87787) made complete with Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific; 78441) on ice for twenty minutes. Protein samples were normalized using the Pierce BCA Protein Assay Kit (Thermo Scientific; 23225). Samples were run on 4-15% Tris-HCl gels (Bio-Rad; 3450029) and subsequently transferred onto nitrocellulose membranes (Bio-Rad; 1704159). Membranes were blocked with Blotting-Grade Blocker (Bio-Rad; 1706404) supplemented with .1% TBST for 1 hr and then incubated with the indicated antibodies overnight at 4°C. Membranes were then washed 3 times with 0.1 % TBST, incubated with the species-specific horseradish peroxidase-conjugated secondary antibodies (Cytiva; NA931V (Mouse) or NA934V (Rabbit)) for 1 hour, and washed three more times with .1% TBST. Lastly, immunoblots were incubated with Supersignal West Femto Maximum Sensitivity Substrate for 5 minutes and horseradish peroxidase activity was measured on the Amersham Imager 600 (GE). Antibodies used to detect proteins of interest are as follows: IRG1 (Cell Signaling; 77510), p-p65 (Cell Signaling; 3033S), p65 (Cell Signaling; 8242S), pl05/50 (Abeam; ab32360), IKBO. (Cell Signaling; 9242), A20 (Cell Signaling; 5630S), p-p38 (Cell Signaling; 451 IS), p38 (Cell Signaling; 8690S), Ubiquitin (Santa Cruz; SC-8017), p-IRAK4 (Cell Signaling; 11927S), IRAK4 (Cell Signaling; 4363S), MYD88 (Cell Signaling, 4283S), p-IRF3 (Cell Signaling; 37829S), IRF3 (Cell Signaling; 4302S), p-TBKl (Cell Signaling; 5483 S), TBK1 (Cell Signaling; 3504S), P-Actin (Novus Biologies; NB600-501), pro-IL-ip (R&D Systems, AF-401-NA), a-tubulin (Cell Signaling, 2148S), Lamin A/C (Cell Signaling, 4777S).

Measurement of metabolites by LC-MS

The LC-MS analysis of itaconate and TCA cycle intermediates was performed on a Shimadzu Nexera 30-series HPLC system coupled to a Sciex Triple Quad 5500 mass spectrometer. Cells (200,000 cells./well) were prepared as described above. The cell culture media was removed and stored for analysis, and cells were extracted in 200 pL of 80% methanol. On the day of analysis, 50 pL of cell extract was combined with 50 pL of internal standard solution in 80% methanol containing six isotope-labeled internal standards at 2000 ng/mL. Citric acid-2,2,4,4-d4 and succinic acid-2,2,3,3-d4 were obtained from MilliporeSigma (Burlington, MA), disodium alpha-ketoglutaric acid-l,2,3,4- ¹³ C4 and fumaric acid- ¹³ C4 were obtained from Cambridge Isotope Laboratories (Cambridge, MA), sodium L-lactate-3,3,3-d3 was obtained from C/D/N Isotopes (Pointe-Claire, Quebec, Canada) and itaconic acid- ¹³ C5 was obtained from Totonto Research Chemicals (Toronto, Ontario, Canada). For analysis of media samples, 10 pL of media was combined with 40 pL of methanol and 50 pL of internal standard solution. The analytes were separated on a Thermo Scientific Hypercarb Javelin HTS guard column (2.1 x 50 mm, 5 pm) with an injection volume of 5 pL and a flow rate of 1.25 mL/min using 10 mM tributylamine with 15 mM acetic acid in water for mobile phase A and 20 mM tributylamine with 30 mM acetic acid in acetonitrile for mobile phase B. The gradient was as follows: 0 min, 5% B; 0.1 min, 5% B; 0.6 min, 8% B; 1.9 min, 10% B; 2.0 min, 14% B; 3.0 min, 18% B; 3.1 min, 50% B; 3.5 min, 50% B; 3.6 min, 5% B; 5.5 min, stop. The analytes were detected using negative ion TurboIonSpray multiple reaction monitoring mode with conditions optimized for each analyte. Analyte concentrations were back-calculated using Sciex MultiQuant 3.0 based on the analyte/internal standard ratios referenced to calibration curves prepared in water.

The LC-MS analysis of phosphate-containing glycolytic intermediates was performed on a Shimadzu Nexera 30-series HPLC system coupled to a Sciex Triple Quad 5500 mass spectrometer. Cells (200,000 cells/well) were prepared as described above. The cell culture media was discarded, and cells were extracted in 200 pL of 80% methanol. On the day of analysis, 50 pL of cell extract was combined with 50 pL of internal standard solution in 80% methanol containing three isotope-labeled internal standards at 1000 ng/mL. D-Glucose 6-phosphate- ¹³ Ce, 2-deoxy-2-fluoro-D-glucose 6-phosphate- ¹³ Ce and D-fructose l,6-bisphosphate- ¹³ Ce were obtained from Omicron Biochemicals (South Bend, IN). The analytes were separated on a Thermo Scientific Hypercarb Javelin HTS guard column (2.1 x 50 mm, 5 pm) with an injection volume of 5 pL and a flow rate of 1.25 mL/min using 10 mM tributylamine with 15 mM acetic acid in water for mobile phase A and 20 mM tributylamine with 30 mM acetic acid in acetonitrile for mobile phase B. The gradient was as follows: 0 min, 5% B; 0.5 min, 5% B; 3.5 min, 40% B; 4.0 min, 40% B; 4.1 min, 5% B; 5.6 min, stop. The analytes were detected using negative ion TurboIonSpray multiple reaction monitoring mode with conditions optimized for each analyte. Analyte concentrations were back-calculated using Sciex MultiQuant 3.0 based on the analyte/internal standard ratios referenced to calibration curves prepared in water.

RNA interference

50 nM of pre-designed silencer select siRNAs targeting human IRG1 (Thermo Fisher, s60727) or negative control (Thermo Fisher, 4390843 (scramble)) were transfected into human macrophages using the K4 transfection system (Biontex) as per the manufacturer’s instructions. Cells were transfected in RPMI medium without serum and antibiotics, which was replaced with complete medium 8 h later. Cells were subsequently left for a further 64 h before treatment. qRT-PCR Analysis

Total RNA was extracted from THP-1 cells with the use of both QIAshredder (Qiagen; 79656) and RNeasy Kits (Qiagen; 74104). Equal amounts of RNA was then converted to cDNA using High Capacity cDNA Reverse Transcription Kits (Applied Biosystems; 4368814). qRT-PCR was performed using the Taqman Fast Advanced Master Mix (Applied Biosystems; 4444557) on the QuantStudio 7 Flex System (Applied Biosystems). Taqman probes used to analyze transcripts of interest are as follows: TNFa (Invitrogen; Hs00174128), IFNfi (Invitrogen; Hs01077958), IL-6 (Invitrogen; Hs00174131), IL-l (Invitrogen; Hs01555410), ACOD1 (Invitrogen; Hs00985781), ICAM1 (Invitrogen; HsOO 164932), CXCL10 (Invitrogen, Hs00171042). GAPDH (Applied Biosystems; 4310884E) was used an internal control gene to determine relative fold changes using the AACT method.

Cytokine Analysis

ELIS As for THP-1 cell studies were performed using R&D Systems Human DuoSet ELISA Kits including TNFa (DY210-05), IL-ip (DY201-05), IL-6 (DY206-05), IFNP (DY814-05), CXCL10 (DY266-05) according to the manufacturer’s instructions. ELISAs for the whole blood assays were performed using the Human Proinflammatory II (4-Plex) Kit by Mesa Scale Discovery (K15053D-2) according to the manufacturer’s instructions.

RNAseq data pre-processing

RNAseq was performed on an Illumina NovaSeq 6000 using the Roche KAPA HyperPrep with RiboErase mRNA Library Prep Kit with paired end sequencing, read length of 150 bp, and targeted read depth of 80-1 OOM reads/sample. Raw FastQ files were quality- and adapter-trimmed using cutadapt (cutadapt- 1.9.1) and aligned using GSNAP (v2013-l l-27, command line parameters -B 5 -A sam -N 1 -t 8 -s splicesites —qualityprotocol sanger —gunzip —sam -multiple-primaries — maxsearch=1000 — npaths=100) to build 37. p5 of the human genome. Read counts were generated against exons annotated in NCBI gene models (NCBI h37.pl3 annotation) using a custom Perl script, then summarized at the gene level as the log2 of mean exon reads and quantile-normalized using a custom R script. Gene-level relative expression levels were estimated using log2 transformed mapped read counts for each exon associated with the gene and fitting a robust linear regression model of the form: log2(countsi,j) ~ Samplei + Exonj + ei,j using the rim function in R (W. N. Venables, 2002). Sample-level estimates of relative gene expression were obtained from the least squares means estimate from the model fit. These estimates of relative gene expression were then normalized using a quantile normalization procedure (Bolstad, 2021). Log2 transformed gene expression values were used for all downstream analysis.

Differential expressed genes

Only protein coding genes were used in the analysis. A two-factor linear regression full model was fitted for the gene expression values for each of genes in the data set using limma R package (Ritchie et al., 2015). Expression ~ Treatment+Genotype+Expression ^Genotype

Treatment: Vehicle = 0, LPS + IFNg = 1; Genotype: Wild type = 0, Knock out = 1.

Genes showing differential response to treatment in wild type and knock out cell lines were identified by using criterial of fold change > 2, adjusted p values (multi -testing corrected with Benjamini -Hochberg procedure) for the interaction term Expression ^Genotype and with mean expression value > 3 across all samples. Differential expressed genes were identified for three time points 6, 12 and 24 hours independently.

Pathway analysis

Gene set enrichment analysis (GSEA) was performed using fgsea R package (Korotkevich et al., 2021) using default parameters and for three timepoints separtately. Genes were ranked by fold change from the linear model terms and GSEA was conducted against the Hallmark and Reactome gene sets from mSigDB. Normalized enrichment scores were used for heatmaps. Top leading edge genes for the enrichment were identified by selecting gene with fold change > 2 from the leading edge genes in GSEA.

Thiol-Reactive Probe ABPP

WT and IRG1 KO THP-1 cells were differentiated for 72 hours with phorbol 12- myristate 13-acetate (100 nM) and then stimulated with LPS (200 ng/mL) and IFNy (200 ng/mL) for 0, 6, and 24 hours. After stimulation, the cells were harvested and stored at -80 °C till ready for Thiol-Reactive Probe ABPP.

The Thiol -Reactive Probe ABPP was performed as described previously (Wijeratne et al. 2018). Briefly, the cells were lysed with 500 pL lysis buffer (DPBS, 1% NP-40) on ice for 10 minutes. The cell lysates were collected by centrifugation at 20,000 x g for 20 minutes. The protein concentrations were determined using the BCA protein assay (Pierce, cat# 23225) and diluted to 2 mg/mL. 500 pL cell lysates were mixed with 500 pL 12 M Urea in 200 mM Tris pH 8, and then labeled with 100 pM thiol -reactive probes (Compound 1 as described in “Chemical Proteomic Characterization of a Covalent KRASG12C Inhibitor,” ACS Med. Chem. Let. 2018 9(6), 557-562 for THP-1 IRG1 KO cells and Compound 2 for THP-1 WT cells; structures reproduced in Table 1 below) at room temperature in the dark for 1 hour. The reactions were quenched with 100 mM DTT at 65°C for 20 minutes. The probe Compound 1 labeled THP-1 IRG1 KO samples and probe Compound 2 labeled THP-1 WT samples were first combined and then desalted using Zeba spin desalting column (7K MWCO, 5 mL) following manufacturer's instructions. The desalted samples were digested with 10 ug sequencing grade modified trypsin (Promega, cat# V5111) at 37°C overnight. The digested sample were diluted with 200 pL of 10X binding buffer (10X PBS, 10% Triton, 5% Tergitol, 10 mM EDTA) for Streptavidin enrichment.

Table 1: Thiol-reactive probes Streptavidin Enrichment

Each biological replicate was divided into two equal aliquots of 700 pL. Each aliquot was loaded onto Agilent Technologies Streptavidin Tips (cat# G5496-60010) that are compatible with Agilent Bravo AssayMap using the vender defined application, "Affinity Purification 1.0". Briefly, the tips were washed two times with PBS, first with 100 pL at 300 pL/min and second with 50 pL at 10 pL/min. The digested samples (i.e. 700 pL eq.) were then loaded onto the tips at 10 pL/min. The tips were then washed twice with double distilled water (250 pL) at 10 pL/min and subsequently eluted with 1/1 (v/v) acetonitrile/0.1% formic acid (50 pL) at 10 pL/min. The resulting samples were dried under vacuum, solubilized in 10 pl 20% acetonitrile (Fisher Chemical, A996-4), 20% acetic acid (EMD, AX0073-6) in water. Solubilized samples (10 pl) were diluted to 100 pl in 0.1% formic acid water (Burdick & Jackson, LC 452-4) solution prior to analysis by mass spectrometry.

LC-MS analysis: lodoacetamide-alkyne & Itaconate-alkyne captures

LC Conditions: An Ultimate 3000 HPLC HPLC system was run at 300 nL/ minute at 1% B with Solvent A as 0.1 % formic acid in water (Thermofisher Optima LSI 18-4) and Solvent B as 0.1% formic acid in acetonitrile (Thermofisher Optima LS120-4). Ten microliters of each sample was loaded onto a trap column (100 pm i.d. x 2 cm; Acclaim PepMap C18, 3 pm, 100 A; ThermoFisher 164564) in 0.1 TFA in water (Burdick & Jackson LC485-1) containing 3% acetonitrile (Thermofisher Optima LC/MS grade A996-4). Analytical column was the Thermo pepmap RSLC (75 pm x 50 cm, C18, 3 pm, 100A; Thermofisher ES803 A). Analytical column separation was at 300 nL/minute with gradient of solvent B consisting of 2 to 30% in 70 minutes followed by 6 minutes at 80% solvent B at 50°C. Michrom Bioresources bovine protein tryptic digest standards (lactoglobulin, lactoperoxidase, carbonic anhydrase, glutamante dehydrogenase, and albumin; catalogue numbers PN 60006, PN 60011, PN 60007, PN 60010, and PN 60012, respectively) were analyzed as instrument performance controls.

Mass Spectrometer Conditions:

A Thermo Fusion Lumos mass spectrometer was operated with the Thermo Easy

Spray source at +1800 volts. The acquisition was Top Speed mode with a parent MS at 1 second in the FT mode at resolution of 240000 for peptides at charge states 2-7 and dynamic exclusion for 60 seconds. Isolation mode was in the quadrupole with a window of 1.2 (m/z) with HCD fragmentation in the fixed collision energy mode. Ion fragments were detected in the ion trap under standard conditions.

LC-MS & mass spectrometer conditions: Thiol-ABPP Capture

Mass spectrometric result files were processed with the software program Proteome Discoverer 2.3 ™. For the file processing workflow, a standard complete human FASTA database was used with SequestHT as the search engine and trypsin as the digest enzyme. Dynamic modifications included 560.357 and 554.343 at cysteine for light and heavy thiol- abpp labels, oxidation at methionine and acetylation at the protein n-terminus. Peptide quantification was with the precursor ion quantifier module in Proteome Discoverer under standard conditions using Low Abundance Resampling as the imputation mode. Other software settings were under standard conditions.

Statistical Analysis

For each peptide sequence, comparisons of log2(abundance) between 24hr, 6hr, and Ohr were conducted for both THP1 wide-type (WT) cells and THP1 IRG1 knock-out cells using mixed-effect repeated-measure model. Peptide sequences that satisfying the following criteria were considered for further analysis: (1) have no significant difference across time in THP1 IRG1 knock-out cells (p. value > 0.05 and |fold change] < 2) and with coefficient of variation (CV) > 5%; (2) significantly different from Ohr at either 6hr or 24hr in THP1 WT cells (Benjamini -Hochberg q.value < 0.1 and fold change < -1.1, where indicates decrease from Ohr).

We used 4-parameter logistic regression to calculate utility scores of maximum fold change decrease between 6hr and 24hr (the larger the |fold change], the larger the utility), CV of peptides from THP1 WT (the smaller the CV, the larger the utility), and ratio of CV of peptides from THP 1 WT and IRG1 KO (the larger the ratio, the larger the utility). Weighted geometric means of the three utility scores were used to rank peptides. All analysis were conducted in R (version 4.0.3). Results

Endogenous production of itaconate is required for IFNp production yet negatively regulates TNFa

As disclosed herein, CRISPR-Cas9 technology can be used to knockout IRG1 in THP-1 cells. Upon cellular differentiation with PMA, THP-1 cells develop into and function similarly to primary human macrophages. Previously, it was demonstrated that LPS/IFNy strongly induces IRG1 in multiple cell types with the subsequent production of itaconate. As disclosed herein, several THP-1 clones (clone 1 utilized in all additional studies) were isolated that no longer express IRG1 protein and thus do not generate itaconate in response to LPS/IFNy treatment (FIG. 2A and 2B). Interestingly, time-course studies demonstrated that IRG1 protein is rapidly produced, becoming apparent within an hour of LPS/IFNy treatment (FIG. 2C).

Although LPS/IFNy induced detectable levels of IRG1 protein within an hour of treatment, significant accumulation of unbound intracellular itaconate did not occur until about 6 hours with extracellular accumulation only becoming apparent around 12 hours post treatment. Both intracellular and extracellular levels of itaconate reached a maximum by 24 hours following LPS/IFNy stimulation (FIG. 3 A). Recently, it was demonstrated that exogenously added itaconate enhanced the secretion of IFNP in response to LPS, while DI and 401 inhibited IFNP production. The present disclosure found that IRG1 and the production of endogenous itaconate are absolutely required for both the transcriptional upregulation and secretion of IFNP in response to LPS alone (data not shown) or LPS/IFNy treatment (FIG. 3B). In contrast, to previous reports using BMDMs from WT and IRG1 knockout mice, the results disclosed herein indicate that the loss of IRG1 /itaconate lead to a massive increase in the transcription and secretion of TNFa in response to LPS/IFNy, suggesting that endogenously produced itaconate negatively regulates TNFa production in human macrophages (FIG. 3C).

The observation that IRG1 restrains TNFa production was verified by suppressing IRG1 in primary human macrophages (FIG. 2D and 2E). Metabolic profiling of WT and IRG1 KO THP-1 cells confirmed previous reports suggesting that both ALDOA, and SDH are direct targets of itaconate as fructose 1,6-bisphosphate (6 hrs) and succinate (24 hrs) accumulated in WT THP-1 cells treated with LPS/IFNy, but not in IRG1 KO cells (FIG. 3D). Together, these data suggest that the endogenous production of itaconate is required for both the increased transcription and production of IFNP downstream of TLR4 signaling, yet also restrains the transcription and production of TNFa. These data highlight the paradoxical pro- and anti-inflammatory effects of itaconate mimetics in various cell types and highlight clear differences in the role of IRG1 and itaconate in the regulation of cytokine production from human versus mouse macrophages. Therefore, the genetic system as disclosed herein provides an important tool to interrogate the function(s) of endogenously produced itaconate.

Endogenous IRGl/itaconate production negatively regulates inflammation

RNAseq analysis of WT and IRG1-K0 THP-1 cells is performed on cells treated with LPS/fFNy for 6, 12, and 24 hours. The RNAseq analysis confirmed the 4-nucleotide deletion in the IRG1 gene (ACOD1) resulting in a frame shift mutation that disrupts the production of IRG1 protein, although the transcriptional regulation of the IRG1 locus by LPS/fFNy remained intact (Figures 4A and 4B). Upon cellular differentiation with phorbol- 12-myri state- 13 -acetate (PMA), which activates protein kinase C to enhance THP-1 differentiation and surface marker expression, THP-1 cells develop into and function similarly to primary human macrophages. Differentially expressed genes were ranked by fold change from the linear model terms and GSEA was conducted against the Hallmark and Reactome gene sets from mSigDBAs. The differences between the WT and IRG1-K0 cells were time-dependent, reflecting the observation that the endogenous production of itaconate increases over time peaking at about 24 hours post LPS/fFNy treatment. Unlike previous studies that demonstrated the induction of NRF2 target genes in cells treated with itaconate mimetics or other electrophilic molecules, the production of endogenous itaconate did not lead to the significant induction of genes downstream of NRF2 (FfG. 4C). NRF2 itself was upregulated in the fRGl KO cells at 24 hours compared to WT (NFE2L2 gene, FfG. 4C).

Analysis of both the Hallmark and Reactome gene sets demonstrates that endogenous production of itaconate negatively regulates multiple sets of genes that regulate inflammation including, but not limited to, fNFy, fFNa, fFNP, the production of chemokines and co-stimulatory molecules such as CD80, and TNFa signaling downstream of NFKB (FfG. 5 A), fn addition to the regulation of genes directly involved in inflammatory processes, the data disclosed herein demonstrate that itaconate production negatively regulates genes involved in cholesterol biosynthesis, translation, and several pathways involved in tRNA processing (FIG. 5A). In fact, as WT cells begin to produce itaconate, the genes involved in tRNA processing are repressed, and this repression is lost in cells unable to produce itaconate (FIG. 5B). As professional antigen presenting cells, macrophages drive cell-based immunity and antibody production through the presentation of antigens on MHC-II along with the expression of co-stimulatory molecules. Surprisingly, the present disclosure demonstrates that the entire MHC-II genetic locus including the invariant chain, CD74, which are upregulated in response to innate danger signals like LPS, are further upregulated in macrophages that cannot produce endogenous itaconate (FIG. 5C). These data suggest that itaconate production is a negative feedback mechanism that restrains MHC-II expression.

The present RNAseq data demonstrate that MYC signature genes are downregulated over the 24-hour time-course in WT macrophages stimulated with LPS/IFNy (FIG. 5D). The downregulation of the MYC-signature is coincident with the production of itaconate (FIG. 5D), suggesting that itaconate shuts down MYC-dependent transcription. Interestingly, unlike other genes sets assessed, which are further upregulated in cells lacking IRG1 and/or itaconate, the MYC signature genes, which are naturally repressed after Ml macrophage activation, are maintained in macrophages that fail to produce itaconate (FIG. 5E). Together, these data suggest that the production of itaconate acts as a negative feedback mechanism that restrains the expression of a whole host of genes that support inflammation providing an important guardrail for the inflammatory process.

Differential proteomics identifies critical targets of endogenously produced itaconate

Paired WT and IRG1 KO THP-1 cell lines are utilized to better define the itaconate- targeted proteome in cells that naturally produce itaconate in response to LPS/IFNy.

Accumulation of intracellular itaconate is reported to take approx. 6 hours and reaches a maximum by 24 hours post treatment with LPS/INFy; these time points are examined to assess the itaconate-targeted proteome using a quantitative chemical proteomic platform based on Thiol-ABPP Capture. Briefly, equal numbers of WT and IRG1 KO THP-1 cells are treated with LPS/IFNy, collected, and lysates generated. Equal amounts of proteins from IRG1-K0 and WT THP-1 cell lysates are denatured and labeled with a desthiobiotin-carbamidomethyl probe either unlabeled (light) or labeled with ¹³ C (heavy), respectively. These labeled lysates are then mixed equally, trypsinized, and peptides with probe-labeled cysteines are isolated using a streptavidin-based separation and detected by data-dependent LC-MS/MS (FIG. 6A).

While WT THP-1 cells treated with LPS/IFNy drive the production of endogenous itaconate, which is free to modify cysteine residues in target proteins, IRG1 KO THP-1 cells do not produce itaconate and natural targets of itaconate remain unlabeled. Cysteine- containing peptides in the WT cells that were modified by endogenously produced itaconate are not available for labeling with the heavy probe (Compound 2). Therefore, the ratio of heavy (WT) to light (IRG1-K0) cysteine-containing peptides will be significantly altered if a specific cysteine is modified by itaconate and thus no longer able to interact with the heavy desthiobiotin-carbamidomethyl probe. Using this method a total of 6085 cysteine-containing peptides were identified. Several previously known glycolytic targets of itaconate-mimetics including ALDOA, LDHA, and GAPDH were identified, validating the methodology; pathway analysis identified glycolysis/gluconeogenesis as a pathway that is potentially regulated by endogenously produced itaconate. In addition to glycolysis, the data identified the regulation of translation initiation, antigen presentation, and a whole host of proteins involved in ubiquitination and proteosomal degradation including several El, E2, E3 enzymes that overlapped with immunomodulatory pathways such as TNF-a and innate-signaling that centered around the regulation of NFKB (FIG. 6B). As with our RNAseq data, the regulation of translation was strongly associated with itaconate production as several tRNA synthetases were identified as potential targets of endogenously produced itaconate. Both the RNAseq and the differential proteomic analyses strongly suggest that itaconate negatively regulates innate-driven inflammatory cytokine production.

Within the proteomic data, cysteine 13 (Cysl3) in IRAK4 was identified as a potential target of endogenously produced itaconate as labeling of Cysl3 was significantly decreased in WT versus IRG1 KO THP1 cells (FIG. 6C). A second cysteine containing peptide from IRAK4 (Cys289) was also detected but not changed between the two cell types, demonstrating the specificity of itaconate targeting IRAK4 (FIG. 6C). Interestingly, Cysl3 in IRAK4 lies at the interface between the IRAK4 tetramer and the MYD88 hexamer of the Myddosome, suggesting the modification of this site by itaconate could potentially disrupt this interaction (FIG. 6D) and thus ablate IRAK4 autophosphorylation and downstream signaling. Further analysis demonstrates that this compound variant in IRAK4 also disrupts heterodimerization with MYD88, reduces downstream signaling, i.e. the loss of p-IRAK4, p-p38 and p-p65, and significantly decreases cytokine production. Human mutational analysis, the modification of Cysl3 in IRAK4 by DMF, and the present data indicating that Cysl3 as a target of endogenously produced itaconate suggests that this site is an important regulatory node in IRAK4 -dep endent signaling.

Although the present data suggest that IRAK4 is an important target of endogenous itaconate and that IRG1 KO THP-1 cells overproduce TNFa in response to LPS/IFNY, studies using WT and IRG1 KO mice demonstrated no difference in TNFa production downstream of LPS/IFNy. Upon inspection, Cysl3 in human IRAK4 is present in dog and cynomologus monkeys, yet absent in mouse or rat IRAK4 (FIG. 6E), suggesting a node of regulation in humans and other species that is not present in these rodent species. Taken together, the differential proteomic and RNAseq data strongly suggest that itaconate negatively regulates inflammation through the disruption of IRAK4 and NFKB signaling pathways, which explains why THP-1 IRG1 knockout cells overproduce TNFa in response to LPS/IFNY (FIG. 3C).

IRG1 is a negative feedback mechanism that restrains the production of inflammatory cytokines downstream of IRAK4-dependent and independent innate signaling pathways

A primary function of macrophages is to release inflammatory cytokines in response to innate stimuli including single and double stranded RNA, LPS, and cytosolic DNA. The receptors for these innate ligands include TLR3,4,7,8, and cGAS/STING. Both RNAseq and differential proteomic data suggested that itaconate production is a broad negative feedback mechanism that restrains the production of inflammatory cytokines whose expression is dependent upon IRAK4 and/or NFKB. Herein, we assess whether resiquimod (R848) (TLR 7/8), Polyinosinic-polycytidylic acid (POLY LC) (TLR3), and Cyclic GMP-AMPP (cGAMP) (cGAS/STING) could upregulate IRG1 in a dose-dependent manner and demonstrated all these stimuli could in fact induce IRG1 expression (FIG. 8A, FIG. 10 A), albeit to different extents and with different kinetics. We utilized both a small molecule inhibitor of TBK1, and WT and IRF3 KO THP-1 cells and demonstrated that the upregulation of IRG1 downstream of TLR3, TLR4, and the cGAS/STING pathways is dependent upon TBKl-mediated phosphorylation and thus activation of IRF3 (FIG. 11A and 11B). Unlike the TLR3, TLR4, and cGAS/STING pathways, TLR7/8 signaling does not lead to the activation of IRF3, and neither TBK1 inhibition nor the loss of IRF3 blocked IRG1 expression downstream of TLR7/8 (FIG. 11A and 11B). In fact, the loss of IRF3 resulted in an increased expression of IRG1 protein downstream of TLR7/8 signaling (FIG. 1 IB). These data demonstrate for the first time that IRGl/itaconate is regulated by multiple innate signaling pathways, some of which require the TBK1/IRF3 axis and others that do not.

Our RNAseq and differential proteomic analysis strongly suggested that IRG1 expression and the production of itaconate negatively regulates multiple inflammatory pathways, and we demonstrated that IRG1 is upregulated downstream of multiple innate signaling pathways. To determine whether IRGl/itaconate is a broad negative feedback mechanism that regulates innate signaling, we assessed the production of inflammatory cytokines in both WT and IRG1 KO THP-1 cells treated with LPS (TLR4), R848 (TLR7/8), cGAMP (cGas/STING), and POLY I:C (TLR3). These data confirmed our initial finding that TNFa production downstream of LPS is greatly enhanced (FIG. 3C and FIG. 7A) in the IRG1 -deficient THP-ls. Surprisingly, the present disclosure shows that TNFa production in IRG1 KO THP-1 cells was increased downstream of all these innate signaling pathways (FIG. 7A). In fact, the loss of the IRGl/itaconate checkpoint resulted in the increased production of not only TNFa, but also of IL6, IL-ip, and the chemokine CXCL10 suggesting a general function of IRGl/itaconate is to restrain the production of inflammatory cytokines (FIGs. 7A-7D). In contrast to TNFa, the production of IFNP downstream of LPS and cGAS/STING was dependent on the production of IRG1 and/or itaconate (FIG. 3B and FIG. 9B). The differential effects on the production of inflammatory cytokines and chemokines such as TNFa, IL6, IL-lfi, IFN , and CXCL10 reflected transcriptional changes in these cytokines (FIGs. 9A-9E), suggesting that IRGl/itaconate regulates both the transcription and production of these important mediators of inflammation. Additionally, WT THP-1 cells were treated with LPS, R848, cGAMP, or POLY I:C for 0, 1, 6, or 24 hr to determine the impact on driving the transcription of ACOD1. As can be seen in FIG. 9F, TLR4 stimulation with LPS leads to the most robust - l- upregulation oiACODl transcript of all of these four treatments, but all of these agents can induce the upregulation of ACOD1.

IRG1 is a potent negative regulator of IRAK4-dependent signaling

TLR4 is partially dependent on IRAK4 to drive inflammatory cytokine production. We assessed the role of itaconate in the activation of IRAK4 downstream of TLR4 by treating both WT and IRG1 KO THP-ls with LPS over a time-course. Interestingly, the activation of IRAK4 evinced by its autophosphorylation and the subsequent phosphorylation of p38 and p65 were all elevated in cells that could not make itaconate (FIG. 10B) suggesting that endogenously produced itaconate can negatively regulate IRAK4-dependent signaling. Unlike TLR4 signaling, which is only partially dependent upon IRAK4, and the TLR3 and cGAS/STING pathways, which function independent of IRAK4, TLR7/8 signaling is dependent on IRAK4. We identified Cysl3 in IRAK4 as an important target of endogenously produced itaconate. To better understand the effects of endogenously produced itaconate on IRAK4 signaling, we used the TLR7/8 agonist R848 and demonstrated a dose-dependent increase in IRG1 production downstream of TLR7/8 signaling (FIG. 8A). We demonstrate that the transcription of TNFa, IL6, and IL-ip and cytokine secretion are upregulated in cells that lack the ability to upregulate IRG1 when stimulated with R848 in a dose-dependent manner (FIGs. 8C-8E). IFNP is not produced downstream of TLR7/8 signaling, yetR848 treatment clearly drives the production of IRG1 (FIGs. 8A and 8B). The instant disclosure suggests that IFNP plays a critical role in the expression of IRG1 and the production of itaconate. Paradoxically, we found that IFNP production downstream of LPS depends on IRG1 expression (FIG. 3B), yet IRG1 expression downstream of TLR7/8 had no effect on IFNP transcription or cytokine production suggesting that IRG1 /itaconate is necessary, but not sufficient for the generation of IFNP (FIG. 8B). LPS also drives the rapid expression of IRG1 (FIG. 2C and 10B) with protein detected within 1 hour of stimulation. Compared with LPS, TLR7/8 stimulation drives IRG1 expression, yet requires 24 hours for maximal expression and never to the same extend as LPS treatment (data not shown) suggesting that IFNP may drive a feed forward loop that enhances the expression of IRG1 downstream of LPS.

The role of itaconate in macrophages is assessed using itaconate mimetics such as 401 and DI. In addition, it is possible the immunomodulatory functions of DMF also result, at least in part, from its ability to mimic the natural functions of itaconate (that is, as an itaconate mimetic). The present studies utilize IRG1 KO THP-1 cells, which overproduce TNFa, IL6 and IL-ip in response to R848, to assess the ability of these molecules to inhibit IRAK4-dependent signaling downstream of TLR7/8. The studies herein further assess the ability of DMF to block IRAK4-dependent signaling in the IRG1 KO THP-1 cells. DMF inhibited the autophosphorylation of IRAK4 (Fig 10C) and dramatically inhibited both the transcription and secretion of TNFa, IL6, and IL-ip in the IRG1 KO cells treated with R848 demonstrating that DMF could indeed block the TLR7/8-dependent production of these inflammatory cytokines (FIGs. 8F-8K and FIG. 10D).

In contrast to the exogenous addition of itaconate, IRG1 KO THP-1 cells treated with 401, MMF, and DMF abolished the production of TNFa, IL6, and IL-ip mRNA (FIG. 10D) and protein in response to R848 stimulation in a dose-dependent manner (FIGs. 8F- 81). It is demonstrated herein that 401, MMF, and DMF covalently modified IRAK4 at Cysl3, and no other cysteine residue in IRAK4 using LC-MS/MS (data not shown and FIG. 8L). These data demonstrate DMF can modify Cysl3 in IRAK4 and both DMF and MMF inhibited R848-driven cytokine production in the IRG1 KO cells in an equipotent manner. Quantification of the Cysl3 modification by LC-MS/MS from cells treated with DMF indicated that while the cells were treated with DMF, >95% of the modification of Cysl3 in IRAK4 was MMF (FIG. 8L). Although the modification of Cysl3 in IRAK4 by LC- MS/MS with 401, DMF and MMF was readily detected, the present disclosure did not identify peptide masses that corresponded to the Cysl 3 -containing peptide from IRAK4 modified by itaconate either in the WT THP-1 cells treated with LPS/IFNy or in IRG1 KO THP-1 cells treated with LPS and high concentrations of itaconate. Together, these data demonstrate that itaconate negatively regulates the production of inflammatory cytokines downstream of TLR7/8 by disrupting IRAK4-dependent signaling.

Endogenously produced itaconate promotes the degradation of NFkB, post- translational modification of A20, and modulates global ubiquitination

While TLR7/8 signaling is IRAK4 dependent, other innate signaling pathways, which the present disclosure demonstrates are negatively regulated by the endogenous production of itaconate, are either only partially dependent upon IRAK4 (TLR4) or altogether independent of IRAK4 (TLR3 and cGAS/STING). Evidence suggests that exogenously added itaconate mimetics like 401, DI, and DMF can inhibit NFKB signaling through a variety of mechanisms. The present studies demonstrate that endogenously produced itaconate strongly inhibits the production of TNFa, IL-6, IL-ip, and CXCL10 mRNA and protein downstream of both IRAK4-dependent and -independent pathways (FIGs. 7A-7D, 9A-9E). In addition, both RNAseq and proteomic analyses strongly implicated NFKB-dependent signaling as a critical axis regulated by itaconate with multiple components of NFKB signaling, including p65, pl05, TRAF2, and IKK 8, identified as targets of endogenously produced itaconate.

The activation of NFKB is initiated by IKK-dependent phosphorylation of IxBa driving its ubiquitination and degradation leading to the phosphorylation of p65 and accumulation of the p65/p50 (NFKB) complex in the nucleus. The activation of NFKB downstream of LPS/IFNy evinced by the degradation of IxBa and the phosphorylation of p65 was similar in both the WT and the IRG1 KO THP-1 cells indicating that the acute activation of NFKB is unaffected by the loss of IRG1 (FIG. 12A). IRG1 expression and the subsequent production of itaconate occurs much later than the acute activation of NFKB suggesting that itaconate may act as a negative feedback regulator of NFKB. After activation, NFKB is negatively regulated by the ubiquitination of p65, which leads to the degradation of the p65/p50 complex. To determine whether endogenously produced itaconate affects the stability of the NFKB complex, we monitored the degradation of NFKB (p65 and p50) 6, 12, and 24 hours post LPS/IFNy treatment, timepoints we demonstrated resulted in elevated levels of free itaconate in the cell. Strikingly, while both p65 and p50 were degraded in the WT THP-1 cells over the time-course, the IRG1 KO cells maintained and accumulated p65 and p50, and p65 remained phosphorylated (FIG. 12B and 12C) suggesting that itaconate is a critical regulator of NFKB destruction.

A20 (TNFa-inducible protein 3) is a cytokine-induced negative regulator of NFKB signaling. Contrary to previous reports, the induction of A20 protein downstream of LPS/fFNy was unaffected by the loss of IRG1 over the time-course (FIG. 12A). Although A20 induction was unaffected, its migration on an SDS-PAGE gel was retarded from WT cell lysates treated with LPS/IFNY, suggesting post-translational modification(s) that were wholly absent in the IRG1 KO cells (FIG. 12B).

Both A20 and p65 are regulated by ubiquitination, and p65’s degradation was clearly dependent upon IRG1 and believed upon the production of itaconate as well. Our differential proteomic analysis also identified multiple components of the ubiquitin machinery as targets of endogenously produced itaconate. Therefore, we assess global ubiquitination patterns in both the WT and the IRG1 KO THP-1 cells over the same timecourse. Remarkably, LPS/IFNy treatment drove accumulation of ubiquitinated aggregates in WT THP-1 cells, which peaked at around 12 hours, yet the accumulation of ubiquitinated aggregates was completely absent in cells unable to produce itaconate (FIG. 12D). These data demonstrate that IRG1 and presumably the production of itaconate are critical for the negative regulation of NFKB-driven cytokine production and that itaconate is a critical arbiter of global ubiquitination in macrophages.

Experiments in primary human macrophages confirm the phenomena described herein. FIG. 13 A shows the impact of IRG1 silencing in primary human macrophages on the level of various proteins upon treatment of said cells with LPS and IFN-y (left column) or R848 (right). Consistent with observations in immortalized cells (see FIG. 7), silencing IRG1 and thus decreasing levels of endogenous itaconate results in increases in TNFa, IL- 6, and CXCL10, but a decrease in IFN-p. These data demonstrate that endogenous itaconate functions as a negative regulator of inflammation both in immortalized cells and in primary cells.

FIGs. 13B and 13C demonstrate the impact of IRG1 silencing in primary human macrophages on levels of pro-IL-ip. FIG. 13C quantifies the western blot bands of FIG. 13B by densitometry, measuring relative strength of the subject band relative to the P -actin control.

Pro-IL-ip 31 kDa protein is expressed during what is referred to as a “priming step,” and is insufficiently secreted. A primed cell which then encounters a further pathogen associated molecular pattern (PAMP) or danger associated molecular pattern (DAMP), such as for example endogenous molecules released from dead cells, may induce processing and secretion of active IL-ip from the precursor. As can be seen in FIGs. 13B and 13C, silencing of IRG1 leads to a marked transient increase in pro-IL-ip protein levels at 6 hours post-stimulation. This level drops off and is not detected 24 hours after stimulation. Therefore decreasing levels of endogenous itaconate may be useful in treatment of autoinflammatory disorders in which IL-ip is involved. Such conditions include, but are not limited to, familial cold autoinflammatory syndrome (FC AS); Muckle- Wells syndrome (MWS); neonatal-onset multisystem inflammatory disease (NOMID); chronic infantile neurologic cutaneous and arthritis (CINCA) syndrome; familial Mediterranean fever (FMF); NLRP12 autoinflammatory syndrome; hyperimmunoglobulinemia D and periodic fever syndrome (HIDS); mevalonate kinase deficiency (MKD); pyogenic arthritis, pyoderma gangrenosum, and acne (PAPA) syndrome; pyoderma gangrenosum, acne, and suppurative hidradentis (PASH) syndrome; pyogenic arthritis, acne, pyoderma gangrenosum, and suppurative hidradentis (PAPASH) syndrome; Majeed syndrome; and TNF -receptor- 1 -associated syndrome (TRAPS).

Human monocytes react to reduction of endogenous itaconate levels in a similar manner. FIG. 13D shows the results of ELIS As conducted on monocytes derived from either wild type or IRG knockout induced pluripotent stem cells (iPSCs). These cells were stimulated with LPS (200 ng/mL) and IFN-y (200 ng/mL) or R848 (5 pg/mL) for 24 hr. Levels of protein (TNFa, IL-6, IL-ip, and CXCL10) were measured in the supernatant. The results reflect a similar pattern to those shown in FIG. 7. Finally, and as shown in FIG. 13E, the impact of IRG1 knockout (and therefore reduction in endogenous itaconate levels) in THP-1 cells on NF-KB behavior was investigated. As can be seen, knockout of IRG1 leads to greater accumulation of p65 and slightly more pl 05 and p50 in the nucleus compared to WT. These data demonstrate that the nuclear translocation of NF-KB subunits may be impacted when modified with endogenous itaconate, thus impacting the production of proinflammatory cytokines (consonant with other results provided herein).

In one aspect, therefore, the present disclosure provides a method of reducing ubiquitin levels in a cell which includes decreasing an activity of IRG1 in the cell. In another aspect, the present disclosure provides a method of reducing ubiquitin levels in a cell, which includes decreasing a quantity of endogenous itaconate in the cell. The present disclosure likewise provides a method of decreasing proteosomal degradation in a cell, comprising decreasing an activity of IRG1 in the cell. The present disclosure also provides a method of decreasing proteosomal degradation in a cell, by decreasing a quantity of endogenous itaconate in the cell. The present disclosure further provides a method of increasing ubiquitin levels in a cell, including contacting the cell with an itaconate mimetic. The present disclosure includes a method of increasing proteosomal degradation in a cell, including contacting the cell with an itaconate mimetic . CLAUSES

1. A method of treating or preventing an inflammatory or autoimmune disease in a subject, comprising modulating a level of endogenous itaconate in a cell of the subject by administering one or more nucleic acids to the subject.

2. The method of clause 1, wherein the cell is a white blood cell.

3. The method of clause 2, wherein the white blood cell is a macrophage.

4. The method of any one of clauses 1-3, comprising decreasing IRG1 expression.

5. The method of clause 4, comprising subjecting the cell to CRISPR.

6. The method of clause 5, wherein a guide RNA comprises a sequence of SEQ ID NO:

1 and wherein a tracrRNA comprises a sequence of SEQ ID NO. 2.

7. The method of clause 4, comprising subjecting the cell to RNA interference.

8. The method of any one of clauses 1-3, comprising increasing IRG1 expression.

9. The method of clause 8, comprising at least one of subjecting the cell to CRISPR, administering a zinc-finger nuclease targeting the IRG1 gene to the cell, and administering activating RNA to the cell.

10. A method of modulating one of TNFa, IL-6, IL-lb, CXCL-10, major histocompatibility complex II (MHC II) and NFKB in a subject, comprising modulating expression of IRG1 in a cell by administering one or more nucleic acids to the cell.

11. The method of clause 10, comprising administering a small interfering RNA targeting an IRG1 gene to the subject.

12. The method of clause 10, comprising subjecting the cell to CRISPR.

13. The method of clause 12, wherein a guide RNA comprises a sequence of SEQ ID NO: 1 and wherein a tracrRNA comprises a sequence of SEQ ID NO. 2.

14. The method of clause 10, comprising administering an activating RNA to the cell.

15. The method of any one of clauses 10-14, wherein the cell is a white blood cell.

16. The method of clause 15, wherein the white blood cell is a macrophage.

17. The method of any one of clauses 1-16, wherein the disease or condition is selected from the group consisting of: Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus, type I diabetes, rheumatoid arthritis, Sjogren s syndrome, dermatomyositis, chilblain lesions necrotizing vasculitis, interstitial lung disease, panni culiti lipody trophy, and spondyloenchondro-dysplasia. 18. A method of treating a condition in a subject, comprising isolating a cell of the subject, subjecting the cell to CRISPR to modulate levels of endogenous itaconate, and readministering the cell to the subject.

19. The method of clause 18, wherein the cell is a white blood cell.

20. The method of clause 19, wherein the white blood cell is a macrophage.

21. The method of any one of clauses 18-20, comprising decreasing IRG1 expression.

22. The method of clause 21, wherein a guide RNA comprises a sequence of SEQ ID NO: 1 and wherein a tracrRNA comprises a sequence of SEQ ID NO. 2.

23. The method of any one of clauses 18-20, comprising increasing IRG1 expression.

24. A method of decreasing interferon beta (IFNP) secretion by a cell, comprising by administering one or more nucleic acids to the cell to reduce a quantity of endogenously-produced itaconate.

25. The method of clause 24, wherein the cell is a white blood cell.

26. The method of clause 25, wherein the cell is a macrophage.

27. The method of any one of clauses 24-26, comprising decreasing expression of IRG1.

28. The method of any one of clauses 24-26, comprising administering an interfering RNA to the subject.

29. The method of any one of clauses 24-26, comprising subjecting the subject to CRISPR.

30. The method of clause 29, wherein a guide RNA comprises a sequence of SEQ ID NO: 1 and wherein a tracrRNA comprises a sequence of SEQ ID NO. 2.

31. The method of any one of clauses 24-30, wherein the method is for treating a patient in need thereof.

32. A method of treating or preventing an inflammatory or autoimmune disease or condition in a subject, comprising administering to the subject at least one nucleic acid targeting the IRG1 gene.

33. The method of clause 32, comprising decreasing production of TNF alpha (TNFa) in the subject.

34. The method of clause 32 or 33, comprising decreasing secretion of TNF alpha (TNFa) by a cell, comprising increasing the quantity of endogenously-produced itaconate by a cell of the subject. 35. The method of any one of clauses 32-34, wherein the disease or condition is selected from the group consisting of: rheumatoid arthritis, juvenile idiopathic arthritis, ankylosing spondylitis, Crohn’s disease, ulcerative colitis, plaque psoriasis, hidradenitis suppurativa, or uveitis.

36. The method of clause 32, comprising attenuating a response to an infection of gramnegative bacteria in the subject.

37. The method of clause 32 or clause 36, wherein the response to the disease or condition involves activation of Toll-like receptor 4 (TLR4).

38. The method of any one of clauses 32 and 36-37, wherein the disease is selected from rheumatoid arthritis, sickle cell disease, and sepsis.

39. The method of clause 32, comprising decreasing production of IL-6 in the subject.

40. The method of clause 32 or clause 39, comprising decreasing secretion of IL-6 by a cell of the subject.

41. The method of any one of clauses 32 and 39-40, wherein the disease or condition is selected from the group consisting of: arthritis, experimental autoimmune encephalomyelitis, multicentric Castleman’s disease, pristane-induced lupus, plasmacytoma, rheumatoid arthritis, giant cell arteritis, systemic sclerosis-associated interstitial lung disease, cytokine release syndrome, COVID-19, systemic sclerosis, polyarticular juvenile idiopathic arthritis, and systemic juvenile idiopathic arthritis.

42. The method of clause 32, comprising decreasing production of IL-lb in the subject.

43. The method of clause 32 or clause 42, comprising decreasing secretion of IL-lb by a cell of the subject.

44. The method of any one of clauses 32 and 42-43, wherein the disease or condition is selected from the group consisting of cryopyrin-associated periodic syndrome, tumor necrosis factor receptor-associated periodic syndrome, hyperimmunoglobulin D syndrome/mevalonate kinase deficiency, familial Mediterranean fever, Still disease, and systemic juvenile idiopathic arthritis.

45. The method of clause 32, comprising decreasing production of CXCL10 in the subject.

46. The method of clause 32 or clause 45, comprising decreasing secretion of CXCL10 by a cell of the subject. 47. The method of any one of clauses 32 and 45-46, wherein the disease or condition is selected from the group consisting of: pelvic inflammatory disease, granuloma inguinale, donovanosis, infections including plague, tularemia, and meningitis; bacterial infection; and infections of the blood, abdomen (stomach area), lungs, skin, bones, joints, and urinary tract.

48. The method of clause 32, comprising reducing IRAK4 activity in the subject.

49. The method of any one of clauses 32 and 48, wherein the disease or condition is selected from the group consisting of lupus, rheumatoid arthritis, plaque psoriasis, and inflammatory bowel disease.

50. The method of clause 49, wherein the subject has a gain of function mutation in TLR7.

51. The method of clause 32, comprising reducing NFKB activity in the subject.

52. The method of clause 32, comprising reducing NFKB expression in the subject.

53. The method of any one of clauses 32 and 51-52, wherein the disease or condition is selected from the group consisting of: Hodgkin lymphoma, diffuse large B-cell lymphoma, mucosa-associated lymphoid tissue lymphoma, primary effusion lymphoma, adult T-cell lymphoma/leukemia, ulcerative colitis, Crohn's disease, rheumatoid arthritis, systemic lupus erythematosus, psoriatic arthritis, giant cell arthritis, type 1 diabetes, multiple sclerosis, celiac disease, and Parkinson's disease, as well as susceptibility of several cancers, such as oral squamous cell carcinoma, colorectal cancer, hepatocellular carcinoma, breast cancer and myeloma.

54. The method of clause 32, comprising increasing IFNP production in the subject.

55. The method of clause 32 or clause 54, wherein the disease or condition is selected from the group consisting of multiple sclerosis and relapsing-remitting multiple sclerosis (RRMS).

56. The method of clause 32, wherein major histocompatibility complex II (MHC-II) expression is decreased in the subject.

57. The method of any one of clauses 32-56, comprising reducing or preventing an inflammatory response in a subject.

58. The method of any one of clauses 32-56, wherein the disease or condition is an autoimmune disease or condition. 59. A method of treating a cancer in a patient, comprising decreasing expression of IRG1 in a cell or tumor of the subject.

60. The method of clause 59, comprising administering a small interfering RNA targeting an IRG1 gene to the cell or tumor.

61. A method of upregulating glycolysis or gluconeogenesis in a cell, comprising reducing a quantity of endogenously-produced itaconate in the cell.

62. A THP-1 cell which lacks IRG1 activity or expression.

63. A method of reducing ubiquitin levels in a cell, comprising decreasing an activity of IRG1 in the cell.

64. A method of reducing ubiquitin levels in a cell, comprising decreasing a quantity of endogenous itaconate in the cell.

65. A method of decreasing proteosomal degradation in a cell, comprising decreasing an activity of IRG1 in the cell.

66. A method of decreasing proteosomal degradation in a cell, comprising decreasing a quantity of endogenous itaconate in the cell.

67. A method of reducing ubiquitin levels in a cell comprising decreasing an activity of IRG1 in the cell.

68. A method of reducing NFKB ubiquitin levels in a cell comprising decreasing an activity of IRG1 in the cell.

69. A method of reducing ubiquitin levels in a cell comprising decreasing an itaconate level in the cell.

SEQUENCE LISTING

SEQ ID NO: 1: crRNA portion of CRISPR guide RNA for diminution of IRG1 expression (5’ - 3’)

UAUGUGAAACACUUCCGUAGGUUUUAGAGCUAUGCU

SEQ ID NO: 2: tracrRNA portion of CRISPR guide RNA for diminution of IRG1 expression (5’ - 3’)

AGCAUAGCAAGUUAAAA.UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGG

CACCGAGUCGGUGCUUU